Novel compounds, their preparation and use as pharmaceuticals

Abstract

The present invention relates to compounds having the formula (I): wherein, for example, #Z represents (II), in which #X represents an NR5R6 group, where R5 and R6 are hydrogen, #R1 represents a hydrogen atom, and #R 2A and R 2B represents hydrogen, #R4 represents a phenyl ring, #R9 represents a (III) group, and #R3 represents OH, or a pharmaceutically acceptable salt of said compound, or isomers of said compound, in particular pure forms diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, and therapeutic uses thereof. [Formula 1] TIFF2025535127000411.tif86102 [2] TIFF2025535127000412.tif6873 [3] TIFF2025535127000413.tif6754

Description

[Technical Field]

[0001] The present invention relates to novel compounds, their preparation methods, and their use as pharmaceuticals. In particular, the present invention relates to novel compounds for treating cancer, psychiatric disorders, neurodegenerative disorders, and other peripheral or metabolic diseases. [Background technology]

[0002] NKCCl and KCC2, the best-known chloride uptake and exporter, respectively, are responsible for the appropriate [Cl - ] i Low levels underlie the traditional inhibitory actions of GABA in adult neurons, while high levels are associated with the paradoxical excitatory actions of GABA. - ] i High levels are observed in pathological conditions where neurons are unable to maintain low levels as a result of high NKCC1 activity and low KCC2 activity (Ben-Ari, Y. et al., 2007. Physiological Reviews 87(4):1215-68; Savardi, Annalisa et al., 2021. Trends in Pharmacological Sciences 42(12):1009-1034; reviewed in Ben-Ari Y. 2017. Trends Neurosci. 40(9):536-554). Excitatory GABAergic effects have been reported in neurodegenerative disorders such as ASD, Rett syndrome, Fragile X syndrome, childhood epilepsy, Parkinson's disease, and Huntington's disease; cerebrovascular infarction, trauma, post-traumatic disorders, chronic pain, spinal cord lesions, glioblastoma, and severe brain tumors; and peripheral diseases including breast and lung cancer (Savardi, Annalisa et al., 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci. 40(9):536-554). NKCCl antagonists (e.g., bumetanide) can lower [Cl] levels. - ] iRestoring the levels and inhibitory effects of GABA reduces the severity of many brain disorders (Savardi, Annalisa et al. 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci. 40(9):536-554). Pilot and larger phase 2 studies have reported that bumetanide reduces the severity of disability in fragile X syndrome, tuberous sclerosis complex, Down syndrome, and Parkinson's disease (Savardi, Annalisa et al., 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y., 2017. Trends Neurosci. 2540(9):536-554; Van Andel, Dorinde M., et al., 2020. Molecular Autism 11(1):1-14). In summary, the convergence of experimental and clinical data reflects the importance of NKCC1 / KCC2 activity and GABAergic activity, particularly bumetanide, as a promising treatment for many brain disorders.

[0003] Bumetanide (3-(butylamino)-4-phenoxy-5-sulfamoylbenzoic acid) inhibits the Na+ receptor expressed in the renal loop of Henle. + , K. + , Cl -Bumetanide was introduced into clinical medicine in 1972 as a drug with potent diuretic activity mediated by inhibition of NKCC2, a cotransporter of NKCC1 (Ingram, 1964, British Medical Journal, December, 16:40-41). Because of this site of action, these drugs are classified as "loop" diuretics, distinguishing them from thiazide diuretics, which act within the more distal segments of the nephron. Loop diuretics are typically delivered orally or intravenously to treat congestive heart failure and cerebral edema. When taken orally, diuretics are absorbed in the intestine, thus delaying the time to peak effect by 60-90 minutes compared with 10-30 minutes for intravenous administration. Upon entering the bloodstream, more than 95% of the diuretic binds to serum albumin, thereby reducing its systemic bioavailability. NKCC1, the second target of bumetanide, is widely expressed throughout the body and in the central and peripheral nervous systems.

[0004] Because most bumetanide in plasma is bound to albumin, only a small fraction diffuses across biological membranes, resulting in brain levels that are 200-300 times lower than in plasma. Furthermore, the blood-brain barrier is highly impermeable to bumetanide, further limiting its central effects, especially when diuretic side effects are also considered. Therefore, the synthesis of new compounds is needed. Summary of the Invention

[0005] One object of the present invention is to provide novel compounds that are inhibitors of the NKCCl transporter.

[0006] Another object of the present invention is to provide inhibitors of the NKCCl transporter that have good blood-brain barrier permeability and high bioavailability.

[0007] Another object of the present invention is to provide inhibitors of the NKCCl transporter that have reduced diuretic side effects.

[0008] Another object of the present invention is to provide a drug that is prone to treat cancers such as glioblastoma, pancreatic cancer, prostate cancer, lung cancer, kidney cancer, and colon cancer.

[0009] Another object of the present invention is to provide medicaments that tend to treat neurological and psychiatric disorders, including schizophrenia and other neurodevelopmental disorders such as autism spectrum disorders, fragile X syndrome, Rett syndrome, Down syndrome, childhood epilepsy, tuberous sclerosis complex, and especially genetic autism.

[0010] Another object of the present invention is to provide drugs that tend to treat neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and Huntington's disease.

[0011] Another object of the present invention is to provide a drug that tends to treat brain trauma, spinal cord injury, chronic pain, and cerebrovascular infarction.

[0012] Another object of the present invention is to provide drugs that tend to treat peripheral diseases such as autosomal dominant polycystic kidney disease.

[0013] [Detailed explanation] The present invention provides compounds of formula (I): [ka] During the ceremony, Z represents: - the following groups: [ka] In the formula, R1 is hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl groups, heteroaryl groups (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. - and X represents: NR5R6 groups, where R5 and R6 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl groups, heteroaryl groups (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or NR5R6 radicals, where R5 and R6, together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, C4-C 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, aryl ring or (C1-C 10 ) optionally substituted with an acyl group; or ○ (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group or (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl groups, the group is optionally substituted with one or more deuterium, halogen atoms, (C1-C10)alkoxy groups, (C3-C10)cycloalkyl(C1-C10)alkoxy groups, or nitro; or - the following groups: [ka] In the formula, R 10 and R 11independently represent hydrogen and an aryl ring, an aryl ring and hydrogen, hydrogen and a heteroaryl ring, or a heteroaryl ring and hydrogen; The aryl and heteroaryl may be one or more of deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; ·R 2A and R 2B are independently hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; or R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; R4 represents a phenyl ring and is substituted with one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8, or (C1-C 10 ) optionally substituted with an acylamino group; R9 represents: The following groups: [ka] In the formula, R3 is OH, (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, or The following groups: [ka] In the formula, R 12 and R 13 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, aryl or heteroaryl ring, aryl (C1-C 10) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl group, and one or more deuterium atoms, halogen atoms, amino groups, hydroxy groups, (C1-C 10 ) alkoxy group, NR7R8 group, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbonylamino groups; or ○ The following rings: [ka] or ○ The following rings: [ka] R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen, C3-C 12 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; The alkyl ring is linear or branched, The aryl ring is a six-membered aromatic carbocyclic ring, The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. a compound, or a pharmaceutically acceptable salt of said compound, its isomers, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, Regarding.

[0014] It has been unexpectedly discovered that the compounds of formula (I) are inhibitors of the NKCCl transporter. The term "NKCCl transporter" refers to the Na-K-Cl cotransporter isoform 1, which is a Na + , K. + , and 2Cl - Intracellular Cl transports Cl into the cell - It is an active cotransporter that plays an important role in accumulation.

[0015] The expression "cycloalkyl" means cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl or cyclodecyl.

[0016] The term "heterocycloalkyl" refers to a cycloalkyl in which one or more carbon atoms has been replaced by oxygen, nitrogen, or sulfur.

[0017] "(C1-C 10 An "alkyl" group means an alkyl group having 1 to 10 carbon atoms.

[0018] "(C1-C 10 An "alkoxy" group means an alkyl group having from 1 to 10 carbon atoms that is single-bonded to an oxygen atom. This has the same meaning as alkyloxy.

[0019] An "alkenyloxy" group refers to a carbon chain containing at least one carbon-carbon double bond and containing an alkoxy functionality that is not supported by a carbon included in the carbon-carbon double bond.

[0020] An "alkynyloxy" group refers to a carbon chain containing at least one carbon-carbon triple bond and containing an alkoxy functionality that is not supported by a carbon included in the carbon-carbon triple bond.

[0021] The expression "pharmaceutically acceptable salt" refers to a salt of R with an inorganic or organic acid. 2A and R 2B "R" refers to all pharmaceutically or physiologically acceptable salt forms of the compounds of formula (I), which may be formed by protonation of the nitrogen of an amino group bearing a group, or as a salt of an acidic group (e.g., a carboxylic acid group) with a physiologically acceptable cation. It may also be formed with a carboxylic acid function when R represents OH and the proton of that function protonates an inorganic or organic base forming a salt. R, R 2A , R 2B , R3, R4, R5, R6, R7, R8, R 10 , R 11 , R 12 , R 13Exemplary base addition salts include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, and choline salts; aralkylamine salts such as N,N-dibenzylethylenediamine salts, benzathine salts, and benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts, or isoquinoline salts; quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts, benzyltrimethylammonium salts, benzyltriethylammonium salts, benzyltributylammonium salts, methyltrioctylammonium salts, or tetrabutylammonium salts; and basic amino acid salts, e.g., arginine salts, lysine salts, or histidine salts.Exemplary acid addition salts include mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate (e.g., sulfate or hydrogen sulfate), nitrate, phosphate (e.g., phosphate, hydrogen phosphate, or dihydrogen phosphate), carbonate, bicarbonate, perchlorate, borate, organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, Preferred pharmaceutically / physiologically acceptable salts of the compound of formula (I) include: phosphate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate; sulfonate salts, such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2-hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate; glycerophosphate; and acidic amino acid salts, such as aspartate or glutamate. Preferred pharmaceutically / physiologically acceptable salts of the compound of formula (I) include hydrochloride, hydrobromide, mesylate, sulfate, tartrate, fumarate, acetate, citrate, and phosphate.

[0022] The expression "enantiomers" is used herein to mean two compounds that have the same molecular formula but different stereochemical configuration.

[0023] The term "isomer" means that a compound may have more than one stereocenter and that the compound may be an epimer, enantiomer, or diastereomer. The term "isomer" also refers to positional isomers of substituents.

[0024] The expression "diastereoisomers" refers to two compounds that have the same chemical formula but are not mirror images and are not identical stereoisomers.

[0025] The expression "epimer" refers to one diastereoisomer of a pair of two diastereoisomers that differ at only one stereocenter.

[0026] The expression "pure form" means a compound having a purity level of at least 95%, more particularly 98%.

[0027] Z is [ka] and X represents NR5R6, the compound is a sulfonimidamide. 10 ) alkyl group, (C3-C 10 ) cycloalkyl group or (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, the compound is a sulfoximine.

[0028] Z is the following group [ka] where R 10 and R 11 When independently represent hydrogen and an aryl ring, an aryl ring and hydrogen, hydrogen and a heteroaryl ring, or a heteroaryl ring and hydrogen, the compound is a sulfonamide.

[0029] In particular, the (S) and (R) enantiomers of the sulfoximine functional group are part of the present invention.

[0030] In particular, the (S) and (R) enantiomers of the sulfonimidamide functional group are part of the present invention.

[0031] In particular, Z [ka] and X represents NR5R6, and at least one selected from R1, R5 and R6 is a hydrogen atom, and at least one selected from R1, R5 and R6 is different from a hydrogen atom, the compound can exist in two tautomeric forms which are part of the invention.

[0032] The case where there is only one hydrogen atom in R1, R5 and R6 corresponds to the situation described above.

[0033] The case where there are two hydrogen atoms in R1, R5 and R6 corresponds to the situation described above.

[0034] As a non-limiting example, if R5 is an ethyl group, R6 is hydrogen, and R1 is an aryl ring, the compound can exist in two forms: [ka]

[0035] R9 is the following group [ka] and when R3 represents OH, the compound contains a carboxylic acid functionality.

[0036] R9 is the following group [ka] and R3 is (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C2-C 10) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, the compound contains an ester functionality.

[0037] R9 is the following group [ka] represents the compound contains an amide functionality.

[0038] R9 is the following ring [ka] When the compound represents an oxadiazolone ring, the compound contains an oxadiazolone ring.

[0039] R9 is the following ring [ka] When the compound represents a tetrazole ring, the compound contains a tetrazole ring.

[0040] In particular, the compounds of the invention can be selected from:

[0041] [Table 1]

[0042] The compounds of the present invention are those in which R9 is [ka] where R3 (excluding OH), R 12 and R 13 has the meaning defined above.

[0043] The compound of the present invention is one in which Z is [ka] For one selection of Z among: 10 , and R 11 has the meaning defined above.

[0044] The present invention relates to all possible combinations of R9 and Z selections in the above table. As a non-limiting example, compounds of the present invention include: [ka] which can be R9 [ka] and Z is [ka] This results from the combination of where X is different from NR5R6, and R1, R 12 and R 13 has the meaning defined above.

[0045] According to another embodiment, the present invention provides a compound of formula (I): [ka] In the above defined compounds During the ceremony Z is [ka] wherein: ○ R1 is hydrogen, (C1-C 10) alkyl group, (C3-C6) cycloalkyl group, (C3-C6) cycloalkyl (C1-C6) alkyl group, (C3-C6) heterocycloalkyl group, (C3-C 10 ) heterocycloalkyl(C1-C6)alkyl group, aryl ring, heteroaryl ring, aryl(C1-C6)alkyl group, aryl(C1-C6)alkoxy group, aryl(C3-C6)cycloalkyl group, aryl(C3-C6)cycloalkyl(C1-C6)alkyl group, heteroaryl(C1-C6)alkyl group, heteroaryl(C3-C6)cycloalkyl group, heteroaryl(C3-C6)cycloalkyl(C1-C6)alkyl group, the group is optionally substituted by one or more deuterium, halogen, (C1-C6)alkyl, (C3-C6)cycloalkyl, (C1-C6)alkoxy, (C3-C6)cycloalkyl(C1-C6)alkoxy, nitro, amino, hydroxy, NRR, (C1-C6)acyl, (C1-C6)acylamino, (C3-C6)cycloalkylcarbonylamino, (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino, (C1-C6)alkylcarbamoyl, (C3-C6)cycloalkylcarbamoyl, or (C3-C6)cycloalkyl(C1-C6)alkylcarbamoyl; The aforementioned cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; - X is: represents the radical NR5R6, where R5 and R6 are independently hydrogen, a (C1-C6)alkyl group, a (C3-C6)cycloalkyl group, a (C3-C6)cycloalkyl(C1-C6)alkyl group, a (C3-C6)heterocycloalkyl group, a (C3-C6)heterocycloalkyl(C1-C6)alkyl group, an aryl ring, a heteroaryl ring, an aryl(C1-C6)alkyl group, an aryl(C1-C6)alkoxy group, an aryl(C3-C6)cycloalkyl group, an aryl(C3-C6)cycloalkyl(C1-C6)alkyl group, a heteroaryl(C1-C6)alkyl group, a heteroaryl(C3-C6)cycloalkyl group, or a heteroaryl(C3-C6)cycloalkyl(C1-C6)alkyl group; the group is optionally substituted with one or more deuterium, halogen, (C1-C6)alkyl, (C3-C6)cycloalkyl, (C1-C6)alkoxy, (C3-C6)cycloalkyl(C1-C6)alkoxy, nitro, amino, hydroxy, NRR, (C1-C6)acyl, (C1-C6)acylamino, (C3-C6)cycloalkylcarbonylamino, (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino, (C1-C6)alkylcarbamoyl, (C3-C6)cycloalkylcarbamoyl, or (C3-C6)cycloalkyl(C1-C6)alkylcarbamoyl; The aforementioned cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; or represents the group NR5R6, in which R5 and R6 together with the nitrogen atom bearing them form a C4-C6 membered heterocycle, optionally containing one or more heteroatoms selected from among nitrogen, sulfur and oxygen, the heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, combinations of these forms, or fused to an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; the aforementioned groups are optionally substituted with one or more deuterium, halogen, (C1-C6)alkyl, (C3-C6)cycloalkyl, (C3-C6)cycloalkyl(C1-C6)alkyl, (C3-C6)heterocycloalkyl, (C3-C6)heterocycloalkyl(C1-C6)alkyl, (C1-C6)alkoxy, (C3-C6)cycloalkyl(C1-C6)alkoxy, nitro, amino, hydroxy, aryl, or (C1-C6)acyl groups; or represents a (C1-C6)alkyl group, a (C3-C6)cycloalkyl group or a (C3-C6)cycloalkyl(C1-C6)alkyl group, said groups being optionally substituted with one or more deuterium atoms, halogen atoms, (C1-C6)alkoxy groups, (C3-C6)cycloalkyl(C1-C6)alkoxy groups or nitro, or -The following groups [ka] wherein R 10 and R 11 each independently represents hydrogen and an aryl ring, an aryl ring and hydrogen, hydrogen and a heteroaryl ring, or a heteroaryl ring and hydrogen; The aryl and heteroaryl may optionally be one or more of deuterium, halogen, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3-C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, (C1-C6)alkoxy group, (C3-C6)cycloalkyl(C1-C6)alkoxy group, nitro, amino, hydroxy, NRR, (C1-C6)acylamino group, (C3-C6)cycloalkylcarbonylamino group, (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C6)alkylcarbamoyl group, (C3-C6)cycloalkylcarbamoyl group, or (C3-C6)cycloalkyl(C1-C 10) substituted by an alkylcarbamoyl group, R 2A and R 2B are independently hydrogen, (C1-C6) alkyl, (C3-C6) cycloalkyl, (C3-C6) cycloalkyl(C1-C 10 )alkyl group, a (C3-C6)heterocycloalkyl group, a (C3-C6)heterocycloalkyl(C1-C6)alkyl group, an aryl ring or a heteroaryl ring, an aryl(C1-C6)alkyl group, an aryl(C3-C6)cycloalkyl group, a heteroaryl(C1-C6)alkyl group or a heteroaryl(C3-C6)cycloalkyl group; The aforementioned alkyl and aryl are optionally substituted with one or more deuterium, halogen atoms, (C3-C6)cycloalkyl groups, (C1-C6)alkoxy groups, (C3-C6)heterocycloalkyl groups, nitro, amino, hydroxy, or NR7R8; or R 2A and R 2B C4-C, optionally containing one or more heteroatoms selected from nitrogen, sulfur and oxygen, together with the nitrogen atom carrying them. 10 forming a membered heterocyclic ring, the heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination thereof, optionally substituted with one or more deuterium, halogen atoms, (C1-C6) alkyl, (C1-C6) alkoxy, or (C3-C6) heterocycloalkyl groups; R4 represents a phenyl ring, optionally substituted with one or more deuterium, halogen, (C1-C6)alkyl, (C3-C6)cycloalkyl, (C3-C6)cycloalkyl(C1-C6)alkyl, (C1-C6)alkoxy, (C3-C6)heterocycloalkyl, (C3-C6)heterocycloalkyl(C1-C6)alkyl, (C3-C6)cycloalkyl(C1-C6)alkoxy, nitro, amino, hydroxy, NR7R8, or (C1-C6)acylamino groups; R9 is: ○ The following bases [ka] wherein R3 represents OH, a (C1-C6)alkoxy group, a (C3-C6)cycloalkoxy group, a (C3-C6)cycloalkyl(C1-C6)alkoxy group, a (C3-C6)heterocycloalkyl(C1-C6)alkoxy group, a (C2-C6)alkenyloxy group containing one to two alkenyl functional groups, a (C2-C6)alkynyloxy group containing one to two alkynyl functional groups, an O-aryl ring, an O-heteroaryl ring, an aryl(C1-C6)alkoxy group, an aryl(C3-C6)cycloalkoxy group, an aryl(C3-C6)cycloalkyl(C1-C6)alkoxy group, a heteroaryl(C1-C6)alkoxy group, a heteroaryl(C3-C6)cycloalkoxy group, or a heteroaryl(C3-C6)cycloalkyl(C1-C6)alkoxy group; or ○ The following bases [ka] represents R 12 and R 13 are independently hydrogen, a (C1-C6)alkyl group, a (C3-C6)cycloalkyl group, a (C3-C6)cycloalkyl(C1-C6)alkyl group, a (C3-C6)heterocycloalkyl group, a (C3-C6)heterocycloalkyl(C1-C6)alkyl group, a (C1-C6)alkoxy group, an aryl or heteroaryl ring, an aryl(C1-C6)alkyl group, an aryl(C3-C6)cycloalkyl group, a heteroaryl(C1-C6)alkyl group, a heteroaryl(C3-C6)cycloalkyl group, optionally substituted by one or more deuterium atoms, halogen atoms, amino, hydroxy, a (C1-C6)alkoxy group, NRR, a (C1-C6)acylamino group, a (C3-C6)cycloalkylcarbonylamino group, or a (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino group; or ○ The following ring [ka] or ○ The following ring [ka] It represents R7 and R8 independently represent a (C1-C6)alkyl group, a (C3-C6)cycloalkyl group, or a (C3-C6)cycloalkyl(C1-C6)alkyl group; or R7 and R8 together with the nitrogen atom bearing them form a C3-C6 membered heterocycle, optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; the heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination thereof, optionally substituted with one or more deuterium, halogen atoms, (C1-C6)alkyl, (C3-C6)cycloalkyl, (C3-C6)cycloalkyl(C1-C6)alkyl, (C1-C6)alkoxy, or (C3-C6)heterocycloalkyl groups; The alkyl rings mentioned above are linear or branched; The aryl ring is a 6-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from nitrogen, sulfur, and oxygen atoms. compound, or a pharmaceutically acceptable salt of said compound, its isomers, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, Regarding.

[0046] The chemical structures refer to compounds having carbon chains of 1 to 6 carbon atoms.

[0047] One advantage of these compounds is their higher solubility in aqueous media.

[0048] According to another embodiment, the present invention provides a compound of formula (II): [ka] In the compounds defined above, R, R 2A , R 2B , R4, R5, R6 and R9 have the meanings defined above.

[0049] The chemical structures defined above correspond to the sulfonimide amide class. These compounds are aza-analogues of sulfonamides, where one of the oxygen atoms is replaced with a nitrogen atom. They contain a stereogenic sulfur center, where both the (S) and (R) enantiomers are part of the present invention.

[0050] According to another embodiment, the present invention provides a compound of formula (III): [ka] In the compounds defined above, R, R 2A , R 2B , R4, and R9 have the meanings defined above; X is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) substituted with an alkoxy group or nitro; Concerning compounds.

[0051] The chemical structure defined above corresponds to the sulfoximine class. These compounds are aza-analogues of sulfones, in which one of the oxygen atoms is replaced by a nitrogen atom. They contain a stereogenic sulfur center, where both the (S) and (R) enantiomers are part of the present invention.

[0052] According to another embodiment, the present invention provides a compound of formula (IV): [ka] In the compounds defined above, R 2A , R 2B , R4, R9, R 10 , and R 11 has the meaning defined above.

[0053] This chemical structure, as defined above, corresponds to the sulfonamide class. These compounds are 10 or R 11 comprises a sulfonyl group linked to an amine group where R is an aryl or heteroaryl ring.

[0054] According to another embodiment, the present invention provides a compound of formula (IV): [ka] In the compounds defined above, R4, R9, R 10 and R 11 has the meaning defined above, R 2A and R 2B are independently hydrogen and (C1-C 10 ) alkyl, or (C1-C 10 ) relating to compounds in which alkyl and hydrogen are represented.

[0055] This chemical structure defined above corresponds to the sulfonamide class. This above chemical structure relates to sulfonamide compounds having a carbon chain of 1 to 10 carbon atoms branched directly to the amine functionality of the central phenyl group.

[0056] One advantage of these compounds is their increased inhibition of NKCCl and increased permeability across the blood-brain barrier.

[0057] According to another embodiment, the present invention provides a compound of formula (V): [ka] In the compounds defined above, Z, R 2A , R 2B and R4 has the meaning defined above.

[0058] The above chemical structure of formula (V) corresponds to a class of carboxylic acid compounds. This type of structure can protonate inorganic or organic bases to form salts.

[0059] According to another embodiment, the present invention provides a compound of formula (VI): [ka] In the compounds defined above, Z, R 2A , R 2B and R4 has the meaning defined above and R3 has the meaning defined above but is different from OH.

[0060] The above chemical structure of formula (VI) corresponds to a class of ester compounds.

[0061] According to another embodiment, the present invention provides a compound of formula (VII): [ka] In the compounds defined above, Z, R 2A , R 2B , R4, R 12 , and R 13 has the meaning defined above.

[0062] The above chemical structure of formula (VI) corresponds to a class of amide compounds.

[0063] According to another embodiment, the present invention comprises: - Z, R 2A , R 2B and formula (VIII) in which R4 has the meaning defined above: [ka] or a compound of - Z, R 2A , R 2B and formula (IX) in which R4 has the meaning defined above: [ka] The compound The present invention relates to a compound as defined above, selected from:

[0064] The above chemical structure of formula (VIII) corresponds to a class of oxadiazolone compounds.

[0065] The above chemical structure of formula (IX) corresponds to a class of tetrazole compounds.

[0066] According to another embodiment, the present invention provides a compound of formula (X): [ka] In the compounds defined above, Z, R 2A , R 2B and R9 has the meaning defined above, R4 is optionally one or more halogen atoms, (C1-C 10 ) alkyl group, or (C1-C 10 ) a phenyl ring substituted with an alkoxy group; Concerning compounds.

[0067] The above chemical structure is for compounds having phenyl rings branched on the ether functionality of a central phenyl group.

[0068] According to another embodiment, the present invention provides a compound of formula (XI): [ka] In the compounds as defined above, Z, R4 and R9 have the meanings as defined above, R 2Aand R 2B independently hydrogen and (C1-C 10 ) alkyl group, (C1-C 10 ) alkyl group and hydrogen, hydrogen and (C 11 -C 12 ) alkyl group, or (C 11 -C 12 ) represents an alkyl group and hydrogen, Said (C1-C 10 ) alkyl group optionally containing one or more halogen atoms or (C1-C 10 ) alkoxy groups.

[0069] The chemical structure includes an alkyl chain attached to the aryloxyphenyl core of the molecule.

[0070] According to another embodiment, the present invention provides a compound of formula (XII): [ka] In the compounds defined above, R, R 2A , R 2B , R4, R5 and R6 have the meanings defined above.

[0071] The above chemical structure of formula (XII) is a carboxylic acid compound that belongs to the sulfonimide amide class.

[0072] According to another embodiment, the present invention provides a compound of formula (XIII): [ka] In the compounds defined above, R, R 2A , R 2B , R4, R5 and R6 have the meanings defined above and R3 has the meaning defined above but is different from OH.

[0073] The above chemical structure of formula (XIII) is an ester compound that belongs to the sulfonimide amide class.

[0074] According to another embodiment, the present invention provides a compound comprising: (XIV): [ka] In the compounds defined above, R, R 2A , R 2B and R4 has the meaning defined above, X is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy or nitro substituted compounds.

[0075] The above chemical structure of formula (XIV) is a carboxylic acid compound that belongs to the sulfoximine class.

[0076] According to another embodiment, the present invention provides a compound of formula (XV): [ka] In the compounds defined above, R, R 2A , R 2B and R4 has the meaning defined above and R3 has the meaning defined above but is different from OH, X is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10) substituted with an alkoxy group or nitro; Concerning compounds.

[0077] The above chemical structure of formula (XV) is an ester compound that belongs to the sulfoximine class.

[0078] According to another embodiment, the present invention comprises: - Formula (XVI): [ka] wherein R, R 2A , R 2B and R4 has the meaning defined above, X is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The above-mentioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) a compound substituted with an alkoxy group or nitro; or - Formula (XVII): [ka] wherein R, R 2A , R 2B and R4 has the meaning defined above and X has the meaning defined above, The present invention relates to a compound as defined above, selected from:

[0079] The above chemical structure of formula (XVI) is an oxadiazolone compound that belongs to the sulfoximine class.

[0080] The above chemical structure of formula (XVII) is a tetrazole compound that belongs to the sulfoximine class.

[0081] According to another embodiment, the present invention provides a compound of formula (XVIII): [ka] In the compounds defined above, R 2A , R 2B , R4, R 10 and R 11 has the meaning defined above.

[0082] The above chemical structure of (XVIII) is a carboxylic acid compound that belongs to the sulfonamide class.

[0083] According to another embodiment, the present invention provides a compound according to the present invention, comprising: (XIX): [ka] In the compounds defined above, R 2A , R 2B , R4, R 10 and R 11 has the meaning defined above and R3 has the meaning defined above but is different from OH.

[0084] The above chemical structure of formula (XIX) is an ester compound that belongs to the sulfonamide class.

[0085] According to another embodiment, the present invention provides a compound of formula (XX): [ka] In the compounds defined above, R 2A , R 2B , R4, R 10 , R 11 , R 12 and R 13 has the meaning defined above.

[0086] The above chemical structure of formula (XX) is an amide compound that belongs to the sulfonamide class.

[0087] According to another embodiment, the present invention provides: - Formula (XXI): [ka] and R 2A , R 2B , R4, R 10 , and R 11 has the meaning defined above, or - Formula (XXII): [ka] and R 2A , R 2B , R4, R 10 and R 11 has the meaning defined above, The present invention relates to a compound as defined above, selected from:

[0088] The above chemical structure of formula (XXI) is an oxadiazolone compound that belongs to the sulfonamide class.

[0089] The above chemical structure of formula (XXII) is a tetrazole compound that belongs to the sulfonamide class.

[0090] According to another embodiment, the present invention provides a compound of formula (XXIII): [ka] In the compounds as defined above, Z is - below [ka] where R1 is a hydrogen atom, (C1-C 10 ) represents an alkyl group or an aryl ring; X is, represents the NR5R6 group, where R5 and R6 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, or heteroaryl (C1-C 10 ) represents an alkyl group, The group may optionally be one or more halogen atoms, (C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C1-C 10 ) acyl group, or (C1-C 10 ) substituted with an alkylcarbamoyl group, The aforementioned cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; or represents a C4-C group NR5R6, in which R5 and R6, together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from among nitrogen, sulfur and oxygen; 10 forming a membered heterocyclic ring, the heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused to an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may optionally be one or more halogen atoms, (C1-C 10 ) alkyl group or (C1-C 10 ) substituted with an acyl group, R 2A and R 2B are independently hydrogen and (C1-C10 ) alkyl group, (C1-C 10 ) alkyl group and hydrogen, or (C1-C 10 ) alkyl groups and (C1-C 10 ) represents an alkyl group, R4 represents a phenyl ring, Concerning compounds.

[0091] The above chemical structure of formula (XXIII) corresponds to a class of carboxylic acid compounds and a class of sulfonimide amide compounds.

[0092] According to another embodiment, the present invention provides a compound of formula (XXIV): [ka] In the compounds as defined above, Z is [ka] where R1 is a hydrogen atom, (C1-C 10 ) alkyl group or aryl ring, and X is (C1-C 10 ) represents an alkyl group, R 2A and R 2B are independently hydrogen and (C1-C 10 ) alkyl group, (C1-C 10 ) alkyl group and hydrogen, or (C1-C 10 ) alkyl groups and (C1-C 10 ) represents an alkyl group, R4 represents a phenyl ring, Concerning compounds.

[0093] The above chemical structure of formula (XXIV) corresponds to a class of carboxylic acid compounds and a class of sulfoximines.

[0094] According to another embodiment, the present invention provides a method for producing a compound according to the present invention, comprising the steps of: [ka] In the compounds as defined above, Z is the following group: [ka] represents R 10 and R 11 independently represent hydrogen and an aryl ring, or an aryl ring and hydrogen; R 2A and R 2B are independently hydrogen and (C1-C 10 ) alkyl group, (C1-C 10 ) alkyl group and hydrogen, or (C1-C 10 ) alkyl groups and (C1-C 10 ) represents an alkyl group, R4 represents a phenyl ring, Concerning compounds.

[0095] The above chemical structure of formula (XXIV) corresponds to a class of carboxylic acid compounds and a class of sulfonamides.

