Cytotoxic necrotic factor as an exogenous carrier in mammalian cells.

A CPP derived from bacterial virulence factors addresses the challenge of endosomal cargo degradation by enabling direct cytoplasmic delivery, improving the efficiency of intracellular molecule delivery.

JP2025535146APending Publication Date: 2025-10-22SE THERAPEUTICS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025521453
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-13
Filing Date
2023-09-19
Publication Date
2025-10-22

AI Technical Summary

Technical Problem

Existing methods for intracellular delivery of molecules face challenges such as cargo modification or destruction in endosomal pathways, making it difficult to efficiently deliver therapeutic agents to the cytoplasm of mammalian cells.

Method used

Utilizing a cell-penetrating polypeptide (CPP) derived from bacterial virulence factors like CNF, which lacks the catalytic domain, to facilitate endosomal escape and deliver molecules of interest directly to the cytoplasm.

Benefits of technology

The CPP effectively delivers intact and functional molecules to the cytoplasm, bypassing endosomal degradation, thereby enhancing the efficiency of intracellular delivery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025535146000007
    Figure 2025535146000007
  • Figure 2025535146000008
    Figure 2025535146000008
  • Figure 2025535146000009
    Figure 2025535146000009
Patent Text Reader

Abstract

The present invention relates to a cell-penetrating polypeptide (CPP) comprising an amino acid sequence derived from or consisting of a portion of a pathogenic factor, as well as a complex comprising the CPP, a polynucleotide encoding the CPP or complex, an expression vector encoding the CPP or complex, and a cell comprising the same. The present invention also relates to a method for introducing or delivering a molecule of interest into a cell using the CPP, and the use of the CPP for preventing or treating a disease.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a cell-penetrating polypeptide (CPP) comprising an amino acid sequence derived from or consisting of a portion of a pathogenic factor, as well as a complex comprising the CPP, a polynucleotide encoding the CPP or complex, an expression vector encoding the CPP or complex, and a cell comprising the same. The present invention also relates to a method for introducing or delivering a molecule of interest into a cell using the CPP, and a CPP for use as a pharmaceutical for preventing or treating a disease. [Background technology]

[0002] Pathogenic bacteria can invade host cells through various mechanisms. For example, some pathogens use toxins-like virulence factors to invade target cells, such as uropathogenic Escherichia coli (uropathogenic Escherichia coli) that utilize cytotoxic necrotizing factor 1 (CNF1). In addition to CNF1, E. coli also expresses CNF1 homologs, such as cytotoxic necrotizing factor 2 (CNF2) and cytotoxic necrotizing factor 3 (CNF3). CNF1, CNF2, and CNF3 are members of the CNF family, and numerous CNF factors have been isolated from diverse bacteria, such as Yersinia, Salmonella, and Bordella. These bacterial virulence factors contain Rho GTPase activation domains and regulate the actin cytoskeleton dynamics of the invaded cells, thereby promoting bacterial invasion and infection.

[0003] CNF enters target mammalian cells by endocytosis after binding to cell membrane receptors. Acidification of the endosomal compartment induces a conformational change in CNF, allowing its catalytic domain (Rho GTPase activation domain) to cross the endosomal membrane and reach the cytoplasm.

[0004] In vitro intracellular delivery of proteins and other molecules is achieved using electroporation or chemicals that permeabilize the cell membrane. However, penetration of the cell membrane remains a hurdle for therapeutic use. Furthermore, targeting drugs or peptides to specific receptors using antibodies or receptor-binding proteins often results in endocytosis of the drug followed by targeting to highly acidic compartments such as lysosomal vesicles for containment in endosomes, extracellular recycling, or destruction. Therefore, there remains a need for simple carriers that can avoid cargo modification or destruction along the endosomal pathway and easily deliver the conjugated cargo to the cytoplasm.

[0005] The present invention exploits the natural ability of some bacterial virulence factors, such as cytotoxic necrotic factor (CNF), to escape endosomal vesicles and release their catalytic domains into the cytoplasm for molecule delivery.

[0006] Surprisingly, the applicant was able to deliver intact and functional molecules of interest into mammalian cells by replacing the catalytic domain of a virulence factor with the molecule of interest.

[0007] Thus, the present invention relates to the use of pathogenic factors as carriers for drug delivery to target cells. Summary of the Invention

[0008] One aspect of the present invention relates to a cell-penetrating polypeptide (CPP), which consists of an amino acid sequence derived from or consisting of a portion of a virulence factor, and which CPP is associated with or suitable to be associated with a heterologous cargo.

[0009] In some embodiments, the virulence factor is a bacterial virulence factor. In some embodiments, the bacterial virulence factor is derived from or consists of a Rho GTPase activator. In some embodiments, the Rho GTPase activator is a cytotoxic necrotizing factor (CNF) family member.

[0010] In some embodiments, the CNF member is selected from among cytotoxic necrotic factor 1 (CNF1), cytotoxic necrotic factor 2 (CNF2), cytotoxic necrotic factor 3 (CNF3), and cytotoxic necrotic factor gamma (CNFγ).

[0011] In some embodiments, the CPP comprises, from N-terminus to C-terminus: a first receptor-binding domain of a virulence factor; - one translocation domain of a virulence factor;

[0012] In some embodiments, the CPP does not comprise the catalytic domain of the virulence factor from which it is derived. In some embodiments, the CPP does not comprise the catalytic domain of any virulence factor.

[0013] In some embodiments, the first receptor binding domain of the CPP is a laminin receptor binding domain.

[0014] In some embodiments, the laminin receptor binding domain comprises or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18.

[0015] In some embodiments, the translocation domain of the CPP is an acidic endosome-to-cytoplasm translocation domain.

[0016] In some embodiments, the translocation domain of the cell-penetrating polypeptide comprises or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:16, or SEQ ID NO:19.

[0017] In some embodiments, the CPP further comprises a second receptor binding domain.

[0018] In some embodiments, the second receptor binding domain of the CPP comprises or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17.

[0019] In some embodiments, the CPP comprises or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26.

[0020] Another aspect of the present invention relates to a complex comprising a cell-penetrating polypeptide (CPP) according to the present invention.

[0021] In some embodiments, the complex comprises a cell-penetrating polypeptide (CPP) according to the invention associated with, eg, bound to, a heterologous cargo.

[0022] In some embodiments, the cargo associated with or bound to the complex is linked to the C-terminus of the CPP. In some embodiments, the cargo is a nucleic acid molecule, an amino acid molecule, a therapeutically active peptide, a protein, an antibody, a ribonucleoprotein, an enzyme, a transcription factor, a carbohydrate, a lipid, a glycan, a contrast or imaging agent, a quantum dot, a diagnostic agent, a therapeutic agent, and any combination thereof.

[0023] In one aspect, the present invention relates to a polynucleotide or set of polynucleotides encoding a cell penetrating polypeptide (CPP) according to the invention, or a polynucleotide or set of polynucleotides encoding a cell penetrating polypeptide (CPP) of the invention and encoding and / or constituting a heterologous cargo or part of a heterologous cargo.

[0024] In another aspect, the present invention relates to a recombinant expression vector comprising a polynucleotide or set of polynucleotides of the present invention.

[0025] Another aspect of the present invention is a cell comprising a cell-penetrating polypeptide (CPP) according to the invention, a complex according to the invention, a polynucleotide or set of polynucleotides according to the invention, or a recombinant expression vector according to the invention.

[0026] In another aspect, the present invention relates to an in vitro method for introducing or delivering a molecule of interest to a cell, comprising contacting the cell with a complex according to the present invention, a polynucleotide or set of polynucleotides according to the present invention, or a recombinant expression vector according to the present invention.

[0027] In some embodiments, the cell comprising the molecule of interest, a cell-penetrating polypeptide (CPP) according to the invention, a complex according to the invention, a polynucleotide according to the invention, or a recombinant expression vector according to the invention is a mammalian cell targeted by the method.

[0028] Another aspect of the present invention is a method for delivering at least one molecule of interest to a cell, comprising contacting the cell with a complex according to the present invention, a polynucleotide or set of polynucleotides according to the present invention, or a recombinant expression vector according to the present invention.

[0029] Another aspect of the present invention is a cell-penetrating polypeptide (CPP) according to the invention, a complex according to the invention, a polynucleotide or set of polynucleotides according to the invention, or a recombinant expression vector according to the invention for use as a medicament, in particular for the prevention and / or treatment of a disease.

[0030] Another aspect of the present invention is a method for preventing and / or treating a disease in a subject in need thereof, comprising administering to the subject a cell-penetrating polypeptide (CPP) according to the present invention, a complex according to the present invention, a polynucleotide or set of polynucleotides according to the present invention, or a recombinant expression vector according to the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0031] definition In the present invention, the following terms have the following meanings:

[0032] "Acidic endosomes" refer to endosomal vesicles with a lower pH than the normal pH of the cytoplasm (e.g., pH=6.5 instead of the cytoplasmic pH=6.8).

[0033] "Amino acid" is understood to include the 20 naturally occurring amino acids, amino acids that are often post-translationally modified in vivo, such as hydroxyproline, phosphoserine, and phosphothreonine, as well as other unusual amino acids, such as, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, norvaline, norleucine, and ornithine. Furthermore, in some embodiments, the term "amino acid" includes both D- and L-amino acids (stereoisomers). "Amino acid" refers to both natural and synthetic amino acids, and both D- and L-amino acids. These are represented by full names, three-letter codes, or one-letter codes, as is well known in the art. Amino acid residues in peptides are abbreviated as follows: phenylalanine is Phe or F, leucine is Leu or L, isoleucine is Ile or I, methionine is Met or M, valine is Val or V, serine is Ser or S, proline is Pro or P, threonine is Thr or T, alanine is Ala or A, tyrosine is Tyr or Y; histidine is His or H, glutamine is Gln or Q, asparagine is Asn or N, lysine is Lys or K, aspartic acid is Asp or D, glutamic acid is Glu or E, cysteine ​​is Cys or C, tryptophan is Trp or W, arginine is Arg or R, and glycine is Gly or G. "Standard amino acid" or "naturally occurring amino acid" means any of the 20 standard L-amino acids commonly found in naturally occurring peptides. "Non-standard amino acids" refers to amino acids other than the standard amino acids, whether synthetically prepared or naturally occurring. For example, naphthylalanine can be substituted for tryptophan for ease of synthesis. Other synthetic amino acids that can be substituted include, but are not limited to, L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, α-amino acids such as L-α-hydroxylysyl and D-α-methylalanyl, L-α-methylalanyl, β-amino acids, isoquinolyl, and the like. CPP fragments of the invention can contain standard or non-standard amino acids.The term "amino acid" also includes, but is not limited to, chemically modified amino acids, such as salts, amino acid derivatives (such as amides), and substituents. An "antibody" refers to a protein containing two heavy chains and two light chains that possess significant, known specific immunoreactive activity against an antigen of interest (e.g., EGFP, TSP1, HTRA1, or Fas). Antibodies and immunoglobulins contain light and heavy chains, with or without interchain covalent bonds. The basic structure of immunoglobulins in vertebrate systems is relatively well understood. The collective term "immunoglobulin" encompasses five biochemically distinct classes of antibodies. The following disclosure generally refers to the IgG class of immunoglobulin molecules, but all five classes of antibodies are within the scope of the present invention. With regard to IgG, immunoglobulins contain two identical light polypeptide chains with a molecular weight of approximately 23 kDa and two identical heavy chains with a molecular weight of approximately 53-70 kDa. The four chains are connected by disulfide bonds in a "Y" configuration, with the light chains originating at the mouth of the "Y" and extending through the variable region to bind the heavy chains. Antibody light chains are classified as kappa (κ) or lambda (λ). Each heavy chain class can be associated with either a kappa or lambda light chain. Generally, light and heavy chains are covalently linked to each other; when immunoglobulins are produced by hybridomas, B cells, or genetically engineered host cells, the "tail" regions of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In heavy chains, the amino acid sequence runs from the N-terminus at the forked end of the Y-shape to the C-terminus at the end of each chain. Those skilled in the art will appreciate that heavy chains are classified as gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε), with several subclasses (e.g., γ1-γ4). It is the nature of each chain that determines the "class" of an antibody: IgG, IgM, IgA, IgD, or IgE. Immunoglobulin subclasses or "isotypes" (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, etc.) have been well characterized and are known to confer functional characteristics. Those skilled in the art can easily distinguish between these classes and modified types of isotypes from the disclosure. As described above, the variable region of an antibody allows the antibody to selectively recognize an epitope on an antigen and specifically bind to it. That is, the light chain variable domain (V Ldomain) and heavy chain variable domain (V H The four domains combine to form the variable region that defines the three-dimensional antigen-binding site. This quaternary antibody structure forms the antigen-binding site displayed at the end of each arm of the "Y." More specifically, the antigen-binding site is represented by the V H Chain and V L It is defined by three complementarity determining regions (CDRs) on each strand.

