Therapeutic nucleic acids and methods of use thereof

Abstract

An isolated nucleic acid is provided comprising the nucleotide sequence: UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). The nucleic acid and compositions thereof find use in the treatment of muscle diseases such as muscular dystrophy, cardiac conditions such as heart failure or myocardial infarction, and / or conditions associated with inflammation and / or fibrosis.

Description

[Technical Field]

[0001] Incorporation by reference of priority applications This application claims the benefit of U.S. Provisional Application No. 63 / 378009, filed September 30, 2022, which is incorporated herein by reference in its entirety.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under grant numbers R01HL124074 and R01HL155346 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Reference to sequence listing This application has been filed with an electronic Sequence Listing XML, which is provided as a file entitled CSMC021seqlist.xml, 8,412 bytes in size, created on September 20, 2023. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0004] background Technical Field The present disclosure relates to therapeutic RNAs, variants thereof, and their use to treat muscular diseases and / or cardiac conditions and / or inflammatory conditions and / or fibrosis. Summary of the Invention [Problem to be solved by the invention]

[0005] An isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) is provided. [Means for solving the problem]

[0006] Also provided are nucleic acids having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence of SEQ ID NO: 1. Also provided are therapeutic uses of the nucleic acids of the disclosure for treating muscle diseases, cardiac conditions, or conditions associated with inflammation and / or fibrosis.

[0007] Provided herein is a method for treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treatment for a condition associated with inflammation and / or fibrosis a therapeutically effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nucleotides (nt) in length.

[0008] Also provided herein is a method for treating a muscle disease or a symptom thereof, comprising administering to a subject in need of treatment for a muscle disease or a symptom thereof a therapeutically effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nt in length.

[0009] Provided herein is a method of immunomodulation comprising contacting a population of macrophages with an effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nt in length.

[0010] Similarly, therapeutic compositions are provided that include a therapeutically effective amount of any of the disclosed isolated nucleic acids and a pharmaceutically acceptable excipient. Kits are also provided that include any of the disclosed isolated nucleic acid(s) and a transfection reagent. [Brief explanation of the drawings]

[0011] [Figure 1A]1A-1D show a proposed mechanism of action for the immunomodulatory effects of the non-coding RNA tREX-1, according to certain non-limiting embodiments of the present disclosure, and initial characterization of tREX-1 in vitro biological activity, according to certain non-limiting embodiments of the present disclosure. Figure 1A is a schematic diagram showing the 5' tRNA half and known biological activity. [Figure 1B] 1A-1D show a proposed mechanism of action for the immunomodulatory effects of the non-coding RNA tREX-1, according to certain non-limiting embodiments of the present disclosure, and initial characterization of tREX-1 in vitro biological activity, according to certain non-limiting embodiments of the present disclosure. FIG. 1B is a collection of schematic diagrams showing the proposed mechanism of action of tREX-1, according to certain non-limiting embodiments of the present disclosure. [Figure 1C] 1A-1D show a proposed mechanism of action for the immunomodulatory effects of the non-coding RNA tREX-1, according to certain non-limiting embodiments of the present disclosure, and initial characterization of tREX-1 in vitro bioactivity, according to certain non-limiting embodiments of the present disclosure. FIG. 1C is a heat map showing transcriptome-wide changes in gene expression in cultured macrophages. [Figure 1D] 1A-1D show a proposed mechanism of action for the immunomodulatory effects of the non-coding RNA tREX-1, according to certain non-limiting embodiments of the present disclosure, and initial characterization of tREX-1 in vitro biological activity, according to certain non-limiting embodiments of the present disclosure. FIG. 1D is a plot showing gene expression changes in cultured macrophages, grouped by gene ontology. [Figure 2A] 2A-2D show the disease-modulating biological activity of tREX-1 in the heart of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 2A is a schematic diagram showing the experimental design. [Figure 2B] 2A-2D show the disease-modulating biological activity of tREX-1 in the heart of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 2B is a plot showing the change in ejection fraction over time as an index of cardiac function. [Figure 2C]2A-2D show the disease-modulating biological activity of tREX-1 in the heart of a muscular dystrophy model in some non-limiting embodiments of the present disclosure. Figure 2C is a collection of images showing Masson's trichrome staining of the heart. [Figure 2D] 2A-2D show the disease-modulating biological activity of tREX-1 in the heart of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 2D is a graph showing cardiac fibrosis. [Figure 3A] 3A-3E show the disease-modulating biological activity of tREX-1 in skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 3A is a schematic diagram showing the experimental design. [Figure 3B] 3A-3E show the disease-modulating biological activity of tREX-1 in skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 3B is a plot showing the change in tetanic torque over time compared to baseline as an index of skeletal muscle function. [Figure 3C] 3A-3E show the disease-modulating biological activity of tREX-1 in skeletal muscle of a muscular dystrophy model in some non-limiting embodiments of the present disclosure. Figure 3C is a collection of images showing Masson's trichrome staining of skeletal muscle (tibialis anterior). [Figure 3D] 3A-3E show the disease-modulating biological activity of tREX-1 in skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. FIG. 3D is a graph showing skeletal muscle fibrosis. [Figure 3E] 3A-3E show the disease-modulating biological activity of tREX-1 in skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 3E is a graph showing muscle fiber number in the tibialis anterior muscle. [Figure 4] FIG. 4 shows the effect of administration of tREX-1 on serum inflammatory cytokine levels in a muscular dystrophy model in some non-limiting embodiments of the present disclosure. [Figure 5] FIG. 5 shows the effect of oral administration of tREX-1 on an acute myocardial infarction (MI) model in some non-limiting embodiments of the present disclosure. [Figure 6] FIG. 6 shows the nucleotide sequences of tREX-1, tRNA corresponding to tREX-1, and scrambled RNA according to some non-limiting embodiments of the present disclosure. [Figure 7A] 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity in some non-limiting embodiments of the present disclosure. Figure 7A is a heatmap showing transcriptome changes. [Figure 7B] Figures 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity in certain non-limiting embodiments of the present disclosure. Figure 7B is a graph showing sequence mapping to different RNAs. [Figure 7C] Figures 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity in certain non-limiting embodiments of the present disclosure. Figure 7C is a graph showing sequence mapping to different tRNAs. [Figure 7D] Figures 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity, in accordance with certain non-limiting embodiments of the present disclosure. Figure 7D is a collection of graphs showing the sequence and changes in gene expression levels in cultured macrophages. [Figure 7E] Figures 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity in certain non-limiting embodiments of the present disclosure. Figure 7E is a plot showing gene expression changes in cultured macrophages, grouped by gene ontology. [Figure 7F]7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted from cardiosphere-derived cells and initial characterization of tREX-1 in vitro bioactivity in some non-limiting embodiments of the present disclosure. Figure 7F is a plot showing gene expression changes in cultured macrophages, grouped by the Kyoto Encyclopedia of Genes and Genomes. [Figure 8A] 8A-8F show the disease-modulating biological activity of tREX-1 in heart and skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 8A is a schematic diagram showing the experimental design. [Figure 8B] 8A-8F show the disease-modulating biological activity of tREX-1 in the heart and skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 8B is a set of graphs showing the change in ejection fraction over time as an index of cardiac function. [Figure 8C] 8A-8F show the disease-modulating biological activity of tREX-1 in heart and skeletal muscle of a muscular dystrophy model in some non-limiting embodiments of the present disclosure. Figure 8C is a set of graphs showing the change in tetanic torque over time as an index of skeletal muscle function. [Figure 8D] 8A-8F show the disease-modulating biological activity of tREX-1 in heart and skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 8D is a collection of images and a graph showing myocardial fibrosis. [Figure 8E] 8A-8F show the disease-modulating biological activity of tREX-1 in cardiac and skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. FIG. 8E is a collection of images and a graph showing muscle fibrosis. [Figure 8F] 8A-8F show the disease-modulating biological activity of tREX-1 in cardiac and skeletal muscle of a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. Figure 8F is a graph showing muscle fiber number in the tibialis anterior muscle. [Figure 9] FIG. 9 shows the uptake of tREX-1 by cultured macrophages in some non-limiting embodiments of the present disclosure. [Figure 10] FIG. 10 shows protein binding partners of tREX-1 that have been identified in some non-limiting embodiments of the present disclosure. [Figure 11] FIG. 11 shows the effect of tREX-1 on cardiac macrophages in a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. [Figure 12] FIG. 12 shows the effect of tREX-1 on skeletal muscle macrophages in a muscular dystrophy model according to some non-limiting embodiments of the present disclosure. [Figure 13] FIG. 13 shows that in some non-limiting embodiments of the present disclosure, the biological activity of tREX-1 is dependent on macrophages in a muscular dystrophy model. DETAILED DESCRIPTION OF THE INVENTION

[0012] Nucleic acids comprising the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), and methods of using same to treat conditions associated with inflammation and / or fibrosis, are provided. The nucleic acids of the present disclosure are essentially 60 nucleotides (nt) or less in length.

[0013] term As used herein, the term "nucleic acid" or "oligonucleotide" refers to a plurality of nucleotides (e.g., a molecule comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and an interchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymidine (T), or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). The term includes polynucleosides (i.e., polynucleotides minus the phosphate) and any other polymer containing an organic base. Purines and pyrimidines include, but are not limited to, adenine, cytosine, guanine, thymidine, inosine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. Nucleic acids can include any other suitable modifications. Thus, the term nucleic acid also encompasses nucleic acids having substitutions or modifications, such as in the base and / or sugar.

[0014] A polypeptide or nucleic acid molecule of the present disclosure may share a degree of sequence similarity or identity with a reference molecule (e.g., a reference polypeptide or reference polynucleotide), such as a molecule described in the art (e.g., an engineered or designed molecule or a wild-type molecule). The term "identity," as known in the art, refers to a relationship between two or more polypeptide or polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between two or more strings of amino acid or nucleic acid residues, as determined by the number of matches between them. Identity measures the percent of identical matches between the smaller of two or more sequences, with gap alignment, if any, accommodated by a particular mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be readily calculated by known methods. "Percent identity," as applied to polypeptide or polynucleotide sequences, is defined as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable method and computer program for alignment can be used. It is understood that identity depends on the calculation of percent identity, but values ​​may vary depending on gaps and penalties introduced into the calculation. Generally, a particular polynucleotide or polypeptide variant will have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to that particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art.Such alignment tools include the BLAST suite of tools (Stephen F. Altschul, et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). Another common local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences", J. Mol. Biol. 147:195-197). A common global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins", J. Mol. Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is believed to produce global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, particularly in the definition of "identity" below.

[0015] The term "identity" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., for optimal alignment, gaps can be introduced into one or both of the first and second nucleic acid sequences, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm.For example, the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 (each of which is incorporated herein by reference). For example, the percent identity between two nucleic acid sequences can be determined using the Meyers and Miller algorithm (CABIOS, 1989, 4:11-17), as incorporated into the ALIGN program (version 2.0), using a PAM 120 weighted residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleic acid sequences can be determined using the GAP program in the GCG software package, using the NWSgapdna.CMP matrix. Commonly used methods for determining percent identity between sequences include, but are not limited to, those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988), incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs.Exemplary computer software for determining homology between two sequences includes, but is not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).

