CAR-T constructs comprising novel CD19 conjugates coupled to IL18 and methods of use thereof

Abstract

The present invention relates to immune cells comprising one or more vectors comprising a nucleic acid sequence encoding a chimeric antigen receptor specific for CD19 and a nucleic acid sequence encoding an enhancer of T cell priming (e.g., IL-18), compositions comprising the T cells, and methods of generating and / or using the T cells to treat diseases associated with expression of CD19.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Provisional Application No. 63 / 417,216, filed October 18, 2022, and U.S. Provisional Application No. 63 / 426,944, filed November 21, 2022, the contents of which are incorporated herein by reference in their entireties for all purposes.

[0002] The present disclosure relates generally to T cells engineered to express a chimeric antigen receptor (CAR) and interleukin-18 to treat diseases associated with expression of the cluster of differentiation 19 protein (CD19). [Background technology]

[0003] Recent advances using chimeric antigen receptor (CAR)-modified autologous T cell (CART) therapy, which relies on redirecting T cells to appropriate cell surface molecules on cancer cells, such as B cell malignancies, have shown promising results in harnessing the power of the immune system to treat B cell malignancies and other cancers. SaSadelain et al., Cancer1907393 1Discovery3:388-398 (2013). Clinical results with murine-derived CART19 (i.e., "CTL019") have shown promise in establishing complete remissions in patients with pediatric acute lymphoblastic leukemia (ALL) as well as chronic lymphocytic leukemia (CLL). Despite the clinical success of various CD19 CAR T cell therapies, the therapeutic index of these therapies remains limited due to issues of immunogenicity, toxicity associated with CAR T cell infusion, and tumor recurrence.

[0004] Thus, there is an urgent need in the art for novel approaches that overcome or mitigate the adverse side effects of CAR T cell therapy and enable more effective, safe, and efficient adoptive immunotherapy. The present disclosure addresses this need. Summary of the Invention

[0005] One aspect of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain; and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or functional derivative thereof that enhances immune cell function. In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide.

[0006] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from the group consisting of a cytokine, an interferon, a chemokine, an antibody or antibody fragment, a checkpoint inhibitor antagonist, a dominant negative receptor, a switch receptor, and combinations thereof.

[0007] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from the group consisting of (a) chemokines, chemokine receptors, cytokines, cytokine receptors, and combinations thereof, (b) interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-13 (IL-13R), interleukin-14 (IL-14R), interleukin-15 (IL-15R), interleukin-16 (IL-16R), interleukin-17 (IL-17R), interleukin-18 (IL-18R), interleukin-19 (IL-19R), interleukin-20 (IL-19R), interleukin-21 (IL-19R), interleukin-22 (IL-19R), interleukin-23 (IL-19R), interleukin-24 (IL-19R), interleukin-25 (IL-19R), interleukin-26 (IL-19R), interleukin-27 (IL-19R), interleukin-28 (IL-19R), interleukin-29 (IL-2 ...0 (IL-29R), interleukin-21 (IL-29R), interleukin-21 (IL-29R), interleukin-22 (IL-2 or (c) a cytokine selected from the group consisting of interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor, alpha, beta, or gamma interferon, erythropoietin, and combinations thereof; or (d) a chemokine selected from CCL21, CCL19, or combinations thereof.

[0008] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function further comprises a leader sequence selected from the group consisting of an IL-2 signal sequence, an IL-12 signal sequence, a kappa leader sequence, a CD8 leader sequence, or an equivalent thereof.

[0009] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function comprises an IL-18 polypeptide, or a polypeptide having an amino acid sequence of SEQ ID NO:105, SEQ ID NO:215, SEQ ID NO:106, SEQ ID NO:107, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:105, SEQ ID NO:215, SEQ ID NO:106, or SEQ ID NO:107.

[0010] In some embodiments, the IL-18 polypeptide further comprises a CD8 leader sequence, or the amino acid sequence of SEQ ID NO:25, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:25.

[0011] In some embodiments, the IL-18 polypeptide comprises a mutation at a position selected from the group consisting of positions 42, 74, 85, 87, 89, 104, 112, 10, 132, 143, 149, 163, and 189 of SEQ ID NO:107.

[0012] In some embodiments, the IL-18 polypeptide comprises "E42A", "E42K", "K89A", "E42A and K89A", "E42K and K89A", "E42A and C74S", "E42A, C74S, and K89A", "C74S and K89A", "C74S, C112S, and C112S", "E42A, C74S, C112S, and C112S", "E42A, K89A, C74S, C112S, and C112S of SEQ ID NO:7".

[0013] In some embodiments, the IL-18 polypeptide (a) exhibits at least about a 2-fold increased activity compared to WT IL-18, (b) is resistant to IL18BP inhibition compared to WT IL-18, and / or (c) requires at least about a 4-fold higher concentration of IL-18BP for neutralization compared to WT IL-18.

[0014] In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector. In some embodiments, the vector is an in vitro transcription vector.

[0015] In some embodiments of the vectors disclosed herein, the constitutive promoter comprises a promoter selected from the group consisting of an EF-1α promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter. In some embodiments, the constitutive promoter (a) is an EF-1 promoter, or (b) comprises the sequence of SEQ ID NO: 101.

[0016] In some embodiments, the vector further comprises a rev response element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and / or a cPPT sequence. In that embodiment, the WPRE comprises the sequence of SEQ ID NO:100.

[0017] In some embodiments, the anti-CD19 binding domain comprises (a) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDRl) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDRl) of SEQ ID NO: 4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6, or (b) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDRl) of SEQ ID NO: 193, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195, and a heavy chain complementarity determining region 1 (HC CDRl) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR3) of SEQ ID NO: 197, and a heavy ...7, a heavy chain complementarity determining region 2 (HC CDR3) of SEQ ID NO: or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2) and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2) and a heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

[0018] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200.

[0019] In some embodiments, the CD19 binding domain is an scFv. In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0020] In some embodiments, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216, or (b) a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0021] In some embodiments, the anti-CD19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0022] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

[0023] In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29, 31, or 33. In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34. In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29.

[0024] In some embodiments, the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO:30, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30.

[0025] In some embodiments, the encoded anti-CD19 binding domain is linked to the transmembrane domain by a hinge region. In some embodiments, the hinge region (a) is derived from a protein selected from the group consisting of an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) comprises the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 35, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 27 or 35.

[0026] In some embodiments, the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27. In some embodiments, the hinge region comprises a nucleic acid sequence selected from SEQ ID NO:28 or SEQ ID NO:36, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:28 or 36.

[0027] In some embodiments of the vectors disclosed herein, the costimulatory domain of the CAR is a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137). In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0028] In some embodiments of the vectors disclosed herein, the intracellular signaling domain of the CAR comprises a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcεRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0029] In some embodiments, the intracellular signaling domain comprises the intracellular signaling domain of CD3ζ, the amino acid sequence of SEQ ID NO:52 or 54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:52 or 54. In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO:53 or 55, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55. In some embodiments, the CAR comprises a functional signaling 4-1BB costimulatory domain and a functional CD3ζ intracellular signaling domain.

[0030] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54. In some embodiments, the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 37 and the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54. In such embodiments, the sequences are expressed in the same frame and as a single polypeptide chain.

[0031] In some embodiments of the vectors disclosed herein, (a) the nucleic acid sequence comprises the sequence of SEQ ID NO: 38, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38, and / or (b) the nucleic acid sequence comprises the sequence of SEQ ID NO: 53 or SEQ ID NO: 55, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

[0032] In some embodiments, the CAR further comprises a leader sequence. In some embodiments, the leader sequence comprises SEQ ID NO:25. In some embodiments, the linker peptide (a) is selected from F2A, E2A, P2A, T2A, or Furin-(G4S)2-T2A (F-GS2-T2A), and / or (b) comprises the amino acid sequence of SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, or SEQ ID NO:99, and / or (c) comprises the nucleic acid sequence of SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, or SEQ ID NO:98.

[0033] One embodiment of the present disclosure provides a method for producing a chimeric antigen receptor (CAR), comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) (1) a LC CDR1 of SEQ ID NO: 1, a LC CDR2 and a LC CDR3 of SEQ ID NO: 2, a HC CDR1 of SEQ ID NO: 4, a HC CDR2 of SEQ ID NO: 5, and a HC CDR3 of SEQ ID NO: 6; or (2) a LC CDR1 of SEQ ID NO: 193, a LC CDR2 of SEQ ID NO: 194, a LC CDR3 of SEQ ID NO: 195, a HC CDR1 of SEQ ID NO: 196, a HC CDR2 of SEQ ID NO: 197, and a HC CDR3 of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain complementarity determining region 1 (HC CDR3) disclosed in Table 2. (ii) an anti-CD19 binding domain comprising a heavy chain variable domain comprising heavy chain complementarity determining region 2 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3); (ii) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R). In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and Furin-(G4S)2-T2A (F-GS2-T2A).

[0034] One embodiment of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-zeta; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R). In that embodiment, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, or Furin-(G4S)2-T2A (F-GS2-T2A).

[0035] One embodiment of the present disclosure provides a method for producing a chimeric antigen receptor (CAR), comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 29, 31, and 33; (iii) a costimulatory domain comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50; and (iv) a co-stimulatory domain comprising the amino acid sequence of SEQ ID NO: 52 or sequence and (b) a second polynucleotide comprising (i) a nucleic acid encoding amino acids of SEQ ID NO: 105, 215, 106, or 107, and / or (ii) an IL-18 polypeptide comprising "E42A," "E42K," "K89A," "E42A and K89A," "E42K and K89A," "E42A and C74S," "E42A, C74S, and K89A," "C74S, and K89A," "C74S, C112S, and C112S," "E42A, C74S, C112S, and C112S," or "E42A, K89A, C74S, C112S, and C112S of SEQ ID NO: 107." In this embodiment, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and Furin-(G4S)2-T2A (F-GS2-T2A).

[0036] One embodiment of the present disclosure provides a method for producing a chimeric antigen receptor (CAR), comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (iii) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (iv) an intracellular signaling domain of SEQ ID NO: 52 or SEQ ID NO: 54; and (b) a first polynucleotide comprising: (i) a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (iii) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (iv) an intracellular signaling domain of SEQ ID NO: 52 or SEQ ID NO: 54. and / or (ii) a second polynucleotide comprising an IL-18 polypeptide comprising: "E42A," "E42K," "K89A," "E42A and K89A," "E42K and K89A," "E42A and C74S," "E42A, C74S and K89A," "C74S and K89A," "C74S, C112S, and C112S," "E42A, C74S, C112S and C112S," "E42A, K89A, C74S, C112S, and C112S of SEQ ID NO: 107." In this embodiment, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and Furin-(G4S)2-T2A (F-GS2-T2A).

[0037] In some embodiments, the first polynucleotide comprises (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20, and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0038] Another aspect of the present disclosure provides a modified cell comprising the vector described herein. In some embodiments, the modified cell is an immune cell or a precursor cell thereof.

[0039] In some embodiments, the modified cells are selected from the group consisting of T cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, natural killer T (NKT) cells, dendritic cells, macrophages, human embryonic stem cells, and pluripotent stem cells from which lymphoid cells can differentiate. In some embodiments, the modified cells are autologous, heterologous, or allogeneic cells. In some embodiments, the cells are modified T cells or modified human T cells. In some embodiments, the modified T cells are CD8 + T cells.

[0040] In some embodiments, the modified cells have a central memory phenotype (CD44 - ;Ly6C + ) with CD8 + T cells, M1 phenotype (MHC-II + ), or macrophages with a mature and activated phenotype (CD86 + ;MHC-II + ) are dendritic cells that have

[0041] In some embodiments, the modified cells comprise (a) a switch receptor comprising a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, and a second polypeptide comprising an intracellular signaling domain of a molecule selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB, linked thereto; and (b) a tructural domain of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA. and / or (c) a polypeptide or functional derivative thereof that enhances immune cell function selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), CCL21, CCL19, and combinations thereof.