[0034] As used herein, the term "antibody fragment" refers to a portion or region of an antibody consisting of fewer amino acid residues than the whole antibody. An "antibody fragment" binds to an antigen and / or competes with the whole antibody from which it was derived for antigen binding. Antibody fragments include, but are not limited to, single-chain antibodies, dimeric single-chain antibodies, Fv, scFv, Fab, Fab', Fab'-SH, F(ab)'2, Fd, defucosylated antibodies, diabodies, triabodies, tetrabodies, etc. They may also encompass unibodies, domain antibodies, and nanobodies.

[0035] "CMV promoter" refers to a nucleic acid sequence that enables transcriptional control of a cytomegalovirus coding sequence. An example of a nucleic acid sequence of a CMV promoter is SEQ ID NO: 29.

[0036] "Cargo" refers to a molecule associated with, e.g., bound to, a cell-penetrating polypeptide that is delivered or intended to be delivered to a cell. Non-limiting examples of such molecules include nucleic acids (e.g., siRNA, sgRNA, mRNA, tRNA, miRNA, cDNA, DNA, etc.), amino acids, therapeutically active peptides, proteins, peptides, polypeptides, antibodies, ribonucleoproteins, enzymes, transcription factors, carbohydrates, lipids, glycans, contrast or imaging agents, quantum dots, diagnostic agents, therapeutic agents, and any combination thereof.

[0037] "Carrier," as defined herein, refers to a polypeptide capable of associating with or binding to a cargo and transporting the cargo.

[0038] The term "cell-penetrating polypeptide" refers to a polypeptide that can pass through a cell membrane by itself due to a specific domain (e.g., a ligand for a cell membrane component, a hydrophobic transmembrane domain).

[0039] "CNF family member" refers to cytotoxic necrotic factors such as cytotoxic necrotic factor 1 (CNF1), cytotoxic necrotic factor 2 (CNF2), cytotoxic necrotic factor 3 (CNF3), and cytotoxic necrotic factor gamma (CNFγ).

[0040] A "complex" or "molecular complex" refers to an association or linkage of molecules of the same or different types, as defined above. For example, the association between molecules occurs through complementary base matching, covalent bonds, ionic bonds, hydrogen bonds, polar bonds, hydrophobic interactions or effects (van der Waals forces), electrostatic interactions or forces (e.g., between RNA or DNA and proteins), biotin / streptavidin interactions, etc.

[0041] "Associated to" or "linked to" refers to any type of possible linkage between molecules, as defined above. This association or linkage may or may not occur via a linker, as defined herein, and may occur through complementary base matching, covalent bonds, ionic bonds, hydrogen bonds, polar bonds, hydrophobic interactions or effects (van der Waals forces), electrostatic interactions or forces (e.g., between RNA or DNA and proteins), biotin / streptavidin interactions, etc. In some embodiments, the associated molecules are linked by a covalent bond.

[0042] According to genome editing technology (The new frontier of genome engineering with CRISPR-Cas9; Jennifer A. Doudna, Emmanuelle Charpentier, Science 2014), a "CRISPR-associated protein" is a protein that has the ability to break hydrogen bonds in double-stranded DNA when complexed with a single guide (sg) RNA. A "CRISPR-associated protein" is an enzyme that associates with CRISPR RNA to bind to and modify DNA or RNA target sequences. Cas enzymes originate from bacteria, and therefore come in a wide variety of types. Some are used for genome editing or RNA editing. Some types have been engineered by humans to perform specific tasks. Common examples of CRISPR-associated proteins include Cas9, which creates a double-strand break in the target DNA sequence, and Cas13, which targets RNA.

[0043] An "expression vector" refers to an artificial construct that allows transcription and / or translation of a DNA (or cDNA) or RNA sequence in a host cell. An expression vector may comprise a nucleic acid sequence encoding a polypeptide of the present invention in operative association with expression control elements. This construct may be any vector capable of being transcribed or translated in a eukaryotic cell, such as a plasmid, cosmid, fosmid, episome, artificial chromosome, phage, or viral vector. The terms "vector," "cloning vector," and "expression vector" refer to a vehicle for introducing a DNA or RNA sequence (e.g., a foreign gene) into a host cell, transforming the host, and promoting the expression (e.g., transcription and translation) of the introduced sequence. An expression vector of the present invention may comprise a functional expression cassette. The expression cassette comprises a nucleic acid sequence encoding a polypeptide of the present invention, operably linked to elements required for its expression. The vector advantageously comprises a promoter sequence, signals for translation initiation and termination, and appropriate regions for translational regulation, such as promoters, enhancers, terminators, etc., to cause or induce expression of the polypeptide upon administration to a subject. Examples of promoters and enhancers used in animal cell expression vectors include the SV40 early promoter and enhancer, the Moloney murine leukemia virus long terminal repeat promoter and enhancer, and the immunoglobulin heavy chain promoter and enhancer. The vector may be inserted into a host cell transiently or stably. The vector may also contain sequences encoding specific signals that trigger the secretion of the translated protein or targeting to a cellular compartment or organelle (e.g., the Golgi apparatus, endosomes, or periplasm). These various control signals are selected depending on the host cell and can be inserted into a vector that replicates autonomously within the host cell or integrates into the host's genome.

[0044] Any expression vector for animal cells can be used. Examples of suitable vectors include pAGE107, pAGE103, pHSG274, pKCR, and pSG1βd2-4. Other examples of plasmids include replicative plasmids containing an origin of replication, or integrative plasmids such as pUC, pcDNA, and pBR. Other examples of viral vectors include adenovirus, retrovirus, herpesvirus, and AAV vectors. Such recombinant viruses can be produced by techniques known in the art, such as transfection of packaging cells or transient transfection with helper plasmids or viruses. Representative examples of viral packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, and 293 cells.

[0045] "Fusion protein" or "fusion polypeptide" refer interchangeably to the synthetic association of at least two proteins or peptides or polypeptides. In some embodiments, this association is achieved by translation of a designed mRNA sequence.

[0046] The term "identity" refers to a measure of the identity of nucleotide or amino acid sequences. Generally, sequences are aligned to maximize the match. "Identity" itself has a meaning recognized by those of skill in the art and can be calculated using published techniques. Methods for assessing identity and similarity have been codified in computer programs. Computer program methods for determining identity and similarity between two sequences include, but are not limited to, the GCG program package and the GAP program. By way of example, a polynucleotide having a nucleotide sequence that is at least, e.g., 95% "identical" to a reference nucleotide sequence means that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that the polynucleotide sequence may contain an average of up to 5 point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with alternative nucleotides, or up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These variations in the reference sequence can occur at the 5' or 3' terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions, and can be interspersed individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

[0047] "Laminin receptor binding domain" refers to an amino acid domain capable of specifically binding to a laminin receptor. Laminins are a group of glycoproteins that make up the extracellular matrix of all animals. They are a major component of the basal lamina (one of the layers of the basement membrane), a protein network that underpins most cells and organs. Laminins are an important and biologically active part of the basal lamina, influencing cell differentiation, migration, and cell adhesion. Laminins are recognized by receptors anchored in the cell membrane and transmit signals from the extracellular matrix to the cell cytoskeleton.

[0048] A "linker," also referred to interchangeably as a "peptide linker" or "spacer linker," refers to an amino acid sequence (generally short in length), typically a synthetic amino acid sequence, that links or connects a peptide or polypeptide to another peptide or polypeptide or to another molecule. A linker typically connects two peptide or polypeptide sequences via a peptide bond. Linkers are well known in the art. An example of a suitable linker is the so-called "GS linker" or "Gly-Ser linker," i.e., an amino acid sequence consisting essentially of glycine (G) and serine (S) residues, usually, but not always, containing two or more repeats of a peptide motif. GS linkers are well known and widely used in the art, particularly due to their flexible properties.

[0049] "Mammalian cells" refers to cells derived from any mammal, including humans, livestock, laboratory animals, farm animals, zoo animals, sport animals, pet animals, such as dogs, mice, primates, cows, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is a human.

[0050] "Nanobodies" refer to single domain antibodies, which are antibody fragments consisting of a single monomeric variable antibody domain engineered from camelid heavy chain antibodies. In some embodiments, single domain antibodies target exogenous or endogenous proteins expressed in eukaryotic cells. In other embodiments, single domain antibodies are directed against pathogenic antigens.

[0051] "Nucleic acid" refers to any arrangement of naturally occurring nucleic acids. In some embodiments, nucleic acids are deoxyribonucleic acids (DNA) composed of the bases A (adenine), T (thymine), C (cytosine), and G (guanine). In other embodiments, nucleic acids are ribonucleic acids composed of the bases A (adenine), U (uracil), C (cytosine), and G (guanine).

[0052] "Optimized sequence" refers to a DNA sequence in which codons have been modified to favor mRNA transcription in a particular species. In some embodiments, the codons are optimized to promote transcription of the CNF family member DNA sequence in mammalian cells.

[0053] "Peptide" refers to a linear polymer of fewer than 50 amino acids linked by peptide bonds.

[0054] "Polypeptide" refers to a linear polymer of more than 50 amino acids joined by peptide linkages.

[0055] "Receptor binding domain" refers to an amino acid domain that has the ability to specifically associate with, or bind transiently or definitively to, a cellular receptor.

[0056] "Rho GTPase activators" refer to proteins that have the ability to deamidate glutamine to glutamic acid in the active site (called switch II) of Rho family proteins (including RhoA, Rac1, and Cdc42), thereby constitutively activating these proteins.

[0057] "Single chain antibody" or "scFv" refers to a V H Antibody domains and V L It refers to an antibody fragment in which antibody domains are linked in a single amino acid chain. Preferably, the amino acid sequence of an scFv is V H Domains and V L The scFv further contains a peptide linker between the domains, enabling it to form the desired structure for antigen binding. "Fv" refers to the minimum antibody fragment that completely contains the antigen recognition and binding site. This fragment consists of a dimer of one heavy-chain variable region and one light-chain variable region in tight, non-covalent association.

