Methods and compositions for the transfer, storage and delivery of nucleic acids and other molecules

Compositions with sugars, zwitterionic compounds, and base polymers, or plasticizers and surfactants, stabilize nucleic acids for storage and delivery at non-frozen temperatures, addressing degradation issues and enabling effective global distribution.

JP2025534345APending Publication Date: 2025-10-15BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025518536
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-12
Filing Date
2023-09-25
Publication Date
2025-10-15

AI Technical Summary

Technical Problem

Current nucleic acid products, such as recombinant DNA and RNA, are prone to degradation and require ultra-low temperature storage and transport, posing logistical and economic challenges for global distribution and access to life-saving drugs.

Method used

Compositions comprising nucleic acids in a carrier with sugars, zwitterionic compounds, and base polymers, or plasticizers and surfactants, allow for stable storage and delivery at temperatures above freezing, including refrigeration and ambient temperature, maintaining biological function and efficacy.

Benefits of technology

The compositions enable extended storage and delivery of nucleic acids at non-frozen temperatures, preserving their biological function and efficacy for therapeutic use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025534345000001_ABST
    Figure 2025534345000001_ABST
Patent Text Reader

Abstract

Aspects of the present disclosure relate to liquid and substantially solid film compositions for storing, transporting, and administering pharmaceuticals, including nucleic acids, without the use of ultra-low temperatures. Compositions are provided that allow for long-term storage of nucleic acids at ambient temperatures. Injectable or oral compositions containing nucleic acids, as well as methods for formulating and administering such compositions, are also disclosed. Aspects of the present disclosure relate to at least the fields of biotechnology and pharmaceutical chemistry. More specifically, the embodiments relate to compositions and methods for storing, preserving, and delivering biological materials, including pharmaceuticals such as nucleic acids.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 466,053, filed May 12, 2023, and U.S. Provisional Patent Application No. 63 / 411,460, filed September 29, 2022, each of which is incorporated by reference herein in its entirety. [Background technology]

[0002] background I.Technical field Aspects of the present disclosure relate to at least the fields of biotechnology and pharmaceutical chemistry. More specifically, aspects relate to compositions and methods for the storage, preservation, and delivery of biological materials, including pharmaceutical agents such as nucleic acids.

[0003] II. Background Recombinant DNA (e.g., gene-containing plasmid DNA (pDNA)) and RNA (e.g., mRNA) are important research tools and potential delivery vectors in gene therapy and vaccination. However, many current nucleic acid products are formulated as liquid products that are stored and transported at ultra-low temperatures because such nucleic acids are prone to alterations and degradation that impair their biological function. Thus, current approaches present significant logistical and economic challenges regarding the global distribution and access of life-saving drugs.

[0004] As part of a project to improve the global distribution of vaccines and other biological drugs, a process for stabilizing live viral vectors within a film matrix was previously developed. The resulting films can be transported and stored at ambient temperature for significant periods without loss of efficacy, and solutions prepared from rehydrated films can be administered by injection and needleless routes. However, initial experiments revealed that film matrices optimized for recombinant viruses were physically incompatible with lipid nanoparticles containing naked plasmid DNA or nucleic acids (e.g., mRNA).

[0005] Thus, there is a recognized need for compositions and methods for the storage, maintenance, and delivery (e.g., via intravenous delivery) of stabilized agents such as nucleic acids (e.g., plasmid DNA, mRNA) without the need for ultra-low temperatures. Summary of the Invention [Means for solving the problem]

[0006] overview Embodiments of the present disclosure address a specific need in the art by providing liquid and film compositions that allow for extended storage of agents (e.g., therapeutic agents), such as nucleic acids, at temperatures above freezing, including refrigeration (e.g., 4°C) and ambient temperature (e.g., 25°C), while retaining biological function and efficacy. Accordingly, certain embodiments relate to compositions comprising an agent (e.g., therapeutic agent) (e.g., nucleic acid) and a carrier, where the carrier enables long-term storage of the agent (e.g., therapeutic agent). As disclosed herein, in some cases, compositions comprising a carrier comprising a sugar, a zwitterionic compound, and a base polymer may be particularly useful for generating stable DNA formulations. In some cases, compositions comprising a plasticizer and / or surfactant and a base polymer may be useful for generating stable RNA formulations. Accordingly, some embodiments of the present disclosure include compositions comprising an agent in a substantially solid carrier comprising at least a sugar, a zwitterionic compound, and a base polymer, and some embodiments of the present disclosure include compositions comprising an agent in a substantially solid carrier comprising at least a plasticizer and / or surfactant and a base polymer. Also disclosed are methods for producing such compositions, methods for storing such compositions, and methods for administering such compositions, e.g., to a patient for therapeutic purposes, including gene therapy.

[0007] In some embodiments, compositions are disclosed herein that include a drug (e.g., a therapeutic agent) in a carrier that includes a sugar, a zwitterionic compound, and a base polymer. In some embodiments, the sugar is glucose, dextrose, fructose, lactose, maltose, xylose, sucrose, corn sugar syrup, sorbitol, hexitol, maltitol, xylitol, mannitol, melezitose, raffinose, cyclodextrin, or a combination thereof. Various cyclodextrins are disclosed herein, including alpha-cyclodextrin, beta-cyclodextrin, gamma-cyclodextrin, hydroxypropyl-beta-cyclodextrin, and methoxy-beta-cyclodextrin. Any one of the sugars disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments.In some embodiments, the sugar is present in an amount between 0.1% and 5.0% of the carrier, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.10%, 3.11%, 3.12%, 3.13%, 3.14%, 3.15%, 3.16%, 3.17%, 3.18%, 3.19%, 3.20%, 3.21%, 3.22%, 3.23%, 3.24%, 3.25%, 3.26%, 3.27%, 3.28%, 3.29%, 3.30%, 3.31%, 3.32%, 3.33%, 3.34%, 3.35%, 3.36%, 3.37%, 3.38%, 3.39%, 3.40%, 3.41%, 3.42%, 3.43%, 3.44%, 3.45%, 3.46%, 3.47%, 3.48%, 3.49%, 3.50%, 3.51%, 3.52%, 3.53%, 3.54%, 3.55%, 3.56%, 3.57%, 3.58%, 3.59%, 3.60%, 3.61%, 3.62%, 3.63%, 3.64 A minimum, maximum, or equal to or between any two of 0.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0%. Alternatively, the carrier may contain a minimum of, a maximum of, or equal to 0.1% to 5.0% sugar, or any two of these values, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9% , 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0% sugar. In some embodiments, the carrier contains a minimum, maximum, or a range of sugars between 0.1% and 3.0%. In certain embodiments, the sugar is trehalose and the carrier contains about 1.0% trehalose. In certain embodiments, the sugar is sucrose and the carrier contains about 0.5% sucrose. In certain embodiments, the sugar is sorbitol and the carrier comprises about 0.5% or about 1.0% sorbitol. In certain embodiments, the sugar is a combination of trehalose and sucrose and the carrier comprises about 1.0% trehalose and about 0.5% sucrose. In certain embodiments, the sugar is a combination of trehalose and sorbitol and the carrier comprises about 1.0% trehalose and about 0.5% sorbitol.

[0008] In some embodiments, the zwitterionic compound is arginine and / or ethylenediaminetetraacetic acid (EDTA). In some embodiments, the zwitterionic compound is present in an amount between 0.1% and 5.0% of the carrier, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, or 3.0% of the carrier. , 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9, or 5.0% as a minimum, maximum, equal to, or between any two of these values. Alternatively, the carrier may contain a minimum of, a maximum of, or equal to 0.1% to 5.0%, or any two of the zwitterionic compounds, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 2.10%, 2.11%, 2.12%, 2.13%, 2.14%, 2.15%, 2.16%, 2.17%, 2.18%, 2.19%, 2.20%, 2.21%, 2.22%, 2.23%, 2.24%, 2.25%, 2.26%, 2.27%, 2.28%, 2.29%, 2.30%, 2.31%, 2.32%, 2.33%, 2.34%, 2.35%, 2.36%, 2.37%, 2.38%, 2.39%, 2.40%, 2.41%, 2.42%, 2.43%, 2.44%, 2.45%, 2.46%, 2.47%, 2.48%, 2.49%, 2.50%, 2.51%, 2.52%, 2.53%, 2.54%, 2.55%, 2.56%, 2.57%, 2.58%, 2.59%, 2.60%, 2.61%, 2.62%, 2.6 The carrier may contain 0.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0% zwitterionic compound. In some embodiments, the carrier contains a minimum, maximum, or a range of zwitterionic compound between 0.1% and 2.0%. In certain embodiments, the zwitterionic compound is arginine and the carrier contains about 0.1% arginine or about 1.0% arginine. In certain embodiments, the zwitterionic compound is EDTA and the carrier comprises about 1 mM EDTA or 2 mM EDTA.In certain embodiments, the zwitterionic compound is a combination of arginine and EDTA, and the carrier comprises about 0.1% arginine or about 1.0% arginine and about 1 mM EDTA or 2 mM EDTA.

[0009] In some embodiments, the base polymer is hydroxypropylmethylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof. Any one of the base polymers disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In some embodiments, the base polymer comprises between 0.1% and 5.0% of the carrier, for example, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, or 3.0% of the carrier. A minimum, maximum, equal to, or a range between any two of 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0% , or the carrier may be a base polymer with a minimum, maximum, or equal to 0.1% to 5.0%, or any two of these values ​​between them, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 2.10%, 2.11%, 2.12%, 2.13%, 2.14%, 2.15%, 2.16%, 2.17%, 2.18%, 2.19%, 2.20%, 2.21%, 2.22%, 2.23%, 2.24%, 2.25%, 2.26%, 2.27%, 2.28%, 2.29%, 2.30%, 2.31%, 2.32%, 2.33%, 2.34%, 2.35%, 2.36%, 2.37%, 2.38%, 2.39%, 2.40%, 2.41%, 2.42%, 2.43%, 2.44%, 2.45%, 2.46%, 2.47%, 2.48%, 2.49%, 2.50%, 2.51%, 2.52%, 2.53%, 2.54%, 2.55%, 2.56%, 2.57%, 2.58%, 2.59%, 2.60%, 2.61%, 2.62%, 2.6 In some embodiments, the carrier comprises a minimum, maximum, or amount of base polymer equal to or between 0.5% and 3.0%.In certain embodiments, the base polymer is HPMC, and the carrier contains about 0.75% to 2.0% HPMC, e.g., HPMC at a minimum, maximum, equal to, or between any two of 0.75%, 0.875%, 1%, 1.125%, 1.25%, 1.375%, 1.5%, 1.625%, 1.75%, 1.875%, or 2%. Various HPMC grades are disclosed herein, including A4C, A4M, A15C, A15LV, E4M, E6LV, F4M, K4M, and K100LV. In certain embodiments, the HPMC is K100LV. In certain embodiments, the HPMC is K4M. Any one of the HPMC grades disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In certain embodiments, the HPMC has a molecular weight that results in a viscosity of less than 4000, 3500, 3000, 2500, 2000, 1800, 1500, 1200, 1000, 800, 600, 500, 400, 300, 200, 100, 50, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 centipoise (cp) at a concentration of 2% in water (including any range or value derivable therein). As disclosed herein, HPMC viscosity is described in terms of the viscosity at a concentration of 2% HPMC in water unless otherwise specified. In certain embodiments, the base polymer is PVA, and the carrier comprises about 2.0% PVA. In certain embodiments, the base polymer is gelatin, and the carrier comprises about 2.0% gelatin. The gelatin may have a pH between 5.0 and 9.0, for example, a minimum, maximum, equal to, or between any two of 5.0, 6.0, 7.0, 8.0, or 9.0.

[0010]

[0001] Embodiments of the present disclosure relate to compositions comprising between 0.001 mg / mL and 1 mg / mL of a drug (e.g., a therapeutic agent) (e.g., DNA) formulated within the range of about 0.1% to about 3.0% sugar; about 0.1% to about 2.0% zwitterionic compound; and about 0.5% to 3.0% base polymer.

[0002] Embodiments of the present disclosure relate to compositions comprising a drug (e.g., a therapeutic agent) (e.g., DNA) in a substantially solid carrier comprising a sugar, a zwitterionic compound, and a base polymer, wherein the sugar is melezatose, trehalose, raffinose, sucrose, dextrose, mannitol, sorbitol, cyclodextrin, or a combination thereof; the zwitterionic compound is arginine and / or ethylenediaminetetraacetic acid (EDTA); and the base polymer is hydroxypropylmethylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof. Aspects of the present disclosure relate to pharmaceutical compositions produced by combining a composition described herein with a pharmaceutically acceptable carrier (e.g., to dilute the composition and / or to further prepare it for administration to a subject).

[0011] In some embodiments, disclosed herein are compositions comprising an agent (e.g., a therapeutic agent) in a carrier comprising a plasticizer and / or surfactant and a base polymer. In some embodiments, the plasticizer is present in an amount between 0.1% and 5.0% of the carrier, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6.9%, 7.0%, 7.1%, 7.2%, 7.3%, 7.4%, 7.5%, 7.6%, 7.7%, 7.8%, 7.9%, 8.0%, 8.1%. A minimum of, a maximum of, or a value equal to, or between any two of the following: 0.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0%. or the carrier contains between 0.1 and 5.0% plasticizer, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.10%, 4.11%, 4.12%, 4.13%, 4.14%, 4.15%, 4.16%, 4.17%, 4.18%, 4.19%, 4.20%, 4.21%, 4.22%, 4.23%, 4.24%, 4.25%, 4.26%, 4.27%, 4.28%, 4.29%, 4.30%, 4.31%, 4.32%, 4.33%, 4.34%, 4.35%, 4.36%, 4.37%, 4.38%, 4.39%, 4.40%, 4.41%, 4.42%, 4.43%, 4.44%, 4.45%, 4.46%, 4.47%, 4.48%, 4.49%, 4.50%, 4.51%, 4.52%, 4.53%, 4.54%, 4.55%, 4.56%, 4.57%, The plasticizer content may be at least, at most, equal to, or between any two of the following: 0.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0%. A variety of plasticizers are contemplated for use in the compositions disclosed herein and generally include low molecular weight compounds that can be added to polymers to improve the processability, flexibility, and / or stretchability of the composition by modifying its mechanical properties (e.g., improving the flexibility or ductility of the composition and / or reducing the melt viscosity without changing the basic chemistry of the composition). Any one of the plasticizers disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In some embodiments, the plasticizer is glycerol and the carrier comprises about 3.0% plasticizer.

[0012] In some embodiments, the surfactant is a zwitterionic and / or non-ionic surfactant. In some embodiments, the zwitterionic surfactant is PMAL-C16. In some embodiments, the zwitterionic surfactant is not PMAL-C16. In some embodiments, the non-ionic surfactant is a poloxamer.In some embodiments, the surfactant is present in an amount between 0.0001% and 3.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06% , 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, or 3.0% are the minimum, maximum, equal to, or between any two of these. or the carrier has a surfactant concentration of at least, at most, or equal to 0.0001% to 3.0%, or any two values ​​between these, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, Contains 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, or 3.0% surfactant.Various poloxamers are disclosed herein, including polyoxypropylene-polyoxyethylene copolymers that have the ability to self-assemble into micelles in aqueous solution at concentrations above the critical micelle concentration (CMC), such as linear (e.g., LUTROL® or Pluronic® copolymers, e.g., LUTROL® F-127 and Pluronic® F68, F108, F127, L61, L122, P85, P94, P105, or P123) or X-shaped (e.g., TETRONIC® copolymers, e.g., TETRONIC® 304, 904, 908, 1304, 1307) amphiphilic triblock copolymers. Any one of the poloxamers disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In certain embodiments, the poloxamer is poloxamer 188 (i.e., Pluronic® F-68) or poloxamer 407 (i.e., Pluronic® F-127). In certain embodiments, the surfactant is poloxamer 407 and the carrier comprises about 0.01% poloxamer 407. In certain embodiments, the surfactants are poloxamer 188 and poloxamer 407 and the carrier comprises about 0.012% poloxamer (e.g., 0.006% poloxamer 188 and 0.006% poloxamer 407).

[0013] In some embodiments, the base polymer is hydroxypropylmethylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof. Any one of the base polymers disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In some embodiments, the base polymer comprises between 0.1% and 5.0% of the carrier, for example, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, or 3.0% of the carrier. A minimum, maximum, equal to, or a range between any two of 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, or 5.0% , or the carrier may be a base polymer with a minimum, maximum, or equal to 0.1% to 5.0%, or any two of these values ​​between them, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 2.10%, 2.11%, 2.12%, 2.13%, 2.14%, 2.15%, 2.16%, 2.17%, 2.18%, 2.19%, 2.20%, 2.21%, 2.22%, 2.23%, 2.24%, 2.25%, 2.26%, 2.27%, 2.28%, 2.29%, 2.30%, 2.31%, 2.32%, 2.33%, 2.34%, 2.35%, 2.36%, 2.37%, 2.38%, 2.39%, 2.40%, 2.41%, 2.42%, 2.43%, 2.44%, 2.45%, 2.46%, 2.47%, 2.48%, 2.49%, 2.50%, 2.51%, 2.52%, 2.53%, 2.54%, 2.55%, 2.56%, 2.57%, 2.58%, 2.59%, 2.60%, 2.61%, 2.62%, 2.6 In some embodiments, the carrier comprises a minimum, maximum, or amount of base polymer equal to or between 0.5% and 3.0%.In certain embodiments, the base polymer is HPMC, and the carrier contains about 0.75% to 2.0% HPMC, e.g., HPMC at a minimum, maximum, equal to, or between any two of 0.75%, 0.875%, 1%, 1.125%, 1.25%, 1.375%, 1.5%, 1.625%, 1.75%, 1.875%, or 2%. Various HPMC grades are disclosed herein, including A4C, A4M, A15C, A15LV, E4M, E6LV, F4M, K4M, and K100LV. In certain embodiments, the HPMC is K100LV. In certain embodiments, the HPMC is K4M. Any one of the HPMC grades disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In certain embodiments, the HPMC has a molecular weight that results in a viscosity of less than 4000, 3500, 3000, 2500, 2000, 1800, 1500, 1200, 1000, 800, 600, 500, 400, 300, 200, 100, 50, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 centipoise (cp) at a concentration of 2% in water (including any range or value derivable therein). As disclosed herein, HPMC viscosity is described in terms of the viscosity at a concentration of 2% HPMC in water unless otherwise specified. In certain embodiments, the base polymer is PVA, and the carrier comprises about 2.0% PVA. In certain embodiments, the base polymer is gelatin, and the carrier comprises about 2.0% gelatin. The gelatin may have a pH between 5.0 and 9.0, for example, a minimum, maximum, equal to, or between any two of 5.0, 6.0, 7.0, 8.0, or 9.0.

[0014] In some embodiments, the carrier further comprises a PEGylated lipid, which may be present in an amount between 0.0001% and 3.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08 ... %, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, or 3.0%, or the carrier is between 0.0001% and 3.0%. PEGylated lipids with a minimum, maximum, or equal to any two of these values, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.07%, 0.08%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.08%, 0.09%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.09%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.0 ... In certain embodiments, the PEGylated lipid comprises a minimum of, a maximum of, equal to, or any two of the following: 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, or 3.0%. In certain embodiments, the PEGylated lipid comprises DMPE-PEG and / or DMG-PEG.Any one or more of the pegylated lipids disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments.

[0015] Embodiments of the present disclosure relate to compositions comprising between 0.001 mg / mL and 1 mg / mL of a drug (e.g., a therapeutic agent) (e.g., RNA) formulated within the range of about 1.0% to about 5.0% plasticizer; about 0.0001% to about 3.0% surfactant; and / or about 0.5% to 3.0% base polymer. Embodiments of the present disclosure relate to compositions comprising a drug (e.g., a therapeutic agent) (e.g., RNA) in a substantially solid carrier comprising a plasticizer and / or surfactant and a base polymer, wherein the plasticizer is glycerol; the surfactant is a poloxamer; and the base polymer is hydroxypropylmethylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof. Embodiments of the present disclosure relate to pharmaceutical compositions produced by combining a composition described herein with a pharmaceutically acceptable carrier (e.g., for diluting the composition and / or for further preparation for administration to a subject).

[0016] In some embodiments, the compositions disclosed herein further comprise one or more excipients. In some embodiments, the one or more excipients can include choline, phosphocholine, calcium D-heptagluconate dihydrate, additional surfactants, additional plasticizers, additional sugars, and / or additional polymers. In some embodiments, the choline and / or phosphocholine is present in an amount between 0.0001% and 10% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02 ... %, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%. The body may be supplemented with between 0.0001% and 10% choline and / or phosphocholine, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.0 Contains choline and / or phosphocholine at a minimum of, a maximum of, equal to, or between any two of 4%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%.

[0017] In some embodiments, calcium D-heptagluconate dihydrate is present in an amount between 0.0001% and 10% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0. ... The minimum or maximum value of, or equal to, or between any two of, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%, or the carrier is a minimum of 0.0001% to 10% , a maximum of, equal to, or between any two of these, D-calcium heptagluconate dihydrate, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, Contains D-calcium heptagluconate dihydrate at a minimum of, a maximum of, equal to, or a value between any two of 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%.

[0018] In some embodiments, the additional surfactant is present in an amount between 0.0001% and 10.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, A minimum of, a maximum of, equal to, or between any two of 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%, or the carrier has a minimum of 0.0001% to 10.0%. or a maximum of, or equal to, or between any two of these, for example, 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0. The composition may comprise 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, or 3.0% surfactant. The additional surfactant may be any one or more of the various surfactants disclosed herein, each of which is contemplated for use in the compositions disclosed herein. Any one of the surfactants disclosed herein may, in certain embodiments, be excluded as an additional surfactant from the compositions of the present disclosure.

[0019] In some embodiments, the additional plasticizer is present in an amount between 0.0001% and 10.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.0 A minimum or maximum of, or equal to, or a value between any two of 2%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%. or the carrier has a minimum, maximum, or equal to 0.0001% to 10.0% plasticizer content, or any two values ​​between these, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.0 0.06%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0% plasticizer. The additional plasticizer may be any one or more of the various plasticizers disclosed herein, each of which is contemplated for use in the compositions disclosed herein. Any one of the plasticizers disclosed herein may, in certain embodiments, be excluded as an additional plasticizer from the compositions of the present disclosure.

[0020] In some embodiments, the additional sugar is present in an amount between 0.0001% and 10.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.02%. %, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0% as a minimum, maximum, or equal to any two of these. or the carrier is a sugar with a minimum, maximum, or equal to 0.0001% to 10.0%, or between any two of these, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0. The sugar content may be 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0%. The additional sugar may be any one or more of the various sugars disclosed herein, each of which is contemplated for use in the compositions disclosed herein. Any one of the sugars disclosed herein may, in certain embodiments, be excluded as an additional sugar from the compositions of the present disclosure.

[0021] In some embodiments, the additional polymer is present in an amount between 0.0001% and 10.0% of the carrier, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.0 A minimum or maximum of, or equal to, or between any two of 2%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0% Alternatively, the carrier may contain a polymer with a minimum, maximum, or equal to 0.0001% to 10.0%, or any two values ​​between these, e.g., 0.0001%, 0.0002%, 0.0003%, 0.0004%, 0.0005%, 0.0006%, 0.0007%, 0.0008%, 0.0009%, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.0 The composition may comprise 0.06%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, or 10.0% of a polymer. The additional polymer may be any one or more of the various polymers disclosed herein, each of which is contemplated for use in the compositions disclosed herein. In certain embodiments, the additional polymer is polyethylene glycol (PEG).PEGs of various molecular weights are disclosed herein, including PEGs having molecular weights of 200 to 20,000 g / mol, such as PEG200, PEG300, PEG400, PEG600, PEG1000, PEG1500, PEG4000, PEG8000, PEG10,000, PEG12,000, and PEG20,000. Any one of the PEGs disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments. In certain embodiments, the PEG is PEG1500, and the carrier comprises about 0.5% PEG. In some embodiments, the additional polymer is pullulan, and the carrier comprises about 0.5% pullulan. Any one of the polymers disclosed herein may be excluded as an additional polymer from the compositions of the present disclosure in certain embodiments.

[0022] In some embodiments, the agent (e.g., therapeutic agent) of the composition is a polypeptide, small molecule, or nucleic acid. In some embodiments, the composition contains between 0.001 mg / mL and 100 mg / mL of agent (e.g., therapeutic agent), for example, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, The composition may comprise a drug (e.g., therapeutic agent) at a concentration of at least, at most, equal to, or between any two of 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL. In some embodiments, the drug (e.g., therapeutic agent) is a nucleic acid, and the composition comprises between 0.001 mg / mL and 1 mg / mL of the nucleic acid. Various nucleic acids are disclosed herein and can include DNA (e.g., recombinant DNA, plasmid DNA, or genomic DNA) and RNA (e.g., mRNA). In certain embodiments, the nucleic acid is plasmid DNA, and the composition comprises between 0.05 mg / mL and 1 mg / mL, e.g., about 0.1 mg / mL, of plasmid DNA. In certain embodiments, the nucleic acid is genomic DNA and the composition comprises between 0.05 mg / mL and 2 g / mL of genomic DNA. In certain embodiments, the nucleic acid is mRNA and the composition comprises between 0.001 mg / mL and 1 mg / mL, e.g., about 0.025 mg / mL or about 0.1 mg / mL of mRNA. In some embodiments, the nucleic acid is naked, e.g., not associated with proteins, lipids, or any other protective molecules. In some embodiments, the nucleic acid is associated with one or more lipids, proteins, carbohydrates, and / or other organic compounds (e.g., squalene).In some embodiments, the nucleic acid is associated with one or more transfection reagents (e.g., Lipofectamine® (a mixture of DOSPA (2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propaniminium trifluoroacetate) and DOPE (1,2-dioleoyl-sn-glycerophosphoethanolamine)), calcium phosphate, polyethyleneimine). In certain embodiments, the nucleic acid is encapsulated in a lipid nanoparticle (LNP) (e.g., LNP-encapsulated mRNA). Any one of the nucleic acids disclosed herein may be excluded from the compositions of the present disclosure in certain embodiments.

[0023] In certain embodiments, the pH of one or more of the composition's components is adjusted so that the composition has a final pH of about pH 6.0-9.0. In some embodiments, the composition has a pH that is at least about, at most about, equal to, or between any two of about 6.0-9.0, e.g., 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0. In certain embodiments, the composition has a pH of about 8.5. In certain embodiments, the composition has a pH of about 8.0. In some embodiments of the compositions and methods disclosed herein, the composition is in a liquid form. In some embodiments of the compositions and methods disclosed herein, the composition is in a substantially solid film form. In some embodiments of the compositions and methods disclosed herein, the composition is a liquid or substantially solid amorphous carrier.

[0024] Embodiments of the present disclosure relate to methods for storing / preserving a pharmaceutical agent (e.g., a therapeutic agent), comprising formulating the pharmaceutical agent in a composition described herein. Additionally, methods for storing a pharmaceutical agent (e.g., a therapeutic agent) are disclosed, comprising formulating the pharmaceutical agent in a composition of the present disclosure and storing the composition, e.g., at a temperature above 0°C, above 4°C, above 15°C, above 25°C, above 30°C, or above 35°C, for a minimum of, a maximum of, equal to, or any two of 1 day, 7 days, 14 days, 30 days, 60 days, 90 days, 120 days, 150 days, 180 days, 210 days, 240 days, 270 days, 300 days, 330 days, or 360 days. In some embodiments of the compositions and methods disclosed herein, the film is stored for at least 1 year, at most 1 year, equal to, or about 1 year. In some embodiments of the compositions and methods disclosed herein, the film is stored for a minimum of, a maximum of, or equal to, or any two of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, or 36 months.

[0025] In some embodiments, after storage, an agent (e.g., a therapeutic agent) is preserved for at least, at most, equal to, or between any two of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of its biological function and efficacy, as measured by the biological function and efficacy. In light of ease of storage and transport, it is believed that compositions described herein that provide for preservation of 50% or less (e.g., about 45%, about 40%, about 35%, about 30%, about 25%, etc.) of biological function and efficacy will offer considerable value. In some embodiments, the agent (e.g., therapeutic agent) is a nucleic acid, and after storage, the nucleic acid is preserved for a minimum of, a maximum of, equal to, or between any two of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 50% preserved after storage, as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 55% preserved after storage, as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 60% preserved after storage, as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 65% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 70% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 75% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 80% preserved after storage as measured by transduction efficiency and / or transfection efficiency.In some embodiments, the nucleic acid is at least 85% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 90% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 95% preserved after storage as measured by transduction efficiency and / or transfection efficiency. In some embodiments, the nucleic acid is at least 99% preserved after storage as measured by transduction efficiency and / or transfection efficiency.

[0026] Also disclosed are methods for delivering an agent (e.g., a therapeutic agent) to a subject, the methods comprising administering to a subject an effective amount of a composition of the present disclosure, in some cases where the composition has been stored at a temperature above 0° C. (e.g., about 4° C., about 25° C., between 15-30° C., or between 0-8° C.) (e.g., for at least 1, 7, 14, 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, 360, or more days) prior to administration to the subject. In some embodiments, the composition is administered intravenously, intradermally, intra-arterially, intra-implant, intraperitoneally, intralesionally, intracranially, intraspinal, intracisternally, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intravesically, mucosally, intracardially, intraumbilically, intraocularly, intranasally, orally, topically, locally, by inhalation, injection, infusion, continuous infusion, directly to target cells in a local perfusion bath, via a catheter, via a lavage solution, in a cream, in a lipid composition (e.g., liposomes), or a combination thereof. In certain embodiments, a method of delivering an agent (e.g., a therapeutic agent) to a subject is disclosed, comprising administering an effective amount of a composition described herein intravenously, intramuscularly, intranasally, sublingually, or bucally.

[0027] In some embodiments, a method of making a composition of the present disclosure is disclosed, comprising forming an aqueous solution containing a drug (e.g., a therapeutic agent), a sugar, a zwitterionic compound, and a base polymer by mixing the drug, sugar, zwitterionic compound, and base polymer until homogeneous. The drug (e.g., a therapeutic agent), sugar, zwitterionic compound, and base polymer may be combined in any order to obtain the aqueous solution. As one non-limiting example, the method may include mixing the sugar and the base polymer to form a first mixture; mixing the drug (e.g., a therapeutic agent) and the zwitterionic compound to form a second mixture; and mixing the first and second mixtures to form the aqueous solution. In some embodiments, the aqueous solution comprises about 2% PVA, about 1% arginine, about 1% trehalose, and about 0.5% sorbitol, and the aqueous solution has a pH between 8.0 and 9.0. In some embodiments, the aqueous solution comprises about 2% PVA, about 1% arginine, about 1% sorbitol, and about 1.5% glycerol, and the aqueous solution has a pH between 8.0 and 9.0.