[0042] Another aspect of the present disclosure provides a composition comprising a modified cell or a population of modified cells described herein.

[0043] Another aspect of the present disclosure provides a method of making a modified cell, comprising transfecting a cell with a vector described herein.

[0044] Another aspect of the present disclosure provides a method of providing anti-tumor immunity in a mammal, comprising administering to the mammal an effective amount of (a) a composition comprising a modified cell described herein or a modified cell produced by a method described herein, (b) a modified cell described herein or a modified cell produced by a method described herein, or (c) a composition described herein.

[0045] Another aspect of the present disclosure is a method of treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of (a) a composition comprising a modified cell described herein or a modified cell produced by a method described herein, (b) a modified cell described herein or a modified cell produced by a method described herein, or (c) a composition described herein.

[0046] In certain embodiments, the modified cells are autologous modified T cells. In some embodiments, the modified cells are allogeneic modified T cells. In some embodiments, the mammal is a human.

[0047] In some embodiments, the disease associated with CD19 expression is selected from (a) a proliferative disease, malignancy, precancerous condition, or non-cancer-related indication associated with CD19 expression, or (b) cancer, atypical cancer and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

[0048] In some embodiments, the disease is (a) acute leukemia, chronic leukemia, hematological disorders, and combinations thereof, or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, leukemia ... The blood cancer is selected from the group consisting of follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective myeloid blood cell production (or dysplasia), and combinations thereof.

[0049] In some embodiments, the modified cells or compositions are administered in combination with: (a) an agent that increases the efficacy of modified cells comprising a vector described herein, modified cells described herein, or modified cells made by a method described herein, (b) an agent that ameliorates one or more side effects associated with the administration of modified cells comprising a vector described herein, modified cells described herein, or modified cells made by a method described herein, or (c) an agent that treats a disease associated with CD19 overexpression. [Brief explanation of the drawings]

[0050] [Figure 1] FIG. 1 is a schematic diagram of identifying unique CD19-specific antibody clones from a phage display library by selection for biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell binding.

[0051] [Figure 2A] FIG. 2A shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2B] FIG. 2B shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2C] FIG. 2C shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2D] FIG. 2D shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2E] FIG. 2E shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure.

[0052] [Figure 2F] FIG. 2F is a percent identity matrix showing the similarity of the novel conjugates at the nucleic acid level.

[0053] [Figure 3] Figures 3A-B are graphs showing the effect of armored CD19CAR T cells expressing CD19CAR containing the original and interleukin-18 (IL-18)-optimized CD19 conjugates 42 and 52 (42og, 42op, 52og, and 52op) on CAR T cell expansion based on cell doublings (Figure 3A) and size (Figure 3B). CD19CAR T cells expressed as CD19-52op, CD19-52op-IL18, CD19-52og-IL-18, and CD19-42op-IL-18 continued to expand after 12 days in culture without stimulation, whereas the expansion of CD19CAR T cells expressed as CD19-52og, CD19-42og, and CD19-42og-IL-18 steadily decreased over time. Among the armored constructs tested, CD19-42og-IL-18CAR T cells underwent the least sustained expansion following activation, with expansion size being relatively similar across all groups tested (Figure 3B).

[0054] [Figure 4A]Figure 4A is a histogram showing that armoring CD19CAR T cells with IL-18 did not alter the expression of CD19CAR on the surface of ND609CAR T cells. [Figure 4B] Figure 4B is a histogram showing that armoring CD19CAR T cells with IL-18 did not alter the expression of CD19CAR on the surface of ND609CAR T cells. Notably, the mean fluorescence intensity (mfi) of CD19CAR on ND609CAR T cells was not abolished by coexpression of 2A-IL-18. However, CD1942og-CAR and CD19-42opCAR (Figure 4A) appeared to have more distinctive expression profiles compared with CD19-52ogCAR and CD19-52opCAR (Figure 4B). Coexpression of IL-18 may have enhanced the surface expression of CD19-42ogCAR.

[0055] [Figure 5] Figure 5 is a schematic diagram showing the timeline used to evaluate the in vivo cytotoxic effects (e.g., killing) of IL-18-armored CD19CAR T cells. ND609CAR T cells were transduced with the original and optimized CD19CAR (conjugates 42 and 52)-2A-IL18 constructs, and the CD19CAR T cells were evaluated in vivo using the Jeko NSG mouse model. Animals were bled at weeks 2, 4, and subsequent weeks to assess peripheral blood levels of huCD45 and serum levels of IL-18. Health status, body weight, and blood-leak index (BLI) were also assessed at the indicated times (downward arrows). Additionally, cells were harvested from the femurs and spleens of the mixed groups at weeks 2, 4, and subsequent weeks, depending on tumor regression, to assess their competitive potential. Table 4 shows the experimental setup.

[0056] [Figure 6-1] Figures 6A-E are graphs showing the anti-tumor activity (tumor control) of IL-18 armored CD19CAR T cells in Jeko1 NSG mice. [Figure 6-2]Figures 6F-I are graphs showing the anti-tumor activity (tumor control) of IL-18 armored CD19CAR T cells in Jeko1 NSG mice. [Figure 6-3] Figures 6J-K are graphs showing the antitumor activity (tumor control) of IL-18 armored CD19CAR T cells in Jeko1 NSG mice. Mice were administered IL-18 armored CD19CAR T cells (Figures 6A-G) or CD19CAR T cells without IL-18 armor (Figures 6H-K) and evaluated as shown in Figure 5. When used at a concentration of 1 x 10 CAR / mouse, all IL-18 armored CD19CAR T cells tested regressed tumors without recurrence for the duration of the experiment (approximately 80 days) based on tumor bioluminescence imaging (BLI). These figures show that CAR T cells containing the original CD19 conjugate 42CAR armored with IL-18 (CD19-42og-IL-18) induced tumor regression more rapidly than CAR T cells containing CD19-42op-IL-18, control CD19-IL-18, CD19-52op-IL-18, or CD19-52og-IL-18. The antitumor activity of the CD19 conjugates in the Jeko1 NSG mouse model was tested using primary T cells from donors ND609 (Figure 6A-C), ND585 (Figure 6D-G), and ND608 (Figure 6H-K).

[0057] [Figure 7]Figures 7A-D are graphs showing the percentage of human CD45-positive (huCD45+) cells in the peripheral blood of animals administered IL-18-armored ND609 CAR T cells expressing CD19-42 original or optimized or CD19-52 original over time, demonstrating that most of the IL-18-armored CD19 CAR T cells tested decreased in number after tumor shrinkage. A good general decrease in peripheral huCD45 blood levels after tumor shrinkage was observed in all tested animals. The mouse in Figure 7A showed a continued expansion of peripheral huCD45 blood levels after tumor shrinkage, likely due to the GVHD response periodically observed in the model.

[0058] [Figure 8] Figures 8A-F are graphs showing the percentage of CAR-positive and human CD45-positive (CD45+ CAR T cells, Figures 8A-C) cells and the percentage of human CD45-positive and CD4-positive (huCD45+CD4+, Figures 8D-F) cells in the peripheral blood of animals administered armored CAR T cells containing the original or optimized CD19-42 CAR and the original CD19-52 CAR over time. IL-18 coexpression enhanced or maintained a high percentage of CD4+ CAR T cells in treated animals. Additionally, the figures show that mouse #534, with continued expansion of peripheral huCD45 blood levels after tumor shrinkage in Figure 7A, most likely experienced a GvHD T-cell response, as the null response drove CAR-independent T-cell expansion (Figure 8D) as the percentage of positive T cells decreased (Figure 8A). Each line represents an individual animal.

[0059] [Figure 9]Figures 9A-F are graphs characterizing human CD45-positive (huCD45+) cells in the peripheral blood of animals administered IL-18-armored ND585CAR T cells expressing the CD19-42 original or optimized CAR over time. The levels of IL-18-armored CD19CAR T cells in the peripheral blood (Figures 9A-B), the percentage of huCD45+ cells that expressed the CD19CAR (Figures 9C-D), and the percent of CD4+ cells in the CD45+ population (Figures 9E-F) are shown. Most tested IL-18-armored CD19CAR T cells decreased in number after tumor shrinkage. No human CD45 was detected in the blood after 14 days in any of the groups tested. Each line represents an individual animal.

[0060] [Figure 10] Figures 10A-F are graphs characterizing human CD45-positive (huCD45+) cells over time in the peripheral blood of animals administered IL-18-armored ND585CAR T cells expressing the CD19-52 original or optimized CAR. The levels of IL-18-armored CD19CAR T cells in the peripheral blood (Figures 10A-B), the percentage of huCD45+ cells that expressed the CD19CAR (Figures 10C-D), and the percentage of CD4+ cells in the CD45+ population (Figures 10E-F) are shown. Most tested IL-18-armored CD19CAR T cells decreased in number after tumor shrinkage. No human CD45 was detected in the blood after 14 days in any of the groups tested. Each line represents an individual animal.

[0061] [Figure 11] Figures 11A-F show weight loss associated with Jeko1 tumor shrinkage in animals injected with IL-18 armored CD19CAR T cells as described in Figures 6A-K. Animals shown in Figures 11A-D correlate with animals shown in Figures 6D-G.

[0062] [Figure 12]Figure 12 shows Kaplan-Meier survival curves for animals receiving 1 x 10 IL-18 armored ND585 CD19CAR T cells expressing the original or optimized CD19 conjugates 42 and 52. 100% of mice receiving CD19-42OP-IL18 and CD19-52OP-IL18CAR T cells survived for the duration of the study (70 days). 80% of mice receiving CD19-42og-IL18CAR T cells survived at the end of the study, with one dying on day 22 due to endpoint weight loss during tumor regression. 60% of mice receiving CD19-52og-IL18CAR T cells survived at the end of the study, with one dying on day 22 due to endpoint weight loss during tumor regression, and the second dying on day 66 due to natural causes. Mice expressing positive control CD19CAR T cells died on day 28, and mice receiving untransduced CAR T cells died on day 29 due to excessive weight loss.

[0063] [Figure 13] Figures 13A-B are graphs showing the effect of IL-18 armoring on CD19CAR T cells expressing CARs containing the original or optimized 42 and 52 conjugates (CD19 conjugate-IL18) on the expansion or growth curves (Figure 13A) and mean cell size or decline (Figure 13B) in human primary cells from donor ND585. All CAR T cells tested showed similar robust expansion and decline. However, IL-18 armored CD19CAR T cells containing the original 42CD19 conjugate (CD19-42og-IL18) expanded and contracted faster than armored CAR T cells containing 42-optimized (CD19-42op-IL18), 52-original (CD19-52og-IL18), and 52-optimized (CD19-52op-IL18).

[0064] [Figure 14]Figures 14A-B are bar graphs quantifying raw mean fluorescence intensity obtained from flow cytometry analysis showing CD19CAR expression in primary human T cells from donors ND585 (Figure 14A) and ND307 (Figure 14B). Specifically, CD19CAR+IL-18 constructs were transduced into ND585 T cells and assessed by flow cytometry. CD19CAR expression was stable over the time period tested in all groups tested. Cells were gated on CD4+ T cells. CD19CAR expression based on mfi showed that control CD19-IL18 expression > CD19-42-IL18 expression > CD19-52-IL18 expression.

[0065] [Figure 15] Figures 15A-F are bar graphs quantifying IL-2 and TNF-α production (IL-2 alone, TNFα alone, and the combination of IL-2 and TNF-α) from donors ND585 (Figures 15A-C) or ND307 (Figures 15D-F) for CD4+ CAR T cells expressing CD19-42og-IL-18, CD19-42op-IL-18, CD19-52og-IL-18, and CD19-52op-IL-18, upon Nalm6 (Figures 15B and E) and Jeko-1 (Figures 15A and D) stimulation on day 9, or in the absence of any stimulation (Figures 15C and F). The figures show that IL-2 and TNF-α production was substantially similar in all groups tested (CD19CAR containing the original and optimized CD19 conjugates 42 and 52). Gating was on CD4+ T cells. The mean fluorescence intensity (mfi) of CD19 surface expression in Nalm6 cells was approximately 13606 mfi and in Jeko cells was 6851 mfi. Table 8 shows the production of INF-γ and TNF-α gated on CD8+ T cells.