[0058] "Single domain antibody" refers to an antibody-derived protein that has the structural and functional properties characteristic of naturally occurring heavy chain-only antibodies. These heavy chain antibodies contain a single variable domain (V H H), e.g., nanobodies®, or single variable domains (V H H) and two constant domains (C H 2 and C H 3, e.g., camelid antibodies), or a single variable domain (V H H) and five constant domains (C H 1. C H 2. C H 3. C H 4 and C H 5, for example, shark antibodies).

[0059] "Subject" refers to a mammal, preferably a human. In some embodiments, the subject is a "patient," i.e., a mammal, preferably a human, awaiting medical treatment, or receiving medical treatment, or having been / will be the subject of medical treatment, or being monitored for the development of disease. In some embodiments, the subject is an adult (e.g., a subject aged 18 years or older). In other embodiments, the subject is a child (e.g., a subject under 18 years of age). In some embodiments, the subject is male. In other embodiments, the subject is female.

[0060] As used herein, a "therapeutic protein" typically refers to a peptide, polypeptide, or protein that is useful in the treatment or prevention of an inherited or acquired disease or that improves a subject's condition. In particular, therapeutic proteins may play a role in altering and repairing genetic defects, destroying cancer cells or pathogens and pathogen-infected cells, and / or treating or preventing a variety of diseases, whether inherited or acquired, including immune system diseases such as autoimmune diseases, metabolic or endocrine diseases, nervous system diseases, circulatory system diseases, respiratory system diseases, digestive system diseases, skin and subcutaneous tissue diseases, musculoskeletal and connective tissue diseases, genitourinary system diseases, and the like. In the context of the present invention, the term "therapeutic protein" generally refers to both peptides and proteins. It may also refer to a polypeptide or polyprotein comprising a therapeutic protein as defined herein. For example, the term may refer to a polypeptide comprising a therapeutic protein fused, preferably at the N- or C-terminus, with additional amino acid sequences not derived from the therapeutic protein.

[0061] "Therapeutic molecule" refers to a molecule (e.g., peptide, polypeptide, enzyme, RNA, DNA, lipid) that may beneficially affect cellular function or improve the condition of a tissue or subject, beneficial in the treatment or prevention of inherited or acquired disease.

[0062] A "therapeutically effective amount" refers to a level or amount of an agent that (1) delays or prevents the onset of a disease, (2) slows or halts the progression, worsening, or deterioration of one or more symptoms of a disease, (3) ameliorates symptoms of a disease, (4) reduces the severity or incidence of a disease, or (5) cures a disease, without causing significant adverse or harmful side effects to the subject. A therapeutically effective amount can also be administered prior to the onset of a disease for a preventative or prophylactic effect. Alternatively, or additionally, a therapeutically effective amount can be administered after the onset of a disease for a therapeutic or maintenance effect.

[0063] "Treating" or "treatment" or "alleviation" refers to both therapeutic and prophylactic or preventative measures, the purpose of which is to prevent or delay (alleviate) the disease or pathological condition or disorder in question. Subjects in need of treatment include those already affected, as well as those susceptible to developing the disease or in whom the disease is to be prevented. A subject, patient, or mammal is considered to have been successfully "treated" for a pathological disorder in question if, after receiving a therapeutic amount of a composition of the invention, the subject shows an observable effect in terms of one or more of the following: some alleviation of one or more symptoms associated with the particular disorder or pathological condition, reduced morbidity and mortality, and improved quality of life issues. The above parameters for assessing successful treatment or improvement of the disorder are readily measurable using routine procedures familiar to physicians.

[0064] "U6 promoter" refers to a nucleic acid sequence that allows for transcriptional control of the small nuclear U6 RNA sequence. An example of a nucleic acid sequence of a U6 promoter is SEQ ID NO: 28.

[0065] "Virulence factor" refers to a molecule derived from a microorganism that is involved in the infectivity of the microorganism.

[0066] Detailed Description The present invention relates to polypeptides having cell-penetrating capabilities (i.e., cell-penetrating polypeptides (CPPs)) derived from virulence factors. In some embodiments, the CPPs comprise an amino acid sequence derived from the virulence factor or consist of a portion of the virulence factor. In some embodiments, the CPPs are associated with, or suitable for association with, a heterologous cargo.

[0067] In some embodiments, the virulence factor is a Rho GTPase activator.

[0068] In some embodiments, the cytotoxic necrotic factor (CNF) family member is selected from among cytotoxic necrotic factor 1 (CNF1), cytotoxic necrotic factor 2 (CNF2), cytotoxic necrotic factor 3 (CNF3), and cytotoxic necrotic factor gamma (CNFγ).

[0069] Cytotoxic necrotizing factor 1 (CNF1) is best known as a virulence factor for Escherichia coli. CNF1 consists of an N-terminal LRP 37 kDa receptor-binding domain, a translocation domain, an Lu / BCAM receptor-binding domain, and a C-terminal catalytic domain. The catalytic domain of CNF1 is released into the cytoplasm following acidification of the endosomal compartment by a conformational change in the translocation domain. The CNF1 catalytic domain enables deamidation of glutamine residues, leading to activation of the eukaryotic regulatory Rho, Rac, and Cdc42 GTPases, which control many processes, including actin cytoskeleton organization and dynamics and DNA transcription. CNF1 is a 1014-amino acid protein (UniProtein accession number Q47106 - SEQ ID NO: 2). An example of a cDNA sequence encoding the CNF1 protein is SEQ ID NO: 1.

[0070] Cytotoxic necrotic factor 2 (CNF2) is also a Rho, Rac, and Cdc42 GTPase-activating virulence factor derived from Escherichia coli. CNF2 is a 1014 amino acid protein (UniProtein accession number C5ZZQ2 - SEQ ID NO: 4) that has been detected in bovine feces. An example of a cDNA sequence encoding the CNF2 protein is SEQ ID NO: 3.

[0071] Cytotoxic necrotizing factor 3 (CNF3) is also a Rho, Rac, and Cdc42 GTPase-activating virulence factor from Escherichia coli. CNF3 is a 1013 amino acid protein (UniProtein accession number Q0E668 - SEQ ID NO: 6) that has been demonstrated in sheep and goats. An example of a cDNA sequence encoding the CNF3 protein is SEQ ID NO: 5.

[0072] Cytotoxic necrotic factor gamma (CNFγ) is a virulence factor of Yersinia pseudotuberculosis. CNFγ is a 1014 amino acid protein (UniProtion accession number Q9EYH7 - SEQ ID NO: 8) that, like other CNFs derived from Escherichia coli, has Rho GTPase activating activity, but has high substrate specificity for RhoA. An example of a cDNA sequence encoding the CNFγ protein is SEQ ID NO: 7.

[0073] Preferably, the amino acid sequence derived from a portion of a virulence factor is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to said portion of a virulence factor.

[0074] In some embodiments, the cell-penetrating polypeptide (CPP) comprises at least two distinct domains, at least three distinct domains, or at least four distinct domains. Preferably, the cell-penetrating polypeptide (CPP) comprises three distinct domains.

[0075] In some embodiments, the CPP comprises, from N-terminus to C-terminus: a first receptor-binding domain of a virulence factor; - one translocation domain of a virulence factor,

[0076] In some embodiments, the first receptor binding domain and the translocation domain are derived from different virulence factors. In other embodiments, the first receptor binding domain and the translocation domain are derived from the same virulence factor.

[0077] In some embodiments, the first receptor-binding domain of the pathogenic factor is a laminin receptor-binding domain, preferably the receptor-binding domain of LRP 37 kDa. LRP 37 kDa is a cell surface laminin (basement membrane protein) receptor anchored to the cell membrane. This receptor is known to be involved in numerous physiological processes, such as translation, maintenance of cytoskeletal structure, cell differentiation, cell proliferation, and cell migration. In some embodiments, the laminin receptor-binding domain comprises or consists of the laminin receptor-binding domain of CNF1, CNF2, CNF3, or CNFγ.

[0078] In some embodiments, the first receptor binding domain of the virulence agent comprises or consists of a sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, or SEQ ID NO: 18, or a functional fragment thereof. Preferably, the first receptor binding domain comprised in a CPP exhibits the same function or activity as the domain from which it is derived or of which it is a part or fragment. For example, a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical to SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18, or a functional fragment thereof, exhibits the same function or activity as SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18, e.g., allows for specific cell targeting.

[0079] In some embodiments, the first receptor binding domain comprises or consists of an amino acid sequence set forth in any one of SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18, or a functional fragment thereof.

[0080] The amino acid sequence set forth in any one of SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18 has at least 60% identity with the amino acid sequence set forth in SEQ ID NO:9.

[0081] In some embodiments, the translocation domain is a pH-sensitive domain that undergoes a conformational change upon endosomal acidification, allowing the catalytic domain to translocate to the cytoplasm, such that a portion of the domain remains in the cytoplasm while remaining in the endosomal compartment after endocytosis. In some embodiments, the translocation domain comprises or consists of the translocation domain of CNF1, CNF2, CNF3, or CNFγ.

[0082] In other embodiments, the translocation domain is an acidic endosomal-cytoplasmic translocation domain that is sensitive to acidic pH, resulting in a conformational change.

[0083] In some embodiments, the translocation domain comprises or consists of an amino acid sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, more preferably at least 85%, to SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19, or a functional fragment thereof. Preferably, the translocation domain contained in the CPP exhibits the same function or activity as the domain from which it is derived or the domain of which it is a part or fragment. For example, a sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, more preferably at least 85% identical, to SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19, or a functional fragment thereof, exhibits the same function or activity as SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19, e.g., enables intracellular delivery.

[0084] In some embodiments, the translocation domain comprises or consists of an amino acid sequence set forth in any one of SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19, or a functional fragment thereof.

[0085] The amino acid sequence set forth in any one of SEQ ID NO:13, SEQ ID NO:16, or SEQ ID NO:19 has at least 60% identity with the amino acid sequence set forth in SEQ ID NO:10.

[0086] In some embodiments, the CPP does not comprise the catalytic domain of the virulence factor from which it is derived. In some embodiments, the CPP does not comprise the catalytic domain of any virulence factor.

[0087] In some embodiments, the cell-penetrating polypeptide (CPP) further comprises, from the N-terminus to the C-terminus, a second receptor-binding domain.

[0088] In some embodiments, the second receptor binding domain is different from the first receptor binding domain.

[0089] In some embodiments, the second receptor binding domain is identical to the first receptor binding domain.

[0090] In some embodiments, the second receptor-binding domain is a receptor-binding domain for the Lu / BCAM protein. Lutheran adhesion glycoprotein / basal cell adhesion molecule (Lu / BCAM) is a transmembrane adhesion molecule of the immunoglobulin family that functions as a laminin receptor and has been reported to be essential for CNF1 uptake by host cells. These differ in the length of their intracellular domains and are abbreviated as Lu / BCAM.

[0091] In some embodiments, the second receptor-binding domain of a pathogenic agent comprises or consists of a sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17, or a functional fragment thereof. Preferably, the second receptor-binding domain contained in a CPP exhibits the same function or activity as the domain from which it is derived or the domain of which it is a part or fragment. For example, a sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17, or a functional fragment thereof, exhibits the same function or activity as SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17, e.g., allows for specific cell targeting.