[0016] The term "Watson-Crick base pairing" or "base pairing" refers to the formation of hydrogen bonds between specific pairs of nucleotide bases ("complementary base pairs"). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C). One way to assess the strength of a bond between two polynucleotides is by quantifying the percentage of bonds formed between guanine and cytosine bases ("GC content") of the two polynucleotides. In some embodiments, the GC content of the bond between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of the linkage between two nucleic acids in a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% and about 60%, or about 30% and about 60%. The formation of a nucleic acid duplex by binding of complementary base pairs can also be referred to as "hybridization." Generally, two nucleic acids that share a complementary region can hybridize (e.g., via nucleic acid base pairing) to form a duplex structure under suitable conditions. The complementary region can vary in size. In some embodiments, the complementary region ranges from about 2 base pairs to about 100 base pairs in length. In some embodiments, the complementary region ranges from about 5 base pairs to about 75 base pairs in length. In some embodiments, the complementary region ranges from about 10 base pairs to about 50 base pairs in length. In some embodiments, the complementary region ranges from about 20 base pairs to about 30 base pairs in length.

[0017] "Isolated," as used herein with respect to isolated biomolecules, e.g., nucleic acids, has its ordinary and accustomed meaning to those of skill in the art in light of the present disclosure. Isolated biomolecules, e.g., isolated nucleic acids, are generally in a non-native environment or an environment in which the biomolecule would not be found but for human intervention in the biomolecule or its environment. In some embodiments, an isolated biomolecule is not inside a cell or organism.

[0018] "Extracellular vesicles" or "EVs," as used herein, have their ordinary and customary meaning as understood by those of ordinary skill in the art in light of the present disclosure. EVs include lipid bilayer structures produced by cells, and include exosomes, microvesicles, epididymosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes, dex, tex, archeosomes, and oncosomes.

[0019] "Micelle," when used herein with respect to casein micelles, has its customary and ordinary meaning as understood by those of skill in the art in light of the present disclosure. Casein micelles are colloidal particles that may comprise aggregates of one or more casein phosphoproteins (e.g., one or more, two or more, three or more, or all four of alpha s1 casein, alpha s2 casein, beta casein, and kappa casein). "Micelle," when used herein with respect to lipid micelles, has its customary and ordinary meaning as understood by those of skill in the art in light of the present disclosure.

[0020] "Subject," as used herein, refers to any vertebrate, including mammals and non-mammals. Subjects can include primates, such as humans, and non-primate mammals, such as rodents, livestock, or game animals. Non-primate mammals can include mice, rats, hamsters, rabbits, dogs, foxes, wolves, cats, horses, cows, pigs, sheep, goats, camels, deer, buffalo, bison, and the like. Non-mammals can include birds (e.g., chickens, ostriches, emus, pigeons), reptiles (e.g., snakes, lizards, turtles), amphibians (e.g., frogs, salamanders), fish (e.g., salmon, cod, pufferfish, tuna), and the like. The terms "individual," "patient," and "subject" are used interchangeably herein.

[0021] "Administering," as used herein, can include any suitable route of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, but are not limited to, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, dermal, injection, or topical administration. Administration can be local or systemic.

[0022] As used herein, "treating" and "treatment" include curing, ameliorating, ameliorating, reducing the severity of, preventing, slowing the progression of, and / or delaying the onset of a disease, condition, and / or symptoms thereof.

[0023] As used herein, a treatment can be considered "effective" or "therapeutically effective" if, following treatment with the methods described herein, one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically acceptable symptoms are improved or even ameliorated, or a desired response or outcome is induced (e.g., by at least 2%, 3%, 4%, 5%, 10%, or more). Efficacy can be assessed, for example, by measuring markers, indicators, symptoms, and / or incidence of a condition treated according to the methods described herein, or any other appropriate measurable parameter, such as exercise endurance. Efficacy can also be measured by the individual's lack of deterioration as assessed by hospitalization or the need for medical intervention (e.g., halting the progression of the disease). Treatment includes any treatment of a disease or condition in an individual or animal (including, in some non-limiting examples, a human or animal), including: (1) inhibiting the disease or condition, e.g., preventing the worsening of symptoms (e.g., pain or inflammation); or (2) alleviating the severity of the disease or condition, e.g., causing regression of symptoms. An effective amount for treating a disease or condition means an amount sufficient to, when administered to a subject in need thereof, effect effective treatment for that disease or condition, as that term is defined herein. The effectiveness of an agent can be determined by assessing physical indicators of the condition or desired response or outcome (e.g., muscle function, mass, or volume, e.g., cardiac function, mass, or volume). One skilled in the art can monitor the effectiveness of administration and / or treatment by measuring any one or any combination of such parameters.

[0024] The term "effective amount" or "therapeutically effective amount," as used herein, refers to the amount of a composition or agent necessary to alleviate at least one or more symptoms of a disease or condition, and relates to a sufficient amount of a therapeutic composition to provide the desired effect. The term "effective amount" or "therapeutically effective amount" can refer to the amount of a composition or therapeutic agent sufficient to provide a particular anti-inflammatory, anti-fibrotic, immunomodulatory, muscle-protective, and / or cardioprotective effect when administered to a typical subject. An effective amount, as used herein, can include, in various contexts, an amount sufficient to delay the onset of symptoms of a disease or condition, alter the course of symptoms of a disease or condition (e.g., but not limited to, slowing the progression of symptoms of a disease or condition), or reverse symptoms of a disease or condition. In some embodiments, a therapeutically effective amount is administered in one or more doses of a therapeutic agent. In some embodiments, a therapeutically effective amount is administered in a single dose or in multiple doses over a period of time.

[0025] As used herein, the phrases "physiologically compatible" and "pharmaceutically acceptable" are used interchangeably herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0026] The singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. The abbreviation "eg" is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example." The term "about," when used herein, when defining values ​​and ranges, e.g., molecular weight, means that the stated value and / or range limits may vary within ±20%, e.g., within ±10%, e.g., within ±5%. The use of "about" before a number is inclusive of the number itself. For example, "about 5" provides an explicit rationale for "5." Numbers provided in ranges include overlapping ranges and integers therebetween; for example, the ranges 1 to 4 and 5 to 7 include, for example, 1 to 7, 1 to 6, 1 to 5, 2 to 5, 2 to 7, 4 to 7, 1, 2, 3, 4, 5, 6, and 7.

[0027] nucleic acid Provided herein is an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a variant thereof. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). In some embodiments, the nucleic acid comprises a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with sequence variation at 1, 2, 3, 4, or up to 5 positions in the nucleotide sequence. As used herein, a "position" within a nucleotide sequence or nucleic acid is defined relative to the 5' end of the nucleotide sequence or nucleic acid. In some embodiments, the nucleotide sequence of the nucleic acid is UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a sequence variant thereof. In some embodiments, the nucleic acid has the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). As used herein, "tREX-1" refers to an RNA having the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). The nucleic acid can be of any suitable length. In some embodiments, the nucleic acid is 32 nucleotides (nt) or about 32 nucleotides (nt) in length. In some embodiments, the nucleic acid is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 nt in length, or longer. In some embodiments, the nucleic acid is up to 60 nt in length. In some embodiments, the nucleic acid is up to 40 nt in length. In some embodiments, the nucleic acid is 20-35 nt in length or 30-35 nt in length. In some embodiments, the nucleic acid consists of or consists essentially of the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).

[0028] In some embodiments, the nucleic acid is derived from a human tRNA. In some embodiments, the nucleic acid is a 5' fragment of a human tRNA. As used herein, a "5' fragment" of a reference nucleic acid refers to a polynucleotide that includes at least the 5' end of the reference nucleic acid and may be truncated at the 3' end relative to the reference nucleic acid. In some embodiments, the 5' fragment of a human tRNA includes the 5' half of a (full-length) human tRNA. In some embodiments, the human tRNA is selected from TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1. TRE-CTC1-7 (corresponding to gene ID: 100189269), TRE-CTC1-1 (corresponding to gene ID: 100189384), and TRE-CTC2-1 (corresponding to gene ID: 100189409), each have the sequence shown in FIG. 6.

[0029] Nucleic acids of the present disclosure can be single-stranded or double-stranded (e.g., RNA / DNA hybrids). In some embodiments, the nucleic acid is single-stranded.

[0030] In some embodiments, the isolated nucleic acids of the present disclosure contain one or more chemically modified nucleotides, e.g., nucleotides with modified backbones. Generally, the chemical modification(s) substantially retain or enhance the therapeutic efficacy of the nucleic acid. Any suitable number of nucleotides in the nucleic acid can be chemically modified. In some embodiments, the nucleic acid contains 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, or 30 or more chemically modified nucleotides. In some embodiments, the nucleic acid comprises 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 15, 1 to 20, 1 to 25, or 1 to 30 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 1 to 10 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 8 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 6 chemically modified nucleotides.

[0031] Chemically modified nucleotides may be distributed along the isolated nucleic acid in any suitable manner. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide in the first half of the nucleic acid, e.g., the 5' half of the nucleic acid. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide in the second half of the nucleic acid, e.g., the 3' half of the nucleic acid. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide in the first half of the nucleic acid, e.g., the 5' half of the nucleic acid, and at least one chemically modified nucleotide in the second half of the nucleic acid, e.g., the 3' half of the nucleic acid. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5' end of the nucleic acid. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 3' end of the nucleic acid. In some embodiments, two chemically modified nucleotides are not adjacent to each other in the nucleic acid. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5' end of the nucleic acid. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3' end of the nucleic acid. In some embodiments, the nucleic acid comprises the same number of chemically modified nucleotides in the 5' and 3' halves of the nucleic acid. In some embodiments, the nucleic acid comprises a different number of chemically modified nucleotides in the 5' and 3' halves of the nucleic acid. In some embodiments, the nucleic acid comprises a greater number of chemically modified nucleotides in the 3' half than in the 5' half of the nucleic acid. In some embodiments, the nucleic acid comprises a greater number of chemically modified nucleotides in the 5' half than in the 3' half of the nucleic acid. In some embodiments, the nucleic acid comprises three chemically modified nucleotides within five nucleotides from the 5' end of the nucleic acid and / or three chemically modified nucleotides within five nucleotides from the 3' end of the nucleic acid.

[0032] In some embodiments, the chemically modified nucleotide(s) increase the in vitro and / or in vivo stability of the nucleic acid, hi some embodiments, the chemically modified nucleotide(s) increase the therapeutic efficacy of the nucleic acid, for example, to treat an inflammatory condition, cardiac injury, or muscular dystrophy.

[0033] In some embodiments, the isolated nucleic acid comprises one or more different types of chemically modified nucleotides, in some embodiments, the chemically modified nucleotides have a methylene bridge connecting the 2'-O atom and the 4'-C atom of the nucleotide sugar ring to lock the conformation (locked nucleic acid (LNA)).