[0096] According to another embodiment, the present invention provides a compound of formula (I): [ka] In the compounds as defined above, Z is - below [ka] where R1 is a hydrogen atom, (C1-C 10 ) an alkyl group or an aryl ring; X is: represents the NR5R6 group, where R5 and R6 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C10 ) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group or heteroaryl (C1-C 10 ) alkyl group, The group may optionally be one or more halogen atoms, (C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C1-C 10 ) acyl group, or (C1-C 10 ) substituted with an alkylcarbamoyl group, The aforementioned cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; or C4-C groups representing NR5R6, in which R5 and R6, together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from among nitrogen, sulfur and oxygen; 10 forming a membered heterocyclic ring, the heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused to an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may optionally be one or more halogen atoms, (C1-C 10 ) alkyl or (C1-C 10 ) substituted by an acyl group, or ○ (C1-C 10 ) alkyl group, Whether it represents or - the following groups [ka] represents R 10 and R 11 independently represent hydrogen and an aryl ring, or an aryl ring and hydrogen; R 2A and R2B are independently hydrogen and (C1-C 10 ) alkyl group, (C1-C 10 ) alkyl group and hydrogen, or (C1-C 10 ) alkyl groups and (C1-C 10 ) represents an alkyl group, R4 represents a phenyl ring; R9 is ○ The following bases [ka] and R3 is (C1-C 10 ) represents an alkoxy group, or ○ The following bases [ka] represents R 12 and R 13 are independently optionally one or more halogen atoms or (C-C 10 ) substituted with alkoxy groups, hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) represents an alkoxy group, or ○ The following ring [ka] or ○ The following ring [ka] The present invention relates to a compound represented by the formula:

[0097] The above chemical structure of this formula (I) may correspond to the classes of esters, amides, oxadiazolones or tetrazoles, and the classes of sulfonimide amides, sulfoximines or sulfonamides.

[0098] According to another embodiment, the invention relates to a compound as defined above, having a formula selected from the following: Methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxybenzoate (compound 1), Methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxybenzoate (compound 2), Methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (compound 3), Methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (compound 4), Methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxybenzoate (compound 5), Methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxybenzoate (compound 6), Methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (compound 7), Methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (compound 8), Methyl 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxybenzoate (compound 9), Methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxybenzoate (compound 10), Methyl 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (compound 11), Methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxybenzoate (compound 12), Methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoate (compound 13), Methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxybenzoate (compound 14), Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoate (compound 15), Methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoate (compound 16), Methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxybenzoate (compound 17), Methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (compound 18), Methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxybenzoate (compound 19), Methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxybenzoate (compound 20), Methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxybenzoate (compound 21), Methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (compound 22), Methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 23), Methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxybenzoate (compound 24), Methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (compound 25), Methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (compound 26), Methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (compound 27), Methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxybenzoate (compound 28), Methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (compound 29), Methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 30), Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (compound 31), Methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (compound 32), Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (compound 33), Methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (compound 34), Methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 35), Methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (compound 36), Methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (compound 37), Methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (compound 38), Methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (compound 39), Methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 40), Methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (compound 41), Methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 42), Methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (compound 43), Methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (compound 44), Methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (compound 45), Methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxybenzoate (compound 46), Methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (compound 47), Methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (compound 48), Methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (compound 49), Methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 50), 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxybenzoic acid (compound 51), 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoic acid (compound 52), 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (compound 53), 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (compound 54), 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 55), 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoic acid (compound 56), 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (compound 57), 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 58), 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 59), 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 60), 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (compound 61), 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 62), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (compound 63), 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (compound 64), 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 65), 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (compound 66), 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 67), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (compound 68), 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 69), 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 70), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 71), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 72), 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (compound 73), 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 74), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (compound 75), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (compound 76), 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 77), 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 78), 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 79), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (compound 80), 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (compound 81), 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 82), 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (compound 83), 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (compound 84), 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (compound 85), 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (compound 86), 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 87), 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 88), 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (compound 89), 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (compound 90), 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (compound 91), 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 92), 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (compound 93), 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxybenzoic acid (compound 94), 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (compound 95), 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (compound 96), 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 97), Methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (compound 98), Methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (compound 99), 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (compound 100), 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 101), 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (compound 102), 3-(butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzamide (compound 103), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy-benzamide (compound 104), 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (compound 105), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (compound 106), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxy-benzamide (compound 107), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (compound 108), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 109), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (compound 110), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (compound 111), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (compound 112), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (compound 113), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 114), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (compound 115), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy-benzamide (compound 116), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy-benzamide (compound 117), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 118), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (compound 119), 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (compound 120), 3-(butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (compound 121), 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (compound 122), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2-trifluoroethyl)benzamide (compound 123), Methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (compound 124), 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (compound 125), 3-(butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (compound 126), 3-(butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenyl-benzenesulfonamide (compound 127), Methyl 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoate (compound 128), Methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxybenzoate (compound 129), 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 130), 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoic acid (compound 131), Methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxybenzoate (compound 132), Methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxybenzoate (compound 133), 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 134), N-butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (compound 135).

[0099] According to another embodiment, the present invention provides a compound of formula (XIIi): [ka] In the compound R 2A and R 2B are independently hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The aforementioned alkyl and aryl may optionally contain one or more deuterium atoms, halogen atoms, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; or R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may optionally contain one or more deuterium atoms, halogen atoms, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) substituted with heterocycloalkyl groups, which may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; Rx is (C1-C 10 ) alkyl group, (C3-C 10) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) substituted with an alkoxy group or nitro; R 14 , R 15 and R 16 each independently represents a methyl group, an ethyl group, an isopropyl group, a tert-butyl group, or an aryl group; R4 is optionally one or more deuterium, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C 10 ) represents a phenyl ring substituted by an acylamino group, R3 is (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or or C3-C, wherein R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; 12 forming a heterocyclic ring, The heterocycle may optionally contain one or more deuterium atoms, halogen atoms, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group or (C3-C 10 ) may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof, substituted with heterocycloalkyl groups; the alkyl group is linear or branched; the aryl group is a 6-membered aromatic carbocyclic ring; The heteroaryl group is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from nitrogen, sulfur, and oxygen atoms; compound, its isomers, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, In particular, as intermediate compounds for the synthesis of the compounds defined above, Concerning compounds.

[0100] These compounds defined above are intermediates in the synthesis of sulfonimidamides and their preparation is included in the description of the synthesis of sulfonimidamides.

[0101] According to another embodiment, the present invention provides a compound of formula (XIIIi): [ka] In the compound Rx is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) substituted with an alkoxy group or nitro; R4 is optionally one or more deuterium, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C 10) represents a phenyl ring substituted by an acylamino group, R3 is (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or or C3-C, wherein R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; 12 forming a heterocyclic ring, The heterocycle may optionally contain one or more deuterium atoms, halogen atoms, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C10 ) alkoxy group or (C3-C 10 ) may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof, substituted with heterocycloalkyl groups; the alkyl group is linear or branched; the aryl group is a 6-membered aromatic carbocyclic ring; The heteroaryl group is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from nitrogen, sulfur, and oxygen atoms; compound, its isomers, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, In particular, as intermediate compounds for the synthesis of the compounds defined above, Concerning compounds.

[0102] These compounds defined above are intermediates in the synthesis of sulfoximines and their preparation is included in the description of the synthesis of sulfoximines.

[0103] According to another embodiment, the present invention provides a compound of formula (XIVi): [ka] In the compound R3 is OH, (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, R 17 teeth, [ka] X represents a group selected from (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The aforementioned groups may optionally be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) substituted by an alkoxy group or nitro; R 18 is chlorine, bromine, fluorine or [ka] and R4 optionally represents a group selected from the group consisting of one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10) alkoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C 10 ) a phenyl ring substituted by an acylamino group, R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or or C3-C, wherein R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; 12 forming a heterocyclic ring, The heterocycle may optionally contain one or more deuterium atoms, halogen atoms, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group or (C3-C 10 ) substituted with heterocycloalkyl groups, which may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations thereof; compound, its isomers, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers, In particular, as intermediate compounds for the synthesis of the compounds defined above, Concerning compounds.

[0104] These compounds defined above are intermediates in the synthesis of sulfoximines containing a thiophenol or thioether function, and their preparation is included in the description of the synthesis of sulfoximines.

[0105] According to another embodiment, the present invention relates to the following compound: methyl 3-(butylamino)-5-[[tert-butyl(dimethyl)silyl]sulfamoyl]-4-phenoxy-benzoate (Int02).

[0106] This compound is an intermediate in the synthesis of sulfonimidamides.

[0107] According to another embodiment, the present invention relates to the following compound: methyl 3-(methylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int07).

[0108] This compound is an intermediate in the synthesis of sulfoximines.

[0109] According to another embodiment, the present invention provides a compound of the following formula: 4-chloro-3-nitro-5-sulfanyl-benzoic acid (Int04), Methyl 4-chloro-3-methylsulfanyl-5-nitro-benzoate (Int05), or Regarding methyl 3-methylsulfanyl-5-nitro-4-phenoxy-benzoate (Int06).

[0110] These compounds are intermediates in the synthesis of sulfoximines.

[0111] The present invention relates to a process for preparing a compound of formula (II) as defined above, comprising the steps of: [ka] During the ceremony, R5 and R6 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C10 ) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl groups, heteroaryl groups (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or R5 and R6, together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, C4-C 10forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, aryl ring or (C1-C 10 ) optionally substituted with an acyl group, - R1 is hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl groups, heteroaryl groups (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; ·R 2A and R 2B are independently hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy or NR7R8; or R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; R4 represents a phenyl ring and is substituted with one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8, or (C1-C 10 ) optionally substituted with an acylamino group; R9 represents: - the following groups: [ka] wherein R3 is OH, (C1-C 10 ) alkoxy group, (C3-C10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, or - the following groups: [ka] In the formula, R 12 and R 13 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10) cycloalkyl group, including one or more deuterium, halogen, amino, hydroxy, (C1-C 10 )Alkoxy, NR7R8, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbonylamino groups; R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen, C3-C 12 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) silylation of a compound of formula (XXVI) with a compound of formula (XXVII) to obtain a compound of formula (XVIII): [ka] In the formula, R 2A , R 2B and R4 have the meanings defined above and GP1 is a protecting group, in particular (C1-C 10 ) alkoxy group, (C3-C 10) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, wherein R7 and R8 have the meanings defined above. [ka] In the formula, R 14 , R 15 , R 16 independently represent a methyl group, an ethyl group, an isopropyl group, a butyl group, a tert-butyl group or an aromatic group; [ka] In the formula, GP1, R 2A , R 2B , R4, R 14 , R 15 and R 16 has the meaning defined above, b) reacting the following groups to obtain a compound of formula (XXIX): [ka] one of the oxygen atoms in [ka] In the compounds of formula (XVIII), in particular with dichlorotriphenylphosphorane or a mixture of PPh3 and (CCl3)2 and HNR5R6, where R5 and R6 have the meanings defined above, [ka] In the formula, GP1, R 2A , R 2B , R4, R5, R6, R 14 , R 15 and R 16 has the meaning defined above, c) deprotection of the silyl function of said compound (XXIX), in particular with acidic acetonitrile, to obtain a compound of formula (XXX): [ka] In the formula, GP1, R 2A , R 2B , R4, R5 and R6 have the meanings defined above; The compound has R9=a group: [ka] , when R3=GP1 and R1=H, it is a compound of formula (II), And, in some cases, d) - addition of R1-B(OH)2, in which R1 represents an aryl or heteroaryl ring, to a compound of formula (XXXI), in particular with Cu(OAc)2, to obtain a compound of formula (XXXI) The aryl or heteroaryl ring may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. [ka] In the formula, GP1, R1, R 2A , R 2B , R4, R5 and R6 have the meanings defined above; The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (II): or - addition of formaldehyde to a compound of formula (XXX) to obtain a compound of formula (XXXI) as follows: [ka] In the formula, GP1, R 2A , R 2B , R4, R5 and R6 have the meanings defined above, and R1 represents a methyl group; The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (II): or - (C1-C2) of the compounds of formula (XXX), in particular with K2CO3, KH or NaH, to obtain compounds of formula (XXXI) 10 ) alkyl-Br group, (C3-C 10 ) cycloalkyl-Br group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl-Br group, (C3-C 10 ) heterocycloalkyl-Br group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl-Br group, aryl (C1-C 10 ) alkyl-Br group, aryl (C1-C 10 ) alkoxy-Br group, aryl (C3-C 10 ) cycloalkyl-Br group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl-Br group, heteroaryl (C1-C 10 ) alkyl-Br group, heteroaryl (C3-C 10 ) cycloalkyl-Br group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) addition of alkyl-Br groups, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. [ka] In the formula, GP1, R 2A , R 2B , R4, R5 and R6 have the meanings defined above, and R1 is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl group or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; In particular, in the compound of formula (XXX) using K2CO3, KH or NaH, The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (II): And, in some cases, e) A compound of the formula (II) wherein R9 is one of the following groups: [ka] and R3 is OH), saponification of the compound of formula (XXX) or (XXXI), in particular with LiOH, NaOH or KOH, to give And, in some cases, f) HNR 12 R 13 (In the formula, R 12 , R 13has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluronium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, to prepare one of the compounds of formula (II) (wherein R is one of the following groups: [ka] and R3 is OH) to give a compound of formula (II) [ka] ) and The alkyl group is linear or branched, the aryl ring is a six-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Regarding the manufacturing method.

[0112] The process described above is a method for preparing compounds of formula (II) which are part of the sulfonimide amide class.

[0113] Step d) is optional when R1 represents hydrogen.

[0114] Step e) is optional if the compound is part of the ester class.

[0115] The compounds obtained at the end of step f) form part of the amide family.

[0116] This method, which comprises three steps a), b) and c), forms part of the present invention.

[0117] This method, which comprises four steps a), b), c) and d), forms part of the present invention.

[0118] This method, which comprises four steps a), b), c) and e), forms part of the present invention.

[0119] This method, which comprises five steps a), b), c), d) and e), forms part of the present invention.

[0120] This method, which comprises five steps a), b), c), e) and f), forms part of the present invention.

[0121] This method, which comprises six steps a), b), c), d), e) and f), forms part of the present invention.

[0122] In this particular embodiment, step a) is a silylation step of compounds of formula (XXVII) and (XXVI) in a cyclic ether, preferably tetrahydrofuran, as solvent selected from among tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tertbutyl methyl ether, tert-butyl ethyl ether, methyltetrahydrofuran, 1,4-dioxane or methoxycyclopentane, and a tertiary or aromatic amine as base, one of triethylamine, diisopropylamine, pyridine or dimethylaminopyridine, for example at a temperature between 0° C. and 100° C., preferably 50° C.

[0123] In this particular embodiment, step b) is a substitution step at the sulfur atom of the compound of formula (XXVIII) to synthesize a sulfonimidamide functional group, for example using dichlorotriphenylphosphorane or triphenylphosphine and hexachloroethane in chloroform or dichloromethane or THF, preferably in chloroform, at a temperature between −50° C. and 75° C., preferably 0° C.

[0124] In this particular embodiment, step c) is a deprotection step of the silyl function of the compound of formula (XXIX), for example using acidic acetonitrile at a temperature between −20° C. and 100° C., preferably 20° C., or using a fluoride ion source, in particular tetrabutylammonium fluoride in THF, or potassium fluoride, or cesium fluoride, at 20° C.

[0125] In this particular embodiment, step d) is the addition of R1-B(OH)3 to a compound of formula (XXX) in a cyclic ether as solvent selected from tetrahydrofuran, diethyl ether, dimethoxymethane, for example at a temperature between 20°C and 200°C, preferably at 100°C, for 16 hours.

[0126] The present invention relates to a process for preparing a compound of formula (III) as defined above, comprising the steps of: [ka] During the ceremony, ·X is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with an alkoxy group or nitro; R1 is hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10) alkyl group, aryl ring, heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl groups, heteroaryl groups (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; ·R 2A and R 2B are independently hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy or NR7R8; or R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; R4 represents a phenyl ring and is substituted with one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8, or (C1-C 10 ) optionally substituted with an acylamino group; R9 represents: - the following groups: [ka] In the formula, R3 is OH, (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, or - the following groups: [ka] In the formula, R 12 and R 13 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl group, including one or more deuterium, halogen, amino, hydroxy, (C1-C 10 ) alkoxy group, NR7R8, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbonylamino groups; or - The following rings: [ka] R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen, C3-C 12 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) Reduction, in particular with PPh or SnCl or zinc powder, of a compound of formula (XXXII) below to obtain a compound of formula (XXXIII) below: [ka] wherein Y represents fluorine, chlorine or bromine; [ka] wherein Y has the meaning defined above. b) Addition of the X and GP1 groups in the compound of formula (XXXIII) to obtain a compound of formula (XXXIV) below, in particular the addition of: - addition of XZ and Gp1-Z, in particular with XZ and a base, in particular with iodomethane and Cs2CO3 or K2CO3, - addition of XZ and Gp1-OH, in a first step, in particular with XZ and an aqueous base, in particular with MeI and aqueous NaOH, followed by a coupling reagent and Gp1-OH, in particular with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in Gp1-OH, or with an alcohol and an acid, in particular with Gp1-OH and sulfuric acid, - addition of XZ and Gp1-OH, in particular with an alcohol and an acid, in particular Gp1-OH and sulfuric acid, in particular methanol and sulfuric acid, in a first step, followed by XZ and a base, in particular MeI and Cs2CO3 or K2CO3, where Z represents bromine or iodine and X has the meaning defined above: [ka] wherein Y, GP1 and X have the meanings defined above. c) aromatic nucleophilic substitution of compound (XXXIV) with R4-OH, in which R4 has the meaning defined above, in particular with K2CO3 or Cs2CO3, NaOMe, triethylamine, N,N-diisopropylethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene, to obtain compounds of formula (XXXV) below: [ka] wherein GP1, X and R4 have the meanings defined above. d) oxidation of compounds of formula (XXXV), in particular with (diacetoxyiodo)benzene and an ammonium donor such as ammonium carbamate, ammonium carbonate, ammonia or ammonium acetate, to give compounds of formula (XXXVI): [ka] wherein GP1, X and R4 have the meanings defined above. e) Reduction of compounds of formula (XXXVI), in particular with palladium and hydrogen, or FeCl, ZnCl or SnCl in aqueous ammonium chloride, to give compounds of formula (XXXVII): [ka] wherein GP1, X and R4 have the meanings defined above. f) - reductive amination of a compound of formula (XXXVII) by adding a compound of formula (XXXVIII) or (XXXIX) and a reducing agent, in particular NaBH(OAc)3 or NaBH3CN: (XXXVIII) is the following group: [ka] and (XXXIX) is the following group: [ka] and In the formula, T 2A and T 2B are independently hydrogen, a (C1-C9) alkyl group, 10 -C 11 ) represents an alkyl group, Optionally, one or more deuterium atoms, halogen atoms, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; or by adding a compound of formula (XL) or (XLI) or a compound of formula (XL) and (XLI) with a base, in particular Cs2CO3 or K2CO3, to obtain a compound of formula (XLII): (XL) is R 2A -Hal, (XLI) is R 2B -Hal, where Hal represents chlorine or bromine. Alkylation of the compound of formula (XXXVII): [ka] wherein GP1, R4 and X have the meanings defined above, and R 2A , R 2B is hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; or - arylation of compounds of formula (XLIII) or (XLIV), or of compounds of formulae (XLIII) and (XLIV), in particular with palladium or copper catalysts, by adding a catalyst selected from copper(II) acetate, palladium diacetate, tris(dibenzylideneacetone)dipalladium(0) or palladium(II)[1,1'-bis(diphenylphosphanyl)ferrocene]dichloride: (XLIII) is R 2A -M, (XLIV) is R 2B -M, where R 2A and R 2B are independently an aryl or heteroaryl ring, an aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; where M is chlorine or bromine or one of the following groups: [ka] represents wherein Mx1 and Mx2 independently represent hydrogen or a (C1-C6) alkyl group, and Mx1 and Mx2 may be linked by a covalent bond. or - nucleophilic aromatic substitution of compounds of formula (XXXVII) with compounds of formula (XLV) and (XLVI) and the addition of a base, in particular triethylamine, to obtain compounds of formula (XLII) below: (XLV) is R 2A -F, (XLVI) is R 2B -F, [ka] wherein GP1, R4 and X have the meanings defined above, and R 2A , R 2B are independently hydrogen, an aryl or heteroaryl ring, an aryl (C-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy or NR7R8; or - double alkylation of a compound of formula (XXXVII) by adding a compound of formula (XLVIII) and a base, in particular Cs2CO3, K2CO3 or triethylamine, to obtain a compound of formula (XLIX): [ka] wherein Hal represents chlorine or bromine and n is a positive integer from 4 to 10. [ka] wherein GP1, R4 and X have the meanings defined above, and R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; The compounds of formula (XLII) or (XLIX) may have R9=the following group: [ka] , when R3=GP1 and R1=H, it is a compound of formula (III): And, in some cases, g) addition of R1-B(OH)2, in which R1 represents an aryl or heteroaryl ring, to one of the compounds of formula (XLII) or (XLIX), in particular using Cu(OAc)2, to obtain a compound of formula (L) below, The aryl or heteroaryl ring may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The above cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms, including: [ka] In the formula, GP1, R1, R 2A , R 2B , R4 and X have the meanings defined above; The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (III): or - addition of formaldehyde in one of the compounds of formula (XLII) or (XLIX) to obtain a compound of formula (L) below: [ka] In the formula, GP1, R 2A , R 2B , R4 and X have the meanings defined above, R1 represents a methyl group, The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (III): or - (C1-C2) in a compound of formula (XXX), in particular with K2CO3, KH or NaH, to obtain a compound of formula (L) 10 ) alkyl-Br group, (C3-C 10 ) cycloalkyl-Br group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl-Br group, (C3-C 10 ) heterocycloalkyl-Br group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl-Br group, aryl (C1-C 10 ) alkyl-Br group, aryl (C1-C 10 ) alkoxy-Br group, aryl (C3-C 10 ) cycloalkyl-Br group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl-Br group, heteroaryl (C1-C 10 ) alkyl-Br group, heteroaryl (C3-C 10 ) cycloalkyl-Br group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) the addition of an alkyl-Br group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The above cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms, including: [ka] In the formula, GP1, R 2A , R 2B , R4 and X have the meanings defined above, and R1 is (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkyl group, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) Cycloalkyl groups, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acyl groups, (C1-C 10 ) acylamino group, (C3-C 10) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (III): And, in some cases, h) R9 is the following group: [ka] saponification of one of the compounds of formula (XLII), (XLIX) or (L), in particular with LiOH, NaOH or KOH, to obtain said compound of formula (III), wherein R3 is OH, And, in some cases, i) HNR 12 R 13 (where R 12 and R 13 has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, in which R is the following group: [ka] and R3 is OH, by amidating the compound of formula (III) so that R9 is the following group: [ka] obtaining a compound of formula (III) which represents Or, after step h), j) In particular, using 1,1'-carbonyldiimidazole and aqueous ammonia (amidation), followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide, or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), followed by sodium azide and ammonium chloride (cyclization), R9 can be converted to the group [ka] and R3 is OH, is subjected to amidation, followed by dehydration, followed by cyclization, to give a compound of formula (III) wherein R9 is the following ring: [ka] obtaining a compound of formula (III) which represents The alkyl group is linear or branched, the aryl ring is a six-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Regarding the manufacturing method.

[0127] The above-mentioned process is a method for preparing compounds of formula (III) which belong to the sulfoximine class.

[0128] Step g) is optional if R1 represents hydrogen.

[0129] Step h) is optional if the compound belongs to the ester class.

[0130] The compounds obtained at the end of step i) form part of the amide family.

[0131] The compounds obtained at the end of step j) form part of the tetrazole family.

[0132] This method, which comprises six steps a), b), c), d), e) and f), forms part of the present invention.

[0133] This method, which comprises seven steps a), b), c), d), e), f) and g), forms part of the present invention.

[0134] This method, which comprises seven steps a), b), c), d), e), f) and h), forms part of the present invention.

[0135] This method, which comprises eight steps a), b), c), d), e), f), g) and h), forms part of the present invention.

[0136] This method, which comprises eight steps a), b), c), d), e), f), h) and i), forms part of the present invention.

[0137] This method, which comprises nine steps a), b), c), d), e), f), g), h) and i), forms part of the present invention.

[0138] This method, which comprises nine steps a), b), c), d), e), f), h), i) and j), forms part of the present invention.

[0139] This method, which comprises ten steps a), b), c), d), e), f), g), h), i) and j), forms part of the present invention.

[0140] In this particular embodiment, step a) is a reduction step of the compound of formula (XXXII), for example at temperatures between 0° C. and 200° C., preferably at 100° C., for 16 hours.

[0141] In this particular embodiment, step b) is a step of addition of X and / or GP1 groups to a compound of formula (XXXIII) in a polar solvent selected from among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular dimethylformamide, for example at a temperature between −20° C. and 100° C., in particular 20° C.

[0142] In this particular embodiment, step c) is a step of aromatic nucleophilic substitution of R4-OH on a compound of formula (XXXIV) in a polar solvent selected from among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular in dimethylformamide, for example at a temperature between 20°C and 200°C, in particular 100°C.

[0143] In this particular embodiment, step d) is an oxidation step on the compound of formula (XXXV) to synthesize a sulfoximine functional group. This reaction is carried out, for example, at a temperature between −75° C. and 80° C., in particular at 20° C., in a polar protic solvent selected from methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol.

[0144] In this particular embodiment, step e) is a reduction step of the compound of formula (XXXVI) in a polar protic solvent selected from among methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol, at a temperature of, for example, between −50° C. and 100° C., preferably 20° C.

[0145] In this particular embodiment, step f) is a step of addition to a compound of formula (XXXVII) in a solvent selected from among dichloromethane, chloroform, 1,2-dichloroethane, tetrachloroethane and tetrahydrofuran, in particular in 1,2-dichloroethane, at a temperature of, for example, between −50° C. and 100° C., preferably at 20° C.

[0146] In this particular embodiment, step g) is the addition of a compound of formula R1-B(OH)2 to a compound of formula (XLII) or (XLIX) in a cyclic ether as solvent selected from tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tert-butyl methyl ether, tert-butyl ethyl ether, methyltetrahydrofuran, 1,4-dioxane or methoxycyclopentane, preferably in 1,4-dioxane, for example at a temperature between 20°C and 200°C, preferably at 100°C, for 16 hours.

[0147] In this particular embodiment, step h) is a saponification step of a compound of one of formulae (XLII), (XLIX) or (L), for example at a temperature between -50°C and 75°C, preferably at 20°C.

[0148] The present invention relates to a process for preparing a compound of formula (IV) as defined above, comprising the steps of: [ka] During the ceremony, ·R 10 and R 11 independently represent hydrogen and aryl, or aryl and hydrogen; The aryl may be one or more of deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy groups, nitro, amino, hydroxy, NR7R8, (C1-C 10 ) acylamino group, (C3-C 10) cycloalkylcarbonylamino group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C 10 ) alkylcarbamoyl group, (C3-C 10 ) cycloalkylcarbamoyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbamoyl groups; ·R 2A and R 2B are independently hydrogen, (C1-C 10 ) alkyl group, (C 11 -C 12 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group or heteroaryl (C3-C 10 ) represents a cycloalkyl group, The above alkyl and aryl may be substituted with one or more deuterium, halogen, (C3-C 10 ) cycloalkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) optionally substituted with a heterocycloalkyl group, nitro, amino, hydroxy, or NR7R8; or R 2A and R 2B C4-C, which together with the nitrogen atom carrying them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen. 10 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; R4 represents a phenyl ring and is substituted with one or more deuterium atoms, halogen atoms, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, nitro, amino, hydroxy, NR7R8, or (C1-C 10 ) optionally substituted with an acylamino group; R9 represents: The following groups: [ka] In the formula, R3 is OH, (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, or The following groups: [ka] In the formula, R 12 and R 13 are independently hydrogen, (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C3-C 10 ) heterocycloalkyl group, (C3-C 10 )Heterocycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, aryl or heteroaryl ring, aryl (C1-C 10 ) alkyl group, aryl (C3-C 10 ) cycloalkyl group, heteroaryl (C1-C 10 ) alkyl group, heteroaryl (C3-C 10 ) cycloalkyl group, including one or more deuterium, halogen, amino, hydroxy, (C1-C 10 ) alkoxy group, NR7R8, (C1-C 10 ) acylamino group, (C3-C 10 ) cycloalkylcarbonylamino group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) optionally substituted with alkylcarbonylamino groups; or ○ The following rings: [ka] or The following ring: [ka] R7 and R8 are independently (C1-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, or (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkyl group, or R7 and R8, together with the nitrogen atom bearing them, optionally contain 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen, C3-C 12 forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C-C 10 ) alkyl group, (C3-C 10 ) cycloalkyl group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkyl group, (C1-C 10 ) alkoxy group, or (C3-C 10 ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) Addition of a Ph-Hal group, where Hal represents bromine or iodine, in a compound of formula (LI) below, in particular using CuI, N,N'-dimethylethylenediamine and potassium carbonate, to obtain a compound of formula (LIII) below: [ka] In the formula, R 2A , R 2B and R4 have the meaning defined above, GP1 is a protecting group, in particular (C1-C 10 ) alkoxy group, (C3-C 10 ) cycloalkoxy group, (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, (C3-C 10 )Heterocycloalkyl(C1-C10 ) alkoxy group, containing 1 to 3 alkenyl functional groups (C2-C 10 ) alkenyloxy group, containing 1 to 3 alkynyl functional groups (C2-C 10 ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C1-C 10 ) alkoxy group, aryl (C3-C 10 ) cycloalkoxy group, aryl (C3-C 10 )Cycloalkyl(C1-C 10 ) alkoxy group, heteroaryl (C1-C 10 ) alkoxy group, heteroaryl (C3-C 10 ) cycloalkoxy group, or heteroaryl (C3-C 10 )Cycloalkyl(C1-C 10 ) represents an alkoxy group, [ka] In the formula, GP1, R 2A , R 2B and R4 has the meaning defined above, The compound has R9=a group: [ka] and R3=GP1, the compound is of formula (IV): And, in some cases, b) R9 = the following group: [ka] Saponification of compounds of formula (LIII), in particular with LiOH, NaOH or KOH, to obtain compounds of formula (IV), in which R3=OH: And, in some cases, c) in particular with 1,1'-carbonyldiimidazole and aqueous ammonia (amidation), followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide, or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), to obtain compounds of formula (LIV) where R9=a group [ka] and R3=OH, followed by a dehydration step: [ka] In the formula, R 2A , R 2B and R4 has the meaning defined above. and, d) R9 is the following ring: [ka] cyclization of compounds of formula (LIV), in particular with sodium azide and ammonium chloride, to give compounds of formula (IV), which represent or d') R9 is the following ring, (sulfonamido oxadiazolone and tetrazole): [ka] a step of addition of HO-NH to said compound of formula (LIV) followed by a cyclization step, in particular with hydroxylammonium chloride and NaHCO3 (addition of HO-NH) followed by 1,1'-carbonyldiimidazole and 1,8-diazabicyclo[5.4.0]undec-7-ene (cyclization), to give a compound of formula (IV) which represents Or, after step b), e) HNR 12 R 13 (where R 12 and R 13has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, in which R is one of the following groups: [ka] and R3 represents OH, is amidated to form a compound of formula (IV) wherein R9 represents the following group: [ka] obtaining a compound of formula (IV) which represents The alkyl group is linear or branched, the aryl ring is a six-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Regarding the manufacturing method.

[0149] The above process is a method for preparing compounds of formula (IV) which belong to the sulfonamide class.

[0150] If the compound is part of the ester class, step b) is optional.

[0151] The compounds obtained at the end of step b) are part of the carboxylic acid family.

[0152] If step c) is performed, one step selected from d) or d') is mandatory.

[0153] The compounds obtained at the end of step d) are part of the tetrazole family.

[0154] The compounds obtained at the end of step d') are part of the oxadiazolone family.

[0155] The compounds obtained at the end of step e) are part of the amide family.

[0156] This method comprising one step a) forms part of the present invention.

[0157] This method, which comprises the two steps a) and b), forms part of the present invention.

[0158] This method, which comprises four steps a), b), c) and d), forms part of the present invention.

[0159] This method, which comprises four steps a), b), c) and d'), forms part of the present invention.

[0160] This method, which comprises the three steps a), b) and e), forms part of the present invention.

[0161] According to another embodiment, the invention relates to a compound as defined above for use as a medicament.

[0162] According to another embodiment, the present invention relates to a pharmaceutical composition comprising a compound as defined above as an active substance and a pharmaceutically acceptable excipient.

[0163] The pharmaceutical composition can be formulated as a dosage form for oral or parenteral administration.

[0164] According to another embodiment, the invention relates to a pharmaceutical composition as defined above in a single form containing between 0.033 mg and 200 mg of active substance (for a human weighing 70 kg).

[0165] According to another embodiment, the present invention relates to a pharmaceutical composition as defined above, formulated for administration of active substance in the range of 0.00047 mg to 2.86 mg per kg of body weight.