[0092] In some embodiments, the second receptor binding domain comprises or consists of an amino acid sequence set forth in any one of SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17, or a functional fragment thereof.

[0093] The amino acid sequence set forth in either SEQ ID NO: 14 or SEQ ID NO: 17 has at least 60% identity with the amino acid sequence set forth in SEQ ID NO: 11.

[0094] In some embodiments, a CPP of the invention comprises, from N-terminus to C-terminus: a first receptor-binding domain comprising or consisting of the amino acid sequence set forth in any of SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15 or SEQ ID NO:18, or a functional fragment thereof as described above; or an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to the amino acid sequence set forth in SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15 or SEQ ID NO:18, or a functional fragment thereof; a translocation domain comprising or consisting of the amino acid sequence set forth in any of SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16 or SEQ ID NO: 19, or a functional fragment thereof as described above; or an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to the amino acid sequence set forth in SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16 or SEQ ID NO: 19, or a functional fragment thereof; - optionally a second receptor binding domain comprising or consisting of the amino acid sequence set forth in any of SEQ ID NO: 11, SEQ ID NO: 14 or SEQ ID NO: 17, or a functional fragment thereof as described above; or comprising or consisting of an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to the amino acid sequence set forth in SEQ ID NO: 11, SEQ ID NO: 14 or SEQ ID NO: 17, or a functional fragment thereof.

[0095] In some embodiments, a CPP of the invention comprises, from N-terminus to C-terminus: - a first receptor-binding domain comprising or consisting of an amino acid sequence set forth in any one of SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, or SEQ ID NO: 18, or a functional fragment thereof; a translocation domain comprising or consisting of an amino acid sequence set forth in any one of SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 19, or a functional fragment thereof; - optionally comprising or consisting of a second receptor binding domain comprising or consisting of the amino acid sequence set forth in any one of SEQ ID NO: 11, SEQ ID NO: 14, or SEQ ID NO: 17, or a functional fragment thereof.

[0096] In another possible embodiment, the CPP has a sequence that is at least 55, 60, 65, 70, 75, 80, 85, 90, 95, preferably 99% identical to the CNF amino acid sequence of its catalytic C-terminal domain.

[0097] In some embodiments, the CPPs of the invention comprise or consist of, from N- to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1. [Table 1] JPEG2025535146000002.jpg223159JPEG2025535146000003.jpg37159

[0098] In some embodiments, a CPP of the invention is an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to the amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof.

[0099] Preferably, a sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical to SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24 or SEQ ID NO:26, or a functional fragment thereof, exhibits the same function or activity as SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24 or SEQ ID NO:26, e.g., allows for specific cell targeting and intracellular delivery.

[0100] The present invention also relates to a complex comprising a cell-penetrating polypeptide (CPP) according to the invention associated with, eg bound to, at least one cargo.

[0101] The CPP may or may not be associated with the cargo via a linker, hi some embodiments, a conjugate comprising a cell-penetrating polypeptide (CPP) according to the invention is linked to at least one cargo via a linker.

[0102] The CPP can be associated with the cargo by complementary base matching, covalent bonds, ionic bonds, hydrogen bonds, polar bonds, hydrophobic interactions or effects (van der Waals forces), electrostatic interactions or forces (e.g., between RNA or DNA and proteins), biotin / streptavidin interactions, etc. In some embodiments, the CPP is associated with the cargo by a covalent bond.

[0103] For example, the cargo is a single domain antibody covalently associated with a CPP.

[0104] In another example, the cargo may be a CRISPR-associated protein (e.g., Cas9) covalently associated with a CPP. In some embodiments, the CRISPR-associated protein is further associated with an sgRNA (guide RNA) through electrostatic interactions.

[0105] In another example, the cargo may be a sgRNA (guide RNA) associated with the CPP through electrostatic interactions.

[0106] In another example, the cargo may be a biotinylated protein, polynucleotide, or ribonucleotide covalently associated with the CPP. In some embodiments, the biotinylated protein further interacts with a streptavidin fusion protein.

[0107] All embodiments detailed in the previous paragraphs in relation to the first aspect of the invention are also preferred embodiments according to this aspect of the invention.

[0108] Methods for non-covalently attaching peptides and polypeptides to molecules of interest are well known. Methods for covalently attaching peptides and polypeptides to molecules of interest are well known.

[0109] In some embodiments, the cargo comprises or consists of at least one molecule of interest associated with, e.g., bound to, the CPP, preferably at least one molecule of interest associated with, e.g., bound to, the C-terminus of the CPP.

[0110] In some embodiments, the cargo is not derived from a virulence agent, particularly a CNF virulence agent.

[0111] In some embodiments, the cargo comprises at least one molecule of interest, or a functionally and / or structurally active fragment thereof. In particular, the molecule of interest can be a nucleic acid molecule, an amino acid molecule, a therapeutically active peptide or protein, a protein, a fluorescent protein, an antibody, a ribonucleoprotein, an enzyme, a transcription factor, a carbohydrate, a lipid, a glycan, a contrast or imaging agent, a quantum dot, a diagnostic agent, a therapeutic agent, and any combination thereof.

[0112] In some embodiments, the cargo comprises or consists of at least one, two, three, four, five, six, or more molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, fluorescent proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, carbohydrates, lipids, glycans, contrast or imaging agents, quantum dots, diagnostic agents, therapeutic agents, and any combination thereof.

[0113] For example, cargo - Molecules used in the CRISPR / Cas system, such as CRISPR-associated proteins and sgRNAs (guide RNAs); - ribonucleoproteins (allowing delivery of RNA or DNA); single chain antibodies (scFv) or single domain antibodies (such as nanobodies), -lysosomal enzymes or polypeptides; ubiquitin ligase; and / or -transcription factor.

[0114] In some embodiments, the molecule of interest comprises or consists of an amino acid sequence, such as a peptide, polypeptide, protein, fluorescent protein, enzyme, linker, address cellular localization sequence (e.g., MTS, NLS, ...), etc. A particular combination of a CPP and an amino acid sequence is called a fusion protein or fusion polypeptide.

[0115] In other embodiments, the molecule of interest comprises or consists of deoxyribonucleic acid (DNA) or complementary DNA (cDNA).

[0116] In other embodiments, the molecule of interest comprises or consists of ribonucleic acid (RNA), which may be of known types, such as small interfering RNA (siRNA), short hairpin RNA (shRNA), single guide RNA (sgRNA), transfer RNA (tRNA), etc.

[0117] In other embodiments, the molecule of interest comprises or consists of an antibody, which may be a combination of two heavy chains and two light chains, or a combination of fragments thereof. In some embodiments, the antibody is an scFv or nanobody.

[0118] In other embodiments, the molecule of interest comprises or consists of a therapeutic molecule, preferably an active therapeutic molecule or antibody, a ribonucleoprotein, an enzyme, a transcription factor, a carbohydrate, a lipid, a sugar chain, a contrast or imaging agent, a quantum dot, a diagnostic agent, a therapeutic agent, or any combination thereof.

[0119] In some embodiments, the cargo comprises or consists of at least two molecules of interest, such as, for example, an amino acid sequence and a nucleic acid sequence that includes both DNA and / or RNA types. In some embodiments, the DNA is cDNA. In some embodiments, the RNA is any type of RNA sequence, such as sgRNA (single guide RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), mRNA (messenger RNA), tRNA (transfer RNA), etc.

[0120] In a preferred embodiment, the cargo comprises or consists of a molecule of interest combination comprising or consisting of a CRISPR-associated protein amino acid sequence and an sgRNA. Preferably, the CRISPR-associated protein amino acid sequence is a Cas9 or Cas12 sequence. Examples of Cas9 and Cas12 sequences include those disclosed in Shmakov et al., 2017, or those defined by amino acid sequence SEQ ID NO: 44 or SEQ ID NO: 46, or those defined by nucleic acid sequence SEQ ID NO: 45 or SEQ ID NO: 47.

[0121] The present invention relates to a polynucleotide or nucleic acid, or a set of polynucleotides or nucleic acids, encoding a CPP according to the invention, or encoding a fusion polypeptide, or encoding and / or constituting a complex or part of a complex according to the invention (including a CPP and part of a heterologous cargo).

[0122] All embodiments detailed in the previous paragraphs in relation to the first aspect of the invention are also preferred embodiments according to this aspect of the invention.

[0123] In some embodiments, polynucleotides of the invention encode CPPs that comprise or consist of, from N- to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1.

[0124] In some embodiments, a polynucleotide of the invention comprises or consists of a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical, more preferably at least 85% identical, to SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27, or a fragment thereof.

[0125] In some embodiments, a polynucleotide of the invention comprises or consists of a nucleic acid sequence set forth in any one of SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27, or a fragment thereof.

[0126] In a preferred embodiment, a polynucleotide of the invention comprises or consists of a nucleic acid sequence as set forth in SEQ ID NO: 21, or a fragment thereof.

[0127] In some embodiments, the polynucleotide or set of polynucleotides of the invention comprises: - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and -encodes a fusion polypeptide comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0128] In some embodiments, the polynucleotide or set of polynucleotides of the invention comprises: a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -encodes a fusion polypeptide comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0129] In some preferred embodiments, the polynucleotide or set of polynucleotides of the invention comprises: a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -encodes a fusion polypeptide comprising or consisting of a CRISPR-associated protein, preferably Cas9 or Cas12.

[0130] In some embodiments, the polynucleotide or set of polynucleotides of the invention comprises: - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and - encoding and / or comprising a conjugate of the invention or a part of a conjugate of the invention, comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof;

[0131] In some preferred embodiments, the polynucleotide or set of polynucleotides of the invention comprises: a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -encoding and / or consisting of a complex of the invention or a part of a complex of the invention comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0132] In some preferred embodiments, the polynucleotide or set of polynucleotides of the invention comprises: - a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to the amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and - Encoding and / or comprising a complex of the invention or part of a complex of the invention consisting of or comprising a CRISPR-associated protein, preferably Cas9 or Cas12, and / or an sgRNA.

[0133] The various parts of the complex, i.e., the CPP and the cargo, are encoded by or comprised of one or more polynucleotides.

[0134] For example, a set of polynucleotides of the present invention may consist of 1, 2, 3, 4, 5, 6 or more polynucleotides.

[0135] According to the present invention, the nucleic acid sequences of the present invention encoding the CPPs described herein above may be any nucleic acid sequence that is a degenerate version of the nucleic acid sequence and encodes the same CPP.

[0136] Those skilled in the art are familiar with methods for adapting coding sequences based on the genetic code, including, but not limited to, methods for taking advantage of codon degeneracy to introduce silent mutations, and methods for taking into account codon usage bias and variations in the standard genetic code associated with the host cell under consideration.

[0137] The present invention also relates to vectors, particularly recombinant expression vectors, including, but not limited to, plasmids, viral vectors, artificial chromosomes, liposomes, lipid nanoparticles, and the like, that comprise the polynucleotides of the invention described herein.

[0138] In some embodiments, the vector is a nucleic acid molecule described herein.

[0139] In some embodiments, the vectors described herein comprise a nucleotide sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, more preferably at least 85% identical to SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27, or a fragment thereof.

[0140] In some embodiments, the vectors described herein comprise a nucleotide sequence set forth in any one of SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27, or a fragment thereof.