[0034] The isolated nucleic acid may, in some embodiments, comprise any suitable chemical modification. In some embodiments, the chemical modification is a backbone modification, e.g., a sugar / phosphate backbone modification. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified nucleotide comprises an LNA. In some embodiments, the chemical modification comprises the introduction of a phosphorothioate group as an internucleotide linker. Suitable backbone modifications of chemically modified nucleotides include, but are not limited to, phosphorothioates, phosphotriesters, methylphosphonates, short-chain alkyl or cycloalkyl intersugar linkages, or short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, the chemical modification is a base modification.

[0035] The nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, but are not limited to, chemical synthesis, enzymatic production, and / or biological production. In some embodiments, the nucleic acids are prepared using chemical synthesis. Any suitable option for chemically synthesizing nucleic acids can be used. Suitable options include, but are not limited to, phosphodiesters, phosphotriesters, phosphoramidites, phosphite-triesters, and solid-phase synthesis approaches. In some embodiments, preparing the nucleic acids comprises in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a desired nucleotide sequence.

[0036] composition Compositions comprising the nucleic acids of the present disclosure are also provided herein. In some embodiments, the composition is a pharmaceutical composition or a therapeutic composition. In some embodiments, the composition comprises a therapeutically effective amount of the nucleic acid. In some embodiments, a therapeutically effective amount of the nucleic acid is an amount that, when administered to a subject, is capable of affecting a desired result in a subject in need of treatment for a condition or disease as described herein (e.g., a condition associated with inflammation and / or fibrosis, a muscle disease, or symptoms thereof). In some embodiments, a therapeutically effective amount of the nucleic acid is sufficient to affect a desired result by itself (e.g., without the administration of another therapeutic agent for the same condition or disease). In some embodiments, the composition contains a nucleic acid comprising a nucleotide sequence of about 25 to about 35 nt in length that is a portion of a tRNA, wherein the tRNA is selected from the group consisting of TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1. In some embodiments, the composition does not include another nucleic acid comprising a nucleotide sequence of about 25 to about 35 nt in length that is a portion of a tRNA (e.g., does not include the nucleotide sequence of the 5' fragment of a tRNA other than TRE-CTC1-7). In some embodiments, the composition does not include another nucleic acid comprising a nucleotide sequence about 30-32 nt in length derived from at least one of TRG-GCC1-2 (corresponding to Gene ID: 100189252) and TRG-GCC4-1 (corresponding to Gene ID: 100189274). In some embodiments, the composition does not include another nucleic acid comprising a nucleotide sequence about 30-32 nt in length that is a 5' fragment of TRG-GCC1-2 or TRG-GCC4-1.

[0037] In some embodiments, the composition comprises a pharmaceutically acceptable excipient. In some embodiments, the composition consists of or consists essentially of a therapeutically effective amount of the isolated nucleic acid and a pharmaceutically acceptable excipient. In some embodiments, the composition is a cell-free composition, e.g., the composition is substantially free of cells such as CDCs. In some embodiments, the composition is a composition free of extracellular vesicles, e.g., the composition is substantially free of extracellular vesicles such as exosomes.

[0038] Some non-limiting examples of materials that can function as pharmaceutically acceptable excipients include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; and (10) glycols, such as propylene glycol. (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids, (23) serum components, such as serum albumin, HDL, and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic, compatible substances used in pharmaceutical formulations.

[0039] In some embodiments, the composition includes a transfection reagent, for example, to facilitate delivery of the nucleic acid to a target cell target (in vitro or in vivo). Any suitable transfection reagent may be included in the composition. Suitable transfection reagents include, but are not limited to, liposomes, extracellular vesicles (EVs), and polyethylene glycol (PEG)-cationic lipid complexes (PCLCs). In some embodiments, the transfection reagent includes a lipid (e.g., a liposome-forming lipid) or a PEGylated lipid. In some embodiments, the lipid is a cationic lipid, as provided herein. In some embodiments, the transfection reagent includes DharmaFECT® or Lipofectamine®. In some embodiments, the nucleic acids of the present disclosure are formulated in a composition with a transfection reagent to facilitate cellular uptake and / or pharmacokinetics of the nucleic acid.

[0040] Liposomes are artificially prepared vesicles that may be composed primarily of lipid bilayers and can be used as delivery vehicles for the administration of pharmaceutical formulations. Liposomes can be of various sizes, including, but not limited to, multilamellar vesicles (MLVs) (which may be hundreds of nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments), small single-cell vesicles (SUVs) (which may be smaller than 50 nm in diameter), and large unilamellar vesicles (LUVs) (which may be between 50 and 500 nm in diameter). Liposome designs can include, but are not limited to, opsonins or ligands to improve attachment of the liposome to target tissues / cells or to activate events such as, but not limited to, endocytosis. Liposomes can also contain low or high pH to improve delivery of cargo, such as the nucleic acids of the present disclosure.

[0041] In some embodiments, the composition comprises liposomes such as, but not limited to, 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3, and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).

[0042] In some embodiments, the composition comprises a cationic lipid. Any suitable cationic lipid can be used in the composition. Suitable cationic lipids include, but are not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and aminoalcohol lipids. In some embodiments, the composition comprises a cationic lipid complex, such as a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated (e.g., 2 kDa PEG) ("PEG2000"). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, the PCLC is formed by exposing a mixture of PEG and cationic lipid to one or more freeze / thaw cycles, for example, 1, 2, 3, 4, 5, or more freeze / thaw cycles. In some embodiments, the freeze / thaw cycle comprises freezing the mixture in liquid nitrogen (e.g., at about -190°C) for about 5 minutes and thawing at about 60°C for about 5 minutes. The nucleic acids of the present disclosure can be mixed with PCLC to form a complex of nucleic acid and PCLC.

[0043] In some embodiments, the composition comprises extracellular vesicles (EVs), such as exosomes. The extracellular vesicles (EVs) can be derived from any suitable source, for example, EVs derived from cardiosphere-derived cells (CDCs) or fibroblasts. Suitable EVs, such as CDC-derived EVs, are provided, for example, in U.S. Patent Publication Nos. 20080267921, 20160158291, and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, MA et al. Stem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. 2014 May 8;2(5):606-19; Ibrahim, AG et al. Nanomedicine 33, 102347 (2020), each of which is incorporated by reference in its entirety. In some embodiments, the EVs are isolated from serum-free medium conditioned by human CDCs in culture. In some embodiments, the composition comprises EVs and liposomes and / or PCLCs as a transfection reagent. In some embodiments, the composition is substantially free of CDC-derived EVs.

[0044] The EVs, e.g., exosomes, disclosed herein can vary in size depending on the embodiment. Depending on the embodiment, the size of the EVs ranges from about 15 nm to about 95 nm in diameter (including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof). In some embodiments, the EVs are larger (e.g., about 140 to about 210 nm, e.g., about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof). In some embodiments, the EV diameter is in the range of about 15 nm to about 200 nm (e.g., about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm to about 200 nm, and overlapping ranges thereof). In some embodiments, the EVs generated from the original cell body are 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cell body.

[0045] Compositions containing EVs and nucleic acids of the present disclosure can be prepared using any suitable method. In some embodiments, loading EVs with nucleic acids includes formulating the nucleic acids with liposomes and / or PCLCs, e.g., as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with EVs; and enriching for EVs associated with exosomal markers to generate a population of EVs enriched for nucleic acids. Combining the nucleic acid-liposome mixture with EVs can be performed using any suitable method. In some embodiments, the nucleic acid-liposome mixture is combined with EVs at 37°C with shaking for about 30 minutes or more. Enriching to generate a population of EVs enriched for nucleic acids can be performed using any suitable method. In some embodiments, enriching for EVs associated with exosomal markers includes immunoprecipitating EVs associated with the exosomal marker using an antibody specific for the exosomal marker. In some embodiments, the exosomal marker is one or more of CD9, CD63, and CD81. In some embodiments, enriching for EVs associated with exosome markers comprises immunoprecipitating EVs associated with all of the exosome markers, CD9, CD63, and CD81. In some embodiments, the size distribution of the EV population enriched for nucleic acids is substantially unimodal. In some embodiments, at least 80%, 85%, 90%, 95%, 97%, or 99% of the population have a diameter under a single peak in the size distribution. In some embodiments, the EV population enriched for nucleic acids has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.

[0046] In some embodiments, the composition includes casein, e.g., casein micelles. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., casein-chitosan micelles. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in the casein-chitosan complex. In some embodiments, the composition includes one or more of the following phosphoproteins: alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the composition includes two or more, three or more, or all four of the following phosphoproteins: alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. The phosphoproteins may be present in the composition in any suitable concentration (relative to each other and to the total volume of the composition) and, in some embodiments, are present in an amount suitable to form casein micelles. In some embodiments, the casein phosphoproteins are present in the composition at a combined concentration of about 5-10% (weight / volume). In some embodiments, the casein phosphoprotein is present in the composition at about 8% (weight / volume) combined. In some embodiments, the casein phosphoprotein is present in the composition at about 5% (weight / volume) combined. The casein phosphoprotein can be derived from any suitable animal, e.g., mammal, including but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep. In some embodiments, the casein phosphoprotein is bovine alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. Suitable casein formulations with EVs are provided, for example, in Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):e12045, incorporated herein by reference in its entirety. In some embodiments, compositions of the present disclosure, e.g., pharmaceutical compositions, formulated with casein, as provided herein, are suitable for oral administration to a subject.Suitable oral formulations of the nucleic acids of the present disclosure are provided, for example, in International Patent Application Nos. PCT / US2022 / 035866 (filed June 30, 2022) and PCT / US2022 / 035870 (filed June 30, 2022), each of which is incorporated by reference herein in its entirety. In some embodiments, an oral formulation of the present disclosure comprises one or more nucleic acids described herein, a cationic lipid, at least one casein protein, and chitosan. In some embodiments, an oral formulation comprises an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), a cationic lipid, at least one casein protein, and chitosan. In some embodiments, the oral formulation comprises an artificial lipid micelle or liposome, one or more nucleic acids of any of the nucleic acids described herein encapsulated in the artificial lipid micelle or liposome, and a coating on the artificial lipid micelle or liposome, the coating comprising a mixture of casein protein and chitosan polymer. In some embodiments, the oral formulation comprises an artificial lipid micelle or liposome, an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), the nucleic acid encapsulated in the artificial lipid micelle or liposome, and a coating on the artificial lipid micelle or liposome, the coating comprising a mixture of casein protein and chitosan polymer. In some embodiments, the artificial lipid micelle comprises a cationic lipid micelle. In some embodiments, the liposome comprises a cationic lipid. In some embodiments, the liposome comprises DharmaFECT® or Lipofectamine®.