[0166] According to another embodiment, the present invention relates to a method for the treatment of a patient in need thereof, comprising the administration of a pharmaceutical composition as defined above, in such a way that the active substance is administered in a dose of 0.1 mg / day to 200 mg / day, preferably in a dose of about 0.5 mg / day to about 100 mg / day.

[0167] According to another embodiment, the invention relates to a compound as defined above or a pharmaceutical composition as defined above for its use in the prevention or treatment of pathologies involving a functional defect in the inhibition of the NKCCl transporter.

[0168] The term "prevention" of a disorder or disease as used herein is well known in the art. For example, a patient / subject suspected of being prone to a disorder or disease may particularly benefit from prevention of that disorder or disease. The subject / patient may have a susceptibility or predisposition to the disorder or disease, including, but not limited to, a genetic predisposition. Such predisposition can be determined, for example, by standard methods or assays using genetic markers or phenotypic indicators. It should be understood that the disorder or disease to be prevented in accordance with the present invention is one that has not been diagnosed or cannot be diagnosed in the patient / subject (e.g., the patient / subject does not exhibit any clinical or pathological symptoms). Thus, the term "prevention" includes the use of a compound of the present invention before clinical and / or pathological symptoms are diagnosed or determined, or can be diagnosed or determined by a physician. It should be understood that the present invention specifically relates to each and every combination of the features described herein, including any combination of general and / or preferred features. In particular, the present invention specifically relates to each combination of the meanings (including general and / or preferred meanings) for the various groups and variables contained in formula (I).

[0169] The term "treatment" of a disorder or disease as used herein is well known in the art. "Treatment" of a disorder or disease means that the disorder or disease is suspected or diagnosed in a patient / subject. A patient / subject suspected of suffering from a disorder or disease typically exhibits certain clinical and / or pathological symptoms that one skilled in the art can readily attribute to a particular pathological condition (i.e., diagnose the disorder or disease).

[0170] "Treatment" of a disorder or disease may, for example, result in halting the progression of the disorder or disease (e.g., no worsening of symptoms) or slowing the progression of the disorder or disease (if the halt in progression is transient). "Treatment" of a disorder or disease may also result in a partial response (e.g., improvement in symptoms) or a complete response (e.g., disappearance of symptoms) in the subject / patient suffering from the disorder or disease. Thus, "treatment" of a disorder or disease may also refer to an improvement in the disorder or disease, which may result in, for example, halting or slowing the progression of the disorder or disease. Such a partial or complete response may be followed by a relapse. It should be understood that a subject / patient may experience a wide range of responses to treatment (e.g., the exemplary responses described above). Treatment of a disorder or disease may include, inter alia, curative treatment (preferably a complete response, ultimately leading to a cure of the disorder or disease) and palliative treatment (including symptomatic relief).

[0171] According to another embodiment, the invention relates to a compound as defined above or a pharmaceutical composition as defined above, intended for use in the prevention or treatment of one of the following pathologies: Cancer, especially glioblastoma, pancreatic cancer, prostate cancer, lung cancer, kidney cancer, colon cancer, and brain diseases; neurodegenerative or psychiatric disorders, particularly schizophrenia, autism spectrum disorder, Fragile X syndrome, Rett syndrome, Down syndrome, or Parkinson's disease; or · Pathologies associated with inflammatory conditions. GABA-induced hyperactivity (with a shift to excitement) - ) iEpilepsy, including temporal lobe epilepsy, childhood epilepsy, partial or generalized seizures, has been shown to be associated with level and inhibition deficiencies. [Brief explanation of the drawings]

[0172] [Figure 1] Functional NKCCl assay. A. Contribution of NKCCl to K+ influx in native HEK293 cells under isotonic (basal) conditions. K+ influx was measured in untreated cells (Cntr), cells exposed to 100 μM ouabain (ouab), 20 μM bumetanide (bum), or both. B. Signal separation between native HEK293 cells with and without 20 μM bumetanide. Cells were tested in the presence of hypertonic saline and 100 μM ouabain. These conditions served as the standard for our drug testing. C. Absence of bumetanide-sensitive K+ influx in Δ-NKCCl HEK293 cells. Note that K+ influx was reduced to basal levels. [Figure 2] Brain slice (hippocampus) with electrical stimulation and recording. (1) Hippocampal subfield CA3, (2) bipolar stimulating electrode, (3) hippocampal subfield CA1, (4) dentate gyrus. [Figure 3] Normalized GDP current density in CA3 pyramidal neurons in the presence of NKCCl inhibitor. A. Normalized GDP current density in CA3 pyramidal neurons as a function of compound 57 concentration in μM. B. Normalized GDP current density in CA3 pyramidal neurons as a function of compound 51 concentration in μM. C. Normalized GDP current density in CA3 pyramidal neurons as a function of compound 57 and compound 51 concentrations in μM. [Figure 4] Cell-attached recording, tetanus in CA1 pyramidal neurons in the presence of Compound 51 expressed in picoamperes per second (20 stimuli, 100 Hz, four consecutive traces superimposed). The top bar represents 100 Hz stimulation of the stratum radiatum in control conditions, and the bottom bar represents 30 min after application of 2 μM Compound 51. [Figure 5]Cell-attached recording, tetanus in CA1 pyramidal neurons in the presence of Compound 57 expressed in picoamperes per second (20 stimuli, 100 Hz, four consecutive traces superimposed). The top bar represents 100 Hz stimulation of the stratum radiatum under control conditions, and the bottom bar represents 30 min after application of 2 μM Compound 57. [Figure 6] Post-tetanic frequency (normalized) (within a 20-second window after tetanic stimulation) in the presence or absence of 2 μM Compound 51 (paired two-tailed t-test: p=1*e-4, n=5 cells). Error bars represent the standard error of the mean. [Figure 7] Post-tetanic frequency (normalized) (within a 20-second window after tetanic stimulation) in the presence or absence of 2 μM Compound 57 (paired two-tailed t-test: p=1*e-4, n=5 cells). Error bars represent the standard error of the mean. DETAILED DESCRIPTION OF THE INVENTION

[0173] Legend CDI: carbonyldiimidazole; CHCl3: chloroform; CH3CN: acetonitrile; CV: column volume; d: doublet; DBU: 1,8-diazabicyclo[5.4.0]undec-7-ene; DIPEA: N-ethyldiisopropylamine; DCM: dichloromethane; DMAP: 4-dimethylaminopyridine; DMF: N,N-dimethylformamide; DMSO: dimethyl sulfoxide; ESI+: positive electrospray ionization; Et2O: diethyl ether; EtOAc: ethyl acetate; GP: general procedure; H2: hydrogen; HATU: 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate; HCl: hydrogen chloride; HPLC / MS: high-pressure liquid chromatography / mass spectrometry; K2CO3: potassium carbonate; KNO3: potassium nitrate; LiOH: lithium hydroxide. m: multiplet; MeI: methyl iodide; MeOH: methanol; MS: mass spectrometry; NaOH: sodium hydroxide; Na2SO4: sodium sulfate nBu: n-butyl; PIDA: (diacetoxyiodo)benzene; Pyr.: pyridine; s: singlet; t: triplet; TBDMSCl: tert-butyldimethylsilyl chloride; TFAA: trifluoroacetic anhydride; THF: tetrahydrofuran; TLC: thin layer chromatography; UV: ultraviolet

[0174] [Analytical equipment] 1 H NMR analysis (400MHz), 13 C NMR (101 MHz), and 19 F NMR spectra (376 MHz) were recorded using a Bruker ULTRASHIELD400 spectrometer. Spectra were processed and analyzed using MestReNova. Data are presented in the following order: chemical shift in ppm relative to the internal solvent signal, multiplicity, coupling constant J in Hertz, and number of protons.

[0175] Reverse-phase HPLC / MS analysis was performed using a Waters Alliance 2795 HPLC equipped with an autosampler, an inline membrane degasser, a column oven (temperature set at 45 °C), a UV detector, and a ZQ quadrupole mass detector operating in electrospray ionization mode. Compounds (0.1–0.3 mg) were solubilized in a minimal amount of DMSO (total volume 1 mL) prepared with acetonitrile. Standard analytical parameters were: flow rate 1 mL / min, injection volume 5 μL.

[0176] Acidic conditions: Waters XSelect CSH C18 column (3.5 μm, 2.1 × 50 mm). Gradient: 95 / 5 to 0 / 100 (H2O + 0.04% v / v HC02H (10 mM)) / ACN in 2.5 min. - Alkaline conditions: Waters Xbridge C18 column (3.5 μm, 2.1 × 50 mm). Gradient: 95 / 5 to 0 / 100 in 2.5 min (H2O + 0.06% v / v NH3(aq) (10 mM)) / ACN.

[0177] 1-[General synthesis scheme for compounds 1-123] [ka]

[0178] Step 1: Methyl 3-(butylamino)-4-phenoxy-5-sulfamoyl-benzoate (Int01) Starting from bumetanide (28395-03-1), compound Int01 was obtained according to the procedure described in Bioorganic Chemistry, 2020, 100, 103878.

[0179] Step 2: Methyl 3-(butylamino)-5-[[tert-butyl(dimethyl)silyl]sulfamoyl]-4-phenoxybenzoate (Int02) To a stirred suspension of Int01 (1.16 g, 3.06 mmol) in dry THF (4 mL, 0.8 M) under an argon atmosphere was added triethylamine (940 μL, 6.75 mmol, 2.2 equiv.). The mixture was stirred at 20 °C for 10 min, and a solution of TBDMSCl (610 mg, 3.83 mmol, 1.25 equiv.) in toluene (1 mL) was added dropwise. The resulting mixture was stirred at 50 °C for 18 h. The solution was cooled to 20 °C, and the resulting suspension was filtered. The solid was washed with EtO, and the combined filtrate was concentrated under reduced pressure. The resulting crude product was stirred in a mixture of THF / EtO (2 / 1, 12 mL) for 5 min, and the suspension was filtered. The filtrate was concentrated under reduced pressure to give Int02 (1.50 g, 2.90 mmol, 94%) as an orange oil. C24H36N2O5SiS; MS (ESI+) m / z: 493 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.95 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.30 (dd, J = 8.7 Hz, J = 7.4 Hz, 2H), 7.14-7.04 (m, 1H), 6.93-6.89 (m, 2H), 4.45 (brs, 1H), 3.94 (s, 3H), 3.83 (t, J = 5.4 Hz, 1H), 3.11-3.09 (m, 2H), 1.45-1.38 (m, 2H), 1.20-1.10 (m, 2H), 0.85 (s, 9H), 0.81 (t, J = 7.3 Hz, 3H), 0.12 (s, 6H).

[0180] General Procedure 1 (GP1): Preparation of sulfonimidamides: Step 3: [Method A] A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3 (0.6 M) was stirred at 70 °C for 3 h. After cooling to 20 °C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred at 20 °C for 10 min and cooled to 0 °C. A solution of Int02 (1 equiv.) in CHCl3 (0.6 M) was added, and the resulting clear solution was stirred at 0 °C for 20 min. An amine (3 equiv.) in CHCl3 (2 M) was added, and the resulting solution was heated to 20 °C and stirred for 2 h. The solvent was removed, and the crude mixture was diluted in CH3CN (0.1 M). 37% HCl (0.5 v / v CH3CN) was added at 20 °C, and the resulting solution was stirred at 20 °C for 45 min. The solution was basified to pH = 10 with a saturated solution of NaHCO3, and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over Na2SO4, filtered, and concentrated under reduced pressure to give the crude sulfonimidamide. The crude residue was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to give pure compounds 1-21.

[0181] [Method B] A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3 (0.6 M) was stirred at 70 °C for 3 h. After cooling to 20 °C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred at 20 °C for 10 min and cooled to 0 °C. A solution of Int02 (1 equiv.) in CHCl3 (0.6 M) was added, and the resulting clear solution was stirred at 0 °C for 20 min. An amine (3 equiv.) in CHCl3 (2 M) was added, and the resulting solution was heated to 20 °C and stirred for 2 h. The solvent was removed, and the crude mixture was diluted in CH3CN (0.1 M). A solution of tetrabutylammonium fluoride (1 M in THF, 1 equiv.) was added at 20 °C, and the resulting solution was stirred at 20 °C for 5 h. If necessary, a solution of tetrabutylammonium fluoride (1 M in THF, 2 equiv.) was added at 20 °C, and the resulting solution was stirred at 20 °C until complete conversion was observed (monitored by LCMS). Water was added to the reaction mixture, which was extracted with a mixture of CHCl3:iPrOH (8:2). The combined organic layers were concentrated under reduced pressure. The crude residue was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to give pure compounds 22–50.

[0182] General Procedure 2 (GP2): Saponification of methyl esters: Step 4 - Compounds 51-101: [Method A] To a solution of the methyl ester (1 equiv.) diluted in a mixture of THF / HO / MeOH 1 / 1 / 1 (0.1 M) was added LiOH (2 equiv.). The resulting mixture was stirred at 20 °C for 2 h or until complete conversion was observed. The THF was removed, and the mixture was diluted in water (5 mL). The aqueous layer was washed with EtOAc and acidified with 1 N HCl to pH = 2-3. The aqueous layer was extracted with EtOAc, and the resulting organic layer was dried over NaSO, filtered, and concentrated under reduced pressure to give the corresponding carboxylic acid.

[0183] [Method B] In a sealed tube, potassium trimethylsilanolate (2.4 equiv.) was added to a solution of the methyl ester (1 equiv.) diluted in dry tetrahydrofuran (0.2 M). The reaction was stirred at 20 °C for 16 h. Portions of potassium trimethylsilanolate (0.6 equiv.) were added every 4 h to achieve complete conversion (monitored by LCMS). Once complete conversion was achieved, water was added to the reaction mixture. The aqueous layer was acidified by adding 1 N aqueous HCl to achieve a pH of 2-3. The organic layer was extracted three times with DCM, and the combined organic layers were washed once with brine, dried over MgSO4, filtered, and concentrated under reduced pressure to give the corresponding carboxylic acid.

[0184] General Procedure 3 (GP3): Peptide Conjugation Reaction: Step 5: To a solution of carboxylic acid (1 equiv.) in N,N-dimethylformamide (0.1 M) was added DIPEA (1.5 equiv.) and HATU (1.2 equiv.) at 20 °C. The resulting mixture was stirred at 20 °C until complete conversion (conversion monitored by LCMS). The reaction was poured into a saturated aqueous solution of NH4Cl and extracted twice with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude products were purified by reverse-phase LCMS. The pure fractions containing the target compounds were collected and concentrated under reduced pressure to give pure compounds 102–123.

[0185] [1.1 Compound 1] [ka] Methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxybenzoate (Compound 1) Starting from Int02 and methylamine 2M in THF, compound 1 was isolated as a white solid (44 mg, 0.11 mmol, 14%) following GP1 (Step 3-Method A). C19H25N3O4S; MS (ESI+) m / z: 392 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.34-7.28 (m, 2H), 7.12-7.05 (m, 1H), 6.93-6.87 (m, 2H), 3.94 (s, 3H), 3.89 (t, J = 5.4 Hz, 1H), 3.15-3.07 (m, 2H), 2.53 (s, 3H), 1.48-1.38 (m, 2H), 1.22-1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0186] [1.2 Compound 2] [ka] Methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxybenzoate (Compound 2) Starting from Int02 and dimethylamine 2M in diTHF, compound 2 was isolated as a sticky yellow solid (25 mg, 0.06 mmol, 8%) according to GP1 (Step 3-Method A). C20H27N3O4S; MS (ESI+) m / z: 406 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.32-7.26 (m, 2H), 7.08-7.03 (m, 2H), 6.85-6.80 (m, 2H), 3.94 (s, 3H), 3.89 (t, J = 5.5 Hz, 1H), 3.14-3.07 (m, 2H), 2.75 (s, 6H), 1.48-1.38 (m, 2H), 1.23-1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0187] [1.3 Compound 3] [ka] Methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (Compound 3) Starting from Int02 and pyrrolidine, compound 3 was isolated as a white solid (25 mg, 0.06 mmol, 7.5%) according to GP1 (Step 3-Method A). C22H29N3O4S; MS (ESI+) m / z: 432 [M+H]+.

[0188] [1.4 Compound 4] [ka] Methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (Compound 4) Starting from Int02 and piperidine, compound 4 was isolated as a sticky white solid (150 mg, 0.34 mmol, 35%) following GP1 (Step 3-Method A). C23H31N3O4S; MS (ESI+) m / z: 446 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.31-7.26 (m, 2H), 7.08-7.01 (m, 1H), 6.84-6.79 (m, 2H), 3.93 (s, 3H), 3.89 (t, J = 5.5 Hz, 1H), 3.21-3.04 (m, 6H), 2.71 (brs, 1H), 1.53-1.46 (m, 4H), 1.46-1.38 (m, 4H), 1.23-1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0189] [1.5 Compound 5] [ka] Methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxybenzoate (Compound 5) Starting from Int02 and N-methylethanamine, compound 5 was isolated as a white solid (102.4 mg, 0.1346 mmol, 25%) according to GP1 (Step 3 - Method A). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.33-7.26 (m, 2H), 7.09 - 7.02 (m, 1H), 6.86 - 6.79 (m, 2H), 3.93 (s, 3H), 3.86 (t, J = 5.5 Hz, 1H), 3.28 - 3.05 (m, 4H), 2.77 (s, 3H), 2.73 (s, 1H), 1.42 (m, 2H), 1.22-1.11 (m, 2H), 1.07 (t, J = 7.1 Hz, 3H), 0.82 (t, J = 7.3 Hz, 3H).

[0190] [1.6 Compound 6] [ka] Methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxybenzoate (Compound 6) Starting from Int02 and morpholine, compound 6 was isolated as a white solid (206 mg, 0.4511 mmol, 47%) according to GP1 (Step 3-Method A). C22H29N3O5S; MS (ESI+) m / z: 448 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.98 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31-7.24 (m, 2H), 7.05 (td, J = 7.4, 1.1 Hz, 1H), 6.85-6.75 (m, 2H), 3.92 (s, 4H), 3.61 - 3.48 (m, 4H), 3.21-3.07 (m, 6H), 1.50-1.37 (m, 2H), 1.25-1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0191] [1.7 Compound 7] [ka] Methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (Compound 7) Starting from Int02 and aniline, compound 7 was isolated as a white solid (86 mg, 0.1877 mmol, 19%) following GP1 (Step 3-Method A). C24H27N3O4S; MS (ESI+) m / z: 454 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.98 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31-7.24 (m, 2H), 7.05 (td, J = 7.4, 1.1 Hz, 1H), 6.85-6.75 (m, 2H), 3.92 (s, 4H), 3.61 - 3.48 (m, 4H), 3.21-3.07 (m, 6H), 1.50 - 1.37 (m, 3H), 1.25-1.09 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0192] [1.8 Compound 8] [ka] Methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (Compound 8) Starting from Int02 and benzylamine, compound 8 was isolated as a white solid (178 mg, 0.3699 mmol, 38%) according to GP1 (Step 3 - Method A). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.07 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.31-7.19 (m, 5H), 7.17-7.11 (m, 2H), 7.08-7.02 (m, 1H), 6.90-6.81 (m, 2H), 4.18-4.10 (m, 1H), 3.95 (s, 3H), 3.98-3.91 (m, 1H), 3.88-3.82 (m, 1H), 3.114-3.08 (m, 2H), 1.49-1.38 (m, 2H), 1.27-1.11 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0193] [1.9 Compound 9] [ka] Methyl 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxybenzoate (Compound 9) Starting from Int02 and 2-methoxyethylamine, compound 9 was isolated as a white solid (161 mg, 0.3697 mmol, 38%) according to GP1 (Step 3 - Method A). C21H29N3O5S; MS (ESI+) m / z: 436 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.03 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.35-7.25 (m, 2H), 7.12-7.02 (m, 1H), 6.94-6.85 (m, 2H), 3.93 (s, 3H), 3.88 (t, J = 5.4 Hz, 1H), 3.41-3.26 (m, 2H), 3.25 (s, 3H), 3.16-3.07 (m, 3H), 3.06-2.97 (m, 1H), 1.48-1.36 (m, 2H), 1.24-1.09 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0194] [1.10 Compound 10] [ka] Methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxybenzoate (Compound 10) Starting from Int02 and cyclopropylamine, compound 10 was isolated as a white solid (173 mg, 0.4141 mmol, 61%) following GP1 (Step 3-Method A). C21H27N3O4S; MS (ESI+) m / z: 418 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.10 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.34-7.27 (m, 2H), 7.12-7.06 (m, 1H), 6.93-6.86 (m, 2H), 3.94 (s, 3H), 3.91 (t, J = 5.8 Hz, 1H), 3.17-3.08 (m, 2H), 2.23-2.16 (m, 1H), 1.49-1.38 (m, 2H), 1.24-1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H), 0.62-0.50 (m, 2H), 0.50-0.44 (m, 1H), 0.44-0.34 (m, 1H).

[0195] [1.11 Compound 11] [ka] Methyl 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (Compound 11) Compound 11 was isolated as a white solid (50 mg, 0.1012 mmol, 15%) according to GP1 (Step 3 - Method A) starting from Int02 and azepane (0.23 mL, 2.02 mmol). C24H33N3O4S; MS (ESI+) m / z: 460 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.98 (d, J = 2.0 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.31-7.25 (m, 2H), 7.08-7.02 (m, 1H), 6.86-6.81 (m, 2H), 3.92 (s, 3H), 3.85-3.78 (m, 1H), 3.36-3.26 (m, 2H), 3.26-3.17 (m, 2H), 3.12-3.04 (m, 2H), 1.74-1.60 (m, 3H), 1.60-1.53 ​​(m, 4H), 1.45-1.34 (m, 2H), 1.28-1.21 (m, 1H), 1.20-1.07 (m, 2H), 0.80 (t, J = 7.3 Hz, 3H).

[0196] [1.12 Compound 12] [ka] Methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxybenzoate (Compound 12) Starting from Int02 and cyclohexanemethylamine, compound 12 was isolated as a white solid (99 mg, 0.2084 mmol, 31%) following GP1 (Step 3-Method A). C25H35N3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.34-7.27 (m, 2H), 7.12-7.03 (m, 1H), 6.92-6.86 (m, 2H), 3.92 (s, 3H), 3.91-3.85 (m, 1H), 3.17-3.06 (m, 2H), 2.77-2.68 (m, 1H), 2.58-2.48 (m, 1H), 1.68-1.55 (m, 5H), 1.48-1.37 (m, 2H), 1.23-1.06 (m, 6H), 0.87-0.72 (m, 5H).

[0197] [1.13 Compound 13] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoate (Compound 13) Starting from Int02 and 4-aminomethyltetrahydropyran, compound 13 was isolated as a white solid (56 mg, 0.1182 mmol, 18%) according to GP1 (Step 3 - Method A). C24H33N3O5S; MS (ESI+) m / z: 476 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.34-7.25 (m, 2H), 7.12-7.04 (m, 1H), 6.89 (d, J = 8.0 Hz, 2H), 3.92 (s, 3H), 3.91-3.82 (m, 4H), 3.32-3.18 (m, 2H), 3.16-3.05 (m, 2H), 2.84-2.73 (m, 1H), 2.65-2.52 (m, 1H), 1.55-1.38 (m, 5H), 1.23-1.05 (m, 4H), 0.82 (t, J = 7.4 Hz, 3H).

[0198] [1.14 Compound 14(B72)] [ka] Methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxybenzoate (Compound 14) Starting from Int02 and N-methylaniline, compound 14 was isolated as a white solid (87 mg, 0.1712 mmol, 18%) following GP1 (Step 3-Method A). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.97 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.33 - 7.19 (m, 3H) overlapped with chloroform-d, 7.18 - 7.10 (m, 2H), 7.08 - 6.99 (m, 1H), 6.71 (dd, J = 8.7, 1.1 Hz, 2H), 3.91 (s, 3H), 3.87 - 3.76 (m, 1H), 3.25 (s, 3H), 3.10 (td, J = 6.9, 5.4 Hz, 2H), 1.47 - 1.34 (m, 2H), 1.21 - 1.09 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).

[0199] [1.15 Compound 15(B73)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoate (Compound 15) Starting from Int02 and 5-pyrimidinemethanamine, compound 15 was isolated as a white solid (31 mg, 0.0594 mmol, 8%) according to GP1 (Step 3 - Method A). C23H27N5O4S; MS (ESI+) m / z: 470 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.99 (s, 1H), 8.45 (s, 2H), 7.97 (d, J = 2.0 Hz, 1H), 7.50 (d, J = 2.0 Hz, 1H), 7.27 - 7.20 (m, 2H), 7.01 (t, J = 7.4 Hz, 1H), 6.88 - 6.75 (m, 2H), 4.10 (d, J = 15.0 Hz, 1H), 3.94 (d, J = 15.0 Hz, 1H), 3.88 (s, 3H), 3.84 - 3.78 (m, 1H), 3.05 (td, J = 6.9, 5.4 Hz, 2H), 1.41 - 1.33 (m, 2H), 1.16 - 1.04 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H).

[0200] [1.16 Compound 16(B74)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoate (Compound 16) Starting from Int02 and pyridin-3-amine, compound 16 was isolated as a white solid (140 mg, 0.3084 mmol, 75%) according to GP1 (Step 3 - Method A). C23H26N4O4; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.97 - 7.89 (m, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.63 (s, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.35 (s, 1H), 7.27 - 7.19 (m, 2H), 7.05 - 6.99 (m, 2H), 6.92 - 6.85 (m, 1H), 6.85 - 6.77 (m, 2H), 5.28 - 5.16 (m, 1H), 3.90 (s, 3H), 3.13 - 3.03 (m, 2H), 1.45 - 1.34 (m, 2H), 1.20 - 1.10 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H).

[0201] [1.17 Compound 17(B76)] [ka] Methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxybenzoate (Compound 17) Starting from Int02 and 3-methoxyaniline, compound 17 was isolated as a white solid (151 mg, 0.3091 mmol, 64%) following GP1 (Step 3 - Method A). C25H29N3O5S; MS (ESI+) m / z: 484 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.11 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.33 - 7.27 (m, 2H), 7.13 - 7.07 (m, 1H), 6.99 (t, J = 8.1 Hz, 1H), 6.93 - 6.87 (m, 2H), 6.46 (dddd, J = 11.8, 7.9, 2.2, 0.9 Hz, 2H), 6.23 (t, J = 2.2 Hz, 1H), 3.94 (s, 3H), 3.64 (s, 3H), 3.11 (t, J = 6.9 Hz, 2H), 1.47 - 1.37 (m, 2H), 1.16 (h, J = 7.4 Hz, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0202] [1.18 Compound 18(B78)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (Compound 18) Starting from Int02 and 4-phenylpiperidine, compound 18 was isolated as a white solid (213 mg, 0.4001 mmol, 83%) according to GP1 (Step 3 - Method A). C29H35N3O4S; MS (ESI+) m / z: 522 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.05 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.36 - 7.27 (m, 4H), 7.22 - 7.17 (m, 1H), 7.14 - 7.07 (m, 3H), 6.88 - 6.84 (m, 2H), 3.94 (s, 3H), 3.98 - 3.90 (m, 2H), 3.13 (t, J = 7.0 Hz, 2H), 2.67 (m, 2H), 2.52 - 2.42 (m, 1H), 1.79 (m, 2H), 1.65 - 1.50 (m, 2H), 1.45 (m, 2H), 1.27 - 1.13 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0203] [1.19 Compound 19(B79)] [ka] Methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxybenzoate (Compound 19) Starting from Int02 and indoline, compound 19 was isolated as a light brown solid (163 mg, 0.3365 mmol, 70%) following GP1 (Step 3-Method A). C26H29N3O4S; MS (ESI+) m / z: 480 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.22 (d, J = 2.0 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.26 - 7.23 (m, 1H), 7.20 - 7.15 (m, 2H), 7.05 - 6.97 (m, 3H), 6.85 (td, J = 7.4, 1.1 Hz, 1H), 6.72 - 6.67 (m, 2H), 3.94 (s, 3H), 3.48 (q, J = 7.0 Hz, 2H), 3.02 (t, J = 6.9 Hz, 2H), 2.83 - 2.62 (m, 2H), 1.38 - 1.30 (m, 2H), 1.08 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0204] [1.20 Compound 20(B80)] [ka] Methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxybenzoate (compound 20) Starting from Int02 and 8-oxa-3-azabicyclo[3.2.1]octane, compound 20 was isolated as a white solid (210 mg, 0.4434 mmol, 92%) according to GP1 (Step 3 - Method A). C24H31N3O5S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.95 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 - 7.26 (m, 2H), 7.09 - 7.03 (m, 1H), 6.85 - 6.80 (m, 2H), 4.36 (m, 2H), 3.93 (s, 3H), 3.50 (dd, J = 41.7, 11.5 Hz, 2H), 3.10 (t, J = 7.0 Hz, 2H), 2.94 (m, 2H), 2.02 - 1.88 (m, 4H), 1.43 (m, 2H), 1.18 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0205] [1.21 Compound 21(B81)] [ka] Methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxybenzoate (Compound 21) Compound 21 was isolated as a pale yellow oil (44 mg, 0.0952 mmol, 20%) following GP1 (Step 3-Method A) starting from Int02 and 1-methylpyrazol-3-amine. C22H37N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.13 (d, J = 2.0 Hz, 1H), 7.70 - 7.64 (m, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.46 (m, 1H), 7.29 (m, 2H), 7.11 - 7.06 (m, 1H), 6.95 - 6.91 (m, 2H), 3.92 (s, 3H), 3.76 (s, 3H), 3.09 (q, J = 6.5 Hz, 2H), 1.41 (m, 2H), 1.16 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0206] [1.22 Compound 22(B96)] [ka] Methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (Compound 22) Starting from Int02 and 3-chloroaniline, compound 22 was isolated as an off-white foam (224 mg, 0.4590 mmol, 91%) according to GP1 (Step 3-Method B). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.17 - 7.11 (m, 1H), 7.02 - 6.96 (m, 1H), 6.91 - 6.83 (m, 3H), 6.69 - 6.64 (m, 1H), 6.56 (t, J = 2.1 Hz, 1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.48 - 1.39 (m, 2H), 1.23 - 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0207] [1.23 Compound 23(B97)] [ka] Methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxybenzoate (Compound 23) Starting from Int02 and (3-chlorophenyl)methanamine, compound 23 was isolated as a white solid (262 mg, 0.5219 mmol, 99%) according to GP1 (Step 3-Method B). C25H28ClN3O4S; MS (ESI+) m / z: 502 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 1.9 Hz, 1H), 7.32 - 7.26 (m, 2H), 7.18 - 7.12 (m, 3H), 7.10 - 7.03 (m, 2H), 6.92 - 6.86 (m, 2H), 4.19 - 3.96 (m, 2H), 3.95 (s, 3H), 3.10 (t, J = 7.0 Hz, 2H), 1.50 - 1.38 (m, 2H), 1.23 - 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0208] [1.24 Compound 24(B98)] [ka] Methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxybenzoate (Compound 24) Starting from Int02 and isoindoline, compound 24 was isolated as a brown oil (239 mg, 0.4834 mmol, 97%) following GP1 (Step 3-Method B). C26H29N3O4S; MS (ESI+) m / z: 480 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.51 (d, J = 2.0 Hz, 1H), 7.24 - 7.16 (m, 4H), 7.14 - 7.09 (m, 2H), 6.99 - 6.94 (m, 1H), 6.85 - 6.80 (m, 2H), 4.71 - 4.61 (m, 4H), 3.91 (s, 3H), 3.07 (t, J = 7.0 Hz, 2H), 1.44 - 1.35 (m, 2H), 1.20 - 1.09 (m, 2H), 0.80 (t, J = 7.4 Hz, 3H).

[0209] [1.25 Compound 25(B99)] [ka] Methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxybenzoate (Compound 25) Compound 25 was isolated as a white solid (113 mg, 0.2994 mmol, 59%) following GP1 (Step 3-Method B) starting from Int02 and a 0.5 M solution of ammonia in dioxane. C18H23N3O4S; MS (ESI+) m / z: 379 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.97 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.35 - 7.29 (m, 2H), 7.10 (td, J = 7.3, 1.0 Hz, 1H), 6.97 - 6.89 (m, 2H), 4.89 (s, 2H), 3.94 (s, 3H), 3.87 (t, J = 5.5 Hz, 1H), 3.14 - 3.07 (m, 2H), 1.46 - 1.37 (m, 2H), 1.21 - 1.11 (m, 2H), 0.82 (t, J = 7.4 Hz, 3H).