[0141] In some embodiments, the vectors described herein comprise a nucleotide sequence encoding a CPP that comprises, or consists of, from N- to C-terminus, either a combination of a first receptor binding domain and a translocation domain, or a combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1 above.

[0142] In some embodiments, the vectors described herein include: - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and -comprises a nucleotide sequence encoding a fusion polypeptide comprising, or consisting of, at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0143] In some embodiments, the vectors described herein include: a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -comprises a nucleotide sequence encoding a fusion polypeptide comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0144] In some embodiments, the vectors described herein include: a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -comprises a nucleotide sequence encoding a fusion polypeptide comprising or consisting of a CRISPR-associated protein, preferably Cas9 or Cas12.

[0145] In some embodiments, the vectors described herein include: - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and - comprising a nucleotide sequence encoding and / or consisting of a complex of the invention or a part of a complex of the invention, comprising or consisting of at least 1, 2, 3, 4, 5 or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0146] In some preferred embodiments, the vectors described herein are - a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to the amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and - comprising a nucleotide sequence encoding and / or comprising a complex of the invention or a part thereof, comprising or consisting of at least 1, 2, 3, 4, 5 or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0147] In some preferred embodiments, the vectors described herein are - a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to the amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -comprises a nucleotide sequence encoding and / or comprising a complex of the invention or a part thereof, comprising or consisting of a CRISPR-associated protein, preferably Cas9 or Cas12, and / or an sgRNA.

[0148] The various parts of the complex, ie, the CPP and the cargo, are encoded by or consist of one or more nucleotide sequences.

[0149] In some embodiments, the vector of the present invention further comprises a nucleic acid sequence encoding the optimized sequence of CNF1 delivery mechanism (OCDM) set forth in SEQ ID NO:21.

[0150] Those skilled in the art are familiar with the nucleic acid sequences required to construct a vector. Expression vectors may contain an origin of replication site and an antibiotic resistance gene sequence under the control of an appropriate promoter to select cells that correctly express the vector. Non-limiting examples of expression vectors include plasmids, cosmids, fosmids, etc.

[0151] In some embodiments, the OCDM sequence is controlled by a viral promoter, preferably the cytomegalovirus (CMV) promoter.

[0152] In some embodiments, the vector further comprises a sequence encoding a nuclear localization sequence (NLS) following the coding sequence for the CRISPR-associated protein under the same promoter of OCDM, and is part of the same transcript.

[0153] In some embodiments, the sgRNA coding sequence is under the control of the U6 (gene) promoter.

[0154] In some embodiments, the vector comprises an OCDM sequence and / or a Flag tag sequence inserted before and / or after the molecule of interest coding sequence.

[0155] In some embodiments, the expression vector comprises a nucleic acid sequence encoding an antibody, which in some embodiments is arranged with a sequence encoding a single chain antibody or nanobody under the same promoter of OCDM so that they are part of the same transcription product.

[0156] The present invention also relates to a cell, a cell population or a cell line which contains or expresses a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention or a vector according to the invention.

[0157] All embodiments detailed in the previous paragraphs in relation to the first aspect of the invention are also preferred embodiments according to this aspect of the invention.

[0158] The cells or cell lines described herein may be genetically modified cells, cell populations or cell lines, i.e. cells or cell lines that have been genetically modified to express a CPP according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention.

[0159] The cell, cell population, or cell line is preferably a eukaryotic cell or cell line. The cell, cell population, or cell line may be an animal cell, cell population, or cell line. The cell, cell population, or cell line may be a mammalian cell, cell population, or cell line. The cell, cell population, or cell line may be a human cell, cell population, or cell line. The cell, cell population, or cell line may be a primary cell, cell population, or cell line, particularly a human primary cell, cell population, or cell line. The cell, cell population, or cell line may be an immortalized cell, cell population, or cell line, particularly a human immortalized cell, cell population, or cell line. The cell, cell population, or cell line may be an immune cell, cell population, or cell line, particularly a human immune cell, cell population, or cell line.

[0160] In some embodiments, the cells are human embryonic kidney 293, particularly 293 cells expressing the simian virus (SV40) tsA1609 large T antigen allele (HEK293T), or Chinese Hamster Ovary (CHO) cells.

[0161] In some embodiments, the cells, cell populations, or cell lines described herein comprise or express the vectors described herein.

[0162] In some embodiments, the cells or cell lines described herein comprise or express at least one CPP according to the invention, a fusion polypeptide or a complex according to the invention.

[0163] In some embodiments, the cells or cell lines described herein are - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and - comprises or expresses at least one fusion polypeptide comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0164] In some embodiments, the cells or cell lines described herein are a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, or a fragment thereof; and - comprises or expresses at least one fusion polypeptide comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, ribonucleoproteins, enzymes, transcription factors, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0165] In some embodiments, the cells or cell lines described herein are a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, or a fragment thereof; and -comprises or expresses at least one fusion polypeptide comprising or consisting of a CRISPR-associated protein, preferably Cas9 or Cas12.

[0166] In some embodiments, the cells or cell lines described herein are - a CPP amino acid sequence comprising or consisting of, from N-terminus to C-terminus, any combination of a first receptor binding domain and a translocation domain, or any combination of a first receptor binding domain, a translocation domain, and a second receptor binding domain, as disclosed in Table 1, or a fragment thereof; and - comprises or expresses at least one complex of the invention or part of a complex of the invention, comprising or consisting of at least 1, 2, 3, 4, 5 or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0167] In some preferred embodiments, the cells or cell lines described herein are a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to an amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -comprises or expresses at least one complex of the invention or a part thereof, comprising or consisting of at least 1, 2, 3, 4, 5, or 6 molecules of interest selected from the group consisting of nucleic acid molecules, amino acid molecules, therapeutically active peptides or proteins, proteins, antibodies, contrast or imaging agents, diagnostic agents, therapeutic agents, and any combination thereof.

[0168] In some preferred embodiments, the cells or cell lines described herein are - a CPP amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; or an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to the amino acid sequence set forth in SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or a fragment thereof; and -comprises or expresses at least one complex of the invention or part thereof comprising or consisting of a CRISPR-associated protein, preferably Cas9 or Cas12, and / or an sgRNA.

[0169] In some embodiments, the CPPs of the invention or the fusion polypeptides of the invention are produced in mammalian cells and purified by methods known to those skilled in the art, such as beads capable of capturing specific peptides of the complex. The beads are typically agarose beads coated with antibodies targeting specific antigens. These beads allow immunoprecipitation of complexes containing the antigen, which can then be isolated, for example, by magnetism or centrifugation.

[0170] In some embodiments, the specific peptide to which the beads are targeted is a Flag tag.

[0171] The present invention further relates to an in vitro method for inducing or delivering a molecule of interest to a cell, a cell population or a cell line, or a method for delivering at least one molecule of interest to a cell, a cell population or a cell line, comprising contacting the cell with a complex according to the invention, a polynucleotide according to the invention, or a recombinant expression vector according to the invention.

[0172] All embodiments detailed in the previous paragraphs in relation to the first aspect of the invention are also preferred embodiments according to this aspect of the invention.

[0173] In some embodiments, the in vitro method of the invention comprises one step of contacting a cell, a cell population or a cell line with a complex according to the invention, or a polynucleotide according to the invention, or a vector according to the invention.

[0174] Without being bound by any theory, complexes comprising cell-penetrating polypeptides (CPPs) according to the present invention may be endocytosed, leading to a conformational change in the translocation domain, ultimately resulting in the release of cargo molecules from the CPPs in the cytoplasm.

[0175] The complex according to the invention, or the polynucleotide according to the invention, or the vector may be purified before being used in the method according to the invention.

[0176] The cell, cell population, or cell line is preferably a eukaryotic cell or cell line. The cell, cell population, or cell line may be an animal cell, cell population, or cell line. The cell, cell population, or cell line may be a mammalian cell, cell population, or cell line. The cell, cell population, or cell line may be a human cell, cell population, or cell line. The cell, cell population, or cell line may be a primary cell, cell population, or cell line, particularly a human primary cell, cell population, or cell line. The cell, cell population, or cell line may be an immortalized cell, cell population, or cell line, particularly a human immortalized cell, cell population, or cell line. The cell, cell population, or cell line may be an immune cell, cell population, or cell line, particularly a human immune cell, cell population, or cell line.

[0177] The cells, cell populations, or cell lines may be lymphocytic cells, cell populations, or cell lines, particularly B or T lymphocytic cells, cell populations, or cell lines. The cells, cell populations, or cell lines may be neuronal cells, cell populations, or cell lines, particularly primary neuronal cells or cell populations. The cells, cell populations, or cell lines may be epithelial cells, cell populations, or cell lines, particularly epithelial cancer cells or cell populations.

[0178] The CPP according to the present invention, the complex according to the present invention, the fusion polypeptide according to the present invention, the polynucleotide or set of polynucleotides according to the present invention, or the vector according to the present invention can be used in, for example: - Gene editing (e.g., using CRISPR / Cas9), inserting DNA fragments into the genome; -modification of gene expression (epigenetic modifications such as methylation, mRNA degradation, e.g. using CRISPR / Cas14a), -removal of viral DNA from the genome, -induction of cell death in specific cell types, - targeting of intracellular proteins and factors to the ubiquitin-proteasome system and / or induction of intracellular protein degradation; -Regulation of protein localization, - Generation of CAR-T cells, and / or -It can be used for applications such as enzyme replacement therapy.

[0179] A further object of the present invention is a composition comprising a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention.

[0180] All embodiments detailed in the previous paragraphs in relation to the first aspect of the invention are also preferred embodiments according to this aspect of the invention.

[0181] In some embodiments, a composition according to the invention is a pharmaceutical composition or medicament and further comprises at least one pharmaceutically acceptable excipient.

[0182] In some embodiments, a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of these, is formulated for administration to a subject.

[0183] In some embodiments, a CPP according to the present invention, a complex according to the present invention, a fusion polypeptide according to the present invention, a polynucleotide according to the present invention, or a vector according to the present invention, or a composition or pharmaceutical composition comprising any of these, is administered systemically or locally.

[0184] In some embodiments, a CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of the same, is administered by injection, oral, topical, nasal, buccal, rectal, vaginal, intratracheal, endoscopic, transmucosal, or transdermal administration.

[0185] In some embodiments, a CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of the same, is injected, preferably systemically.

[0186] Examples of injectable preparations include, but are not limited to, solutions such as sterile aqueous solutions, gels, dispersions, emulsions, suspensions, solid forms suitable for preparing a solution or suspension by adding a liquid prior to use, such as powders, liposomal forms, and the like.

[0187] Examples of systemic injections include, but are not limited to, intravenous injection (iv), subcutaneous injection, intramuscular injection (im), intradermal injection (id), intraperitoneal injection (ip), intranasal injection (in), and perfusion.

[0188] Other suitable routes of administration are contemplated by the present invention, it being understood that the mode of administration will ultimately be decided by the attending physician within the scope of sound medical judgment.

[0189] In some embodiments, a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of these, is administered to a subject in need thereof in a therapeutically effective amount.