[0066] [Figure 16]Figures 16A-F are bar graphs quantifying cytokine production (IL-2, TNF-α, and IFN-γ) by ND307 CD4+ and CD8+ CAR T cells expressing CD19-42og-IL-18, CD19-42op-IL-18, CD19-52og-IL-18, and CD19-52op-IL-18 upon stimulation with recombinant K562 cells transfected with different amounts of RNA encoding a truncated CD19 antigen (CD19AgRNA). K562 cells were transfected with no CD19 antigen, low CD19 antigen (approximately 3% CD19 antigen expression), medium CD19 antigen (approximately 49% CD19 antigen expression), or high CD19 antigen (approximately 71% CD19 antigen expression). CD19 antigen expression was measured by flow cytometry. CAR T cells expressing CD19-42og-IL-18 resulted in higher TNF-α production in ND307CD4+CAR T cells. DETAILED DESCRIPTION OF THE INVENTION

[0067] Detailed explanation I. Overview The present disclosure provides a novel CD19CAR construct operably linked to a recombinant interleukin-18 construct (CD19CAR-IL-18), CAR T cells comprising the CD19CAR-IL-18 construct, and methods of using CD19CAR T cells armored with IL-18. Armoring the novel CD19CAR T cells with IL-18 (1) enhances CD19CAR expression, (2) reduces their expansion in the absence of stimulation, (3) enhances their tumor-resolving efficacy, (4) stimulates CD19CAR T cell contraction after tumor regression, and (5) reduces CD4 expression in treated animals. + (6) enhanced or maintained a high percentage of CD19CAR T cells, and (7) reduced side effects (e.g., weight loss). In general, co-expression of novel CD19CARs with IL-18 reduced systemic CAR-induced toxicity (e.g., weight loss) and tumor recurrence or remission. As shown herein, 80-100% of animals administered the IL-18 armored CD19CAR T cells described herein survived for the duration of the study, whereas animals administered "positive control" CD19CAR T cells (e.g., a clinically approved CD19 conjugate) died on day 28 and animals administered non-transformed CAR T cells died on day 29. A. Identification of Novel CD19 Binders

[0068] The present disclosure provides novel CD19 chimeric antigen receptors with lower affinity and faster off-rates compared to CD19 CARs known in the prior art and CARs based on clinically approved CD19 conjugates (e.g., FMC63), an IgG2a murine monoclonal antibody specific for CD19, which is a target for immunotherapy of B-lineage leukemias and lymphomas. The full characteristics of these novel CD19 conjugates are described in co-pending PCT and U.S. applications claiming priority to U.S. Provisional Application No. 63 / 417,220, filed October 18, 2022, and U.S. Provisional Application No. 63 / 426,967, filed November 21, 2022, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0069] CD19-directed chimeric antigen receptor-modified T cells (CAR T cells) are promising novel therapeutic approaches for hematological malignancies. Anti-CD19 CAR-T therapy has demonstrated remarkable antitumor efficacy in B-cell acute lymphoblastic leukemia (B-ALL) and other refractory B-cell malignancies. Complete remission (CR) has been achieved in 70–90% of relapsed / refractory acute lymphoblastic leukemia (R / RB-ALL) cases. Based on these promising experimental results, the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) have approved several CD19-directed CAR T cell products, including tisagenlecleucel (KYMRIAH®, Novartis), axicabtagene ciloleucel (YESCARTA®, Kite Pharma-Gilead), and lisocabtagene malareucel (BREYANZI®, Juno Therapeutics-Celgene-BMS), for the treatment of large B-cell lymphoma. Additionally, brexucabtagene autoleucel (TECARTUS®, Kite Pharma-Gilead) has been approved for the treatment of relapsed or refractory mantle cell lymphoma. Despite the wide variety of efficacious CAR T-cell therapies, the success of these approved CAR T-cell therapies has been limited. Approximately 40–50% of patients who respond to CD19 CAR T-cell therapy relapse within one year, and nearly half of these relapses contain CD19-positive leukemia cells. Recent evidence suggests that resistance to CD19 chimeric antigen receptor (CAR)-modified T-cell therapy may be due to the presence of CD19 isoforms that lose binding to currently used single-chain variable fragments (scFvs). Other resistance mechanisms limiting current CAR T-cell therapies include T-cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome, and / or neurotoxicity.

[0070] To solve these problems, the present disclosure provides improved CD19CAR constructs operably linked to interleukin-18 (IL-18), and IL-18 armored CD19CAR T cells comprising novel CD19 binders that target distinct, non-overlapping epitopes on the CD19 protein.

[0071] Novel CD19 binders (e.g., antibodies, antibody fragments, or scFvs) were specifically screened for desired properties. In particular, novel CD19 binders were screened for low affinity and fast off-rates. Low affinity binding is characterized by a low on-rate (K on ) or off-rate (K off ), the anti-CD19 conjugates (e.g., scFvs) disclosed herein were selected for their fast off-rates, which allow the CD19CAR to dissociate quickly from CD19, resulting in shorter interactions between the CAR T cell and the tumor. This shortening of the interaction time can reduce cytokine release, thereby reducing toxicity. In one embodiment, the CD19 conjugates disclosed herein have a K of about 1 nM to about 50 nM. D In another embodiment, the CD19 conjugates disclosed herein have a value of about 1.0 x 10 -3 s -1 ~Approx. 5.0×10 -3 s -1 K off It has a value.

[0072] Furthermore, a short interaction time reduced T cell exhaustion and enhanced CAR T cell persistence. Thus, the novel conjugates were selected from a human antibody library of CD19-specific antibodies or antibody fragments with low binding affinity (e.g., K D 1 nM to approximately 50 nM), fast off-rates (e.g., K off is approximately 1.0 × 10 -3 s -1 to approximately 5.0 × 10 -3 s -1 ) were identified by specifically screening for Figure 1 is a schematic outlining the general steps used to identify 12 unique CD19 binders, from phage display library and yeast display screening to selection by biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell binding.

[0073] This yeast display screening yielded approximately 13 novel binders, as shown in Table 3 and Figures 2A-2E. The nucleic acid sequences of the novel CD19 binders disclosed herein are about 58% to about 97% identical to each other, as shown in Figure 2F.

[0074] T cells expressing a CD19CAR containing the novel conjugate of the present disclosure showed higher efficacy, increased in vivo persistence, and lower toxicity compared to T cells expressing a known CD19CAR (e.g., an FMC63-based CAR). However, T cells expressing a low-affinity CD19CAR of the present disclosure killed tumor cells similarly to T cells expressing a high-affinity CD19CAR. Furthermore, T cells expressing the low-affinity CD19CAR of the present disclosure can exhibit similar cytokine production (e.g., interferon-γ or IL-2 production) and proliferation as T cells expressing high-affinity CD19CARs (e.g., FMC63-based CARs).

[0075] The final selection of the top 12 novel CD19 binder candidates was based on the following functional characteristics, taking into account known CD19 binders: (1) low tonic signal, (2) strong activation rate, (3) robust spreading profile, (4) robust and stable surface expression, and (5) cytokine production. Based on these criteria, CD19 binders 42 (P1) and 52 (P11 and P13) appeared to be exemplary candidates. Preliminary analysis showed that the 12 novel CD19 binders showed similar transcriptional profiles. As described herein, these 12 novel CD19 conjugates exhibited unique and unusual functional, signaling, pharmacological, and tumor-suppressive properties. The novel properties described herein address current CD19CAR problems, such as T cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome, and / or neurotoxicity.

[0076] Furthermore, CAR T cells expressing CARs containing the original or optimized CD19 conjugates 42 and 52 effectively suppressed tumor growth in the Jeko NSG mouse model. Tumor growth was most suppressed by the original CD19 conjugate 42 CAR T cells. CD19 conjugate 42optCAR T cells, CD19 conjugate 52original CAR T cells, and CD19 conjugate 52opCAR T cells also suppressed tumor growth. The full characteristics of these novel CD19 conjugates are described in co-pending PCT and U.S. applications claiming priority to U.S. Provisional Application No. 63 / 417,220, filed October 18, 2022, and U.S. Provisional Application No. 63 / 426,967, filed November 21, 2022, the contents of which are incorporated herein by reference in their entirety for all purposes. B. Epitope mapping of novel CD19 binders

[0077] The present disclosure provides improved CD19CAR T cells, including novel CD19 binders that target distinct, non-overlapping epitopes on the CD19 protein and are armored with (i.e., co-expressed with) interleukin-18 (IL-18).

[0078] To determine whether the novel CD19 conjugates bind to anti-FMC63 antibodies, share the same binding site (e.g., epitope), or bind to the same region, initial evaluation of the epitope-binding region of the CD19 conjugates was performed using binding assays. These data indicated that the anti-FMC63 antibodies were not idiotypic antibodies to the novel CD19 conjugates. For example, the anti-FMC63 antibodies did not bind to cells expressing CARs containing the novel CD19 conjugates described herein. Furthermore, the anti-FMC63 antibodies did not inhibit the interaction between any of the novel CD19 conjugates tested and recombinant CD19 protein.

[0079] Furthermore, high-throughput shotgun mutagenesis analysis was performed to map the epitopes of the novel CD19 binders onto the extracellular domain of the full-length CD19 protein (SEQ ID NO: 217). High-throughput shotgun mutagenesis analysis of CD19 42og (42og) showed that CD19 42og binds to a distinct epitope on the extracellular domain of CD19 (Table 10). The CD1942og scFv binds to the complete region of the extracellular domain of CD19 and does not overlap with the region bound by well-characterized CD19 antibodies such as FMC63, 4G7, or 3B10.

[0080] [Table 1]

[0081] Klesmith et al. (Biochemistry 58:4869-4881 (2019)) characterized the conformational epitopes of FMC63, 4G7, and 3B10 (e.g., anti-CD19 clinical antibodies) using a high-throughput screening strategy to comprehensively map the binding sequences of these antibodies to the extracellular domain of the CD19 variant CD19.1. Extensive analysis of the conformational epitope maps of FMC63, 4G7, and 3B10 showed that all three antibodies possess epitopes adjacent to and partially overlapping the published epitope of antibody B43, which cocrystallized with CD19. Two major epitope regions were identified. The first region encompasses the amino acid sequence WAKDRPEIWEGEP (SEQ ID NO: 219), located at positions 159-171 of the full-length CD19 protein (SEQ ID NO: 217). The second region contained the amino acid sequence of PKGPKSLLSLE (SEQ ID NO: 220) and was located at positions 219 to 229 of SEQ ID NO: 217.

[0082] In contrast, CD19 42og scFv primarily bound to the amino acid sequence QPGPPSEKAWQP (SEQ ID NO: 221) located at positions 98-109 of SEQ ID NO: 217. CD19 42og scFv also interacted with another region containing the amino acid sequence VPPDSVSRGPL (SEQ ID NO: 222) located at positions 202-212 of SEQ ID NO: 217 (full-length CD19). Thus, CD19 42og does not bind to the same epitope as FMC63, 4G7, 3B10, or B43 (e.g., anti-CD19 clinical antibodies).

[0083] These results further demonstrate the unique functional properties of the novel CD19 conjugates described herein, and in particular CD19 42og. The novel conjugates disclosed herein discovered a new, clinically relevant CD19 epitope that does not overlap with the epitopes of at least three well-characterized, clinically relevant antibodies: FMC63, 4G7, and 3B10 (Table 10).