[0210] [1.26 Compound 26(B105)] [ka] Methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (Compound 26) Starting from Int02 and 2-chloroaniline, compound 26 was isolated as a white solid (63 mg, 0.1291 mmol, 28%) according to GP1 (Step 3-Method B). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.26 (d, J = 1.9 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.34 (dd, J = 8.1, 1.5 Hz, 1H), 7.30 - 7.26 (m, 3H), 7.08 (td, J = 7.7, 1.6 Hz, 2H), 6.93 - 6.89 (m, 3H), 3.95 (s, 3H), 3.09 (t, J = 6.9 Hz, 2H), 1.46 - 1.34 (m, 2H), 1.21 - 1.06 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).

[0211] [1.27 Compound 27(B106)] [ka] Methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxybenzoate (Compound 27) Starting from Int02 and 4-chloroaniline, compound 27 was isolated as a white solid (97 mg, 0.1990 mmol, 43%) following GP1 (Step 3-Method B). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.35 - 7.27 (m, 2H), 7.12 (t, J = 7.4 Hz, 1H), 7.07 - 7.00 (m, 2H), 6.93 - 6.85 (m, 2H), 6.71 - 6.58 (m, 2H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.50 - 1.37 (m, 2H), 1.22 - 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0212] [1.28 Compound 28(B107)] [ka] Methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxybenzoate (Compound 28) Starting from Int02 and 3-(difluoromethoxy)aniline, compound 28 was isolated as a white solid (209 mg, 0.4023 mmol, 87%) following GP1 (Step 3-Method B). C25H27F2N3O5S; MS (ESI+) m / z: 520 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.31 (dd, J = 8.5, 7.2 Hz, 2H), 7.17 - 7.09 (m, 1H), 7.05 (t, J = 8.1 Hz, 1H), 6.92 - 6.85 (m, 2H), 6.71 - 6.61 (m, 2H), 6.43 (d, J = 74.4 Hz, 1H), 6.31 (t, J = 2.3 Hz, 1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.49 - 1.37 (m, 2H), 1.24 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0213] [1.29 Compound 29(B108)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (Compound 29) Starting from Int02 and tetrahydropyran-4-amine, compound 29 was isolated as an off-white solid (236 mg, 0.4959 mmol, 95%) following GP1 (Step 3-Method B). C23H31N3O5S; MS (ESI+) m / z: 462 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.1 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.12 - 7.06 (m, 1H), 6.95 - 6.88 (m, 2H), 3.94 (s, 3H), 3.91 - 3.71 (m, 2H), 3.45 - 3.23 (m, 3H), 3.17 - 3.06 (m, 2H), 1.90 - 1.50 (m, 2H), 1.48 - 1.24 (m, 4H), 1.22 - 1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0214] [1.30 Compound 30(B109)] [ka] Methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxybenzoate (Compound 30) Compound 30 was isolated as a yellow oil (191 mg, 0.4024 mmol, 87%) following GP1 (Step 3-Method B) starting from Int02 and 1-methylpiperidin-4-amine. C24H34N4O4S; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.03 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.37 - 7.26 (m, 2H), 7.13 - 7.05 (m, 1H), 6.97 - 6.84 (m, 2H), 3.94 (s, 3H), 3.86 (t, J = 5.4 Hz, 1H), 3.11 (q, J = 6.5 Hz, 2H), 2.75 - 2.61 (m, 2H), 2.27 (s, 3H), 1.95 - 1.82 (m, 2H), 1.77 - 1.61 (m, 2H), 1.53 - 1.34 (m, 4H), 1.21 - 1.11 (m, 2H), 1.01 (t, J = 7.3 Hz, 1H), 0.82 (t, J = 7.3 Hz, 3H).

[0215] [1.31 Compound 31(B110)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (Compound 31) Starting from Int02 and pyrimidin-2-amine, compound 31 was isolated as a yellow oil (129 mg, 0.2832 mmol, 61%) according to GP1 (Step 3-Method B). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.24 (d, J = 5.1 Hz, 2H), 8.06 (d, J = 1.9 Hz, 1H), 7.52 (d, J = 1.9 Hz, 1H), 7.12 (t, J = 7.7 Hz, 2H), 6.92 (d, J = 8.5 Hz, 1H), 6.72 (t, J = 7.6 Hz, 3H), 3.88 (s, 3H), 3.86 - 3.80 (m, 1H), 3.07 - 2.99 (m, 2H), 1.42 - 1.30 (m, 2H), 1.14 - 1.06 (m, 2H), 0.74 (t, J = 7.3 Hz, 3H).

[0216] [1.32 Compound 32(B118)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (Compound 32) Starting from Int02 and pyrazin-2-amine, compound 32 was isolated as a yellow oil (30 mg, 0.0667 mmol, 13%) according to GP1 (Step 3 - Method A). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.06 (d, J = 1.9 Hz, 1H), 7.94 - 7.91 (m, 2H), 7.59 (d, J = 1.2 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.24 - 7.18 (m, 2H), 7.09 - 7.04 (m, 1H), 6.75 - 6.71 (m, 2H), 5.80 (s, 1H), 3.94 (s, 3H), 3.87 (t, J = 5.3Hz, 1H), 3.15 - 3.06 (m, 2H), 1.47 - 1.37 (m, 2H), 1.22 - 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0217] [1.33 Compound 33(B121)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (Compound 33) Starting from Int02 and pyrimidin-5-amine, compound 33 was isolated as an off-white solid (16 mg, 0.0358 mmol, 10%) according to GP1 (Step 3-Method B). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.68 (s, 1H), 8.09 (d, J = 2.0 Hz, 1H), 7.99 (s, 2H), 7.62 (d, J = 2.0 Hz, 1H), 7.34 - 7.28 (m, 2H), 7.18 - 7.11 (m, 1H), 6.88 - 6.83 (m, 2H), 5.16 (s, 1H), 3.96 (s, 3H), 3.93 (t, J = 5.4 Hz, 1H), 3.14 (q, J = 6.5 Hz, 2H), 1.49 - 1.40 (m, 2H), 1.25 - 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0218] [1.34 Compound 34(B122)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (Compound 34) Starting from Int02 and 2-phenylethanamine, compound 34 was isolated as an off-white solid (73 mg, 0.1258 mmol, 83%) following GP1 (Step 3-Method B). C26H31N3O4S; MS (ESI+) m / z: 482 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.30 - 7.26 (m, 3H), 7.26 - 7.21 (m, 2H), 7.10 - 7.06 (m, 3H), 6.80 - 6.75 (m, 2H), 3.94 (s, 3H), 3.82 (s, 1H), 3.27 - 3.19 (m, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.08 - 2.99 (m, 1H), 2.74 - 2.58 (m, 2H), 1.48 - 1.38 (m, 2H), 1.24 - 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0219] [1.35 Compound 35(B123)] [ka] Methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxybenzoate (Compound 35) Compound 35 was isolated as an off-white solid (136 mg, 0.2187 mmol, 59%) following GP1 (Step 3-Method B) starting from Int02 and 2-(3-chlorophenyl)ethanamine. C26H30ClN3O4S; MS (ESI+) m / z: 516 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.01 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.29 - 7.27 (m, 3H), 7.22 - 7.19 (m, 2H), 7.10 - 7.04 (m, 2H), 6.83 - 6.78 (m, 2H), 3.94 (s, 3H), 3.88 - 3.79 (m, 1H), 3.30 - 3.17 (m, 1H), 3.11 (t, J = 7.0Hz, 2H), 3.08 - 2.98 (m, 1H), 2.72 - 2.55 (m, 2H), 1.48 - 1.38 (m, 2H), 1.23 - 1.14 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H).

[0220] [1.36 Compound 36(B124)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (Compound 36) Starting from Int02 and 3-pyridylmethylamine, compound 36 was isolated as a white solid (129 mg, 0.2753 mmol, 74%) according to GP1 (Step 3-Method B). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.42 (d, J = 39.5 Hz, 2H), 8.05 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 8.1 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.22 (t, J = 6.4 Hz, 1H), 7.09 - 7.04 (m, 1H), 6.90 - 6.86 (m, 2H), 4.21 - 3.97 (m, 2H), 3.95 (s, 3H), 3.88 (t, J = 5.6 Hz, 1H), 3.11 (q, J = 6.6 Hz, 2H), 1.49 - 1.40 (m, 2H), 1.24 - 1.13 (m, 2H), 0.84 (t, J = 7.4 Hz, 3H).

[0221] [1.37 Compound 37(B125)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (Compound 37) Starting from Int02 and 2-(3-pyridyl)ethylamine, compound 37 was isolated as a white solid (121 mg, 0.2507 mmol, 68%) according to GP1 (Step 3-Method B). C25H30N4O4S; MS (ESI+) m / z: 483 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.48 (d, J = 4.9 Hz, 1H), 8.38 (s, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.54 - 7.51 (m, 1H), 7.32 - 7.27 (m, 3H), 7.08 (t, J = 7.4 Hz, 1H), 6.87 - 6.80 (m, 2H), 3.94 (s, 3H), 3.87 (t, J = 5.8 Hz, 1H), 3.27 - 3.17 (m, 1H), 3.11 (q, J = 6.6 Hz, 2H), 3.07 - 2.99 (m, 1H), 2.74 - 2.63 (m, 2H), 1.49 - 1.39 (m, 2H), 1.23 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0222] [1.38 Compound 38(B126)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (Compound 38) Compound 38 was isolated as a yellow oil (197 mg, 0.4151 mmol, 95%) following GP1 (Step 3-Method B) starting from Int02 and thiazol-2-ylmethylamine. C22H26N4O4S2; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.05 (d, J = 2.0 Hz, 1H), 7.64 (d, J = 3.3 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31 - 7.25 (m, 2H), 7.22 (d, J = 3.3 Hz, 1H), 7.09 - 7.02 (m, 1H), 6.89 (dt, J = 7.8, 1.0 Hz, 2H), 4.52 - 4.33 (m, 2H), 3.94 (s, 3H), 3.88 (d, J = 12.2 Hz, 1H), 3.10 (t, J = 7.1 Hz, 2H), 1.42 (dq, J = 8.2, 7.0 Hz, 2H), 1.22 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0223] [1.39 Compound 39(B127)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (Compound 39) Compound 39 was isolated as a white solid (111 mg, 0.2272 mmol, 61%) following GP1 (Step 3-Method B) starting from Int02 and 2-thiazol-2-ylethylamine. C23H28N4O4S2; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.70 (d, J = 3.4 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.32 - 7.26 (m, 2H), 7.23 (d, J = 3.3 Hz, 1H), 7.10 - 7.03 (m, 1H), 6.89 - 6.85 (m, 2H), 3.93 (s, 3H), 3.83 (s, 1H), 3.49 - 3.42 (m, 1H), 3.39 - 3.30 (m, 1H), 3.15 - 3.06 (m, 4H), 1.46 - 1.38 (m, 2H), 1.22 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0224] [1.40 Compound 40(B128)] [ka] Methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxybenzoate (Compound 40) Starting from Int02 and (1-methylimidazol-2-yl)amine, compound 40 was isolated as a yellow solid (8 mg, 0.0177 mmol, 5%) according to GP1 (Step 3-Method B). C22H27N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.06 (d, J = 1.9 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.24 - 7.20 (m, 2H), 7.02 - 6.95 (m, 1H), 6.89 - 6.85 (m, 2H), 6.83 (d, J = 2.3 Hz, 1H), 6.54 (d, J = 2.4 Hz, 1H), 3.88 (s, 3H), 3.84 (t, J = 6.2, 4.3 Hz, 1H), 3.25 (s, 3H), 3.05 (q, J = 6.5 Hz, 2H), 1.40 - 1.33 (m, 2H), 1.15 - 1.06 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0225] [1.41 Compound 41(B129)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (Compound 41) Starting from Int02 and 2-pyridylamine, compound 41 was isolated as a yellow solid (57 mg, 0.1254 mmol, 34%) following GP1 (Step 3-Method B). C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.01 (d, J = 2.0 Hz, 1H), 7.99 - 7.93 (m, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.45 - 7.38 (m, 1H), 7.25 - 7.20 (m, 2H), 7.08 - 7.01 (m, 1H), 6.86 - 6.79 (m, 2H), 6.77 - 6.69 (m, 1H), 6.60 - 6.55 (m, 1H), 3.90 (s, 3H), 3.83 (t, J = 5.5 Hz, 1H), 3.12 - 3.04 (m, 2H), 1.44 - 1.35 (m, 2H), 1.20 - 1.08 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).

[0226] [1.42 Compound 42(B139)] [ka] Methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxybenzoate (Compound 42) Compound 42 was isolated as a yellow solid (49.5 mg, 0.0997 mmol, 27%) following GP1 (Step 3-Method B) starting from Int02 and (1-methylpyrazol-3-yl)methylamino. C23H29N5O4S; MS (ESI+) m / z: 472 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.05 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 - 7.23 (m, 2H), 7.17 (d, J = 2.2 Hz, 1H), 7.07 - 7.00 (m, 1H), 6.91 - 6.84 (m, 2H), 6.02 (d, J = 2.2 Hz, 1H), 4.19 - 3.99 (m, 2H), 3.93 (s, 3H), 3.88 - 3.81 (m, 1H), 3.79 (s, 3H), 3.09 (q, J = 6.0, 5.4 Hz, 2H), 1.47 - 1.36 (m, 2H), 1.23 - 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0227] [1.43 Compound 43(B153)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (Compound 43) Starting from Int02 and thiazol-2-ylamine, compound 43 was isolated as a grey solid (5 mg, 0.0115 mmol, 3%) according to GP1 (Step 3-Method B). C21H24N4O4S2; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.32 - 7.23 (m, 2H), 7.11 - 7.05 (m, 2H), 6.88 - 6.83 (m, 2H), 6.61 (d, J = 3.9 Hz, 1H), 3.92 (s, 3H), 3.85 (t, J = 5.4 Hz, 1H), 3.09 (q, J = 6.5 Hz, 2H), 1.45 - 1.35 (m, 2H), 1.21 - 1.08 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).

[0228] [1.44 Compound 44(B154)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (Compound 44) Starting from Int02 and pyridin-4-amine, compound 44 was isolated as a white solid (10 mg, 0.0418 mmol, 10%) according to GP1 (Step 3-Method B). C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.16 (d, J = 5.4 Hz, 2H), 8.09 (d, J = 2.0 Hz, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.32 - 7.27 (m, 2H), 7.15 - 7.10 (m, 1H), 6.85 - 6.81 (m, 2H), 6.54 (d, J = 5.4 Hz, 2H), 3.96 (s, 3H), 3.90 (t, J = 5.4 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 1.49 - 1.39 (m, 2H), 1.24 - 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0229] [1.45 Compound 45(B156)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (Compound 45) Starting from Int02 and pyridazin-4-amine, compound 45 was isolated as a white solid (28 mg, 0.0608 mmol, 14%) according to GP1 (Step 3-Method B). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.62 (dd, J = 6.0, 1.0 Hz, 1H), 8.16 (dd, J = 2.8, 1.0 Hz, 1H), 8.05 (d, J = 1.9 Hz, 1H), 7.61 (d, J = 2.0 Hz, 1H), 7.30 - 7.24 (m, 2H), 7.15 - 7.10 (m, 1H), 6.82 - 6.77 (m, 3H), 3.96 (s, 3H), 3.95 - 3.91 (m, 1H), 3.17 - 3.09 (m, 2H), 1.49 - 1.38 (m, 2H), 1.23 - 1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0230] [1.46 Compound 46(B157)] [ka] Methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxybenzoate (Compound 46) Starting from Int02 and butylamine, compound 46 was isolated as a white solid (136 mg, 0.3074 mmol, 70%) following GP1 (Step 3-Method B). C22H31N3O4S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J= 2.0 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.12 - 7.06 (m, 1H), 6.93 - 6.88 (m, 2H), 3.93 (s, 3H), 3.90 (t, J = 8.8 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 2.95 - 2.86 (m, 1H), 2.76 - 2.67 (m, 1H), 1.48 - 1.39 (m, 2H), 1.31 - 1.13 (m, 6H), 0.85 - 0.79 (m, 6H).

[0231] [1.47 Compound 47(B158)] [ka] Methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (Compound 47) Starting from Int02 and bicyclo[1.1.1]pentan-1-amine, compound 47 was isolated as a white solid (62 mg, 0.1398 mmol, 32%) according to GP1 (Step 3 - Method B). C23H29N3O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.06 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.13 - 7.05 (m, 1H), 6.95 - 6.88 (m, 2H), 3.94 (s, 3H), 3.91 - 3.84 (m, 1H), 3.12 (t, J = 6.5 Hz, 2H), 2.26 (s, 1H), 1.78 (s, 6H), 1.49 - 1.39 (m, 2H), 1.24 - 1.12 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0232] [1.48 Compound 48(B159)] [ka] Methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (Compound 48) Starting from Int02 and 3-aminoquinuclidine, compound 48 was isolated as a colorless oil (7.5 mg, 0.0154 mmol, 4%) according to GP1 (Step 3-Method B). C25H34N4O4S; MS (ESI+) m / z: 487 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 7.93 (d, J = 1.9 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.27 - 7.21 (m, 2H), 7.06 - 7.00 (m, 1H), 6.86 - 6.81 (m, 2H), 3.87 (s, 3H), 3.80 (t, J = 5.5 Hz, 1H), 3.39 - 3.30 (m, 1H), 3.08 - 3.01 (m, 2H), 3.01 - 2.94 (m, 1H), 2.80 - 2.61 (m, 4H), 2.36 - 2.27 (m, 1H), 1.77 - 1.42 (m, 4H), 1.41 - 1.32 (m, 2H), 1.32 - 1.23 (m, 1H), 1.16 - 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0233] [1.49 Compound 49(B160)] [ka] Methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoate (Compound 49) Compound 49 was isolated as a colorless oil (166 mg, 0.3252 mmol, 74%) according to GP1 (Step 3-Method B) starting from Int02 and 1-[4-(aminomethyl)-1-piperidyl]ethenone. C26H36N4O5S; MS (ESI+) m / z: 517 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 8.01 (t, J = 2.4 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.10 (t, J = 7.3 Hz, 1H), 6.93 - 6.88 (m, 2H), 4.54 (d, J = 13.7 Hz, 1H), 3.94 (s, 3H), 3.92 - 3.86 (m, 1H), 3.75 (d, J = 13.7 Hz, 1H), 3.11 (q, J = 5.9 Hz, 2H), 2.93 (t, J = 12.9 Hz, 1H), 2.81 (dd, J = 12.8, 6.7 Hz, 1H), 2.59 (td, J = 13.5, 6.6 Hz, 1H), 2.44 (q, J = 11.9 Hz, 1H), 2.05 (s, 3H), 1.71 (t, J = 15.8 Hz, 1H), 1.57 (d, J = 13.6 Hz, 2H), 1.48 - 1.40 (m, 2H), 1.24 - 1.13 (m, 2H), 1.09 - 0.86 (m, 2H), 0.83 (t, J = 7.3Hz, 3H).

[0234] [1.50 Compound 50(B161)] [ka] Methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxybenzoate (Compound 50) Starting from Int02 and (1-methyl-4-piperidyl)methanamine, compound 50 was isolated as a white solid (5 mg, 0.0102 mmol, 2%) according to GP1 (Step 3-Method B). C25H36N4O4S; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 7.99 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.35 - 7.29 (m, 2H), 7.14 - 7.08 (m, 1H), 6.92 - 6.87 (m, 2H), 3.94 (s, 3H), 3.92 - 3.88 (m, 1H), 3.32 (d, J = 11.7 Hz, 2H), 3.16 - 3.07 (m, 2H), 2.84 (dd, J = 13.1, 4.5 Hz, 1H), 2.62 (s, 3H), 2.61 - 2.56 (m, 0H), 2.49 (s, 3H), 1.88 - 1.70 (m, 2H), 1.61 (s, 3H), 1.48 - 1.40 (m, 2H), 1.24 - 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0235] [1.51 Compound 51] [ka] 3-(Butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxybenzoic acid (Compound 51) Starting from compound 1, compound 51 was isolated as a white solid (32 mg, 0.08 mmol, 74%) following GP2 (Step 4-Method A). C18H23N3O4S; MS (ESI+) m / z: MS (ESI+) m / z: 378 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.75 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.29-7.24 (m, 2H), 7.04-6.98 (m, 1H), 6.87- 6.82 (m, 2H), 4.91 (t, J = 5.7 Hz, 1H), 3.05-3.03 (m, 2H), 2.42 (s, 3H), 1.42-1.30 (m, 2H), 1.14-1.04 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.2, 142.3, 139.7, 136.1, 129.1 (2C), 127.9, 122.2, 116.9, 115.5 (2C), 114.3, 42.1, 30.2, 29.4, 19.3, 13.6.

[0236] [1.52 Compound 52] [ka] 3-(Butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxybenzoic acid (compound 52) Starting from compound 2, compound 52 was isolated as a white solid (22 mg, 0.055 mmol, 89%) following GP2 (Step 4-Method A). C19H25N3O4S; MS (ESI+) m / z: 392 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.13 (s, 1H), 7.79 (d, J = 1.9 Hz, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.31 - 7.23 (m, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.1 Hz, 2H), 4.97-4.91 (m, 1H), 4.13 (s, 1H), 3.09-3.01 (m, 2H), 2.63 (s, 6H), 1.40-1.31 (m, 2H), 1.25-1.06 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.54, 139.7, 133.4, 129.2 (2C), 128, 122, 118.2, 115.1 (2C), 114.6, 42.1, 40.1, 37.6, 30.1, 19.3, 13.5.

[0237] [1.53 Compound 53] [ka] 3-(Butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (Compound 53) Starting from compound 3, compound 53 was isolated as a white solid (22 mg, 0.055 mmol, 89%) following GP2 (Step 4-Method A). C21H27N3O4S; MS (ESI+) m / z: 418 [M+H]+; 1H NMR (400 MHz, CD3OD): δ 7.93 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.37 - 7.26 (m, 2H), 7.09 - 7.04 (m, 1H), 6.93-6.82 (m, 2H), 3.25 - 3.17 (m, 4H), 3.13 (t, J = 6.9 Hz, 2H), 1.72-1.58 (m, 4H), 1.50-1.38 (m, 2H), 1.24-1.12 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, CD3OD): δ 168.8, 157.5, 144.4, 141.3, 136.2, 130.8 (2C), 129.7, 124.0, 119.2, 117.1, 116.2 (2C), 48.7 (2C), 43.7, 32.0, 26.5 (2C), 20.9, 14.

[0238] [1.54 Compound 54] [ka] 3-(Butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (Compound 54) Starting from compound 4, compound 54 was isolated as a white solid (105 mg, 0.24 mmol, 90%) following GP2 (Step 4-Method A). C22H29N3O4S; MS (ESI+) m / z: 432 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.12 (s, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.31-7.23 (m, 2H), 7.03-6.97 (m, 1H), 6.79-6.72 (m, 2H), 4.97 (t, J = 5.7 Hz, 1H), 4.06 (brs, 1H), 3.09-3.02 (m, 2H), 3.01-2.92 (m, 4H), 1.48-1.30 (m, 8H), 1.15-1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.6, 157.1, 143.6, 140.7, 134.6, 130.1 (2C), 128.9, 122.9, 119.1, 116.1 (2C), 115.5, 47.5 (2C), 43.0, 31.1, 26.2 (2C), 24.3, 20.2, 14.5.

[0239] [1.55 Compound 55] [ka] 3-(Butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 55) Starting from compound 5, compound 55 was isolated as a white solid (24 mg, 0.0586 mmol, 99%) following GP2 (Step 4-Method A). C20H27N3O4S; MS (ESI+) m / z: 406 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.12 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.31-7.23 (m, 2H), 7.05-6.98 (m, 1H), 6.81-6.75 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 4.08 (s, 1H), 3.16-2.91 (m, 4H), 2.65 (s, 3H), 1.41-1.30 (m, 2H), 1.17-1.04 (m, 2H), 0.98 (t, J = 7.1 Hz, 3H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7 156.0, 142.5, 139.5, 135.2, 129.2 (2C), 127.9, 122.1, 117.9, 115.2 (2C), 114.5, 44.4, 42.1, 34.1, 30.1, 19.3, 13.6, 13.3.

[0240] [1.56 Compound 56] [ka] 3-(Butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxybenzoic acid (Compound 56) Starting from compound 6, compound 56 was isolated as a white solid (38 mg, 0.085 mmol, 95%) following GP2 (Step 4-Method A). C21H27N3O5S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 1.9 Hz, 1H), 7.50-7.44 (m, 1H), 7.27 (t, J = 7.8 Hz, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.0 Hz, 2H), 4.87 (m, 1H), 3.48-3.35 (m, 4H), 3.10-3.02 (m, 2H), 2.98-2.92 (m, 4H), 1.42-1.32 (m, 2H), 1.18-1.06 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): 167.6, 156.8, 142.8, 139.4, 132.6, 129.7 (2C), 122.4, 118.8, 115.8, 115.6 (2C), 66.2 (2C), 46.5 (2C), 42.7, 30.8 (2C), 19.8, 14.1.

[0241] [1.57 Compound 57] [ka] 3-(Anilinosulfonimidoyl)-5-(butylamino)-4-phenoxybenzoic acid (Compound 57) Starting from compound 7, compound 57 was isolated as a white solid (46 mg, 0.100 mmol, 91%) following GP2 (Step 4-Method A). C23H25N3O4S; MS (ESI+) m / z: 440 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.95 (s, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.42 (d, J = 2.1 Hz, 1H), 7.29-7.20 (m, 2H), 7.06-6.96 (m, 3H), 6.84 (d, J = 8.0 Hz, 2H), 6.79-6.71 (m, 1H), 6.57 (d, J = 7.9 Hz, 2H), 5.07-5.00 (m, 1H), 3.12-3.04 (m, 2H), 1.43-1.32 (m, 2H), 1.19-1.05 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156, 142.5, 139.6, 137.8, 128.9 (2C), 128.9 (3C), 127.8, 122.5, 122, 120.4 (2C), 116, 115.7 (2C), 114.5, 42, 30.1, 19.3, 13.6.

[0242] [1.58 Compound 58] [ka] 3-[(Benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (Compound 58) Starting from compound 8, compound 58 was isolated as a white solid (43 mg, 0.092 mmol, 86%) following GP2 (Step 4-Method A). C24H27N3O4S; MS (ESI+) m / z: 454 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.80 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.30-7.14 (m, 7H) 7.04-6.98 (m, 1H), 6.89-6.82 (m, 2H), 4.88 (t, J = 5.7 Hz, 1H), 4.03 (s, 2H), 3.05 (q, J = 6.6 Hz, 2H), 1.43 - 1.30 (m, 2H), 1.18-1.06 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.6, 137.4, 129.1 (2C), 127.9 (3C), 127.4 (3C), 126.6, 122.1, 116.6, 115.5 (2C), 114.3, 46.7, 42.1, 30.2, 19.3, 13.6.

[0243] [1.59 Compound 59] [ka] 3-(Butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 59) Starting from compound 9, compound 59 was isolated as a white solid (43 mg, 0.092 mmol, 86%) following GP2 (Step 4-Method A). C20H27N3O5S; MS (ESI+) m / z: 422 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.31-7.22 (m, 2H), 7.05-6.97 (m, 1H), 6.87-6.80 (m, 2H), 4.93 (t, J = 5.7 Hz, 1H), 3.23 (t, J = 6.1 Hz, 2H), 3.15 (s, 3H), 3.09-3.01 (m, 2H), 2.94 (t, J = 6.1 Hz, 2H), 1.41-1.32 (m, 2H), 1.17-1.04 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.6, 137.1, 129.2 (2C), 127.8, 122.2, 116.6, 115.4 (2C), 114.3, 71, 57.8, 42.6, 42.1, 30.1, 19.3, 13.6.

[0244] [1.60 Compound 60] [ka] 3-(Butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 60) Starting from compound 10, compound 60 was isolated as a white solid (33 mg, 0.0823 mmol, 86%) following GP2 (Step 4-Method A). C20H25N3O4S; MS (ESI+) m / z: 404 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.83 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.30-7.22 (m, 2H), 7.04-6.98 (m, 1H), 6.88-6.78 (m, 2H), 4.94 (t, J = 5.7 Hz, 1H), 3.11-3.00 (m, 2H), 2.27-2.14 (m, 1H), 1.43-1.31 (m, 2H), 1.17-1.04 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H), 0.43-0.24 (m, 4H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.9, 136.8, 129 (2C), 127.8, 122.1, 117.1, 115.6 (2C), 114.3, 42.1, 30.2, 24.8, 19.3, 13.6, 5.43, 5.4. [1.61 Compound 61] [ka] 3-(Azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxybenzoic acid (Compound 61) Starting from compound 11, compound 61 was isolated as a white solid (37 mg, 0.077 mmol, 71%) according to GP2 (Step 4 - Method A). C23H31N3O4S; MS (ESI+) m / z: 446 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.09 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.32-7.25 (m, 2H), 7.08-6.98 (m, 1H), 6.81-6.76 (m, 2H), 4.88-4.84 (m, 1H), 4.04 (s, 1H), 3.24-3.15 (m, 2H), 3.24-3.06 (m, 2H), 3.06-2.99 (m, 2H), 1.59-1.45 (m, 8H), 1.38-1.29 (m, 2H), 1.16-1.03 (m, 2H), 0.76 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 155.9, 142.3, 139.4, 136.1, 129.3 (2C), 127.7, 122.2, 117.7, 115.2 (2C), 114.4, 48.3 (2C), 42.1, 30.1, 29.2 (2C), 26.3 (2C), 19.2, 13.5.

[0245] [1.62 Compound 62] [ka] 3-(Butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 62) Starting from compound 12, compound 62 was isolated as a white solid (19 mg, 0.0407 mmol, 39%) according to GP2 (Step 4 - Method A). C24H33N3O4S; MS (ESI+) m / z: 460 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.76 (s, 1H), 7.40 (s, 1H), 7.32-7.24 (m, 2H), 7.07-6.97 (m, 1H), 6.85 (d, J = 8.0 Hz, 2H), 5.01-4.93 (m, 1H), 3.09-3.00 (m, 2H), 2.62 (d, J = 6.8 Hz, 2H), 1.66-1.48 (m, 6H), 1.43-1.30 (m, 2H), 1.17-1.02 (m, 5H), 0.82-0.70 (m, 5H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.4, 139.7, 136.9, 129.2 (2C), 127.9, 122.2, 116.6, 115.5 (2C), 114.4, 49.2, 42, 37.5, 30.2, 30.2 (2C), 26, 25.3 (2C), 19.3, 13.6.

[0246] [1.63 Compound 63] [ka] 3-(Butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 63) Starting from compound 13, compound 63 was isolated as a white solid (36 mg, 0.0782 mmol, 74%) according to GP2 (Step 4 - Method A). C23H31N3O5S; MS (ESI+) m / z: 462 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.77 (d, J = 1.9 Hz, 1H), 7.40 (d, J = 1.9 Hz, 1H), 7.33-7.21 (m, 2H), 7.07-6.97 (m, 1H), 6.85 (d, J = 8.1 Hz, 2H), 5.02-4.94 (m, 1H), 3.82 - 3.70 (m, 2H), 3.21-3.10 (m, 2H), 3.10-3.01 (m, 2H), 2.73-2.64 (m, 2H), 1.55-1.42 (m, 3H), 1.41-1.32 (m, 2H), 1.18-0.84 (m, 4H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.4, 139.7, 136.8, 129.2 (2C), 127.9, 122.2, 116.5, 115.5 (2C), 114.4, 66.7 (2C), 48.7, 42.1, 35.1, 30.3 30.3, 30.1, 19.3, 13.6.

[0247] [1.64 Compound 64(B82)] [ka] 3-(Butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (Compound 64) Starting from compound 16, compound 64 was isolated as a yellow solid (30 mg, 0.0647 mmol, 22%) according to GP2 (Step 4 - Method A). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.94 (dd, J = 4.7, 1.5 Hz, 1H), 7.85 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.45 (d, J = 2.0 Hz, 1H), 7.22 (dd, J = 8.6, 7.3 Hz, 2H), 7.10 - 6.98 (m, 2H), 6.98 - 6.90 (m, 1H), 6.86 - 6.78 (m, 2H), 5.14 (t, J = 5.8 Hz, 1H), 3.14 - 3.00 (m, 2H), 1.44 - 1.33 (m, 2H), 1.17 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 156.5, 144.0, 143.2, 141.1, 139.9, 137.7, 129.4 (2C), 129.2, 128.4, 123.9, 122.6, 116.3 (2C), 116.0, 115.3, 42.5, 30.6, 19.8, 14.5, 14.1.