[0028] In some embodiments, the aqueous solution further comprises a plasticizer, and the drug (e.g., therapeutic agent), sugar, zwitterionic compound, base polymer, and plasticizer may be combined in any order to obtain the aqueous solution. As one example, the method may include mixing the plasticizer with the sugar and base polymer to form a first mixture; mixing the drug (e.g., therapeutic agent) and zwitterionic compound to form a second mixture; and mixing the first and second mixtures to form the aqueous solution.

[0029] In some embodiments, the aqueous solution further comprises a surfactant, and the drug (e.g., therapeutic agent), sugar, zwitterionic compound, base polymer, and surfactant may be combined in any order to obtain the aqueous solution. As one example, the method may include mixing the surfactant with the sugar and base polymer to form a first mixture; mixing the drug (e.g., therapeutic agent) and zwitterionic compound to form a second mixture; and mixing the first and second mixtures to form the aqueous solution.

[0030] In some embodiments, the aqueous solution further comprises a surfactant and a plasticizer, and the drug (e.g., therapeutic agent), sugar, zwitterionic compound, base polymer, surfactant, and plasticizer may be combined in any order to obtain the aqueous solution. As one example, the method may further comprise mixing the surfactant and plasticizer with the sugar and base polymer to form a first mixture; mixing the drug (e.g., therapeutic agent) and zwitterionic compound to form a second mixture; and mixing the first and second mixtures to form the aqueous solution.

[0031] In some embodiments, a method of making a composition of the present disclosure is disclosed, the method comprising forming an aqueous solution comprising a drug (e.g., a therapeutic agent), a plasticizer, a surfactant, and a base polymer by mixing the drug, the plasticizer, the surfactant, and the base polymer until homogeneous. The drug (e.g., a therapeutic agent), the plasticizer, the surfactant, and the base polymer may be combined in any order to obtain an aqueous solution. In one embodiment, a method of making a composition of the present disclosure is disclosed, the method comprising: mixing the drug with a surfactant to form a first mixture; mixing the plasticizer with the base polymer to form a second mixture; and mixing the first and second mixtures to form an aqueous solution, thereby forming an aqueous solution comprising the drug (e.g., a therapeutic agent), the plasticizer, the surfactant, and the base polymer. In some embodiments, the method further comprises mixing the drug (e.g., a therapeutic agent) with a PEGylated lipid before mixing the drug with the surfactant to form the first mixture. In some embodiments, the aqueous solution comprises about 1.5% HPMC, about 0.01% poloxamer, and about 3% glycerol. In some embodiments, the aqueous solution comprises about 1% HPMC, about 0.012% poloxamer, about 3% glycerol, and about 0.008% PEGylated lipid. In some embodiments, the aqueous solution has a pH between 7.5 and 8.5.

[0032] In some embodiments, the components of the aqueous solution are mixed in the presence of sufficient buffer to promote a pH of the composition between 6.0 and 9.0. In some embodiments, an agent (e.g., a therapeutic agent) is added to the homogeneous mixture at ambient temperature and dispersed throughout the homogeneous mixture to produce a liquid form of the composition. In some embodiments of the compositions and methods disclosed herein, the liquid composition is stored at a temperature above 0°C, above 4°C, above 15°C, above 25°C, above 30°C, or above 35°C for a minimum of, a maximum of, or equal to, or any two of 1 day, 7 days, 14 days, 30 days, 60 days, 90 days, 120 days, 150 days, 180 days, 210 days, 240 days, 270 days, 300 days, 330 days, or 360 days; for a minimum of 1 year, a maximum of 1 year, equal to, or about 1 year; or for a minimum of, a maximum of, or equal to, or any two of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, or 36 months. Additionally or alternatively, in some aspects of the compositions and methods disclosed herein, the liquid composition is subjected to freeze-thawing.

[0033] In some embodiments, the method further comprises drying the aqueous solution to form a substantially solid film. In some embodiments, the composition is dried at ambient temperature and pressure, optionally under a constant air flow. In some embodiments, the method does not comprise drying the aqueous solution to form a substantially solid film. In some embodiments, the dry, substantially solid film is stored at a temperature above 0°C, above 4°C, above 15°C, above 25°C, above 30°C, or above 35°C for a minimum of, a maximum of, equal to, or any two of 1 day, 7 days, 14 days, 30 days, 60 days, 90 days, 120 days, 150 days, 180 days, 210 days, 240 days, 270 days, 300 days, 330 days, or 360 days; a minimum of 1 year, a maximum of 1 year, equal to, or about 1 year; or a minimum of, a maximum of, equal to, or any two of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, or 36 months. Additionally or alternatively, in some embodiments of the compositions and methods disclosed herein, the dry, substantially solid film is subjected to freeze-thawing. In some embodiments, the method does not include storing the dry, substantially solid film.

[0034] In some embodiments, the method further comprises dissolving the substantially solid film in a suitably buffered aqueous solution to produce a liquid reconstituted form of the composition. In some embodiments, the suitably buffered aqueous solution comprises buffered saline or a poloxamer. The buffered saline can have a concentration of at least, at most, equal to, or between any two of 0.1% and 10%, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In some embodiments, the suitably buffered aqueous rehydration solution comprises a 0.9% concentration of buffered saline. The poloxamer can be any poloxamer disclosed herein and can be present in solution at a concentration between 0.00001% and 0.1%, for example, 0.00001, 0.00002, 0.00003, 0.00004, 0.00005, 0.00006, 0.00007, 0.00008, 0.00009, 0.0001, 0.0002, 0.0003, 0.0004, 0.0005, 0.0006, 0. The poloxamer concentration may be at least, at most, equal to, or between any two of the following: 0.0007, 0.0008, 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1%. In some embodiments, the poloxamer is Poloxamer 188 and the appropriately buffered aqueous rehydration solution comprises about 0.001% poloxamer. In some embodiments, the poloxamer is Poloxamer 407 and the rehydration solution comprises about 0.01% poloxamer.

[0035] The terms "about" or "approximately" are defined as close as would be understood by one of ordinary skill in the art. In one non-limiting aspect, these terms are defined as within 10%, preferably within 5%, more preferably within 1%, and most preferably within 0.5%.

[0036] The use of the words "a" or "an" when used in conjunction with the term "comprising" can mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more than one."

[0037] The phrase "and / or" means "and" or "or." By way of example, A, B, and / or C includes A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination. In other words, "and / or" operates as an inclusive "or."

[0038] The terms "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0039] Compositions and methods for their use can "comprise," "consist essentially of," or "consist of" any of the components or steps disclosed throughout this specification. Compositions and methods "consisting essentially of" any of the disclosed components or steps limit the scope of the claims to the specified materials or steps that do not materially affect the basic and novel characteristics of the claimed embodiment.

[0040] "Individual," "subject," and "patient" are used interchangeably and can refer to a human or non-human.

[0041] "Ambient temperature" and "room temperature" can each encompass temperatures between 15°C and 30°C, or any range or value derivable therein. In some embodiments, ambient or room temperature can encompass temperatures between 15°C and 25°C, between 20°C and 25°C, between 18°C ​​and 28°C, or any range or value derivable therein. In certain embodiments, ambient or room temperature encompasses 25°C.

[0042] Any method in the context of a therapeutic, diagnostic, or physiological purpose or effect may also be described in "use" claim language, such as "use of" any compound, composition, or agent discussed herein to achieve or carry out the stated therapeutic, diagnostic, or physiological purpose or effect.

[0043] It is specifically contemplated that any limitation discussed with respect to one aspect of the present disclosure may be applied to any other aspect of the present disclosure. Furthermore, any composition of the present disclosure may be used in any method of the present disclosure, and any method of the present disclosure may be used to produce or utilize any composition of the present disclosure. Any embodiment discussed with respect to one aspect of the present disclosure also applies to other aspects of the present disclosure, and vice versa. For example, any step in a method described herein may be applied to any other method. Furthermore, any method described herein may exclude any step or combination of steps. Aspects of an embodiment described in an example are also aspects that can be implemented in the context of embodiments discussed elsewhere in a different example or elsewhere in this application, such as the summary, detailed description, claims, and brief description of the drawings.

[0044] Other objects, features, and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating particular aspects of the present disclosure, are given by way of illustration only, as various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description.

[0045] BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The present disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of certain aspects presented herein. [Brief explanation of the drawings]

[0046] [Figure 1] Figure 1 shows the adenoviral transduction efficiency relative to the plasmid transfection efficiency after long-term storage at 25°C on films with the same MSI-TX-1 formulation.

[0047] [Figure 2]Figures 2A-2C show the effect of the film base and surfactant on plasmid transfection efficiency (Figure 2A) and the mobility of plasmid DNA on agarose gels (Figures 2B and 2C).

[0048] [Figure 3] Figure 3 shows the compatibility of hydroxypropylmethylcellulose (HPMC) film base with transfection reagents. Method 1 corresponds to calcium phosphate-mediated transfection. Method 2 corresponds to polyethyleneimine (PEI)-mediated transfection.

[0049] [Figure 4] FIG. 4 shows the effect of film-based buffer on transfection efficiency after storage at room temperature.

[0050] [Figure 5] Figures 5A-5D show the effect of various film formulations P1-P5 on transfection efficiency (Figures 5A-5C) and plasmid conformation (Figures 5B-5D) after 48 hours of storage of plasmid DNA in the liquid formulations (Figures 5A-5B) or after rehydration of the plasmid DNA film after 7 days of storage at 25°C (Figures 5C-5D).

[0051] [Figure 6] Figures 6A-6C show the effect of the excipients EDTA (Figure 6A; E1), arginine (Figure 6B; E2), and EDTA + arginine (Figure 6C) on the transfection efficiency of plasmid DNA after storage at 40°C for 4 weeks (Figures 6A and 6C) or at 50°C for 7 days (Figure 6B).

[0052] [Figure 7] FIG. 7 shows the effect of film formulations containing EDTA (E1) or arginine (E2) on plasmid DNA stability after 8 weeks of storage at 25° C.

[0053] [Figure 8] Figure 8 shows the effect of film formulations containing various sugars S1-S7 on the transfection efficiency of plasmid DNA prepared in films and stored at 25°C for 8 weeks.

[0054] [Figure 9] 9A-9B show the effect of plasmid DNA concentration on the transfection efficiency of plasmid DNA after drying of films containing plasmid DNA (FIG. 9A) and after storing the dried films at 25° C. for 30 days (FIG. 9B).

[0055] [Figure 10] Figures 10A-10B show the effect of RH on the transfection efficiency of plasmid DNA prepared in films (at various RH) after storing the films at 25°C for 12 weeks (Figure 10A) or at 40°C for 10 days (Figure 10B).

[0056] [Figure 11] FIG. 11 shows the effect of film template material on the transfection efficiency of plasmid DNA.

[0057] [Figure 12] Figures 12A-B show the effect of optimized film formulations F1-F4 on the transfection efficiency (Figure 12A) and conformation (Figure 12B) of plasmid DNA prepared in films and stored at 25°C and 60% RH for 12 weeks. ***, p<0.001; **, p<0.01; *, p<0.05 vs. buffer-only control (Buffer (Liq)).

[0058] [Figure 13] 13A-13B show the effect of a film formulation comprised of HPMC (FIG. 13A) and a film formulation containing polyvinyl alcohol (FIG. 13B) on the release of plasmid DNA from the film.

[0059] [Figure 14]FIG. 14 shows the transfection efficiency of plasmid DNA after storage of the plasmid DNA in solid film form at 25° C. for up to 8 weeks.

[0060] [Figure 15] Figure 15 shows the effect of optimized liquid (liq) or film formulations F1-F3 on the transfection efficiency of Lipofectamine-complexed plasmid DNA prepared in liquid or film formulations after 2 weeks of storage at 25 °C and 60% relative humidity (RH).

[0061] [Figure 16] Figures 16A-16C show the effect of gelatin-containing film formulations F1-F4 on transfection efficiency after storage at room temperature for 4 hours (Figure 16A); after drying films containing plasmid DNA complexed with PEI in OPTI-MEM™ or PBS as solvent (Figure 16B); and after storage at 25°C and 60% RH for up to 11 days (Figure 16C). *p<0.05, **p<0.01.

[0062] [Figure 17] Figure 17 shows the effect of gelatin-containing film formulations (pH 5-9) on the transfection efficiency of lipid nanoparticle (LNP)-encapsulated mRNA before drying (liquid) and after film formation (film).

[0063] [Figure 18] 18A-18B show the effect of sugars on the stability of LNP-encapsulated mRNA in frozen and dried states (FIG. 18A), and the effect of polymers on the transfection efficiency of LNP-encapsulated mRNA during the film formation process (FIG. 18B).

[0064] [Figure 19]Figures 19A-19B show the effect of cyclodextrin on the transfection efficiency of LNP-encapsulated mRNA prepared in a liquid film formulation stored at 20°C for up to 24 hours (Figure 19A) or in a dry film stored at 4°C for 4 days (Figure 19B).

[0065] [Figure 20] FIG. 20 shows the effect of LNP-encapsulated mRNA concentration on the transfection efficiency of LNP-encapsulated mRNA after drying of the film, including LNP-encapsulated mRNA drying and rehydration.

[0066] [Figure 21] FIG. 21 shows the effect of various solvents 1-10 on the transfection efficiency of LNP-encapsulated mRNA prepared in films after the films were rehydrated with solvents 1-10.

[0067] [Figure 22] FIG. 22 shows the effect of optimized film formulations GP, GPT, GPS, KP, KPT and KPS on the transfection efficiency of LNP-encapsulated mRNA prepared in the film formulation.

[0068] [Figure 23] FIG. 23 shows the effect of Pluronic® F127 on the transfection efficiency of LNP-encapsulated mRNA compared to the transfection efficiency of LNP-encapsulated mRNA prepared in films containing other surfactants or plasticizers.

[0069] [Figure 24] Figure 24 shows the effect of the order of excipient addition during the preparation of LNP-encapsulated mRNA films with formulations 1 to 3 on the transfection efficiency of LNP-encapsulated mRNA.

[0070] [Figure 25]Figures 25A-25E. Effect of established film formulations and their individual components on transfection efficiency of plasmid DNA. Figure 25A. Surfactant (SF) and polymer base significantly reduced transfection efficiency. Figure 25B. Plasmid precipitation in the presence of surfactant. Figure 25C. Mobility patterns of plasmid DNA in the presence of different concentrations of surfactant. Figure 25D. Effect of polymer base concentration on transfection efficiency. Figure 25E. Effect of modified film formulations on preservation of transfection efficiency during the film formation process and during 3-month storage at room temperature. Calculation of transfection efficiency is outlined in the Materials and Methods section. In Figures 25A, 25D, and 25E, data represent the mean ± standard error of the mean of quadruplicates for each formulation. Statistical significance between formulations for unformulated plasmid in 10 mM Tris buffer pH 8.0 was determined by one-way ANOVA followed by Dunnett's multiple comparison test (Figures 25A and 25D) and Tukey's multiple comparison test (Figure 25E). *p<0.05, **p<0.01, ***p<0.001.

[0071] [Figure 26] Figures 26A-C. Cationic basic amino acids improve the thermal stability of plasmid DNA in solution at 50°C. Figure 26A. Agarose gel electrophoresis separation of three different conformations of plasmid DNA stored in various amino acid-based formulations after 2 days at 50°C. Figure 26B. Agarose gel electrophoresis separation of three different conformations of plasmid DNA stored in formulations containing basic amino acids after 4 days at 50°C. Figure 26C. Tabular summary of the isoelectric point (pI), measured pH, and major charge (estimated using pH and pI values) of formulations containing 1% w / v of each amino acid. Specific details of each formulation shown in this figure are summarized in Table 1.

[0072] [Figure 27]Figures 27A-27F. Positively charged amino acids improve the thermal stability of plasmid DNA at elevated temperatures in solution relative to EDTA. Each excipient was added only to Tris buffer (pH 8) to determine whether they interfered with transfection efficiency (Figure 27A) or transgene-specific qPCR reactions (Figure 27B). Note: 4 ng / ml of polyethyleneimine (PEI) combined with 1 ng / ml of pDNA was included as a positive control for qPCR. Figure 27C. Separation of three different forms of plasmid DNA by agarose gel electrophoresis after two weeks of storage in solution at 40°C. Figure 27D. Transfection efficiency of plasmids stored in solution at 40°C for two weeks. Figure 27E. Effect of EDTA on transfection efficiency of plasmids in solutions with various concentrations of amino acids (aa2) or choline (CA). Figure 27F. Agarose gel of plasmid DNA stored in various formulations at 40°C for two weeks. Specific details for each formulation shown in this figure are summarized in Table 1. Calculations of transfection efficiency are outlined in the Materials and Methods section. In Figures 27A, 27B, 27D, and 27E, data represent the mean ± standard error of the mean of quadruplicates for each individual formulation. Statistical significance between formulations relative to unformulated plasmid in 10 mM Tris buffer was determined by one-way ANOVA followed by Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001.

[0073] [Figure 28]Figures 28A-28F. Evaluation of film-forming polymers, amino acids, and sugars for stabilizing plasmid DNA within a film matrix at 25°C. Figure 28A. Evaluation of five different polymers for their ability to maintain plasmid transfection efficiency during the film formation process. P2 was selected for use in further studies. Figure 28B. The absence of supercoiled DNA and the presence of significant amounts of nicked DNA were visualized in samples from films prepared with polymers that failed to maintain transfection efficiency after 1 week at 25°C. Figure 28C. The addition of amino acids to the polymer base significantly improves plasmid stability at 25°C. This preparation contained the most supercoiled DNA after 3 weeks at 25°C than the other formulations tested (Figure 28D). Figure 28E. Stability profiles of formulations containing polymer P2 and seven different sugars. Over the 8-week study period, none of the formulations improved the transfection efficiency of plasmids stored in Tris buffer, pH 8 (liquid control). Figure 28F. Visualization of three different forms of plasmid DNA at 8 weeks. Specific details for each formulation shown in this figure are summarized in Table 1, and calculations of transfection efficiency are outlined in Example 5. In Figures 28A, 28C, and 28E, data represent the mean ± standard error of the mean of quadruplicates for each formulation at each time point. Statistical significance between formulations relative to the liquid control was assessed by one-way ANOVA with Dunnett's post-hoc multiple comparison test. **p<0.01, ***p<0.001.

[0074] [Figure 29]Figures 29A-29D. Incorporation of amino acids and sugars into a film matrix composed of plasticizers and polymers significantly improves plasmid stability at 25°C. Figure 29A. 12-week stability profiles of plasmids stored in different film matrices at 25°C. Figure 29B. Separation of three different conformations of DNA after 4 weeks at 25°C. Figure 29C. 17-week stability profile of plasmids stored at 4°C. Figure 29D. Separation of three different conformations of DNA after 2 and 8 weeks of storage at 4°C. In Figures 29A and 29C, the liquid control consisted of plasmid in 10 mM Tris pH 8.0 stored at 4 or 25°C. This corresponds to the "Tris" lane of the gel shown in Figure 29D. Specific details of each formulation shown in this figure are summarized in Table 1, and calculations of transfection efficiency are outlined in Example 5. Data reported in these panels represent the mean ± standard error of the mean of quadruplicates per formulation at each time point.

[0075] [Figure 30]Figures 30A-30C. Environmental storage conditions and the manner in which excipients are mixed in the bulk formulation affect the long-term stability of the plasmid within the film matrix. Plasmid-containing films prepared using formulation F4 were packaged and stored at 25°C in chambers with different relative humidity (RH). This formulation contained a polymer (P), an amino acid (A), a plasticizer (S), and a sugar (T) (collectively referred to as PAST). Figure 30A. Transfection efficiency was not affected by RH up to 12 weeks, when transfection efficiency decreased by 20% in films stored at 90% RH. Despite this effect, the water content within the films did not change significantly over time (Figure 30B). Figure 30C. Addition of amino acids with the plasmid prior to addition to the bulk formulation (pDNA+A)-PST significantly reduced transfection efficiency after drying. In each panel, data represent the mean ± standard error of the mean for triplicates for each condition and / or time point tested. Calculation of transfection efficiency is outlined in Example 5. Statistical significance between storage conditions was determined by two-way ANOVA and Tukey's post-hoc multiple comparison test. *p<0.05, ***p<0.001.

[0076] [Figure 31]Figures 31A-31D. PAST formulations maintain transfection efficiency of plasmids within the film matrix for 9 months at 25°C. Figure 31A. 9-month stability profile of plasmids embedded within PAST matrices at 25°C. The increase in transfection efficiency toward the end of the study correlates with an increase in plasmid copy number (Figure 31B) due to an increase in nicked DNA, as visualized by agarose gel electrophoresis (Figure 31C). Further analysis of band intensity revealed an increase in the ratio of nicked:supercoiled DNA in the rehydrated samples over time (Figure 31D). In Figures 31A and 31B, data represent the mean ± standard error of the mean of triplicates for each time point tested. Calculation of transfection efficiency is outlined in Example 5. Statistical significance between data from each time point and fresh films (t=0) was determined by two-way ANOVA and Dunnett's post-hoc test. *p<0.05, **p<0.01.

[0077] [Figure 32] Figures 32A-32D. Films prepared with the PAST formulation are amorphous solids and rapidly release the plasmid. Figure 32A. Release profile in PBS at 37°C. Data are reported as the fraction of the plasmid (100 μg) in the film found in PBS cumulatively over time. Figure 32B. The presence of amino acids and sugars within the film matrix creates a flexible film. Two components of tensile strength are shown here: the force required to puncture the film and the distance across the film layer. Figure 32C. X-ray diffraction. The film remains an amorphous solid with each excipient and plasmid addition. Figure 32D. FTIR scans suggest that the plasmid is not bound by the excipients in the film matrix. In Figures 32A and 32B, data represent the mean ± standard deviation of the mean of five replicates per formulation and / or time point. Statistical significance was determined by one-way ANOVA with Tukey's post-hoc test for multiple comparisons between all two formulations. *p<0.05, **p<0.01, ***p<0.001.

[0078] [Figure 33] Figures 33A-B. Proposed mechanism for stabilization of plasmid DNA within the film matrix. Figure 33A. The PAST formulation significantly improves the stability of solid-state plasmid DNA at 25 °C compared to the plasmid (powder) dried in Tris buffer alone. Figure 33B. Amino acids present in the film matrix play an important role in mitigating plasmid degradation. Positively charged amino acids shield electron-dense groups such as phosphates, amines, or purines along the helical strands of the plasmid, restricting the access of free H+ to these regions, thereby limiting acidic hydrolysis or depurination (red lightning bolt). Positively charged amino acids also attract hydroxyl ions (OH-) away from electrophilic hydrogens between the helical strands of the plasmid (red X), which can further reduce the disruption of internucleotide hydrogen bonds or the hydrolysis of phosphodiester bonds along the plasmid.

[0079] [Figure 34]Figures 34A-34D. Effect of plasmid concentration and template composition on transfection efficiency of plasmids stabilized within a film matrix. The transfection efficiency of liquid film formulations decreased slightly with increasing amounts of plasmid (Figure 34A). This effect was more pronounced when the formulations were dried and rehydrated (Figure 34B), demonstrating that concentrations above 0.5 mg / ml were detrimental to long-term stability within the film matrix (Figure 34C). Figure 34D. When plasmid-containing films were dried in polystyrene (plastic) molds, transfection efficiency was significantly impaired. Although transfection efficiency remained high when films were dried on stainless steel (SS) and foil-laminated (foil) molds, these were not used due to the risk of promoting oxidative degradation during long-term storage. Silicone molds were used to produce all films in this study. Calculations for transfection efficiency are outlined in the Materials and Methods section. Data represent the mean ± standard error of the mean of triplicates for each formulation. In Figures 34A-C, statistical significance for 0.1 mg / ml plasmid concentration was determined by two-way ANOVA followed by Dunnett's post-hoc test. In Figure 34D, statistical significance between different template surfaces was determined by one-way ANOVA followed by Tukey's post-hoc multiple comparison test. *p<0.05, **p<0.01, ***p<0.001.

[0080] [Figure 35]Figures 35A-35C. Three conformations of plasmid DNA and their effects on stability index assays. Figure 35A. Visualization of linear, nicked, and supercoiled plasmid DNA by agarose gel electrophoresis. Plasmids stored frozen in Tris buffer at room temperature (20°C) or elevated temperature (40°C) enhanced the transition from supercoiled plasmid DNA to linear and nicked forms. Figure 35B. The presence of linear and nicked DNA in samples can increase plasmid copy number as determined by quantitative PCR. Figure 35C. Conversion of supercoiled plasmid DNA to linear and nicked forms significantly impairs transfection efficiency. Data represent the mean ± standard deviation of the mean for triplicates for each condition. Statistical significance between different DNA conformations was determined using one-way ANOVA followed by Tukey's post-hoc test. *p<0.05 and ***p<0.001.

[0081] [Figure 36] Figures 36A-36D. Compatibility of transfection reagents with film matrix components. Polyethylenimine (PEI)-mediated transfection was unaffected by the presence of EDTA (Figure 36A), whereas calcium phosphate (CaP)-mediated transfection was significantly reduced in a concentration-dependent manner (Figure 36B). PEI-mediated transfection was affected by several film-forming polymers (Figure 36C), whereas CaP was only slightly affected by different polymers (Figure 36D). These results and the fact that PEI provides highly reproducible transfection efficiencies supported the use of PEI for the remainder of the experiments summarized in this manuscript. Specific details of each formulation shown in this figure are summarized in Table 1. Data represent the mean ± standard error of the mean of quadruplicates for each formulation. Statistical significance between samples in Tris buffer alone (0 mM EDTA in Figures 36A and 36B, Tris in Figures 36C and 36D) and plasmid was determined by one-way ANOVA and Dunnett's multiple comparison test. *p<0.05, ***p<0.001.

[0082] [Figure 37] Figures 37A-37C. Sugars affect plasmid stability within the film matrix under standard (25°C, 60% RH, Figure 37A) and stress (40°C, 75% RH, Figure 37B) storage conditions. The most optimal formulation contained more supercoiled DNA after 2 weeks (Figure 37C). Specific details for each formulation shown in this figure are summarized in Table 1. Data represent the mean ± standard error of the mean of quadruplicates per formulation. In Figures 37A and 37B, statistical significance between plasmids stored in Tris buffer (Tris) under the same conditions was determined by one-way ANOVA followed by Tukey's post-hoc multiple comparison test. *p<0.05, ***p<0.001.

[0083] [Figure 38] Figures 38A-38B. Transition of plasmid DNA stabilized in different film formulations from supercoiled to nicked forms over 12 weeks at 25°C. Figure 38A. Representative agarose gel showing different forms of plasmid DNA in rehydrated film samples collected after 4, 8, and 12 weeks at 25°C. Figure 38B. Changes in the supercoiled:nicked plasmid ratio over 12 weeks at 25°C. The density of supercoiled and nicked bands was analyzed using ImageJ software. Data were calculated as the ratio of the fluorescence intensity of the supercoiled (yellow) or nicked (gray) DNA band to the sum of the intensities of the bands representing the three DNA conformations. Specific details of each formulation shown in this figure are summarized in Table 1.

[0084] [Figure 39]Individual excipients and film complexes are not cytotoxic after 2 hours of exposure to HEK 293 cells. Specific details of each formulation component shown in this figure are summarized in Table 1. A positive control solution of 0.1% Triton® X-100 was used to qualify the assay. Data represent the mean ± standard error of the mean of triplicates for each formulation. Statistical significance between cells maintained in culture medium (no treatment) and each formulation component was determined by one-way ANOVA followed by Dunnett's post-hoc multiple comparison test. ***p<0.001.

[0085] [Figure 40] Figures 40A-40D. Effect of sugars and amino acids on the glass transition temperature (Tg) of thin film formulations. Figure 40A. DSC thermograms of film base and sugar-containing formulations. Figure 40B. Tabular summary of Tg and pH values ​​of sugar-containing film formulations. Figure 40C. DSC thermograms of films made from individual excipients of the PAST formulation. Figure 40AD. Tabular summary detailing how Tg and pH change in the film matrix in response to each component of the PAST formulation. Specific details of each formulation component shown in this figure are summarized in Table 1. pH was measured by visual inspection of the prepared films using universal pH paper.

[0086] [Figure 41] Figures 41A-B. Assessment of DNA content in plasmid-containing films stored at 25°C and 60% RH for 9 months. The amount of DNA in rehydrated films was quantified by measuring absorbance at 260 nm using a standard UV-Vis (Figure 41A) or Nanodrop (Figure 41B) spectrophotometer. Data were normalized to the concentration of plasmid in Tris buffer stored frozen at -20°C. Data represent the mean ± standard error of the mean for triplicates for each time point. Statistical significance for data collected at the beginning of the study (t=0) was determined by one-way ANOVA followed by Dunnett's post-hoc test. *p<0.05, **p<0.01.

[0087] [Figure 42] General structure of lipid nanoparticles.

[0088] [Figure 43] Intracellular fate of mRNA lipid nanoparticles.

[0089] [Figure 44] A typical mRNA LNP manufacturing process.

[0090] [Figure 45] Figures 45A-C. Transfection efficiency of PEI-DNA complexes is maintained within the film matrix. Figure 45A. Analysis of different methods of complex formation before addition to film formulation on transfection efficiency. Method 1: Equal mixture of PEI and DNA. Method 2: Dropwise addition of PEI to plasmid. Method 3: Dropwise addition of plasmid to PEI. In each case, the transfection efficiency of complexes containing 1 μg DNA in 32 μl medium after dilution to 1 μg DNA in 100 μl medium was normalized to the control prepared with 1 μg DNA in 100 μl medium. Figure 45B. Effect of medium recovery on transfection efficiency during the film formation process. Figure 45C. Stability of PEI-DNA complexes in films stored at 25°C and 60% RH for 2 weeks. In each panel, % transfection efficiency is expressed as the amount of beta-galactosidase present in a given cell population for each formulation relative to cells transfected with fresh complexes made from plasmids stored at -20°C in Tris buffer. Data represent the mean ± standard error of the mean of quadruplicates for each formulation. Statistical significance between formulations relative to unformulated complexes was determined by one-way ANOVA followed by Tukey's multiple comparison test. **p<0.01, ***p<0.001.

[0091] [Figure 46]Figures 46A-46D. The transfection efficiency of lipofectamine (LPF)-DNA complexes is enhanced during storage at 25°C in the film matrix. Figure 46A. Effect of medium volume ratio on the transfection efficiency of LFP-DNA complexes. Figure 46B. Effect of polymer on transfection efficiency during the film formation process. Figure 46C. Stability of LPF-DNA complexes within films after 4 days at 4°C and 25°C. Figure 46D. Stability of LPF-DNA complexes over 14 days at 25°C. Specific details of each formulation shown in this figure are summarized in Table 4. In each panel, the % transfection efficiency is the amount of beta-galactosidase present in a given cell population for each formulation relative to cells transfected with fresh complexes made from plasmids stored at -20°C. Data represent the mean ± standard error of the mean for quadruplicates of each formulation. Statistical significance between formulations relative to unformulated complexes placed in the same conditions was determined by one-way ANOVA followed by Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001.