[0084] Finally, we evaluated the specificity and selectivity of the novel CD19s disclosed herein using a high-throughput membrane proteome array (Integral Molecular). These experiments demonstrated that CD19 42og selectively binds to CD19, as assessed for cross-reactivity against an array of 5,220 human membrane proteins, representing over 94% of the human membrane proteome. C. Effect of IL-18 armored CD19-42 and CD19-52 CAR T cells

[0085] Among the 12 novel CD19CAR T cells tested, CAR T cells expressing CARs containing either the original (og) or optimized (op) CD19 conjugates 42 or 52 possessed the best attributes: low tonic signal, strong activation rates (e.g., NFAT), similar doubling times during productive expansion (e.g., expansion profile), robust and stable surface expression (e.g., good maintenance of MFI), enhanced killing potency, and long-term persistence of therapeutic activity. To further enhance the efficacy of the novel CD19CAR T cells, we measured the effects of various immune modulators (e.g., enhancers, payloads, or armors) on the original (og) or optimized (op) CD19-42 and CD19-52CAR T cells.

[0086] Some immunomodulators enhance the efficacy of engineered CAR T cells. These immunomodulators can enhance the efficacy of CAR T cells using different mechanisms. For example, immunomodulators can increase the initiation of endogenous immune cells (e.g., NK cell infiltration) to the tumor site, increase persistence, decrease T cell exhaustion, and / or enable resistance to checkpoint inhibitors. Furthermore, immune modulators such as cytokines (e.g., IL-2, IL-7, IL-12, IL-15, IL-15 / IL-15sushi, IL-15 / IL-15sushi anchor, IL-15 / IL-15RA, IL-18, IL-21, IL-21) can enhance T cell priming, antigen presentation, and T cell infiltration in solid tumors. However, not all known immune modulators can enhance the efficacy (enhanced tumor regression and low toxicity) and persistence of CAR T cells in vivo. The present disclosure shows that IL-18 enhanced the efficacy of CAR T cells expressing CARs containing the novel CD19 binders 42 or 52, either in their original or optimized versions.

[0087] CD19-42-IL18 and CD19-52-IL18 CAR T cells each demonstrated the ability to shrink tumors in mice. However, CD19-42(original)-IL18 CAR T cells were slightly slower overall in terms of the time to first tumor shrinkage compared to CD19-42(optimized)-IL18 CAR T cells. Similar tumor shrinkage was observed in mice injected with CD19-52(original)-IL18 CAR T cells and CD19-52(optimized)-IL18 CAR T cells. For all CAR T cells tested, tumors recurred in at least one treated animal. However, CD19-42og-IL-18 CAR T cells were able to regain control of the recurrent tumor (Figure 6D-G). In contrast, CD19-42 CAR T cells not armored with IL-18 were unable to regain control of the recurrent tumor (Figure 6H-K). These data suggest that armoring CD19-42 and 52 original or optimized CAR T cells enhanced the efficacy of CD19CAR T cells.

[0088] Mice injected with the well-known CD19CAR relapsed. This was unexpected, as these mice were the positive control. Furthermore, the positive control CD19CAR has been reported to consistently shrink tumors. However, the positive control CD19CAR T cells did not demonstrate the expected tumor control. Despite showing signs of tumor control, the mice were euthanized due to excessive weight loss. The novel CD19 conjugates disclosed herein showed stronger tumor regression effects and fewer side effects when armored with IL-18 compared to the positive control CAR. Thus, the attenuated response of the positive control in this assay indicated that the novel CD19 conjugates disclosed herein, when armored with IL-18, are superior, more efficient / effective, and less toxic than known CD19 conjugates.

[0089] Figures 8A-F, 9C-F, and 10C-F show that co-expression of IL-18 significantly increased CD4 + The study showed that the CD19CAR T cells enhanced or maintained a high percentage of huCD45 in the blood of treated animals. + The concentration of T cells decreased over time. + T cells decreased linearly from day 20 onwards (Figure 7A-D). This decrease correlated with the time of tumor shrinkage, as shown in Figure 6A-C and G. These results further demonstrated that CD19-42(og)-IL18CAR T cells, CD19-42(op)-IL18CAR T cells, CD19-52(og)-IL18CAR T cells, and CD19-52(op)-IL18CAR T cells decreased in number after tumor shrinkage. See Figure 3 (IL-18 vs. no IL-18).

[0090] In Figure 12, Kaplan-Meier survival curves are plotted for 1 x 10 mice expressing the original or optimized CD19 conjugates 42 and 52. 5 Shows survival of animals administered IL-18 armored ND585CD19CAR T cells. 100% of mice receiving CD19-42OP-IL18CAR and CD19-52OP-IL18CAR T cells survived for the duration of the study (70 days). Eighty percent of mice receiving CD19-42og-IL18CAR T cells survived the end of the study, with one dying on day 22 due to endpoint weight loss during tumor shrinkage. Sixty percent of mice receiving CD19-52og-IL18CAR T cells survived at the end of the study. One mouse receiving CD19-52og-IL18CAR T cells died on day 22 due to endpoint weight loss during tumor shrinkage, and a second mouse died on day 66 due to natural causes. Mice expressing the positive control CD19CAR T cells died on day 28, and mice receiving untransduced CAR T cells died on day 29 due to excessive weight loss. The positive control CD19CAR results were unexpected but consistent with the observations made in the tumor shrinkage assays described above. These data demonstrated that the novel CD19 conjugates described herein have improved efficacy and tolerability over existing CD19 conjugates.

[0091] [Table 2]

[0092] Accordingly, one aspect of the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR) comprising a CD19 binder disclosed herein. In some embodiments, the CAR comprises an anti-CD19 binding domain selected from P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, or P13. In some embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0093] Another aspect of the disclosure provides an isolated polypeptide molecule encoded by a nucleic acid molecule disclosed in Table 3 or Table 1.

[0094] Another aspect of the present disclosure provides a vector and / or a T cell comprising a nucleic acid molecule encoding any one of the novel CD19 binders described herein (e.g., P1-P13) and a nucleic acid encoding a polypeptide that enhances immune cell function, or a functional derivative thereof. The inventors of the present disclosure further discovered that by arming CAR T cells, including the low-affinity CD19CAR of the present disclosure, with one or more molecules that enhance T cell priming, the anti-tumor activity of the low-affinity CD19CAR T cells is significantly enhanced while reducing the side effects associated with the CD19CAR disclosed herein. In fact, the armor (e.g., T cell priming molecule) conferred antigen-presenting function ("APC") to the low-affinity CAR T cells. This novel property allows the low-affinity CD19CAR T cells to express CD19 + They are capable of killing cells and at the same time, after stimulation with antigen, can induce endogenous naive T cells to differentiate into effector cytotoxic T cells. ii. Chimeric antigen receptors (CARS)

[0095] One aspect of the present disclosure provides compositions of matter and methods of use for the treatment of diseases such as cancer using anti-CD19 chimeric antigen receptors (CARs). In particular, the present disclosure provides a number of chimeric antigen receptors (CARs) comprising antibodies or antibody fragments engineered to have enhanced binding to the CD19 protein. In some embodiments, the CAR comprises the amino acid sequence of any one of SEQ ID NO:63, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:145, SEQ ID NO:167, SEQ ID NO:178, SEQ ID NO:200, SEQ ID NO:211, SEQ ID NO:156, SEQ ID NO:189, SEQ ID NO:17, SEQ ID NO:8, SEQ ID NO:62, SEQ ID NO:73, SEQ ID NO:84, SEQ ID NO:144, SEQ ID NO:166, SEQ ID NO:177, SEQ ID NO:199, SEQ ID NO:210, SEQ ID NO:155, SEQ ID NO:188, SEQ ID NO:16, and SEQ ID NO:7. In some embodiments, the CAR comprises a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, and SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:21, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0096] In some embodiments, CARs of the present disclosure comprising an anti-CD19 antigen binding domain described herein have lower affinity and faster off-rate compared to CARs comprising anti-CD19 antigen binding domains known in the art.

[0097] Thus, the present disclosure provides cells (e.g., T cells) engineered to express a CAR, where the CAR T cells ("CART") exhibit anti-tumor properties. The cells are transduced with a CAR, and the CAR is expressed on the cell surface. The cells (e.g., T cells) are transduced with a viral vector encoding the CAR. The viral vector is a retroviral vector. In some embodiments, the viral vector is a lentiviral vector. Cells can stably express CAR. Cells (e.g., T cells) can be transfected with nucleic acid (e.g., mRNA, cDNA, DNA) encoding CAR. In some embodiments, cells can transiently express CAR.

[0098] In some embodiments, the anti-CD19 protein binding portion of CAR is an scFv antibody fragment. Such antibody fragments can be functional in that they retain the same binding affinity. For example, antibody fragments bind to the same antigen with the same effectiveness as the IgG antibody from which the antibody fragment is derived. As will be understood by those skilled in the art, such antibody fragments can be functional in that they provide biological responses, including but not limited to, activating immune responses, inhibiting signal transduction origins from target antigens, inhibiting kinase activity, etc. In some embodiments, the anti-CD19 antigen binding domain of the CAR is a human-derived scFv antibody fragment.

[0099] A novel CD19 antigen-binding domain was engineered to have low affinity and a fast off-rate. The CD19 antigen-binding domain was identified based on its binding to CD19 on HEK293 cells followed by binding to NALM6, which either expresses CD19 or lacks CD19 expression. In some embodiments, the novel anti-CD19 antigen-binding domains described herein may have binding affinity for the human CD19 (hCD19) antigen. For example, the anti-CD19 antigen-binding domains described herein may have binding affinity of at least about 2×10 5 M -1 s 1 , at least about 5 × 10 5 M -1 s -1 , at least about 10 6 M -1 s -1 , at least about 5 × 10 6 M -1 s -1 , at least about 10 7 M -1 s -1 , or at least about 10 8 M -1 s -1 association rate constant or K on rate (association rate constant (M -1 min -1 ); antibody (Ab) + antigen (Ag) → (Ab-Ag). A. Chimeric Antigen Receptor

[0100] The present disclosure provides engineered immune effector cells (e.g., T cells or NK cells) that contain one or more CARs that target the immune effector cells to cancer. In some embodiments, the CAR comprises an antigen-binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain. The CAR may comprise any antigen-binding domain, any hinge, any transmembrane domain, any costimulatory domain, and any intracellular signaling domain described herein.

[0101] The antigen binding domain can be operably linked to another domain of the CAR, such as a transmembrane domain or an intracellular domain described herein, for expression in any of the immune cells described herein. In one embodiment, a first nucleic acid sequence encoding an antigen-binding domain is operably linked to a second nucleic acid sequence encoding a transmembrane domain, which is further operably linked to a third nucleic acid sequence encoding an intracellular domain.

[0102] The antigen-binding domains described herein can be combined with any of the transmembrane domains described herein, any of the intracellular or cytoplasmic domains described herein, or any of the other domains described herein that can be included in a CAR of the present disclosure. A subject CAR of the present disclosure can also include a spacer domain described herein. In some embodiments, each of the antigen binding domain, the transmembrane domain, and the intracellular domain is separated by a linker.

[0103] One embodiment of the present disclosure provides a chimeric antigen receptor (CAR) comprising a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. The anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0104] Alternatively, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198.

[0105] In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0106] [Table 3-1] [Table 3-2] [Table 3-3]

[0107] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200.

[0108] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200. In some embodiments, the CD19 binding domain is an scFv.

[0109] In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0110] In some embodiments, the anti-CD19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0111] In some embodiments, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 9 to 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. 1. Antigen-binding domain

[0112] The antigen-binding domain of a CAR is the extracellular region of the CAR that binds to a specific target antigen, including proteins, carbohydrates, and glycolipids. In some embodiments, the CAR has affinity for a target antigen (e.g., a tumor-associated antigen) on a target cell (e.g., a cancer cell). The target antigen can include any type of protein associated with the target cell or an epitope thereof. For example, the CAR may have affinity for a target antigen on a target cell that indicates a specific state of the target cell.