[0248] [1.65 Compound 65(B84)] [ka] 3-(Butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 65) Starting from compound 17, compound 65 was isolated as an off-white solid (116 mg, 0.2470 mmol, 79%) according to GP2 (Step 4 - Method A). C24H27N3O5S; MS (ESI+) m / z: 470 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.11 (s, 1H), 7.85 (d, J = 2.0 Hz, 1H), 7.42 (d, J = 2.0 Hz, 1H), 7.26 - 7.21 (m, 2H), 7.03 - 6.97 (m, 1H), 6.89 (t, J = 8.1 Hz, 1H), 6.84 - 6.81 (m, 2H), 6.32 (dd, J = 8.1, 2.5 Hz, 1H), 6.28 - 6.23 (m, 1H), 6.01 (s, 1H), 5.02 (s, 1H), 3.55 (s, 3H), 3.06 (t, J = 6.8 Hz, 2H), 1.43 - 1.31 (m, 2H), 1.18 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 160, 156, 143, 140, 129 (4C), 128, 123, 116 (3C), 115 (2C), 109, 107 (2C), 55.1, 42.4, 30.6, 19.7, 14.1.

[0249] [1.66 Compound 66(B85)] [ka] 3-(Butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (Compound 66) Starting from compound 18, compound 66 was isolated as an off-white solid (241 mg, 0.4652 mmol, 95%) according to GP2 (Step 4 - Method A). C28H33N3O4S; MS (ESI+) m / z: 508 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H), 7.82 (d, J = 2.0 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.34 - 7.24 (m, 4H), 7.20 - 7.11 (m, 3H), 7.03 (t, J = 7.3 Hz, 1H), 6.83 - 6.78 (m, 2H), 5.05 (t, J = 5.4 Hz, 2H), 3.76 (d, J = 12.0 Hz, 2H), 3.12 - 3.02 (m, 2H), 2.59 - 2.51 (m, 3H), 1.73 - 1.66 (m, 2H), 1.49 - 1.29 (m, 3H), 1.13 (h, J = 7.4 Hz, 2H), 0.78 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157, 146, 143, 140, 134, 130 (2C), 129 (2C), 128, 127 (2C), 126, 122, 119, 116 (2C), 115, 46.4 (2C), 42.3, 33.0 (2C), 30.7, 19.7, 14.1.

[0250] [1.67 Compound 67(B86)] [ka] 3-(Butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 67) Starting from compound 21, compound 67 was isolated as a white solid (7 mg, 0.0160 mmol, 17%) according to GP2 (Step 4 - Method A). C21H25N5O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.07 (s, 1H), 7.89 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.29 - 7.19 (m, 3H), 7.06 - 6.97 (m, 3H), 6.86 - 6.80 (m, 2H), 5.39 (s, 1H), 4.88 (t, J = 5.7 Hz, 1H), 3.58 (s, 3H), 3.04 (q, J = 6.6 Hz, 2H), 1.39 - 1.31 (m, 2H), 1.15 - 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0251] [1.68 Compound 68(B87)] [ka] 3-(Butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 68) Starting from compound 15, compound 68 was isolated as an off-white solid (50 mg, 0.1076 mmol, 70%) following GP2 (Step 4-Method A). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.97 (s, 1H), 8.58 (s, 2H), 7.79 (d, J = 1.9 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.24 (dd, J = 8.7, 7.3 Hz, 2H), 7.03 - 6.91 (m, 1H), 6.89 - 6.78 (m, 2H), 4.95 - 4.80 (m, 1H), 4.09 (s, 2H), 3.05 (q, J = 6.5Hz, 2H), 1.47 - 1.26 (m, 2H), 1.23 - 1.04 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.2, 157.2, 156.6, 156.5 (3C), 142.8, 140.0, 137.5, 129.5 (2C), 128.7, 122.6, 117.0, 115.9 (2C), 115.0, 42.6, 42.5, 30.7, 19.8, 14.1.

[0252] [1.69 Compound 69(B95)] [ka] 3-(Butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxybenzoic acid (compound 69) Starting from compound 20, compound 69 was isolated as a white solid (29 mg, 0.0625 mmol, 14%) according to GP2 (Step 4 - Method A). C23H29N3O5S; MS (ESI+) m / z: 460 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.10 (s, 1H), 7.75 (d, J = 1.9 Hz, 1H), 7.41 (d, J = 1.9 Hz, 1H), 7.30 - 7.23 (m, 2H), 7.03 - 6.97 (m, 1H), 6.78 - 6.73 (m, 2H), 4.93 (t, J = 5.7 Hz, 1H), 4.33 - 4.27 (m, 2H), 3.38 - 3.25 (m, 2H), 3.08 - 3.01 (m, 2H), 2.76 - 2.64 (m, 2H), 1.90 - 1.84 (m, 1H), 1.77 - 1.68 (m, 3H), 1.41 - 1.31 (m, 2H), 1.16 - 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157, 150, 143, 140, 130 (2C), 128, 122, 119, 116 (2C), 115, 73.6, 51.8 (2C), 42.4, 30.4, 27.6 (3C), 19.7, 14.0.

[0253] [1.70 Compound 70(B100)] [ka] 3-(Butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 70) Starting from compound 22, compound 70 was isolated as an off-white foam (221 mg, 0.4476 mmol, 98%) following GP2 (Step 4-Method A). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.14 (s, 1H), 7.83 (d, J = 1.9 Hz, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.23 (dd, J = 8.6, 7.3 Hz, 2H), 7.01 (q, J = 7.8 Hz, 2H), 6.83 - 6.79 (m, 2H), 6.76 (dd, J = 7.8, 2.1 Hz, 1H), 6.47 (d, J = 8.1 Hz, 1H), 6.37 (s, 1H), 5.13 (t, J = 5.7 Hz, 1H), 3.08 (q, J = 6.4 Hz, 2H), 1.42 - 1.33 (m, 2H), 1.19 - 1.08 (m, 2H), 0.78 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157 (2C), 143, 140, 138, 133, 130, 129 (2C), 128, 122 (2C), 121, 120, 116 (3C), 115, 42.4, 30.5, 19.7, 14.0.

[0254] [1.71 Compound 71(B101)] [ka] 3-(Butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 71) Starting from compound 23, compound 71 was isolated as a white solid (238 mg, 0.4828 mmol, 93%) according to GP2 (Step 4 - Method A). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 2.0 Hz, 1H), 7.35 (d, J = 2.0 Hz, 1H), 7.29 - 7.18 (m, 5H), 7.15 (d, J = 7.1 Hz, 1H), 7.00 (t, J = 7.3 Hz, 1H), 6.87 - 6.83 (m, 2H), 4.82 (t, J = 5.4 Hz, 1H), 4.04 (s, 2H), 3.03 (q, J = 6.4 Hz, 2H), 1.41 - 1.32 (m, 2H), 1.17 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156, 142, 140, 137, 133 (2C), 130, 129 (2C), 128, 127, 126, 123, 117, 116 (2C), 115, 46.4, 42.4, 30.6, 19.6, 14.0.

[0255] [1.72 Compound 72(B102)] [ka] 3-(Butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxybenzoic acid (Compound 72) Starting from compound 24, compound 72 was isolated as a brown foam (242 mg, 0.5042 mmol, 95%) according to GP2 (Step 4 - Method A). C25H27N3O4S; MS (ESI+) m / z: 466 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.09 (s, 1H), 7.89 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.22 (s, 4H), 7.21 - 7.18 (m, 2H), 6.93 (t, J = 7.4 Hz, 1H), 6.80 - 6.77 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 4.60 - 4.47 (m, 4H), 2.99 (q, J = 6.4 Hz, 2H), 1.35 - 1.27 (m, 2H), 1.10 - 1.00 (m, 2H), 0.72 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156, 142, 140, 137, 133 (2C), 130, 129 (2C), 128, 127, 126, 123, 117, 116 (2C), 115, 46.4, 42.4, 30.6, 19.6, 14.0.

[0256] [1.73 Compound 73 (B104)] [ka] 3-(Butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 73) Starting from compound 32, compound 73 was isolated as a brown foam (20 mg, 0.0453 mmol, 10%) according to GP2 (Step 4 - Method A). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.19 (s, 1H), 7.87 (d, J = 2.0 Hz, 1H), 7.83 - 7.81 (m, 1H), 7.75 (d, J = 2.7 Hz, 1H), 7.43 - 7.40 (m, 2H), 7.11 (d, J = 1.5 Hz, 1H), 7.08 - 7.02 (m, 2H), 6.88 (t, J = 7.3 Hz, 1H), 6.62 - 6.58 (m, 2H), 5.06 (t, J = 6.0 Hz, 1H), 3.05 (q, J = 6.3 Hz, 2H), 1.40 - 1.30 (m, 2H), 1.16 - 1.06 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156 (2C), 155, 142, 141, 139, 135, 134, 129 (2C), 122, 118, 116 (2C), 115 (2C), 42.4, 30.4, 19.7, 14.0.

[0257] [1.74 Compound 74(B111)] [ka] 3-(Butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 74) Starting from compound 28, compound 74 was isolated as a white solid (25 mg, 0.0472 mmol, 52%) according to GP2 (Step 4-Method B). C24H25F2N3O5S; MS (ESI+) m / z: 506 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H), 7.84 (d, J = 2.0 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.26 - 7.19 (m, 3H), 7.04 - 6.99 (m, 2H), 6.83 - 6.80 (m, 2H), 6.54 (dd, J = 8.2, 2.4 Hz, 1H), 6.44 (d, J = 8.0 Hz, 1H), 6.21 (s, 1H), 5.09 (t, J = 5.8 Hz, 1H), 3.07 (q, J = 6.5 Hz, 2H), 1.42 - 1.33 (m, 2H), 1.19 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.55 (2C), 156.01 (2C), 142.64 (2C), 139.50, 129.31, 128.86 (2C), 122.01 (2C), 121.80, 117.86, 116.32, 115.58 (2C), 114.69, 113.33, 110.33, 42.00, 30.13, 19.30, 13.58.

[0258] [1.75 Compound 75(B112)] [ka] 3-(Butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (Compound 75) Starting from compound 29, compound 75 was isolated as a white solid (34 mg, 0.0760 mmol, 72%) according to GP2 (Step 4-Method B). C22H29N3O5S; MS (ESI+) m / z: 448 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.81 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.27 (t, J = 7.9 Hz, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.87 - 6.83 (m, 2H), 4.89 (t, J = 6.5 Hz, 1H), 3.75 - 3.65 (m, 2H), 3.30 - 3.22 (m, 2H), 3.18 (t, J = 11.4 Hz, 2H), 3.04 (q, J = 6.5 Hz, 2H), 1.56 - 1.46 (m, 2H), 1.39 - 1.31 (m, 3H), 1.14 - 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.69 (2C), 156.08 (2C), 142.30 (2C), 138.47, 129.08 (2C), 122.13, 116.42, 115.57 (2C), 114.22, 65.77 (2C), 49.58, 42.05, 33.89, 30.14, 19.25, 13.57.

[0259] [1.76 Compound 76(B113)] [ka] 3-(Butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 76) Starting from compound 31, compound 76 was isolated as a yellow solid (40 mg, 0.0897 mmol, 82%) according to GP2 (Step 4-Method B). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.30 - 8.25 (m, 2H), 7.96 - 7.88 (m, 1H), 7.87 (d, J = 1.9 Hz, 1H), 7.45 (d, J = 2.0 Hz, 1H), 7.04 (t, J = 7.7 Hz, 2H), 6.93 - 6.82 (m, 1H), 6.58 (d, J = 8.1 Hz, 2H), 5.29 - 5.17 (m, 1H), 3.09 - 3.02 (m, 2H), 1.40 - 1.30 (m, 2H), 1.16 - 1.08 (m, 2H), 0.76 (t, J = 7.4 Hz, 3H).

[0260] [1.77 Compound 77(B114)] [ka] 3-(Butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 77) Starting from compound 26, compound 77 was isolated as a white solid (31 mg, 0.0646 mmol, 96%) according to GP2 (Step 4-Method B). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.13 (s, 1H), 8.07 (d, J = 1.9 Hz, 1H), 7.42 (d, J = 1.9 Hz, 1H), 7.26 - 7.22 (m, 3H), 7.22 - 7.19 (m, 2H), 7.08 - 6.95 (m, 2H), 6.85 - 6.75 (m, 3H), 4.93 (t, J = 5.7 Hz, 1H), 3.05 (q, J = 6.5 Hz, 2H), 1.40 - 1.29 (m, 2H), 1.14 - 1.03 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.60, 156.04, 142.35, 139.94, 137.62, 129.40, 128.99 (2C), 127.44, 126.83 (2C), 122.59 (2C), 122.19, 121.30, 116.61, 115.63 (2C), 114.75, 42.03, 30.12, 19.25, 13.56.

[0261] [1.78 Compound 78(B115)] [ka] 3-(Butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxybenzoic acid (Compound 78) Starting from compound 27, compound 78 was isolated as a white solid (44 mg, 0.0939 mmol, 97%) according to GP2 (Step 4-Method B). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 7.83 (d, J = 1.9 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.23 (dd, J = 8.6, 7.2 Hz, 2H), 7.18 (s, 1H), 7.05 - 6.98 (m, 3H), 6.81 (dd, J = 8.1, 1.4 Hz, 2H), 6.48 (d, J = 8.0 Hz, 2H), 5.09 - 5.03 (m, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.42 - 1.33 (m, 2H), 1.18 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H).

[0262] [1.79 Compound 79(B116)] [ka] 3-(Butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 79) Starting from compound 30, compound 79 was isolated as a white solid (15 mg, 0.0326 mmol, 31%) according to GP2 (Step 4-Method B). C23H32N4O4S; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 1.9 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.32 - 7.23 (m, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.87 - 6.82 (m, 2H), 4.84 (t, J = 5.0 Hz, 1H), 4.34 (s, 3H), 3.04 (q, J = 6.5 Hz, 2H), 2.73 - 2.62 (m, 2H), 2.19 (s, 3H), 2.14 - 1.90 (m, 2H), 1.62 - 1.51 (m, 2H), 1.39 - 1.31 (m, 3H), 1.17 - 1.08 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0263] [1.80 Compound 80(B117)] [ka] 3-(Butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (Compound 80) Starting from compound 33, compound 80 was isolated as a yellow solid (34 mg, 0.0761 mmol, 76%) according to GP2 (Step 4-Method B). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.50 (s, 1H), 7.84 (d, J = 1.8 Hz, 1H), 7.76 (s, 2H), 7.50 (d, J = 1.9 Hz, 1H), 7.49 - 7.46 (m, 2H), 7.20 (t, J = 7.8 Hz, 2H), 6.99 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.1 Hz, 2H), 5.07 - 4.99 (m, 1H), 3.07 (q, J = 6.5 Hz, 2H), 1.43 - 1.33 (m, 2H), 1.19 - 1.09 (m, 2H), 0.79 (t, J = 7.4 Hz, 3H).

[0264] [1.81 Compound 81(B130)] [ka] 3-(Butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (Compound 81) Starting from compound 34, compound 81 was isolated as a white solid (25 mg, 0.0543 mmol, 97%) following GP2 (Step 4 - Method A). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.78 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.31 - 7.22 (m, 4H), 7.21 - 7.15 (m, 1H), 7.14 - 7.08 (m, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.84 - 6.79 (m, 2H), 4.91 (t, J = 5.8 Hz, 1H), 3.09 - 2.93 (m, 4H), 2.58 (t, J = 7.7 Hz, 2H), 1.41 - 1.31 (m, 2H), 1.17 - 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.15, 156.60, 142.83, 140.14, 137.48, 129.65 (2C), 129.01 (3C), 128.77 (2C), 128.39, 126.56, 122.68, 117.20, 115.94 (2C), 114.82, 45.19, 42.55, 36.31, 30.66, 19.77, 14.07.

[0265] [1.82 Compound 82(B131)] [ka] 3-(Butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 82) Starting from compound 35, compound 82 was isolated as a white solid (35 mg, 0.0691 mmol, 94%) following GP2 (Step 4 - Method A). C25H28ClN3O4S; MS (ESI+) m / z: 502 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.77 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.30 - 7.23 (m, 4H), 7.20 - 7.18 (m, 1H), 7.10 - 7.06 (m, 1H), 7.01 (t, J = 7.3 Hz, 1H), 6.82 (d, J = 8.1 Hz, 2H), 4.85 (t, J = 5.7 Hz, 1H), 3.08 - 2.95 (m, 4H), 2.60 (t, J = 7.4 Hz, 2H), 1.43 - 1.30 (m, 2H), 1.14 - 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.21, 156.62, 142.76, 140.03, 137.42, 133.30, 130.51, 129.65 (4C), 128.96, 127.86, 126.53, 122.67, 117.23, 115.96 (2C), 114.86, 44.75, 42.56, 35.79, 30.68, 19.77, 14.06.

[0266] [1.83 Compound 83(B132)] [ka] 3-(Butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (Compound 83) Starting from compound 36, compound 83 was isolated as a white solid (32 mg, 0.0704 mmol, 98%) following GP2 (Step 4 - Method A). C23H26ClN4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.42 - 8.32 (m, 2H), 7.78 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 7.6 Hz, 1H), 7.36 (d, J = 2.0 Hz, 1H), 7.30 - 7.18 (m, 3H), 6.99 (t, J = 7.3 Hz, 1H), 6.88 - 6.81 (m, 2H), 4.85 (t, J = 5.8 Hz, 1H), 4.06 (s, 2H), 3.03 (q, J = 6.6 Hz, 2H), 1.42 - 1.32 (m, 2H), 1.19 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.71, 159.88, 156.16, 148.79, 147.79, 142.26, 139.51, 137.22, 135.15, 129.11 (2C), 122.99 (2C), 122.13, 116.58, 115.51 (2C), 114.38, 44.19, 42.09, 30.20, 19.29, 13.59.

[0267] [1.84 Compound 84(B133)] [ka] 3-(Butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (Compound 84) Starting from compound 37, compound 84 was isolated as a white solid (33 mg, 0.0702 mmol, 94%) following GP2 (Step 4 - Method A). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.41 - 8.33 (m, 2H), 7.77 (d, J = 1.9 Hz, 1H), 7.57 - 7.52 (m, 1H), 7.42 - 7.35 (m, 1H), 7.32 - 7.23 (m, 3H), 7.01 (t, J = 7.3 Hz, 1H), 6.82 (d, J = 8.1 Hz, 2H), 4.87 (t, J = 5.7 Hz, 1H), 3.10 - 2.97 (m, 4H), 2.61 (t, J = 7.3 Hz, 2H), 1.43 - 1.30 (m, 2H), 1.17 - 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.77, 156.15, 149.81 (2C), 147.33, 142.27, 139.49, 136.90 (2C), 136.10, 129.14 (2C), 123.31, 122.16, 116.71, 115.48 (2C), 114.38, 44.14, 42.08, 32.91, 30.19, 19.28, 13.58.

[0268] [1.85 Compound 85(B134)] [ka] 3-(Butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 85) Starting from compound 38, compound 85 was isolated as a white solid (38 mg, 0.0792 mmol, 98%) following GP2 (Step 4 - Method A). C21H24N4O4S2; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.82 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 3.3 Hz, 1H), 7.56 - 7.50 (m, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.24 (t, J = 7.8 Hz, 2H), 6.98 (t, J = 7.4 Hz, 1H), 6.88 - 6.83 (m, 2H), 4.97 - 4.89 (m, 1H), 4.28 (s, 2H), 3.05 (q, J = 6.6 Hz, 2H), 1.41 - 1.31 (m, 2H), 1.17 - 1.05 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.11, 158.42, 156.62, 153.55, 142.52 (2C), 136.46, 129.59 (2C), 126.18, 122.83, 120.10, 116.78, 116.02 (2C), 114.97, 45.23, 42.55, 30.65, 19.77, 14.07.

[0269] [1.86 Compound 86(B135)] [ka] 3-(Butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (Compound 86) Starting from compound 39, compound 86 was isolated as a white solid (28 mg, 0.0594 mmol, 99%) following GP2 (Step 4 - Method A). C22H26N4O4S2; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 2.0 Hz, 1H), 7.62 (dd, J = 49.1, 3.3 Hz, 2H), 7.39 (d, J = 2.0 Hz, 1H), 7.31 - 7.23 (m, 2H), 7.04 - 6.97 (m, 1H), 6.87 - 6.81 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 3.19 - 3.13 (m, 2H), 3.09 - 2.96 (m, 4H), 1.42 - 1.30 (m, 2H), 1.17 - 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.10, 166.69, 156.12, 142.31, 142.09, 139.57, 136.87, 129.13 (2C), 128.17, 122.16, 119.49, 116.67, 115.46 (2C), 114.44, 42.83, 42.07, 33.36, 30.17, 19.28, 13.57.

[0270] [1.87 Compound 87(B136)] [ka] 3-(Butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 87) Starting from compound 42, compound 87 was isolated as a colorless oil (8 mg, 0.0145 mmol, 27%) according to GP2 (Step 4-Method A). C22H27N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 - 7.76 (m, 1H), 7.65 - 7.60 (m, 1H), 7.51 - 7.44 (m, 1H), 7.41 - 7.36 (m, 1H), 7.30 - 7.22 (m, 2H), 7.04 - 6.96 (m, 1H), 6.83 (d, J = 8.1 Hz, 2H), 6.01 (s, 1H), 4.83 - 4.75 (m, 1H), 3.94 (s, 2H), 3.71 (s, 3H), 3.03 (q, J = 6.5 Hz, 2H), 1.40 - 1.31 (m, 2H), 1.17 - 1.05 (m, 2H), 0.80 - 0.75 (m, 3H).

[0271] [1.88 Compound 88(B137)] [ka] 3-(Butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxybenzoic acid (Compound 88) Starting from compound 40, compound 88 was isolated as a white solid (8 mg, 0.0177 mmol, 97%) following GP2 (Step 4-Method B). C21H25N5O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 7.86 (d, J = 1.9 Hz, 1H), 7.41 (s, 1H), 7.17 (t, J = 7.8 Hz, 2H), 6.97 (t, J = 7.3 Hz, 1H), 6.71 - 6.66 (m, 2H), 6.63 (d, J = 8.1 Hz, 2H), 6.59 - 6.52 (m, 1H), 4.95 - 4.85 (m, 1H), 3.07 - 2.98 (m, 2H), 2.71 (s, 3H), 1.37 - 1.28 (m, 2H), 1.13 - 1.01 (m, 2H), 0.75 (t, J = 7.3 Hz, 3H).

[0272] [1.89 Compound 89(B138)] [ka] 3-(Butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (Compound 89) Starting from compound 41, compound 89 was isolated as a white solid (18 mg, 0.0386 mmol, 70%) following GP2 (Step 4-Method A). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.13 (s, 1H), 7.90 - 7.85 (m, 2H), 7.39 (d, J = 2.0 Hz, 1H), 7.35 - 7.23 (m, 2H), 7.14 - 7.06 (m, 2H), 6.94 - 6.89 (m, 1H), 6.70 - 6.62 (m, 3H), 5.01 - 4.94 (m, 1H), 3.03 (q, J = 6.6 Hz, 2H), 1.39 - 1.29 (m, 2H), 1.15 - 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0273] [1.90 Compound 90(B163)] [ka] 3-(Butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (Compound 90) Starting from compound 43, compound 90 was isolated as a white solid (20 mg, 0.0448 mmol, 55%) according to GP2 (Step 4-Method A). C20H22N4O4S2; MS (ESI+) m / z: 447 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.09 (d, J = 2.0 Hz, 1H), 7.64 - 7.62 (m, 1H), 7.27 - 7.19 (m, 2H), 7.08 (d, J = 4.0 Hz, 1H), 7.03 (t, J = 7.4 Hz, 1H), 6.82 (d, J = 8.0 Hz, 2H), 6.77 (d, J = 3.9 Hz, 1H), 3.13 (t, J = 6.9 Hz, 2H), 1.48 - 1.37 (m, 2H), 1.17 (h, J = 7.4 Hz, 2H), 0.83 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.72, 168.43, 157.38, 143.98, 141.08, 136.47, 135.90, 133.76, 130.57 (2C), 123.92, 119.01, 117.74, 116.47 (2C), 112.74, 43.72, 31.96, 20.84, 14.00.

[0274] [1.91 Compound 91(B164)] [ka] 3-(Butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (Compound 91) Starting from compound 44, compound 91 was isolated as a white solid (16 mg, 0.0374 mmol, 96%) according to GP2 (Step 4-Method A). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.08 (d, J = 5.8 Hz, 2H), 7.84 (d, J = 1.9 Hz, 1H), 7.47 (d, J = 1.9 Hz, 1H), 7.19 (t, J = 7.8 Hz, 2H), 6.99 (t, J = 7.3 Hz, 1H), 6.75 (d, J = 8.1 Hz, 2H), 6.48 (d, J = 5.8 Hz, 2H), 5.25 (t, J = 5.7 Hz, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.44 - 1.31 (m, 2H), 1.19 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H).

[0275] [1.92 Compound 92(B165)] [ka] 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (Compound 92) Starting from Int02 and 1-(4-amino-1-piperidyl)ethanone, according to GP1 (Step 3 - Method B), the methyl ester intermediate was not isolated in pure form and was directly saponified for isolation according to GP2 (Step 4 - Method A), leading to the isolation of compound 92 as a white solid (37 mg, 0.0779 mmol, 20% over two steps). C24H32N4O5S; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.81 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.31 - 7.23 (m, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.88 - 6.82 (m, 2H), 4.88 (t, J = 5.8 Hz, 1H), 4.07 - 3.84 (m, 1H), 3.67 - 3.49 (m, 1H), 3.04 (q, J = 6.5 Hz, 2H), 3.01 - 2.92 (m, 1H), 2.70 - 2.60 (m, 1H), 1.92 (s, 3H), 1.63 - 1.44 (m, 2H), 1.41 - 1.31 (m, 2H), 1.30 - 1.16 (m, 2H), 1.15 - 1.06 (m, 3H), 0.76 (t, J = 7.3 Hz, 3H).

[0276] [1.93 Compound 93(B166)] [ka] 3-(Butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (Compound 93) Starting from compound 45, compound 93 was isolated as a white solid (15 mg, 0.0340 mmol, 83%) following GP2 (Step 4-Method A). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.58 (s, 1H), 8.06 (s, 1H), 7.98 - 7.80 (m, 1H), 7.68 (s, 1H), 7.22 (t, J = 7.8 Hz, 2H), 7.06 (t, J = 7.3 Hz, 1H), 7.02 - 6.84 (m, 1H), 6.79 (d, J = 8.0 Hz, 2H), 3.17 (t, J = 6.9 Hz, 2H), 1.52 - 1.41 (m, 2H), 1.28 - 1.15 (m, 2H), 0.85 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 157.48, 152.92, 144.52, 142.10, 140.55, 136.49, 132.34, 130.48 (3C), 123.94, 118.10, 117.88, 116.89, 116.45 (2C), 43.70, 31.98, 20.91, 14.02.

[0277] [1.94 Compound 94(B167)] [ka] 3-(Butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxybenzoic acid (Compound 94) Starting from compound 46, compound 94 was isolated as a white solid (38 mg, 0.0906 mmol, 97%) following GP2 (Step 4-Method A). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.09 (d, J = 1.9 Hz, 1H), 7.58 (d, J = 1.9 Hz, 1H), 7.35 - 7.27 (m, 2H), 7.09 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 7.9 Hz, 2H), 3.12 (t, J = 6.9 Hz, 2H), 2.97 (dt, J = 12.9, 6.8 Hz, 1H), 2.83 - 2.74 (m, 1H), 1.50 - 1.40 (m, 2H), 1.39 - 1.14 (m, 6H), 0.84 (t, J = 7.2 Hz, 6H). 13C NMR (101 MHz, DMSO-d6): δ 169.42, 155.91, 142.67, 140.38, 135.54, 130.17 (2C), 123.63, 119.18, 116.53, 115.24 (2C), 43.53, 43.26, 31.73, 31.15, 19.99, 19.93, 13.81, 13.76.

[0278] [1.95 Compound 95(B168)] [ka] 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (compound 95) Starting from compound 47, compound 95 was isolated as a white solid (14 mg, 0.0340 mmol, 98%) following GP2 (Step 4 - Method A). C22H27N3O4S; MS (ESI+) m / z: 430 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.14 - 8.11 (m, 1H), 7.58 - 7.56 (m, 1H), 7.30 (t, J = 7.8 Hz, 2H), 7.08 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 3.12 (t, J = 7.0 Hz, 2H), 2.27 (s, 1H), 1.82 (s, 6H), 1.48 - 1.39 (m, 2H), 1.23 - 1.13 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 155.84, 149.38, 142.60, 140.54, 136.71, 130.11 (2C), 123.62, 118.86, 116.50, 115.46 (2C), 53.30 (3C), 43.27, 31.14, 24.21, 19.98, 13.81.

[0279] [1.96 Compound 96(B169)] [ka] 3-(Butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (Compound 96) Starting from compound 48, compound 96 was isolated as a white solid (5 mg, 0.0113 mmol, 99%) according to GP2 (Step 4-Method A). C24H32N4O4S; MS (ESI+) m / z: 473 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.94 (d, J = 1.9 Hz, 1H), 7.66 (d, J = 1.9 Hz, 1H), 7.42 - 7.29 (m, 2H), 7.09 (t, J = 7.3 Hz, 1H), 6.97 (d, J = 7.8 Hz, 2H), 4.62 - 4.55 (m, 1H), 3.88 - 3.79 (m, 1H), 3.34 - 3.29 (m, 1H), 3.25 - 3.04 (m, 5H), 2.99 - 2.89 (m, 1H), 2.70 - 2.62 (m, 1H), 2.07 - 1.77 (m, 4H), 1.53 - 1.43 (m, 2H), 1.29 - 1.18 (m, 2H), 0.87 (t, J = 7.4 Hz, 3H).

[0280] [1.97 Compound 97(B170)] [ka] 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (Compound 97) Starting from compound 49, compound 97 was isolated as a white solid (65 mg, 0.1203 mmol, 99%) following GP2 (Step 4-Method A). C25H34N4O5S; MS (ESI+) m / z: 504 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.02 - 8.00 (m, 1H), 7.57 - 7.55 (m, 1H), 7.33 - 7.26 (m, 2H), 7.08 (t, J = 7.4 Hz, 1H), 6.90 (d, J = 8.1 Hz, 2H), 4.54 (d, J = 9.0 Hz, 1H), 3.77 (d, J = 13.5 Hz, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.04 - 2.83 (m, 2H), 2.70 (dt, J = 13.2, 7.4 Hz, 1H), 2.55 - 2.41 (m, 1H), 2.08 (s, 3H), 1.76 (t, J = 15.5 Hz, 1H), 1.68 - 1.53 (m, 2H), 1.51 - 1.37 (m, 2H), 1.23 - 0.94 (m, 5H), 0.82 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.44, 168.74, 155.93, 142.67, 139.98, 130.17 (2C), 128.28, 123.64, 118.53, 116.59, 115.26 (2C), 48.54, 46.42, 43.23, 41.64, 36.68, 31.13, 30.21, 29.38, 25.47, 21.49, 19.97, 13.80.

[0281] [1.98 Compound 98] [ka] Methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (Compound 98) To a solution of compound 5 (50 mg, 0.110 mmol, 1.00 equiv) in 1,4-dioxane (0.5482 mL, 0.2 M) in a sealed tube under an O atmosphere were added copper(II) acetate (30 mg, 0.164 mmol, 1.50 equiv), pyridine (0.021 mL, 0.263 mmol, 2.40 equiv), and methylboronic acid (13 mg, 0.219 mmol, 2.00 equiv) in succession. The reaction mixture was stirred at 100 °C for 16 h. The conversion was checked by LC-MS. The reaction mixture was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 99 / 1 to 65 / 35) to give compound 98 as a colorless oil (m = 6 mg, 0.0138 mmol, 13%). C22H31N3O4S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.05 (d, J = 2.0 Hz, 1H), 7.48 (d, J = 2.0 Hz, 1H), 7.32-7.22 (m, 2H), 7.08-6.98 (m, 1H), 6.87-6.79 (m, 2H), 3.93 (s, 3H), 3.89-3.83 m, 1H), 3.32-3.19 (m, 1H), 3.17-3.03 (m, 3H), 2.77 (s, 3H), 2.67 (s, 3H), 1.47-1.35 (m, 2H), 1.21-1.12 (m, 2H), 1.10 (t, J = 7.1 Hz, 3H), 0.81 (t, J = 7.3 Hz, 3H).