[0092] [Figure 47] Figures 47A-47D. Effect of pH on LNP stability in solution and within the film matrix. Effect of pH on LNP particle size and PDI (blue dots, Figure 47A) and transfection and encapsulation efficiency (orange dots, Figure 47B) in solution at 4°C for 3 days. Effect of pH on LNP particle size and PDI (Figure 47C) and transfection and encapsulation efficiency (Figure 47D) at the completion of the film formation process compared to unthawed stock solution (buffer). Buffers used in this study were 20 mM histidine (pH 6 and 6.5), 150 mM PBS (pH 7), and 10 mM Tris (pH 8 and 9). In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical analysis was performed using two-way ANOVA and Dunnett's post-hoc test to compare LNP characteristics in the formulations to those found in Tris pH 8. **p<0.01, ***p<0.001.

[0093] [Figure 48] Figures 48A-B. Effect of polymer on preserving LNP particle size (Figure 48A) and transfection efficiency (Figure 48B) during the film formation process. LNPs were placed into low-viscosity polymer formulations and allowed to dry under ambient and sterile conditions. Films were then reconstituted with 0.9% NaCl for analysis and comparison to unthawed stock solutions (buffer). Specific details of the formulations utilized in this figure are summarized in Table 3. Data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical significance for freshly thawed LNPs in Tris buffer was determined by two-way ANOVA and Dunnett's post-hoc test. **p<0.01, ***p<0.001.

[0094] [Figure 49] Figures 49A-49B. Glycerol improves stabilization of mRNA-containing LNPs within the film matrix. Figure 49A. Glycerol at concentrations greater than 2% v / v maintains LNP particle size and PDI (blue dots) relative to the unthawed stock solution (buffer). Figure 49B. Effect of glycerol on transfection efficiency of LNPs during the film formation process. The formulation utilized in these studies was K100LV HPMC in 10 mM Tris buffer, pH 8. In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical analysis was performed using two-way ANOVA and Dunnett's post-hoc test to compare the characteristics of mRNA LNPs in film formulations to those of freshly thawed mRNA LNPs in Tris buffer. *p<0.05, ***p<0.001.

[0095] [Figure 50]Figures 50A-50B. Addition of Pluronic® F127 to LNPs prior to incorporation into the film matrix significantly improves their physical and biological properties during the drying process. Pluronic® F127 was added directly to the film formulation (1.5% K100LV, 3% glycerol) before mixing with the LNPs (F127 Base) or to the LNP stock before mixing with the bulk formulation (F127 LNP). Figure 50A. Effect of mixing on particle size and PDI (blue dots). Figure 50B. Effect of mixing on transfection and encapsulation (orange dots) efficiency. In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. Statistical significance between conditions was determined by two-way ANOVA and Tukey's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001.

[0096] [Figure 51] Figures 51A-51D. The use of PEG-lipid as an excipient improves LNP stability within the film matrix at 4°C. PEG-conjugated lipid was included in bulk film formulations (1.5% K100 LV + 3% glycerol + 0.01% Pluronic® F127) at high (0.04%) and low (0.008%) concentrations. Freshly prepared films (DO) stored at 4°C for 1 week (D7) were rehydrated and the particle size (Figure 51A), PDI (Figure 51B), encapsulation efficiency (Figure 51C), and transfection efficiency (Figure 51D) were measured. Specific details of the formulations utilized in this figure are summarized in Table 4. Data generated from frozen stock LNP stored at 400 μg / ml (buffer) were also included for comparison. In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. Statistics between formulations with and without PEG-lipid were determined using two-way ANOVA and Dunnett's post-hoc test. *p<0.05, **p<0.01, ***p<0.001.

[0097] [Figure 52]Figures 52A-52D. Formulations containing high-viscosity polymers and DMPC lipids preserved the physical properties of mRNA LNPs but failed to support transfection efficiency at 4°C. Individual lipids (0.008% DMPE-PEG, 0.008% DMG-PEG, or 0.01% DMPC) were added to bulk formulations containing either K4M (solid bars) or K100LV (hatched bars) HPMC. Films were rehydrated immediately after drying (DO) and stored at 4°C for 14 and 28 days for measurements of particle size (Figure 52A), PDI (Figure 52B), encapsulation efficiency (Figure 52C), and transfection efficiency (Figure 52D). Specific details of the formulations utilized in this figure are summarized in Table 4. In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. Statistical differences between K4M and K100LV formulations containing the same lipid components were determined using two-way ANOVA and Tukey's multiple comparison test. **p<0.01, ***p<0.001.

[0098] [Figure 53] Figures 53A-53D. The combination of a nonionic surfactant within the film matrix improves the physical properties of LNPs but fails to improve transfection efficiency after 14 days at 4°C. A combination of Pluronic® F127 and a second nonionic surfactant was added to the LNPs before mixing with K4M HPMC. The fully packaged films were stored at 4°C for 2 weeks and then rehydrated for measurement of particle size (Figure 53A), PDI (Figure 53B), encapsulation efficiency (Figure 53C), and transfection efficiency (Figure 53D). Specific formulation details are listed in Table 4. In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. Statistical differences between formulations containing two surfactants and formulations containing Pluronic® F127 were determined by two-way ANOVA and Dunnett's post-hoc test. *p<0.05, **p<0.01, ***p<0.001.

[0099] [Figure 54]Figures 54A-54D. A pH 8.5 buffer preserves the physical and biological properties of LNPs within the film matrix during storage at 4°C. Film bases were prepared using several different buffers ranging from pH 5.5 to 9.0. The internal pH of films prepared using these buffers and their compositions are summarized in Table 6. The films were stored at 4°C for 14 days and rehydrated with 10 mM Tris buffer, pH 8, to determine particle size (Figure 54A), PDI (Figure 54B), encapsulation efficiency (Figure 54C), and transfection efficiency (Figure 54D). In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical significance between measurements performed on days 0 and 14 within the same formulation was determined by two-way ANOVA and Sidak's multiple comparison test. p<0.05, **p<0.01, ***p<0.001.

[0100] [Figure 55] Figures 55A-55D. Excipients that prevent degradation of naked DNA within the film matrix significantly improved LNP stability at 4°C for 28 days. Arginine (0.05%), cysteine ​​(0.005%), and EDTA (1 mM) were added separately to the optimized formulation (OF, Table 4). Fully packaged films were stored at 4°C for up to 28 days and rehydrated with 10 mM Tris buffer, pH 8, for measurements of particle size (Figure 55A), PDI (Figure 55B), encapsulation efficiency (Figure 55C), and transfection efficiency (Figure 55D). In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical significance between LNP characteristics at 14 and 28 days within the same film formulation was determined by two-way ANOVA and Sidak's multiple comparison test. **p<0.01, ***p<0.001.

[0101] [Figure 56]Figures 56A-56D. Storage temperature affects the biological properties of mRNA LNPs within the film matrix more than changes in relative humidity at 4°C. Figure 56A. Effect of storage temperature on LNP particle size and PDI (blue dots). Figure 56B. Effect of storage temperature on LNP encapsulation (orange dots) and transfection efficiency. Figure 56C. Effect of relative humidity on LNP particle size and PDI (blue dots). Figure 56D. Effect of relative humidity on LNP encapsulation (orange dots) and transfection efficiency. In each panel, films were prepared with the optimized formulation (OF) as described in Table 4. Different humidity conditions were established using desiccants or Boveda packs. In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical differences between fresh and 2-week-old films for each formulation were determined using two-way ANOVA and Dunnett's multiple comparison test. p<0.05, **p<0.01, ***p<0.001.

[0102] [Figure 57] Figures 57A-57F. Mold design significantly influences physical properties. Films of the optimized formulation (OF formulation, Table 4) in 10 mM Tris buffer, pH 8.0, were cast on single silicone septa in the form of flat disks or on silicone trays with individual wells. The films were rehydrated for measurement of particle size and PDI (Figure 57A), transfection efficiency (Figure 57B), or used directly for water content determination by Karl Fischer titration (Figure 57C). Photographs of silicone septa are captured in Figure 57D, while silicone trays are shown in the form of multiple wells (Figure 57E) and a cross section of a single well (Figure 57F). Data represent the mean ± standard error of the mean for triplicates for each mold type. *p<0.05, **p<0.01, ***p<0.001. Statistical analysis was performed by unpaired t-test.

[0103] [Figure 58]Figures 58A-58B. Fabrication of LNP-containing films in a low-humidity environment and over-drying significantly impact their physical and biological properties. Films containing mRNA LNPs were dried in a chamber under controlled airflow, temperature (20°C), and different relative humidity conditions. For each condition, four films were collected at two time points: fully dried, when the film appeared visually dry, and extended dried, after 1 hour when the film was determined to be dry by visual inspection. The films were immediately rehydrated and analyzed for particle size and distribution (blue dots, Figure 58A), transfection, and encapsulation efficiency (orange dots, Figure 58B). Optimized formulations made in Tris buffer, pH 8, were used in this study (Table 4, OF formulations). In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation. Statistical differences between films prepared under each condition were determined by two-way ANOVA and Tukey's post-hoc test. *p<0.05, ***p<0.001.

[0104] [Figure 59] Figures 59A-B. Physical and biological properties of LNP stocks. Figure 59A. Physical properties of particles determined by dynamic light scattering and Ribogreen assay. Figure 59B. Linear relationship between luciferase expression and amount of LNP utilized to assess transfection efficiency.

[0105] [Figure 60] Figures 60A-60D. Effect of polymer viscosity on the physical and biological attributes of LNPs after 28 days of storage at 4°C in a film matrix. Formulations of varying viscosity (56-169 cp) were prepared by blending K100LV (low-viscosity HPMC) with K4M (high-viscosity HPMC). Specific details of formulations F20-F24 are summarized in Table 4. Fully packaged films were stored at 4°C and collected at 1, 2, and 4 weeks. They were then rehydrated and evaluated for particle size (Figure 60A), PDI (Figure 60B), encapsulation efficiency (Figure 60C), and transfection efficiency (Figure 60D). In each panel, data represent the mean ± standard error of the mean for triplicates for each formulation.

[0106] [Figure 61] Figures 61A-61B. Stability profile of LNPS within film matrix over 10 weeks at -20°C. Films containing LNPS and optimized formulations in 10 mM Tris pH 8 were dried, placed into particle-free Ziploc®-like bags, grouped in triplicate, and packaged in heat-sealed foil bags for storage at -20°C. At each time point, films were warmed to room temperature and rehydrated for analysis of particle size and PDI (blue dots, Figure 61A), as well as encapsulation (orange dots, Figure 61B) and transfection efficiency. The optimized formulation (OF) in Tris buffer pH 8 was used in this study, with the formulations detailed in Table 4. In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. Statistical significance between LNP characteristics in aged and fresh films (t=0) was determined by two-way ANOVA and Dunnett's post-hoc test. *p<0.05, **p<0.01.

[0107] [Figure 62] Figures 62A-62C. TEM images of mRNA LNPs in films. Each panel shows images of mRNA LNPs in a particular formulation at two magnifications. The top panel shows low magnification captured with a 500 nm ruler, and the bottom panel shows high magnification captured with a 100 nm ruler. Figure 62A. mRNA LNPs in Tris buffer, pH 8.0. Figure 62B. mRNA LNPs in the film base of the optimized formulation before drying. Figure 62C. mRNA LNPs in the optimized formulation film after drying and rehydration. The average particle diameters estimated by ImageJ in Figures 62A, 62B, and 62C are 116 ± 13 nm, 115 ± 13 nm, and 125 ± 14 nm, respectively. The background captured in Figure 62B may be due to the film-forming polymer as the main component of the film formulation; this network was resolved into scattered, distinct parts in Figure 62C.

[0108] [Figure 63] Figures 63A-63D. Stability profile of mRNA LNPs over 112 days at 4°C. Arginine (0.05%) and EDTA (1 mM) were added separately to the optimized formulation (OF) described in Table 4. Fully packaged films were stored at 4°C for up to 112 days and rehydrated with 10 mM Tris buffer pH 8 for measurement of particle size (Figure 63A), PDI (Figure 63B), encapsulation efficiency (Figure 63C), and transfection efficiency (Figure 63D). In each panel, data represent the mean ± standard error of the mean of triplicates for each formulation. DETAILED DESCRIPTION OF THE INVENTION

[0109] Detailed Description Aspects of the present disclosure generally relate to compositions comprising pharmaceutical agents (e.g., therapeutic agents), including nucleic acids, formulated in a stabilizing carrier, including a liquid carrier and a substantially solid carrier, such as a thin film matrix. Methods for the storage and delivery of such pharmaceutical agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids) are also disclosed. As described herein, the disclosed formulations provide compositions and methods for stably storing pharmaceutical agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids) at ambient temperatures. As disclosed herein, pharmaceutical agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids) stabilized as disclosed herein retain significant biological activity even after extended storage conditions that would normally inactivate the composition. Thus, the compositions of the present disclosure offer significant advantages over previous formulations of pharmaceutical agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids), which may require refrigeration or even freezing to maintain activity for any significant period of time. This allows previously highly unstable compositions to be stored and transported over long distances without the typically required cold chain. Another advantage of the provided compositions is that they can facilitate storage of agents (e.g., therapeutic agents) (e.g., nucleic acids) at concentrations that may be desirable for administration and / or use, significantly exceeding the solubility limit but without compromising the physical stability and performance of the agent. This is a significant advantage over lyophilization and conventional formulations. Specific methods for producing the formulations described herein and using the formulations (e.g., formulations produced thereby) to deliver agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids) to a subject are also included. Certain embodiments relate to dissolvable formulations and the delivery of such formulations via intravenous, intramuscular, intranasal, sublingual, or oral methods.

[0110] I. Composition In some aspects, the present disclosure provides compositions containing agents (e.g., therapeutic agents) (e.g., polypeptides, small molecules, nucleic acids and / or components thereof), such as for use in gene delivery / gene therapy, vaccine delivery, etc., dispersed within a liquid or amorphous solid carrier, such as an amorphous film / thin film matrix. Agents (e.g., therapeutic agents) and / or components thereof may include, for example, killed, attenuated, or live whole organisms (including killed and attenuated viruses); subunits or parts of organisms; recombinant vectors containing inserts; pieces or fragments of nucleic acid (DNA, RNA, etc.) associated with bacteria, fungi, parasites, or viruses, recombinant bacteria, fungi, parasites, or viruses, bacteria, fungi, parasites, or viral vectors, and / or components thereof, such as proteins, polypeptides, peptides associated with capsid proteins and / or empty capsids, bacteria, fungi, parasite, or viral particles, and / or infectious particles; small molecules targeting any of the foregoing; or any combination thereof.

[0111] In some embodiments, the agent (e.g., therapeutic agent) and / or components thereof may be administered to a virus, including but not limited to: Arenaviridae (e.g., Lymphocytic choriomeningitis virus), Arterivirus (e.g., equine arteritis virus), Astroviridae (human astrovirus 1), Birnaviridae (e.g., infectious pancreatic necrosis virus, infectious bursal disease virus), Bunyaviridae (e.g., California encephalitis virus group), Caliciviridae (e.g., calicivirus), Coronaviridae (e.g., human coronaviruses 299E and OC43, SARS-CoV-1, SARS-CoV-2), Deltavirus (e.g., hepatitis delta virus), Filoviridae (e.g., Marburg virus, Ebola virus), Flaviviridae (e.g., yellow fever virus group, hepatitis C virus), Hepadnaviridae (e.g., hepatitis B virus), Herpesviridae (e.g., Epstein-Barr virus, simplex virus, varicella virus, cytomegalovirus, roseolovirus, lymphocryptovirus, rhadinovirus), Orthomyxoviridae (e.g., influenza virus, Influenza viruses A, B, and C), Papovaviridae (e.g., papillomaviruses), Paramyxoviridae (e.g., paramyxoviruses (e.g., human parainfluenza virus 1), morbilliviruses (e.g., measles virus), rubulaviruses (e.g., mumps virus), pneumoviruses (e.g., human respiratory syncytial virus)), Picornaviridae (e.g., rhinoviruses (e.g., human rhinovirus 1A), hepatoviruses (e.g., human hepatitis A virus), human poliovirus, Cardioviruses (e.g., encephalomyocarditis virus), aphthoviruses (e.g., foot-and-mouth disease virus 0), coxsackieviruses), Poxyiridae (e.g., orthopoxviruses (e.g., smallpox virus or monkeypox virus)), Reoviridae (e.g., rotaviruses such as rotaviruses A-F), Retroviridae (primate lentiviruses such as human immunodeficiency virus 1 and 2), Rhabdoviridae (e.g., rabies virus), Togaviridae (e.g.,rubella virus, rubeola virus, human T-cell leukemia virus, murine leukemia virus, vesicular stomatitis virus, wart virus, blue tongue virus, Sendai virus, feline leukemia virus, simian virus 40, mouse mammary tumor virus, dengue virus, HIV-1 and HIV-2, West Nile, H1N1, SARS, 1918 influenza, tick-borne encephalitis virus complex (Absettarov, Hanzalova, Hypr), Russian spring-summer encephalitis virus, Congo-Crimean hemorrhagic fever virus viruses derived from: rabies, Junin virus, Kumringe virus, Marburg virus, Machupo virus, Kisanur Forest virus, Lassa virus, Omsk hemorrhagic fever virus, FIV, SIV, herpes simplex 1 and 2, varicella zoster, human parvovirus (B19), respiratory syncytial virus, poxvirus (all types and serotypes), coltivirus, reovirus (all types), and / or rubivirus (rubella); bacteria and fungi, including but not limited to: Streptococcus agalactiae, Legionella pneumophilia, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhosae, Neisseria meningitidis, Pneumococcus, Hemophilis influenzae B, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, Brucella abortus, Mycobacterium tuberculosis, Plasmodium falciparum, Plasmodium vivax, Toxoplasma gondii, Trypanosoma rangeli, Trypanosoma cruzi, Trypanosoma rhodesiensei, Trypanosoma brucei, Schistosoma mansoni, Schistosoma japanicum, Babesia bovis, Elmeria tenella, Onchocerca volvulus, Leishmania tropica,Trichinella spiralis, Theileria parva, Taenia hydatigena, Taenia ovis, Taenia saginata, Echinococcus granulosus, Mesocestoides corti, Mycoplasma arthritidis, M.hyorhinis, M.orale, M.arginini, Acholeplasma laidlawii, M.salivarium, M.pneumoniae, Candida spp., Candida albicans, Cryptococcus spp., Cryptococcus neoformans, Histoplasma spp., Histoplasma capsulatum, Coccidioides spp., Coccidioides immitis, Blastomyces spp., Blastomyces dermatitidis, Aspergillus spp., Aspergillus fumigatus, Pneumocystis spp., Penicillium marneffei, Bacillus anthracis, Bartonella, Bordetella pertussis, Brucella - all serotypes, Chlamydia trachomatis, Chlamydia pneumoniae, Clostridium botulinum, Clostridium - all serotypes, Haemophilus influenzae, Helicobacter pylori, Klebsiella - all serotypes, Legionella - all serotypes, Listeria, Mycobacterium - all serotypes, Mycoplasma - human and animal serotypes, Rickettsia - all serotypes, Shigella - all serotypes, Staphylococcus aureus, Streptococcus - S. pneumoniae, S. pyogenes, Vibrio cholera, Yersinia enterocolitica, and / or Yersinia pestis; parasites including, but not limited to: Ancylostoma human hookworm,Leishmania - all strains, Microsporidium, Necator human hookworm, Onchocerca filarial worm, Plasmodium - all human strains and monkey species, Toxoplasma - all strains, Trypanosoma - all serotypes, and / or Wuchereria bancrofti filarial worm; pieces or fragments of nucleic acid (DNA, RNA, etc.) from a combination of any two or more of the foregoing, and / or proteins, polypeptides, peptides, or fragments thereof, or may be derived from or targeted to (e.g., inhibited by) any type of bacterial or viral vector envisioned by a person skilled in the art for gene transfer, including, but not limited to,

[0112] In some embodiments, a drug (e.g., a therapeutic agent) and / or a component thereof may include a heterologous nucleic acid encoding a heterologous polypeptide that may have a biological function and / or activity, and / or may include a heterologous nucleic acid encoding a heterologous polypeptide that may have a biological function and / or activity, such as, but not limited to, an RNAi, a crRNA, an enhancer RNA, a long non-coding RNA, a microRNA, an sRNA, and / or an shRNA. For example, in some embodiments, a heterologous nucleic acid may express a polypeptide that has a biological function and / or activity, and may express an RNA that has a biological function and / or activity that directs / targets expression of the polypeptide to specific cells, tissues, and / or organs of a subject.

[0113] Heterologous nucleic acids can include DNA (e.g., genomic DNA or recombinant DNA or plasmid DNA) and RNA (e.g., mRNA, RNAi, crRNA, enhancer RNA, long non-coding RNA, microRNA, sRNA and / or shRNA). In one embodiment, the nucleic acid is plasmid DNA, and the composition can comprise between 0.05 mg / mL and 1 mg / mL, e.g., at least, at most, or between any two of 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, or 1.00 mg / mL of plasmid DNA. In one embodiment, the nucleic acid is genomic DNA and the composition has a concentration of between 0.05 mg / mL and 2 g / mL, e.g., at least, at most, or at most 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.9 It may contain between any two of 0, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, 1.80, 1.85, 1.90, 1.95, or 2.00 mg or g / mL of genomic DNA.In one embodiment, the nucleic acid is mRNA and the composition has a concentration of between 0.001 mg / mL and 0.5 mg / mL, e.g., at least, at most, or at most 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 10.20, 10.21, 10.22, 10.23, 10.24, 10.25, 10.26, 10.27, 10.28, 10.29, 10.30, 10.31, 10.32, 10.33, 10.34, 10.35, 10.36, 10.37, 10.38, 10.39, 10.40, 10.41, 10.42, 10.43, 10.44, 10.45, 10.46, 10.47, 10.48, 10.49, 10.50, 10.51, 10.52, 10.53, 10.54, 10.55, 10.56, 10.57, 10.58, 10.59, 10.6 The mRNA may be present at any two of the following concentrations: 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.50 mg / mL.

[0114] The nucleic acid can be naked, e.g., not associated with proteins, lipids, or any other protective molecules. Alternatively, the nucleic acid can be associated with one or more lipids, proteins, carbohydrates, and / or other organic molecules. Additionally or alternatively, the nucleic acid can be associated with one or more transfection reagents (e.g., Lipofectamine® (a mixture of DOSPA (2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propaniminium trifluoroacetate) and DOPE (1,2-dioleoyl-sn-glycerophosphoethanolamine)), calcium phosphate, polyethyleneimine).

[0115] In certain embodiments, the compositions disclosed herein can include lipids and heterologous nucleic acids (e.g., DNA, mRNA, RNAi, crRNA, enhancer RNA, long non-coding RNA, microRNA, sRNA, and / or shRNA), which together form nanoparticles, thereby producing lipid-containing heterologous nucleic acid-containing nanoparticles. The lipids can encapsulate or associate with the heterologous nucleic acids in the form of lipid nanoparticles (LNPs) to aid in the stability, cellular entry, and intracellular release of the heterologous nucleic acid / lipid nanoparticles. LNPs can include, for example, micelles, solid lipid nanoparticles, nanoemulsions, liposomes, etc., or combinations thereof. The lipid components of the LNPs can include, for example, cationic lipids, phospholipids (such as unsaturated lipids, e.g., DOPE or DSPC), polymer-lipid conjugates (e.g., PEGylated lipids), structured lipids (e.g., cholesterol), ionizable lipids, neutral lipids, or any combination thereof. The components of the lipid components can be provided in specific fractions. Suitable cationic lipids, phospholipids, polymer-lipid conjugates, structural lipids, ionizable lipids and neutral lipids, and the specific fractions that provide these lipids for the compositions and methods of the present disclosure are known in the art.In addition to these lipid components, lipid nanoparticles can contain any substance that is useful in pharmaceutical compositions.For example, lipid nanoparticles can contain one or more pharmaceutically acceptable excipients or auxiliary components, such as but not limited to one or more solvents, dispersion mediums, diluents, dispersing aids, suspending aids, surfactants, buffers, preservatives and other species.

[0116] The chemical properties of the LNPs, LNP suspensions, lyophilized LNP compositions, or LNP formulations of the present disclosure can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the LNPs. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can be used to measure several properties of LNPs, such as particle size, polydispersity index, and zeta potential.

[0117] In some embodiments, between 0.001 and 10 ng, μg, or mg of agent (e.g., therapeutic agent) (e.g., polypeptide, small molecule, nucleic acid) per mL, e.g., 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0. ...8, 0.09, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, The formulation contains ng, μg, or mg of agent (e.g., therapeutic agent) at a minimum, maximum, or between any two of the following: 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10. In some embodiments, the composition contains about 1×10 6 ~Approx. 1×10 13 viral particles / mL or approximately 1 x 10 3 ~Approx. 1×10 13The amount of a drug (e.g., a therapeutic agent) may include bacterial colony-forming units / mL. When the formulation is in a non-liquid form (e.g., a substantially solid film), the measurement of the drug (e.g., a therapeutic agent) may be conveniently referred to as ng, μg, or mg per mL, or viral particles per mL, or colony-forming units per mL of the liquid before conversion to a non-liquid form. As discussed herein, when the amount of a drug (e.g., a therapeutic agent) is referred to in units of ng, μg, or mg / mL, or viral particles / mL or colony-forming units / mL in a non-liquid composition, this is what is intended. Without being bound by theory, it is believed that the disclosed formulations increase the ability to store higher concentrations of a drug (e.g., a therapeutic agent) while avoiding aggregation, thus allowing for storage and use at higher concentrations.

[0118] The compositions of the present disclosure may contain one, two, three, four, or more different components disclosed herein. For example, the compositions of the present disclosure may contain a drug (e.g., a therapeutic agent) (e.g., a nucleic acid) and an additional component (such as one or more lipids, peptides, or small molecules). The compositions of the present disclosure may contain two or more components (e.g., nucleic acids and lipids, nucleic acids and peptides, nucleic acids and small molecules, etc.) where all components in the composition retain biological activity (e.g., immunogenicity, biological activity, etc.) when stored at ambient temperature (e.g., between 15°C and 30°C) for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 days or more, or any range or value derivable therein.

[0119] In some embodiments, the composition of the present disclosure is an amorphous solid, such as a substantially solid film.In some embodiments, the amorphous solid suitable for use in the present disclosure can dissolve when contacted with aqueous liquid.In some embodiments, the amorphous solid suitable for use in the present disclosure is prepared as a liquid solution at a concentration that allows the sugar and / or derivative to flow freely when poured, but can be formed from any sugar, sugar derivative, or sugar / derivative combination, as long as it also forms an amorphous phase at ambient temperature on a physical surface that facilitates this process, such as aluminum or polytetrafluoroethylene. Examples of suitable sugars include, but are not limited to, glucose, dextrose, fructose, lactose, maltose, xylose, sucrose, corn sugar syrup, sorbitol, hexitol, maltitol, xylitol, mannitol, melezitose, raffinose, cyclodextrins (e.g., alpha-cyclodextrin, beta-cyclodextrin, gamma-cyclodextrin, hydroxypropyl-beta-cyclodextrin, or methoxy-beta-cyclodextrin), and combinations thereof. In some embodiments, the compositions of the present disclosure comprise trehalose. In some embodiments, the compositions of the present disclosure comprise sorbitol. In some embodiments, the compositions of the present disclosure comprise trehalose and sorbitol. In some embodiments, the compositions of the present disclosure comprise sucrose. In some embodiments, the compositions of the present disclosure comprise a cyclodextrin. In some embodiments, the compositions of the present disclosure comprise a sugar that is not sorbitol, trehalose, and / or sucrose. Any one or more of the foregoing sugars may, in some embodiments, be explicitly excluded from the compositions of the present disclosure. In certain embodiments, it may be desirable for the properties of the sugar and / or derivative to allow for its preparation as a liquid solution at a concentration that allows it to flow freely when poured, but also form an amorphous phase at ambient temperature on physical surfaces such as aluminum or polytetrafluoroethylene that facilitate this process.Without being bound by any particular theory, it is believed that the sugar minimizes the interaction of the drug (e.g., therapeutic) molecule (e.g., polypeptide, nucleic acid, antigen, antibody, small molecule) with water during storage and drying, and prevents damage to the three-dimensional shape and subsequent loss of potency due to crystal formation during the drying process.

[0120] In some embodiments, amorphous solids suitable for use in the present disclosure have a particle size of about 0.05 millimeters to about 5 millimeters, e.g., 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05 , 4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or 5.0 mm, or may have a thickness that is a minimum of, a maximum of, or equal to, or between any two of these.

[0121] In some embodiments, the amorphous solid may contain an amount of water after drying. For example, the amorphous solid of the present disclosure may have a water content after drying that is at least about, at most about, equal to, or between about 1% and 30%, e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30%. In some embodiments, the amorphous solids of the present disclosure may contain plasmid or genomic DNA and may have a moisture content of at least, at most, equal to, or between any two of about 10-20%, e.g., 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, after drying. In some embodiments, the amorphous solids of the present disclosure may contain plasmid or genomic DNA and may have a moisture content of at least, at most, equal to, or between any two of about 14-17%. In some embodiments, the amorphous solids of the present disclosure may contain mRNA LNPs and may have a moisture content of at least, at most, equal to, or between any two of about 20-30%, e.g., 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30%, after drying. In some embodiments, the amorphous solids of the present disclosure may include mRNA LNPs and may have a moisture content of about 22-25% after drying.

[0122] Additionally, in some embodiments, certain sugars can also function as binders, which can provide "substance" to pharmaceutical preparations containing small amounts of highly potent drugs for ease of handling / administration. They can also hold components together or promote bonding to surfaces (such as film backings) to facilitate drug delivery and handling. Finally, they can also contribute to the overall pharmaceutical aesthetics of the preparation by forming a uniform glass upon drying.

[0123] The compositions of the present disclosure may also contain water-soluble polymers, including, but not limited to, carboxymethylcellulose, carboxyvinyl polymers, high amylose starch, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose (HPMC), methyl methacrylate copolymers, polyacrylic acid, polyvinyl alcohol, polyvinylpyrrolidone, gelatin, pullulan, sodium alginate, poly(lactic-co-glycolic acid), poly(ethylene) oxide, poly(hydroxyalkanoates), polyethylene glycol, and combinations thereof. Any one or more of the foregoing water-soluble polymers may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0124] In some embodiments, the water-soluble polymer is selected to provide specific properties to the composition. In some embodiments, the water-soluble polymer is selected to provide specific properties to the composition, for example, after reconstitution in a solution. In some embodiments, the water-soluble polymer is HPMC. The grades of HPMC included in the present disclosure include, but are not limited to, higher viscosity grades such as K4M, E10M, and / or J75MS HPMC, and lower viscosity grades such as K100LV, A4M, A15LV, E4M, F4M, E6LV (also known as "E6 Premium LV"), and / or F50 HPMC.