[0113] As described herein, a CAR of the present disclosure that has affinity for a specific target antigen on a target cell can include a target-specific binding domain. In some embodiments, the target-specific binding domain is a mouse target-specific binding domain, e.g., the target-specific binding domain is of mouse origin. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is of human origin.

[0114] The antigen-binding domain can include any domain that binds to an antigen, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. In some embodiments, the antigen-binding domain comprises a full-length antibody. In some embodiments, the antigen-binding domain comprises an antigen-binding fragment (Fab), e.g., a Fab, Fab', F(ab')2, single-chain specific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragment (scFv), dAb, tandem scFv, VhH, V-NAR, camelbody, diabody, minibody, triabody, or tetrabody. In some embodiments, the antigen-binding domain is selected from the group consisting of: (a) a full-length antibody or antigen-binding fragment thereof; (b) a Fab; (c) a single-chain variable fragment (scFv); and (d) a single-domain antibody.

[0115] In some embodiments, a CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, a CAR can have affinity for one or more target antigens on a single target cell. In such embodiments, the CAR is a bispecific or multispecific CAR. In some embodiments, a CAR comprises one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, CAR comprises one or more target-specific binding domains that confer affinity to the same target antigen.For example, CAR comprises one or more target-specific binding domains that have affinity to the same target antigen, and can bind to different epitopes of the target antigen.When CAR has multiple target-specific binding domains, the binding domains can be arranged in tandem or separated by a linker peptide.For example, in CAR comprising two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain via a polypeptide linker, an Fc hinge region, or a membrane hinge region.

[0116] In some cases, the antigen-binding domain may be derived from the same species in which the CAR will ultimately be used, for example, for human use, the antigen-binding domain of the CAR may comprise a human antibody, or fragment thereof, as described elsewhere herein.

[0117] Thus, the CAR encoded by the lentiviral or retroviral vectors of the present disclosure may target one of the following cancer-associated antigens (tumor antigens): CD19, CD20, CD22 (Siglec 2), CD37, CD123, CD22, CD30, CD171, CS-1 (also see CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24), C-type lectin-like molecule-1 (CLL-1 or CLECL1), CD33, CD133, epidermal growth factor receptor (EGFR), epidermal growth factor receptor variant III (EGFRvIII), human epidermal growth factor receptor (HER1), ganglioside G2 (GD2), ganglioside GD3 (a Neu5Ac(2-8)aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer), TNF receptor family member B-cell maturation antigen (BCMA), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (E PCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit α2 (IL-13Ra2 or CD213A2), mesothelin, interleukin-11 receptor α (IL-llRa), prostate stem cell antigen (PSCA), serine protease 21 (Testisin or PRSS21), vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor β (PDGFR-β), stage-specific embryonic antigen-4 (SSEA-4), and leaflet Acid receptor α, receptor tyrosine-protein kinase ERBB2 (Her2 / neu), cell surface-associated mucin 1 (MUC1), GalNAca1-O-Ser / Thr(Tn)MUC1 (TnMUC1), neural cell adhesion molecule (NCAM), prostase, prostatic acid phosphatase (PAP), elongation factor 2 mutant (ELF2M), ephrin B2, fibroblast activation protein α (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (prosome,Macropain beta subunit 9 (LMP2), glycoprotein 100 (gp100), oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl), tyrosinase, ephrin type A receptor 2 (EphA2), fucosyl GM1, sialyl Lewis adhesion molecule (sLe), ganglioside GM3 (aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer), transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (H MWMAA), o-acetyl-GD2 ganglioside (OAcGD2), folate receptor β, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7-related (TEM7R), claudin 6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5 member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), hexasaccharide moiety of globulin H (GloboH) H), mammary differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), tyrosine protein kinase Met (c-Met), hepatitis A virus cellular receptor 1 (HAVCR1), adrenergic receptor β3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor 20 (GPR20), lymphocyte antigen 6 complex K locus 9 (LY6K), olfactory receptor 51E2 (OR51E2), TCR gamma alternative reading frame protein (TARP), Wilms tumor protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-la ), melanoma-associated antigen 1 (MAGE-A1), ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML), sperm protein 17 (SPA17), X antigen family member 1A (XAGEl), angiopoietin-binding cell surface receptor 2 (Tie2), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-related antigen 1, tumor protein p53 (p53), p53 mutant, prostein, survivin, telomerase, prostate cancer tumor antigen 1 (PCTA-1 or galectin 8),Melanoma antigen 1 recognized by T cells (MelanA or MARTI), rat sarcoma (Ras) mutants, human telomerase reverse transcriptase (hTERT), sarcoma chromosomal translocation stumps, melanoma inhibitor of apoptosis (ML-IAP), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosaminyltransferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-related protein 2 (TRP-2), and cytochrome P450 1B1 (CYP1B1), CCCTC-binding factor-like (zinc finger protein)-(sibling of BORIS or imprinted regulator), squamous cell carcinoma antigen recognized by T cells 3 (SART3), paired box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TESl), lymphocyte-specific protein tyrosine kinase (LCK), A-kinase anchoring protein 4 (AKAP-4), synovial sarcoma X-chromosome breakage 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal ubiquitous 1 (RU1), renal ubiquitous 2 (RU2), legumain, human papillomavirus E6 (HPVE6), human papillomavirus E7 (HPVE7), intestinal carboxylesterase, heat shock protein 70-2 mutant (mutant hsp70- 2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecule-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), lymphocyte antigen 75 (LY75), glypican-2 (GPC2), glypican-3 (GPC3), NKG2D, KRAS, GDNF family receptor alpha 4 (GFRa4), IL13Ra2, Fc receptor-like 5 (FCRL5), and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0118] In some embodiments, the CAR targets CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some embodiments, the antigen binding domain specifically binds to a target antigen selected from the group consisting of CD4, CD19, CD20, CD22, BCMA, CD123, CD133, EGFR, EGFRvIII, mesothelin, Her2, PSMA, CEA, GD2, IL-13Ra2, glypican-3, GPC2, TnMuc1, CIAX, LI-CAM, CA125, CTAG1B, mucin 1, and folate receptor alpha. In some embodiments, the CAR targets CD19.

[0119] Thus, one embodiment of the present disclosure provides an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6. Alternatively, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0120] In some embodiments, the anti-CD19 binding domain is an scFv comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 or 199, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199, and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 or 200, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200.

[0121] In one embodiment of the present disclosure, the anti-CD19 binding domain (e.g., scFv) comprises a light chain variable domain or a heavy chain variable domain encoded by a nucleic acid sequence selected from SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the nucleic acid sequence of the light chain variable domain or heavy chain variable domain of the anti-CD19 binding domain (e.g., scFv) is encoded by a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0122] The anti-CD19 antigen binding domain of the present disclosure is about 5×10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than or about 10 -1 s -1 Less than K off Rate (dissociation rate constant (min -1 ), (Ab-Ag) → antibody (Ab) + antigen (Ag)). In another embodiment, the antibody of the disclosure is administered in a concentration of about 5×10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10-1 s -1 Less than or about 10 -1 s -1 Less than K off It has.

[0123] The anti-CD19 antigen binding domain of the present disclosure comprises at least about 10 2 M -1 , at least about 5 × 10 2 M -1 , at least about 10 3 M -1 , at least about 5 × 10 3 M -1 , at least about 10 4 M -1 , at least about 5 × 10 4 M -1 , at least about 10 5 M -1 , at least about 5 × 10 5 M -1 , at least about 10 6 M -1 , at least about 5 × 10 6 M -1 , at least about 10 7 M -1 , at least about 5 × 10 7 M -1 , at least about 10 8 M -1 , at least about 5 × 10 8 M -1 , at least about 10 9 M -1 , at least about 5 × 10 9 M -1 , at least about 10 10 M -1 , at least about 5 × 10 10 M -1 , at least about 10 11 M -1 , at least about 5 × 10 11 M -1 , at least about 10 12 M -1 , at least about 5 × 10 12 M -1 , at least about 10 13 M -1 , at least about 5 × 1013 M -1 , at least about 10 14 M -1 , at least about 5 × 10 14 M -1 , at least about 10 15 M -1 , or at least about 5 × 10 15 M -1 The affinity constant or K a (K on / K off ).

[0124] The anti-CD19 antigen binding domain of the present disclosure is about 5×10 -2 Less than M, about 10 -2 Less than M, approximately 5 x 10 -3 Less than M, about 10 -3 Less than M, approximately 5 x 10 -4 Less than M, about 10 -4 Less than M, approximately 5 x 10 -5 Less than M, about 10 -5 Less than M, approximately 5 x 10 -6 Less than M, about 10 -6 Less than M, approximately 5 x 10 -7 Less than M, about 10 -7 Less than M, approximately 5 x 10 -8 Less than M, about 10 -8 Less than M, approximately 5 x 10 -9 Less than M, about 10 -9 Less than M, approximately 5 x 10 -10 Less than M, about 10 -10 Less than M, approximately 5 x 10 -11 Less than M, about 10 -11 Less than M, approximately 5 x 10 -12 Less than M, about 10 -12 Less than M, approximately 5 x 10 -13 Less than M, about 10 -13 Less than M, approximately 5 x 10 -14 Less than M, about 10 -14 Less than M, approximately 5 x 10 -15 Less than M or about 10 -15 A dissociation constant or K less than M D (K off / K on ).

[0125] When used with the methods described herein, an anti-CD19 antigen binding domain of the disclosure has a dissociation constant (K) of less than about 3000 nM, less than about 2500 nM, less than about 2000 nM, less than about 1500 nM, less than about 1000 nM, less than about 750 nM, less than about 500 nM, less than about 250 nM, less than about 200 nM, less than about 150 nM, less than about 100 nM, or less than about 75 nM. d ) can specifically bind to human CD19. This can be measured using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA) (Biacore International AB, Uppsala, Sweden).

[0126] In some embodiments, the anti-CD19 antigen binding domain of the present disclosure has a dissociation constant (K d ) can specifically bind to human CD19 antigen. This can be measured using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA). In another embodiment, the anti-CD19 antigen binding domain has a dissociation constant (K) of at least about 500 nM, at least about 100 nM, at least about 75 nM, or at least about 50 nM. d ) can specifically bind to hCD19 having a nucleotide sequence similar to that of the nucleotide sequence of the present invention. This can be measured using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA). 2. Transmembrane domain

[0127] The CAR of the present disclosure can be designed to include a transmembrane domain that connects the antigen-binding domain of the CAR to the intracellular domain. The transmembrane domain of the subject CAR is a region that can penetrate the cell membrane of a cell (e.g., an immune cell or its precursor). The transmembrane domain is for insertion into a cell membrane, for example, a eukaryotic cell membrane. In some embodiments, the transmembrane domain is interposed between the antigen-binding domain and the intracellular domain of the CAR.

[0128] In one embodiment, the transmembrane domain naturally associates with one or more domains of the CAR. In some embodiments, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, in order to minimize interaction with other members of the receptor complex.

[0129] In some embodiments, the transmembrane domain can be derived from either natural or synthetic sources.If derived from nature, the domain can be derived from any membrane-binding or transmembrane protein, for example, type I transmembrane protein.If derived from synthesis, the transmembrane domain can be an artificial sequence, for example, an artificial hydrophobic sequence, that facilitates the insertion of CAR into the cell membrane. In some embodiments, transmembrane domains of particular use in the present disclosure include, but are not limited to, transmembrane domains derived from (the α, β, or ζ chain of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD401), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer immunoglobulin-like receptors (KIR).

[0130] In some embodiments, the transmembrane domain comprises at least the transmembrane region of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer immunoglobulin-like receptors (KIR).

[0131] In some embodiments, the transmembrane domain may be synthetic. In some embodiments, the synthetic transmembrane domain comprises primarily hydrophobic residues such as leucine and valine. In one exemplary embodiment, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.

[0132] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that can be included in a subject CAR.

[0133] In one embodiment, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:29. In some embodiments, the transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO:30.