[0047] In some embodiments, the composition is a parenteral dosage form. In some embodiments, the parenteral dosage form is sterile or can be sterilized before administration to a patient. Examples of parenteral dosage forms include, but are not limited to, ready-to-inject solutions, dry products that can be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, ready-to-inject suspensions, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of nucleic acids include, but are not limited to, sterile water; water for injection, USP; saline solution; glucose solution; aqueous vehicles (such as, but not limited to, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's injection); water-miscible vehicles (such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol); and non-aqueous vehicles (such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate).

[0048] In some embodiments, the composition comprises an antisense oligonucleotide, such as one that targets one or more exons of a dystrophin transcript, hi some embodiments, the composition comprises an antisense oligonucleotide that comprises an exon-skipping agent that targets a dystrophin transcript.

[0049] method Provided herein are methods of treating a subject in need thereof (also referred to herein as "therapeutic methods") using the nucleic acids of the present disclosure. Conditions treatable by the therapeutic methods include, but are not limited to, muscle diseases, cardiac conditions, fibrotic conditions, and inflammatory conditions. In some embodiments, the condition includes, but is not limited to, muscle diseases, myocardial infarction, cardiac disease, myocardial changes, muscular dystrophy, fibrotic diseases, inflammatory diseases, viral infections, sepsis, or wound healing. In some embodiments, the condition includes acute myocardial infarction. In some embodiments, the condition treated by the therapeutic methods includes, but is not limited to, conditions associated with inflammation and / or fibrosis. In some embodiments, a subject treated by administering a nucleic acid of the present disclosure according to the therapeutic methods herein is in need of treatment for a condition associated with inflammation and / or fibrosis. Conditions associated with inflammation and / or fibrosis may include, but are not limited to, inflammation and / or fibrosis of cardiac or skeletal muscle. In some embodiments, the condition treated by the therapeutic methods is a symptom and / or sequela of an infection. In some embodiments, the infection is a viral infection, e.g., a respiratory viral infection such as COVID-19, other coronaviruses, or other viral pathogens (e.g., influenza, H1N1, hepatitis C, HIV, etc.). In some embodiments, the method includes identifying a subject suffering from or diagnosed with a muscular disease, cardiac condition, or inflammatory condition, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the disclosure.

[0050] Therapeutic methods of the present disclosure can include administering a therapeutically effective amount of a nucleic acid of the present disclosure (or a composition comprising the same, as described herein) to a subject in need of treatment, thereby treating the subject. In some embodiments, methods of treating a muscle disease or a symptom thereof include administering a therapeutically effective amount of a nucleic acid of the present disclosure (or a composition comprising the same, as described herein) to a subject in need of treatment, thereby treating the muscle disease or a symptom thereof. In some embodiments, the muscle disease includes a skeletal muscle disease and / or a cardiac condition. In some embodiments, the muscle disease includes a muscular dystrophy (e.g., Duchenne muscular dystrophy). In some embodiments, methods of treating a muscular dystrophy (e.g., Duchenne muscular dystrophy) further include administering a secondary therapy for the muscle disease (e.g., an exon-skipping agent and / or gene therapy). In some embodiments, the exon-skipping agent includes an antisense oligonucleotide targeting a dystrophin transcript. In some embodiments, the cardiac condition includes myocardial infarction, heart failure, or a symptom or sequela thereof (e.g., cardiac dysfunction, cardiac tissue fibrosis, etc.). In some embodiments, the cardiac condition comprises acute myocardial infarction. In some embodiments, the cardiac function comprises left ventricular function, which may be expressed by any suitable option, such as, but not limited to, ejection fraction. In some embodiments, the method comprises identifying a subject suffering from or diagnosed with a muscular disease or a symptom thereof, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure. In some embodiments, the method comprises identifying a subject suffering from or diagnosed with a muscular dystrophy (e.g., Duchenne muscular dystrophy) or a symptom thereof, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure. In some embodiments, the method comprises identifying a subject suffering from or diagnosed with heart failure or a symptom or sequela thereof, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure.In some embodiments, the method comprises identifying a subject at risk of or suffering from a myocardial infarction or a symptom or sequelae thereof, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure. In some embodiments, the method comprises identifying a subject at risk of or suffering from an acute myocardial infarction or a symptom or sequelae thereof, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure.

[0051] In some embodiments, a method for treating a condition associated with inflammation and / or fibrosis comprises administering to a subject in need of treatment for a condition associated with inflammation and / or fibrosis a therapeutically effective amount of a nucleic acid of the present disclosure (or a composition comprising same, as described herein), thereby treating the condition associated with inflammation and / or fibrosis. In some embodiments, the condition associated with inflammation and / or fibrosis comprises cardiac or skeletal muscle inflammation and / or fibrosis, or a symptom and / or sequela of myocardial infarction, heart failure, or muscular dystrophy, or a symptom or sequela of an infection (e.g., a viral infection), or is associated with immunotherapy or a symptom or sequela of an infection, idiopathic pulmonary fibrosis, or liver cirrhosis. In some embodiments, the condition associated with inflammation and / or fibrosis comprises cardiac inflammation and / or fibrosis. In some embodiments, the condition associated with inflammation and / or fibrosis comprises skeletal muscle inflammation and / or fibrosis. In some embodiments, the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequela of myocardial infarction or heart failure (e.g., cardiac function decline, cardiac tissue fibrosis, etc.). In some embodiments, the condition associated with inflammation and / or fibrosis comprises symptoms and / or sequelae of muscular dystrophy (e.g., muscle loss, tissue fibrosis, etc.). In some embodiments, the method comprises identifying a subject suffering from or diagnosed with cardiac inflammation and / or fibrosis, as described herein, and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure.

[0052] In some embodiments, the subject is suffering from or has heart failure. In some embodiments, the subject is suffering from or has a myocardial infarction. In some embodiments, the subject is a subject with or suffering from acute myocardial infarction. In some embodiments, the subject is at risk for heart failure and / or myocardial infarction (e.g., acute myocardial infarction). In some embodiments, administering a therapeutically effective amount of a nucleic acid to the subject prevents a decrease in ejection fraction due to heart failure. In some embodiments, administering a therapeutically effective amount of a nucleic acid to the subject prevents a decrease in ejection fraction after a myocardial infarction (e.g., acute myocardial infarction). In some embodiments, the subject's ejection fraction is not substantially reduced by heart failure or myocardial infarction after administering a therapeutically effective amount of a nucleic acid to the subject. In some embodiments, the subject's ejection fraction is not substantially reduced by acute myocardial infarction after administering a therapeutically effective amount of a nucleic acid to the subject. In some embodiments, the subject's ejection fraction is not decreased, or is decreased by 1, 2, 3, 4, 5%, or by about 1, 2, 3, 4, 5%, or by at most 1, 2, 3, 4, 5%, or a range of percentages defined by any two of the foregoing values ​​(e.g., 0-5%, 0-3%, 1-4%, etc.) due to heart failure or myocardial infarction after administering a therapeutically effective amount of a nucleic acid to the subject. In some embodiments, the subject's ejection fraction is not decreased, or is decreased by 1, 2, 3, 4, 5%, or by about 1, 2, 3, 4, 5%, or by at most 1, 2, 3, 4, 5%, or a range of percentages defined by any two of the foregoing values ​​(e.g., 0-5%, 0-3%, 1-4%, etc.) due to acute myocardial infarction after administering a therapeutically effective amount of a nucleic acid to the subject. In some embodiments, the subject's ejection fraction increases after administering a therapeutically effective amount of a nucleic acid to a subject suffering from heart failure and / or myocardial infarction. In some embodiments, the ejection fraction of a subject is increased after administering a therapeutically effective amount of a nucleic acid to a subject suffering from acute myocardial infarction. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces myocardial fibrosis due to heart failure and / or myocardial infarction. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces myocardial fibrosis due to acute myocardial infarction.

[0053] In some embodiments, the subject has or is predisposed to a muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the subject is genetically predisposed to a muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the method comprises identifying a subject predisposed to a muscular dystrophy and administering to the subject a therapeutically effective amount of a nucleic acid of the present disclosure. In some embodiments, the subject has one or more mutations in the dystrophin gene that predispose the subject to developing a muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, administering a therapeutically effective amount of the nucleic acid to the subject prevents or alleviates a decrease in skeletal muscle function, e.g., force or torque generated by a skeletal muscle group, due to muscular dystrophy. In some embodiments, administering a therapeutically effective amount of the nucleic acid to a subject with muscular dystrophy increases or restores skeletal muscle function, e.g., force or torque generated by an affected skeletal muscle group. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject suffering from muscular dystrophy increases the force or torque generated by the affected skeletal muscle group by 5, 7, 10, 12, 15, 17, 20%, about 5, 7, 10, 12, 15, 17, 20%, or at least 5, 7, 10, 12, 15, 17, 20%, or a percentage defined by any two of the foregoing values ​​(e.g., 5-20%, 5-15%, 7-17%, etc.) compared to pre-administration. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces skeletal muscle fibrosis due to muscular dystrophy.In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces the percentage of skeletal muscle fibrosis due to muscular dystrophy by 2, 5, 7, 10, 12, or 15 percentage points, by about 2, 5, 7, 10, 12, or 15 percentage points, or by at least 2, 5, 7, 10, 12, or 15 percentage points, or by a range defined by any two of the foregoing values ​​(e.g., 2-15%, 5-15%, 10-12%, 7-15%, etc.) compared to a suitable reference (e.g., the average percentage of skeletal muscle fibrosis due to muscular dystrophy in subjects not receiving a therapeutically effective amount of a nucleic acid). In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject suffering from muscular dystrophy increases the number of muscle fibers in skeletal muscle. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject suffering from muscular dystrophy increases the number of muscle fibers in skeletal muscle by 5, 10, 12, 15, 18, 20, 25%, about 5, 10, 12, 15, 18, 20, 25%, or at least 5, 10, 12, 15, 18, 20, 25%, or a percentage range defined by any two of the foregoing values ​​(e.g., 5-25%, 10-20%, 120-18%, 10-15%, etc.) compared to before administration. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject suffering from muscular dystrophy increases skeletal muscle weight or volume. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject suffering from muscular dystrophy results in a 5, 10, 12, 15, 18, 20, 25% increase, about a 5, 10, 12, 15, 18, 20, 25% increase, or at least a 5, 10, 12, 15, 18, 20, 25% increase in skeletal muscle weight or volume compared to before administration, or a percentage increase in a range defined by any two of the foregoing values ​​(e.g., 5-25%, 10-20%, 120-18%, 10-15%, etc.).