[0125] It is contemplated that HPMC of various molecular weights can be used in the formulations and methods described herein. Varying the molecular weight of HPMC in a composition results in formulations with different viscosities. In some embodiments, the HPMC has a molecular weight that, at a 2% concentration in water, results in a viscosity of about 12 cp to about 4000 cp (including any range or value derivable therein). In some embodiments, the HPMC has a MW that, at a 2% concentration in water, results in a viscosity of less than 4000 cp, less than 3000 cp, less than 2000 cp, less than 1800 cp, or less than 400 cp. In some embodiments, the HPMC has a MW that, at a 2% concentration in water, results in a viscosity of about 12 cp to about 3000 cp or about 12 cp to about 1800 cp. In some embodiments, the HPMC has a MW that, at a 2% concentration in water, results in a viscosity of about 12 cp to about 400 cp, about 12 cp to about 100 cp, or about 100 cp to about 400 cp. In some embodiments, a formulation, solution, or composition of the disclosure has at least, at most, about, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 , 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340 0, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720 , 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080,1090、1100、1110、1120、1130、1140、1150、1160、1170、1180、1190、1200、1210、1220、1230、1240、1250、1260、1270、1280、1290、1300、1310、1320、1330、1340、1350、1360、1370、1380、1390、1400、1410、1420、1430、1440、1450、1460、1470、1480、1490、1500、1510、1520、1530、1540、1550、1560、1570、1580、1590、1600、1610、1620、1630、1640、1650、1660、1670、1680、1690、1700、1710、1720、1730、1740、1750、1760、1770、1780、1790、1800、1810、1820、1830、1840、1850、1860、1870、1880、1890、1900、1910、1920、1930、1940、1950、1960、1970、1980、1990、2000、2010、2020、2030、2040、2050、2060、2070、2080、2090、2100、2110、2120、2130、2140、2150、2160、2170、2180、2190、2200、2210、2220、2230、2240、2250、2260、2270、2280、2290、2300、2310、2320、2330、2340、2350、2360、2370、2380、2390、2400、2410、2420、2430、2440、2450、2460、2470、2480、2490、2500、2510、2520、2530、2540、2550、2560、2570、2580、2590、2600、2610、2620、2630、2640、2650、2660、2670、2680、2690、2700、2710、2720、2730、2740、2750、2760、2770、2780、2790、2800、2810、2820、2830、2840、2850、2860、2870、2880、2890、2900、2910、2920、2930、2940、2950、2960、2970、2980、2990、3000、3010、3020、3030、3040、3050、3060、3070、3080、3090、3100、3110、3120、3130、3140、3150、3160、3170、3180、3190、3200、3210、3220、3230、3240、3250、3260、3270、3280、3290、3300、3310、3320、3330、3340、3350、3360、3370、3380、3390、3400、3410、3420、3430、3440、3450、3460、3470、3480、3490、3500、3510、3520、3530、3540、3550、3560、3570、3580、3590、3600、3610、3620、3630、3640、3650、3660、3670、3680、3690、3700、3710、3720、3730、3740、3750、3760、3770、3780、3790、3800、3810、3820、3830、3840、3850、3860、3870、3880、3890、3900、3910、3920、3930、3940、3950、3960、3970、3980、3990、4000、4010、4020、4030、4040、4050、4060、4070、4080、4090、4100、4110、4120、4130、4140、4150、4160、4170、4180、4190、4200、4210、4220、4230、4240、4250、4260、4270、4280、4290、4300、4310、4320、4330、4340、4350、4360、4370、4380、4390、4400、4410、4420、4430、4440、4450、4460、4470、4480、4490、4500、4510、4520、4530、4540、4550、4560、4570、4580、4590、4600、4610、4620、4630、4640、4650、4660、4670、4680、4690、4700、4710、4720、4730、4740、4750、4760、4770、4780、4790、4800、4810、4820、4830、4840、4850、4860、4870、4880、4890、4900、4910、4920、4930、4940、4950、4960、4970、4980、4990、or HPMC having a molecular weight that produces a viscosity of 5000 cp (including any range or value derivable therein).

[0126] Examples of HPMC of various molecular weights are known and available in the art and include, but are not limited to, A4C, A4M, A15C, A15LV, E4M, E6LV, F4M, K4M, or K100LV. A single molecular weight HPMC may be used, or the use of combinations of HPMC of various molecular weights (e.g., as disclosed herein) is also contemplated. The compositions of the present disclosure may comprise at least, at most, about, or exactly 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5% HPMC (including any range or value derivable therein). In some embodiments, the compositions of the present disclosure comprise 1.0%, 1.5%, 2.0% HPMC, or any range or value derivable therein. In some embodiments, the compositions of the present disclosure comprise about or exactly 1.5% HPMC. In some embodiments, the compositions of the present disclosure comprise about or exactly 1% HPMC.

[0127] Other water-soluble polymers may be substituted for part or all of the HPMC. Examples of suitable water-soluble polymers include, but are not limited to, carboxymethylcellulose, carboxyvinyl polymers, high amylase starch, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, methyl methacrylate copolymer, polyacrylic acid, polyvinyl alcohol, polyvinylpyrrolidone, gelatin, pullulan, sodium alginate, poly(lactic-co-glycolic acid), poly(ethylene) oxide, poly(hydroxyalkanoates), polyethylene glycol, and combinations thereof. In some embodiments, the polymer is gelatin. In some embodiments, the polymer is polyvinyl alcohol. In some embodiments, the polymer is polyvinylpyrrolidone. In some embodiments, the polymer is pullulan. In some embodiments, the polymer is PEG. Any one or more of the aforementioned water-soluble polymers may be explicitly excluded from the compositions of the present disclosure in some embodiments.

[0128] Additionally, in some embodiments, the compositions of the present disclosure may further contain one or more oils, polyalcohols, plasticizers, surfactants, permeability enhancers, and / or edible organic acids. Any one or more of the foregoing components may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0129] Examples of suitable oils may include, but are not limited to, eucalyptol, menthol, vacrol, thymol, methyl salicylate, verbenone, eugenol, gerianol, and combinations thereof. Any one or more of the foregoing oils may, in some embodiments, be expressly excluded from the compositions of the present disclosure. Examples of suitable polyalcohols may include, but are not limited to, glycerol, polyethylene glycol, propylene glycol, and combinations thereof. In some embodiments, the compositions of the present disclosure include glycerol. In some embodiments, the compositions of the present disclosure include a polyalcohol that is not glycerol. Any one or more of the foregoing polyalcohols may, in some embodiments, be expressly excluded from the compositions of the present disclosure. Examples of suitable edible organic acids may include, but are not limited to, citric acid, malic acid, tartaric acid, fumaric acid, phosphoric acid, oxalic acid, ascorbic acid, and combinations thereof. Any one or more of the foregoing edible organic acids may, in some embodiments, be expressly excluded from the compositions of the present disclosure. Examples of suitable surfactants may include, but are not limited to, difunctional block copolymer surfactants terminating in primary hydroxyl groups, such as Poloxamer 188 (i.e., Pluronic® F-68) or Poloxamer 407 (i.e., Pluronic® F-127), commercially available from BASF, poly(ethylene) glycol 3000, dodecyl-β-D-maltopyranoside, PEG-4 cocamide MIPA-sulfosuccinate disodium (DMPS), etc. Any one or more of the foregoing surfactants may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0130] In some embodiments, the compositions of the present disclosure may contain zwitterionic molecules or compounds, such as zwitterionic surfactants, amino acids or amino acid derivatives, or ethylenediaminetetraacetic acid (EDTA). In some embodiments, zwitterionic molecules are molecules containing positively and negatively charged groups. In some embodiments, both positively and negatively charged groups are present at physiological pH, such that the molecule has a net neutral charge. In some embodiments, the positively charged groups include protonated or quaternary ammonium groups. In some embodiments, the negatively charged groups include sulfate, phosphate, or carboxylate. The zwitterionic molecule can further include one or more lipid groups consisting essentially of alkyl, cycloalkyl, or alkenyl groups. Preferably, the zwitterionic molecule includes one or more lipid groups consisting essentially of alkyl, cycloalkyl, or alkenyl groups with a carbon chain of more than 12 carbon atoms. In some embodiments, the lipid groups have a carbon chain of 12 to 30 carbon atoms. In some embodiments, the lipid group has a carbon chain of 12 to 24 carbon atoms. In some embodiments, the lipid group has 12 to 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 carbon atoms, or any range derivable therein. In some embodiments, the zwitterionic molecule is a polymeric structure containing multiple zwitterionic groups and multiple lipid groups on a central backbone. In some embodiments, the zwitterionic molecule is a polymer having about 50 to about 200 repeating units, each repeating unit containing one positively charged group, one negatively charged group, and one lipid group. In some embodiments, the zwitterionic molecule is a polymer having 75 to 150 repeating units. In some embodiments, the central backbone is an alkyl, polyethylene glycol, or polypropylene chain. In some embodiments, the central chain is an alkyl group.

[0131] Non-limiting examples of zwitterionic surfactants include 3-(N,N-dimethyltetradecylammonio)propanesulfonate (SB3-14), 3-(4-heptyl)phenyl-3-hydroxypropyl)dimethylammoniopropanesulfonate (CBzO), 3-(decyldimethylammonio)propanesulfonate inner salt (SB3-10), 3-(dodecyldimethylammonio)propanesulfonate inner salt (SB3-12), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-18), 3-(N,N-dimethyl-octadecylammonio)propanesulfonate (SB3-19), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-20), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-21), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-22), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-23), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-24), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-25), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-26), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-27), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-28), 3-(N,N-dimethyloctadecylammonio)propanesulfonate (SB3-29), 3-(N,N-dimethyloctadecylammonio)propanesulfonate Ctylammonio)propanesulfonate inner salt (SB3-8), 3-(N,N-dimethylpalmitylammonio)propanesulfonate (SB3-16), 3-[N,N-dimethyl(3-myristoylaminopropyl)ammonio]propanesulfonate (ASB-14), CHAPS, CHAPSO, acetylated lecithin, alkyl (C12-30) dialkylamine-N-oxide, apricotamidopropyl betaine, babassuamidopropyl betaine, behenyl betaine, bis-2-hydroxyethyl tallow glycinate, C12-14 alkyl di Methyl Betaine, Canolamidopropyl Betaine, Capric / Caprylic Amidopropyl Betaine, Capryloamidopropyl Betaine, Cetyl Betaine, 3-[(Cocamidoethyl)dimethylammonio]-2-hydroxypropanesulfonate, 3-[(Cocamidoethyl)dimethyl-ammonio]propanesulfonate, Cocamidopropyl Betaine, Cocamidopropyl Dimethylamino-Hydroxypropyl Hydrolyzed Collagen, N-[3-Cocamido)propyl]-N,N-Dimethyl Betaine, Potassium Salt, Cocamidopropyl Hydroxysultaine , Cocamidopropyl Sulfobetaine, Cocaminobutyric Acid, Cocaminopropionic Acid, Cocoamphodipropionic Acid, Cocobetaine, Cocodimethylammonium-3-sulfopropyl Betaine, Cocoiminodiglycinate, Cocoiminodipropionate, Coco / Oleamidopropyl Betaine, Cocoyl Sarcosinamide DEA, DEA-Cocoamphodipropionate, Dihydroxyethyl Tallow Glycinate, Dimethicone Propyl PG-Betaine, N,N-Dimethyl-N-Lauryl-Amidopropyl-N-(3-Sulfopropyl)-Ammonium Betaine,N,N-Dimethyl-N-myristyl-N-(3-sulfopropyl)-ammonium betaine, N,N-Dimethyl-N-palmityl-N-(3-sulfopropyl)-ammonium betaine, N,N-Dimethyl-N-stearamidopropyl-N-(3-sulfopropyl)-ammonium betaine, N,N-Dimethyl-N-stearyl-N-(3-sulfopropyl)-ammonium betaine, N,N-Dimethyl-N-tallow-N-(3-sulfopropyl)-ammonium betaine, Disodium Caproamphodiacetate, Disodium Caproamphodipropionate Disodium Capryloamphodiacetate, Disodium Capryloamphodipropionate, Disodium Cocoamphodiacetate, Disodium Cocoamphodipropionate, Disodium Isostearoamphodipropionate, Disodium Laureth-5 Carboxyamphodiacetate, Disodium Lauriminodipropionate, Disodium Lauroamphodiacetate, Disodium Lauroamphodipropionate, Disodium Octyl β-Iminodipropionate, Disodium Oleoamphodiacetate, Disodium Oleoamphodipropionate, PPG-2-Isodeceth- Disodium 7-carboxyamphodiacetate, Disodium Soyamphodiacetate, Disodium Stearoamphodiacetate, Disodium Tallowamphodipropionate, Disodium Tallowamphodiacetate, Disodium Tallowiminodipropionate, Disodium Wheat Germamphodiacetate, N,N-Distearyl-N-methyl-N-(3-sulfopropyl)ammonium Betaine, Erucamidopropyl Hydroxysultaine, Ethylhexyl Dipropionate, Ethyl Hydroxymethyl Oleyl Oxazoline, Ethyl PEG-15 Cocamine Sulfonate, Hydrogenated Resin Ingredients: cinnamal, hydrolyzed protein, isostearamidopropyl betaine, 3-[(lauramidoethyl)dimethylammonio]-2-hydroxypropanesulfonate, 3-[(lauramidoethyl)dimethylammonio]propanesulfonate, lauramidopropyl betaine, lauramidopropyl dimethyl betaine, lauramidopropyl dimethyl betaine, lauraminopropionic acid, lauroamphodipropionic acid, lauroyl lysine, lauryl betaine, lauryl hydroxysultaine, lauryl sultaine, linoleamidopropyl betaine, lysolecithin, milk lipid amidopropyl betaine,Myristamidopropyl Betaine, Octyliminodipropionate, Octyl Dipropionate, n-Octyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, n-Decyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, n-Dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, n-Tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, n-Hexadecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, n-Octadecyl-N,N-dimethyl -3-Ammonio-1-propane-sulfonate, oleamidopropyl betaine, oleyl betaine, 4,4(5H)-oxazole dimethanol, 2-(heptadecenyl) betaine, palmitamidopropyl betaine, palmitamine oxide, PMAL-C6 substituted with 3-(dimethylamino)propylamine, PMAL-C12 substituted with 3-(dimethylamino)propylamine, PMAL-C16 substituted with 3-(dimethylamino)propylamine, ricinoleamidopropyl betaine, ricinoleamidopropyl betaine / IPDI copolymer -, Sesamidopropyl Betaine, Sodium C12-15 Alkoxypropyliminodipropionate, Sodium Caproamphoacetate, Sodium Capryloamphoacetate, Sodium Capryloamphohydroxypropylsulfonate, Sodium Capryloamphopropionate, Sodium Carboxymethyl Tallow Polypropylamine, Sodium Cocaminopropionate, Sodium Cocoamphoacetate, Sodium Cocoamphohydroxypropylsulfonate, Sodium Cocoamphopropionate, Sodium Dicarboxyethyl Cocophosphoethylimidazoline, Hydrogen Sodium tallow dimethylglycinate, sodium isostearoamphopropionate, sodium lauriminodipropionate, sodium lauroamphoacetate, sodium oleoamphohydroxypropylsulfonate, sodium oleoamphopropionate, sodium stearoamphoacetate, sodium taloamphopropionate, soyamidopropyl betaine, stearyl betaine, 3-[(stearamidoethyl)dimethylammonio]-2-hydroxypropanesulfonate, 3-[(stearamidoethyl)dimethylammonio]propanesulfonate,Examples of zwitterionic surfactants include tallowamidopropyl hydroxysultaine, tallowamphopoly-carboxypropionic acid, lauroamphoPG-acetic acid phosphate trisodium chloride, undecylenamidopropyl betaine, and wheat germamidopropyl betaine. In some embodiments, the zwitterionic surfactant is PMAL-C16 substituted with 3-(dimethylamino)propylamine. The terms "PMAL," "PMAL C-16," and "PMAL-C16 substituted with 3-(dimethylamino)propylamine" are used interchangeably herein. Any one or more of the foregoing zwitterionic surfactants may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0132] In some embodiments, the zwitterionic molecule or compound can be an amino acid and / or amino acid derivative, such as any natural or artificial / synthetic amino acid and / or amino acid derivative, including, but not limited to, alanine, arginine, asparagine, aspartic acid, glutamic acid, cysteine, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, selenocysteine, serine, threonine, tryptophan, tyrosine, valine, citrulline, ornithine, theanine, betaine, carnitine, taurine, tyramine, and / or gamma-aminobutyric acid, and / or any derivative thereof. In certain embodiments, the amino acid is arginine. In some embodiments, the zwitterionic molecule or compound can be ethylenediaminetetraacetic acid (EDTA). Any one or more of the foregoing zwitterionic molecules or compounds can, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0133] In some embodiments, the compositions of the present disclosure may contain a plasticizer, such as any natural or artificial / synthetic plasticizer and / or plasticizer derivative, including, but not limited to, a monosaccharide (glucose), a disaccharide (sucrose), an oligosaccharide (e.g., pullulan), a polyol (e.g., sorbitol, glycerol, mannitol, glycerol derivatives, polyethylene glycol), a lipid, or a combination thereof. In certain embodiments, the plasticizer is glycerol. Any one or more of the foregoing plasticizers may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0134] In some embodiments, the compositions of the present disclosure comprise PEGylated lipids, including, but not limited to: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, glycol lipids, including: PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamoyl]-1,2-dimyristyloxylpropyl-3-amine (PEG-c-DMA) and PEG-2000-DMG, PEGylated diacylglycerols (PEG-DAG), such as: 1-(monomethoxy-polyethylene glycol) PEGylated lipids may contain PEG-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEG-S-DAG), such as: 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, such as: co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. Any one or more of the foregoing PEGylated lipids may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0135] In some embodiments, the compositions of the present disclosure may contain a neutral lipid. In some embodiments, the neutral lipid may be PEGylated. The neutral lipid may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyl-oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (D ... Neutral lipids include, but are not limited to, 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and / or 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE). In certain embodiments, the PEGylated lipid of the composition of the present disclosure is DMPE-PEG. In some embodiments, any one or more of the above neutral lipids may be explicitly excluded from the composition of the present disclosure.

[0136] Additionally, in some embodiments, the compositions of the present disclosure may further contain one or more adjuvants, or substances formulated as part of the composition to boost the immune response and enhance the effectiveness of the composition. Exemplary adjuvants that may be included in the compositions of the present disclosure include, but are not limited to, amorphous aluminum hydroxyphosphate sulfate (AAHS), aluminum hydroxide, aluminum phosphate, aluminum potassium sulfate (Alum), monophosphoryl lipid A (MPL), and Quillaja saponaria. Molina: Fraction 21 (QS-21) (AS01, AS02), monophosphoryl lipid A (MPL) and aluminum salt (AS04), squalene / dl-α-tocopherol / polysorbate 80 (AS03), MPL / CpG / QS-21 (AS15), ADDAS03™, ADDAVAX™, cytosine phosphoguanine (CpG), ISCOM, ISCOMATRIX, MATRIX-M™, MF59, bacterial enterotoxins (e.g., dmLT, LTB, CT, mmCT), bacterial flagellins (e.g., FliC, FljB, FliCd), bacterial enterocyte targeting proteins (e.g., mInIA, FnB) PA), bacterial-derived proteins (e.g., MT, PorA, c-di-AMP, RCK), protozoan-derived proteins (VSPs), intestinal immune cell targeting peptides (Co1, CKS9, Gb-1), small molecule immunomodulatory proteins (e.g., cytokines [e.g., RANKL, IL-1β, IL-2, IL-12, cGM-CSF, thymosin alpha-1 [Tα1]), the Fc region of immunoglobulin (Ig) G, biodegradable polymers (e.g., poly(d,l-lactide-co-glycolide) [PLG], poly(d,l-lactic-co-glycolic acid) [PLGA], chitosan and its derivatives, alpha-galactosylceramide [α-GalCer], Ulex europaeus agglutinin-1 [UEA-1]), several synthetic Toll-like receptor agonists and their derivatives (e.g., GS-986), etc., or any combination thereof. Any one or more of the foregoing adjuvants may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0137] Agents (e.g., therapeutic agents) and / or components of compositions other than components thereof (e.g., polypeptides, small molecules, nucleic acids) described herein are exemplified, for example, in PCT International Publication No. WO 2012 / 018628 and U.S. Patent Application Publication No. 2019 / 0298836, which are incorporated herein by reference.

[0138] In some embodiments of the present disclosure, the pH of the composition is adjusted so that the final pH of the composition is about pH 6.0 to 9 (including any range or value derivable therein). Adjustment to the desired pH can be achieved using an appropriate buffer, such as phosphate-buffered saline (PBS) and tris (tris(hydroxymethyl)aminomethane) buffer. In some embodiments, a buffer or combination thereof is added to achieve a final pH of about 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0 (including any range or value derivable therein). In some embodiments, compositions of the present disclosure have a pH of at least, at most, or about 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, or 8.5. In some embodiments, the pH of compositions of the present disclosure is at least 7.0. In some embodiments, the pH is between 7.5 and 8.5. In certain embodiments, the pH is about or exactly 8.0. In some embodiments, the pH is between 8.0 and 9.0. In certain embodiments, the pH is about or exactly 8.5.

[0139] As described herein, the disclosed formulations, both in liquid and solid form, facilitate significant preservation of the drug (e.g., therapeutic agent) contained therein, thereby stabilizing the therapeutic agent for an extended period of time. This allows the drug (e.g., therapeutic agent) composition to retain significantly greater activity than when stored in other forms. For example, when stored at room temperature, stability is expected for at least 3 years. These formulations or formulation forms (e.g., liquid or solid forms) facilitate significant preservation of the agent (e.g., therapeutic agent) when stored for a minimum of, a maximum of, or equal to, or between any two of 1 day, 7 days, 14 days, 30 days, 60 days, 90 days, 120 days, 150 days, 180 days, 210 days, 240 days, 270 days, 300 days, 330 days, or 360 days; for a minimum of 1 year, a maximum of 1 year, or equal to or about 1 year; or for a minimum of, a maximum of, or equal to, or between any two of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, or 36 months. Storage at temperatures at or above 0°C is contemplated (e.g., at least about, or exactly 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40°C, including any range or value derivable therein).

[0140] A significant amount of preservation is considered to be one that results in a quantity of agent (e.g., therapeutic agent) that is usable for its intended purpose (e.g., gene therapy to deliver nucleic acids, or diagnostic purposes). In light of ease of storage and transport, even compositions described herein that result in preservation of 50% or less (e.g., about 45%, about 40%, about 35%, about 30%, about 25%, etc.) of agent activity are considered to be of considerable value.

[0141] The amount of preserved agent (e.g., therapeutic agent) can be determined by comparing the amount of active agent in the preserved form to the original amount of active agent. Activity can be measured by various methods known in the art, such as transduction efficiency, transfection efficiency, infectivity, vector genome copy number, and / or percent recovery of agent (e.g., therapeutic agent) after storage. In some embodiments, the activity of the agent (e.g., therapeutic agent) is preserved by at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the transduction efficiency, transfection efficiency, infectivity, vector genome copy number, and / or percent recovery of the agent (e.g., therapeutic agent) after storage is preserved at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more after exposure to conditions of up to 95% relative humidity and temperatures of up to 40° C. In some embodiments, the agent (e.g., therapeutic agent) is preserved at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more for 150 days or more.

[0142] One way to determine preservation is by comparing the activity of the agent (e.g., as measured by transduction efficiency, transfection efficiency, infectivity, vector genome copy number, percent recovery of agent (e.g., therapeutic agent), etc. after storage) before storage (e.g., before or immediately after addition to the remainder of the composition components, or immediately after film formation) with the activity after storage.

[0143] Various conditions may be encountered during storage, such as storage at about 4°C, storage at about 0°C, storage at about 25°C, combinations of different temperatures, exposure to extreme temperatures, freeze-thawing, or combinations thereof. In some embodiments, storage is at ambient temperature. In some embodiments, various temperatures ranging from 4°C to 40°C or higher are encountered during storage. Such variations may be encountered during transportation and / or storage in areas lacking refrigeration. In some embodiments, the stored formulation is subjected to ambient temperatures (e.g., 20°C + / - 10°C, + / - 5°C, + / - 4°C, + / - 3°C, + / - 2°C, + / - 1°C) and ambient pressures (e.g., approximately 1 atm, + / - 0.5 atm). The formulations and methods described herein are expected to provide significant preservation of medications (e.g., therapeutic agents) under a variety of conditions, including different relative humidities (e.g., 5% RH to 99% RH, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% RH, about 95% RH, etc.) and different pressures.

[0144] II. Methods of Preparation and Use In some embodiments, compositions containing amorphous solids can be made by preparing a solution containing a sugar, sugar derivative, or sugar / derivative combination in a buffer solution, and optionally other additives as described above. In some embodiments, the sugar, sugar derivative, or sugar / derivative combination can be present in the solution in an amount of up to about 50%, about 60%, about 70%, or up to about 80% by weight of the solution. In some embodiments, the additive may be present in an amount of about 5% or less, about 4% or less, about 3% or less, about 2% or less, or 1% or less by weight of the solution. Generally, solutions containing sugars, sugar derivatives, or sugar / derivative combinations are made at a concentration higher than the desired final concentration to compensate for dilution that may occur when a drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, small molecule) or other molecule is added. The desired drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, small molecule) or other molecule may be added to the solution at a concentration known to induce a desired immune response.

[0145] In some embodiments, compositions containing amorphous solids can be made by preparing a solution containing a plasticizer and / or surfactant and polymer in a buffer solution, and optionally other additives as described above. In some embodiments, the plasticizer and / or surfactant and polymer may be present in the solution in an amount of about 5% or less, about 4% or less, about 3% or less, about 2% or less, or 1% or less by weight of the solution. In some embodiments, the additive may be present in an amount of about 5% or less, about 4% or less, about 3% or less, about 2% or less, or 1% or less by weight of the solution. Generally, the solution containing the plasticizer and / or surfactant and polymer is made at a concentration higher than the desired final concentration to compensate for dilution that may occur when a drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, small molecule) or other molecule is added. The desired drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, small molecule) or other molecule may be added to the solution at a concentration known to induce a desired immune response.

[0146] In some embodiments, the solution has a pH of at least, at most, or about 5, 6, 7, 8, 9, or 10, or any range or value derivable therein. In some embodiments, the solution has a pH between 7 and 9 (including any range or value derivable therein). In some embodiments, the solution has a pH of about or exactly 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9, or any value derivable therein. In some embodiments, the solution has a pH of about 8. In some embodiments, the solution has a pH of 8. In some embodiments, the solution has a pH of about 8.5. In some embodiments, the solution has a pH of 8.5.

[0147] The mixture may then be stirred at ambient temperature until a substantially homogeneous mixture is obtained. In some embodiments, the mixture may then be sonicated briefly under cooled conditions, e.g., at about 4°C, to remove any air bubbles that may have formed. In other embodiments, the mixture may be slightly heated, e.g., to about 40°C or below, about 45°C or below, or about 50°C or below, slightly cooled, or in some instances, frozen. In some embodiments, compositions (e.g., nucleic acid-containing compositions) of the present disclosure may be produced without freeze-drying or spray-drying. The final formulation may then be cast onto a flat backing surface under controlled airflow, controlled laminar airflow, or the like, and allowed to form an amorphous solid at ambient temperature (e.g., about 15-25°C). Examples of suitable backing surfaces may include, but are not limited to, aluminum, polytetrafluoroethylene, silicate, polyetheretherketone, polyethylene, polypropylene, polyvinyl chloride, polyamide, polyacrylate, polyester, ethylcellulose, and silicone (including any combination thereof). In some embodiments, a glass plate can be used to cast the composition, which can be dried under controlled laminar air flow at room temperature or under refrigerated conditions. In some embodiments, a silicone backing surface can be used to cast the composition, which can be dried under controlled laminar air flow at room temperature or under refrigerated conditions. Once the process is complete, the composition can be peeled off the backing and administered immediately (e.g., by placing in the mouth or by injection) and / or stored at ambient temperature for up to about 1 day, up to about 7 days, up to about 14 days, up to about 1 month (about 30 days), up to about 2 months (about 60 days), up to about 3 months (about 90 days), up to about 4 months (about 120 days), up to about 5 months (about 150 days), up to about 6 months (about 180 days), up to about 1 year (about 50 weeks), up to about 2 years (about 100 weeks), or even up to about 3 years (about 150 weeks) from the time of manufacture.

[0148] In some embodiments, compositions of the present disclosure can be made by contacting an amorphous solid with a drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule), or by optionally mixing the drug with one or more excipients (surfactants, plasticizers, sugars, starches, etc.) and contacting the amorphous solid with the mixture to disperse the drug within the amorphous solid. In some embodiments, the mixture is then dried and then ready for administration. Compositions of the present disclosure can be used in a variety of ways (e.g., as a therapeutic delivery vehicle for gene therapy, etc., as a vaccine capable of eliciting an immune response from the immune system of a subject receiving the composition, for storing one or more biological components such as nucleic acids or peptides, etc.).

[0149] Compositions suitable for use according to the present disclosure can be prepared in a single layer or multiple layers. In some embodiments, the compositions of the present disclosure may further contain a protective layer disposed on the surface of the amorphous solid containing a drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule). Exemplary protective layers may include, but are not limited to, additional layer(s) of film such as polyethylene, polyurethane, polyetheretherketone, etc., and / or additional layer(s) of amorphous solid that does not contain any drug (e.g., a therapeutic agent). In some embodiments, the use of a protective film layer can minimize absorption of moisture from the atmosphere and prevent adhesion to other objects during storage and / or transport. Prior to administration, this layer may be removed (e.g., by peeling) from the amorphous solid containing the drug (e.g., a therapeutic agent) and discarded.

[0150] The amount of an agent (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) that can be used in the compositions of the present disclosure can vary widely depending on the type of agent (e.g., a nucleic acid, polypeptide, or small molecule) used, the formulation used to prepare the composition, the size, solubility of the amorphous solid, etc. One of ordinary skill in the art having the benefit of this disclosure will be able to determine the amount of an agent (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) that is appropriate to include in a composition of the present disclosure. In embodiments of the present disclosure, the composition can contain, for example, about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10 mg / mL of an agent (e.g., therapeutic agent). In some embodiments, the agent (e.g., therapeutic agent) is a nucleic acid, and the composition contains, for example, between 0.001 mg / mL and 1 mg / mL of the nucleic acid.

[0151] It is also important to note that any toxicity and / or adverse effects must also be considered when formulating compositions according to the present disclosure. Additionally, to create a stable composition, it may also be important to identify the ratio of components that interact with water and molecules (e.g., nucleic acids, polypeptides, or small molecules) in a way that prevents crystallization during drying.

[0152] Generally, compositions of the present disclosure can be formulated to dissolve in a period of about 5-60 seconds up to 2 hours. When administered, compositions of the present disclosure can be handled by a portion of the composition that does not contain a drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, or small molecule) and placed in the upper cheek cavity for buccal delivery or far under the tongue for sublingual delivery, or can be reconstituted and utilized, for example, as a solution for inhalation or a nasal spray.