[0282] [1.99 Compound 99(B94)] [ka] Methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 99) To a solution of compound 11 (100 mg, 0.217 mmol, 1.00 equiv) in acetonitrile (0.7860 mL, 0.5 M) in a sealed tube under an O atmosphere were added copper(II) acetate (49 mg, 0.272 mmol, 1.25 equiv), triethylamine (0.040 mL, 0.2720 mmol, 1.25 equiv), and phenylboronic acid (40 mg, 0.326 mmol, 1.5 equiv) sequentially. The reaction mixture was stirred at 20 °C for 24 h. The conversion was checked by LC-MS. The reaction mixture was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 99 / 1 to 65 / 35) to give compound 11 as a brown oil (m = 8 mg, 0.0149 mmol, 7%). C30H37N3O4S; MS (ESI+) m / z: 536 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.20 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 - 7.27 (m, 2H), 7.13 - 7.04 (m, 3H), 6.93 - 6.91 (m, 1H), 6.91 - 6.83 (m, 4H), 3.95 (s, 3H), 3.45 - 3.31 (m, 4H), 3.10 (t, J = 7.0 Hz, 2H), 1.56 - 1.32 (m, 10H), 1.22 - 1.11 (m, 2H), 0.81 (t, J = 7.4 Hz, 3H).

[0283] [1.100 Compound 100] [ka] 3-(Butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (Compound 100) Starting from compound 98, compound 100 was isolated as a colorless viscous oil (5.6 mg, 0.0129 mmol, 94%) according to GP2 (Step 4 - Method A). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.10 (s, 1H), 7.88 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.1 Hz, 1H), 7.31-7.23 (m, 2H), 7.06-6.97 (m, 1H), 6.79-6.73 (m, 2H), 4.96-4.88 (m, 1H), 3.20-3.08 (m, 1H), 3.09-2.95 (m, 3H), 2.67 (s, 3H), 2.52 (s, 3H), 1.40-1.29 (m, 2H), 1.15-1.05 (m, 2H), 1.01 (t, J = 7.1 Hz, 3H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.5, 139.9, 133.2, 129.2 (2C), 127.8, 122.1, 118.6, 115.2 (2C), 114.4, 44.4, 42, 33.9, 30.1, 27.6, 19.3, 13.6, 13.2.

[0284] [1.101 Compound 101 (B103)] [ka] 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 101) Starting from compound 99, compound 101 was isolated as a colorless oil (7 mg, 0.0134 mmol, 90%) according to GP2 (Step 4 - Method A). C29H35N3O4S; MS (ESI+) m / z: 522 [M+H]+; 1H NMR (400 MHz, acetonitrile-d3): δ 8.03 (d, J = 2.0 Hz, 1H), 7.51 (d, J = 2.0 Hz, 1H), 7.36 - 7.27 (m, 2H), 7.17 - 7.03 (m, 3H), 6.92 - 6.78 (m, 5H), 4.40 - 4.22 (m, 1H), 3.42 - 3.23 (m, 4H), 3.10 (t, J = 7.0 Hz, 2H), 1.58 - 1.30 (m, 10H), 1.18 - 1.07 (m, 2H), 0.80 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, acetonitrile-d3): δ 166.6, 156.8, 145.1, 143.7, 130.0 (2C), 129.3 (2C), 127.9, 124.0 (2C), 123.1, 121.9, 119.2, 116.0 (3C), 49.6 (2C), 43.1, 31.1, 29.3 (2C), 27.0 (2C), 20.1, 13.5. (+2C, overlapping with CD3CN signal).

[0285] [1.102 Compound 102(B71)] [ka] 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 102) Starting from compound 58, compound 102 was isolated as a yellow oil (3 mg, 0.0062 mmol, 15%) according to GP3 (step 5). C25H34N4O5S; MS (ESI+) m / z: 467 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.52 (d, J = 2.1 Hz, 1H), 7.41 (d, J = 2.1 Hz, 1H), 7.24 - 7.13 (m, 3H) Overlapping with chloroform-d, 7.08 - 7.00 (m, 2H), 7.00 - 6.92 (m, 1H), 6.85 - 6.73 (m, 2H), 6.38 - 6.21 (m, 1H), 4.04 (d, J = 13.9 Hz, 1H), 3.88 - 3.76 (m, 2H), 3.11 - 2.99 (m, 2H), 2.95 (d, J = 4.8 Hz, 3H), 1.42 - 1.29 (m, 2H), 1.16 - 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 155.7, 142.8, 138.5, 136.6, 134.1, 132.4, 130.0 (2C), 128.5 (2C), 127.9 (2C), 127.7, 123.5, 115.1, 115.0 (2C), 114.0, 48.0, 43.1, 31.0, 26.9, 19.8, 13.6.

[0286] [1.103 Compound 103(B77)] [ka] 3-(Butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzamide (Compound 103) Starting from compound 63, compound 103 was isolated as a yellow oil (6 mg, 0.0119 mmol, 2%) according to GP3 (step 5). C24H34N4O4S; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.60 (d, J = 2.1 Hz, 1H), 7.50 (d, J = 2.1 Hz, 1H), 7.38 - 7.30 (m, 2H), 7.11 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 6.55 (d, J = 4.9 Hz, 1H), 3.97 - 3.87 (m, 3H), 3.35 - 3.23 (m, 2H), 3.20 - 3.10 (m, 2H), 3.06 - 2.97 (m, 4H), 2.82 - 2.72 (m, 1H), 2.62 - 2.52 (m, 1H), 1.50 - 1.40 (m, 4H), 1.28 - 1.09 (m, 4H), 0.84 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 155.8, 142.8, 138.3, 134.2, 132.5, 130.1 (2C), 123.5, 115.0, 115.0 (2C), 114.1, 67.4, 67.4, 49.5, 43.1, 35.3, 31.0, 30.4, 30.4, 26.9, 19.8, 13.6.

[0287] [1.104 Compound 104(B88)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 104) Starting from compound 57, compound 104 was isolated as a yellow oil (4 mg, 0.0088 mmol, 8%) according to GP3 (step 5). C24H28N4O3S; MS (ESI+) m / z: 453 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.53 (d, J = 4.7 Hz, 1H), 7.76 (d, J = 2.1 Hz, 1H), 7.36 (d, J = 2.0 Hz, 1H), 7.26 - 7.19 (m, 2H), 7.08 - 6.91 (m, 5H), 6.87 - 6.78 (m, 2H), 6.78 - 6.71 (m, 1H), 6.60 - 6.45 (m, 2H), 4.93 - 4.82 (m, 1H), 3.15 - 3.04 (m, 2H), 2.81 (d, J = 4.5 Hz, 3H), 1.45 - 1.32 (m, 2H), 1.20 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.2, 156.6, 142.8, 138.5, 132.0, 129.3 (2C), 128.7 (3C), 123.1 (2C), 122.3 (2C), 120.7, 116.2 (2C), 114.7, 113.2, 42.6, 30.8, 26.8, 19.8, 14.1.

[0288] [1.105 Compound 105(B89)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (Compound 105) Starting from compound 57, compound 105 was isolated as a yellow oil (8 mg, 0.0163 mmol, 15%) according to GP3 (step 5). C25H30N4O3S; MS (ESI+) m / z: 467 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.29 - 7.15 (m, 3H), 7.08 - 6.94 (m, 4H), 6.91 (d, J = 1.9 Hz, 1H), 6.87 - 6.79 (m, 2H), 6.74 (t, J = 7.3 Hz, 1H), 6.66 - 6.50 (m, 2H), 4.95 (t, J = 5.8 Hz, 1H), 3.09 - 2.91 (m, 8H), 1.44 - 1.29 (m, 2H), 1.18 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.3, 156.3, 142.4, 136.7, 133.6, 128.9 (2C), 128.3 (3C), 122.5 (2C), 121.9, 120.3, 115.6 (2C), 113.2, 112.7, 42.0, 40.1, 34.7, 30.3, 19.3, 13.6 + 1C (overlapped with DMSO signals).

[0289] [1.106 Compound 106(B90)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (Compound 106) Starting from compound 57, compound 106 was isolated as a yellow oil (25 mg, 0.0486 mmol, 44%) according to GP3 (step 5). C26H30N4O3S; MS (ESI+) m / z: 479 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.56 (d, J = 4.1 Hz, 1H), 7.74 (d, J = 2.0 Hz, 1H), 7.32 (d, J = 2.0 Hz, 1H), 7.28 - 7.18 (m, 2H), 7.06 - 6.92 (m, 5H), 6.88 - 6.79 (m, 2H), 6.79 - 6.69 (m, 1H), 6.62 - 6.44 (m, 2H), 4.91 - 4.75 (m, 1H), 3.14 - 3.04 (m, 2H), 2.93 - 2.79 (m, 1H), 1.45 - 1.31 (m, 2H), 1.20 - 1.08 (m, 2H), 0.83 - 0.68 (m, 5H), 0.66 - 0.56 (m, 2H). 13C NMR (101 MHz, DMSO-d6): δ 167.2, 156.6, 142.7, 138.5, 132.0, 129.3 (3C), 128.7 (3C), 123.1, 122.4, 120.8, 116.1 (3C), 114.7, 113.4, 42.6, 30.8, 23.6, 19.8, 14.1, 6.3, 6.2.

[0290] [1.107 Compound 107(B91)] [ka] 3-(Anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxybenzamide (Compound 107) Starting from compound 57, compound 107 was isolated as a yellow oil (31 mg, 0.0629 mmol, 57%) according to GP3 (step 5). C27H32N4O3S; MS (ESI+) m / z: 493 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.68 (t, J = 5.7 Hz, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.30 - 7.17 (m, 2H), 7.07 - 6.90 (m, 5H), 6.89 - 6.80 (m, 2H), 6.73 (t, J = 7.3 Hz, 1H), 6.61 - 6.45 (m, 2H), 4.90 - 4.78 (m, 1H), 3.22 - 3.15 (m, 2H), 3.14 - 3.03 (m, 2H), 1.45 - 1.33 (m, 2H), 1.20 - 0.99 (m, 4H), 0.78 (t, J = 7.3 Hz, 3H), 0.51 - 0.40 (m, 2H), 0.29 - 0.20 (m, 2H). 13C NMR (101 MHz, DMSO-d6): δ 165.8, 156.7, 142.7, 138.5, 132.2, 129.3 (2C), 128.7 (3C), 123.1 (2C), 122.4 (2C), 120.8, 116.1 (2C), 114.7, 113.5, 44.1, 42.6, 30.8, 26.0, 19.8, 14.1, 11.5, 3.8.

[0291] [1.108 Compound 108(B92)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (Compound 108) Starting from compound 57, compound 108 was isolated as a yellow oil (27 mg, 0.0576 mmol, 53%) according to GP3 (step 5). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 11.88 (s, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.33 - 7.16 (m, 3H), 7.08 - 6.93 (m, 5H), 6.88 - 6.79 (m, 2H), 6.79 - 6.71 (m, 1H), 6.54 (s, 2H), 5.07 - 4.89 (m, 1H), 3.74 (s, 3H), 3.14 - 3.00 (m, 2H), 1.47 - 1.31 (m, 2H), 1.22 - 1.08 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 163.7, 156.6 (2C), 142.9, 139.0, 129.8, 129.4 (2C), 128.8, 127.8 (4C), 123.1, 122.5, 116.2 (2C), 114.5, 113.0, 63.8, 42.5, 30.7, 19.8, 14.1.

[0292] [1.109 Compound 109(B93)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 109) Starting from compound 57, compound 109 was isolated as a yellow oil (29 mg, 0.0584 mmol, 53%) according to GP3 (step 5). C26H32N4O4S; MS (ESI+) m / z: 497 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.73 - 8.59 (m, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.1 Hz, 1H), 7.30 - 7.19 (m, 2H), 7.07 - 6.92 (m, 5H), 6.89 - 6.80 (m, 2H), 6.80 - 6.69 (m, 1H), 6.61 - 6.45 (m, 2H), 4.94 - 4.79 (m, 1H), 3.59 - 3.40 (m, 4H), 3.29 (s, 3H), 3.14 - 3.05 (m, 2H), 1.47 - 1.33 (m, 2H), 1.19 - 1.08 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 165.9 (2C), 156.6 (2C), 142.8, 138.6, 131.9, 129.3 (2C), 128.7 (2C), 123.1 (2C), 122.4, 120.7, 116.1 (2C), 114.7, 113.4, 71.0, 58.4, 42.6, 30.8, 19.8, 14.1 (+ 1C, overlapping with DMSO signal).

[0293] [1.110 Compound 110(B119)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (Compound 110) Starting from compound 57, compound 110 was isolated as a purple oil (15.7 mg, 0.0306 mmol, 52%) according to GP3 (step 5). C25H28F2N4O3S; MS (ESI+) m / z: 503 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.68 (d, J = 2.1 Hz, 1H), 7.45 (d, J = 2.1 Hz, 1H), 7.33 - 7.27 (m, 2H), 7.14 - 7.07 (m, 3H), 6.95 - 6.88 (m, 3H), 6.77 - 6.73 (m, 2H), 6.61 (t, J = 6.2 Hz, 1H), 5.97 (tt, J = 56.0, 4.1 Hz, 1H), 3.92 (s, 1H), 3.89 - 3.76 (m, 2H), 3.11 (t, J = 7.0 Hz, 2H), 1.46 - 1.38 (m, 2H), 1.22 - 1.10 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0294] [1.111 Compound 111(B120)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (Compound 111) Starting from compound 57, compound 111 was isolated as a yellow oil (11.2 mg, 0.0204 mmol, 35%) according to GP3 (step 5). C25H27F3N4O3S; MS (ESI+) m / z: 521 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.68 (d, J = 2.1 Hz, 1H), 7.49 - 7.47 (m, 1H), 7.33 - 7.28 (m, 1H), 7.15 - 7.07 (m, 3H), 6.96 - 6.88 (m, 3H), 6.77 - 6.73 (m, 2H), 6.65 (t, J = 6.5 Hz, 1H), 4.18 - 4.05 (m, 2H), 3.97 - 3.89 (m, 1H), 3.15 - 3.06 (m, 2H), 1.47 - 1.36 (m, 2H), 1.22 - 1.09 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).

[0295] [1.112 Compound 112(B140)] [ka] 3-(Butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (Compound 112) Starting from compound 72, compound 112 was isolated as a grey solid (10 mg, 0.0197 mmol, 31%) according to GP3 (step 5). C26H30N4O3S; MS (ESI+) m / z: 479 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.62 (d, J = 2.0 Hz, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.23 - 7.15 (m, 4H), 7.13 - 7.08 (m, 2H), 6.94 (t, J = 7.3 Hz, 1H), 6.83 - 6.77 (m, 2H), 6.32 - 6.23 (m, 1H), 4.69 - 4.57 (m, 4H), 3.86 (t, J = 5.2 Hz, 1H), 3.08 (q, J = 6.4 Hz, 2H), 3.01 (d, J = 4.8 Hz, 3H), 1.44 - 1.33 (m, 2H), 1.18 - 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 167.17, 156.07, 143.23, 138.95, 136.66, 134.20, 132.37, 129.93 (2C), 127.57 (2C), 123.22, 122.63 (2C), 114.97, 114.91 (3C), 114.50, 53.90 (2C), 43.18, 31.13, 27.06, 19.93, 13.76.

[0296] [1.113 Compound 113(B141)] [ka] 3-(Butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (Compound 113) Starting from compound 72, compound 113 was isolated as a yellow oil (6 mg, 0.0116 mmol, 18%) according to GP3 (step 5). C26H30N4O4S; MS (ESI+) m / z: 495 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 9.40 (s, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.23 - 7.14 (m, 4H), 7.12 - 7.07 (m, 2H), 6.97 - 6.92 (m, 1H), 6.82 - 6.76 (m, 2H), 4.63 (s, 4H), 3.88 (s, 3H), 3.10 - 3.02 (m, 2H), 1.42 - 1.33 (m, 2H), 1.17 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 165.22, 155.96, 143.32, 139.41, 136.55 (2C), 134.30, 129.94 (2C), 127.59 (2C), 123.29 (2C), 122.62 (2C), 114.89 (3C), 64.74, 53.90 (2C), 43.16, 31.08, 19.90, 13.74.

[0297] [1.114 Compound 114(B142)] [ka] 3-(Butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 114) Starting from compound 72, compound 114 was isolated as a yellow oil (9.7 mg, 0.0182 mmol, 28%) according to GP3 (step 5). C28H34N4O4S; MS (ESI+) m / z: 523 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.69 (d, J = 2.1 Hz, 1H), 7.42 (d, J = 2.1 Hz, 1H), 7.22 - 7.07 (m, 6H), 6.98 - 6.90 (m, 1H), 6.85 - 6.75 (m, 2H), 6.65 (t, J = 5.3 Hz, 1H), 4.71 - 4.56 (m, 4H), 3.85 (t, J = 5.1 Hz, 1H), 3.72 - 3.53 (m, 4H), 3.40 (s, 3H), 3.06 (q, J = 6.5 Hz, 2H), 1.44 - 1.32 (m, 2H), 1.19 - 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.69, 162.66, 156.05, 143.10, 138.98, 136.64 (2C), 134.40, 132.36, 129.90 (2C), 127.53 (2C), 123.20, 122.60 (2C), 114.99, 114.89 (2C), 71.17, 59.01, 53.86 (2C), 43.17, 40.11, 31.12, 19.92, 13.74.

[0298] [1.115 Compound 115(B143)] [ka] 3-(Butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 115) Starting from compound 72, compound 115 was isolated as a white solid (4.4 mg, 0.0076 mmol, 12%) according to GP3 (step 5). C27H29F3N4O3S; MS (ESI+) m / z: 547 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.69 (d, J = 2.1 Hz, 1H), 7.44 (d, J = 2.1 Hz, 1H), 7.24 - 7.15 (m, 4H), 7.14 - 7.08 (m, 2H), 6.96 (t, J = 7.4 Hz, 1H), 6.82 - 6.78 (m, 2H), 6.63 (t, J = 6.6 Hz, 1H), 4.70 - 4.60 (m, 4H), 4.17 - 4.07 (m, 2H), 3.89 (t, J = 5.4 Hz, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.43 - 1.33 (m, 2H), 1.17 - 1.07 (m, 2H), 0.78 (t, J = 7.4 Hz, 3H).

[0299] [1.116 Compound 116(B144)] [ka] 3-(Butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy-benzamide (Compound 116) Starting from compound 71, compound 116 was isolated as a white solid (7.6 mg, 0.0141 mmol, 21%) according to GP3 (step 5). C25H29ClN4O3S; MS (ESI+) m / z: 501 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.00 (s, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.47 (d, J = 2.1 Hz, 1H), 7.31 - 7.26 (m, 2H), 7.21 - 7.11 (m, 3H), 7.06 (t, J = 7.4 Hz, 1H), 7.03 - 6.99 (m, 1H), 6.89 - 6.85 (m, 2H), 6.37 - 6.28 (m, 1H), 4.12 - 3.89 (m, 2H), 3.86 (s, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.03 (d, J = 4.9 Hz, 3H), 1.48 - 1.37 (m, 2H), 1.23 - 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 167.06, 155.86, 142.96, 138.89, 138.57, 134.47, 134.33, 132.55, 130.21 (2C), 129.86, 128.14, 127.94, 126.11, 123.72, 115.29, 115.17 (2C), 113.99, 47.64, 43.21, 31.19, 27.09, 19.99, 13.80.

[0300] [1.117 Compound 117(B145)] [ka] 3-(Butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy-benzamide (Compound 117) Starting from compound 71, compound 117 was isolated as a yellow oil (7.7 mg, 0.0149 mmol, 22%) according to GP3 (step 5). C25H29ClN4O4S; MS (ESI+) m / z: 517 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 9.60 (s, 1H), 7.55 (s, 1H), 7.39 (d, J = 1.9 Hz, 1H), 7.31 - 7.23 (m, 2H), 7.20 - 7.12 (m, 2H), 7.11 - 7.09 (m, 1H), 7.08 - 7.03 (m, 1H), 7.02 - 6.98 (m, 1H), 6.88 - 6.83 (m, 2H), 4.12 - 3.89 (m, 2H), 3.89 (s, 3H), 3.13 - 3.06 (m, 2H), 1.47 - 1.37 (m, 2H), 1.23 - 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 165.02, 162.72, 155.77, 143.03, 138.97, 138.88, 134.43, 130.21 (2C), 129.84, 128.11, 127.91, 126.13, 123.75, 115.16 (2C), 115.10, 114.24, 64.70, 47.62 (2C), 43.18, 31.14, 19.96, 13.78.

[0301] [1.118 Compound 118(B146)] [ka] 3-(Butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 118) Starting from compound 71, compound 118 was isolated as a colorless oil (9.7 mg, 0.0169 mmol, 25%) according to GP3 (step 5). C27H33ClN4O4S; MS (ESI+) m / z: 545 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.61 (d, J = 2.0 Hz, 1H), 7.46 (d, J = 2.1 Hz, 1H), 7.32 - 7.26 (m, 2H), 7.19 - 7.15 (m, 2H), 7.13 - 7.10 (m, 1H), 7.09 - 7.05 (m, 1H), 7.05 - 7.00 (m, 1H), 6.90 - 6.85 (m, 2H), 6.62 (t, J = 5.3 Hz, 1H), 4.13 - 3.88 (m, 2H), 3.87 (t, J = 5.3 Hz, 1H), 3.71 - 3.63 (m, 2H), 3.61 - 3.56 (m, 2H), 3.41 (s, 3H), 3.11 (q, J = 6.4 Hz, 2H), 1.48 - 1.38 (m, 2H), 1.23 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.51, 155.87, 142.86, 138.95, 138.59, 134.48, 132.56, 130.21 (2C), 129.85, 128.12, 127.92, 126.14, 123.71, 115.30, 115.18 (2C), 114.23, 71.17, 59.03, 47.72, 43.22, 40.14, 31.19, 19.99, 13.80.

[0302] [1.119 Compound 119(B147)] [ka] 3-(Butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 119) Starting from compound 71, compound 119 was isolated as a yellow oil (2.7 mg, 0.0047 mmol, 7%) according to GP3 (step 5). C26H28ClF3N4O3S; MS (ESI+) m / z: 569 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.64 - 7.61 (m, 1H), 7.48 - 7.45 (m, 1H), 7.31 - 7.27 (m, 2H), 7.19 - 7.13 (m, 2H), 7.12 - 7.11 (m, 1H), 7.10 - 7.05 (m, 1H), 7.04 - 7.00 (m, 1H), 6.87 (d, J = 21.7 Hz, 2H), 6.81 (t, J = 5.8 Hz, 1H), 4.19 - 4.09 (m, 2H), 4.10 - 3.92 (m, 2H), 3.90 (t, J = 5.4 Hz, 1H), 3.11 (q, J = 6.6 Hz, 2H), 1.48 - 1.38 (m, 2H), 1.22 - 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.43, 161.65, 155.76, 143.05, 139.19, 138.78, 134.49, 131.03, 130.26 (2C), 129.86, 128.13, 127.97, 126.15, 123.85, 115.42, 115.19 (2C), 114.10, 47.74, 43.19, 41.52, 41.17, 31.14, 19.97, 13.78.

[0303] [1.120 Compound 120(B148)] [ka] 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (Compound 120) Starting from compound 57, compound 120 was isolated as a colorless oil (9 mg, 0.0152 mmol, 19%) according to GP3 (step 5). C26H29F3N3O3S; MS (ESI+) m / z: 535 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.63 (d, J = 2.1 Hz, 1H), 7.44 (d, J = 2.1 Hz, 1H), 7.33 - 7.27 (m, 2H), 7.15 - 7.06 (m, 3H), 6.97 - 6.86 (m, 3H), 6.77 - 6.71 (m, 2H), 6.59 (t, J = 6.2 Hz, 1H), 3.91 (t, J = 5.2 Hz, 1H), 3.71 (q, J = 6.5 Hz, 2H), 3.11 (q, J = 6.6 Hz, 2H), 2.56 - 2.41 (m, 2H), 1.47 - 1.36 (m, 2H), 1.22 - 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.58, 155.68, 142.93, 138.70, 136.03, 131.88, 130.27, 130.13 (2C), 128.99 (2C), 123.70, 123.21 (2C), 123.02, 115.38 (2C), 115.19, 113.28, 43.18, 33.92, 33.65, 31.12, 19.94, 13.77.

[0304] [1.121 Compound 121(B149)] [ka] 3-(Butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 121) Starting from compound 75, compound 121 was isolated as a yellow oil (9 mg, 0.0105 mmol, 27%) according to GP3 (step 5). C23H32N4O5S; MS (ESI+) m / z: 477 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 9.46 (s, 1H), 7.56 (s, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.33 - 7.28 (m, 2H), 7.12 - 7.06 (m, 1H), 6.92 - 6.87 (m, 2H), 3.89 (s, 3H), 3.88 - 3.75 (m, 2H), 3.41 - 3.23 (m, 3H), 3.15 - 3.06 (m, 2H), 1.79 - 1.71 (m, 1H), 1.57 - 1.51 (m, 1H), 1.46 - 1.26 (m, 4H), 1.19 - 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 155.74, 143.07, 139.07, 136.16, 130.20 (3C), 123.78 (2C), 115.33 (3C), 113.77, 66.69, 66.49, 64.60, 50.77, 43.18, 34.22, 33.72, 31.09, 19.93, 13.76.

[0305] [1.122 Compound 122(B150)] [ka] 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 122) Starting from compound 75, compound 122 was isolated as a yellow oil (6.3 mg, 0.0125 mmol, 32%) according to GP3 (step 5). C25H36N4O5S; MS (ESI+) m / z: 505 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.62 (d, J = 2.1 Hz, 1H), 7.46 (d, J = 1.8 Hz, 1H), 7.33 - 7.28 (m, 2H), 7.09 (t, J = 7.4 Hz, 1H), 6.90 (d, J = 8.1 Hz, 2H), 6.65 (t, J = 5.2 Hz, 1H), 3.92 - 3.75 (m, 2H), 3.73 - 3.52 (m, 4H), 3.40 (s, 3H), 3.40 - 3.24 (m, 3H), 3.16 - 3.06 (m, 2H), 1.79 (d, J = 13.1 Hz, 1H), 1.54 (d, J = 13.1 Hz, 1H), 1.47 - 1.26 (m, 4H), 1.21 - 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.60, 155.87, 142.85, 138.67, 132.59, 130.16 (2C), 123.68 (2C), 115.35 (2C), 115.20, 113.71, 71.15, 66.73, 66.51, 59.02, 50.74, 43.20, 40.13, 34.31, 33.71, 31.14, 19.94, 13.77.

[0306] [1.123 Compound 123(B151)] [ka] 3-(Butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2-trifluoroethyl)benzamide (Compound 123) Starting from compound 75, compound 123 was isolated as a yellow oil (5 mg, 0.0105 mmol, 27%) according to GP3 (step 5). C24H31F3N4O4S; MS (ESI+) m / z: 529 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 7.66 (d, J = 2.1 Hz, 1H), 7.47 (d, J = 2.0 Hz, 1H), 7.35 - 7.28 (m, 2H), 7.13 - 7.07 (m, 2H), 6.91 - 6.87 (m, 2H), 4.13 - 4.05 (m, 1H), 3.93 - 3.76 (m, 3H), 3.42 - 3.24 (m, 3H), 3.11 (q, J = 6.6 Hz, 2H), 1.77 (d, J = 13.1 Hz, 1H), 1.56 (d, J = 12.9 Hz, 1H), 1.48 - 1.27 (m, 4H), 1.19 - 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). C NMR (101 MHz, chloroform-d): δ 166.58, 155.73, 142.98, 132.19, 130.19 (2C), 128.58, 123.78 (2C), 115.30 (3C), 113.66, 66.69, 66.49, 64.57, 50.80, 43.17, 38.75, 34.29, 33.72, 31.09, 19.92, 13.75.

[0307] 3-[Synthetic scheme for the synthesis of compounds 124-127] [ka]

[0308] Step 1: Methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (Compound 124) To a stirred solution of Int01 (2.00 g, 3.28 mmol, 1 equiv) in dry acetonitrile (16.4 mL, 0.2 M) was added potassium carbonate (1.13 g, 8.19 mmol, 2.5 equiv), copper(I) iodide (62 mg, 0.328 mmol, 0.1 equiv), and N,N'-dimethylethylenediamine (176 μL, 1.64 mmol, 0.5 equiv). The solution was degassed under argon and sonicated, followed by the addition of bromobenzene (412 μL, 3.93 mmol, 1.20 equiv) at 20 °C. The reaction vessel was flushed with argon, sealed, and stirred at 80 °C for 16 h. The reaction was cooled to 20° C. and filtered on a pad of Celite to give the crude product, which was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 100 / 0 to 40 / 60 over 10 CV) to give compound 124 (1.45 g, 3.2 mmol, 97%) as a white solid. C24H26N2O5S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.24 (s, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.32 - 7.16 (m, 4H), 7.08 - 6.97 (m, 4H), 6.82 - 6.77 (m, 2H), 5.10 (t, J = 5.6 Hz, 1H), 3.86 (s, 3H), 3.00 (q, J = 6.5 Hz, 2H), 1.36 - 1.24 (m, 2H), 1.09 - 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H).

[0309] Step 2: 3-(Butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (Compound 125) To a stirred solution of compound 124 (1.45 g, 3.2 mmol, 1 equiv.) in a mixture of THF / MeOH / water 1 / 1 / 1 (30 mL, 0.1 M) was added LiOH monohydrate (270 mg, 6.4 mmol, 2 equiv.). The resulting mixture was stirred at 20 °C for 36 h. The mixture was acidified with 1 N aqueous HCl until pH = 2-3. The aqueous layer was extracted with EtOAc, and the resulting organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure to give compound 125 (1.3 g, 2.95 mmol, 92%) as a white solid. C23H24N2O5S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.21 (s, 1H), 10.21 (s, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.28 - 7.18 (m, 4H), 7.08 - 6.97 (m, 4H), 6.82 - 6.78 (m, 2H), 5.03 (t, J = 5.7 Hz, 1H), 3.00 (q, J = 6.5 Hz, 2H), 1.37 - 1.26 (m, 2H), 1.09 - 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.8, 156.5, 142.9, 140.5, 138.1, 134.1, 129.6 (2C), 129.5 (2C), 128.8, 124.0, 122.9, 119.7 (2C), 117.2, 116.2, 116.2 (2C), 42.4, 30.5, 19.7, 14.0.

[0310] Step 3: 3-(Butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzamide (Int03) To a stirred solution of compound 125 (283 mg, 0.565 mmol, 1 equiv) in CHCN (5.6 mL, 0.1 M) was added CDI (101 mg, 0.622 mmol, 1.1 equiv). The resulting mixture was stirred at 50 °C for 1 h. After cooling at 20 °C, a 28% aqueous solution of ammonium hydroxide (90 μL, 0.622 mmol, 1.1 equiv) was added. The reaction mixture was stirred at 20 °C for 16 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by automated flash chromatography using DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 13 CV) to give Int03 (234 mg, 0.533 mmol, 94%) as a yellow oil. C23H25N3O4S; MS (ESI+) m / z: 440 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.13 (s, 1H), 8.12 (s, 1H), 7.67 (d, J = 2.1 Hz, 1H), 7.43 (s, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.29 - 7.15 (m, 4H), 7.08 - 6.93 (m, 4H), 6.84 - 6.76 (m, 2H), 4.83 (t, J = 5.7 Hz, 1H), 3.01 (q, J = 6.6 Hz, 2H), 1.37 - 1.23 (m, 2H), 1.15 - 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H).

[0311] Step 4: 3-(Butylamino)-5-cyano-2-phenoxy-N-phenylbenzenesulfonamide (Int04) To a stirred solution of Int03 (180 mg, 0.315 mmol, 1 equiv.) in CH3CN (1.8 mL, 0.18 M) was added dry pyridine (25 μL, 0.315 mmol, 1 equiv.) and TFAA (44 μL, 0.315 mmol, 1 equiv.). The resulting mixture was stirred at 20 °C for 4 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 100 / 0 to 40 / 60 over 10 CV) to give Int04 (135 mg, 0.266 mmol, 84%) as a colorless oil. C23H23N3O3S; MS (ESI+) m / z: 422 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.31 (s, 1H), 7.41 - 7.35 (m, 2H), 7.29 - 7.20 (m, 4H), 7.08 - 7.00 (m, 4H), 6.82 - 6.77 (m, 2H), 5.35 (t, J = 5.7 Hz, 1H), 3.00 (q, J = 6.6 Hz, 2H), 1.33 - 1.24 (m, 2H), 1.08 - 0.96 (m, 2H), 0.72 (t, J = 7.3 Hz, 3H).