[0054] In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject alters the macrophage subtype composition of muscle tissue, e.g., skeletal muscle or cardiac muscle. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject increases the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., skeletal muscle, compared to a suitable reference (e.g., prior to administration, other subjects treated with a scrambled oligonucleotide, etc.). In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject increases the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., skeletal muscle, by a 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 2-, 2.2-, 2.5-, 3-, 3.5-, 4-, 4.5-, 5-fold increase, about a 1.1-fold increase, about a 1.1-fold increase, about a 1.2-fold increase, about a 1.3-fold increase, about a 1.4-fold increase, about a 2.2-fold increase, about a 2.5-fold increase, about a 3.5-fold increase, about a 3.5-fold increase, about a 4.5-fold increase, about a 5.5-fold increase, about a 6.5-fold increase, about a 6.5-fold increase, about a 7.5-fold increase, about a 7.5-fold increase, about a 8.5-fold increase, about a 9.5-fold increase, about a 10 ... , 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5-fold increase, or at least a 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5-fold increase, or a range defined by any two of the foregoing values ​​(e.g., 1.1-5-fold, 1.5-4.5-fold, 2-4-fold, 1.2-5-fold, etc.). In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject increases the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., skeletal muscle, relative to a suitable control. In some embodiments, the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., skeletal or cardiac muscle, is determined relative to the number and / or abundance of CD68+ / CD206− cells in the same tissue. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., myocardium, compared to a suitable reference (e.g., another subject treated with a scrambled oligonucleotide prior to administration).In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., cardiac muscle, by 0.1, 0.2, 0.3, 0.4, or 0.5-fold, by about 0.1, 0.2, 0.3, 0.4, or 0.5-fold, or by at least 0.1, 0.2, 0.3, 0.4, or 0.5-fold, or by a range defined by any two of the foregoing values ​​(e.g., 0.1-0.5-fold, 0.1-0.4-fold, 0.2-0.4-fold, 0.1-0.3-fold, etc.) compared to a suitable reference (e.g., another subject treated with a scrambled oligonucleotide prior to administration). In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject reduces the number and / or abundance of CD68+ / CD206+ cells in muscle tissue, e.g., cardiac muscle, compared to a suitable control. In some embodiments, administering a therapeutically effective amount of a nucleic acid to a subject does not alter the number and / or abundance of CD68+ / CD80+ cells in muscle tissue, e.g., skeletal or cardiac muscle. In some embodiments, the number and / or abundance of CD68+ / CD80+ cells in muscle tissue, e.g., skeletal or cardiac muscle, is determined relative to the number and / or abundance of CD68+ / CD80- cells in the same tissue.

[0055] The nucleic acid can be administered to the subject in any suitable amount. In some embodiments, a therapeutically effective amount of a nucleic acid is about 0.01 μg, 0.02 μg, 0.05 μg, 0.1 μg, 0.2 μg, 0.5 μg, 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 40 μg μg, 50 μg, 75 μg, 100 μg, 125 μg, 150 μg, 175 μg, 200 μg, 250 μg, 300 μg, 400 μg, 500 μg, 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 40 mg, 50 mg, 75 mg, 100 mg or more, or a range defined by any two of the foregoing values ​​(e.g., 0.01 μg-0.1 μg, 0.1 μg-1 μg, 1 μg-10 μg, 10 μg-100 μg, 100 μg-1 mg, 1 mg-10 mg, 10 mg-100 mg). In some embodiments, the therapeutically effective amount of the nucleic acid is about 0.001 μg / g, 0.002 μg / g, 0.005 μg / g, 0.01 μg / g, 0.02 μg / g, 0.05 μg / g, 0.1 μg / g, 0.15 μg / g, 0.2 μg / g, 0.5 μg / g, 1 μg / g, 2 μg / g, 3 μg / g, 4 μg / g, 5 μg / g, 6 μg / g, 7 μg / g, 8 μg / g, 9 μg / g, 10 μg / g, 15 μg / g, 20 μg / g, 25 μg / g, 30 μg / g, 35 μg / g, 40 μg / g, 45 μg / g, 50 μg / g, 60 μg / g, 70 μg / g, 80 μg / g, 90 μg / g, 100 μg / g, or more, or a range defined by any two of the foregoing values ​​(e.g., 0.001 μg / g-0.01 μg / g, 0.01 μg / g-0.1 μg / g, 0.1 μg / g-1 μg / g, 1 μg / g-10 μg / g, 10 μg / g-100 μg / g).In some embodiments, a therapeutically effective amount of nucleic acid is about 0.001 μg / g, 0.002 μg / g, 0.005 μg / g, 0.01 μg / g, 0.02 μg / g, 0.05 μg / g, 0.1 μg / g, 0.2 μg / g, 0.5 μg / g, or about 1 μg / g or more by body weight, or an amount in a range defined by any two of the foregoing values ​​(e.g., 0.001 μg / g-0.01 μg / g, 0.01 μg / g-0.05 μg / g, 0.05 μg / g-0.1 μg / g, 0.1 μg / g-0.2 μg / g, 0.2 μg / g-0.5 μg / g, or 0.5 μg / g-1 μg / g). In some embodiments, a therapeutically effective amount of a nucleic acid is about 0.001 mg / kg, 0.002 mg / kg, 0.005 mg / kg, 0.01 mg / kg, 0.02 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg or more by body weight, or an amount in a range defined by any two of the foregoing values ​​(e.g., 0.001 mg / kg-0.01 mg / kg, 0.01 mg / kg-0.1 mg / kg, 0.1 mg / kg-1 mg / kg, 1 mg / kg-10 mg / kg, 10 mg / kg-100 mg / kg).In some embodiments, a therapeutically effective amount of a nucleic acid is about or greater than 0.001 mg / kg, 0.002 mg / kg, 0.005 mg / kg, 0.01 mg / kg, 0.02 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.5 mg / kg, or about 1 mg / kg of body weight, or an amount in a range defined by any two of the foregoing values ​​(e.g., 0.001 mg / kg-0.01 mg / kg, 0.01 mg / kg-0.05 mg / kg, 0.05 mg / kg-0.1 mg / kg, 0.1 mg / kg-0.2 mg / kg, 0.2 mg / kg-0.5 mg / kg, or 0.5 mg / kg-1 mg / kg).

[0056] In some embodiments of any of the methods of the present disclosure, a therapeutically effective amount of the nucleic acid is sufficient to affect the desired result by itself (e.g., without administering another therapeutic agent for the same condition or disease). In some embodiments of any of the methods of the present disclosure, the method does not include administering another nucleic acid that includes a nucleotide sequence about 25 to about 35 nt in length that is a portion of a tRNA (e.g., does not include a nucleotide sequence that is a 5' fragment of TRE-CTC1-7). In some embodiments of any of the methods of the present disclosure, the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt in length derived from at least one of TRE-GCC1-2 and TRE-GCC4-1. In some embodiments of any of the methods of the present disclosure, the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt in length that is a 5' fragment of TRE-GCC1-2 or TRE-GCC4-1. In some embodiments of any of the methods disclosed herein, the method comprises administering a therapeutically effective amount of a composition consisting of or consisting essentially of an isolated nucleic acid and a pharmaceutically acceptable excipient. In some embodiments, the method comprises administering a therapeutically effective amount of a composition comprising the isolated nucleic acid and not containing cells (e.g., a composition substantially free of cells such as CDCs). In some embodiments, the method comprises administering a therapeutically effective amount of a composition comprising the isolated nucleic acid and not containing extracellular vesicles (e.g., a composition substantially free of extracellular vesicles such as exosomes).

[0057] The nucleic acid or composition can be administered to a subject according to any suitable dosing schedule. In some embodiments, a therapeutically effective amount of the nucleic acid or composition is administered to a subject no more frequently than three times per week, twice per week, once per week (QW), once every two weeks (Q2W), once per month (QM), once every two months (Q2M), once every three months (Q3M), once every four months (Q4M), or more frequently, or within a range defined by any two of the foregoing values ​​(e.g., three times per week to once every four months (Q4M), twice per week to once every two months (Q2M), or twice per week to once per month (QM)). In some embodiments, the nucleic acid is administered to the subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times, or a range defined by any two of the foregoing values ​​(e.g., 1-30 times, 2-20 times, 5-15 times, 1-20 times, etc.). In some embodiments, the nucleic acid is administered to the subject at regular intervals. In some embodiments, the nucleic acid is administered to the subject chronically.

[0058] The nucleic acid or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable options for administration include, but are not limited to, intravenous, intramuscular, subcutaneous, intraarterial, intraperitoneal, or oral administration. In some embodiments, the nucleic acid or composition is administered orally. In some embodiments, the nucleic acid or composition is administered by oral gavage. In some embodiments, the nucleic acid or composition is administered intravenously. In some embodiments, the nucleic acid or composition is administered by injection.

[0059] Methods of immunomodulation ("immunomodulatory methods") are also provided herein. Immunomodulatory methods can include contacting a macrophage population, e.g., human macrophages, with an effective amount of a nucleic acid of the present disclosure (or a composition comprising same, as described herein). In some embodiments, the contacting includes administering an effective amount of the nucleic acid or composition to a subject in need of treatment for a condition characterized by inflammation and / or fibrosis. In some embodiments, contacting a macrophage population with an effective amount of a nucleic acid of the present disclosure increases expression of one or more anti-inflammatory cytokines. In some embodiments, contacting a macrophage population with an effective amount of a nucleic acid of the present disclosure increases expression of IL-10, IL-1α, and / or ARG-1 in the macrophage population. In some embodiments, contacting a macrophage population with an effective amount of a nucleic acid of the disclosure increases the expression of IL-10, IL-1α and / or ARG-1 in the macrophage population by about 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 fold, ... 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10-fold increase, or at least a 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10-fold increase, or a range defined by any two of the foregoing values ​​(e.g., 1.1-10-fold, 1.5-9-fold, 2-8-fold, 1.2-5-fold, etc.). In some embodiments, the expression of IL-10, IL-1α and / or ARG-1 is mRNA expression of IL-10, IL-1α and / or ARG-1.

[0060] In some embodiments, the contacting step is performed in vitro, e.g., in culture. In some embodiments, after contacting the macrophages in vitro, the method includes administering the macrophages to a subject in need of treatment for a muscle disease, cardiac condition, fibrotic condition, or inflammatory condition, as described herein.

[0061] kit Also provided herein are kits comprising the nucleic acids or compositions of the present disclosure. In some embodiments, the kits find use in treating muscle diseases, cardiac conditions, fibrotic conditions, and inflammatory conditions (e.g., associated with muscle diseases or viral infections) as provided herein. The kits may include a nucleic acid of the present disclosure and a transfection reagent. The transfection reagent may be any suitable transfection reagent as provided herein. In some embodiments, the transfection reagent includes one or more of a lipid (e.g., a liposome-forming lipid), a PEGylated lipid, and an extracellular vesicle. In some embodiments, the kit includes a pharmaceutically acceptable excipient as provided herein. In some embodiments, the kit includes casein and / or chitosan. In some embodiments, the kit includes an antisense oligonucleotide, such as, but not limited to, an exon-skipping agent targeting a dystrophin transcript. The kit may include one or more containers (e.g., vials, ampoules, test tubes, flasks, or bottles) for holding one or more components of the kit. The kit may further include instructions for using the kit to treat a condition (e.g., muscular dystrophy, heart failure, myocardial infarction or an inflammatory condition associated therewith, or an inflammatory condition associated with a viral infection). The information and instructions may be in the form of words, pictures, or both, etc.

[0062] Additional Embodiments Additional non-limiting embodiments of the present disclosure are provided below.