[0153] Reconstitution of the disclosed compositions, such as thin film matrices, can be achieved by solubilizing them in, for example, buffered saline; PBS; salt solutions; formulations requiring specific sugar- or lipid-based excipients; conventional solutions used for IV reconstitution of medicinal agents; body fluids; or any other fluid matrix that allows the disclosed compositions to reconstitute the drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, or small molecule) stored in such a matrix. In some embodiments, the composition is dissolved in an appropriately buffered aqueous solution to produce a liquid reconstituted composition. Suitable buffered aqueous solutions can include, for example, buffered saline; PBS; salt solutions; formulations requiring specific sugar- or lipid-based excipients; conventional solutions used for IV reconstitution of medicinal agents; body fluids; polyethylene glycol (PEG) (e.g., PEG1500); poloxamer (e.g., Pluronic® F68 or F-127); or any other fluid matrix that allows the disclosed compositions to reconstitute the drug (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, or small molecule) stored in such a matrix. In certain embodiments, reconstitution of the disclosed compositions is achieved by solubilization in a solution containing buffered saline, which can be at a concentration of at least, at most, equal to, or between any two of 0.1% and 10%, e.g., 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In certain embodiments, reconstitution of the disclosed compositions is achieved by solubilization in a solution containing a poloxamer, such as the poloxamers disclosed herein.Poloxamers are used in solutions at concentrations between 0.00001% and 0.1%, e.g., 0.00001, 0.00002, 0.00003, 0.00004, 0.00005, 0.00006, 0.00007, 0.00008, 0.00009, 0.0001, 0.0002, 0.0003, 0.0004, 0.0005, 0.0006, 0.0007, 0.0008, 0.00009. The concentration can be at a minimum of, a maximum of, equal to, or any two of the following: 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1%. In certain embodiments, reconstitution of the compositions of the present disclosure is achieved by solubilization in a solution containing PEG, such as the PEGs disclosed herein. PEG can be at a minimum, maximum, equal to, or any two of the following concentrations in solution: 0.001-1.0%, e.g., 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1.0%.

[0154] In some embodiments, methods for producing compositions in a substantially solid carrier are provided. Such methods may involve obtaining or formulating a solution containing sufficient stabilizers (e.g., sugars and sugar derivatives, polymers) and permeability enhancers (e.g., surfactants, such as the zwitterionic surfactants of the present disclosure, and / or plasticizers) in a solvent system (e.g., distilled deionized water, ethanol, methanol). In some cases, the formulation is such that the total amount of solid components added to the solvent is within a concentration of 10% to 90% w / w. This suspension can be prepared by stirring, homogenizing, mixing, and / or blending these compounds with the solvent. In some cases, a small portion of each component (e.g., about 1 / 10 of the total amount) is added to the solvent, the solution is mixed, and then an additional portion of the same or new agent is added.

[0155] In some embodiments, once each stabilizer and permeability enhancer is added, the bulk solution is placed at 4°C for a period of between 2 and 24 hours. In some embodiments, the bulk solution is subjected to additional homogenization, such as sonication (e.g., for a period of about 5 to 60 minutes), to remove trapped air bubbles in the preparation. After sonication is complete, a drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) is added to the preparation. In some cases, the amount of drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) ranges from about 0.001% to 30% of the total solids concentration.

[0156] In some embodiments, the formulation is then slowly pipetted into a mold of a shape appropriate for the application. Molds can be constructed of a variety of materials, including, but not limited to, stainless steel, glass, silicone, polystyrene, polypropylene, and other pharmaceutical-grade plastics. In certain embodiments, the mold is constructed of silicone. In some embodiments, the formulation can be placed into the mold by slowly pouring it by hand or by pushing it through a narrow opening in a collection container at a slow, controlled rate (e.g., about 0.25 mL / min) to prevent premature hardening and / or air bubble formation in the final film product. In certain preferred embodiments, films can be poured to a thickness of about 12.5 μm to 5000 μm. In some embodiments, the mold for casting the film can be sterilized by autoclaving and placed in a laminar airflow hood prior to casting.

[0157] In a further embodiment, the mold may be lined with a peelable backing material suitable for protecting the film product. Suitable backings include, but are not limited to, aluminum, gelatin, polyester, polyethylene, polyvinyl and polylactic-co-glycolide polymers, wax paper, and / or any other pharmaceutically acceptable plastic polymer.

[0158] In some cases, the cast film is maintained at ambient temperature (e.g., about 15-25°C), such as in a laminar flow hood, for 2-24 hours, after which a thin, peelable film is formed. In some cases, this film may be opaque or translucent. In some cases, individual films are peeled from the casting / drying surface, wrapped in wax paper, and stored at room temperature (e.g., between 15°C and 30°C, between 18°C ​​and 28°C, between 24°C and 26°C, or about 25°C) in a sealable plastic bag under controlled humidity conditions. However, in certain embodiments, films can also be stored at lower temperatures, such as 4°C, under controlled humidity.

[0159] In some embodiments, a multilayer film can be created at this point by applying a second coating to the thin film as a solution containing the same agent (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, or small molecule) as the first layer or another different agent (e.g., therapeutic agent) (e.g., nucleic acid, polypeptide, or small molecule). Again, in some embodiments, this is held at ambient temperature (e.g., about 15-30°C, about 20-25°C, about 18-28°C, or about 25°C), such as in a laminar flow hood, for an additional 2-24 hours, after which a thin, peelable film is formed. Again, the film can be opaque or translucent.

[0160] In some embodiments, the film is dissolved in a solution before use. For example, water or warmed buffered saline (e.g., about 37°C, body temperature) may be used. In certain embodiments, the film is dissolved in a solution containing buffered saline. In certain embodiments, the film is dissolved in a solution containing a poloxamer, such as the poloxamers disclosed herein. In certain embodiments, the film is dissolved in a solution containing a PEG, such as the PEG disclosed herein. In some embodiments, the resulting solution can be screened for activity / particle count to determine the effectiveness of the formulation in maintaining the preparation's potency over time. Such dissolved films can be administered to a subject, for example, intravenously, intramuscularly, orally (e.g., bucally or sublingually), or intranasally.

[0161] Agents (e.g., therapeutic agents) contained within the disclosed formulations can be further diluted (e.g., in a pharmaceutically acceptable carrier) as needed prior to administration. Appropriate routes of administration can be determined by those skilled in the art.

[0162] As used herein, "pharmaceutically acceptable carriers" include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonicity agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, and similar materials and combinations thereof, as known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in therapeutic or pharmaceutical compositions is contemplated. Any one or more of the foregoing carrier components may, in some embodiments, be expressly excluded from the compositions of the present disclosure.

[0163] In some embodiments, the formulations described herein are used to deliver an effective amount of a drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) to a subject. Accordingly, another aspect of the present disclosure relates to a method of delivering a drug (e.g., a therapeutic agent) (e.g., a nucleic acid, polypeptide, or small molecule) to a subject, comprising administering to the subject an effective amount of a composition described herein. In some embodiments, the composition is administered directly. In some embodiments, the composition is minimally manipulated (e.g., rehydrated as a film and then administered). In some embodiments, the composition is further diluted (e.g., with a pharmaceutically acceptable carrier).

[0164] In some embodiments, such an effective amount is a therapeutically effective amount. As used herein, a "therapeutically effective" amount is an amount sufficient to provide some improvement or benefit to a subject. In other words, a "therapeutically effective" amount is an amount that provides some relief, alleviation, or reduction of at least one clinical symptom in a subject. Those skilled in the art will understand that the therapeutic effect does not need to be complete or curative, as long as some benefit is provided to the subject. In certain embodiments, a therapeutically effective amount is not curative.

[0165] The pharmaceutical compositions of the present disclosure can utilize different types of carriers depending on whether they are to be administered in solid, liquid, or aerosol form, and whether they need to be sterile for routes of administration such as injection. Pharmaceutical compositions can be administered intravenously, intradermally, intra-arterially, intra-graft, intraperitoneally, intralesionally, intracranially, intraspinal, intracisternally, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intravesically, mucosally, intracardially, intraumbilically, intraocularly, intranasally, orally, bucally, sublingually, locally, by inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, in a local perfusion bath directly to target cells (e.g., in autologous tissue grafts), via a catheter, via a lavage solution, in a cream, in a lipid composition (e.g., liposomes), or by any other method known to those skilled in the art or any combination of the foregoing (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990). Intracisternal, intraventricular, intraparenchymal, lumbar puncture, intrathecal, intraureteral, intrarenal, subretinal, subpial, intracoronary (intracardiac) administration, intrasalivary, intraaural (e.g., to treat hearing loss), intraganglionic, intraarticular, direct placental / intravenous injection, and limb perfusion are also contemplated. Any one or more of the foregoing routes of administration may, in some embodiments, be explicitly excluded for the compositions of the present disclosure.

[0166] III. General Pharmaceutical Compositions The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable carriers" include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in immunogenic and therapeutic compositions is contemplated. Supplementary active ingredients, such as other anti-infective agents and vaccines, can also be incorporated into the composition. Any one or more of the aforementioned ingredients may, in some embodiments, be explicitly excluded from the compositions of the present disclosure.

[0167] Active compound can be formulated for oral administration, for example, can be formulated for oral or sublingual administration, or can be formulated for intranasal administration.Active compound can be formulated for parenteral administration, for example, can be formulated for injection via intravenous, intramuscular, subcutaneous or intraperitoneal route.Typically, this composition can be prepared as either liquid solution or suspension; it can also be prepared as a solid form that is suitable for preparing solution or suspension by adding liquid before injection; it can also be emulsified.Also contemplated is the substantially solid film formulation as disclosed herein.

[0168] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations containing, for example, aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid enough to allow easy injection. It must also be stable under the conditions of manufacture and storage, and must be preserved to prevent the contaminating action of microorganisms such as bacteria and fungi.

[0169] The pharmaceutical compositions may contain solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by controlling the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0170] Injectable solution is prepared by incorporating the required amount of active compound into suitable solvent with various other components as listed above as necessary, and then sterilizing by filtration or equivalent procedures.Generally, dispersion is prepared by incorporating various sterilized active components into a sterile vehicle that contains basic dispersion medium and other necessary components from those listed above.For the sterile powder that is used to prepare sterile injectable solution, specific preparation method is vacuum drying and freeze-drying technology, thereby obtaining the powder of active component and any additional desired components from its solution that has been previously sterilized and filtered.

[0171] Administration of the disclosed compositions is typically via any common route, including, but not limited to, oral or intravenous administration. In some embodiments, the disclosed compositions are particularly useful for intravenous administration, for example, due to their low viscosity (e.g., less than 4000, 3000, 2000, 1000, 500, or 250 cp or less). Alternatively, administration can be via orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal, or intranasal administration. Such compositions are typically administered as pharmaceutically acceptable compositions containing physiologically acceptable carriers, buffers, or other excipients.

[0172] Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the types of injectable solutions described above. [Example]

[0173] IV. Working Examples The following examples are included to demonstrate certain aspects of the present disclosure. Those skilled in the art will understand that the techniques disclosed in the following examples represent techniques discovered by the inventors to function well in the practice of the present disclosure and can therefore be considered to constitute specific modes for its practice. However, those skilled in the art should, in light of the present disclosure, understand that many changes can be made in the specific aspects disclosed and still obtain like or similar results without departing from the spirit and scope of the present disclosure.

[0174] Example 1 - Evaluation of long-term plasmid DNA stability in previously optimized formulations Plasmid DNA was prepared in a film formulation previously optimized for use with recombinant adenovirus to assess changes in plasmid DNA (pDNA) transfection efficiency upon film drying. As shown in Figure 1, the same film matrix (MSI-TX-1) previously shown to increase recombinant adenovirus potency and support long-term storage of recombinant adenovirus at room temperature failed to preserve pDNA transfection efficiency. The MSI-TX-1 formulation contains 1.5% HPMC, 0.2% tragacanth gum, 2% sorbitol, 1% PMAL C16, and 10 mM Tris, pH 8.1.

[0175] To evaluate the effect of various MSI-TX-1 film formulation components on pDNA transfection efficiency after storage in the film, a model plasmid (AAVlacZ) was mixed with each film component in liquid form, and transfection efficiency was measured. Both the HPMC film base and PMAL-C16 surfactant were shown to significantly hinder transfection efficiency (Figure 2A). Furthermore, gel electrophoresis was used to separate different pDNA conformations on an agarose gel containing linear and nicked pDNA standards produced by digestion with BsaI and Nb.BsrD I. Both the HPMC film base and PMAL-C16 surfactant were shown to hinder pDNA mobility on the agarose gel (Figure 2B and Figure 2C).

[0176] pAAVlacZ was mixed with the liquid formulation at a 1:3 ratio. The resulting solution transfected only 3.7 ± 0.8% of the cell population, suggesting that this formulation significantly impaired transfection efficiency by over 90% relative to the plasmid placed in Tris buffer (100%, p<0.001, Figure 25A). Further evaluation of individual formulation components revealed that surfactant (SF) individually impaired transfection the most (25.7 ± 0.6%, p<0.001). The strong interaction between surfactant and recombinant DNA at concentrations utilized in previously published formulations initiated precipitation of the plasmid (Figure 25B) and hindered its mobility when analyzed by gel electrophoresis (Figure 25C). The polymer base alone reduced transfection efficiency to 55.2 ± 1.7% (Figure 25A). Mixing it with sugar significantly impaired transfection from 123.6 ± 13.6% (Sug) to 31.6 ± 3.2% (polymer + Sug). Reducing the polymer concentration to 0.5% and removing the surfactant significantly improved plasmid performance to 88.6 ± 12.0% (Figure 25D). The transfection efficiency of this formulation decreased from 99.5 ± 2.1% to 83.1 ± 5.3% during the film formation process and further decreased (34.0 ± 4.6%) after 3 months of storage at room temperature (Figure 25E). Without wishing to be bound by theory, it is believed that HPMC and PMAL-C16 interfere with pDNA stability by binding to pDNA and thereby impairing its biological function.

[0177] In addition to reduced transfection efficiency, HPMC film-based constructs were also shown to be incompatible with transfection reagents, including calcium phosphate and polyethyleneimine (PEI), resulting in reduced transfection efficiency in transfection methods using either reagent (Figure 3; Method 1: calcium phosphate; Method 2: PEI).

[0178] Example 2 - Optimization of Plasmid DNA Film Formulation Considering the adverse effect of the MSI-TX-1 formulation on pDNA stability, studies were initiated to optimize the film formulation for pDNA stability and corresponding transfection efficiency.

[0179] A. Overview of the formulation Specific details of the formulation of Example 2 are summarized in Table 1. Table 1 [Table 1]

[0180] B. Film base selection As shown in Figure 4, the film base can be buffered (10 mM Tris, pH 8.5) to maintain pDNA stability at room temperature. The film base contained in the optimized film formulation for pDNA was determined by evaluating the effects of film bases containing polyvinylpyrrolidone (P1; PVP, 2% w / v), polyvinyl alcohol (P2; PVA, 2% w / v), pectin (P3; 2% w / v), sodium alginate (P4; 2% w / v), and low-viscosity HPMC (P5; A15C, 1% HPMC) on transfection efficiency and plasmid conformation, as measured by agarose gel electrophoresis. When pDNA was mixed with PVP, PVA, or low-viscosity HPMC in a liquid state and stored at room temperature for 48 hours, pDNA transfection efficiency (Figure 5A) and pDNA conformation (Figure 5B) were maintained. pDNA transfection efficiency (Figure 5C) and pDNA conformation (Figure 5D) were also shown to be maintained for pDNA in films stored at 25 °C for 7 days and then rehydrated. PVA was selected for further study based on its maintenance of transfection efficiency and film peelability after drying.

[0181] In a second experiment, the same five polymers were selected, some at different concentrations (see Table 1), to determine their effect on transfection efficiency. P1 did not significantly interfere with transfection efficiency for unformulated plasmid (96.1 + 2.3% vs. 100 + 3.6%, Figure 28A). P2 improved transfection to 121.6 + 1.6% (p = 0.006). P3 blocked transfection efficiency, resulting in undetectable transgene expression, while P4 and P5 reduced transfection to 2.2% and 18.1%, respectively. Additional investigation revealed that this reduction in transfection efficiency may be due in part to the ability of the different polymers to interact with drugs used in the transfection assay (Figure 36) and their inability to protect plasmid DNA from degradation after storage in solution at 25°C (Figure 28B).

[0182] C. Excipient Selection Surfactants are often included in film-based formulations to improve the dispersion of medicinal agents throughout the matrix and their release during dissolution. It is known that molecules with charged groups can potentially shield exposed hydrogen and hydroxyl groups on DNA strands, but the use of novel zwitterionic surfactants hindered transfection efficiency and did not support DNA stability within the film matrix. However, because surfactants in MSI-TX-1 film formulations were shown to have a negative impact on pDNA stability, alternatives to such surfactants were investigated.

[0183] As shown in Figures 6 and 26, charged components, EDTA, and / or amino acids (e.g., arginine) can replace surfactants in some film formulations. In Figure 26, eight amino acids, divided into three groups (basic, acidic, and neutral) based on their isoelectric point (pI), were evaluated for their thermostabilizing properties in 10 mM Tris buffer (pH 8) at 50°C. The fastest degradation rates were observed in formulations containing amino acids with pIs < 5.5, including all amino acids considered "acidic" and one "neutral" amino acid (Figure 26C), which showed no detectable DNA after 2 days at 50°C (Figure 26A). In contrast, basic and neutral amino acids preserved DNA in a supercoiled conformation in solution at 50°C. That is, 83.8% of the original supercoiled conformation was found in the 1% arginine (aa2) preparation, while less than 57% was found in the other formulations (Figure 26A). After 4 days, 69.7% of the original supercoiled DNA remained in the 1% aa2 formulation, whereas it was completely converted to nicked and linear conformations in the lysine (aa1) and histidine (aa3) formulations (Figure 26B).

[0184] EDTA improves the thermal stability of recombinant DNA through its ability to bind metal ions in solution and halt degradation processes that require these ions as cofactors. Therefore, the next series of studies was designed to compare the stability profiles of aa2 formulations with those containing EDTA at elevated temperatures (Figure 27). The concentration of each excipient was selected so that it could not interfere with transfection (Figure 27A) and qPCR (Figure 27B)-based assays. After 2 weeks at 40 °C, solutions containing amino acid aa2 retained more of their supercoiled conformation (68.1% at 1% and 55.8% at 0.1% aa2) than plasmids in Tris buffer alone (26.6%, lane 2, Figure 27C). This led to an increase in transfection efficiency from 79.5% (Tris buffer) to 96.0% (p = 0.003) and 91.7% (p = 0.0077) for the 0.1% and 1% aa2 formulations, respectively (Figure 27D). There was no significant difference in transfection efficiency between the arginine (aa2)-containing formulation and the EDTA-containing formulation.

[0185] pDNA was formulated with EDTA and Tris buffer (pH 8.1) and stored in liquid form at 40°C for 4 weeks. Both 1 mM and 2 mM EDTA (E1) maintained pDNA transfection efficiency >80% (Figure 6A). pDNA was formulated with arginine and Tris buffer (pH 10) and stored in liquid form at 50°C for 7 days. Arginine (E2) at a concentration of 1% w / v in the formulation maintained pDNA transfection efficiency >30% (Figure 6B). A combination of 0.1% w / v arginine and 1 mM or 2 mM EDTA preserved pDNA transfection efficiency >80% after 4 weeks of storage at 40°C (Figure 6C). These results demonstrate that, in some embodiments, EDTA and arginine can work in tandem to maintain pDNA transfection efficiency after long-term storage at elevated temperatures.

[0186] Studies were also conducted to evaluate the effects of EDTA and arginine on pDNA stability upon 8 weeks of storage at 25°C. As shown in Figure 7, the transfection efficiency of pDNA in a 2% w / v PVA film base alone decreased to 47.2%, while the incorporation of 1% w / v arginine increased the transfection efficiency to 79% at the same time point. EDTA reduced pDNA stability in the 2% w / v PVA film matrix, as the transfection efficiency after 8 weeks at 25°C decreased to 11%.

[0187] Because amino acids were successful, choline (CA) was also added to the formulation to determine whether the stabilizing effect observed on recombinant DNA was general to all compounds with positively charged amine groups or unique to arginine (aa2). After 2 weeks at 40°C, more supercoiled DNA was found in formulations containing 0.1% choline (59.0%) than in 1 mM EDTA (53.6%) and Tris buffer alone (26.6%) (Figure 27C). CA and aa2 were also combined with EDTA to evaluate possible synergistic effects between the compounds. After 2 weeks at 40°C, each formulation studied, regardless of the amount of EDTA present, significantly improved transfection efficiency (≥89.2±1.2%, p<0.001) compared to that observed with buffer alone (79.4±1.3%), except for those containing 1% choline (1 mM EDTA + 1% CA, 75.3±0.5%, 2 mM EDTA + 1% CA, 78.3±1.0%, Figure 27E). The supercoiled (SC) conformation of plasmid DNA rapidly disintegrated in unformulated buffer samples at 40°C (27.2% of total DNA), whereas solutions containing 1% choline contained 82.3% (1 mM EDTA + 1% CA) and 87.4% (2 mM EDTA + 1% CA) of DNA in the SC conformation. This pattern was similar to that seen for the 1% aa2 preparations (83.1% and 84% SC DNA, respectively, Figure 27F), despite the fact that these formulations were able to maintain transfection efficiency significantly better at 40°C than those prepared with 1% choline (p < 0.001), suggesting that the 1% choline / EDTA combination may have interfered with the transfection assay (Figure 27E). Although the presence of EDTA resulted in a slight improvement in the presence of SC DNA over the course of the study (EDTA + aa2, 69.6% SC DNA, Figure 27F vs. aa2 alone, 68.1% SC DNA, Figure 27C), there was no significant change in transfection efficiency between these two formulations (EDTA + aa2, 94.9%, Figure 27E vs. 96.0% aa2 alone, Figure 27D, p > 0.05).

[0188] D. Film base and excipient combinations Films were then prepared with P2 and each agent found to support the stability of the plasmid in solution (1 mM EDTA, 1% arginine (aa2) and choline (CA)), packaged, and stored at 25°C for 8 weeks (Figure 28C). The transfection efficiency of the plasmid stabilized in the CA-containing film decreased to 10.8 ± 3.0% within 7 days and remained at this level for the remainder of the study. Agarose gel electrophoresis revealed that 38.8% of the DNA was in supercoiled form after 3 weeks (Figure 28D). Combining EDTA with the polymer improved transfection to 46.2 ± 2.2% at 7 days. This further decreased to 23.2% by 2 weeks, a difference that was not statistically significant from that seen with the choline formulation by the end of the study. This preparation contained 35.3% of the DNA in supercoiled form. Of all the formulations tested, films prepared with the polymer alone and in combination with aa2 were the most stable at 25°C. After 3 weeks at 25°C, transfection efficiencies were 74.8 ± 2.4% and 93.2 ± 2.8% for the P2 and aa2 formulations, respectively. The most significant difference between these formulations was seen at 8 weeks, when transfection efficiencies dropped to 47.2 ± 0.2% (P2) and 78.5 ± 0.9% (aa2). At this time point, 70.6% of the plasmid in the aa2 matrix remained in a supercoiled form, while 37.4% was supercoiled in the P2 matrix (Figure 28D).

[0189] E. Sugar Selection Sugars are often included in solid formulations of biological drugs due to their ability to form amorphous glasses that protect the biological drug from degradation. While sugars have not been shown to adversely affect pDNA stability, we evaluated the effect of various sugars on the transfection efficiency of pDNA prepared in films (Figure 8, Figures 28E-28F). Each film contained 2% w / v PVA film base and 1% w / v sugar. The sugars tested included melezitose (S1), trehalose (S2), raffinose (S3), sucrose (S4), dextrose (S5), mannitol (S6), and sorbitol (S7) (Table 1).

[0190] In the first experiment (Figure 8), the prepared films were stored at 25°C for 8 weeks. Raffinose was determined to be the most effective, with a transfection efficiency of 81.4% seen at 8 weeks, while dextrose was the least effective, with a transfection efficiency of 39% seen at the same time point.

[0191] In the second experiment, of all the formulations tested, the one containing glucose (Sug5) was the worst, with transfection efficiency declining to 56.3 ± 3.2% after 2 weeks at 25°C and further declining to 23.6 ± 1.1% after 4 weeks. Transgene expression was undetectable in cells treated with solutions made from rehydrated films containing glucose. Agarose gel electrophoresis revealed that 14.6% of the DNA present at 8 weeks was in supercoiled form (Figure 28F). Plasmids stabilized in films prepared with melezitose (Sug1) had a similar profile to that of plasmids in films containing only P2 after 4 weeks (48.4 ± 1.4% P2 vs. 48.8 ± 0.7% Sug1) and 8 weeks (35.2 ± 0.9% P2 vs. 40.7 ± 1.4% Sug1) at 25°C. Each formulation contained approximately 25% of the plasmid DNA in supercoiled form. The remaining formulations demonstrated that all of the other sugars improved plasmid stability relative to films made with polymer alone, although the transfection efficiency of each was significantly lower (p<0.001) than that of the plasmid stored in Tris buffer alone throughout the course of the study (77.3±1.0%). The exceptions to this were preparations made with trehalose (Sug2) and raffinose (Sug3) (Figure 28E), which had transfection efficiencies of 76.3±2.6% and 79.5±3.6%, respectively, after 8 weeks at 25°C. Approximately 25.2% (Sug2) and 63.1% (Sug3) of the plasmid DNA remained in a supercoiled form in these preparations, compared with the plasmid stored in Tris buffer at 25°C (69.1%, Figure 28F). Further refinements to the film matrix involved combining several sugars with the amino acid arginine (aa2), which had previously supported plasmid stability (Figures 26 and 27). Of these combinations, preparations made with aa2 and Sug2 supported the highest transfection efficiency and showed reduced amounts of nicked and linear DNA after 2 weeks at 25°C and 40°C (Figure 37).Given the superior ability of Sug3 to stabilize the plasmid in the absence of aa2, it and the Sug 2+aa2 formulation were selected for further studies.

[0192] F. Combination of film base, excipient and sugar The transfection efficiency of the plasmid stored in the film containing aa2 remained at 89.8% when stored for 12 weeks at 25 °C (formulation F1, Figure 29A). Adding a plasticizer (S) to the aa2 formulation allowed for easier removal of the film from the template without compromising transfection efficiency (F3, 86.2 ± 1.7%). Adding Sug2 to the film matrix (F4) along with aa2 maintained a transfection efficiency of 83.4 ± 2.2% after 12 weeks at 25 °C, which was superior to the transfection efficiency of the plasmid in liquid buffer (74.8 ± 1.3%, liquid control, Figure 29A). Visualization of DNA from the F4 preparation revealed that it contained more supercoiled DNA (73.6%) than all formulations (60.9–67.5%, Figure 29B) after 4 weeks at 25 °C. This trend continued for 12 weeks (Figure 38A). Plasmid transfection efficiency in films prepared with Sug3 alone (formulation F2) decreased at a rate of 3.55% per week over the first 4 weeks, and at 12 weeks the transfection efficiency was not statistically different from the liquid control preparation (p=0.99), despite containing more supercoiled DNA (59.1% vs. 41.3%, Figure 38).

[0193] When stored at 4°C, plasmids embedded in films containing 0.1% aa2 alone (formulation F0) maintained a transfection efficiency of 77.1 ± 1.1% throughout the 17-week period (Figure 29C). This preparation contained minimal amounts of supercoiled DNA after 2 weeks (67.2%) and 8 weeks (68.0%), respectively (Figure 29D). The transfection efficiency of the plasmid in formulation F2 decreased from 91.3 ± 2.7% to 81.3 ± 5.7% after 1 week and remained at this level throughout the remainder of the study. The transfection efficiencies of plasmids prepared in formulations F1 and F4 were initially as high as the liquid control formulation (>90%) but then rapidly decreased to 77.2 ± 4.5% and 76.2 ± 3.2% after 8 weeks at 4°C. The transfection efficiency of the plasmid in the liquid control formulation underwent a similar decrease from 98.8 ± 3.2% to 79.6 ± 0.3% between the 1-week and 2-week time points, which in both cases corresponded to a slight increase in the amount of nicked DNA in the samples (Figure 29D).

[0194] G.pDNA concentration Figures 9A-9B show that the concentration of pDNA in the film can affect transfection efficiency after drying and during storage at 25°C for 30 days. Films were prepared with a base formulation of 2% (w / v) PVA, 1% (w / v) arginine, 1% (w / v) trehalose, and 0.5% (w / v) sorbitol in 10 mM Tris pH 8.1. pDNA was included in the film at concentrations of 0.05 mg / mL, 0.1 mg / mL, 0.25 mg / mL, 0.5 mg / mL, or 1 mg / mL. Figure 9A shows the transfection efficiency after drying. Figure 9B shows the transfection efficiency after 30 days of storage at 25°C. As shown, pDNA at a concentration of 1 mg / mL significantly reduces transfection efficiency after drying and during storage at 25°C for 30 days.

[0195] H. Relative humidity Environmental humidity can affect the long-term stability of recombinant viruses within the film matrix. As shown in Figures 10A-10B, pDNA is most stable in films at low relative humidity (RH), regardless of temperature. pDNA (100 μg / ml) was prepared in a base formulation of 2% (w / v) PVA, 1% (w / v) arginine, 1% (w / v) trehalose, and 0.5% (w / v) sorbitol in 10 mM Tris pH 8.1. Films were stored at 25°C and 30%, 60%, or 90% RH (Figure 10A) for 12 weeks or at 40°C and 20% or 75% RH (Figure 10B) for 10 days. As shown, higher RH during storage of pDNA-containing films can significantly reduce pDNA stability, as measured by reduced transfection efficiency.

[0196] In a second experiment, F4 formulations were stored at 25 °C under different humidity conditions. After 4 weeks at 25 °C, there was no significant difference between storage conditions (p = 0.43 to 0.99, Figure 30A). However, the transfection efficiency of the plasmid stored at 90% RH was significantly reduced to 60.4 ± 0.7%, while the transfection efficiency of the plasmids stored at 30 and 60% RH was 84.3 ± 1.0% and 83.9 ± 1.6%, respectively (p < 0.001, Figure 30A). The residual moisture within the film remained constant at 14.8–16.8% for 12 weeks, regardless of the storage environment (Figure 30B).

[0197] I. Film Mold Selection As shown in Figure 11, the composition of the mold material onto which the pDNA-containing film was cast can significantly affect the transfection efficiency of pDNA during the film formation process. The plastic mold was made of polystyrene. The foil mold was an AMCOR foil OPA25 / AL45 / PE60 cold press well.