[0312] Step 5: 3-(Butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (Compound 126) To a stirred solution of Int04 (50 mg, 0.120 mmol, 1 equiv) in DMF (2 mL, 0.06 M) was added sodium azide (32 mg, 0.498 mmol, 4.5 equiv) and ammonium chloride (25 mg, 0.468 mmol, 3.9 equiv). The resulting mixture was stirred at 120 °C for 4 h. After cooling at 20 °C, the reaction mixture was diluted with EtOAc and washed with brine, and the organic layer was dried over Na SO , filtered, and concentrated under reduced pressure to give compound 126 (51 mg, 0.110 mmol, 91%) as an off-white solid. C23H24N6O3S; MS (ESI+) m / z: 465 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.10 (s, 1H), 7.81 (d, J = 1.8 Hz, 1H), 7.53 (d, J = 1.9 Hz, 1H), 7.28 - 7.15 (m, 5H), 7.10 - 7.05 (m, 2H), 7.03 - 6.93 (m, 2H), 6.85 - 6.81 (m, 2H), 4.75 (t, J = 5.7 Hz, 1H), 3.02 (q, J = 6.6 Hz, 2H), 1.39 - 1.30 (m, 2H), 1.14 - 1.03 (m, 2H), 0.75 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 159.20, 156.68, 142.21, 137.97, 136.04, 133.48, 128.97 (2C), 128.87 (3C), 123.15, 121.99, 118.92 (2C), 115.62 (2C), 113.53, 112.74, 42.14, 30.27, 19.28, 13.58.

[0313] Step 6: 3-(Butylamino)-N-hydroxy-4-phenoxy-5-(phenylsulfamoyl)benzamidine (Int05) To a stirred solution of Int04 (135 mg, 0.266 mmol, 1 equiv.) in EtOH (3 mL, 0.09 M) was added a solution of hydroxylamine hydrochloride (37 mg, 0.532 mmol, 2 equiv.) in a 1 M aqueous solution of NaHCO3 (800 μL, 3 equiv.), and the resulting white suspension was stirred at 80 °C for 4 h. The reaction mixture was cooled to 20 °C and poured into water. The organic layer was extracted twice with EtOAc. The combined organic layers were concentrated under reduced pressure to give Int05 (116 mg, 0.255 mmol, 96%) as an off-white solid. C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+.

[0314] Step 7: 3-(Butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenylbenzenesulfonamide (Compound 127) To a stirred solution of Int05 (116 mg, 0.255 mmol, 1 equiv) in dioxane (2.5 mL, 0.1 M) was added DBU (42 μL, 0.280 mmol, 1.10 equiv) and CDI (58 mg, 0.383 mg, 1.5 equiv). The resulting solution was stirred at 100° C. for 16 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by automated flash chromatography using DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to give compound 127 (62 mg, 0.129 mmol, 51%) as a yellow oil. C24H24N4O5S; MS (ESI+) m / z: 481 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.08 (s, 1H), 10.26 (s, 1H), 7.61 (d, J = 2.0 Hz, 1H), 7.30 - 7.18 (m, 5H), 7.09 - 6.98 (m, 4H), 6.84 - 6.79 (m, 2H), 5.20 (t, J = 5.7 Hz, 1H), 3.01 (q, J = 6.6 Hz, 2H), 1.37 - 1.28 (m, 2H), 1.10 - 1.00 (m, 2H), 0.74 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 160.37, 157.10, 156.02, 142.92, 139.07, 137.50, 134.35, 129.04 (2C), 128.99 (2C), 123.54, 122.43, 121.22, 119.16 (2C), 115.70 (2C), 112.93, 112.54, 41.90, 29.98, 19.20, 13.54.

[0315] 4-[Synthetic scheme for the synthesis of compounds 128-135] [ka] [ka]

[0316] Step 1: 4-Chloro-3-chlorosulfonyl-5-nitrobenzoic acid (Int06) To a solution of 4-chloro-3-chlorosulfonylbenzoic acid (CAS 2494-79-3) (1.4 g, 5.49 mmol, 1 equiv.) diluted in concentrated sulfuric acid (4.4 mL, 82.33 mmol, 15 equiv.) was added KNO (555 mg, 5.79 mmol, 1 equiv.) at 0 °C, and the resulting yellow suspension was stirred at 100 °C for 16 h. The suspension dissolved during the temperature increase. The reaction mixture was poured into 20 mL of ice / water and extracted with EtOAc. The combined organic layers were dried over NaSO, filtered, and concentrated under reduced pressure to give Int06 (793 mg, 2.64 mmol, 48%) as a white solid. C7H3Cl2NO6S; 1H NMR (400 MHz, DMSO-d6): δ 8.63 (d, J = 2.1 Hz, 1H), 8.37 (d, J = 2.1 Hz, 1H).

[0317] Step 2: 4-Chloro-3-nitro-5-sulfanylbenzoic acid (Int07) To a solution of Int06 (2 g, 6.66 mmol, 1 equiv.) diluted in toluene (66.6 mL, 0.1 M) was added triphenylphosphine (5.25 g, 20 mmol, 3 equiv.) at 20 °C, and the resulting yellow suspension was stirred at 20 °C for 1 h. Water was added, and stirring was continued for 1 h. 1 M NaOH was added and the phases were separated. The organic layer was washed twice with 1 M NaOH. The aqueous layer was acidified to pH 3, with filtration of the suspension with 2 M HCl, and the solid was washed once with water and air-dried to give Int07 (400 mg, 1.54 mmol, 23%) as a white solid. C7H4ClNO4S; MS (ESI+) m / z: 232 [M-1]-; 1H NMR (400 MHz, DMSO-d6): δ 8.55 (d, J = 1.7 Hz, 1H), 8.45 (s, 2H), 8.33 (d, J = 1.7 Hz, 1H).

[0318] Step 3: Methyl 4-chloro-3-methylsulfanyl-5-nitrobenzoate (Int08) To a solution of Int07 (400 mg, 1.71 mmol, 1 equiv) diluted in DMF (11 mL, 0.15 M) was added KCO (710 mg, 5.14 mmol, 3 equiv) and MeI (234 μL, 3.77 mmol, 2.2 equiv) at 20° C., and the resulting yellow suspension was stirred for 16 h at 20° C. The reaction mixture was poured into water and extracted with EtOAc, and the combined organic layers were dried over NaSO, filtered, and concentrated under reduced pressure to give Int08 (220 mg, 0.80 mmol, 47%) as a yellow solid. C9H8ClNO4S; MS (ESI+) m / z: 262, 264 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.26 (d, J = 1.8 Hz, 1H), 7.95 (d, J = 1.8 Hz, 1H), 3.93 (s, 3H), 2.67 (s, 3H).

[0319] Step 4: Methyl 3-methylsulfanyl-5-nitro-4-phenoxybenzoate (Int09) To a solution of Int08 (90 mg, 0.34 mmol, 1 equiv.) diluted in DMF (3 mL, 0.1 M) were added phenol (35.6 mg, 0.38 mmol, 1.1 equiv.) and K2CO3 (95 mg, 0.70 mmol, 2 equiv.) at 20 °C, and the resulting yellow suspension was stirred at 100 °C for 4 h. The reaction mixture was poured into water and extracted with EtOAc, and the combined organic layers were dried over Na2SO4, filtered, and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 100 / 0 to 1 / 1 over 10 CV) to give Int09 (64 mg, 0.2 mmol, 60%) as a yellow solid. C15H13NO5S; MS (ESI+) m / z: 320 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.32 (d, J = 2.0 Hz, 1H), 8.10 (d, J = 2.0 Hz, 1H), 7.38-7.31 (m, 2H), 6.91-6.87 (m, 2H), 6.80 - 6.71 (m, 1H), 3.95 (s, 3H), 2.54 (s, 3H).

[0320] Step 5: Methyl 3-(methylsulfonimidoyl)-5-nitro-4-phenoxybenzoate (Int10) To a solution of Int09 (270 mg, 0.85 mmol, 1.00 equiv) diluted in MeOH (8 mL, 0.1 M) and CHCl (2 mL) were added ammonium carbamate (264 mg, 3.38 mmol, 4 equiv) and (diacetoxyiodo)benzene (817 mg, 2.54 mmol, 3 equiv) at 20° C., and the resulting yellow suspension was stirred for 2 h at 20° C. The reaction mixture was concentrated under reduced pressure and then purified by automated flash chromatography using cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 9 CV) to give Int10 (276 mg, 0.75 mmol, 89%) as a yellow solid. C15H14N2O6S; MS (ESI+) m / z: 351 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.82 (d, J = 2.2 Hz, 1H), 8.70 (d, J = 2.2 Hz, 1H), 7.37-7.31 (m, 2H), 7.19-7.08 (m, 1H), 7.01-6.91 (m, 2H), 4.92 (d, J = 1.4 Hz, 1H), 3.97 (s, 3H), 3.28 (d, J = 1.4 Hz, 3H).

[0321] Step 6 and Step 7: Methyl 3-(butylamino)-5-(N-butyl-S-methylsulfonimidoyl)-4-phenoxybenzoate (Compound 128) Methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxybenzoate (Compound 129) To a stirred solution of Int10 (276 mg, 0.75 mmol, 1.00 equiv) in MeOH (7.5 mL, 0.1 M) under argon was added palladium on activated carbon 10% (80 mg, 0.07 mmol, 0.100 equiv) and the resulting black suspension was stirred under 1 atmosphere of H for 16 h at 20 °C. The reaction mixture was filtered over Celite and the filtrate was concentrated under reduced pressure to give Int11.

[0322] Step 7: Int11 as a crude oil was taken up in 1,2-dichloroethane (7.5 mL, 0.1 M) and treated with butyraldehyde (276 μL, 2.99 mmol, 4.00 equiv.) and sodium triacetoxyborohydride (280 mg, 1.49 mmol, 2.00 equiv.), and the resulting yellow suspension was stirred at 20 °C for 4 h. Water was added to the reaction mixture and extracted with CHCl. ​​The organic layer was dried over NaSO, filtered, and concentrated under reduced pressure. The crude oil was purified by preparative TLC using 95 / 5 CHCl / MeOH to give: Compound 128 (3 mg, 0.007 mmol, 1%) as a yellow oil. C23H32N2O4S; MS (ESI+) m / z: 433 [M+H]+ Compound 129 (13 mg, 0.03 mmol, 19%) as a yellow oil C19H24N2O4S; MS (ESI+) m / z: 377 [M+H]+; 1H NMR (400 MHz, chloroform-d) δ 7.93 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.29-7.18 (m, 2H), 7.00 (t, J = 7.4 Hz, 1H), 6.79 (d, J = 8.1 Hz, 2H), 3.87 (s, 3H), 3.13 (s, 3H), 3.8-3.01 (m, 2H), 1.44-1.31 (m, 2H), 1.17-1.03 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).

[0323] Step 8: 3-(Butylamino)-5-(methylsulfonimidoyl)-4-phenoxybenzoic acid (Compound 130) To a stirred solution of compound 129 (13 mg, 0.03 mmol, 1 equiv.) in THF (690 μL, 0.05 M) at 20° C. was added a 2 M aqueous solution of sodium hydroxide (104 μL, 0.18 mmol, 6 equiv.), and the resulting solution was stirred at 20° C. for 16 h. The THF was removed, and the mixture was diluted with water (5 mL). The aqueous layer was washed with EtOAc and acidified with 1 N HCl to pH = 2-3. The aqueous layer was extracted with EtOAc, and the resulting organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure to give compound 130 (2 mg, 0.005 mmol, 14%) as a yellow oil. C18H22N2O4S; MS (ESI+) m / z: 363 [M+H]+, MS (ESI-) m / z: 361 [MH]-; 1H NMR (400 MHz, CD3CN) δ 7.87 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.39-7.28 (m, 2H), 7.14-7.06 (m, 1H), 6.93-6.86 (m, 2H), 4.37 (brs, 1H), 3.19 (s, 3H), 3.14 (t, J = 7.0 Hz, 2H), 1.99 (s, 1H), 1.49-1.38 (m, 2H), 1.24-1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).

[0324] Step 9: 3-(Butylamino)-5-(N-butyl-S-methylsulfonimidoyl)-4-phenoxybenzoic acid (Compound 131) To a stirred solution of compound 128 (3 mg, 0.007 mmol, 1 equiv.) in THF (140 μL, 0.05 M) at 20° C. was added 2 M aqueous sodium hydroxide (21 μL, 0.042 mmol, 6 equiv.), and the resulting solution was stirred at 20° C. for 16 h. The THF was removed, and the mixture was diluted with water (1 mL). The aqueous layer was washed with EtOAc and acidified with 1 N HCl to pH = 2-3. The aqueous layer was extracted with EtOAc, and the resulting organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure to give compound 131 (2 mg, 0.005 mmol, 80%) as a yellow oil. C22H30N2O4S; MS (ESI+) m / z: 419 [M+H]+; 1H NMR (400 MHz, acetonitrile-d3) δ 7.82 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.32 (dd, J = 8.7, 7.3 Hz, 2H), 7.14 - 7.04 (m, 1H), 6.86 (dt, J = 7.8, 1.1 Hz, 2H), 4.41 (s, 1H), 3.15 (s, 3H), 2.85 - 2.72 (m, 1H), 2.48 - 2.37 (m, 1H), 1.54 - 1.38 (m, 2H), 1.34 - 1.09 (m, 6H), 1.08 - 0.94 (m, 1H). 0.91 - 0.73 (m, 6H).

[0325] Step 10: Methyl 3-(N,S-dimethylsulfonimidoyl)-5-nitro-4-phenoxybenzoate (Int11) A solution of Int10 (249 mg, 0.618 mmol, 1 equiv) diluted in a 37% aqueous solution of formaldehyde (54 mL, 33.3 mmol, 54 equiv) and formic acid (10 mL, 264 mmol, 430 equiv) was stirred at 100° C. for 48 h. The reaction mixture was concentrated under reduced pressure and the crude product was purified by automated flash chromatography with cyclohexane / EtOAc (gradient from 100 / 0 to 0 / 100 over 10 CV) to give Int11 (129 mg, 0.354 mmol, 57%) as a yellow solid. C16H16N2O6S; MS (ESI+) m / z: 365 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.76 - 8.70 (m, 2H), 7.36 - 7.31 (m, 2H), 7.15 - 7.09 (m, 1H), 6.99 - 6.94 (m, 2H), 3.97 (s, 3H), 3.35 (s, 3H), 2.35 (s, 3H).

[0326] Step 11: Methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxybenzoate (Compound 132) To a solution of Int11 (124 mg, 0.313 mmol, 1 equiv) diluted in a 1 / 2 mixture of water and ethanol (1 mL / 2 mL, 0.1 M), ammonium chloride (167 mg, 3.13 mmol, 10 equiv) was added and the resulting solution was stirred at 85 °C, after which iron powder (70 mg, 1.25 mmol, 4 equiv) was added and the resulting gray suspension was stirred at 85 °C for 16 h. The reaction mixture was filtered over a pad of Celite, the filtrate was concentrated under reduced pressure, and the crude product was purified by automated flash chromatography using DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to give compound 132 (25 mg, 0.075 mmol, 24%) as a white solid. C16H18N2O4S; MS (ESI+) m / z: 335 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.10 (d, J = 2.0 Hz, 1H), 7.72 (d, J = 2.0 Hz, 1H), 7.34 - 7.28 (m, 2H), 7.15 - 7.02 (m, 1H), 6.93 - 6.84 (m, 2H), 3.94 (s, 3H), 3.22 (s, 3H), 2.44 (s, 3H).

[0327] Step 12: Methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxybenzoate (Compound 133) To a solution of compound 132 (23 mg, 0.065 mmol, 1 equiv.) diluted in MeOH (300 μL, 0.25 M), butyraldehyde (6.5 μL, 0.072 mmol, 1.1 equiv.), acetic acid (3.7 μL, 0.065 mmol, 1 equiv.), and sodium cyanoborohydride (6.6 mg, 0.104 mmol, 1.6 equiv.) were added, and the resulting solution was stirred at 20 °C for 1 h. The reaction was quenched with 1 M aqueous NaOH. The organic layer was extracted with AcOEt, washed with brine, dried over NaSO, filtered, and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography using DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to give compound 133 (13 mg, 0.033 mmol, 51%) as a yellow oil. C20H26N2O4S; MS (ESI+) m / z: 391 [M+H]+; 1H NMR (400 MHz, chloroform-d): δ 8.00 (s, 1H), 7.60 (s, 1H), 7.29 (t, J = 7.9 Hz, 2H), 7.06 (t, J = 7.3 Hz, 1H), 6.84 (d, J = 8.0 Hz, 2H), 3.95 (s, 3H), 3.19 (s, 3H), 3.17 - 3.11 (m, 2H), 2.43 (s, 3H), 1.51 - 1.41 (m, 2H), 1.25 - 1.16 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).

[0328] Step 13: 3-(Butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxybenzoic acid (Compound 134) To a solution of compound 133 (7 mg, 0.013 mmol, 1 equiv.) diluted in THF / MeOH / HO (100 μL / 100 μL / 100 μL, 0.03 M) was added lithium hydroxide monohydrate (1.1 mg, 0.052 mmol, 4 equiv.). After 4 h at 20 °C, the mixture was diluted with water (1 mL). The aqueous layer was washed with EtOAc and then acidified with 1 N HCl to pH = 2-3. The aqueous layer was extracted with EtOAc, and the resulting organic layer was dried over NaSO, filtered, and concentrated under reduced pressure to give compound 134 (3 mg, 0.008 mmol, 61%) as a yellow oil. C19H24N2O4S; MS (ESI+) m / z: 377 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.78 - 7.70 (m, 1H), 7.55 (s, 1H), 7.33 - 7.24 (m, 2H), 7.02 (t, J = 7.3 Hz, 1H), 6.79 (d, J = 8.0 Hz, 2H), 4.96 - 4.82 (m, 1H), 3.13 (s, 3H), 3.11 - 3.04 (m, 2H), 2.19 (s, 3H), 1.46 - 1.36 (m, 2H), 1.20 - 1.12 (m, 2H), 0.80 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 162.3, 156.6 (2C), 142.6, 132.5, 129.7 (2C), 122.6, 118.7, 118.5, 116.6, 115.5 (2C), 43.6, 42.7, 30.9, 29.7, 19.9, 14.1.

[0329] Step 14: 3-(Butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzamide (Int12) To a solution of compound 134 (140 mg, 0.346 mmol, 1 equiv) diluted in acetonitrile (3.5 mL, 0.1 M) was added CDI (62 mg, 0.380 mmol, 1.1 equiv) at 20° C. The resulting solution was stirred at 50° C. for 1 h, after which a 28% aqueous solution of ammonium hydroxide (58 μL, 0.415 mmol, 1.20 equiv) was added at 20° C., and the resulting suspension was stirred at 20° C. for 4 h. The reaction mixture was concentrated under reduced pressure, and the crude product was purified by automated flash chromatography using DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to give Int12 (70 mg, 0.186 mmol, 50%) as a yellow oil. C19H25N3O3S; MS (ESI+) m / z: 376 [M+H]+.

[0330] Step 15: 3-(Butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzonitrile (Int13) To a solution of Int12 (70 mg, 0.186 mmol, 1 equiv.) diluted in dry 1,4-dioxane (0.8 mL, 0.2 M) in a flame-dried vial under Ar, pyridine (15 μL, 0.190 mmol, 1.20 equiv.) followed by trifluoroacetic anhydride (22 μL, 0.158 mmol, 1 equiv.) was added dropwise at 20 °C. The same amounts of pyridine and TFAA were added again every 30 min until complete conversion was reached. The reaction mixture was purified by preparative TLC eluted with 1 / 1 CyHex / EA to give Int13 (14 mg, 0.038 mmol, 21%) as a yellow oil. C19H23N3O2S; MS (ESI+) m / z: 358 [M+H]+.

[0331] Step 16: N-Butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (Compound 135) To a solution of Int13 (14 mg, 0.038 mmol, 1 equiv.) diluted in N,N-dimethylformamide (0.8 mL, 0.0500 M) was added ammonium chloride (8.1 mg, 0.152 mmol, 4 equiv.) and sodium azide (7.4 mg, 0.114 mmol, 3 equiv.) at 20 °C. The resulting white suspension was stirred at 120 °C for 5 h. The reaction mixture was concentrated under reduced pressure, taken up in EtOAc, washed with water, and the aqueous layer was extracted three times with EtOAc and then twice with 8 / 2 CHCl3 / iPrOH. The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure to give compound 135 (5 mg, 0.038 mmol, 33%) as a yellow oil. C19H24N6O2S; MS (ESI+) m / z: 401 [M+H]+; 1 H NMR (400 MHz, methanol-d4) δ 7.94 (s, 1H), 7.76 (s, 1H), 7.39 - 7.28 (m, 2H), 7.18 - 7.05 (m, 1H), 6.94 (d, J = 8.0 Hz, 2H), 3.27 - 3.20 (m, 2H), 2.42 (s, 3H), 1.59 - 1.49 (m, 2H), 1.31 (s, 3H), 1.28 - 1.21 (m, 2H), 0.90 - 0.81 (m, 3H). C NMR (101 MHz, methanol-d) δ 156.1, 143.8, 138.5, 132.2, 129.3 (2C), 124.1, 122.7, 115.5, 114.9 (2C), 113.7, 42.4, 42.2, 30.6, 29.4, 28.4, 19.6, 12.6.

[0332] 3-[Analysis Data Table] [Table 2-1] [Table 2-2] [Table 2-3]

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

[0333] 4-[Biological Protocol] The compounds of the present invention are tested to evaluate their efficacy in inhibiting NKCCl channel.The test used is a cell assay that expresses NKCCl channel.That is, HEK293 cells are human cells derived from embryonic kidney.The inhibitory activity of compounds is evaluated by measuring the modulation of potassium flux at two concentrations, as described below in the biological protocol.

[0334] [4.1 Native HEK293 cells] HEK293 cells are human cells derived from embryonic kidneys. These cells express potassium (K + These proteins include the Na-K-2Cl cotransporter or NKCCl. This transporter transports K into the cell. + Contributes to 40-50% of inflow. + The remainder of the transport is primarily K+ Na also contributes approximately 40-50% of the influent base flux, with 5-10% attributable to channels. + / K + -ATPase(Na + Pump or Na + / K + Transport of NKCCl is mediated by NKCCl transporters (also known as pumps) (Figure 1A). Therefore, HEK293 cells in culture are an ideal model for studying the function of NKCCl and testing compounds that inhibit its transport.

[0335] The assay measuring NKCCl function was optimized to obtain the following signal-to-noise ratio: 0.05; a. Slightly hypertonic saline was used to stimulate NKCCl function. The medium in which the cells were grown and subcultured had a measured osmolality of 330 mOsM. + The saline used for influx measurements had an osmolality of 370–380 mOsM. Consistent use of this simple procedure enhanced the NKCCl signal. b. Na + / K + The pump inhibitor ouabain was used at 100 μM. The use of ouabain significantly reduced non-cotransporter-mediated flux, resulting in a significant increase in the signal-to-noise ratio. c. K into the cell + Radioactive isotopes were used to track the inward migration (influx) of K. + This allows for extremely accurate measurement of inflow. + The radioactive isotope Rb has a very short half-life. + The radioisotope rubidium was used. Rubidium inhibits the K transport by many transporters and channels. + It was a monovalent cation that immediately transported Rb at the binding site. + is K + K is transported without distinction + It is a homologue of 86 Rb (half-life 19.6 days) is no longer commercially available.83 Rb (half-life 83 days) was used. 83 Rb isotopes are used as tracers, i.e., K + It was used in minute amounts to track the movements of

[0336] The assay was validated using two reference compounds, Ref1 bumetanide and Ref2 furosemide, as shown in Figure 1B. K measured in native HEK293 cells. + The influx is 7000-9000 pmoles of K per mg of protein per minute. + In the presence of 20 μM Ref1, the flux ranged from 600 to 900 pmoles K per mg of protein per minute. + Thus, there was a very stable dynamic range. In each experiment, the flux without Ref1 was set to 1000 (equivalent to 100.0%), and the flux with 20 μM bumetanide was set to 0 (equivalent to 0%).

[0337] Table 3. [Inhibition rate of drugs against NKCCl at 2 μM and 20 μM] [Table 3]

[0338] 4.2 NKCCl-KO HEK293 cells CRISPR / cas9 was used to ablate NKCCl expression from HEK293 cells. Cells were transfected with a vector expressing a cas9-EGFP fusion protein and a guide RNA specific for the NKCCl sequence (CCGCTTCCGCGTGAACTTCG; SEQ ID NO: 1) located within exon 1. Two days after transfection, cells were FACS sorted, and EGFP- and cas9-expressing cells (green cells) were plated at one cell per well in a 96-well plate. Cells were grown to confluence, replicated, and then cultured in the presence or absence of bumetanide. + (K +We tested NKCCl function using a thallium-sensitive fluorescent dye (another homolog of NKCCl). 83 K measured using the Rb absorption assay + Influx was reduced to baseline levels in NKCCl-KO HEK293 cells. In these cells, bumetanide no longer inhibited K + It had no effect on inflow.

[0339] [4.3 Detailed Flux Protocol] For flux experiments, 35 mm culture dishes were coated with 0.1 mg / mL poly-L-lysine and placed inside a larger 20 x 20 square dish. For convenience, poly-L-lysine was placed in the dishes the day before the experiment. Prior to plating the cells, the poly-L-lysine was aspirated, and each dish was washed twice with 1 mL of sterile water. Cells from three confluent 10 cm dishes were detached with trypsin and resuspended in 49 mL of complete medium. Cells (2 mL per 35 mm dish) were plated onto 24 dishes and allowed to attach for at least 2 hours prior to flux. This setup allowed for eight conditions to be measured in triplicate. For flux, the medium was aspirated and replaced with 1 mL of saline for a 15-minute preincubation period. The saline was aspirated and 0.25 μCi / mL of saline was added for 15 minutes. 83 The solution was replaced with 1 mL of the same saline solution containing Rb. After the absorption period, the radioactive solution was aspirated, and the cells were washed three times with ice-cold saline. Cells were then lysed with 500 μL of 0.25 N NaOH for 1 hour, neutralized with 250 μL of glacial acetic acid, and 300 μL and 30 μL aliquots were used for μ-scintillation counting and protein assay, respectively. Duplicate 5 μL of each flux solution was used to determine cpm, and these cpm were converted to nanomolar K. + Potassium influx was calculated as nanomoles K per mg of protein per minute. + Within one experiment, groups of three dishes were separated by 2 minutes for ease of handling. Protein content was measured from a subset of dishes because all dishes were identical and homogenous cell suspensions were plated on all dishes.

[0340] [4.4 Approach] Each compound was initially tested at 2 μM and 20 μM concentrations against NKCCl, always in experiments without drug (flux = 1000) or with 20 μM bumetanide (flux = 0). Many experiments also included 2 μM bumetanide, and under these conditions, flux was highly consistent (171 ± 21, n = 6).

[0341] Table 4. Inhibition of drugs on NKCCl at 2 μM and 20 μM. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10]

[0342] These compounds are active in inhibiting NKCCl.

[0343] [NKCCl-mediated flux inhibition rate] NKCCl-mediated flux inhibition rate ≥ 75%: ++++ 75%>NKCCl-mediated flux inhibition ≥ 50%: +++ 50%>NKCCl-mediated flux inhibition ≥30%:++ 30%>NKCCl-mediated flux inhibition ≥10%:+

[0344] Among the compounds of the present invention, there is a particularly interesting set of molecules, called Group 1, which exhibit an inhibition rate of 30% or more. Within this Class 1 set, there is a particularly interesting subset of molecules, called Group 2, with inhibitory rates of 50% or more. Within this Class 2 set, there is a particularly interesting subset of molecules, termed Group 3, with inhibition rates of 75% or greater.

[0345] 4.5 Dose-response of 51 and 57 to giant depolarization potentials (GDPs) in hippocampal CA3 pyramidal neurons 51 and 57 were tested to assess their basic neuronal intrinsic properties and excitability. Current-clamp whole-cell recordings were performed in CA3 pyramidal neurons in hippocampal slices from P14–15 mice using bipolar stimulating electrodes (Figure 2).

[0346] Table 5. GDP current density in the presence of compound 57 [Table 5]

[0347] Table 6. GDP current density (average) in the presence of compound 57 [Table 6]

[0348] As can be seen from Figure 3A and Figure 3C, compound 57 can block GDP in CA3 pyramidal neurons in the hippocampus.

[0349] Table 7. GDP current density in the presence of compound 51 [Table 7]

[0350] Table 8. GDP current density (average) in the presence of compound 51 [Table 8]

[0351] As can be seen from Figure 3B and Figure 3C, compound 51 can block GDP in CA3 pyramidal neurons in the hippocampus.

[0352] 4.5 Effects of 51 and 57 on seizure-like events (SLE) induced by tetanic stimulation of the stratum radiatum in the hippocampus. Using NKCCl inhibitors to block the activation of NKCCl resulted in [Cl - ] i can reduce excitatory GABA levels during epileptic seizures. A Therefore, the anticonvulsant effect of 51 on regulating GABA polarity in an acute seizure model was investigated. Seizure-like events in CA1 pyramidal neurons were induced by tetanic stimulation of the stratum radiatum in the hippocampus with 51 (Figure 4) and 57 (Figure 5). 51 (2 μM) significantly reduced the post-tetanic spike frequency to 0.27 ± 0.07 of control (n = 5, two-tailed, paired t-test, p = 5*e -4 ) Therefore, 51 is a GABA inhibitor in SLE. A 57 also potently inhibited GABA R-mediated depolarization in SLE (Fig. 6), demonstrating potent anticonvulsant activity. A It potently inhibited R-mediated depolarization (Fig. 7), demonstrating potent anticonvulsant activity.

[0353] [4.6 Conclusion] Biological results showed that the compounds of the present invention are inhibitors of NKCCl. A preferred set of compounds had inhibitory activity within the range of 10-95% inhibition at 20 μM. Another preferred set of compounds had inhibitory activity within the range of 30-95% inhibition. Among the former set, a preferred set of compounds had inhibitory activity within the range of 50-95% inhibition. Ultimately, a set of compounds having inhibitory activity of 70-95% inhibition is a preferred set.

Claims

1. A compound of formula (I): 【Chemical 1】 During the ceremony, Z represents: - the following groups: 【Chemistry 2】 In the formula, R １ is hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. and X represents: ○NR ５ R ６ group, in the formula, R ５ and R ６ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or ○NR ５ R ６ group, in the formula, R ５ and R ６ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, nitro, amino, hydroxy, an aryl ring or (C １ -C １０ ) optionally substituted with an acyl group; or ○ (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl group or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl groups, the group is optionally substituted with one or more deuterium, halogen atoms, (C1-C10)alkoxy groups, (C3-C10)cycloalkyl(C1-C10)alkoxy groups, or nitro; or - the following groups: 【Chemistry 3】 In the formula, R １０ and R １１ independently represent hydrogen and an aryl ring, an aryl ring and hydrogen, hydrogen and a heteroaryl ring, or a heteroaryl ring and hydrogen; The aryl and heteroaryl may be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; ・R ２Ａ and R ２Ｂ are independently hydrogen, (C １ -C １０ ) alkyl group, (C １１ -C １２ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a heterocycloalkyl group, nitro, amino, hydroxy, or NR ７ R ８ optionally substituted with or R ２Ａ and R ２Ｂ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; ・R ４ represents a phenyl ring, and is substituted with one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , or (C １ -C １０ ) optionally substituted with an acylamino group; ・R ９ represents: The following groups: 【Chemistry 4】 In the formula, R ３ is OH, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group, or The following groups: 【Chemistry 5】 In the formula, R １２ and R １３ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkoxy group, aryl ring or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, and may include one or more deuterium atoms, halogen atoms, amino, hydroxy, (C １ -C １０ ) alkoxy group, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbonylamino groups; or ○ The following ring: 【Chemistry 6】 or ○ The following ring: 【Chemistry 7】 ・R ７ and R ８ are independently １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, or R ７ and R ８ C, which together with the nitrogen atom bearing it, optionally contains 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; ３ -C １２ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; The alkyl ring is linear or branched, The aryl ring is a six-membered aromatic carbocyclic ring, The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. a compound, or a pharmaceutically acceptable salt of said compound, The isomers thereof, in particular in pure form, diastereomers, epimers and enantiomers, or mixtures of said isomers, diastereomers, epimers and enantiomers.

2. 10. The compound of claim 1 of formula (II): 【Chemistry 8】 In the formula, R １ , R ２Ａ , R ２Ｂ , R ４ , R ５ , R ６ and R ９ has the meaning defined in claim 1.

3. 10. The compound of claim 1 of formula (III): 【Chemistry 9】 In the formula, R １ , R ２Ａ , R ２Ｂ , R ４ , and R ９ has the meaning defined in claim 1, And X is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl group or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) a compound optionally substituted with an alkoxy group or nitro.

4. 10. The compound of claim 1 of formula (IV): 【Chemistry 10】 In the formula, R ２Ａ , R ２Ｂ , R ４ , R ９ , R １０ and R １１ has the meaning defined in claim 1.