[0190] It will be understood, however, that the dosage of a CPP according to the present invention, a conjugate according to the present invention, a fusion polypeptide according to the present invention, a polynucleotide according to the present invention, or a vector according to the present invention, or a composition or pharmaceutical composition comprising any of these, will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective amount for a particular patient will depend on a variety of factors, including the disease and severity of the disease to be prevented; the activity of the CPP according to the present invention, the conjugate according to the present invention, the fusion polypeptide according to the present invention, the polynucleotide according to the present invention, or the vector according to the present invention, or the composition or pharmaceutical composition comprising them; the age, weight, general health, sex, and diet of the subject; the timing, route of administration, and excretion rate of the CPP according to the present invention, the conjugate according to the present invention, the fusion polypeptide according to the present invention, the polynucleotide according to the present invention, the vector according to the present invention, or the composition or pharmaceutical composition comprising them; the duration and regimen of treatment; drugs used in combination or simultaneously with the CPP according to the present invention, the conjugate according to the present invention, the fusion polypeptide according to the present invention, the polynucleotide according to the present invention, or the vector according to the present invention, or the composition or pharmaceutical composition comprising them; and factors well known in the medical art.

[0191] In some embodiments, the CPP according to the invention, the conjugate according to the invention, the fusion polypeptide according to the invention, the polynucleotide according to the invention, or the vector according to the invention, or a composition or pharmaceutical composition comprising them, is for use as a medicament, in particular for use in the prevention and / or treatment of disease.

[0192] The disease to be prevented and / or treated is, for example, an α-synucleinopathic disorder such as Parkinson's disease, multiple system atrophy, or dementia with Lewy bodies; a tauopathy such as Alzheimer's disease, frontotemporal dementia, or Pick's disease; or a tumor or cancer.

[0193] Thus, in some embodiments, a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of these, is for use as a medicament.

[0194] In some embodiments, the CPP according to the invention, the complex according to the invention, the fusion polypeptide according to the invention, the polynucleotide according to the invention, or the vector according to the invention, or a composition or pharmaceutical composition comprising any of them, is for use in the prevention and / or treatment of an α-synucleinopathy such as Parkinson's disease, multiple system atrophy, or dementia with Lewy bodies, for example, for the prevention and / or treatment of Alzheimer's disease, frontotemporal dementia, tauopathy such as Pick's disease, tumors, or cancer.

[0195] The CPP according to the invention, the conjugate according to the invention, the fusion polypeptide according to the invention, the polynucleotide according to the invention, or the vector according to the invention, or a composition or pharmaceutical composition comprising any of them, may be for use in cell therapy, for example, for generating CAR-T cells, or for allogeneic CAR-T cell therapy, allogeneic stem cell therapy, or enzyme replacement therapy.

[0196] In some embodiments, the method according to the invention is used to prevent and / or treat a disease in a subject in need thereof, and comprises administering to the subject a CPP according to the invention, a complex according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of them.

[0197] In some embodiments, a therapeutically effective amount of at least one CPP in accordance with the invention, a conjugate in accordance with the invention, a fusion polypeptide in accordance with the invention, a polynucleotide in accordance with the invention, or a vector in accordance with the invention, or a composition or pharmaceutical composition comprising the same, is administered at least once a day, twice a day, at least three times a day, or at least four times a day.

[0198] In other embodiments, a therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of the above, is administered every 2, 3, 4, 5, or 6 days.

[0199] In other embodiments, a therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising the same, is administered twice a week, every week, once every two weeks, or once a month.

[0200] In other embodiments, a therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising same, is administered monthly for at least 2 months, 3 months, 4 months, 5 months, 6 months, or for the remainder of the subject's lifespan.

[0201] In other embodiments, the therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of the same, is in the range of about 1 μg to 100 g, 1 mg to 1 g, or 10 mg to 500 mg.

[0202] In another embodiment, the therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of these, is in the range of about 10 to 100 mg, preferably 60 mg.

[0203] In other embodiments, the therapeutically effective amount of at least one CPP according to the invention, a conjugate according to the invention, a fusion polypeptide according to the invention, a polynucleotide according to the invention, or a vector according to the invention, or a composition or pharmaceutical composition comprising any of the same, is in the range of about 0.1 μg / kg to 1 g / kg body weight, 0.1 mg / kg to 500 mg / kg body weight, or 10 mg / kg to 100 mg / kg body weight.

[0204] The present invention also provides - obtaining a purified complex comprising a cell-penetrating polypeptide (CPP) according to the invention bound to a molecule of interest; - contacting said complex with a cell or a population of cells; This relates to an in vitro assay for the uptake of a molecule of interest into a cell or cell population, comprising incorporating the molecule of interest into the cell or cell population.

[0205] In some embodiments, the in vitro assay involves the incorporation of the antibody into a cell or cell population.

[0206] In some embodiments, the assay involves uptake of the complex or molecular complex in a cell or cell population.

[0207] In some embodiments, the in vitro assay is for modifying DNA material in a cell or population of cells by incorporation of a CRISPR-associated protein complexed with an sgRNA. [Brief explanation of the drawings]

[0208] [Figure 1] Figure 1 is a schematic diagram illustrating an intracellular delivery strategy using the CNF1 delivery mechanism by replacing the catalytic domain (C domain) with a cargo of interest. 1) The A1 and A2 domains of CNF1 enable receptor binding. 2) CNF1 enters the cell via endocytosis. 3) Upon endosome acidification, CNF1 changes conformation, thereby releasing the cargo through the plasma membrane into the host cell cytoplasm. [Figure 2] FIG. 2 shows a plasmid vector for expressing FlagSE-CRISPR Cas9EGFP. [Figure 3] Figure 3 shows gene knockout using SE-CRISPR / Cas9EGFP. a) SE-CRISPR / Cas9EGFP successfully knocked out gene expression. HeLa cells stably expressing EGFP-p65 were treated with control or purified FlagSE-CRISPR / Cas9EGFP. 20 hours after treatment, cells were fixed and permeabilized, and nuclei were stained with DAPI. Coverslips were analyzed under a fluorescent microscope. Photographs were analyzed using ImageJ (Figure 3a). Box-and-whisker plots show EGFP intensity in untreated and FlagSE-CRISPR / Cas9EGFP-treated cells. b) SE-CRISPR / Cas9EGFP successfully knocked out EGFP gene expression. HeLa cells stably expressing EGFP-p65 were treated with control or purified FlagSE-CRISPR / Cas9EGFP. 20 hours after treatment, cells were lysed in 2x Laemmli buffer. Proteins from each condition were separated using SDS / Page and transferred to a PVDF membrane. Efficacy of the knockout was confirmed using antibodies against EGFP and a loading control against GAPDH. Immunoblot quantification showed a reduction in EGFP protein levels following FlagSE-CRISPR / Cas9EGFP treatment. [Figure 4]Figure 4 shows the construction and testing of the SE-NanoEGFP plasmid. a) Plasmid map for expression of the OCDM-nanobody against EGFP (FlagSE-NANOEGFP). b) Immunofluorescence showing colocalization of cytoplasmic FlagSE-NanoEGFP and EGFP-Rab6. Hek293T cells seeded on coverslips were transfected with the EGFP-Rab6 plasmid for 24 hours. Cells were then treated with 5% purified FlagSE-NanoEGFP for 1 hour. After washing twice with PBS, cells were fixed and permeabilized. Cytoplasmic FlagSE-NanoEGFP was stained with a FLAGM2 antibody and detected with a Texas Red-conjugated secondary antibody against mouse IgG. [Figure 5]Figure 5 shows in cellulo knockout of TCRα in primary T cells from healthy donors. a) Primary CD4+ T cells from healthy donors were activated using CD3 / CD28 beads and complemented with IL2 (10 ng / mL) as described in the methods. From day 3 onwards, cells showed very robust proliferation. b) Number of activated CD4+ T cells after 24 and 48 hours of treatment with 5 μg of FLAGSE (condition 1), FLAGSE-CRISPR / Cas9TCRα1 (condition 2), and FLAGSE-CRISPR / Cas9TCRα2 (condition 3). c) Immunoblot quantification showing the reduction of TCRα protein levels in whole lysates from cells treated for 48 hours as in 5b. Cells were lysed in 2x Laemmli buffer supplemented with reducing agents. Proteins from each condition were separated by SDS-PAGE and then transferred to a PVDF membrane. Efficacy of the knockout was demonstrated using an antibody against TCRα (catalog no. TCR1145), and protein loading consistency was verified using an antibody against GAPDH. (d) Fold change relative to condition 1. (e) Geometric mean (arbitrary units) of TCRα fluorescence measured by flow cytometry assay using Flowjo software. This shows the reduction in TCRα levels from cells in conditions 2 and 3 compared to condition 1 (treated as in b). Fixed cells were treated with TCRα primary antibody (diluted 1:50 in PBS with 0.1% TWEEN 20) for 1 hour. After washing twice with PBS, cells were stained with FITC-conjugated secondary antibody (diluted 1:1000 in PBS with 0.1% TWEEN 20) for 1 hour and analyzed on a Beckman Coulter CytoFLEX. [Figure 6]Figure 6 shows in cellulo knockout of SNCAm in primary neurons. a) Overview of the in vitro SNCA knockout procedure in primary neurons. b) Photographs of neuronal striatal cells at days 2 and 10. c) Immunoblot quantification showed a strong reduction in SNCA protein levels in whole lysates from cells treated with FlagSE-CRISPR / CasSNCAm for 48 hours compared to control. Cells were lysed in 2x Laemmli buffer supplemented with reducing agents. Proteins from each condition were separated using SDS / Page and then transferred to a PVDF membrane. Efficacy of the knockout was demonstrated using an antibody against SNCA (Cat. No. PA5-85791) and a loading control against GAPDH. [Example]

[0209] The present invention is further illustrated by the following examples.

[0210] Example 1: Delivery of large functional ribonucleoproteins Materials and Methods Construction of an expression vector containing the recombinant protein. A DNA sequence encoding the delivery mechanism of cytotoxic necrotic factor 1 (CNF1) was generated using GeneArt Services. This sequence is referred to as OCDM, an acronym for Optimized sequence of CNF Delivery Mechanism. This sequence was optimized for expression in mammalian cells. OCDM was amplified by PCR using the following probes: 1FWD: ACGACAAGCTTGCGGCCGCGAATTCACATCACCATCACCAT (SEQ ID NO: 30) 1RVS: GATGCCACCCGGGATCCTCTCCAGGCCGATGCTGTACTTCT (SEQ ID NO: 31). 1 μg of the PCR product was digested with EcoRI (R0101S) and XmaI (R0180S) according to the manufacturer's protocol. 100 ng of the digested OCDM was ligated into 50 ng of pre-linearized pCMV-Flag vector with EcoRI and XmaI. Next, the CMV-flag-OCDM sequence was amplified using the following probes (2FWD: CAAATGGCTCTAGAGGTACCCGTTACATAACTTACGGTAA (SEQ ID NO: 32) 2RVS: CCGATGCTGTACTTCTTGTCG (SEQ ID NO: 33)), and pSpCas9(BB)-2APuro (Addgene 62988 Feng Zhang Lab) was amplified using the following probes (3FWD: GACAAGAAGTACAGCATCGGC (SEQ ID NO: 34) 3RVS: GGTACCTCTAGAGCCATTTG (SEQ ID NO: 35)). 100 ng of each PCR product was mixed and diluted with Geneart GIBSON mastermix (HiFi A46628) was used to stitch the vector according to the manufacturer's protocol. As shown in Figure 2, the final vector contained a U6 promoter followed by a sequence encoding a single guide RNA construct for EGFP (guide FWD: GGGCGAGGAGCTGTTCACCG (SEQ ID NO: 36); guide RVS: AAACCGGTGAACAGCTCCTCGCCC (SEQ ID NO: 37)) and an OCDM sequence upstream of the csn1 gene (CRISPR Cas9) derived from S. pyrogenes under the control of a CMV promoter.The clustered regularly interspaced short palindromic repeats (CRISPR) CRISPR-associated protein (Cas9) binds to a synthetic single guide RNA (sgRNA) to form a ribonucleotide complex and cleave double-stranded DNA hydrogen bonds. The sgRNA guides CRISPR-Cas9 to a complementary 20-nucleotide sequence upstream of a protospacer adjacent motif (PAM) sequence. This construct allows the expression of a synthetic fusion of OCDM and CRISPR-Cas9, along with a single guide RNA for EGFP, to assemble a functional ribonucleoprotein complex.