[0198] J. Optimized pDNA Film Formulation Based on the aforementioned studies, four optimized film formulations, F1-F4, were generated and their effects on transfection efficiency were evaluated. In each formulation, the film base was PVA, 2% w / v. Different excipients were added to the 2% w / v PVA base to obtain the following formulations, F1-F4: F1 (Arg): 2% w / v PVA, 1% w / v arginine, 10 mM Tris (pH 8.5) F2 (Raf): 2% w / v PVA, 1% w / v raffinose, 10 mM Tris (pH 8.5) F3 (Arg-S): 2% w / v PVA, 1% w / v arginine, 1% w / v sorbitol, 10 mM Tris (pH 8.5) F4 (Arg-T): 2% w / v PVA, 1% w / v arginine, 1% w / v trehalose, 0.5% (w / v) sorbitol, 10 mM Tris (pH 8.5)

[0199] As shown in Figure 12A, optimized formulations F1, F3, and F4 maintained significantly higher pDNA transfection efficiencies after up to 12 weeks of storage at 25 °C and 60% relative humidity (RH) compared to pDNA prepared in a buffer-only control (Buffer (Liq)). Surprisingly, transfection efficiencies of >80%, and often >90%, were observed for pDNA prepared with these formulations after 12 weeks of storage. All optimized formulations maintained pDNA conformation to a similar extent over 12 weeks (Figure 12B).

[0200] The film matrix can be further optimized to control the rate of release of pDNA from the film matrix. Figures 13A-13B show the release profiles of plasmid DNA (100 μg / ml) from a film containing 0.75% (w / v) HPMC K4M (Figure 13A) versus 2% (w / v) PVA, 1% (w / v) arginine, and 1% (w / v) trehalose in Tris buffer, pH 8.1 (Figure 13B).

[0201] Storage of pDNA in a film matrix, such as the optimized matrix described above, can better maintain pDNA stability over time compared to storage of buffered and dried pDNA. pDNA transfection efficiency was compared for pDNA embedded in an optimized film matrix containing 2% (w / v) PVA, 1% (w / v) arginine, and 1% (w / v) trehalose in Tris buffer (pH 8.1) and buffered and dried pDNA after storage at room temperature for up to 8 days (Figure 14). Plasmids in 10 mM Tris buffer, pH 8.1, were dried under ambient conditions (Buffer (Dry)). Transfection efficiency was compared with that of plasmids (100 μg / ml) embedded in the optimized film matrix. Replicate samples (n=3) were collected over time, and transfection efficiency was compared to that of samples at the beginning of the study. The transfection efficiency of the dried plasmids was reduced by 15% due to the drying process itself (t=0). However, as shown in Figure 14, the optimized film matrix provided superior stability of solid-state pDNA for up to 8 weeks at room temperature compared to buffered pDNA alone.

[0202] K. Long-term stability of plasmid DNA in optimized formulations Before evaluating the long-term stability of recombinant DNA under optimized environmental conditions, one final optimization study was performed. This study revealed that the method of mixing the different components of the film before drying could significantly affect the performance of the plasmid in the rehydration solution (Figure 30C). Mixing the plasmid with sugar or plasticizer alone before adding it to the bulk formulation did not significantly affect transfection efficiency once drying was complete (p = 0.75-0.99), whereas mixing the plasmid with amino acids alone before bulk addition reduced transfection efficiency by 23.3% after drying was complete. This practice was avoided when preparing films for extended stability studies. Throughout a 9-month period in which the films were stored at 25 °C and 60% RH, transfection efficiency remained high, ranging from 83.0 to 111.5% for frozen-stored plasmid stocks (Figure 31A). Plasmid copy numbers of the plasmids in the film matrix were stable for the first 3 months of the study, with significant increases observed at 7 months (117.6 ± 8.5%, p = 0.006) and 9 months (131.4 ± 7.3%, p = 0.01) relative to the copy number in the freshly dried film (t = 0, Figure 31B). This change was also observed visually, as 35% and 44% of the original supercoiled DNA conformation were converted to nicked forms at these time points (Figure 31C), and the overall supercoiled:nicked ratio decreased over time (Figure 31D).

[0203] L. Optimized Film Physical and Biological Properties Films prepared with the optimized formulation (PAST; 2% PVA + 1% arginine + 0.5% sorbitol + 1% trehalose) released 77.7 ± 3.3% of the plasmid payload within 2.5 minutes (Figure 32A). Linear regression of data collected during the first 2 minutes of the dissolution curve revealed that the plasmid was released at 21.3 ± 4.4% of its original concentration or 2.7 ± 0.5 × 10 10The results revealed that the PAST was released at a rate of 100 copies / ml / min. Individual components of the PAST formulation, the complete liquid formulation (PAST liquid), or the solution prepared from the rehydrated film (PAST film) were not cytotoxic (Figure 39). The stepwise addition of excipients revealed that films prepared with plasticizer (S) alone were significantly stronger, thicker, heavier, and more elastic than films containing polymer (P) alone (Figure 32B, Table 2). The addition of amino acids (A) and plasticizer (S) to the formulation produced significantly more flexible films. The addition of amino acids and sugars to the plasticizer-containing formulation increased the thickness from 53.8 ± 1.9 μm to 59.4 ± 5.1 μm (Table 2). Table 2 [Table 2]

[0204] X-ray diffraction revealed that films prepared with the individual components were amorphous solids (Figure 32C). A single glass transition event in the DSC analysis of the PAST formulation confirms the amorphous state of the film matrix (Figure 40). FTIR analysis showed that formulations containing amino acids (PAS, PAST) exhibited peaks at 1664 and 1560 cm corresponding to C=O or C=N residues found in amino acids. -1 (boxed region, Figure 32D). Addition of the plasmid to the PAST formulation did not result in any additional peaks.

[0205] M.Overview Plasmids stabilized within an optimized film matrix (PAST formulation; %PVA + 1% arginine + 0.5% sorbitol + 1% trehalose) were significantly more stable than those formulated as dry powders in the absence of excipients (Figure 33A). The stability profile of solid-state plasmid DNA is generally believed to be due to the limited mobility of nucleotides in the absence of water. However, degradation of recombinant DNA can occur through enzymatic processes, which may be mediated by residual materials from the manufacturing process, as well as non-enzymatic processes influenced by the macro- and microenvironments in which it is stabilized and stored. Non-enzymatic degradation of purified plasmids for clinical use occurs through free radical oxidation, hydroxylation, depurination, and beta-elimination, which are greatly influenced by temperature, pH, and ionic strength (Figure 33B). In the solid state, oxidation and phosphodiester hydrolysis are the most prominent mechanisms of DNA degradation. Phosphodiester bonds along the sugar-phosphate backbone are susceptible to disruption by hydroxyl radicals / ions, which convert deoxyribose molecules into carbon-based sugar radicals, disrupting the nucleic acid chain. Hydrolysis and depurination-mediated degradation can occur under acidic conditions and in the presence of water, resulting in the protonation of purine residues, cleavage of N-glycosidic bonds, and release of nucleotides from DNA strands. The free protons generated from these processes also disrupt bonds along the phosphate backbone of the DNA molecule and between nucleotides. Under alkaline conditions, excess hydroxyl ions disrupt the hydrogen bonds between the two DNA strands. This generally occurs at a much slower rate than degradation under acidic and elevated temperatures, but is accelerated when the pH is increased above 11.6, resulting in strand separation and unwinding of the twisted helix.

[0206] Plasmid DNA typically exists in three distinct physical conformations with unique structures and biological functions. Plasmids naturally adopt a supercoiled (SC) state to relieve stress caused by the helical arrangement of nucleotides. Upon strand cleavage in response to a stressor, the supercoiled plasmid relaxes and adopts a nicked or open circular state. Disruption of both strands converts the plasmid to a linear form. Plasmids in the SC conformation have been reported to have superior transfection efficiency compared with nicked and linearized plasmids, although results can vary with cell line, tissue, and delivery method. As disclosed herein, the presence of different plasmid conformations can significantly affect important stability indicator assays, such as transfection efficiency and plasmid copy number as determined by quantitative PCR (Figure 35), while remaining undetectable by other assays (Figure 41). Considering that nicked and linear forms are removed during clinical manufacturing due to the risk of recombination and integration into genomic DNA, and the US FDA Guidance for Industry recommends that SC content be greater than 80% of bulk material, the presence of SC conformation was monitored in the formulations disclosed herein by agarose gel electrophoresis and paired with transfection efficiency. The optimal formulation was defined as one that can support greater than 80% SC conformation when stored at ambient temperature for a certain period of time.

[0207] The primary component of all film-based dosage forms is a polymer base capable of forming an amorphous solid during the drying process. As disclosed herein, polymers that stabilized recombinant adenovirus and AAV at ambient temperatures significantly impaired transfection efficiency (Figure 25A). Data from screening other polymers suggests that it and polymers of similar composition may not completely release the plasmid during the dissolution process (Figure 28A). Zwitterionic surfactants, known to stabilize viruses within the film matrix, strongly condensed the plasmid DNA, making it unable to transfect cells and unable to migrate from the wells during agarose gel electrophoresis (Figures 25A-C). EDTA, a known stabilizer of recombinant DNA in solution and a molecule that can also retain a double charge, maintained plasmid stability in solution at 40°C (Figure 27C), but failed to preserve the SC form within the film matrix for 8 weeks (Figure 28C). During this time, the pH within the film matrix shifted from 6.5 to 5.5, suggesting that acid-mediated hydrolysis may be responsible for this effect. The ionization state of EDTA within the film may differ from that observed in solution, which may disrupt the interactions between the polymer, the plasmid, and the Tris buffer, promoting degradation of the plasmid and / or interfering with the ability of the buffer to maintain pH.

[0208] Sugars are often included in oral film formulations for their flavor-masking properties, but they are also utilized to stabilize biological drugs due to their unique ability to displace water and maintain structural conformation in an amorphous, glassy state. While all sugars tested formed amorphous solids (Figure 32C, Figure 40), reducing sugars had the poorest stability profile and were most likely to support acid hydrolysis of the plasmid, as indicated by a significant decrease in pH within the film matrix (Figure 40B). In contrast, films prepared with trehalose did not experience a decrease in pH during storage at 25°C and maintained transfection efficiency when stored under extreme conditions (Figure 37B). Another sugar in the panel was also able to maintain pH within the film during storage, but it significantly altered the overall Tg of the formulation, suggesting that interactions between it and the polymer base did not support plasmid stability (Figure 28C, Figure 40B).

[0209] As demonstrated herein, amino acids stabilized plasmids in solution and within film matrices. While various amino acids have been included in pharmaceutical formulations to increase solubility, reduce viscosity, and prevent aggregation during drying and rehydration, there is limited understanding of how they contribute to nucleic acid stabilization. The amino acids in the formulations herein provided a superior stability profile to EDTA, a compound shown to stabilize DNA in solution and frozen states. According to solution thermodynamics, plasmids are highly charged molecules that consume a significant amount of energy to remain separated from one another. Certain concentrations of positively charged counterions in liquid formulations reduce electrostatic repulsion between plasmids and promote nucleic acid folding, while other concentrations may favor plasmid relaxation and conformational transitions. This effect was observed in the liquid formulations utilized in the prescreening process (Figures 27C-27D). Although the combination of ETDA with amino acids did not affect the stability provided by amino acids alone, the data generated from these studies suggested that amino acids could prevent significant pH changes caused by ETDA alone, as they uniquely maintain an alkaline pH within the film matrix (Figure 26C and Figure 40D). Collectively, this suggests that the manner in which this amino acid stabilizes plasmid DNA within the film matrix is ​​twofold. During the drying process, the positively charged compounds align along electron-dense regions of the plasmid, preserving a supercoiled conformation during the drying process (Figure 33B). In the solid state, this interaction prevents degradation by hydrolysis and depurination. Amino acid molecules not involved in the protective shell can retain excess hydroxyl ions to prevent the disruption of phosphodiester bonds formed between the double DNA strands and within the plasmid backbone.

[0210] To date, most plasmid-based products have been formulated and stored as frozen or refrigerated liquid solutions. Recent strategies for delivering plasmids to the lungs or through the skin have promoted the use of advanced drying techniques to preserve high-quality plasmids in solid formulations. These include freeze-drying, spray freeze-drying, and dry cooling with supercritical carbon dioxide. One report showed that dried powders containing naked plasmids lyophilized in a hyaluronic acid-containing formulation exhibited improved gene expression in the lung and a significantly higher long-term stability profile at 25°C compared to the same plasmids lyophilized in mannitol or in solutions complexed with the transfection reagent PEI. Other reports have demonstrated that complexation with biopolymers can prevent plasmid DNA degradation during the drying process. For example, spray-dried powders containing plasmid-chitosan nanoparticles retained higher transfection efficiency with minimal aggregation after 3 months at 4°C compared to the same particles stored as a liquid suspension. Powders produced by supercritical CO2 drying show high levels of transgene expression 24 h after intratracheal administration in mice, but the acidic environment created by water and CO2 during the drying process does not support long-term plasmid stability.

[0211] There are limited reports in the literature of naked plasmid DNA being stabilized in the monolayer film matrix described herein. Most reports involve complexing agents, such as PEI or liposomes, with the plasmid prior to application to the surface of a preformed film to create a multilayer substrate. These multilayer films have been incorporated into implantable stents for therapeutic applications. In one report, a bilayer film containing a mucoadhesive polymer and a naked plasmid encoding beta-galactosidase placed on an impermeable backing layer was evaluated for its ability to induce an immune response after oral administration in rabbits. After 60-80% of the plasmid was released within 2 hours, a systemic immune response similar to that achieved by subcutaneous injection was found in animals receiving the film.

[0212] Disclosed herein is a formulation that preserves the transfection efficiency of naked plasmid DNA within a monolayer film matrix for up to nine months. It is important to note that the plasmids utilized herein were purified from bacterial stocks using a laboratory-grade kit, and 20% of the starting material was in nicked and linear conformations. Therefore, the stability profile may have been further improved with a highly purified stock that did not contain compromised plasmid. This disclosure is the first to characterize the stability of naked plasmid DNA at ambient temperatures within a monolayer film matrix using several stability-indicating assays. The impact of different conformations of plasmid DNA on the data generated thereby was assessed, and the inclusion of compounds capable of maintaining a positive charge while supporting an alkaline environment within the film matrix was identified.

[0213] N. Exemplary Materials and Methods (Examples 1 and 2) Materials. Dulbecco's phosphate buffer solution (PBS), Trizma base [2-amino-2-(hydroxymethyl)-1,3-propanediol] (Tris), mannitol, melezitose, trehalose, sucrose, raffinose, poly(vinyl alcohol) MW 9,000–10,000, 80% hydrolyzed, ortho-nitrophenyl-β-galactopyranoside (ONPG), and β-mercaptoethanol were purchased from Sigma-Aldrich (St. Louis, MO). Poly(maleic anhydride-alt-1-octadecene) substituted with 3-(dimethylamino)propylamine (PMAL) was obtained from Anatrace (Maumee, OH). Polyethylenimine (PEI, linear, MW 25,000, transfection grade) was purchased from Polysciences (Warrington, PA). Glycerol and Aqualine Complete 5 were purchased from Fisher Chemical (Fairlawn, NJ). Dulbecco's modified Eagle's medium (DMEM), penicillin (10,000 IU), streptomycin (10,000 μg / ml), and 0.25% trypsin-EDTA were purchased from Mediatech (Manassas, VA). Fetal bovine serum was purchased from Mediatech (Corning, Woodlands, CA). Hydranal formamide dry was purchased from Honeywell (Charlotte, NC). Methanol, 99.8% ultra-dry, was provided by Acros Organics (Fair Lawn, NJ). CellTiter-Glo® Luminescent Cell Viability Assay Kit was ordered from Promega (Madison, WI). All other chemicals were purchased from Thermo Fisher Scientific (Pittsburgh, PA).

[0214] Plasmid preparation. pAAV-LacZ (AAV Helper-Free System, Stratagene, La Jolla, CA) was used in these studies as a model plasmid. Transfection-grade plasmids were amplified in E. coli (HB101 competent cells, Promega, Madison, WI) and purified using the Qiagen Maxi Plasmid kit (Qiagen, Hilden, Germany). Purified plasmids had OD260 / 280 ratios of 1.7–1.9 as determined by UV spectrophotometric analysis (Beckman Coulter, Brea, CA). Plasmid stock solutions were prepared in 10 mM Tris buffer, pH 8.0, at concentrations of 1–2 mg / mL and stored at -20°C. These stocks served as controls for all formulations evaluated in these studies.

[0215] Film preparation and storage. Film formulations were prepared in bulk and homogenized using a rotary mixer before adding pAAV-LacZ to a final concentration of 0.1 mg / ml (Figure 34). The formulations were dispensed into 100 μl silicone molds (Bold Maker, Amesbury, MA) and films were formed under sterile conditions at 20°C. Once dry, films were either reconstituted in Tris buffer for analysis or packaged in Ziploc®-like particle-free bags (American Cleanstat, Irvine, CA) within heat-sealed foil bags (Ted Pella Inc., Redding, CA). For most stability studies summarized in this manuscript, packaged films were stored in a stability chamber (Binder, Tuttlingen, Germany) at 25°C and 60% RH or 4°C and 40-50% RH.

[0216] Establishment of Stability-Indicating Assays. Prior to the initiation of formulation screening studies, methods were established to detect different conformations of plasmid DNA in solution and their impact on several different assays was evaluated (Figure 35). Standards representing nicked and linear forms were generated by enzymatic digestion with the enzymes BsaI and Nb.BsrDI (New England Biolabs, Ipswich, MA) at 37°C and 65°C, respectively. The digestion products were purified separately with a Qiagen DNA Mini Kit (Qiagen, Germany). The efficiency of the digestion reaction was confirmed by visualization of distinct bands of nicked and linear DNA by gel electrophoresis.

[0217] Gel electrophoresis. Plasmids (0.25 μg) from the rehydrated film were mixed with 6× loading dye and then added to individual wells of a 0.8% agarose gel prepared in Tris-borate-EDTA (TBE) buffer and cast using an OWL B1 Horizontal Electrophoresis System (Owl Separation Systems, Portsmouth, NH). DNA standards (1 kb+ DNA ladder, New England Biolabs) were included in each gel for quality control. Gels were run at 105 V for 90 minutes and stained with SYBR Safe dye (Thermo Fisher Scientific, Pittsburgh, PA). Bands were visualized and images were captured using the Axygen Gel Documentation System (Corning, NY). The density of supercoiled and nicked bands was determined using ImageJ (US National Institutes of Health, Bethesda, MD). The supercoiled plasmid content was calculated as the ratio of the fluorescence intensity of the supercoiled DNA band to the sum of the intensities of the bands representing the three DNA conformations.

[0218] Cell culture and transfection. HEK293 cells (CRL-1573, ATCC, Manassas, VA, passages 12–26) were maintained in DMEM, 10% FBS, and 1% penicillin (10,000 IU) / streptomycin (10,000 μg / ml). Cells (7 × 10 5 Plasmids (1 μg / well) were seeded into 12-well plates (Falcon, Corning, Durham, NC) to achieve 80% confluence for 24 hours. The culture medium was changed 1 hour before transfection. Plasmid (1 μg) in 50 μl of Opti-MEM (Life Technologies, Grand Island, NY) was mixed with 4 μg of PEI in 50 μl of Opti-MEM and allowed to sit at room temperature for 20 minutes before being added to the cells. Cells were then incubated at 37°C, 5% CO2, and the culture medium was changed every 24 hours. 48 hours after transfection, cells were harvested for evaluation of transgene expression.

[0219] Transfection efficiency. Analysis of beta-galactosidase expression was performed using a colorimetric assay based on the reaction with ortho-nitrophenyl-β-galactopyranoside (ONPG). 48 hours after transfection, cells were washed with PBS and then treated with Reporter Lysis buffer (Promega, Madison, WI). After a freeze / thaw cycle and centrifugation at 14,000 rpm for 1 minute, 10 μl of diluted supernatant was mixed with 150 μl of 14.3 M β-mercaptoethanol in 150 mM phosphate buffer, pH 7.5, and incubated at 37°C and 5% CO2 for 5 minutes. At this time, 50 μl of 4 mg / ml ONPG was added to the sample. After 2.5 minutes, color development was stopped by adding 90 μl of 1 M Na2CO3. The absorbance of each sample at 420 nm was recorded using a Glomax Multi-detection Plate Reader (Promega, Madison, WI). The protein content of cell lysates was determined by a standard Lowry assay (Bio-Rad, Hercules, California). Transfection efficiency is expressed as the amount of beta-galactosidase present per mg of cellular protein in a given cell population for each formulation relative to cells transfected with plasmid stocks stored frozen at -20°C in Tris buffer, pH 8.

[0220] Plasmid copy number. The number of intact plasmids in a given formulation was determined by quantitative PCR. Samples were prepared by diluting the formulated plasmid 100,000-fold in Tris buffer or film matrix (0.1 mg / ml). Primers and TaqMan probes targeting the ITR region of the pAAVlacZ plasmid were as follows: forward primer, 5'GGAACCCCTAGTGATGGAGTT-3'; reverse primer, 5'-CGGCCTCAGTGAGCGA-3' (Sigma-Geneosys, The Woodlands, TX); TaqMan probe, 5'- / 6 FAM / CACTCCCTCTCTGCGCGCTCG / 3BHQ_1 / -3' (Applied Biosystems, Foster City, CA). Each sample reaction (25 μl) consisted of 5 μl of sample, 20 μl of forward primer (0.1 μM), reverse primer (0.3 μM), and probe (0.1 μM), and 12.5 μl of 2× TaqMan Fast Advanced MasterMix (Thermo Fisher Scientific, Baltics, Vilnius, Lithuania) in a MicroAmp Fast 96-well optical reaction plate (Applied Biosystems, Foster City, CA). Reactions were performed on an Applied Biosystems ViiA 7 system (Thermo Fisher Scientific, Pittsburgh, PA) according to the following protocol: 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds. Standard curve samples were prepared from 40–4×10 nucleotides. 6 A range of copies / μl of the same plasmid was prepared. The amount of intact plasmid recovered from each formulation was determined by dividing the copy number obtained from each formulation by that obtained from a plasmid stock stored frozen at −20°C in Tris buffer, pH 8, and this value was reported as % plasmid copy number.

[0221] Cell viability. Solutions of individual excipients were prepared in Tris buffer (pH 8.0). Ten microliters of each solution was applied to HEK 293 cells (7 × 10 cells) in a 96-well plate. 4 Cells were added to the test formulations (cells / well). After 24 hours of treatment, cell viability was assessed using the CellTiter-Glo Luminescent Cell Viability Assay kit according to the manufacturer's instructions (Promega, Madison, WI). Viability greater than 80% was considered acceptable for the test formulation.

[0222] Physical Characterization: Dissolution. Films containing 100 μg of plasmid DNA were placed in sterile scintillation vials (Kimble Glass, Vineland, NJ) containing 1 ml of nuclease-free 10 mM Tris buffer, pH 8 (Invitrogen, Grand Island, NY). The vials were kept at 37°C, and the solutions were stirred at 60 rpm for 15 minutes. Samples (15 μl) were collected and replaced with an equal volume of buffer to maintain a constant volume throughout the study. The DNA concentration in each sample was determined by measuring absorbance at 260 nm. The percentage of release was calculated as the cumulative percentage of plasmid released from the film relative to the plasmid in the liquid film formulation.

[0223] Physical Characterization: Moisture Content. Films were dissolved in 1 ml of extraction solvent (anhydrous formamide: extra-dry methanol in a 1:1 volume ratio) at 50°C. The weights of the dry film (m1) and extraction solvent (m2) were recorded. The moisture content of the blank extraction solvent (B%) and film-containing sample (C%) was determined by Karl Fischer titration using a V10S Volumetric Karl Fischer Titrator (Mettler Toledo, Columbus, OH). Specifically, 0.3 ml of sample was injected into the titration chamber, and the sample was mixed with excess dry methanol for 3 minutes before the titration began. The moisture content in the film was calculated using the following equation:

number

[0224] Physical Characterization: Tensile Strength. Films (2.5 × 2.5 cm) were immobilized on a TA XT Plus Texture Analyzer (TA Instruments, New Castle, Delaware) with tensile grips (TA-108S-5). The pre-test speed was set at 2 mm / s; the test speed at 1 mm / s; and the post-test speed at 10 mm / s. The distance the probe traveled across the puncture site was 12 mm, and the trigger force was 5.0 g. The maximum force required to break the film indicates the strength of the film, and the travel distance correlates with the elasticity of the film.

[0225] Physical Characterization: Differential Scanning Calorimetry (DSC). Films were cut into 5-10 mg pieces, sealed in aluminum sample pans (DSC Consumables, Austin, MN), and placed in a TA Q20 differential scanning calorimeter (TA Instruments; New Castle, Delaware). Conventional modulation was followed, with an amplitude of 1 °C and a modulation time of 60 seconds. The ramp rate was set at 3 °C / min during the run from 30 °C to 180 °C. The dry nitrogen gas flow rate was 50 mL / min. Data were analyzed using TA Instruments Trios v.5.1.1.46572 analysis software.

[0226] Physical Characterization: X-ray Diffraction (XRD). A Rigaku MiniFlex 600 II was used to study the crystallinity of the films and film components. The films were fixed in a hollow aluminum frame as a sample holder before being inserted into the diffractometer. Measurements were performed with a scan step of 0.04°, a 2θ scan range of 5 to 70°, and a generator operating voltage and current of 40 kV and 15 mA, respectively.

[0227] Physical Characterization: Fourier Transform Infrared Spectroscopy (FTIR). FTIR spectroscopy of the films was performed using a Nicolet™ iS50 FT-IR Spectrometer (Thermo Fisher Scientific; Waltham, Massachusetts). The films were placed in a Smart Omni-Sampler (Thermo Fisher Scientific; Waltham, Massachusetts) and analyzed using the ATR (attenuated total reflection) technique with a diamond / ZnSe prism from 4000 to 800 cm. -1 The area was scanned.

[0228] Statistical analysis. Statistical analysis of data was performed using Prism software (GraphPad Prism v.9.5.1, San Diego, CA). Paired t-tests were used to compare significant differences between values ​​obtained from two treatment groups. In studies containing more than two unique treatments, one-way or two-way ANOVA was used to assess statistical significance. Dunnett's multiple comparison test was used to compare individual treatment groups with the control group, and Tukey's post-hoc test was used to compare each of the two groups with the entire dataset.

[0229] Example 3 - Optimization of Plasmid DNA Film Formulation Complexed with Transfection Reagents In addition to optimizing the film formulation for naked pDNA, the formulation was also optimized for pDNA complexed with a transfection reagent. Polyethylenimine (PEI), a common transfection reagent that condenses DNA into positively charged complexes, can be added to solutions prepared from rehydrated films for efficient cell entry. Therefore, to simplify the transfection process for use in large-scale production of recombinant proteins and viruses, the stability of preformed DNA complexes using either PEI or lipofectamine (LFP), a common lipid-based transfection reagent, was evaluated within the film matrix.

[0230] A. PEI complexed pDNA In the first experiment, to evaluate the effect of formulation on transfection efficiency, pDNA complexed with PEI was prepared for use with four optimized formulations (F1–F4). pDNA-PEI complexes were prepared by mixing plasmid DNA (2.5 μg DNA / 40 μl) and PEI (10 μg / 40 μl) in Tris buffer (pH 8.5) and waiting 20 minutes for complex formation. The complexes were then stored at room temperature for 4 hours in either OPTI-MEM™ or PBS, but neither solvent affected the transfection efficiency of the pDNA-PEI complexes (Figure 16A).

[0231] PEI-complexed pDNA was then added to the four optimized formulations F1-F4 to evaluate the effect of the formulation on pDNA transfection efficiency. The complexes were added so that each 100 μl film contained 2.5 μg of DNA at a DNA:PEI ratio of 1:4. Formulations F1-F4 for PEI-complexed pDNA were as follows: F1: 2% w / v PVA F2: 0.8% w / v HPMC A4C F3: 2% w / v gelatin (pH 5) F4: 2% w / v gelatin (pH 8) Gelatin-based film formulations F3 and F4 containing pDNA complexed with PEI in OPTI-MEM™ or PBS as solvent maintained pDNA transfection efficiency after drying of the films (Figure 16B).

[0232] Further results for films containing pDNA complexes after storage at 25° C. and 60% RH for up to 11 days were obtained with the following gelatin-based film formulations (FIG. 16C): F1: 2% w / v gelatin in OPTI-MEM™ (pH 5) F2: 2% w / v gelatin in PBS (pH 5) F3: 2% w / v gelatin in OPTI-MEM™ (pH 8) F4: 2% w / v gelatin in PBS (pH 8) As previously described, pDNA-PEI complexes were added to the film matrix so that each 100 μl of film contained 2.5 μg of DNA at a DNA:PEI ratio of 1:4. These results demonstrate that the resulting gelatin-based film formulation can significantly improve the stability and performance of pDNA complexes after storage at 25 °C and 60% RH for up to 11 days.

[0233] In a second experiment, complexes were again formed in several aqueous media (water, Opti-MEM, PBS, Tris buffer) by three different methods. Method 1 involved mixing equal volumes of PEI and plasmid DNA together before adding them to the film formulation. This approach supported high levels of transfection (79.0 ± 0.5% Opti-MEM, 96.1 ± 1.0% PBS, Figure 45A). Method 2, in which PEI was added dropwise to a solution of plasmid, produced somewhat improved results (81.5 ± 2.1% Opti-MEM, 107.8 ± 2.3% PBS). In contrast, Method 3, in which the plasmid was added dropwise to a solution of PEI, induced rapid precipitation of the plasmid, which significantly impaired transfection efficiency. Water and Tris buffer, which did not have the pH and ionic strength to support proper condensation of the plasmid, also failed to transfect cells (Figure 45A). Therefore, method 1 was chosen to form the plasmid-PEI complexes before drying within the film matrix for the remainder of the study. Although preparations made in PBS supported higher transfection efficiencies than Opti-MEM during the screening process, there was no statistical difference between the transfection efficiencies of the plasmids in films prepared using either solution (p>0.18 for all polymers, Figure 45B). Films prepared in gelatin were able to maintain the full transfection efficiency of PEI-DNA complexes (103.2–111.6% relative to complexes freshly prepared in medium). Complexes prepared in medium and left at room temperature during the drying process retained only 12.2–14.1% of their original transfection capacity (RT control in Figure 45B). Gelatin films prepared in PBS were able to maintain high levels of transfection efficiency after 7 days (pH 5, 83.2 ± 1.2%; pH 8, 93.4 ± 4.5%) and 14 days (pH 5, 73.3 ± 1.9%; pH 8, 71.1 ± 7.1%) at 25 °C (Figure 45C). The pH of the film matrix significantly affected the stability of PEI-DNA complexes prepared in Opti-MEM after 14 days at 25°C (pH 5, 64.9 ± 3.6% and pH 8, 34.1 ± 3.0%, respectively).