5. A compound according to claim 1 or 4 of formula (IV): 【Chemistry 11】 In the formula, R ４ , R ９ , R １０ and R １１ has the meaning defined in claim 1, And R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl, or (C １ -C １０ ) alkyl and hydrogen, compounds.

6. A compound according to any one of claims 1 to 5 of formula (V): 【Chemistry 12】 In the formula, Z, R ２Ａ , R ２Ｂ , and R ４ has the meaning defined in claim 1.

7. A compound according to any one of claims 1 to 5 of formula (VI): 【Chemistry 13】 In the formula, Z, R ２Ａ , R ２Ｂ , and R ４ has the meaning defined in claim 1, R ３ has the meaning defined in claim 1 but is different from OH.

8. A compound according to any one of claims 1 to 5 of formula (VII): 【Chemistry 14】 In the formula, Z, R ２Ａ , R ２Ｂ , R ４ , R １２ and R １３ has the meaning defined in claim 1.

9. A compound according to any one of claims 1 to 5, selected from the following compounds: a compound of formula (VIII): 【Chemistry 15】 In the formula, Z, R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1, or a compound of formula (IX): 【Chemistry 16】 In the formula, Z, R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1.

10. A compound according to any one of claims 1 to 9 of formula (X): 【Chemistry 17】 In the formula, Z, R ２Ａ , R ２Ｂ and R ９ has the meaning defined in claim 1, And R ４ represents a phenyl ring, and one or more halogen atoms, (C １ -C １０ ) alkyl group, or (C １ -C １０ ) a compound optionally substituted with an alkoxy group.

11. A compound according to any one of claims 1 to 10 of formula (XI): 【Chemistry 18】 In the formula, Z, R ４ and R ９ has the meaning defined in claim 1, And R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkyl group and hydrogen, hydrogen and (C １１ -C １２ ) alkyl group, or (C １１ -C １２ ) represents an alkyl group and hydrogen; Said (C １ -C １０ ) alkyl group is one or more halogen atoms or (C １ -C １０ ) a compound optionally substituted with an alkoxy group.

12. A compound according to any one of claims 1 to 2 or 6 of formula (XII): 【Chemistry 19】 In the formula, R １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined in claim 1.

13. A compound according to any one of claims 1 to 2 or 7 of formula (XIII): 【Chemistry 20】 In the formula, R １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined in claim 1, R ３ has the meaning defined in claim 1 but is different from OH.

14. A compound according to any one of claims 1, 3 or 6 of formula (XIV): 【Chemical 21】 In the formula, R １ , R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1, And X is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl group or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) a compound optionally substituted with an alkoxy group or nitro.

15. 10. A compound according to any one of claims 1, 3 or 7 of formula (XV): 【Chemical 22】 In the formula, R １ , R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1, R ３ has the meaning defined in claim 1 but is different from OH, X is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl group or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) a compound optionally substituted with an alkoxy group or nitro.

16. 10. A compound according to any one of claims 1, 3 or 9, selected from the following compounds: a compound of formula (XVI): 【Chemical 23】 In the formula, R １ , R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1, And X is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl group or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with an alkoxy group or nitro; or a compound of formula (XVII): 【Chemistry 24】 In the formula, R １ , R ２Ａ , R ２Ｂ and R ４ has the meaning defined in claim 1 and X has the meaning defined above.

17. A compound according to any one of claims 1, 4, 5 or 6 of formula (XVIII): 【Chemistry 25】 In the formula, R ２Ａ , R ２Ｂ , R ４ , R １０ and R １１ has the meaning defined in claim 1.

18. 10. A compound according to any one of claims 1, 4, 5 or 7 of formula (XIX): 【Chemical formula 26】 In the formula, R ２Ａ , R ２Ｂ , R ４ , R １０ and R １１ has the meaning defined in claim 1, R ３ has the meaning defined in claim 1 but is different from OH.

19. 10. A compound according to any one of claims 1, 4, 5 or 8 of formula (XX): 【Chemical 27】 In the formula, R ２Ａ , R ２Ｂ , R ４ , R １０ , R １１ , R １２ and R １３ has the meaning defined in claim 1.

20. 10. A compound according to any one of claims 1, 4, 5 or 9, selected from the following compounds: a compound of formula (XXI): [Chemical Formula 28] In the formula, R ２Ａ , R ２Ｂ , R ４ , R １０ and R １１ has the meaning defined in claim 1, or a compound of formula (XXII): 【Chemical 29】 In the formula, R ２Ａ , R ２Ｂ , R ４ , R １０ and R １１ has the meaning defined in claim 1.

21. A compound according to any one of claims 1, 2, 6 or 12 of formula (XXIII): 【Chemistry 30】 During the ceremony, Z represents: - the following groups: 【Chemical 31】 In the formula, R １ is a hydrogen atom, (C １ -C １０ ) represents an alkyl group or an aryl ring; and X represents: ○NR ５ R ６ group, in the formula, R ５ and R ６ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, or heteroaryl (C １ -C １０ ) alkyl group, The group may be one or more halogen atoms, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C １ -C １０ ) an acyl group, or (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or ○NR ５ R ６ group, in the formula, R ５ and R ６ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more halogen atoms, (C １ -C １０ ) alkyl group, or (C １ -C １０ ) optionally substituted with an acyl group; ・R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkyl group and hydrogen, or (C １ -C １０ ) alkyl group and (C １ -C １０ ) represents an alkyl group, ・R ４ represents a phenyl ring, compound.

22. 15. A compound according to any one of claims 1, 3, 6 or 14 of formula (XXIV): 【Chemical 32】 During the ceremony, Z represents the following group: 【Chemical 33】 In the formula, R １ is a hydrogen atom, (C １ -C １０ ) alkyl group or aryl ring, and X is (C １ -C １０ ) represents an alkyl group, ・R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkyl group and hydrogen, or (C １ -C １０ ) alkyl group and (C １ -C １０ ) represents an alkyl group, ・R ４ represents a phenyl ring, compound.

23. 20. A compound according to any one of claims 1, 4, 6 or 17 of formula (XXV): 【Chemical 34】 During the ceremony, Z represents the following group: 【Chemistry 35】 In the formula, R １０ and R １１ independently represent hydrogen and an aryl ring, or an aryl ring and hydrogen; ・R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkyl group and hydrogen, or (C １ -C １０ ) alkyl group and (C １ -C １０ ) represents an alkyl group, ・R ４ represents a phenyl ring, compound.

24. 1. A compound according to claim 1 of formula (I): 【Chemical 36】 During the ceremony, Z represents: - the following groups: 【Chemical 37】 In the formula, R １ is a hydrogen atom, (C １ -C １０ ) represents an alkyl group or an aryl ring; and X represents: ○NR ５ R ６ group, in the formula, R ５ and R ６ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, or heteroaryl (C １ -C １０ ) alkyl group, The group may be one or more halogen atoms, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C １ -C １０ ) an acyl group, or (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or ○NR ５ R ６ group, in the formula, R ５ and R ６ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more halogen atoms, (C １ -C １０ ) alkyl group or (C １ -C １０ ) optionally substituted with an acyl group; or ○ (C １ -C １０ ) alkyl groups, or - the following groups: 【Chemical Formula 38】 In the formula, R １０ and R １１ independently represent hydrogen and an aryl ring, or an aryl ring and hydrogen; ・R ２Ａ and R ２Ｂ are independently hydrogen and (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkyl group and hydrogen, or (C １ -C １０ ) alkyl group and (C １ -C １０ ) represents an alkyl group, ・R ４ represents a phenyl ring, ・R ９ Below: The following groups: 【Chemical 39】 In the formula, R ３ is (C １ -C １０ ) represents an alkoxy group, or The following groups: 【Chemistry 40】 In the formula, R １２ and R １３ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkoxy group, and one or more halogen atoms or (C １ -C １０ ) optionally substituted with an alkoxy group; or ○ The following ring: 【Chemistry 41】 or ○ The following ring: 【Chemistry 42】 Represents a compound.

25. The compound of claim 1 having a formula selected from the following compounds: methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoate (compound 1), methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoate (compound 2), methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (compound 3), methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (compound 4), methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 5), methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoate (compound 6), methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (compound 7), methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (compound 8), methyl 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoate (compound 9), methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoate (compound 10), methyl 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (compound 11), methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoate (compound 12), methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoate (compound 13), methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxy-benzoate (compound 14), methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoate (compound 15), methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoate (compound 16), methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoate (compound 17), methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (compound 18), methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxy-benzoate (compound 19), methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoate (compound 20), methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 21), methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (compound 22), methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 23), methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoate (compound 24), methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (compound 25), methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (compound 26), methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (compound 27), methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoate (compound 28), methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (compound 29), methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 30), methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (compound 31), methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (compound 32), methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (compound 33), methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (compound 34), methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 35), methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (compound 36), methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (compound 37), methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (compound 38), methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (compound 39), methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (compound 40), methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (compound 41), methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 42), methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (compound 43), methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (compound 44), methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (compound 45), methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoate (compound 46), methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (compound 47), methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (compound 48), methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (compound 49), methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (compound 50), 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoic acid (compound 51), 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoic acid (compound 52), 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (compound 53), 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (compound 54), 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 55), 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoic acid (compound 56), 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (compound 57), 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 58), 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 59), 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 60), 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (compound 61), 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 62), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (compound 63), 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (compound 64), 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 65), 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (compound 66), 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 67), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (compound 68), 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 69), 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 70), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 71), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 72), 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (compound 73), 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 74), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (compound 75), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (compound 76), 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 77), 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (compound 78), 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 79), 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (compound 80), 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (compound 81), 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 82), 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (compound 83), 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (compound 84), 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (compound 85), 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (compound 86), 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 87), 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (compound 88), 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (compound 89), 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (compound 90), 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (compound 91), 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 92), 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (compound 93), 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoic acid (compound 94), 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxybenzoic acid (compound 95), 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (compound 96), 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 97), methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (compound 98), methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (compound 99), 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (compound 100), 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (compound 101), 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (compound 102), 3-(butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzamide (compound 103), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy-benzamide (compound 104), 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (compound 105), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (compound 106), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxy-benzamide (compound 107), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (compound 108), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 109), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (compound 110), 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (compound 111), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (compound 112), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (compound 113), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 114), 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (compound 115), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy-benzamide (compound 116), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy-benzamide (compound 117), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4-phenoxy-benzamide (compound 118), 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (compound 119), 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (compound 120), 3-(butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (compound 121), 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (compound 122), 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2-trifluoroethyl)benzamide (compound 123), methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (compound 124), 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (compound 125), 3-(butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (compound 126), 3-(butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenyl-benzenesulfonamide (compound 127), methyl 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoate (compound 128), methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoate (compound 129), 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 130), 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoic acid (compound 131), methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (compound 132), methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (compound 133), 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (compound 134), N-butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (compound 135).

26. A method for preparing a compound of formula (II) according to claim 2, comprising: 【Chemistry 43】 During the ceremony, -R ５ and R ６ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. or -R ５ and R ６ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, a combination of these forms, or fused with an aryl ring; optionally containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, nitro, amino, hydroxy, an aryl ring or (C １ -C １０ ) optionally substituted with an acyl group; -R １ is hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; ・R ２Ａ and R ２Ｂ are independently hydrogen, (C １ -C １０ ) alkyl group, (C １１ -C １２ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, nitro, amino, hydroxy or NR ７ R ８ optionally substituted with or R ２Ａ and R ２Ｂ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; ・R ４ represents a phenyl ring, and one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , or (C １ -C １０ ) optionally substituted with an acylamino group; ・R ９ represents: - the following groups: 【Chemical 44】 In the formula, R ３ But, OH, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group, or - the following groups: 【Chemistry 45】 In the formula, R １２ and R １３ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkoxy group, aryl ring or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, and may include one or more deuterium atoms, halogen atoms, amino, hydroxy, (C １ -C １０ ) alkoxy group, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbonylamino groups; ・R ７ and R ８ are independently １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, or R ７ and R ８ C, which together with the nitrogen atom bearing it, optionally contains 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; ３ -C １２ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) silylation of a compound of formula (XXVI) with a compound of formula (XXVII) to obtain a compound of formula (XVIII): 【Chemistry 46】 In the formula, R ２Ａ , R ２Ｂ and R ４ has the meaning defined above, and GP １ is a protecting group, particularly (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group; In the formula, R ７ and R ８ has the meaning defined above, 【Chemistry 47】 In the formula, R １４ , R １５ , R １６ independently represent a methyl group, an ethyl group, an isopropyl group, a butyl group, a tert-butyl group or an aromatic group; 【Chemistry 48】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ , R １４ , R １５ and R １６ has the meaning defined above, b) reacting the following groups to obtain a compound of formula (XXIX): 【Chemistry 49】 by replacing one of the oxygen atoms with the group 【Chemistry 50】 by dichlorotriphenylphosphorane or PPh ３ and (CCl ３ ) ２ and HNR ５ R ６ (In the formula, R ５ and R ６ has the meaning defined above), 【Chemistry 51】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ , R ５ , R ６ , R １４ , R １５ and R １６ has the meaning defined above, c) deprotection of the silyl function of said compound (XXIX), in particular with acidic acetonitrile, to obtain a compound of formula (XXX): 【Chemistry 52】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined above, The compound is R ９ = the following group: 【Chemistry 53】 , R ３ =GP １ , and R １ =H, the compound is of formula (II), And, in some cases, d) in particular Cu(OAc) to obtain compounds of formula (XXXI) ２ R in the compound of formula (XXX) １ R represents an aryl ring or a heteroaryl ring １ -B(OH) ２ Addition of The aryl or heteroaryl ring may be one or more of a deuterium atom, a halogen atom, a (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. 【Chemical 54】 During the ceremony, G.P. １ , R １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined above, The compound is R ９ = the following group: 【Chemistry 55】 And R ３ =GP １ is a compound of formula (II): or Addition of formaldehyde in the compound of formula (XXX) to obtain a compound of formula (XXXI) as follows: 【Chemical Formula 56】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined above, and R １ represents a methyl group, The compound is R ９ = the following group: 【Chemical Formula 57】 And R ３ =GP １ is a compound of formula (II): or in particular K to obtain compounds of formula (XXXI) ２ CO ３ , KH or NaH in the compound of formula (XXX), １ -C １０ ) alkyl-Br group, (C ３ -C １０ ) cycloalkyl-Br group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl-Br group, (C ３ -C １０ ) heterocycloalkyl-Br group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl-Br group, aryl (C １ -C １０ ) alkyl-Br group, aryl (C １ -C １０ ) alkoxy-Br group, aryl (C ３ -C １０ ) cycloalkyl-Br group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl-Br group, heteroaryl (C １ -C １０ ) alkyl-Br group, heteroaryl (C ３ -C １０ ) cycloalkyl-Br group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) the addition of an alkyl-Br group; The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above can be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms. 【Chemistry 58】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ , R ５ and R ６ has the meaning defined above, R １ is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; The compound is R ９ = the following group: 【Chemical Formula 59】 And R ３ =GP １ is a compound of formula (II): And, in some cases, e) a compound of formula (II) ９ is the following group: 【Chemistry 60】 and R ３ saponification of the compounds of formula (XXX) or (XXXI), in particular with LiOH, NaOH or KOH, to give And, in some cases, f) HNR １２ R １３ (In the formula, R １２ , R １３ has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluronium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, to prepare one of the compounds of formula (II) ９ is the following group: 【Hua 61】 and R ３ is OH) to give a compound of formula (II), ９ is the following group: 【Hua 62】 ) and The alkyl group is linear or branched, the aryl ring is a 6-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Manufacturing method.

27. 4. A method for preparing a compound of formula (III) according to claim 3, comprising: 【Chemistry 63】 During the ceremony, ・X is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, or aryl (C １ -C １０ ) represents an alkyl group, in particular a benzyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with an alkoxy group or nitro; ・R １ is hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl ring, heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; ・R ２Ａ and R ２Ｂ are independently hydrogen, (C １ -C １０ ) alkyl group, (C １１ -C １２ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, nitro, amino, hydroxy or NR ７ R ８ optionally substituted with or R ２Ａ and R ２Ｂ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; ・R ４ represents a phenyl ring, and is substituted with one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , or (C １ -C １０ ) optionally substituted with an acylamino group; ・R ９ represents: - the following groups: 【Hua 64】 In the formula, R ３ is OH, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group, or - the following groups: 【Chemistry 65】 In the formula, R １２ and R １３ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkoxy group, aryl ring or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, and may include one or more deuterium atoms, halogen atoms, amino, hydroxy, (C １ -C １０ ) alkoxy group, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbonylamino groups; or - the following rings: 【Hua 66】 ・R ７ and R ８ are independently １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, or R ７ and R ８ C, which together with the nitrogen atom bearing it, optionally contains 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; ３ -C １２ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) the reaction of a compound of formula (XXXII) below, in particular PPh, to obtain a compound of formula (XXXIII) below ３ or SnCl ２ or reduction with zinc powder: 【Hua 67】 wherein Y represents fluorine, chlorine or bromine; 【Chemistry 68】 wherein Y has the meaning defined above. b) Reacting the X group and GP in the compound of formula (XXXIII) to obtain a compound of formula (XXXIV) １ Addition of groups, in particular the addition of: In particular X—Z and bases, in particular iodomethane and Cs ２ CO ３ or K ２ CO ３ X-Z and Gp １ -Addition of Z, - a first step using in particular X-Z and an aqueous base, in particular MeI and aqueous NaOH, followed by a coupling reagent and Gp １ -OH, especially Gp １ 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in —OH, or alcohols and acids, especially Gp １ X-Z and Gp with -OH and sulfuric acid １ Addition of —OH, - in particular alcohols and acids, especially Gp １ A first step using -OH and sulfuric acid, particularly methanol and sulfuric acid, followed by a second step using X-Z and a base, particularly MeI and Cs ２ CO ３ or K ２ CO ３ X-Z and Gp １ Addition of —OH, where Z represents bromine or iodine and X has the meaning defined above: 【Chemical Formula 69】 In the formula, Y, GP １ and X has the meaning defined above. c) reacting R ４ -OH (where R ４ has the meaning defined above), in particular K ２ CO ３ or Cs ２ CO ３ Aromatic nucleophilic substitution of compound (XXXIV) with NaOMe, triethylamine, N,N-diisopropylethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene: 【Chemistry 70】 During the ceremony, G.P. １ , X and R ４ has the meaning defined above, d) oxidation of compounds of formula (XXXV) using, in particular, (diacetoxyiodo)benzene and an ammonium donor such as ammonium carbamate, ammonium carbonate, ammonia or ammonium acetate to obtain compounds of formula (XXXVI): 【Chemical Formula 71】 During the ceremony, G.P. １ , X and R ４ has the meaning defined above, e) FeCl in particular in aqueous palladium and hydrogen or ammonium chloride solution ２ , ZnCl ２ or SnCl ２ Reduction of the compound of formula (XXXVI) with 【Chemical Formula 72】 During the ceremony, G.P. １ , X and R ４ has the meaning defined above, f) a compound of formula (XXXVIII) or (XXXIX) and a reducing agent, in particular NaBH(OAc) ３ or NaBH ３ Reductive amination of the compound of formula (XXXVII) by addition of CN: (XXXVIII) is the following group: 【Chemical 73】 and (XXXIX) is the following group: 【Chemical 74】 and In the ceremony, T ２Ａ and T ２Ｂ are independently hydrogen, (C １ -C ９ ) alkyl group, (C １０ -C １１ ) represents an alkyl group, Optionally, one or more deuterium atoms, halogen atoms, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a heterocycloalkyl group, nitro, amino, hydroxy, or NR ７ R ８ has been replaced by or a compound of formula (XL) or (XLI) or a compound of formula (XL) and (XLI) with a base, in particular Cs, to obtain a compound of formula (XLII) ２ CO ３ or K ２ CO ３ , by adding (XL) is R ２Ａ -Hal, (XLI) is R ２Ｂ -Hal, where Hal represents chlorine or bromine. Alkylation of the compound of formula (XXXVII): 【Chemistry 75】 During the ceremony, G.P. １ , R ４ and X has the meaning defined above, R ２Ａ , R ２Ｂ is hydrogen, (C １ -C １０ ) alkyl group, (C １１ -C １２ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a heterocycloalkyl group, nitro, amino, hydroxy, or NR ７ R ８ optionally substituted with or Arylation of compounds of formula (XLIII) or (XLIV), or of compounds of formulae (XLIII) and (XLIV), in particular of compounds of formula (XXXVII), by adding a catalyst selected in particular from among copper(II) acetate, palladium diacetate, tris(dibenzylideneacetone)dipalladium(0) or palladium(II)[1,1′-bis(diphenylphosphanyl)ferrocene]dichloride, in particular with palladium or copper catalysis: (XLIII) is R ２Ａ -M, (XLIV) is R ２Ｂ -M, Here, R ２Ａ and R ２Ｂ are independently an aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, nitro, amino, hydroxy or NR ７ R ８ and optionally substituted with where M is chlorine or bromine or one of the following groups: 【Chemical 76】 represents In the formula, Mx １ and Mx ２ are independently hydrogen or (C １ -C ６ ) represents an alkyl group, Mx １ and Mx ２ can be linked by a covalent bond, or - nucleophilic aromatic substitution of compounds of formula (XXXVII) with compounds of formula (XLV) and (XLVI) and the addition of a base, in particular triethylamine, to obtain compounds of formula (XLII): (XLV) is R ２Ａ -F, (XLVI) is R ２Ｂ -F, 【Chemical 77】 During the ceremony, G.P. １ , R ４ and X has the meaning defined above, R ２Ａ , R ２Ｂ are independently hydrogen, an aryl ring or a heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, nitro, amino, hydroxy or NR ７ R ８ optionally substituted with or a compound of formula (XLVIII) below and a base, in particular Cs, to obtain a compound of formula (XLIX) below ２ CO ３ , K. ２ CO ３ or by the addition of triethylamine, double alkylation of the compound of formula (XXXVII): 【Chemical 78】 wherein Hal represents chlorine or bromine and n is a positive integer from 4 to 10. 【Chemical 79】 During the ceremony, G.P. １ , R ４ and X has the meaning defined above, R ２Ａ and R ２Ｂ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; The compound of formula (XLII) or (XLIX) is R ９ = the following group: 【Chemistry 80】 , R ３ =GP １ And R １ =H, the compound is of formula (III): And, in some cases, g) in particular Cu(OAc) to obtain compounds of formula (L) ２ to one of the compounds of formula (XLII) or (XLIX) using １ R represents an aryl ring or a heteroaryl ring １ -B(OH) ２ The addition of The aryl or heteroaryl ring may be one or more of a deuterium atom, a halogen atom, a (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The above cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, including: 【Chemistry 81】 During the ceremony, G.P. １ , R １ , R ２Ａ , R ２Ｂ , R ４ and X has the meaning defined above, The compound is R ９ = the following group: 【Chemistry 82】 And R ３ =GP １ is a compound of formula (III): or Addition of formaldehyde in one of the compounds of formula (XLII) or (XLIX) to obtain a compound of formula (L) below: 【Chemistry 83】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ and X has the meaning defined above, R １ represents a methyl group, The compound is R ９ = the following group: 【Chemistry 84】 And R ３ =GP １ is a compound of formula (III): or in particular K to obtain compounds of formula (L) ２ CO ３ , KH or NaH in one of the compounds of formula (XLII) or (XLIX), １ -C １０ ) alkyl-Br group, (C ３ -C １０ ) cycloalkyl-Br group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl-Br group, (C ３ -C １０ ) heterocycloalkyl-Br group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl-Br group, aryl (C １ -C １０ ) alkyl-Br group, aryl (C １ -C １０ ) alkoxy-Br group, aryl (C ３ -C １０ ) cycloalkyl-Br group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl-Br group, heteroaryl (C １ -C １０ ) alkyl-Br group, heteroaryl (C ３ -C １０ ) cycloalkyl-Br group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) the addition of an alkyl-Br group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The above cycloalkyl and heterocycloalkyl may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, including: 【Chemistry 85】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ , R ４ and X has the meaning defined above, and R １ is (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkyl group, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkyl group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, The group may be one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acyl group, (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; The cycloalkyl and heterocycloalkyl groups mentioned above may be monocyclic or polycyclic, spiro, fused, bridgehead, or combinations of these forms; The compound is R ９ = the following group: 【Chemistry 86】 And R ３ =GP １ is a compound of formula (III): And, in some cases, h) R ９ is the following group: 【Hua 87】 and R ３ saponification of one of the compounds of formula (XLII), (XLIX) or (L), in particular with LiOH, NaOH or KOH, to obtain said compound of formula (III), wherein is OH, And, in some cases, i) HNR １２ R １３ (where R １２ and R １３ has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, ９ is the following group: 【Hua 88】 and R ３ is OH, by amidating the compound of formula (III) to form R ９ is the following group: 【Chemistry 89】 obtaining a compound of formula (III) which represents Or after step h), j) the synthesis of R 2 , in particular with 1,1′-carbonyldiimidazole and aqueous ammonia (amidation), followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide, or phosphorus pentoxide in methanol, chloroform, or toluene (dehydration), followed by sodium azide and ammonium chloride (cyclization) ９ is the following group: 【Chemistry 90】 and R ３ is OH, the compound of formula (III) is amidated, followed by dehydration, followed by cyclization to give R ９ is the ring: 【Chemistry 91】 obtaining a compound of formula (III) (sulfoximine tetrazole) which represents The alkyl group is linear or branched, the aryl ring is a 6-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Manufacturing method.

28. A method for preparing a compound of formula (IV) according to claim 4, comprising: 【Chemistry 92】 During the ceremony, ・R １０ and R １１ independently represent hydrogen and aryl, or aryl and hydrogen; The aryl may be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkylcarbonylamino group, an arylcarbonylamino group, a heteroarylcarbonylamino group, (C １ -C １０ ) alkylcarbamoyl group, (C ３ -C １０ ) a cycloalkylcarbamoyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbamoyl groups; ・R ２Ａ and R ２Ｂ are independently hydrogen, (C １ -C １０ ) alkyl group, (C １１ -C １２ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, aryl or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group or heteroaryl (C ３ -C １０ ) represents a cycloalkyl group; The above alkyl and aryl may each be one or more of deuterium, halogen, (C ３ -C １０ ) a cycloalkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a heterocycloalkyl group, nitro, amino, hydroxy, or NR ７ R ８ optionally substituted with or R ２Ａ and R ２Ｂ C, which together with the nitrogen atom bearing them, optionally contain one or more heteroatoms selected from nitrogen, sulfur and oxygen, ４ -C １０ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; ・R ４ represents a phenyl ring, and is substituted with one or more deuterium atoms, halogen atoms, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, nitro, amino, hydroxy, NR ７ R ８ , or (C １ -C １０ ) optionally substituted with an acylamino group; ・R ９ represents: The following groups: 【Chemistry 93】 In the formula, R ３ is OH, (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group, or The following groups: 【Chemistry 94】 In the formula, R １２ and R １３ are independently hydrogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C ３ -C １０ ) heterocycloalkyl group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) alkoxy group, aryl ring or heteroaryl ring, aryl (C １ -C １０ ) alkyl group, aryl (C ３ -C １０ ) cycloalkyl group, heteroaryl (C １ -C １０ ) alkyl group, heteroaryl (C ３ -C １０ ) cycloalkyl group, and may include one or more deuterium atoms, halogen atoms, amino, hydroxy, (C １ -C １０ ) alkoxy group, NR ７ R ８ , (C １ -C １０ ) acylamino group, (C ３ -C １０ ) a cycloalkylcarbonylamino group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) optionally substituted with alkylcarbonylamino groups; or ○ The following ring: 【Chemistry 95】 or The following ring: 【Chemistry 96】 ・R ７ and R ８ are independently １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, or (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkyl group, or R ７ and R ８ C, which together with the nitrogen atom bearing it, optionally contains 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen; ３ -C １２ forming a membered heterocyclic ring, The heterocycle may be monocyclic or polycyclic, spiro, fused, bridgehead, or a combination of these forms, and may contain one or more deuterium, halogen, (C １ -C １０ ) alkyl group, (C ３ -C １０ ) a cycloalkyl group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkyl group, (C １ -C １０ ) an alkoxy group, or (C ３ -C １０ ) optionally substituted with a heterocycloalkyl group; It includes the following steps: a) addition of a Ph-Hal group, where Hal represents bromine or iodine, in a compound of formula (LI) below, using in particular CuI, N,N'-dimethylethylenediamine and potassium carbonate, to obtain a compound of formula (LIII) below: 【Chemistry 97】 In the formula, R ２Ａ , R ２Ｂ and R ４ has the meaning defined above, and GP １ is a protecting group, particularly (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) a cycloalkoxy group, (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) an alkoxy group, (C ３ -C １０ ) heterocycloalkyl (C １ -C １０ ) alkoxy groups, containing 1 to 3 alkenyl functional groups (C ２ -C １０ ) alkenyloxy groups, containing 1 to 3 alkynyl functional groups (C ２ -C １０ ) alkynyloxy group, O-aryl ring, O-heteroaryl ring, aryl (C １ -C １０ ) alkoxy group, aryl (C ３ -C １０ ) cycloalkoxy group, aryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) alkoxy group, heteroaryl (C １ -C １０ ) alkoxy group, heteroaryl (C ３ -C １０ ) cycloalkoxy group, or heteroaryl (C ３ -C １０ ) cycloalkyl (C １ -C １０ ) represents an alkoxy group, 【Chemistry 98】 During the ceremony, G.P. １ , R ２Ａ , R ２Ｂ and R ４ has the meaning defined above, The compound is R ９ = the following group: 【Hua99】 And R ３ =GP １ is a compound of formula (IV): And, in some cases, b) R ９ = the following group: 【Chemistry 100】 And R ３ Saponification of the compound of formula (LIII), in particular with LiOH, NaOH or KOH, to obtain the compound of formula (IV), where =OH: And, in some cases, c) R 1 with, in particular, 1,1′-carbonyldiimidazole and aqueous ammonia (amidation), followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide, or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), to give compounds of formula (LIV) ９ = the following group: 【Chemistry 101】 And R ３ amidation of said compound of formula (IV), wherein =OH, followed by a dehydration step: 【Chemistry 102】 In the formula, R ２Ａ , R ２Ｂ and R ４ has the meaning defined above, and, ○ d) R ９ is the ring: 【Chemistry 103】 cyclization of said compound of formula (LIV), in particular with sodium azide and ammonium chloride, to give a compound of formula (IV) which represents or ○ d') R ９ is the ring: 【Chemistry 104】 in particular hydroxylammonium chloride and NaHCO to obtain compounds of formula (IV), ３ (addition of HO-NH) to the compound of formula (LIV) followed by a cyclization step using 1,1'-carbonyldiimidazole and 1,8-diazabicyclo[5.4.0]undec-7-ene (cyclization); Or after step b), c) HNR １２ R １３ (where R １２ and R １３ has the meaning defined above), in particular N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyluranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, ９ is the following group: 【Chemistry 105】 and R ３ represents OH, by amidating the compound of formula (IV) to form R ９ is the following group: 【Chemistry 106】 obtaining a compound of formula (IV) which represents The alkyl group is linear or branched, the aryl ring is a 6-membered aromatic carbocyclic ring; The heteroaryl ring is a 5- or 6-membered aromatic ring containing at least one heteroatom selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Manufacturing method.

29. A compound according to any one of claims 1 to 25 for use as a medicament.

30. A pharmaceutical composition comprising a compound according to any one of claims 1 to 25 as an active substance, and a pharmaceutically acceptable excipient.

31. 31. Pharmaceutical composition according to claim 30, in unit form, containing from 0.033 mg to 200 mg of active substance (for a person weighing 70 kg).

32. 32. The pharmaceutical composition of claim 31, formulated to administer the active agent in the range of 0.00047 mg to 2.86 mg per kg of body weight.

33. A compound according to any one of claims 1 to 25 for use in the prevention or treatment of a pathology associated with dysfunction of the inhibition of the NKCCl transporter.

34. Cancer, especially glioblastoma, pancreatic cancer, prostate cancer, lung cancer, kidney cancer, colon cancer, brain disorders, neurodegenerative diseases or psychiatric disorders, especially schizophrenia, autism spectrum disorders, fragile X syndrome, Rett syndrome, Down syndrome, Parkinson's disease, inhibition deficiency and hyper(Cl) with a shift towards GABA-mediated excitation － ) ｉ 26. A compound according to any one of claims 1 to 25 for use in the prophylaxis or treatment of one of the conditions associated with partial or generalised seizures, temporal lobe epilepsy, epilepsy including childhood epilepsy or inflammatory conditions which have been shown to be associated with levels of inflammatory cytokines.

Images