[0063] Cardiosphere-derived cells (CDCs) are cardiac progenitor / stromal cells with immunomodulatory, antifibrotic, and pro-regenerative properties. These therapeutic actions antagonize key pathways central to the pathogenesis of Duchenne muscular dystrophy (DMD). Without being bound by theory, mechanistic studies in preclinical models demonstrate that CDCs act indirectly by secreting extracellular vesicles (CDC-EVs), lipid nanoparticles containing a rich repertoire of bioactive molecules. The inventory of CDC-EV contents generated by RNA-seq now serves as a Rosetta Stone for deciphering and exploiting complex EV biology. In CDC-EVs, the largest proportion of mapped reads are transfer RNA (tRNA) fragments. These molecular entities, previously thought to be nonspecific degradation products, are increasingly recognized as constituting a novel class of small ncRNAs with potential therapeutic bioactivity. Species containing the 5' half of a single specific tRNA are particularly abundant in CDC-EVs. This entity, tREX-1, was validated in mdx mice (see Examples below). When synthetically produced and packaged into a transfection reagent, tREX-1 possesses disease-modulating bioactivity, and core disease symptoms of DMD, including structural and functional abnormalities of the heart and skeletal muscle, are partially and significantly reversed by twice-weekly intravenous infusion of tREX-1 for 4 weeks. Thus, tREX-1 represents a new class of defined ncRNAs unearthed from CDC-EVs.

[0064] Non-limiting embodiments of the present disclosure are further provided in the following numbered paragraphs: Item 1 An isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the isolated nucleic acid is RNA and is at most 60 nt in length or at most 40 nt in length. Section 2 1. An isolated nucleic acid comprising a nucleotide sequence at least 95% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the isolated nucleic acid is RNA and is at most 60 nt in length or at most 40 nt in length. Section 3 An isolated nucleic acid comprising the nucleotide sequence of a 5' fragment of a human tRNA, wherein the human tRNA is selected from TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1, the nucleic acid is RNA, and the nucleic acid is at most 60 nt in length or at most 40 nt in length. Section 4 4. The isolated nucleic acid of any one of the preceding claims, wherein the nucleic acid comprises at least one chemically modified nucleotide. Section 5 5. The isolated nucleic acid of paragraph 4, wherein the nucleic acid comprises 1 to 10 chemically modified nucleotides. Section 6 5. The isolated nucleic acid of paragraph 4, wherein at least one chemically modified nucleotide comprises a backbone modification. Section 7 7. The isolated nucleic acid of paragraph 6, wherein the backbone modification comprises a backbone sugar modification. Section 8 8. The isolated nucleic acid of claim 6 or 7, wherein at least one chemically modified nucleotide comprises a locked nucleic acid (LNA). Section 9 9. The isolated nucleic acid according to any one of items 4 to 8, wherein at least one chemically modified nucleotide increases the stability of the nucleic acid. Item 10 10. The isolated nucleic acid of paragraph 9, wherein at least one chemically modified nucleotide increases the in vivo stability of the nucleic acid. Section 11 Item 11. The isolated nucleic acid of any one of the preceding items, wherein the nucleotide sequence is at the 5' end of the nucleic acid. Item 12 Item 11. The isolated nucleic acid of any one of the preceding items, wherein the nucleic acid is 32 nt in length or about 32 nt in length. Item 13 Item 10. The isolated nucleic acid of any one of the preceding items, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). Section 14 A therapeutic composition comprising a therapeutically effective amount of the isolated nucleic acid of any one of the preceding paragraphs and a pharmaceutically acceptable excipient. Section 15 15. The composition of paragraph 14, further comprising a transfection reagent. Section 16 16. The composition of claim 15, wherein the transfection reagent comprises one or more of liposomes, extracellular vesicles (EVs), and polyethylene glycol (PEG)-cationic lipid complexes (PCLCs). Section 17 17. The composition of claim 15 or 16, wherein the transfection reagent comprises EVs derived from cardiosphere-derived cells (CDCs). Section 18 18. The composition according to any one of items 14 to 17, further comprising casein phosphoprotein. Section 19 19. The composition of paragraph 18, comprising casein micelles. Section 20 20. The composition of claim 18 or 19, comprising chitosan. Section 21 21. The composition of claim 20, wherein the isolated nucleic acid is encapsulated in a casein-chitosan complex. Section 22 22. The composition of claim 20 or 21, comprising casein-chitosan micelles. Section 23 23. The composition according to any one of items 14 to 22, further comprising an antisense oligonucleotide. Section 24 24. The composition of paragraph 23, wherein the antisense oligonucleotide comprises an exon skipping agent that targets a dystrophin transcript. Section 25 A kit comprising the nucleic acid according to any one of items 1 to 13 and a transfection reagent. Section 26 26. The kit of paragraph 25, wherein the transfection reagent comprises one or more of a lipid, a PEGylated lipid, and an extracellular vesicle (EV). Section 27 27. The kit of claim 25 or 26, further comprising a pharmaceutically acceptable excipient. Section 28 28. The kit according to any one of items 25 to 27, further comprising casein phosphoprotein. Section 29 29. The kit according to any one of items 25 to 28, further comprising chitosan. Section 30 30. The kit according to any one of items 25 to 29, further comprising an antisense oligonucleotide. Section 31 31. The kit of paragraph 30, wherein the antisense oligonucleotide comprises an exon skipping agent that targets a dystrophin transcript. Section 32 A method for treating a muscular disease or a symptom thereof, comprising the step of administering a therapeutically effective amount of the nucleic acid described in any one of items 1 to 13 or the composition described in any one of items 14 to 24 to a subject in need of treatment for the muscular disease or a symptom thereof, thereby treating the muscular disease or a symptom thereof. Item 33 33. The method of clause 32, wherein the muscle disease comprises a skeletal muscle disease and / or a cardiac condition. Section 34 34. The method of claim 32 or 33, wherein the muscle disease comprises muscular dystrophy. Section 35 35. The method of any one of items 32 to 34, wherein the muscle disease comprises Duchenne muscular dystrophy. Section 36 36. The method of claim 34 or 35, further comprising administering a secondary treatment for the muscle disease. Section 37 37. The method of paragraph 36, wherein the secondary treatment comprises an exon skipping agent and / or gene therapy. Section 38 A method for treating a cardiac condition or a symptom thereof, comprising the step of administering to a subject in need of treatment for the cardiac condition or a symptom thereof a therapeutically effective amount of the nucleic acid described in any one of items 1 to 13 or the composition described in any one of items 14 to 24, thereby treating the cardiac condition or a symptom thereof. Section 39 39. The method of clause 38, wherein the cardiac condition comprises symptoms and / or sequelae of heart failure or myocardial infarction. Section 40 A method for treating a condition associated with inflammation and / or fibrosis, comprising the step of administering a therapeutically effective amount of the nucleic acid described in any one of items 1 to 13 or the composition described in any one of items 14 to 24 to a subject in need of treatment for a condition associated with inflammation and / or fibrosis, thereby treating the condition associated with inflammation and / or fibrosis. Section 41 41. The method of paragraph 40, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart or skeletal muscle. Section 42 42. The method of claim 40 or 41, wherein the condition associated with inflammation and / or fibrosis comprises symptoms and / or sequelae of heart failure, myocardial infarction or muscular dystrophy. Section 43 41. The method of paragraph 40, wherein the condition associated with inflammation and / or fibrosis includes symptoms or sequelae of an infectious disease or is associated with immunotherapy. Section 44 44. The method of clause 43, wherein the infectious disease comprises a viral infection. Section 45 41. The method of claim 40, wherein the condition associated with inflammation and / or fibrosis comprises a cytokine storm or an autoimmune disease. Section 46 41. The method of claim 40, wherein the condition associated with inflammation and / or fibrosis comprises a symptom or sequela of infection, idiopathic pulmonary fibrosis or cirrhosis. Section 47 47. The method of any one of items 32 to 46, comprising orally administering to a subject a therapeutically effective amount of the nucleic acid or composition. Section 48 47. The method of any one of items 32 to 46, comprising parenterally administering to a subject a therapeutically effective amount of the nucleic acid or composition. Section 49 49. The method of paragraph 48, comprising administering to the subject a therapeutically effective amount of the nucleic acid or composition intravenously, intramuscularly, or intracardially. Section 50 50. The method of any one of items 32 to 49, wherein the therapeutically effective amount comprises from about 0.001 μg / g to about 100 μg / g of nucleic acid. Section 51 51. The method of any one of items 32 to 50, comprising administering a therapeutically effective amount of the nucleic acid or composition no more than twice a week. Section 52 26. A method for immunomodulation, comprising the step of contacting a macrophage population with an effective amount of the nucleic acid according to any one of items 1 to 13 or the composition according to any one of items 14 to 24. Section 53 53. The method of paragraph 52, wherein the contacting step comprises administering an effective amount of the nucleic acid or composition to a subject in need of treatment for a condition characterized by inflammation and / or fibrosis. Section 54 54. The method of claim 52 or 53, wherein the macrophages are human macrophages. Section 55 55. The method of any one of paragraphs 52 to 54, wherein the step of contacting with an effective amount of the isolated nucleic acid increases expression of IL-10, IL-1α and / or ARG-1 in the macrophage population. Section 56 56. The method of any one of paragraphs 52 to 55, wherein the contacting step is carried out in vitro. Section 57 Item 11. The method of any one of the preceding items, wherein the subject is suffering from heart failure or myocardial infarction. Section 58 Item 11. The method of any one of the preceding paragraphs, wherein the subject is suffering from or predisposed to suffering from muscular dystrophy (e.g., Duchenne muscular dystrophy). Section 59 25. Use of the nucleic acid of any one of paragraphs 1 to 13 or the composition of any one of paragraphs 14 to 24 for the treatment of a muscular disease or a symptom thereof in a subject in need thereof. Item 60 Use of the nucleic acid of any one of items 1 to 13 or the composition of any one of items 14 to 24 for the preparation of a medicament for treating a muscle disease or a symptom thereof in a subject in need thereof. Section 61 61. Use of the nucleic acid or composition of paragraph 59 or 60, wherein the muscle disease comprises a skeletal muscle disease and / or a cardiac condition. Section 62 62. Use of the nucleic acid or composition according to paragraph 61, wherein the cardiac condition comprises symptoms and / or sequelae of heart failure or myocardial infarction. Section 63 62. Use of the nucleic acid or composition according to any one of items 59 to 61, wherein the muscle disease comprises muscular dystrophy. Section 64 25. Use of the nucleic acid of any one of paragraphs 1 to 13 or the composition of any one of paragraphs 14 to 24 for the treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof. Section 65 25. Use of the nucleic acid of any one of paragraphs 1 to 13 or the composition of any one of paragraphs 14 to 24 for the preparation of a medicament for the treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof. Section 66 66. Use of the nucleic acid or composition according to paragraph 64 or 65, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart and / or skeletal muscle. Section 67 67. Use of the nucleic acid or composition according to any one of items 64 to 66, wherein the condition associated with inflammation and / or fibrosis comprises symptoms and / or sequelae of heart failure, myocardial infarction or muscular dystrophy.