[0134] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises a CD28 transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 31. In some embodiments, the CD28 transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO: 32.

[0135] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises an ICOS transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the ICOS transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO: 34.

[0136] Acceptable changes to the transmembrane and / or hinge domain, while maintaining its intended function, will be known to those of skill in the art. In some embodiments, the transmembrane domain has an amino acid sequence with at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 29, 31, and / or 33, including amino acid sequences with at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, or at least about 89% identity. In some embodiments, the transmembrane domain is encoded by a nucleic acid comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 30, 32, and / or 34. The transmembrane domain may be combined with any hinge domain and / or may be composed of one or more transmembrane domains described herein.

[0137] In some embodiments, the CAR comprises any transmembrane domain selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, killer immunoglobulin-like receptor (KIR), any costimulatory signaling domain, an intracellular or cytoplasmic domain described herein, or other domains described herein that may be included in a CAR, and optionally a hinge domain.

[0138] In some embodiments, the CAR further comprises a spacer domain between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR. In some embodiments, the spacer domain can be a short oligo- or polypeptide linker, e.g., between about 2 and about 10 amino acids in length. For example, a glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of a subject CAR. Thus, a CAR of the present disclosure can comprise any of the transmembrane domains, hinge domains, or spacer domains described herein. 2. Hinge domain

[0139] In some embodiments, a CAR of the present disclosure further comprises a hinge region, which is a hydrophilic region located between the antigen-binding domain and the transmembrane domain. In some embodiments, the hinge region promotes proper protein folding of the CAR. In some embodiments, the hinge domain is an optional component of the CAR. In some embodiments, the hinge domain comprises a domain selected from an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. In some embodiments, the hinge domain is selected from, but is not limited to, a CD8a hinge, an artificial hinge consisting of a polypeptide that may be as small as three glycines (Gly). In some embodiments, the hinge region is a receptor-derived hinge region polypeptide. In one embodiment, the hinge region is a CD8-derived hinge region. In certain embodiments, the hinge region comprises an amino acid sequence derived from human CD8, or a variant thereof. In some embodiments, a subject CAR comprises a CD8α hinge domain and a CD8α transmembrane domain. In some embodiments, the CD8α hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 27 or 35. In some embodiments, the CD8α hinge domain comprises the nucleotide sequence set forth in SEQ ID NO: 28 or 36.

[0140] In some embodiments, the hinge domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NO: 27 or 35.

[0141] In some embodiments, the hinge domain is encoded by a nucleic acid sequence having a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO:28 or 36.

[0142] In some embodiments, the hinge region connects the antigen-binding domain to the transmembrane domain connected to the intracellular domain, hi representative embodiments, the hinge region can support the antigen-binding domain to recognize and bind to a target antigen on a target cell. In some embodiments, the hinge region is a flexible domain, thus allowing the antigen-binding domain to have a structure that optimally recognizes the specific structure and density of the target antigen on a cell, such as a tumor cell. The flexibility of the hinge region allows it to adopt many different conformations.

[0143] In some embodiments, the hinge region has a length selected from about 4 to about 50 amino acids, about 4 to about 10 amino acids, about 10 to about 15 amino acids, about 15 to about 20 amino acids, about 20 to about 25 amino acids, about 25 to about 30 amino acids, about 30 to about 40 amino acids, or about 40 to about 50 amino acids. A suitable hinge region can be readily selected and can be any of a number of suitable lengths, such as about 1, about 2, about 3, about 4, about 5, about 6, or about 7 amino acids, including about 1 amino acid (e.g., glycine (Gly)) to about 20 amino acids, about 2 to about 15 amino acids, about 3 to about 12 amino acids, about 4 to about 10 amino acids, about 5 to about 9 amino acids, about 6 to about 8 amino acids, or about 7 to about 8 amino acids.

[0144] In some embodiments, the amino acid is glycine (Gly). Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and can therefore function as neutral tethers between components. Glycine polymers can be used; glycine has access to significantly more φ-Ψ space than alanine and is much less restrictive than residues with long side chains. In some embodiments, the hinge region comprises a glycine polymer (G)n, a glycine-serine polymer, hi some embodiments, the hinge region comprises a glycine-serine polymer selected from the group consisting of (GS)n, (GSGGS)n, and (GGGS)n, where n is an integer of at least 1. In some embodiments, the hinge region comprises an amino acid sequence including, but not limited to, GGSG (SEQ ID NO: 121), GGSGG (SEQ ID NO: 122), GSGSG (SEQ ID NO: 123), GSGGG (SEQ ID NO: 124), GGGSG (SEQ ID NO: 125), GSSSG (SEQ ID NO: 126). In some embodiments, the hinge region comprises a glycine-alanine polymer, an alanine-serine polymer, or other flexible linker known in the art.

[0145] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art. In some embodiments, the immunoglobulin hinge region comprises an amino acid sequence selected from the group consisting of DKTHT (SEQ ID NO: 130), CPPC (SEQ ID NO: 131), CPEPKSCDTPPPCPR (SEQ ID NO: 132) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503), ELKTPLGDTTHT (SEQ ID NO: 133), KSCDKTHTCP (SEQ ID NO: 134), KCCVDCP (SEQ ID NO: 135), KYGPPCP (SEQ ID NO: 136), EPKSCDKTHTCPPCP (SEQ ID NO: 137) (human IgG1 hinge), ERKCCVECPPCP (SEQ ID NO: 138) (human IgG2 hinge), ELKTPLGDTTHTCPRCP (SEQ ID NO: 139) (human IgG3 hinge), SPNMVPHAHHAQ (SEQ ID NO: 49) (human IgG4 hinge), and the like.

[0146] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge is selected from the CH1 and CH3 domains of an IgG (such as human IgG4). In some embodiments, the hinge domain comprises the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge domain. In some embodiments, the hinge region may contain one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. In some embodiments, the histidine at position 229 (His229) of the human IgG1 hinge is substituted with a tyrosine (Tyr). In some embodiments, the hinge domain comprises the amino acid sequence EPKSCDKTYTCPPCP (SEQ ID NO: 137). 4. Intracellular domain

[0147] The CAR of the present disclosure also comprises an intracellular domain. The intracellular domain or otherwise cytoplasmic domain of the CAR is responsible for the activation of the cell in which the CAR is expressed. Thus, the term "intracellular domain" is meant to include any portion of the intracellular domain that is sufficient to transmit an activation signal. In one embodiment, the intracellular domain comprises a domain responsible for effector function. The term "effector function" refers to a specialized function of a cell. For example, the effector function of a T cell may be cytotoxic activity or helper activity, including secretion of cytokines. In one embodiment, the intracellular domain of the CAR comprises a domain responsible for signal activation and / or transduction. The intracellular domain can transduce signal activation through protein-protein interactions, biochemical changes, or other responses to alter the cell's metabolism, shape, gene expression, or other cellular response to activation of the chimeric intracellular signaling molecule.

[0148] Examples of intracellular domains for use in the present invention include, but are not limited to, the cytoplasmic portion of the T cell receptor (TCR), a costimulatory molecule, or any molecule that acts in concert with the TCR to initiate signaling in the T cell after binding to the antigen receptor, as well as derivatives or variants of these elements, and any synthetic sequences with the same functional capabilities.

[0149] In certain embodiments, the intracellular domain comprises an intracellular signaling domain. Examples of intracellular domains include TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (Fcε rib), CD79a, CD79b, FcγR11a, DAP10, DAP12, T cell receptor (TCR), CD2, CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGH Ligands that specifically bind to T, NKG2C, B7-H3, and CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1Id, ITGAE, and CD103 , ITGAL, CD11a, LFA-1, ITGAM, CDlib, ITGAX, CD11c, ITGBl, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD 226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, S LAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, Syk family tyrosine kinase (Syk), ZAP70, etc.), src family tyrosine kinases (such as Lck, Fyn, Lyn), other costimulatory molecules described herein, derivatives, variants, or fragments thereof, any synthetic sequence of a costimulatory molecule having the same functional capability, and any combination thereof.

[0150] In some embodiments, the intracellular signaling domain comprises an intracellular domain selected from the group consisting of the cytoplasmic signaling domain of human CD2, CD3ζ chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof. In some embodiments, the intracellular signaling domain comprises a CD3ζ intracellular signaling domain.

[0151] Additional examples of intracellular domains include the intracellular signaling domains of several types of other immune signaling receptors, including, but not limited to, first-, second-, and third-generation T cell signaling proteins, including CD3, costimulatory members of the B7 family, and tumor necrosis factor receptor (TNFR) superfamily receptors. Additionally, intracellular signaling domains can include signaling domains used by NK cells and NKT cells, such as the signaling domains of NKp30 (B7-H6), DAP12, NKG2D, NKp44, NKp46, DAP10, and CD3z.

[0152] Intracellular signaling domains suitable for use in the CARs of the present disclosure include any desired signaling domain that transmits a signal in response to activation of the CAR (i.e., activated by an antigen and a dimerization agent). In some embodiments, the distinct and detectable signal includes, for example, an increase in the production of one or more cytokines by the cell, a change in the transcription of a target gene, a change in the activity of a protein, a change in cell behavior (e.g., cell death), cell proliferation, cell differentiation, cell survival, and / or modulation of a cell signaling response. For example, in some embodiments, the intracellular signaling domain comprises a DAP10 / CD28-type signaling chain. In some embodiments, the intracellular signaling domain is not covalently linked to the membrane-bound CAR, but instead is diffused within the cytoplasm.

[0153] Intracellular signaling domains suitable for use in the CARs of the present disclosure include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides. In some embodiments, the intracellular signaling domain comprises at least one, at least two, at least three, at least four, at least five, or at least six ITAM motifs, as described below. In some embodiments, the ITAM motif is repeated twice in the intracellular signaling domain, where the first and second instances of the ITAM motif are separated from each other by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of a subject CAR comprises three ITAM motifs. In some embodiments, the intracellular signaling domain comprises a signaling domain of a human immunoglobulin receptor, including but not limited to, an immunoreceptor tyrosine-based activation motif (ITAM), such as, but not limited to, FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, FcRL5.

[0154] A suitable intracellular signaling domain can be an ITAM motif-containing portion derived from a polypeptide containing an ITAM motif, for example, a suitable intracellular signaling domain can be an ITAM motif-containing domain derived from any ITAM motif-containing protein. Thus, a suitable intracellular signaling domain need not comprise the entire sequence of the entire protein from which it is derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to, DAP12, FCER1G (Fcε receptor Iγ chain), CD3D (CD3δ), CD3E (CD3ε), CD3G (CD3γ), CD3Z (CD3ζ), and CD79A (antigen receptor complex-associated protein α chain).

[0155] In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP, TYRO protein tyrosine kinase-binding protein, KARAP, PLOSL, DNAX-activating protein 12, KAR-associated protein, TYRO protein tyrosine kinase-binding protein, killer-activating receptor-associated protein, killer-activating receptor-associated protein, etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG, Fcε receptor Iγ chain, Fc receptor γ chain, fcεRIγ, fcRγ, fceR1γ, high-affinity immunoglobulin ε receptor subunit γ, immunoglobulin E receptor high-affinity γ chain, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 delta chain (also known as CD3D, CD3-DELTA, T3D, CD3 antigen delta subunit, CD3 delta, CD3d antigen delta polypeptide (TiT3 complex), OKT3 delta chain, T cell receptor T3 delta chain, T cell surface glycoprotein CD3 delta chain, etc.). In one embodiment, the intracellular signaling domain is derived from T cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T cell surface antigen T3 / Leu-4 epsilon chain, T cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3 epsilon chain, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 gamma chain (also known as CD3G, T cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 zeta chain (CD3Z, also known as T cell receptor T3 zeta chain, CD247, CD3-zeta, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain, CD79a antigen (immunoglobulin-associated alpha), MB-1 membrane glycoprotein, Ig-alpha, membrane-associated immunoglobulin-associated protein, surface IgM-associated protein, etc.). In one embodiment, an intracellular signaling domain suitable for use in a CAR of the present disclosure comprises a DAP10 / CD28-type signaling chain. In some embodiments, the intracellular signaling domain suitable for use in the subject CARs of the present disclosure comprises a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain comprises the cytoplasmic signaling domain of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain of the CAR comprises the cytoplasmic signaling domain of human CD3ζ.