[0234] B. Lipofectamine™ Complexed pDNA In the first experiment, pDNA complexed with Lipofectamine™ was prepared in four optimized formulations (F1 Liq, F1-F3 Films) to evaluate the effect of the formulation on pDNA transfection efficiency. The formulations for pDNA complexed with Lipofectamine™, F1 Liq and F1-F3 Films, were as follows: F1 Liq: 2% w / v HPMC A4C (viscosity 400 cP) liquid formulation, 10 mM Tris (pH 8.5) F1 film: 2% w / v HPMC A4C (viscosity 400 cP) film formulation, 10 mM Tris (pH 8.5) F2 Film: 1% w / v HPMC A4C (viscosity 100 cP) film formulation, 10 mM Tris (pH 8.5) F3 film: 2% w / v gelatin The formulation contained 2 μg of plasmid DNA complexed with Lipofectamine™ 2000 CD Reagent and films were dried onto 100 μl silicone molds.

[0235] Figure 15 shows the effect of optimized liquid (liq) or film formulations F1-F3 on the transfection efficiency of Lipofectamine-complexed plasmid DNA prepared in the liquid or film formulations after 2 weeks of storage at 25°C and 60% relative humidity (RH). The transfection efficiency of plasmid DNA prepared in the F3 formulation was statistically higher (p<0.001) than that of plasmid DNA prepared in the buffer-only control (Buffer (Liq)), F1 liquid (F1 Liq), and F2 film on days 4-21. The transfection efficiency of plasmid DNA prepared in the F3 film formulation was also statistically higher (p<0.05) than that of plasmid DNA prepared in the F1 film formulation on day 21.

[0236] In a second experiment, the formation of DNA-lipofectamine (LPF) complexes was optimized by varying the volume of Opti-Pro medium used to individually dilute the plasmid and lipofectamine before mixing (Figure 46A). The highest level of transfection was achieved by placing 1 μg of DNA in 10–12.5 μl of medium. This was 15-fold higher than that recommended by the manufacturer (1 μg of DNA in 50 μl of medium). Films prepared using gelatin (pH 5, P3 and pH 8, P4) and different types of HPMC (P6 and P7) retained over 80% of their original transfection efficiency during the film formation process, whereas those made with chitosan (P1), pectin (P2), and alginate (P8) did not support any transfection efficiency at all (Figure 46B). Formulations F2, F3, and F4 (Table 4) preserved the transfection efficiency of LPF-DNA complexes within the film matrix after 4 days at either 4°C or 25°C, whereas the transfection efficiency of complexes in medium alone (control) decreased to 48.0±0.3% at 4°C and 3.2±0.2% at 25°C (Figure 46C). Formulations F3 and F4 retained 86.2±6.0% and 92.0±3.7% of their original transfection efficiency after 14 days at 25°C, whereas complexes in medium alone decreased to 12.6±0.1% (Figure 46D). Collectively, these data demonstrate that embedding DNA complexes within a film matrix can preserve transfection efficiency during storage at 25°C, as complexes stored in buffer solution under the same conditions precipitated and were unable to transfect cells after 24 hours under the same conditions. It was also apparent that the LPF-DNA complexes were more stable than those formed with PEI, as the transfection efficiency never fell below 90% over the 14-day period. Therefore, the stability of the mRNA LNPs within the film matrix was assessed.

[0237] Example 4 - Optimization of LNP-encapsulated RNA film formulation In addition to optimizing film formulations for naked or transfection-reagent-complexed DNA, we also conducted studies to optimize film formulations for lipid nanoparticle (LNP)-encapsulated RNA (e.g., mRNA). LNPs are lipid droplets with an aqueous core containing a series of reverse micelles that bind, protect, and deliver nucleotides such as mRNA (Figure 43). Several different types of lipids are commonly used to create these particles. Ionizable lipids retain a positive charge within the acidic environment of the aqueous core to form a micellar network that binds to mRNA through electrostatic interactions. When they reach physiological pH in solution or in vivo, they become neutral, making them biocompatible. In endosomes, ionizable lipids return to their original positively charged state and interact with anionic phospholipids to disrupt the endosomal membrane, facilitating the release of intact mRNA-containing micelles into the cytoplasm (Figure 44). Neutral phospholipids and cholesterol are responsible for maintaining the organized lipid shell. Helper lipids, such as distearoylphosphatidylcholine (DSPC), also contribute to endosomal escape by interacting with the endosomal membrane. Small amounts of lipids attached to polyethylene glycol (PEG) dispersed throughout the lipid phase of particles have been shown to prevent aggregation, prolong circulation time, and reduce particle clearance, significantly affecting particle size, surface charge, and physical stability. PEG molecules on the outer shell of particles form a hydration shell that prevents opsonization and partially governs particle stability. PEG can also serve as a linker for the attachment of targeting molecules to restrict where particles are taken up and genes are expressed.

[0238] LNPs containing mRNA are typically prepared by mixing single-stranded ribonucleic acid molecules in an acidic aqueous buffer with lipids in an ethanol solution in a microfluidic system where the flow rate, volume ratio, and flow pattern within the mixing chamber are highly controlled (Figure 45). In practice, 40–80% of LNPs prepared in this manner do not contain mRNA, although each LNP contains two to six mRNA molecules. Unencapsulated material is removed by dialysis or ultracentrifugation, and the particles are suspended in a buffer solution, often phosphate-buffered saline (PBS, pH 7.4) or Tris (pH 8). The buffer choice has been shown to significantly affect the physical stability of LNPs. For example, Tris-buffered self-replicating mRNA-containing LNPs stored at 4 and -20°C were greater than those stored in phosphate-buffered saline. Tris buffers have also been found to minimize changes in solution pH during freezing and adduct formation from aldehyde impurities derived from the lipid components. Each of the currently commercially available COVID-19 vaccines is formulated as a frozen buffered solution containing sucrose (Table 3). Each of these products has been shown to be stable in solution for up to 10 weeks at 4°C, but is discarded within 24 hours at 25°C. Interestingly, an LNP-based product containing siRNA (ONPATTRO®) is formulated as a buffered solution that is stable for 3 years at 4°C (Table 3). This improved stability profile may be due to the short double-stranded structure of mRNA and self-replicating RNA, as opposed to the long single-stranded structure. Table 3 - Stability of current RNA LNP products on the market [Table 3]

[0239] To date, limited information is available regarding the stability of mRNA LNPs in the solid state. A careful review of the literature revealed that most lyophilized products are stored frozen to maintain transfection efficiency. LNPs prepared with formulations containing more than 5% (w / v) sugars showed an increase in particle size before lyophilization, which further increased once the process was completed. Storage at 4 or -20 °C was necessary to maintain the physicochemical properties of the particles. After the lyophilization process was completed, some reports were conflicting, as the transfection efficiency or in vivo bioactivity of lyophilized LNPs was not impaired, despite the fact that a significant decrease in encapsulation efficiency and an increase in particle size were detected upon completion of drying. Taken together, this suggests that lyophilization cannot yet support storage of mRNA LNPs outside the cold chain and that the physicochemical properties of LNPs may not fully predict in vitro or in vivo performance.

[0240] Disclosed herein is a drying technique that avoids cold denaturation and dramatic temperature fluctuations during freeze-drying due to its ability to stabilize mRNA LNPs under ambient conditions within a film matrix. The use of data collected from commonly accepted stability-indicating assays for LNP products to predict biological activity is also disclosed. The successful identification of a film-based formulation that eliminates the need for ultra-low temperature cold chain storage and transport, as well as the identification of predictors of LNP performance, could significantly improve access to these life-saving drugs and prepare for the next pandemic.

[0241] A. Formulation overview. Specific details of the formulations of Examples 3 and 4 are summarized in Table 4. Table 4 [Table 4-1] [Table 4-2]

[0242] B. pH and Film Base Selection Films prepared with gelatin (grade A, pI 7-9.5) were shown to improve the transfection efficiency of mRNA LNPs containing the beta-galactosidase gene sequence (Figure 17). Solutions containing mRNA LNPs (100 μg / ml) were prepared using 2% gelatin in various buffers. Films formulated at pH 5 were prepared in 100 mM citrate buffer, while films formulated at pH 7-9 were prepared in 10 mM Tris, with the pH adjusted accordingly. Transfection efficiency was assessed before drying (liquid) and after film formation (film). The pH 9 preparation significantly enhanced the transfection efficiency of the LNP stock and maintained the enhanced transfection efficiency throughout the film formation process.

[0243] In a second experiment, we evaluated the effect of pH on mRNA-containing LNPs, as we previously found that gelatin-based films prepared in pH 5 and pH 8 buffers preserved the transfection efficiency of DNA complexes within the film matrix (Figure 47). pH 6 and pH 6.5 buffers increased the mean particle size and particle distribution index (PDI) of LNPs after 3 days at 4 °C (Figure 47A). Encapsulation efficiency also decreased, although transfection efficiency remained high under these conditions (Figure 47B). The mean particle size and PDI of LNPs increased in formulations prepared in K100LV and buffers pH 7–9 during the film formation process (Figure 47C). However, LNPs in formulations buffered at pH 8 and 9 had transfection efficiencies of 83.2 ± 10.6% and 165.8 ± 14.0%, respectively, despite the decreased encapsulation efficiency (Figure 47D). Therefore, Tris buffer pH 8 was selected for use in all formulations for screening studies.

[0244] Gelatin-based formulations, which preserved the transfection efficiency of DNA complexes, did not support the stability of mRNA-containing LNPs (Figure 48). LNPs placed within this formulation (P8) underwent a significant increase in particle size from 136 to 222 nm and the associated particle distribution index from 0.055 to 0.338 (blue dots, Figure 48A). Transfection efficiency also decreased to 30.7 ± 7.8%. Screening of additional polymers revealed that formulations containing different types of HPMC (P1–P3) could maintain transfection efficiency with a moderate increase in particle size and PDI during the drying process. Formulations containing hydroxyethylcellulose (P4), Walocel (P5), pullulan (P6), and PVA (P7) formed large aggregates (Figure 48A) and were unable to enter cells (Figure 48B). LNPs formulated with K100LV had very similar properties to the original stock solution (particle size 189 nm; PDI 0.297; transfection efficiency 96.7%) (Figure 59).

[0245] C. Sugar Selection Gelatin-based films have been shown to improve the transfection efficiency of mRNA LNPs, but the inclusion of sugars in the film formulation impaired the stability of mRNA LNPs in frozen and dried states (Figure 18A). Particle size analysis of LNPs (25 μg / ml) in phosphate-buffered saline (PBS, pH 7.4) and 1% glycerol (Record 29, green line) or 1% sucrose (Record 62, blue line) after storage at -80°C showed that the inclusion of sucrose in the LNPs increased the size distribution of the LNPs. All data were compared to particle size data for LNPs stored in water at 4°C (Record 58, red line), which remained unagglomerated. In contrast to sugars, the inclusion of film-forming polymers in the film formulation preserved transfection efficiency during the film formation process (Figure 18B). The formulations tested were PBS-T: trehalose 1%; Gel: gelatin 2%; PVA: polyvinyl alcohol 2%; K4M: HPMC 2% (4000 cps); and A4C: HPMC 2% (400 cps). All formulations were prepared in 10 mM Tris buffer, pH 8.1.

[0246] As an alternative to sucrose, cyclodextrin was included in the liquid and dry formulations to test the effect of cyclodextrin on the transfection efficiency of LNP-encapsulated mRNA after storage in the liquid film formulation or dry film. It was demonstrated that cyclodextrin improved the transfection efficiency in the liquid formulation and maintained the transfection efficiency in the dry film. Figure 19A shows the stability of mRNA LNPs (25 μg / ml) stored in the liquid formulation at 20 ° C for 5 hours (dark bars) and 24 hours (white bars). The formulations tested contained the following: Stock: Tris buffer (pH 9); PBS: phosphate-buffered saline (pH 7.4); alpha: alpha cyclodextrin 1% (w / v); beta: beta cyclodextrin 0.1% (w / v); gamma: gamma cyclodextrin 1% (w / v); HP-BCD: hydroxypropyl beta cyclodextrin 1% (w / v); and M-BCD: methoxy beta cyclodextrin 1% (w / v). Figure 19B shows the transfection efficiency of mRNA LNPs (25 μg / ml) in film stored at 4°C for 4 days. Data are normalized to the transfection efficiency of a fresh frozen stock of LNPs. The formulations tested contained the following: Buff (Liq): LNP stored in liquid form in phosphate-buffered saline (pH 7.4); G-HP-B: 2% gelatin, 1% (w / v) hydroxypropyl beta-cyclodextrin; G-GCD: 2% gelatin, 1% (w / v) gamma-cyclodextrin; and G-MBCD: 2% gelatin, 1% (w / v) methoxy beta-cyclodextrin. All of the aforementioned cyclodextrin formulations were prepared in PBS pH 7.4.

[0247] D. Glycerol and surfactants Increasing glycerol from 2% to 4% significantly reduced particle size from 199 nm to 161 nm and PDI from 0.336 to 0.131 (p<0.001, Figure 49A), without changing transfection efficiency (2%, 83.2 ± 10.6% vs. 4%, 71.8 ± 5.9%, p=0.63, Figure 49B). Films made with 8% glycerol remained wet like hydrogels, despite a longer drying time. Adding the hydrophilic nonionic surfactant Pluronic® F127 to the film matrix produced smaller, more homogeneous LNPs in the solution produced upon rehydration (F127-based, Figure 50A). This also significantly improved transfection efficiency (189.1 ± 9.7%, Figure 50B). This effect was more pronounced when Pluronic® F127 was mixed with the LNP stock before mixing with the bulk film formulation (F127 LNP, particle size 159 nm; PDI 0.137; EE 83.0%; transfection efficiency 234.4%). While these results appeared promising, films prepared using the F127 LNP approach showed a significant increase in particle size (from 152±6 nm to 213±7 nm) and PDI (from 0.122±0.027 to 0.354±0.018) after 1 week of storage at 4°C, accompanied by a corresponding decrease in transfection efficiency (from 127.5±5.4% to 33.5±5.2%, without PEG lipid, Figure 51).

[0248] E. PEG lipid Two PEG lipids commonly used in LNP fabrication, DMPE-PEG and DMG-PEG, were included as excipients in the film matrix at two concentrations: 0.008% (low) and 0.04% (high). The inclusion of these excipients in the film base significantly improved particle size and PDI relative to lipid-free formulations (no PEG lipid 152 ± 6 nm vs. low DMPE-PEG 143 ± 1 nm, p = 0.61; vs. high DMPE-PEG 131 ± 4 nm, p = 0.01, Figure 51A). The effect of lipid became more evident after 7 days at 4 °C, as particle size increased in lipid-free films (213 ± 7 nm), whereas particle sizes remained at 166 ± 1 nm and 126 ± 5 nm for low DMPE-PEG and high DMPE-PEG, respectively (p < 0.001). Despite the improved particle size, higher lipid concentrations made the LNPs "leaky," with encapsulation efficiencies of 36.2 ± 3.3% (DMPE-PEG) and 56.2 ± 0.4% (DMG-PEG, Figure 51C). Transfection efficiencies followed a similar trend in freshly prepared films (10.3 ± 1.7% (DMPE-PEG) and 37.9 ± 11.3% (DMG-PEG, Figure 51D). Lower concentrations of PEG lipids did not impair encapsulation and transfection efficiencies during the film formation process (day 0, red and dark blue bars, Figures 51C and 51D). Despite these findings, the transfection efficiencies of LNPs in these preparations decreased to 76.5 ± 10.6% (DMPE-PEG) and 66.9 ± 13.2% (DMG-PEG) after 7 days at 4 °C.

[0249] F. Polymer viscosity An initial screening of film-forming polymers was performed using low-viscosity preparations for ease of dissolution and use as an injectable product. The optimal polymer from these studies failed to support long-term stability of mRNA-containing LNPs, so we evaluated stability in high-viscosity polymers, which were shown to be superior to the low-viscosity polymers used in studies for stabilizing AAV9 within a film matrix. Mixing the polymers (K4M and K100LV) in different ratios produced solutions with viscosities ranging from 56 to 169 cps (Table 5). Table 5 Film Viscosity [Table 5]

[0250] The LNPs in films prepared using these formulations had comparable particle size (162–193 nm), PDI (0.158–0.261), and encapsulation efficiency (80.0–87.5%) (Figure 60A–60C). Transfection efficiency was 2–4-fold higher than that observed from frozen LNP stock solutions (Figure 60D, buffer solution). After 4 weeks at 4°C, a significant increase in particle size and a decrease in transfection efficiency were observed in all formulations tested. Formulations containing low-viscosity (F20) and high-viscosity (F24) polymers maintained the smallest particles (268 ± 43 and 234 ± 14, respectively) and the best encapsulation efficiencies (82.6 ± 1.2% and 80.8 ± 2.3%, respectively), so additional studies were conducted using films containing each polymer and several different phospholipids (Figure 52).

[0251] LNPs in films prepared with K4M and PEG lipids showed a significant increase in particle size (DMPE-PEG, 168 nm to 193 nm; DMG-PEG, 163 nm to 215 nm, Figure 52A) and a significant decrease in encapsulation efficiency (DMPE-PEG, 80 to 63%; DMG-PEG 80 to 59%, Figure 52C) after 28 days at 4 °C. Films containing K4M and the phospholipid, DMPC, supported minimal changes in particle size (150 to 160 nm) and PDI (0.195 to 0.215, Figure 52B) and encapsulation efficiency (85% to 79%) after 28 days at 4 °C. Despite this, the transfection efficiency of LNPs in this formulation was very low after drying was complete (47.0 ± 4.5%, D0) and after 28 days at 4 °C (14.4 ± 3.8%, Figure 52D). Degradation of LNPs in formulations prepared with low-viscosity polymers occurred at a much faster rate. A significant increase in particle size was observed in these preparations after 14 and 28 days at 4 °C (Day 14: DMPE PEG 171 ± 9 nm; DMG PEG 270 ± 26 nm; DMPC 275 ± 6 nm and Day 28: DMPE PEG 309 ± 17 nm; DMG PEG 348 ± 37 nm; DMPC 288 ± 19 nm, p < 0.001, Figure 52A). A similar trend was observed for encapsulation efficiency (Day 14: DMPE PEG 67.7 ± 4.6%; DMG PEG 44.8 ± 9.1%; DMPC 46.7 ± 4.0% and Day 28: DMPE PEG 48.7 ± 6.2; DMG PEG 26.4 ± 4.9%; DMPC 47.2 ± 1.0%, Figure 52C). However, the transfection efficiency of LNPs in these preparations was similar to that in formulations containing the K4M polymer (Figure 52D).

[0252] G. Surfactant Combinations As shown in Figure 23, the addition of a plasticizer (e.g., Pluronic® F127) can significantly improve the transfection efficiency of LNP-encapsulated mRNA compared to that of LNP-encapsulated mRNA prepared in films containing other surfactants or plasticizers. Films containing 100 μg / mL of mRNA LNPs containing the firefly luciferase gene sequence were prepared using 1.5% KLV100 film base, surfactants and plasticizers including 0.5% pullulan, 0.1% PMAL, 0.5% PEG 1500, or 0.01% Pluronic® F127, and 2% glycerol. Transfection efficiency represents the number of cells expressing the luciferase transgene normalized to that obtained with a fresh, unformulated LNP stock.

[0253] To further improve LNP stability within the film matrix, additional studies combined Pluronic® F127 with a nonionic surfactant, often used in pharmaceutical formulations to prevent aggregation and in suspension culture media to protect cells from hydrodynamic and bubble-induced shear. The addition of the surfactant combination did not significantly affect particle size, PDI, or transfection efficiency of LNPs during the film formation process (DO, Figure 53). However, encapsulation efficiency was significantly reduced by all formulations tested (DO, Figure 53C). After 2 weeks at 4°C, LNPs in formulations containing the surfactant combination had significantly better physical properties than those containing Pluronic® F127 alone. The formulations containing Pluronic® F68 and Brij® 58 had the lowest particle size (151±1 nm and 155±4 nm) and PDI (0.150±0.001 and 0.184±0.001) of all formulations tested (Figures 53A and 53B). Encapsulation efficiency was significantly reduced in all formulations tested at day 14, with the formulation containing Pluronic® F68 having the highest value (77.4±0.5%). Despite these results, transfection efficiency was reduced by approximately 40% in all formulations tested (D14, Figure 53D).

[0254] H. pH of the film base Screening of several different film formulations revealed that the pH of films prepared in 10 mM Tris pH 8 decreased to 6.5 after drying, sucrose (10%) in the same buffer further reduced the pH to 6.0, and those prepared in PBS reduced the pH to 5.5 (Table 6). Table 6 Dry film pH [Table 6]

[0255] The internal film pH did not affect the physical and biological properties of LNPs during the drying process (D0, Figure 54). After 14 days at 4 °C, the particle size and PDI of LNPs in formulations prepared with pH 7.4 buffer increased to 242 ± 17 nm and 0.365 ± 0.030, respectively (Figures 54A and 54B). Despite this, encapsulation efficiency remained high (82 ± 0.6%), and transfection efficiency was 62.8 ± 3.4% (Figures 54C and 54D). LNPs stored in films prepared with pH 8.5 buffer had optimal particle size (149 ± 1 nm), PDI (0.139 ± 0.009), encapsulation (82.6 ± 0.9%), and transfection (103.9 ± 6.3%) efficiencies. The formulation in pH 9 buffer had similar properties, but the transfection efficiency increased to 197 ± 19.2% after 2 weeks at 4° C. As this may be a sign of particle instability, pH 8.5 buffer was selected to prepare additional optimized formulations.

[0256] I. Amino acids and EDTA in optimized formulations To further improve the stability of mRNA-containing LNPs, a compound found to stabilize DNA within the film matrix for up to 9 months at room temperature was added to an optimized formulation of 1% K4M / 3% glycerol / 0.006% Pluronic® F127 / 0.006% Pluronic® F68 / 0.008% DMPE-PEG in 10 mM Tris buffer, pH 8.5. Addition of the cationic alkaline amino acid arginine to the formulation significantly enhanced the transfection efficiency of LNPs stored in the formulation for 14 days (241.5 ± 9.5%) and 28 days (268.5 ± 1.0%) (Figure 55D), up to 112 days (Figure 63D). Addition of the chelating agent EDTA to the optimized formulation also had a similar effect (241.7 ± 8.4%, day 14; 265.4 ± 3.1%, day 28). Each of these formulations was also able to maintain LNP particle size, PDI, and encapsulation efficiency for 1 month at 4°C (Figures 55A-C) and up to 112 days at 4°C (Figures 63A-C). It is also important to note that only the optimized formulations were able to maintain optimal physical and biological attributes throughout the 28-day and 112-day periods at 4°C. In contrast, the incorporation of cysteine, known to prevent oxidation, did not significantly improve transfection efficiency at day 14 (103±7.7%), but did improve this value at day 28 (210.3±14.3%, Figure 55D).

[0257] J.mRNA LNP concentration Figure 20 shows that the concentration of mRNA LNPs in the film matrix can affect transfection efficiency upon rehydration. Films containing 40, 100, or 250 μg / mL of mRNA LNPs were prepared in a base formulation of 1.5% KLV100, 0.5% pullulan, and 3% glycerol. The films containing mRNA LNPs were dried, rehydrated, and transfection was evaluated. As shown, increasing the concentration of mRNA LNPs in the film corresponds to a decrease in transfection efficiency for the mRNA LNPs.

[0258] K. Selection of Rehydration Solvent Figure 21 shows that the solvent used to rehydrate the film can affect the transfection efficiency of mRNA LNPs containing the gene sequence for firefly luciferase. All films were prepared with 100 μg / mL mRNA LNPs in a base formulation of 1.5% K100LV HPMC, 0.5% pullulan, and 3% glycerol in Tris buffer (pH 8). Films were dried at 22 °C and 60% relative humidity. Once dry, the films were rehydrated in the following solvents to assess transfection efficiency: 1: fresh stock (control for comparison); 2: water for injection (WFI); 3: buffered saline; 4: Tris (pH 8); 5: 1% Pluronic® F127 in Tris (pH 8); 6: 0.01% Pluronic® F127 in Tris; 7: 0.001% Pluronic® F127 in Tris; 8: 0.001% Pluronic® F68 in Tris (pH 8); 9: 0.5% PEG 1500 in Tris (pH 8); and 10: 0.01% PEG 1500 in Tris.

[0259] L. Manufacturing and Storage Conditions Films were dried at 20 °C in chambers set at relative humidity levels of 52.5, 49, 45, and 40%. For each condition, films were collected upon visual inspection (thorough drying) and after 1 h (extended drying, Figure 58). The sufficient drying time was reduced by the low humidity environment. LNPs in films prepared under the thorough drying protocol had similar particle sizes (Figure 58A). The PDI increased as RH decreased (blue dots, Figure 58A). Increasing the drying time by 1 h significantly increased LNP particle size (from 160 nm to 262 nm in decreasing order of humidity) and PDI (from 0.293 to 0.462), and significantly reduced encapsulation (from 73.5% to 45.5%) and transfection (from 128.6% to 75.2%) efficiencies (Figure 58B).

[0260] LNPs in films stored at 25°C for 14 days showed an increase in particle size (193 ± 29 nm) and PDI (0.199 ± 0.042), but the encapsulation efficiency remained at 81.6 ± 1.7%, and the transfection efficiency decreased to 2.7 ± 0.6% (Figures 56A and 56B). LNPs in films stored at -20°C did not undergo significant changes in physical and biological properties over the 14-day period. The effect of environmental humidity on LNP stability within the film matrix was studied at 4°C. Relative humidity did not significantly affect the particle size, PDI, or encapsulation efficiency of LNPs stored within the film matrix (Figures 56C and 56D). Transfection efficiency was compromised after 2 weeks at 4°C, regardless of the relative humidity of the storage chamber (102.9 ± 11.4%, fresh film vs. 24.3-40.0% (in decreasing order of humidity), Figure 56D). Taken together, this data suggests that temperature, but not relative humidity, significantly affects the transfection efficiency of mRNA LNPs stored within a film matrix.

[0261] M. Optimized LNP-encapsulated RNA film formulation Based on the aforementioned studies, six optimized film formulations, F1-F4, were generated and their effects on LNP-encapsulated mRNA transfection efficiency were evaluated. The formulations were GP, GPT, GPS, KP, KPT, and KPS: GP: Gelatin 2%: Pluronic® F68 0.01% GPT: Gelatin 2%: Pluronic® F68 0.1%, Trehalose 1% GPS: Gelatin 2%: Pluronic® F68 0.1%, Sucrose 1% KP:K4M HPMC 2%:Pluronic® F68 0.01% KPT:K4M HPMC 2%:Pluronic® F68 0.1%, Trehalose 1% KPS:K4M HPMC 2%:Pluronic® F68 0.1%, Sucrose 1% All preparations were made in 10 mM Tris buffer, pH 8. As shown in Figure 22, all of the above complex formulations improved the transfection efficiency of mRNA LNPs containing the gene sequence of beta-galactosidase during the film formation process.

[0262] We also conducted a study to demonstrate that the order in which excipients were added to form an optimized film could significantly affect the transfection efficiency of mRNA LNPs in the film (Figure 24). Films were prepared using two methods: bulk or blended. In the bulk method, excipients for the film matrix were blended to create a homogenous solution. LNPs were then added to the solution, blended, and the formulation was added to a mold for drying. For the blended method, surfactant or plasticizer components of the film were blended with LNPs. This blend was then added to a homogenous solution of the film base polymer and glycerol, blended, and added to a mold for drying. The formulations tested contained the following: 1. 1.5% KLV100 HPMC, 0.01% Pluronic® F127, and 3% glycerol in Tris, pH 8 (the "mixed" formulation was prepared by adding Pluronic® F127 to the LNP and then adding the resulting solution to a mixture of KLV100 and glycerol). 2. 1.5% KLV100 HPMC, 0.5% PEG1500, and 3% glycerol in Tris, pH 8 (the "mixed" formulation was prepared by adding PEG1500 to the LNP and then adding the resulting solution to a mixture of KLV100 and glycerol). 3. 1.5% KLV100 HPMC, 0.1% PMAL in Tris, pH 8. C16 and 2% glycerol ("mixed" formulations were prepared by adding PMAL to LNPs and then adding the resulting solution to a mixture of KLV100 and glycerol.) For all formulations tested, the mixing method, in which the surfactant or plasticizer component of the film was mixed with the LNPs, resulted in higher transfection efficiencies for mRNA LNPs.

[0263] N. Overview Herein, we describe the influence of various parameters related to the incorporation of mRNA LNPs within a film matrix using the current gold standard metrics of LNP performance. Particle size, size distribution (reported as polydispersity index (PDI)), and encapsulation efficiency provide information on the physical properties of the LNPs and offer insight into the particle structure and integrity. Specifications for these parameters can be found in Figure 59.

[0264] One obstacle to stabilizing mRNA-containing lipid nanoparticles in liquid formulations is maintaining the particle's lipid network in its lowest energy state. As lipid molecules bend, the energy associated with this molecular motion rises, gradually increasing particle size in a manner that favors particle aggregation, fusion, or eventual disruption. The bending of lipid molecules and the presence of electrophilic impurities associated with ionizable lipid stocks can also initiate lipid degradation, the byproducts of which can accelerate RNA degradation within the particle, often at a faster pace than free RNA in solution. This process accelerates as temperature increases and molecular motion increases, or when stabilizing water molecules are removed from around the lipid shell during the film formation process. During this process, the particle's phases may also begin to separate internally, shifting the RNA into the particle's aqueous phase and accelerating its degradation by hydrolysis and oxidation. This can also occur during freezing, but molecular motion is subsequently interrupted in the frozen and / or solid state. When films of the optimized formulation (of pH 8) were placed at -20 °C, physical and biological parameters remained stable for at least 5 weeks (Figure 56, Figure 61); however, transfection efficiency was significantly impaired after 2 weeks at 4 °C (Figure 56B and Figure 56D). The in vivo activity of LNPs containing self-replicating RNA has been shown to decrease 2-4 fold after 7 days of storage at 4 °C, despite their excellent stability profile at -20 °C. Collectively, this highlights the challenges of stabilizing LNPs at temperatures above freezing and the complex role excipients play in maintaining LNP stability in the liquid and solid states.

[0265] Of the polymers evaluated, HPMC did not impair transfection efficiency during the film formation process (Figure 48). HPMC is unique in that it is available in various grades with different physical and thermal properties regarding water absorption and water vapor and gas permeability. They also differ in molecular weight and hydroxypropyl / methoxy substituents, which affect the release of materials from the film, hydration capacity, and emulsion stabilization efficacy. Of the three grades tested (A, E, and K), grade K HPMC was able to better maintain LNP particle shape and transfection efficiency (Figure 48). Interestingly, grade K contained the lowest methoxy content (19.0–24.0%) with a similar hydroxypropyl content (7–12%) as grade E material, suggesting that this hydroxypropyl / methoxy substitution ratio is optimal for forming a protective matrix around the hydrophilic shell of LNPs during the drying process and upon rehydration (Figures 60 and 52).