[0065] All patents and other publications cited throughout this application; e.g., literature references, issued patents, published patent applications, and co-pending patent applications; are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methods described in such publications that may be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements regarding the date or contents of these documents are based on the information available to the applicant and do not constitute any admission as to the accuracy of the dates or contents of these documents.

[0066] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Specific embodiments and examples of the present disclosure are described herein for illustrative purposes; however, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions may be presented in a given order, alternative embodiments may perform the functions in a different order, or may perform the functions substantially simultaneously. The teachings of the present disclosure provided herein can be applied to other procedures or methods, as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the present disclosure can be modified, where necessary, using the structure, function, and concepts of the above-mentioned references and applications to provide further embodiments of the present disclosure. Furthermore, considerations of biological functional equivalence allow for some changes to be made to protein or nucleic acid structure without affecting biological or chemical activity in type or amount. These and other modifications can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.

[0067] Particular elements of any of the foregoing embodiments can be combined with or substituted for elements in other embodiments. Furthermore, although advantages associated with certain embodiments of the present disclosure are described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages, to fall within the scope of the present disclosure.

[0068] The technology described herein is further illustrated by the following examples, which should not be construed as further limiting in any way. [Example]

[0069] Example 1 This non-limiting example demonstrates the discovery of tREX-1, a non-coding RNA (ncRNA) identified as a payload within CDC-derived extracellular vesicles (CDC-EVs), and the initial in vitro characterization of its immunomodulatory effects.

[0070] A ncRNA species specifically enriched in CDC-EVs was identified with the sequence 5'-UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC-3' (SEQ ID NO: 1) (Figure 7D). Extracellular vesicles (EVs) secreted from cardiomyocyte-derived cells induced transcriptome changes in cultured macrophages, sharing characteristics with alternatively activated (M2) and classically activated (M1) macrophages (Figure 7A). Sequencing of small RNAs in EVs revealed that tRNAs accounted for the largest proportion of mapped reads (Figure 7B). The most abundant tRNA reads mapped to tREX-1 (Figure 7C).

[0071] This ncRNA species represents the 5' fragment (specifically, the first 32 nucleotides from the 5' end) of the TRE-CTC1-7 tRNA and was designated tREX-1 (Figures 1A, 6, and 7D). Figure 1A shows a schematic diagram of the 5' tRNA half and its known biological activity. The sequence of tREX-1 also shared 100% identity with the 5' fragments (specifically, the first 32 nucleotides from the 5' end) of at least two other tRNA-Glu-CTC isodecoders, TRE-CTC1-1 and TRE-CTC2-1 (Figure 6).

[0072] To determine the potential biological activity of tREX-1, bone marrow-derived macrophages (BMDMs) from mdx mice were exposed to tREX-1 in vitro. RNA-seq analysis revealed widespread (or transcriptome-wide) gene expression changes in cultured BMDMs exposed to tREX-1 compared with control cells exposed to vehicle (Veh) or scrambled (Scr) RNA. The scrambled RNA has the sequence of SEQ ID NO: 5, shown in Figure 6. Figure 1C shows a transcriptome heat map of bone marrow-derived macrophages from mdx mice exposed to tREX-1 (20 nM), scrambled RNA, or vehicle. Gene expression changes in cultured macrophages were specific to tREX-1; neither tREX-1 scramble (the same RNA content in a random order not complementary to the mouse genome) nor the next most abundant non-Glu-tRNA half induced significant changes in gene expression (Figure 7D; *P<0.05, **P<0.01, ****P<0.0001, ns: not significant; data represent mean ± standard error. Statistical significance was determined by one-way ANOVA (α=0.05)). Gene ontology analysis of the RNA-seq data (shown in Figure 1C) revealed enrichment of transcripts for genes specifically involved in various immune processes (Figure 1D). The analysis in Figure 1D is presented in a different format in Figure 7E. Gene ontology analysis also indicated that tREX-1 may regulate immune responses, reactive oxygen species (ROS) metabolism, and promote fibrosis-induced fibroblast apoptosis (Figures 1D and 7E). The Kyoto Encyclopedia of Genes and Genomes showed that tREX-1 stimulates insulin and hypoxia-inducible factor 1 signaling pathways and regulates endocytosis, spliceosome, phagosome, lysosome, protein degradation, and cell cycle (Figure 7F). These results demonstrate that tREX-1 has potential immunomodulatory effects by regulating macrophage function.

[0073] Figure 1B shows a schematic of the hypothesized mechanism of action of tREX-1, in which tREX-1 enters target cells, binds to gene expression response elements, and alters gene expression, resulting in changes in cellular behavior consistent with a regenerative response to tissue injury or disease.

[0074] Example 2 This non-limiting example demonstrates the disease-modulating biological activity of tREX-1 in a muscular dystrophy model.

[0075] The disease-modulating biological activity of tREX-1 was examined in relation to cardiac pathophysiology in mdx mice, a model of Duchenne muscular dystrophy. Figure 2A outlines the experimental protocol (see also Figure 8A). 14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 μg / g body weight) twice weekly via retro-orbital injection (i.e., intravenous) for 4 weeks. Figure 2B shows that mice treated with tREX-1 had a higher left ventricular ejection fraction (EF) compared with mice treated with the scrambled control. Figure 8B presents the EF data in a separate format, including the data from Figure 2B. Thus, mice treated with tREX-1 exhibited preserved cardiac function, whereas control mice had impaired cardiac function.

[0076] Cardiac tissue was harvested to quantify myocardial fibrosis in the animals. Figure 2C shows representative Masson's trichrome-stained micrographs of myocardial tissue sections. Quantification of myocardial fibrosis in tissue sections similar to those shown in Figure 2C is shown in Figure 2D. Figure 8D shows the staining data and quantification of myocardial fibrosis in myocardial tissue sections in a separate format, incorporating the data from Figures 2C and 2D. Animals treated with tREX-1 showed significantly reduced myocardial fibrosis compared with animals treated with scrambled RNA (Figure 2D, right panel of Figure 8D). * P < 0.05, ** P < 0.01, *** P < 0.001; ns: not significant. Data represent mean ± standard error. Statistical significance (α = 0.05) was determined using a two-way repeated-measures analysis of variance or an unpaired t-test. These results demonstrate the disease-modulating biological activity of tREX-1 on both cardiac function and fibrosis in muscular dystrophy.

[0077] Example 3 This non-limiting example demonstrates the disease-modulating biological activity of tREX-1 in a muscular dystrophy model.

[0078] The disease-modulating biological activity of tREX-1 was examined in relation to skeletal muscle pathophysiology in mdx mice. Figure 3A outlines the experimental protocol (see also Figure 8A). 14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 μg / g body weight) twice weekly via retroorbital injection (i.e., intravenous) for 4 weeks. Figure 3B shows that mice administered tREX-1 produced greater muscle torque than mice administered the scrambled control. Figure 8C presents the tetanic torque data, including the data from Figure 3B, in a separate format. Thus, muscle function improved in mice administered tREX-1, whereas no changes were observed in control mice (Figure 8C).

[0079] Skeletal muscle tissue was harvested to quantify myocardial fibrosis in the animals. Figure 3C shows a representative Masson's trichrome-stained photomicrograph of myocardial tissue sections. Quantification of fibrosis and myofiber number in skeletal muscle tissue sections was performed. Animals treated with tREX-1 showed a significant decrease in myocardial fibrosis (Figure 3D) and a significant increase in myofiber number (Figure 3E) compared to animals treated with scrambled RNA. Figure 8E shows the staining data and myocardial fibrosis quantification of skeletal muscle tissue sections in a separate format, incorporating the data from Figures 3C and 3D, and Figure 8F shows the myofiber number data in a separate format, incorporating the data from Figure 3E. * P<0.05, ** P<0.01, *** P<0.001, ns: not significant. Data represent mean ± standard error. Statistical significance (α=0.05) was determined using a repeated measures two-way analysis of variance or an unpaired t-test. These results demonstrate the disease-modulating biological activity of tREX-1 on both skeletal muscle function and fibrosis in muscular dystrophies.

[0080] The results presented in Examples 2 and 3 demonstrate that, in some non-limiting embodiments, tREX-1 administered after disease onset can improve cardiac and skeletal muscle function and reduce fibrosis.

[0081] Example 4 This non-limiting example shows the effect of tREX-1 administration on the levels of inflammatory cytokines in serum.

[0082] A serum proinflammatory cytokine array was performed on 14-month-old mdx mice treated with tREX-1 or scrambled RNA (0.15 μg / g body weight) via retroorbital injection (i.e., intravenous) twice weekly for 4 weeks. Figure 4 shows the changes in proinflammatory cytokines in the serum of mdx mice. At the end of the 4-week experiment, mice treated with tREX-1 showed significant changes in proinflammatory cytokines compared to scrambled controls, demonstrating immunomodulatory properties in vivo.

[0083] Example 5 This non-limiting example demonstrates the effect of oral administration of tREX-1 in an acute myocardial infarction (MI) model.

[0084] The biological activity of orally administered tREX-1 was examined in an acute myocardial ischemia / reperfusion injury model (MI). Mice underwent 45 minutes of left anterior descending coronary artery (LAD) ligation, followed by 20 minutes of reperfusion. After reperfusion, mice were orally gavaged with tREX-1 or scrambled RNA (0.15 μg / g body weight). Two days after ischemia / reperfusion, hearts were excised and subjected to TTC staining to quantify the infarct area relative to the left ventricle (average of the apex, midpapillary, and base) (Figure 5). Data represent mean ± standard error. * P<0.05. Statistical significance was determined using an unpaired t-test. Animals treated with tREX-1 showed a significant reduction in infarct area. These results demonstrate that, in some embodiments, oral tREX-1 has disease-modulating activity in acute MI.

[0085] Example 6 This non-limiting example demonstrates the uptake of tREX-1 by cultured macrophages.

[0086] A fluorescent version of tREX-1 was synthesized by replacing the adenosine residue with 2-aminopurine (2-AP), a fluorescent adenosine analog that maintains Watson-Crick base pairing. Cultured macrophages were incubated with the fluorescent (tREX-1 2-AP The cells were exposed to fluorescent tREX-1 (25 nM) and non-fluorescent tREX-1 (25 nM) for 90 minutes. The cells were then subjected to flow cytometry analysis. As shown in Figure 9, cultured macrophages demonstrated uptake of labeled tREX-1.

[0087] Example 7 This non-limiting example shows the identification of protein binding partners of tREX-1.

[0088] Biotinylated tREX-1 or scrambled RNA (20 pM) was added to cell extracts of cultured macrophages, and RNA pull-down was performed using streptavidin-coated beads. RNA-binding proteins (RBPs) eluted by pull-down were then identified by mass spectrometry (Figure 10). In total, five predicted RBPs (based on sequence complementarity) were confirmed by mass spectrometry. Each of the identified RBPs has well-established roles in regulating gene expression at the transcriptional, post-transcriptional, and translational levels. Mass spectrometry analysis failed to detect any RBPs in samples spiked with biotinylated scrambled RNA, further supporting the idea that the specificity of tREX-1 is inherent to its sequence. These data suggest that tREX-1 interacts with RBPs to regulate macrophage gene expression and, consequently, alter macrophage biological function.