[0211] Expression of recombinant proteins in HEK293T cells Cell Expression Protocol: 4.10 6 HEK293T cells were seeded onto 100 mm cell plates. The next day, cells were transfected with 5 μg of plasmid using Lipofectamine 2000 (ThermoFisher Scientist, 11668027) according to the manufacturer's protocol. 48 hours after transfection, cells were lysed using multiple buffers and methods to assess solubility and extraction.

[0212] The optimal lysis protocol was determined as follows: Plated cells were placed on ice and washed with pre-chilled PBS to remove residual cell culture medium. 150 μl of lysis buffer (Tris-HCl 50 mM pH 8, NaCl 100 mM, pmsf 100 nM) was added to the plate and incubated on ice for 10 minutes. Cells were scraped, transferred to an Eppendorf tube, and subjected to soft sonication (five 15-second pulses at 15%). Cells were centrifuged at 10,000 g for 10 minutes, and the soluble fraction was transferred to a clean tube and the pellet discarded. 30 μl of the soluble fraction was mixed with 10 μl of loading buffer (4x Laemmli buffer supplemented with 400 mM DTT). The lysate was loaded onto a 4-12% Tris-Glycine Gel (Thermo NP0322BOX) and transferred to a PVDF membrane. The expression levels of the synthetic constructs were assessed by Western blot using a FLAG-M2 primary antibody (Sigma F1804) and a secondary anti-mouse HRP (data not shown).

[0213] Purification of ribonucleoprotein complexes 5*10 in 3x100mm2 dish 6HEK293T cells were seeded onto the plate. After 24 hours, the cells were transfected with 5 μg of plasmid using Lipofectamine 2000 according to the manufacturer's protocol. 48 hours after transfection, cells from each plate were lysed in 500 μl of optimal lysis buffer, and the following protocol was followed: lysates were pooled into a single 2 ml tube. 40 μl of the clarified lysate (2.5%) was removed, and the remainder was incubated with 100 μl of Slurry FlagM2-beads (reference) for 2 hours. The beads were centrifuged at 500 g for 2 minutes and washed four times with 1.5 ml of lysis buffer. Recombinant proteins were eluted by competition with 200 μl of Flag peptide (Flag [0.5 mg / ml] in Tris-HCl 50 mM pH 8, NaCl 100 mM, MgCl2 10 mM) for 30 minutes at 4°C. Loading buffer was added to the beads to assess elution efficiency. The input, beads, and elution fractions were separated by Western blot to assess purification efficiency (data not shown). Thirty microliters of the purified solution was incubated with 300 ng of EGFP plasmid diluted in elution buffer, and vector linearization was assessed by DNA electrophoresis on a 1% agarose gel in TAE buffer (data not shown).

[0214] In cellulo knockout of EGFP 25,000 HeLa cells stably expressing EGFP-p65 were seeded onto p24 wells with coverslips and treated with either 40 μl of elution buffer or 40 μl of recombinant OCDM-CRISPR Cas9 protein (hereafter referred to as FlagSE-CRISPR Cas9EGFP) (SE stands for self-entering, and EGFP stands for single RNA guide targeting EGFP). After 24 h of treatment, cells were fixed with 4% paraformaldehyde in PBS, and coverslips were mounted using MOWIOL (Merck 81381) supplemented with Hoescht (1 / 50,000). Mean fluorescence was assessed using a fluorescence microscope (Olympus BX53F2) and quantified using ImageJ (Figure 3a). 25,000 HeLa cells stably expressing EGFP-p65 were seeded onto p48 wells and treated with either 40 μl of elution buffer or 40 μl of recombinant FlagSE-CRISPR Cas9. EGFP After 24 hours of treatment, cells were lysed in Laemmli buffer supplemented with 100 mM DTT. Lysates were separated on a 4-12% Tris-glycine acrylamide gel (Thermo NP0322BOX) before being transferred to a PVDF membrane. EGFP levels were determined by immunoblotting using a primary antibody (Novus NB600-308) and an HRP-conjugated secondary anti-rabbit antibody (Figure 3b).

[0215] result The experimental results in Example 1 demonstrated that the CNF1 entry mechanism can be transplanted into a very large ribonucleoprotein called CRISPR-Cas9 and its associated sgRNA. The final synthesized protein is soluble and can be purified using affinity chromatography. Furthermore, by co-expressing a single guide RNA with FlagSE-CRISPR-Cas9, we were able to purify a functional complex capable of cleaving DNA in vitro. Cells stably expressing EGFP-p65 were transfected with FlagSE-CRISPR-Cas9. EGFPTreatment with CNF1 silences EGFP expression in these cells, as measured by fluorescence or Western blot. Overall, the results of Example 1 demonstrate that the CNF1 delivery mechanism can be used to deliver functional large ribonucleoproteins into cells.

[0216] Example 2: Delivery of small single-chain antibodies Materials and Methods Construction of an expression vector containing the recombinant protein. OCDM was amplified by PCR using the following probes (4FWD: CTTGTCGTCATCGTCTTTGTAGTCGTCAACTTCGTC (SEQ ID NO: 38) 4RVS: GCCGCGAATTCACATCACCATCACCATCAC (SEQ ID NO: 39)). Next, the pCMV-Flag vector was amplified using the following probes: 5FWD: GTGATGGTGATGGTGATGTGAATTCGCGGCCGCAAG (SEQ ID NO: 40) 5RVS: acccaggttaccgttagcagcAGAGGATCCCGGGTGGCAT (SEQ ID NO: 41)). The sequence of a single-chain antibody targeting EGFP (referred to here as nanobody) was amplified from the plasmid (pGEX6P1-GFP-Nanobody) (Addgene 61838) using the following probes: 6FWD: GACTACAAAGACGATGACGACAAGGTTCAGCTGGTTGAA (SEQ ID NO: 42) 6RVS: GATGCCACCCGGGATCCTCTGCTGCTAACGGTAAC (SEQ ID NO: 43)). 100 pmol of each PCR product was mixed and stitched using Geneart GIBSON Master Mix according to the manufacturer's protocol. As shown in Figure 4a, the final constructed vector contains an OCDM sequence followed by an EGFP-targeting nanobody under the control of the CMV promoter.

[0217] Expression and purification of nanobodies in HEK293T cells 105 HEK293T cells were seeded into two p12 wells. The next day, cells were transfected with 0.5 μg of plasmid using Lipofectamine 2000 according to the manufacturer's protocol. Cells were lysed as follows: Plated cells were placed on ice and washed with pre-chilled PBS to remove residual cell culture medium. 100 μl of lysis buffer (Tris-HCl 50 mM pH 8, NaCl 100 mM, PMSF 100 nM) was added to the plate and incubated on ice for 10 minutes. The cell lysate was centrifuged at 10,000 x g for 10 minutes, the soluble fraction was transferred to a clean tube (1.5 mL), and the pellet was discarded. 30 μl of the soluble fraction was mixed with 10 μl of loading buffer (4x Laemmli buffer supplemented with 400 mM DTT). The lysate was loaded onto a 4-12% Tris-Glycine Gel (Thermo NP0322BOX) and transferred to a PVDF membrane. Expression levels of the synthetic constructs were assessed by Western blot using a Flag-M2 primary antibody (Sigma F1804) and a secondary anti-mouse HRP (data not shown).

[0218] 5*10 in 5 T75 flasks 6 HEK293T cells were inoculated with 5 μg of the expression vector FlagSE-Nano. EGFPThe cells were transfected using Lipofectamine 2000 according to the manufacturer's protocol. 24 hours after transfection, each plate was lysed with 500 μl of lysis buffer at 4°C and then pooled into one tube. The entire lysate was syringed and centrifuged at 10,000 g for 10 minutes. The soluble fraction was transferred to a 15 ml tube, and the pellet was discarded. 400 μl of Flag M2 resin slurry was equilibrated with 1 ml of lysis buffer and mixed with the entire lysate at 4°C for 2 hours to purify the recombinant protein. The beads were then centrifuged at 500 g for 2 minutes and washed four times with 1.5 ml of lysis buffer. The recombinant protein was eluted by competition with 1 ml of Flag peptide for 30 minutes at 4°C (Flag [0.1 mg / ml] in Tris-HCl 50 mM pH 8, NaCl 100 mM, MgCl2 10 mM). A 50 μl elution fraction was separated on a Tris-Glycine 4-12% gel and stained with Instant Blue (ab119211) to assess the purification efficiency and purity (data not shown).

[0219] Delivery of nanobodies into HEK293T cytoplasm 50,000 HEK293T cells were seeded into three p12 wells with coverslips. The following day, each well was transfected with 500 ng of EGFP-Rab6 expression vector using Lipofectamine 2000. The following day, two of the p12 wells were treated with 50 μl of the purified batch and one well with 50 μl of elution buffer. After 1 hour of treatment, cells were fixed with 4% paraformaldehyde in PBS and then permeabilized with 0.1% Triton for 10 minutes. To block nonspecific antibody binding, the cells were then incubated for 1 hour in 500 μl of PBS containing 5% BSA. The coverslips were then stained with a FlagM2 primary antibody solution (diluted 1:500 in 5% PBS-BSA), followed by secondary antibody staining against mouse IGG conjugated with Alexa 594. The coverslips were mounted with Hoescht (1 / 50,000) in MOWIOL. The coverslips were then analyzed under a fluorescent microscope (Fig. 4b).

[0220] result From the experimental results of Example 2, the CNF1 entry mechanism was confirmed by a small single-chain antibody against EGFP (hereinafter referred to as FlagSE-Nano EGFP The final synthesized protein was soluble and could be purified using affinity chromatography. Finally, cells expressing EGFP-Rab6 were transfected with FlagSE-Nano. EGFP The cells were treated with FlagSE-Nano for 1 hour. EGFP The cells were stained with Flag antibody to observe the cytoplasmic localization of the synthetic nanobody bearing EGFP-Rab6. Overall, the results of Example 2 confirmed that the CNF1 delivery mechanism can be used to deliver small single-chain antibodies.

[0221] Example 3: CNF as an exogenous carrier for editing primary immune cells using the CRISPR / Cas system Materials and Methods An sgRNA guide against the TCR α subunit gene was inserted into a FLAGSE-CRISPR / Cas9 expression vector. As described in Example 1, two independent guides for the TCR alpha constant region were inserted into a custom vector containing a U6 promoter and OCDM-CRISPR / Cas9.