[0266] Because most mRNA LNP preparations are currently formulated as injectable products, initial formulation development focused on polymers with viscosities ranging from 56 to 169 cps (Figure 58). Because the lowest-viscosity polymer (K100LV) performed poorly alone (Figure 52), it was mixed in various ratios with the highest-viscosity polymer (K4M) to improve LNP stability by preventing aggregation and maintaining particle integrity during the drying process. All formulations tested improved the transfection efficiency of LNPs in freshly prepared films, but those containing each polymer alone (K100LV, F20 and K4M, F24) showed an increase in particle size and a decrease in encapsulation and transfection efficiency during storage at 4 °C (Figure 60, Table 5). Additional studies were initiated to evaluate the stability of LNPs in films prepared individually with the K100LV and K4M polymers. In these preparations, PEG-conjugated lipids were added to the matrix to support particle integrity during the film formation process and long-term storage (Figure 52). The lipids selected for this study are common components of mRNA LNPs (Figure 42). Various reports have found that the amount of PEG-conjugated lipid contained in the LNP structure can significantly affect the bioactivity of the preparation without any detectable changes in physical properties. LNPs containing 0.5–3% DMPE-PEG lipid in the particle structure were previously evaluated, and particles containing 1.5% lipid were found to have the highest transfection efficiency. It has been reported that particle size decreases as the amount of PEG-conjugated lipid contained in the particles increases, but in vivo gene expression is significantly reduced due to steric hindrance between the particles and cellular targets. Exogenous PEG-conjugated lipids added to LNP preparations at concentrations far exceeding those typically contained in the particle structure (25–60% vs. 15% or less lipid molar content) have been utilized to maintain particle size during nebulization and improve pulmonary delivery. Although these concentrations cannot be supported in film-based dosage forms or injectable products, very small amounts of lipid (0.008%) maintained LNP stability, while higher concentrations (0.04%) destroyed the particles during the film formation process (Figure 51).A single PEG-free lipid was also evaluated as an external excipient. It was able to maintain the physical properties of the LNPs, but the transfection efficiency was low, suggesting that it formed a seal around the LNPs, making them too robust to release mRNA for transfection (Figure 52). It is important to note that the concentration of PEG-conjugated lipid used as an external excipient in the formulation herein is significantly lower than the PEG-lipid concentration in commercially available LNP particles, which ranges from 0.02 to 0.035% w / w. Since no PEG-lipid was detected in patients who received multiple doses of the LNP-based COVID-19 vaccine, it should not inhibit cell entry or promote toxic effects such as the formation of anti-PEG antibodies. Interestingly, the high-viscosity polymer maintained the physical properties of the LNPs within the film matrix better than the low-viscosity polymer (Figure 52).

[0267] Surfactants have been used to produce and stabilize solid lipid nanoparticles to improve the permeability and oral bioavailability of small molecule drugs. They are typically added to the aqueous phase of the particles before mixing with the drug-containing lipid phase so that they are present on the particle surface. Surfactants are also common components of film-based dosage forms because they spread across the template surface during dissolution and promote wetting of the film. They also lower the surface tension of the film matrix, reducing the water-absorbing properties of the HPMC base and making the hydrophilic groups less accessible to water molecules. They have also been shown to play an important role in the thermal stabilization and delivery of biological drugs. However, when used as external excipients, surfactants can easily dissolve mRNA LNPs. Adding Pluronic® F68 and Pluronic® F127 to LNP stocks up to a concentration of 0.006% before mixing with the polymer base did not change the physical and biological properties of LNPs in fresh films (Figure 50) and improved stability during storage at 4°C (Figure 53). This concentration was useful for maintaining LNP stability, as lower concentrations (0.001–0.003%) promoted LNP aggregation after 14 days at 4 °C (data not shown). The use of other amphiphilic nonionic surfactants, such as Tween® 20, Tween® 80, and Brij® 58, was less effective. This suggests that when poly(ethylene oxide) (PEO)-poly(propylene oxide) (PPO)-poly(ethylene oxide) (PEO) triblock copolymers are used at concentrations much lower than their critical micelle concentrations (F127, 0.26–0.8 wt %; F68, 0.033–0.4 wt %), they form a molecular dispersion of the monomer when the monomer is added to the viscous film base, forming a network of protective micelles around the particles during the drying process when water is removed from the hydrophilic groups. Reconstitution of the film matrix allows the Pluronics® to disperse as monomers that align themselves with the PEG-lipid and polymer base, maintaining the particle size and transfection efficiency of the LNPs.

[0268] Glycerol is commonly included in film-based products to enhance the flexibility and flexibility of the final product. Glycerol is also an established cryoprotectant for cells, tissues, viruses, and liposomes through its ability to reduce ice crystal formation and osmotic pressure changes during freezing. It has been shown to maintain the lipid bilayer of liposomes during drying and can form hydrogen bonds with water and free hydroxide groups on the LNP. Glycerol may protect mRNA LNPs from dehydration and osmotic pressure changes during the film formation process, as the addition of sugars (i.e., sucrose, trehalose, isomalt) did not affect the LNP properties of fresh films or enhance the 4°C stability of mRNA LNPs. It is important to note that the amount of glycerol required to support LNP stability within the optimized film matrix was higher than the amount required to stabilize other biomolecules (Figure 49). This, coupled with the fact that hydrogen bonding between plasticizers like glycerol and polymers like HPMC creates pockets accessible to water molecules, highlights the importance of packaging to prevent water absorption from the environment.

[0269] Although various excipients have been identified that collectively improve the physical attributes of LNPs during drying and storage, transfection efficiency remains impaired. As previously mentioned, transfection efficiency depends on both an intact lipid shell and mRNA. Recognizing that the pH of the particle and film matrix can affect lipid and mRNA degradation, as shown herein, low pH caused a rapid increase in particle size and loss of transfection in both liquid (pH 6-6.5, Figure 45) and dry (pH 5.5-6.5, Figures 47 and 54) formulations due to acid-mediated hydrolysis of lipids and mRNA. While strong bonds are known to form between the mRNA and ionizable lipids within LNPs, this could not prevent degradation during storage at 4 °C (Figure 54). This also explains why mRNA-based COVID-19 formulations are often formulated at pH 7.5-8 (Table 3), although several reports suggest that maintaining the pH below the pKa of the lipids is necessary to maintain transfection and stability. Increasing the pH of the dried film to above 7 or preparing the film base at pH 8.5-9.0 delayed acid-mediated degradation and significantly improved mRNA LNP stability at 4 °C for 2 weeks (Figure 54).

[0270] In addition to formulation design, operational parameters play a significant role in stabilizing mRNA LNPs within the film matrix. A relative humidity of 52.5% showed minimal impact on mRNA LNP properties during normal and extended drying cycles (Figure 58). Lower humidity and longer drying times damaged mRNA LNPs in fresh films, as indicated by increased particle size and reduced encapsulation and transfection efficiency. mRNA LNPs contain significant amounts of internal water (24 ± 2%). Films prepared with the formulation herein contained 22–25% water content (Figure 57C), suggesting that the drying process maintains equilibrium between the environment within the LNP and the environment within the film matrix. Low humidity and overdrying (or formulations with different tonicity) disrupt this balance, causing the LNPs to collapse or swell in response to disruption. Environmental humidity was previously found to affect the long-term stability of adenovirus, AAV, and plasmids at 25°C and 40°C within a film matrix, but did not significantly affect mRNA LNP stability at 4°C (Figures 56C and 56D).

[0271] The complex structure of mRNA LNPs requires ultra-low temperatures for storage. This posed a significant barrier to the rapid and efficient distribution of vaccines during the COVID-19 pandemic. An optimized formulation containing a series of hydrophilic excipients, including HPMC, PEG-lipid, glycerol, and surfactant, produced preparations with a slightly increased particle size (<10 nm), a 5% decrease in encapsulation efficiency, and no loss of transfection efficiency (Figure 55). This, coupled with the fact that LNPs within the 60–150 nm range retained immunogenicity in nonhuman primates, suggests that a slight increase in LNP size indicates poor clinical performance of the LNPs. A specific concentration of triblock nonionic surfactant can be added to the LNP stock before adding the film-forming polymer to preserve the physical properties of the LNPs during the film formation process. The pH within the film matrix is ​​important for maintaining transfection efficiency. The multi-component optimized formulation disclosed herein can prevent damage to LNPs due to physical changes (osmotic pressure, surface tension, spatial stress, and water loss) during dehydration. They also form a network of hydrogen bonds that preserves the original structure of the LNPs. This is the first report in which the criteria for stabilizing mRNA LNPs within a film matrix have been extensively characterized.

[0272] O. Exemplary Materials and Methods (Examples 3 and 4) Materials. Dulbecco's phosphate buffer solution (DPBS), Trizma base [2-amino-2-(hydroxymethyl)-1,3-propanediol] (Tris), polyvinyl acetate (PVA), Pluronic® F127, sucrose, and trehalose were purchased from Sigma-Aldrich (St. Louis, MO). Glycerol [USP grade] and Aqualine Complete 5 solvent were purchased from Thermo Fisher Scientific Chemicals (Fair Lawn, NJ). Dulbecco's modified Eagle's medium (DMEM), penicillin (10,000 IU), streptomycin (10,000 μg / ml), and 0.25% trypsin-EDTA sterile solution were purchased from Mediatech (Manassas, VA). Pluronic® F68 was purchased from Gibco Life Technologies (Grand Island, NY). Fetal bovine serum was purchased from Mediatech (Corning, Woodlands, CA). Hydranal formamide dry was purchased from Honeywell (Charlotte, NC). Methanol, 99.8% ultra dry, was provided by Acros Organics (Fair Lawn, NJ). Pullulan was obtained from TCI Chemicals (Tokyo, Japan). Gelatin powder type A, 300 bloom, was purchased from Electron Microscopy Sciences (Hatfield, Pennsylvania). The compounds N-(methylpolyoxyethyleneoxycarbonyl)-1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine sodium salt (DMPE-PEG; Sunbright PM-020CN), 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG), and 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) were purchased from NOF America (White Plains, NY) and Avanti Polar Lipids (Alabaster, AL), respectively.Polyethylenimine (linear, MW 25000, transfection grade) was purchased from Polysciences (Warrington, PA). Lipofectamine™ 2000 CD was purchased from Thermo Fisher Scientific Baltics (Vilnius, Lithuania). All other chemicals were analytical reagent grade and purchased from Thermo Fisher Scientific (Pittsburgh, PA) unless otherwise noted.

[0273] Plasmid preparation. Transfection-grade plasmid (pAAV-LacZ, AAV Helper-Free System Stratagene, La Jolla, CA) was amplified in E. coli (HB101 competent cells, Promega, Madison, WI) and purified using the Qiagen Maxi Plasmid kit (Qiagen, Germany). Plasmid stock (OD 260 / 280 ratio 1.7–1.9) was diluted to a concentration of 1–2 mg / ml with 10 mM Tris buffer, pH 8, and stored at -20°C.

[0274] Preparation and storage of films containing plasmid complexes. PEI-DNA complexes were formed by adding 25 μg of pAAV-LacZ in 400 μl to 100 μg of PEI in 400 μl of medium. Lipofectamine (LPF)-DNA complexes were formed by adding 20 μg of pAAV-LacZ in 250 μl (total volume) of Opti-Pro™ SFM medium (Gibco, Thermo Fisher Scientific) to 20 μl of LPF. The sample was kept at room temperature for 20 minutes. At this time, 800 μl of the solution containing the PEI-DNA complex was mixed with 200 μl of the film formulation for a final DNA concentration of 25 μg / ml. The solution containing the LPF-DNA complex was mixed with the film formulation at a 1:1 v:v ratio for a final DNA concentration of 20 μg / ml. The resulting solution was dispensed into 100 μl silicone molds (Bold Maker, Amesbury, MA). All films were dried under sterile conditions at 20 °C. Once drying was complete, a subset of films was reconstituted in transfection medium to analyze loss due to drying. The remaining films were peeled and placed in a Ziploc®-like particle-free bag (American Cleanstat, Irvine, CA) inside a heat-sealed foil bag (Ted Pella Inc., Redding, CA). For most stability studies summarized here, the packaging films were stored in a stability chamber (Binder, Tuttlingen, Germany) set at 25 °C and 60% RH or 4 °C and 40–50% RH. Details of each formulation are summarized in Supplementary Table 1.

[0275] Transfection (plasmid). HEK293 cells (CRL-1573, ATCC, Manassas, VA, passages 12–26) were transfected with 7 × 10 5Cells were seeded into 12-well plates (Falcon, Corning, Durham, NC) at a density of 100 cells / well. The culture medium was changed when the cells reached 80% confluence. After 1 hour, 1 μg of plasmid in 50 μl of Opti-MEM (Life Technologies, Grand Island, NY) was mixed with 4 μg of PEI in 50 μl of Opti-MEM. The resulting solution was incubated at room temperature for 20 minutes before being added to the cells. For LPF-mediated transfection, 1 μg of plasmid in 12.5 μl of Opti-Pro was mixed well with 1 μl of LPF in 12.5 μl of Opti-Pro and then diluted to a concentration of 1 μg of pAAV-LacZ per 100 μl of medium per well. The cells were then incubated at 37°C and 5% CO2, with the culture medium changed every 24 hours. 48 hours after transfection, cells were harvested for evaluation of transgene expression.

[0276] Plasmid transfection efficiency. Analysis of beta-galactosidase expression was performed using a colorimetric assay based on an enzyme-mediated reaction with ortho-nitrophenyl-β-galactoside (ONPG). Upon harvesting, cells were washed with PBS and then treated with Reporter Lysis buffer (Promega, Madison, WI). After a freeze / thaw cycle and centrifugation at 14,000 rpm for 1 minute, 10 μl of diluted supernatant was mixed with 150 μl of 14.3 M β-mercaptoethanol in 100 mM phosphate buffer, pH 7.5, and incubated at 37°C and 5% CO2 for 5 minutes. At this time, 50 μl of 4 mg / ml ONPG stock was added to the sample. After 2.5 minutes, color development was stopped by adding 90 μl of 1 M Na2CO3. The absorbance of each sample at 420 nm was recorded using a Glomax Multi-detection Plate Reader (Promega, Madison, WI). The protein content of cell lysates was determined by a standard Lowry assay (Bio-Rad, Hercules, California). Transfection efficiency is expressed as the amount of beta-galactosidase present per mg of cellular protein in a given cell population for each formulation for cells transfected with freshly made PEI or LPF complexes prepared from frozen plasmids in Tris (pH 8).

[0277] Preparation and storage of films containing mRNA lipid nanoparticles (LNPs). A stock solution of LNPs containing luciferase-encoding mRNA in 10% sucrose / Tris buffer (pH 8) was diluted with additional Tris buffer to a concentration of 0.4 mg mRNA / ml. The concentration of mRNA was used to represent the concentration of mRNA LNPs in solution. Bulk formulations were prepared by first adding PEG lipid (4% stock in water) to 10 mM Tris buffer to a final concentration of 0.008%. A volume of mRNA LNP stock equivalent to 25% of the total bulk formulation volume was then added and gently mixed three times. If used in the formulation, surfactants were added to the resulting solution with gentle mixing. Finally, a mixture of polymer base and glycerol (100%, USP grade) prepared in 10 mM Tris buffer was incorporated to achieve a final LNP concentration of 0.1 mg / ml. The complete formulation was dispensed into 100 μl silicone molds (Figure 57) using an E3 repeater pipette (Eppendorf, Hauppauge, NY) and dried under constant airflow, ambient (20±1.5°C, 1 atm, 52.5% RH, Figure 58), and sterile conditions. Temperature and humidity were monitored during the film formation process using an Ambient Weather WS-3000-X5 Wireless Thermo-Hygrometer (Chandler, AZ). Once dry, the film was peeled off and rehydrated in 100 μl of sterile Tris buffer at room temperature for 10 minutes, followed by gentle mixing 10 times to ensure the solution was homogenous. The resulting solution was then diluted 20-fold with DPBS for transfection, 40-fold with nuclease-free Tris-EDTA for encapsulation efficiency, and 500-fold with 0.1x DPBS for dynamic light scattering assays. The physical properties of the LNP stock are summarized in Figure 59.

[0278] Physical Characterization of LNPs: Dynamic Light Scattering. Samples were placed in cuvettes and hydrodynamic particle size was measured at 25°C and a 173° backscattering angle using a Zetasizer ZS90 instrument (Malvern Instruments Ltd., Worcestershire, UK). Parameters were set for a particle refractive index of 1.45, an absorbance of 0.001, a diluent viscosity of 0.888 cP, and a refractive index of 1.335. Data were analyzed using Malvern Zetasizer Software version 8.00.4813.

[0279] The encapsulation efficiency of LNPs in stock and various formulations was determined using the Quant-it™ RiboGreen Assay Kit (Thermo Fisher Scientific, Eugene, OR). The total amount of mRNA in a sample was determined by treating an aliquot of the sample with 0.5% Triton® X-100 for 14 minutes. RiboGreen reagent was added to all samples, and fluorescence intensity (excitation at 480 nm and emission at 520 nm) was measured after 5 minutes. The total and free mRNA concentrations in each sample were calculated using an mRNA standard curve ranging from 15 to 1000 ng / ml. The encapsulation efficiency was determined based on the following equation:

number

[0280] Transfection (mRNA LNP) transgene expression. H1 Hela cells (ATCC CRL-1958, passages 6–30) were cultured in a 96-well plate (Thermo Fisher Scientific, Waltham, MA) at 2 × 10 4Cells were seeded at a density of 1000 cells / well. After 24 hours, the medium was changed 1 hour before adding samples containing mRNA LNPs equivalent to 50 ng mRNA to each well (Figure 59). After 24 hours, the culture medium was replaced with 100 μl of Glo Lysis Buffer (Promega, Madison, WI), and luciferase expression was measured using the Pierce™ Firefly Luc One-Step Glow Assay Kit (Thermo Fisher, Rockford, IL) according to the manufacturer's instructions. A portion of the lysate was also used to determine the protein content in each sample using the Pierce BCA Protein Assay Kit (Thermo Fisher, Rockford, IL). Transgene expression in each sample was reported as RLU / mg protein, and transfection efficiency was calculated using the following equation:

number

[0281] Cytotoxicity. The cytotoxicity of the film formulations was evaluated using the CyQUANT™ LDH Cytotoxicity Assay Kit (Thermo Fisher, Rockford, IL). Spontaneous LDH activity was determined from cells in standard culture medium. Maximum LDH activity was determined using cells treated with lysis buffer. Media (50 μl) collected from cells at the end of transfection was mixed with 50 μl of the reaction mixture from the kit. After 10 minutes, the reaction was stopped by adding stop solution, and fluorescence (excitation 560 nm, emission 590 nm) was immediately analyzed using a Glomax Multi-detection Plate Reader (Promega, Madison, WI). LDH activity was recorded as fluorescence intensity minus background fluorescence. Background fluorescence was collected from wells containing culture medium in the absence of cells. Cytotoxicity was calculated using the following formula:

number

[0282] Rheology. The viscosity of the formulations was measured using an LVDV Brookfield viscometer (Brookfield AMETEK, Middleboro, MA). A cylindrical sample adapter spindle (SC4-21) was lowered into a sample chamber (SC4-13R) filled with 8 grams of formulation. The spindle was rotated at 20 rpm, and the torque (%) and viscosity (cP) were recorded.

[0283] Residual moisture. The film was completely dissolved in 1 ml of extraction solvent (anhydrous formamide: extra-dry methanol in a 1:1 v:v ratio) at 50 °C. The weights of the dry film (m1) and the extraction solvent (m2) used to dissolve the film were recorded. The moisture content of the blank extraction solvent (B%) and the sample-containing solution (C%) was determined by Karl Fischer titration using a V10S Volumetric Karl Fischer Titrator (Mettler Toledo, Columbus, OH). Specifically, 0.3 ml of sample was injected into the titration chamber, and the sample was mixed with excess dry methanol for 3 minutes before the titration reaction began. The weight of the injected sample was used to calculate the moisture content using the following equation and the values ​​above.

number

[0284] Transmission electron microscopy (TEM). LNPs (0.1 mg / ml) were prepared in Tris buffer, liquid formulation, or dry films that were rehydrated before analysis. Carbon-coated grids (CTU300-CU, Electron Microscopy Sciences, Hatfield, PA) were pretreated with 25 mA plasma for 2 minutes to render them hydrophilic. Samples (5 μl of a 1:1 dilution in Tris) were placed on the grid for 2 minutes. Excess liquid was removed by blotting with filter paper. Samples were washed twice with 5 μl of distilled water. For negative staining, 5 μl of 1% phosphotungstic acid (pH 7) was blotted along with excess fluid. Images were collected on a Tecnai 80 kV transmission electron microscope.

[0285] V. References The following references, as well as any and all other references cited herein, including literature references, patent applications, patent publications, UniProtKB accession numbers, and GenBank accession numbers, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically and expressly incorporated by reference herein as if each individual reference were specifically and individually indicated to be incorporated by reference in its entirety. In the event that definitions of terms in documents incorporated by reference herein conflict with those used herein, the definitions used herein shall govern.

[0286] Examples 1 and 2: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0287] Examples 3 and 4: [ka] [ka] [ka] [ka] [ka]

[0288] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of the present disclosure have been described with reference to specific embodiments, it will be apparent to those skilled in the art that variations can be applied to the methods and steps or sequence of steps of the methods described herein without departing from the concept, spirit, and scope of the present disclosure. More specifically, it will be apparent that certain chemically and physiologically related agents may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the present disclosure as defined by the appended claims.

Claims

1. A composition comprising a drug and a carrier, wherein the carrier comprises a sugar, a zwitterionic compound, and a base polymer.

2. the sugar is melezatose, trehalose, raffinose, sucrose, dextrose, mannitol, sorbitol, cyclodextrin, or a combination thereof; and / or the carrier comprises between 0.1% and 3.0% of the sugar; The composition of claim 1.

3. the zwitterionic compound is arginine and / or ethylenediaminetetraacetic acid (EDTA); and / or the carrier comprises between 0.1% and 2.0% of the zwitterionic compound; The composition according to claim 1 or 2.

4. the base polymer is hydroxypropyl methylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof; and / or the carrier comprises between 0.5% and 3.0% of the base polymer; The composition according to any one of claims 1 to 3.

5. 5. The composition of claim 1, wherein the composition comprises about 1% trehalose and about 0.5% sucrose, about 1% arginine, and about 2% PVA.

6. The composition of any one of claims 1 to 4, wherein the composition comprises about 1% sorbitol, about 1% arginine, and about 2% PVA.

7. 7. The composition of any one of claims 1 to 6, comprising between 0.001 mg / mL and 1 mg / mL of the agent.

8. The composition of any one of claims 1 to 7, wherein the drug is a therapeutic agent.

9. The composition of any one of claims 1 to 8, wherein the agent is a nucleic acid.

10. The composition of claim 9 , wherein the nucleic acid is DNA.

11. 11. The composition of claim 10, wherein the DNA is at a concentration between 0.05 mg / mL and 2 g / mL.

12. The composition of claim 10 or 11, wherein the DNA is a plasmid DNA.

13. The composition of claim 10 or 11, wherein the DNA is genomic DNA.

14. The composition of any one of claims 10 to 13, wherein the DNA is complexed with lipofectamine or polyethyleneimine.

15. The composition of any one of claims 1 to 14, wherein the carrier further comprises one or more additional excipients.

16. 16. The composition of claim 15, wherein the one or more additional excipients comprise a surfactant, a plasticizer, an additional sugar, and / or an additional polymer.

17. The composition of any one of claims 1 to 16, wherein the composition has a pH of 7.0 to 9.

0.

18. The composition of any one of claims 1 to 17, wherein the composition is a liquid.

19. The composition of any one of claims 1 to 17, wherein the composition is a substantially solid film.

20. 20. A method of storing a drug comprising formulating the drug in a composition according to any one of claims 1 to 19, wherein the method comprises storing the drug in the composition at a temperature of at least 0°C for up to 1 year.

21. 21. The method of claim 20, wherein the agent is a nucleic acid and after storage, the nucleic acid is preserved at least 80% as measured by transduction efficiency and / or transfection efficiency.

22. 20. A method of delivering a therapeutic agent to a subject, comprising administering to the subject an effective amount of a composition according to any one of claims 1 to 19.

23. 23. The method of claim 22, wherein the composition is administered to the subject intravenously, intramuscularly, intranasally, sublingually, or bucally.

24. 20. A method of making the composition of any one of claims 1 to 19, comprising forming an aqueous solution comprising the drug, the sugar, the zwitterionic compound, and the base polymer.

25. 25. The method of claim 24, wherein the drug and the zwitterionic compound are mixed to form a first mixture, the sugar and the base polymer are mixed to form a second mixture, and the second mixture is added to the first mixture to obtain the aqueous solution.

26. 26. The method of claim 25, wherein the second mixture further comprises a surfactant and a plasticizer mixed with the sugar and the base polymer.

27. 27. The method of any one of claims 24-26, wherein the aqueous solution comprises about 2% PVA, about 1% arginine, about 1% trehalose, and about 0.5% sorbitol, and the aqueous solution has a pH between 8.0 and 9.

0.

28. 28. The method of any one of claims 24-27, wherein the aqueous solution comprises about 22% PVA, about 1% arginine, about 1% trehalose, about 0.5% sorbitol, and about 1.5% glycerol, and the aqueous solution has a pH between 8.0 and 9.

0.

29. 29. The method of any one of claims 24 to 28, further comprising drying the aqueous solution to form a substantially solid film.

30. 30. The method of claim 29, further comprising: (a) storing the substantially solid film at a temperature of at least 0°C for up to one year; and (b) dissolving the substantially solid film in a suitably buffered aqueous solution.

31. A composition comprising a drug and a carrier, wherein the carrier comprises a plasticizer and / or surfactant and a base polymer.

32. the plasticizer is glycerol; and / or the carrier comprises between 1% and 5% of the plasticizer; 32. The composition of claim 31.

33. the surfactant is a poloxamer; and / or the carrier comprises between 0.0001% and 3.0% of the surfactant; 33. The composition of claim 31 or 32.

34. 34. The composition of claim 33, wherein the poloxamer is poloxamer 188 and / or poloxamer 407.

35. the base polymer is hydroxypropyl methylcellulose (HPMC), polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA), gelatin, or a combination thereof; and / or the carrier comprises between 0.5% and 3.0% of the base polymer; The composition according to any one of claims 31 to 34.

36. 36. The composition of claim 35, wherein the HPMC has a molecular weight (MW) that produces a viscosity of about 4000 cp or less at a 2% concentration in water, and / or the HPMC is A4C, A4M, A15C, A15LV, E4M, E6LV, F4M, K4M, or K100LV.

37. 37. The composition of any one of claims 31 to 36, further comprising a pegylated lipid.

38. 38. The composition of claim 37, wherein the pegylated lipid comprises DMPE-PEG and / or DMG-PEG.

39. 39. The composition of any one of claims 31-38, wherein the composition comprises about 1.5% HPMC, about 0.01% poloxamer, and about 3% glycerol.

40. 40. The composition of claim 39, wherein the HPMC is HPMC K100LV and / or the poloxamer is poloxamer 407.

41. 39. The composition of any one of claims 31-38, wherein the composition comprises about 1% HPMC, about 0.012% poloxamer, about 3% glycerol, and about 0.008% PEGylated lipid.

42. 42. The composition of claim 41, wherein the HPMC is K4M, the poloxamer is poloxamer 188 and poloxamer 407, and / or the pegylated lipid is DMPE-PEG.

43. 43. The composition of any one of claims 31 to 42, comprising between 0.001 mg / mL and 1 mg / mL of the agent.

44. The composition of any one of claims 31 to 43, wherein the agent is a therapeutic agent.

45. The composition of any one of claims 31 to 44, wherein the agent is a nucleic acid.

46. 46. ​​The composition of claim 45, wherein the nucleic acid is RNA.

47. 47. The composition of claim 46, wherein the RNA is mRNA.

48. 47. The composition of claim 45 or 46, wherein the RNA is at a concentration of between 0.001 mg / mL and 1 mg / mL.

49. The composition of any one of claims 46 to 48, wherein the RNA is encapsulated in a lipid nanoparticle (LNP).

50. 50. The composition of any one of claims 31 to 49, wherein the carrier further comprises one or more additional excipients.

51. 51. The composition of claim 50, wherein the one or more additional excipients are a sugar, choline, phosphocholine, D-calcium heptagluconate dihydrate, an additional surfactant, an additional plasticizer, and / or an additional polymer.

52. 52. The composition of any one of claims 31 to 51, wherein the composition has a pH of 7.0 to 9.

0.

53. The composition of any one of claims 31 to 52, wherein the composition is a liquid.

54. The composition of any one of claims 31 to 52, wherein the composition is a substantially solid film.

55. 55. A method of storing a drug comprising formulating the drug in a composition according to any one of claims 31 to 54, wherein the method comprises storing the drug in the composition at a temperature of at least 0°C for up to 12 weeks.

56. 56. The method of claim 55, wherein the agent is a nucleic acid and after storage, the nucleic acid is preserved at least 80% as measured by transduction efficiency and / or transfection efficiency.

57. 55. A method of delivering a pharmaceutical agent to a subject, comprising administering to said subject an effective amount of a composition according to any one of claims 31 to 54.

58. 58. The method of claim 57, wherein the composition is administered to the subject intravenously, intramuscularly, intranasally, sublingually, or bucally.

59. 55. A method for making the composition of any one of claims 31 to 54, comprising: adding an aqueous solution comprising the drug, the plasticizer, the surfactant, and the base polymer to: mixing the agent with the surfactant to form a first mixture; mixing the plasticizer with the base polymer to form a second mixture; and adding the second mixture to the first mixture to obtain the aqueous solution; forming a

60. 60. The method of claim 59, wherein the aqueous solution comprises about 1.5% HPMC, about 0.01% poloxamer, and about 3% glycerol, and the aqueous solution has a pH between 7.5 and 8.

5.

61. 61. The method of claim 59 or 60, further comprising mixing the agent with a PEGylated lipid prior to mixing the agent with the surfactant to form the first mixture.

62. 62. The method of claim 61, wherein the aqueous solution comprises about 1% HPMC, about 0.012% poloxamer, about 3% glycerol, about 0.008% PEGylated lipid, and wherein the aqueous solution has a pH between 7.5 and 9.

5.

63. 63. The method of any one of claims 59 to 62, comprising: drying the aqueous solution, optionally under a constant air flow, to form a substantially solid film; and storing the substantially solid film at a temperature of at least 0°C for up to 16 weeks; and The method further comprising rehydrating said substantially solid film in a suitably buffered aqueous solution.

64. 65. The method of claim 64, wherein the appropriately buffered aqueous solution comprises buffered saline or a poloxamer.

65. 65. The method of claim 64, wherein the poloxamer is poloxamer 188 and / or poloxamer 407.

66. 66. The method of claim 64 or 65, wherein the poloxamer is buffered in Tris at about pH 8.

67. 67. The method of any one of claims 64 to 66, wherein the poloxamer is at a concentration of between 0.0001% and 1.0%.