[0089] Example 8 This non-limiting example demonstrates the effect of tREX-1 on cardiac macrophages.

[0090] Twelve to fourteen-month-old mdx mice were intravenously administered tREX-1 or scrambled RNA (0.15 μg / g body weight) twice weekly for four weeks. Hearts were subjected to immunohistochemistry to quantify CD68+ / CD80- and CD68+ / CD80+ cells (Figure 11, upper panel), as well as CD68+ / CD206- and CD68+ / CD206+ cells (Figure 11, lower panel). tREX-1 had no effect on CD68+ / CD80+ (classically activated) cardiac macrophages but dramatically reduced the number of CD68+ / CD206+ (alternatively activated) macrophages (Figure 11, upper right and lower right panels, respectively). These data indicate that tREX-1 alters the subtype composition of cardiac macrophages. ****P<0.0001. Data represent the mean ± standard error, and statistical significance (α = 0.05) was determined using an unpaired t test.

[0091] Example 9 This non-limiting example demonstrates the effect of tREX-1 on skeletal muscle macrophages.

[0092] Twelve to fourteen-month-old mdx mice were intravenously administered tREX-1 or scrambled RNA (0.15 μg / g body weight) twice weekly for four weeks. Hearts were subjected to immunohistochemistry to quantify CD68+ / CD80- and CD68+ / CD80+ cells (Figure 12, upper panel), as well as CD68+ / CD206- and CD68+ / CD206+ cells (Figure 12, lower panel). tREX-1 had no effect on CD68+ / CD80+ (classically activated) skeletal muscle macrophages but dramatically increased the number of CD68+ / CD206+ (alternatively activated) macrophages (Figure 12, upper right and lower right panels, respectively). These data indicate that tREX-1 alters the subtype composition of skeletal muscle macrophages. ****P<0.0001. Data represent the mean ± standard error, and statistical significance (α = 0.05) was determined using an unpaired t test.

[0093] Example 10 This non-limiting example demonstrates that the biological activity of tREX-1 is macrophage-dependent.

[0094] Twelve- to fourteen-month-old mdx mice were either depleted of macrophages (Mφ-) or maintained in the presence (Mφ+) of macrophages using clodronate liposomes and then administered tREX-1 or scrambled RNA (0.15 μg / g body weight) intravenously twice weekly for four weeks. Cardiac function was measured by echocardiography at baseline (after macrophage depletion but before tREX-1 administration) and at the end point of the four-week experiment. In the presence of macrophages, tREX-1 improved cardiac function (Figure 13). In contrast, tREX-1 had no effect in the absence of macrophages (Figure 13). These data demonstrate that macrophages are the target of tREX-1. ***P<0.001, ns: not significant. Data represent mean ± standard error. Statistical significance (α=0.05) was determined using two-way ANOVA.

Claims

1. 1. A method for treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treatment for a condition associated with inflammation and / or fibrosis a therapeutically effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nucleotides (nt) in length.

2. The method of claim 1, wherein the nucleic acid is a maximum of 40 nt in length.

3. The method of claim 1, wherein the nucleic acid is about 32 nt in length.

4. 2. The method of claim 1, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).

5. The method of claim 3, wherein the condition associated with inflammation and / or fibrosis includes inflammation and / or fibrosis of the heart or skeletal muscle.

6. The method of claim 3, wherein the condition associated with inflammation and / or fibrosis includes symptoms and / or sequelae of heart failure, myocardial infarction or muscular dystrophy.

7. The method of claim 6, wherein the subject is suffering from heart failure or myocardial infarction.

8. 7. The method of claim 6, wherein the subject is suffering from or predisposed to suffering from muscular dystrophy.

9. 9. The method of claim 8, wherein the subject is suffering from or predisposed to suffering from Duchenne muscular dystrophy.

10. 10. The method of claim 9, further comprising administering a secondary treatment for the muscle disease.

11. The method of claim 10, wherein the secondary treatment comprises an exon skipping agent and / or gene therapy.

12. 4. The method of claim 3, comprising orally administering to a subject a therapeutically effective amount of the nucleic acid or composition.

13. 7. The method of claim 6, comprising parenterally administering to a subject a therapeutically effective amount of the nucleic acid or composition.

14. 14. The method of claim 13, comprising administering to a subject a therapeutically effective amount of the nucleic acid or composition intravenously, intramuscularly, or intracardially.

15. 1. A method for treating a muscle disease or a symptom thereof, comprising administering to a subject in need of treatment for a muscle disease or a symptom thereof a therapeutically effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nt in length.

16. 16. The method of claim 15, wherein the nucleic acid is a maximum of 40 nt in length.

17. 16. The method of claim 15, wherein the nucleic acid is about 32 nt in length.

18. 18. The method of claim 17, wherein the muscle disorder comprises a skeletal muscle disorder and / or a cardiac condition.

19. 19. The method of claim 18, wherein the cardiac condition comprises symptoms and / or sequelae of heart failure or myocardial infarction.

20. 19. The method of claim 18, wherein the muscle disease comprises muscular dystrophy.

21. 21. The method of claim 20, wherein the muscle disease comprises Duchenne muscular dystrophy.

22. 22. The method of claim 21, further comprising administering a secondary treatment for the muscle disease.

23. 23. The method of claim 22, wherein the secondary treatment comprises an exon skipping agent and / or gene therapy.

24. 24. The method of any one of claims 1 to 23, wherein the therapeutically effective amount comprises from about 0.001 μg / g to about 100 μg / g of nucleic acid.

25. 25. The method of any one of claims 1 to 24, comprising administering a therapeutically effective amount of the nucleic acid or composition no more frequently than twice a week.

26. 1. A method of immunomodulating comprising contacting a population of macrophages with an effective amount of an isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA and the nucleic acid is up to 60 nt in length.

27. 27. The method of claim 26, wherein the nucleic acid is a maximum of 40 nt in length.

28. 27. The method of claim 26, wherein the nucleic acid is about 32 nt in length.

29. 30. The method of claim 28, wherein the contacting step comprises administering an effective amount of the isolated nucleic acid to a subject in need of treatment for a condition associated with inflammation and / or fibrosis.

30. 29. The method of claim 28, wherein the macrophages are human macrophages.

31. 31. The method of claim 30, wherein the contacting step with an effective amount of the isolated nucleic acid increases expression of IL-10, IL-1α and / or ARG-1 in the macrophage population.

32. 29. The method of claim 28, wherein the contacting step is carried out in vitro.

33. An isolated nucleic acid comprising the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), which is RNA and is up to 60 nt in length.

34. 1. An isolated nucleic acid comprising a nucleotide sequence that is at least 95% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the isolated nucleic acid is RNA and is a maximum of 60 nt in length.

35. An isolated nucleic acid comprising the nucleotide sequence of a human tRNA 5' fragment, wherein the human tRNA is selected from TRE-CTC1-7, TRE-CTC1-1 and TRE-CTC2-1, the nucleic acid is RNA, and the nucleic acid is up to 60 nt in length.

36. 34. The isolated nucleic acid of claim 33, wherein the nucleotide sequence is at the 5' end of the nucleic acid.

37. 34. The isolated nucleic acid of claim 33, wherein the nucleic acid is about 32 nt in length.

38. 34. The isolated nucleic acid of claim 33, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).

39. A therapeutically effective amount of the isolated nucleic acid of claim 37 and a pharmaceutically acceptable excipient, A therapeutic composition comprising:

40. 40. The composition of claim 39, wherein the composition consists essentially of a therapeutically effective amount of the isolated nucleic acid and a pharmaceutically acceptable excipient.

41. 40. The composition of claim 39, wherein the composition is a cell-free composition.

42. The composition of claim 39, wherein the composition does not contain extracellular vesicles.

43. 40. The composition of claim 39, further comprising a transfection reagent.

44. 44. The composition of claim 43, wherein the transfection reagent comprises one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC).

45. 44. The composition of claim 43, wherein the transfection reagent comprises EVs derived from cardiosphere-derived cells (CDCs).

46. 44. The composition of claim 43, further comprising casein phosphoprotein.

47. 47. The composition of claim 46, comprising casein micelles.

48. 48. The composition of claim 47, comprising chitosan.

49. 49. The composition of claim 48, wherein the isolated nucleic acid is encapsulated in a casein-chitosan complex.

50. 50. The composition of claim 49, comprising casein-chitosan micelles.

51. 40. The composition of claim 39, further comprising an antisense oligonucleotide.

52. 52. The composition of claim 51, wherein the antisense oligonucleotide is an exon-skipping agent that targets a dystrophin transcript.

53. The nucleic acid according to any one of claims 33 to 38, and transfection reagents, Kit including:

54. 54. The kit of claim 53, wherein the transfection reagent comprises one or more of a lipid, a PEGylated lipid, and an extracellular vesicle (EV).

55. 55. The kit of claim 53 or 54, further comprising a pharmaceutically acceptable excipient.

56. 56. The kit of any one of claims 53 to 55, further comprising casein phosphoprotein.

57. 57. The kit of any one of claims 53 to 56, further comprising chitosan.

58. 58. The kit of any one of claims 53 to 57, further comprising an antisense oligonucleotide.

59. 59. The kit of claim 58, wherein the antisense oligonucleotide comprises an exon skipping agent that targets a dystrophin transcript.

60. 53. Use of a nucleic acid according to any one of claims 33 to 38 or a composition according to any one of claims 39 to 52 for the treatment of a muscle disease or a symptom thereof in a subject in need thereof.

61. 53. Use of a nucleic acid according to any one of claims 33 to 38 or a composition according to any one of claims 39 to 52 for the preparation of a medicament for the treatment of a muscle disease or a symptom thereof in a subject in need thereof.

62. 62. Use of a nucleic acid or composition according to claim 60 or 61, wherein the muscle disease comprises a skeletal muscle disease and / or a cardiac condition.

63. 63. Use of a nucleic acid or composition according to claim 62, wherein the cardiac condition comprises symptoms and / or sequelae of heart failure or myocardial infarction.

64. 63. Use of a nucleic acid or composition according to any one of claims 60 to 62, wherein the muscle disease comprises muscular dystrophy.

65. 53. Use of a nucleic acid according to any one of claims 33 to 38 or a composition according to any one of claims 39 to 52 for the treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof.

66. 53. Use of a nucleic acid according to any one of claims 33 to 38 or a composition according to any one of claims 39 to 52 for the preparation of a medicament for the treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof.

67. 67. Use of a nucleic acid or composition according to claim 65 or 66, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart and / or skeletal muscle.

68. 68. Use of a nucleic acid or composition according to any one of claims 65 to 67, wherein the condition associated with inflammation and / or fibrosis comprises symptoms and / or sequelae of heart failure, myocardial infarction or muscular dystrophy.

Images