[0222] TCRα guide1 FWD:GATTAAACCCGGCCACTTTCAGG (SEQ ID NO: 48)

[0223] TCRα guide1 RVS: CCTGAAAGTGGCCGGGTTTAATC (SEQ ID NO: 49)

[0224] TCRα guide2 FWD: TGTGCTAGACATGAGGTCTA (SEQ ID NO: 50).

[0225] TCRα guide2 RVS:TAGACCTCATGTCTAGCACA (SEQ ID NO: 51).

[0226] As a result, FLAGSE-CRISPR / Cas9 TCRα1and FLAGSE-CRISPR / Cas9 TCRα2 Two independent vectors, designated as OCDM and CRISPR / Cas9 constructs, were obtained. These constructs express a synthetic fusion product of OCDM and CRISPR / Cas9 together with two single guide RNAs against TCRα to form a functional complex.

[0227] FLAGSE-CRISPR / Cas9 TCRa1 and FLAGSE-CRISPR / Cas9 TCRa2 Purification of the complex 10 in 5 T175 flasks 7 HEK293T cells were seeded onto the flask. 24 hours later, each flask was transfected with 5 μg of plasmid using Lipofectamine 2000 according to the manufacturer's protocol. 48 hours after transfection, cells were detached using trypsin-EDTA. Cells were then centrifuged at 500 g, washed once with PBS, and lysed in 20 mL of optimal lysis buffer using the same protocol as described in Example 1. After sonication, the insoluble fraction was removed from the total lysate by centrifugation (10,000 g, 10 min). The insoluble fraction was discarded, and the soluble fraction was incubated with 400 μL of equilibrated Slurry FLAGM2-beads for 2 hours to capture soluble Flag-tagged proteins. The beads were centrifuged at 500 × g for 2 minutes and washed four times with 5 mL of lysis buffer. The recombinant protein was eluted by competition with 500 μL of FLAG peptide (FLAG [0.5 mg / mL] in Tris-HCl 50 mM pH 8, NaCl 100 mM, MgCl2 10 mM) for 1 h at 4°C. 50 μL of the eluted fraction was separated on a Tris-Glycine 4-12% gel and stained with Instant Blue (ab119211) to assess the purification efficiency and purity (data not shown).

[0228] TCRα was knocked out in cellulo from primary T cells from healthy donors. 10 7A vial of 1 million T lymphocytes (obtained from Lonza, donor number: 42819) was thawed in complete medium (RPMI supplemented with glutamine and 10% heat-inactivated human AB serum). 7 Cells were activated with CD3 / CD28 beads and IL-2 (10 ng / mL) (cells were fed with medium changes every 2 days). Cells were counted daily and viability was checked using trypan blue. T cell activation and proliferation was achieved after 3 days (Figure 5a).

[0229] On day 7, 1.5x10 6 Activated T cells were evenly distributed across a 12-well plate. The next day, the cells were incubated with approximately 5 μg of control (FLAGSE-condition 1), FLAGSE-CRISPR / Cas9 TCRa1 (Condition 2), FLAGSE-CRISPR / Cas9 TCRa2 Cells were treated with either 1 or 2 of the following conditions: (1) Normal TCRα (condition 1), (2) Normal TCRα (condition 2), (3) Normal TCRα (condition 3), (4) Normal TCRα (condition 4), (5) Normal TCRα (condition 5), (6) Normal TCRα (condition 6), (7) Normal TCRα (condition 7), (8) Normal TCRα (condition 8), (9) Normal TCRα (condition 9), (10) Normal TCRα (condition 10), (11) Normal TCRα (condition 11), (12) Normal TCRα (condition 12), (13) Normal TCRα (condition 13), (14) Normal TCRα (condition 14), (15) Normal TCRα (condition 15), (16) Normal TCRα (condition 16), (17) Normal TCRα (condition 17), (18) Normal TCRα (condition 18), (19) Normal TCRα (condition 19), (20) Normal TCRα (condition 20), (21) Normal TCRα (condition 21), (22) Normal TCRα (condition 22), (23) Normal TCRα (condition 23), (24) Normal TCRα (condition 24), (25) Normal TCRα (condition 25), (26) Normal TCRα (condition 26), (27) Normal TCRα (condition 27), (28) Normal TCRα (condition 28), (29) Normal TCRα (condition 29), (30) Normal TCRα (condition 29), (31) Normal TCRα (condition 29), (32) Normal TCRα (condition 29), (33) Normal TCRα (condition 29), (34) Normal TCRα (condition 29), (35

[0230] result: FLAGSE-CRISPR / Cas9 TCRα1 and FLAGSE-CRISPR / Cas9 TCRα2 demonstrated very high efficiency in knocking out the expression of the TCR α subunit of the TCR complex, as measured by Western blot and flow cytometry. TCRα1 , or FLAGSE-CRISPR / Cas9 TCRα2 Cells treated with FLAGSE showed no cytotoxicity or cell death and continued to divide 48 hours after treatment, suggesting that FLAGSE-CRISPR / Cas9 can be used to generate allogeneic immune cells (e.g., TCR-deficient T lymphocytes) or to insert CAR receptors into immune cells (e.g., CAR-T cells).

[0231] Example 4: CNF as an exogenous carrier for editing neurons using the CRISPR / Cas system Materials and Methods Mouse α-synuclein (SNCA m ) The sgRNA guide for the gene was inserted into a FlagSE-CRISPR / Cas9 expression vector. SNCA m A DNA sequence encoding an RNA guide for was inserted into a custom vector containing a U6 promoter and OCDM-CRISPR / Cas9, as described in Example 1.

[0232] SNCA m guide1 FWD:AGGGAGTCCTCTATGTAGGTAGG (SEQ ID NO: 52)

[0233] SNCA m guide1 RVS:CCTACCTACATAGAGGACTCCCT (SEQ ID NO: 53).

[0234] As a result, FlagSE-CRISPR / CAS9 SNCAm A vector named SNCA was obtained, which contains a synthetic fusion of OCDM and CRISPR / CAS9. m We were able to express it together with a single guide RNA against the α-glucanase gene and construct a functional complex.

[0235] FlagSE-CRISPR / Cas9 SNCAm Purification of 10 in 5 T175 flasks 7HEK293T cells were seeded onto the flask. 24 hours later, each flask was transfected with 5 μg of plasmid using Lipofectamine 2000 according to the manufacturer's protocol. 48 hours after transfection, cells were detached using trypsin-EDTA. Cells were then centrifuged at 500 g, washed once with PBS, and lysed in 20 ml of optimal lysis buffer, following the same protocol as in Example 1. After sonication, the total lysate was removed by centrifugation (10,000 g x 10 min). The insoluble fraction was discarded, and the remainder was incubated with 400 μl of equilibrated Slurry FlagM2-beads for 2 hours to capture soluble Flag-tagged proteins. The beads were centrifuged at 500 g for 2 minutes and washed four times with 5 ml of lysis buffer. The recombinant protein was eluted by competition with 500 μl of Flag peptide (0.5 mg / ml Flag, 50 mM Tris-HCl pH 8, 100 mM NaCl, 10 mM MgCl2) for 1 h at 4°C. A 50 μl elution fraction was separated on a Tris-Glycine 4-12% gel and stained with Instant Blue (ab119211) to assess purification efficiency and purity (data not shown).

[0236] In cellulo knockout of SNCAm in primary neurons Four million mouse primary brain striatal neurons (obtained from Lonza, reference number M-CP-402) were thawed in Lonza's recommended medium (PNG M™ BulletKit™) and plated into four p12 wells precoated overnight with laminin (30 μg / ml) and poly-D-lysin (50 μg / ml). 50% of the medium was replaced every three days. Neurite formation was observed one week after thawing (Figure 6b).

[0237] On day 10, cells were incubated with approximately 5 μg of control (FlagSE-condition 1), 10 μg of control (FlagSE-condition 2), or 5 μg of FlagSE-CRISPR / Cas9. SNCAm (Condition 3), or 10 μg of FlagSE-CRISPR / Cas9 SNCAmThe cells were treated with condition 4 (Fig. 6a). After 48 hours of treatment, the cells were lysed with Laemmli and immunoblotted to measure the total SNCA protein level. GAPDH was used as a loading control (Fig. 6c).

[0238] result: FlagSE-CRISPR / Cas9 SNCAm demonstrated very high efficiency in knocking out α-synuclein expression as measured by Western blot. SNCAm Cells treated with FlagSE-CRISPR / Cas9 showed no cytotoxicity after 48 hours of treatment. This suggests that FlagSE-CRISPR / Cas9 can be used to edit genes in neurons and has applications in neurobiology. Therefore, blocking alpha-synuclein expression using FlagSE-CRISPR / Cas9 may be a therapeutic solution for treating Parkinson's disease. [Table 2] JPEG2025535146000005.jpg217159JPEG2025535146000006.jpg186159

Claims

1. A cell-penetrating polypeptide (CPP) comprising an amino acid sequence derived from or consisting of a portion of a virulence factor, said CPP being associated with or adapted to be associated with a heterologous cargo.

2. 2. The CPP of claim 1, wherein the virulence factor is a cytotoxic necrosis factor (CNF) family member selected from among cytotoxic necrosis factor 1 (CNF1), cytotoxic necrosis factor 2 (CNF2), cytotoxic necrosis factor 3 (CNF3), and cytotoxic necrosis factor gamma (CNFγ).

3. The CPP comprises, from N-terminus to C-terminus: - a first receptor-binding domain of the virulence factor, - the translocation domain of one of the virulence factors; 3. The CPP of claim 1, comprising:

4. The CPP of claim 1 , wherein the first receptor-binding domain is a laminin receptor-binding domain.

5. The CPP of claim 4, wherein the laminin receptor binding domain comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:18, or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:

18.

6. 6. The CPP of any one of claims 3 to 5, wherein the translocation domain comprises or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 16 or SEQ ID NO:

19.

7. The CPP of claim 3 , wherein the CPP further comprises a second receptor binding domain.

8. 8. The CPP of claim 7, wherein the second receptor binding domain comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:17, or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:11, SEQ ID NO:14, or SEQ ID NO:

17.

9. 9. The CPP of any one of claims 1 to 8, wherein the CPP comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26, or consists of an amino acid sequence that is at least 85% identical to SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:

26.

10. A complex comprising a cell-penetrating polypeptide (CPP) according to any one of claims 1 to 9 associated with a cargo.

11. 10. A polynucleotide or set of polynucleotides encoding a cell penetrating polypeptide (CPP) according to any one of claims 1 to 9, or encoding a cell penetrating polypeptide (CPP) according to any one of claims 1 to 9 and encoding and / or constituting said heterologous cargo or part of said heterologous cargo.

12. A recombinant expression vector comprising the polynucleotide or set of polynucleotides according to claim 11.

13. A cell comprising a cell-penetrating polypeptide (CPP) described in any one of claims 1 to 9, a complex described in claim 10, a polynucleotide or set of polynucleotides described in claim 11, or a recombinant expression vector described in claim 12.

14. An in vitro method for inducing or delivering a molecule of interest to a cell, comprising contacting the cell with the complex described in claim 10, the polynucleotide or set of polynucleotides described in claim 11, or the recombinant expression vector described in claim 12.

15. A cell-penetrating polypeptide (CPP) according to any one of claims 1 to 9, or a complex according to claim 10, a polynucleotide or set of polynucleotides according to claim 11, or a recombinant expression vector according to claim 12, for use as a pharmaceutical.