[0156] Typically, the entire intracellular signaling domain can be used, but in many cases, it is not necessary to use the entire chain. When a truncated portion of the intracellular signaling domain is used, the truncated portion can be used in place of the intact chain, so long as it transduces the effector function signal. The intracellular signaling domain includes a sufficient truncated portion of the intracellular signaling domain to transduce the effector function signal.

[0157] The intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that can be included in a CAR. In some embodiments, the intracellular domain of the CAR comprises a dual signaling domain, which can comprise a fragment or domain from any of the molecules described herein. In some embodiments, the intracellular domain comprises a 4-1BB costimulatory domain and a CD3ζ signaling domain, a CD28 costimulatory domain and a CD3ζ signaling domain, or a CD2 costimulatory domain and a CD3ζ signaling domain. In some embodiments, the intracellular domain of the CAR comprises at least one signaling domain from any portion of a costimulatory molecule, such as CD3, CD27, CD28, ICOS, 4-1BB, PD-1, a T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0158] Furthermore, variant intracellular signaling domains suitable for use in the subject CAR are known in the art. The YMFM motif is found in ICOS and is an SH2 binding motif that recruits both the p85 and p50α subunits of PI3K, thereby enhancing AKT signal transduction. In one embodiment, CD28 intracellular domain variants can be generated to contain the YMFM motif.

[0159] In one embodiment, the intracellular domain of a subject CAR comprises a CD3ζ intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO:52 or SEQ ID NO:54, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:53 or SEQ ID NO:55, respectively.

[0160] Acceptable mutations of the intracellular domain, while maintaining a particular activity, will be known to those of skill in the art. In some embodiments, the intracellular domain has amino acids with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 52 or 54. In some embodiments, the intracellular domain is encoded by a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 53 or 55. 5. Costimulatory Domain

[0161] In some embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain. In one embodiment, the intracellular domain of the CAR comprises a costimulatory signaling domain selected from the group consisting of a portion of a signaling domain derived from a protein of the TNFR superfamily, CD27, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and a killer immunoglobulin-like receptor (KIR), a derivative or variant thereof, a synthetic sequence thereof having the same functional capability, and any combination thereof.

[0162] In some embodiments, the costimulatory domain comprises one or more of the costimulatory domains of a protein selected from the group consisting of proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and the intracellular domain from a killer immunoglobulin-like receptor (KIR), or a variant thereof. In some embodiments, the costimulatory domain comprises one or more costimulatory domains of a protein selected from the group consisting of CD28, 4-1BB (CD137), OX40 (CD134), CD27, CD2, or a combination thereof. In some embodiments, the costimulatory signaling domain comprises a 4-1BB costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD2 costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD28 costimulatory domain.

[0163] In some embodiments, the costimulatory domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 37, 39, 41, 43, 46, 48, or 50. In some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 38, 40, 42, 44, 45, 47, 49, or 51.

[0164] In one embodiment, the intracellular domain of a subject CAR comprises an ICOS costimulatory domain and a CD3ζ intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28 costimulatory domain and a CD3ζ intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28YMFM variant costimulatory domain and a CD3ζ intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD27 costimulatory domain and a CD3ζ intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises an OX40 costimulatory domain and a CD3ζ intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a 4-1BB costimulatory domain and a CD3ζ intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain and a CD3ζ intracellular signaling domain. B. Other Antigen-Binding Polypeptides

[0165] In some embodiments, the modified T cells express an antigen-binding polypeptide, a cell surface receptor ligand, or a polypeptide that binds to a tumor antigen. In some embodiments, the antigen binding domain comprises an antibody that recognizes a cell surface protein or receptor expressed on a tumor cell. In some embodiments, the antigen-binding domain comprises an antibody that recognizes a tumor antigen. In some embodiments, the antigen-binding domain comprises a full-length antibody or antigen-binding fragment thereof, a Fab, a F(ab)2, a monospecific Fab2, a bispecific Fab2, a trispecific Fab2, a single-chain variable fragment (scFv), a diabody, a triabody, a minibody, a V-NAR, or a VhH. C. Cell surface receptor ligands

[0166] In some embodiments, the lentiviral or retroviral vector of the present disclosure further comprises a nucleic acid encoding a cell surface receptor ligand. In some embodiments, the ligand binds to a cell surface receptor expressed on tumor cells. In some cases, the ligand comprises a wild-type protein or a variant thereof that binds to a cell surface receptor. In some cases, the ligand comprises a full-length protein or a functional fragment thereof that binds to a cell surface receptor. In some cases, a functional fragment is about 90%, about 80%, about 70%, about 60%, about 50%, or about 40% in length compared to the full-length version of the protein, but retains binding to a cell surface receptor. In some cases, the ligand is a de novo engineered protein that binds to a cell surface receptor. Exemplary ligands include, but are not limited to, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), or Wnt3A. D. Tumor antigens

[0167] In some embodiments, the lentiviral or retroviral vectors of the present disclosure further comprise a nucleic acid encoding a polypeptide that binds to a tumor antigen. In some embodiments, the tumor antigen is associated with a hematological malignancy. Representative tumor antigens include, but are not limited to, CD19, CD20, CD22, CD33 / IL3Ra, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFRvIII, GPC2, Tn-MUC1, GDNF family receptor alpha-4 (GFRa4), fibroblast activation protein (FAP), and IL13Ra2. In some embodiments, the tumor antigen comprises CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some embodiments, the polypeptide is a ligand for a tumor antigen, e.g., a full-length protein that binds to the tumor antigen, a functional fragment thereof, or a de novo engineered ligand that binds to the tumor antigen. In some embodiments, the polypeptide is an antibody that binds to the tumor antigen. E. Engineered T cell receptors

[0168] In some embodiments, the antigen-binding domain of a CAR described herein can be grafted onto one or more constant regions of a T cell receptor ("TCR") chain (e.g., a TCR alpha chain or a TCR beta chain) to create a chimeric TCR. The chimeric TCR can transmit a signal through the TCR complex upon antigen binding. For example, an scFv as disclosed herein can be grafted onto at least a portion of the constant region, extracellular constant region, or transmembrane domain of a TCR chain. As another example, an antibody fragment, such as a VL domain as described herein, can be grafted onto the constant region of the TCR alpha chain. Such chimeric TCRs can be generated, for example, by methods known in the art (e.g., Willemsen RA et al., Gene Therapy 2000;7:1369-1377; Zhang T et al., Cancer Gene Ther 2004;11:487-496; Aggen et al., Gene Ther. 2012 Apr;19(4):365-74). F. Switch receptors and dominant-negative receptors

[0169] In one embodiment, the lentiviral or retroviral vector of the present disclosure further comprises a nucleic acid encoding a dominant negative receptor, a switch receptor, or a combination thereof. In some embodiments, the lentiviral or retroviral vectors described herein comprise a chimeric antigen receptor (CAR) and / or a dominant-negative receptor. In some embodiments, the lentiviral or retroviral vectors comprise a CAR and / or a switch receptor. In some embodiments, the lentiviral or retroviral vectors described herein comprise an engineered TCR and a switch receptor, hi some embodiments, the lentiviral or retroviral vectors described herein comprise an engineered TCR and a dominant-negative receptor. In some embodiments, the lentiviral or retroviral vectors described herein comprise a KIR and a switch receptor. In some embodiments, the lentiviral or retroviral vectors described herein further comprise a KIR and a dominant negative receptor. 1. Switch receptor

[0170] The present disclosure provides a rapid and efficient manufacturing process for generating CARs or engineered modified immune cells containing exogenous TCRs and / or switch receptors. In some embodiments, the CAR, TCR and / or switch receptor is encoded by one or more nucleic acids. In some embodiments, the lentiviral or retroviral vectors disclosed herein comprise one or more nucleic acid sequences encoding a CAR, a TCR and / or a switch receptor. In some embodiments, the nucleic acid sequence encoding the CAR is operably linked to a nucleic acid sequence encoding a switch receptor. In some embodiments, the switch receptor can increase the efficiency of the CAR or a CAR-expressing cell.

[0171] Tumor cells create an immunosuppressive microenvironment that protects them from immune recognition and elimination. This immunosuppressive microenvironment can limit the effectiveness of immunosuppressive therapies, such as CAR-T and TCR-T cell therapies. For example, the secreted cytokine transforming growth factor β (TGFβ) directly inhibits the function of cytotoxic T cells and further suppresses the immune response by inducing the formation of regulatory T cells. TGFβ-mediated T cell immunosuppression in prostate cancer has been demonstrated. To mitigate the immunosuppressive effects of TGF on immune cells, they can be modified to express engineered TGFβRs, which combine the extracellular ligand-binding domain of TGFβR with the intracellular signaling domain of, for example, the interleukin-12 receptor (IL12R, TGFβR-IL12R). Thus, modified immune cells contain switch receptors that can bind to negative signaling molecules in the microenvironment of the modified immune cells and convert the negative signaling signals that inhibitory molecules may exert on the modified immune cells into positive signals that stimulate the modified immune cells. The switch receptors of the present disclosure can be designed to reduce the effect of negative signaling molecules or to convert negative signals into positive signals by including intracellular domains associated with positive signals.

[0172] As used herein, the term "switch receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule on a modified immune cell of the present disclosure. A switch receptor comprises a first domain derived from a first polypeptide associated with a negative signal (a signaling signal that suppresses or inhibits cell or T cell activation) and a second domain derived from a second polypeptide associated with a positive signal (a signaling signal that stimulates cells or T cells). In some embodiments, the protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3. In some embodiments, the protein associated with a positive signal is selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0173] In one embodiment, the first domain comprises at least a portion of an extracellular domain of a first polypeptide associated with a negative signal, and the second domain comprises at least a portion of an intracellular domain of a second polypeptide associated with a positive signal. Thus, the switch receptor comprises a combination of an extracellular domain associated with a negative signal and an intracellular domain associated with a positive signal. In some embodiments, the switch receptor comprises an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and an intracellular domain of a signaling protein associated with a positive signal. In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane domain of a protein associated with a negative signal or a transmembrane domain of a protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein selected from the group consisting of CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0174] In some embodiments, the switch receptor is PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-C D27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2. 2. Dominant-negative receptors

[0175] The present disclosure provides a rapid and efficient manufacturing process for producing CARs, or engineered modified immune cells comprising exogenous TCRs and dominant-negative receptors. In some embodiments, the CARs, TCRs, and / or switch receptors are encoded by one or more nucleic acids. In some embodiments, the lentiviral vector or retroviral vector disclosed herein comprises one or more nucleic acid sequences encoding CAR, TCR and / or dominant negative receptor.In some embodiments, the nucleic acid sequence encoding CAR is operably linked to the nucleic acid sequence encoding dominant negative receptor.In some embodiments, the dominant negative receptor enhances the efficiency of CAR or CAR-expressing cells.

[0176] As used herein, the term "dominant negative receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule (e.g., the effect of a negative signaling molecule on a modified immune cell of the present disclosure). Dominant negative receptors are truncated variants of the wild-type protein associated with the negative signal. In some embodiments, the protein associated with negative signaling is selected from the group consisting of CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3.

[0177] The dominant-negative receptors of the present disclosure may bind to negative signaling molecules (e.g., CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3) via their extracellular domains associated with negative signals, potentially reducing the effects of the negative signaling molecules. For example, modified immune cells containing dominant-negative receptors may bind to negative signaling molecules in the microenvironment of the modified immune cells, but this binding does not transduce this signal intracellularly to modify the activity of the modified T cells. Rather, this binding sequesters the negative signaling molecules, preventing them from binding to endogenous receptors / ligands, thereby reducing the effect of the negative signaling molecules on the modified immune cells. Thus, to reduce the immunosuppressive effects of certain molecules, immune cells can be modified to express dominant-negative receptors.

[0178] In some embodiments, the dominant negative receptor comprises a truncated variant of the wild-type protein associated with a negative signal. In some embodiments, the dominant negative receptor comprises a variant of a wild-type protein associated with a negative signal, comprising an extracellular domain, a transmembrane domain, and an intracellular signaling domain that is substantially absent. In some embodiments, a dominant negative receptor comprises the extracellular domain and transmembrane domain of a signaling protein associated with a negative signal. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor. In some embodiments, the dominant negative receptor is a PD-1 or TGFβRII dominant negative receptor. Acceptable variations of dominant negative receptors will be known to those of skill in the art while maintaining their intended biological activity (e.g., blocking a negative signal and / or sequestering a molecule that has a negative signal when expressed in a cell). G. Chemokines and Cytokines as Immune Enhancers for Physical Fitness

[0179] The present disclosure provides a rapid and efficient manufacturing process for producing engineered modified immune cells comprising a CAR, or an exogenous TCR, and / or an immune-enhancing factor that improves the fitness of the engineered immune cell. In some embodiments, the immune-enhancing factor or functional derivative thereof is a polypeptide that enhances the function of the immune cell.

[0180] In some embodiments, the polypeptide that enhances immune cell function, or a functional derivative thereof, is selected from a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, or a combination thereof. In some embodiments, a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, C-C motif chemokine ligand 21 (CCL21), or C-C motif chemokine ligand 19 (CCL19) is an immune function enhancer that improves the fitness of the claimed modified immune cells. Without wishing to be bound by theory, the addition of a nucleic acid encoding a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, or CCL19 to the modified immune cells of the present disclosure enhances the immune induction effect and anti-tumor activity of the modified immune cells. 1.T cell infiltration

[0181] Without wishing to be bound by theory, interleukins and chemokines may promote T cell priming and infiltration in solid tumors. For example, in microsatellite-stable colorectal cancer (CRC), which has low T cell infiltration, IL-15 promotes T cell priming. In some embodiments, the combination of a CAR and a chemokine / interleukin receptor complex promotes T cell priming. Additionally, IL-15 may induce NK cell infiltration. In some embodiments, the response to the IL-15 / IL-15RA complex may result in the infiltration of NK cells. In certain embodiments, the modified immune cells described herein further comprise an IL-15 / IL-15Ra complex. In some embodiments, the IL-15 / IL-15Ra complex is selected from NIZ985 (Novartis), ATL-803 (Altor), or CYP0150 (Cytune). In some embodiments, the IL-15 / IL-15RA complex is NIZ 985. In some embodiments, IL-15 stimulates natural killer cells to eliminate (eg, kill) pancreatic cancer cells. In some embodiments, a therapeutic response to the modified immune cells described herein further comprising IL-15 / IL15Ra is associated with natural killer cell infiltration in an animal model of colorectal cancer. In some embodiments, the IL-15 / IL-15Ra complex comprises human IL-15 complexed with a soluble form of human IL-15Ra. The complex may comprise IL-15 covalently or non-covalently bound to the soluble form of IL-15Ra. In a specific embodiment, human IL-15 is non-covalently bound to the soluble form of IL-15Ra.

[0182] The limited efficacy of CAR T cell therapy for solid tumors is due in part to the limited accumulation and proliferation of immune cells and CAR T cells in these tumors. One approach to address this issue is to engineer CAR T cells that mimic the function of fibroblastic reticular cells (FRCs) in the T zone. Lymph nodes are responsible for detecting pathogens and immunogens. The T zone contains three types of cells: (1) innate immune cells such as dendritic cells, monocytes, macrophages, and granulocytes; (2) adaptive immune cells such as CD4 and CD8 lymphocytes; and (3) stromal cells (FRCs). These cells cooperate to mount an effective immune response against pathogens by promoting the activation, differentiation, and maturation of CD4 T cells. FRCs are particularly important because they allow dendritic cells and T cells to migrate within the lymph node and form a network that attracts B cells. Specifically, FRCs form a network that (i) promotes the recruitment of naive T cells, B cells, and dendritic cells to lymph nodes by releasing two chemokines (CCL21 and CCL19), (ii) promotes T cell survival by secreting IL-7, a survival factor particularly for naive T cells, and (iii) promotes the transport of CD4+ T cells to germinal centers (GCs, another part of lymph nodes). Thus, CARs armored with exogenous CCL21 or CCL19 and IL-7 enhance the recruitment of T cells, B cells, and dendritic cells to solid tumors. In some embodiments, the modified immune cells engineered by the methods disclosed herein comprise a lentiviral or retroviral vector comprising a nucleic acid encoding an immune function enhancer and a CAR, in which the nucleic acid encoding the immune function enhancer is a nucleic acid encoding interleukin-7 and a nucleic acid encoding CCL19 or CCL21.

[0183] In some embodiments, a nucleic acid of an immune function enhancer (i.e., a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19) is attached to the CAR. In some embodiments, the chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19 is attached to the CAR via a self-cleaving peptide such as P2A, T2A, E2A, or F2A. 2. T cell priming (IL-18)

[0184] The present disclosure provides a rapid and efficient manufacturing process for generating CARs, or engineered modified immune cells comprising exogenous TCRs and / or polypeptides that enhance T cell priming (i.e., T cell priming polypeptides). In some embodiments, the polypeptide that enhances T cell priming (ETP) is selected from the group consisting of a costimulatory molecule, a soluble cytokine, a polypeptide involved in antigen presentation, a polypeptide involved in trafficking and / or migration, or a polypeptide involved in dendritic cell targeting, or a functional fragment or variant thereof. In one embodiment, the T cell priming costimulatory molecule is selected from the group consisting of CD70, CD83, CD80, CD86, CD40, CD154, CD137L (4-1BBL), CD252 (OX40L), CD275 (ICOS-L), CD54 (ICAM-1), CD49a, CD43, CD48, CD112 (PVRL2), CD150 (SLAM), CD155 (PVR), CD265 (RANK), CD270 (HVEM), TL1A, CD127, IL-4R, GITR-L, CD160, CD258, TIM-4, CD153 (CD30L), CD200R (OX2R), CD44, their ligands, and functional fragments and variants thereof. In embodiments, the soluble cytokine is selected from the group consisting of IL-2, IL-12, IL-6, IL-7, IL-15, IL-18, IL-21, GM-CSF, IL-18, IL-21, IL-27, and functional fragments and variants thereof. In an embodiment, the polypeptide involved in antigen presentation is selected from the group consisting of CD64, MHC1, MHCII, and functional fragments and variants thereof. In embodiments, the polypeptide involved in trafficking and / or migration is selected from the group consisting of CD183, CCR2, CCR6, CD50, CD197, CD58, CD62L, and functional fragments and variants thereof. In embodiments, the polypeptide involved in DC targeting is selected from the group consisting of a TLR ligand, an anti-DEC-205 antibody, an anti-DC-SIGN antibody, and functional fragments and variants thereof.

[0185] In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 2 (IL-2) (e.g., GenBank Acc. No. AAB46833.1) or the nucleic acid sequence of IL-2 (e.g., GenBank Acc. No. S82692.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 12 (IL-12) (e.g., GenBank Acc. No. AAD16432.1) or the nucleic acid sequence of IL-12 (e.g., GenBank Acc. No. AF101062.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 6 (IL-6) (e.g., GenBank Acc. No. AAD13886.1 or NP_000591.1) or the nucleic acid sequence of IL-6 (e.g., GenBank Acc. No. S56892.1 or NM_000600.3). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 7 (IL-7) (e.g., GenBank Acc. No. AAH47698.1 or NP_000871.1) or the nucleic acid sequence of IL-7 (e.g., GenBank Acc. No. BC047698.1 or NM_000880.3). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 15 (IL-15) (e.g., GenBank Acc. No. AAU21241.1) or the nucleic acid sequence of IL-15 (e.g., GenBank Acc. No. AY720442.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 18 (IL-18) (e.g., GenBank Acc. No. AAK95950.1) or the nucleic acid sequence of IL-18 (e.g., GenBank Acc. No. AY044641.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin-21 (IL-21) (e.g., GenBank Acc. No. AAG29348.1) or the nucleic acid sequence of IL-21 (e.g., GenBank Acc. No. AF254069.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of GM-CSF (eg, GenBank Acc. No. AAA52578.1) or the nucleic acid sequence of GM-CSF (eg, GenBank Acc. No. M11 1220.1). In some embodiments, the T cell priming polypeptide is IL-18.

[0186] In some embodiments, expression of the CAR or CARs does not substantially affect the expression level of a T cell priming polypeptide in the armored CAR T cells. In some embodiments, the CAR comprises an antigen-binding domain that binds an antigen, and expression of the T cell priming polypeptide does not substantially affect the expression level or cell-killing function of the CAR or CARs in the armored CAR T cells.

[0187] In some embodiments, the lentiviral or retroviral vectors disclosed herein comprise and deliver one or more T cell priming polypeptides. In certain embodiments, the lentiviral or retroviral vectors comprise two, three, four, five, six, or more nucleic acids encoding one or more T cell priming polypeptides and further comprise a nucleic acid sequence encoding a CAR. In some embodiments, co-introduction of one or more T cell priming polypeptides does not affect (e.g., substantially reduce or substantially inhibit) the expression or activity of the co-expressed CAR in the armored CAR T cells or armored CAR-expressing immune cells. In some embodiments, the CAR does not affect (e.g., substantially reduce or substantially inhibit) the expression or activity of the co-expressed T cell priming polypeptide. III. Nucleic Acids and Expression Vectors A. Nucleic Acid Encoding CAR

[0188] The present disclosure provides a nucleic acid molecule encoding one or more CAR constructs described herein.The nucleic acid molecule can be a messenger RNA transcript.The nucleic acid molecule can also be a DNA construct.

[0189] In one embodiment, the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), which may comprise a single chain antibody or a single chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In some embodiments, the anti-CD19 binding domain is encoded by a nucleic acid sequence selected from SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain is encoded by a nucleic acid molecule having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:21. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:24. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:102. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:103. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:104. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:114. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:115. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:116. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:117. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:118. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:119. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:120. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:225.

[0190] In some embodiments, the CAR comprises an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0191] In some embodiments, the CAR comprises an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain consisting of heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0192] The light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 7 or 199. Alternatively, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 8 or 200.

[0193] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO:7 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8.

[0194] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200. In some embodiments, the CD19 binding domain may be an scFv.

[0195] In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0196] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. The anti-CD19 binding domain may comprise a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 19-24, 102, 103, 104, 114, 115, 116, 117, 118, 119, 120, 225, or 216.

[0197] In some embodiments of the isolated nucleic acid molecules described herein, the transmembrane domain of the CAR may comprise a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29, 31, or 33. In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34. In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29. In some embodiments, the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO:30, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30.

[0198] In some embodiments of the isolated nucleic acid molecules described herein, the CAR further comprises a hinge domain. In some embodiments, the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region as described herein. In some embodiments, the hinge region may be from a protein selected from the group consisting of an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof.

[0199] In some embodiments of the isolated nucleic acid molecules described herein, the CAR comprises a costimulatory domain that may be a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137). In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0200] In some embodiments of the isolated nucleic acid molecules described herein, the CAR can comprise an intracellular signaling domain. The signaling domain can consist of a protein selected from the group consisting of CD3ζ, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In this embodiment, the intracellular signaling domain comprises the intracellular signaling domain of CD3ζ, the amino acid sequence of SEQ ID NO:52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:52 or 54. Alternatively, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO:53 or 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55.

[0201] In some embodiments, the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3ζ intracellular signaling domain. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54.

[0202] The intracellular signaling domain can comprise the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54. These sequences can be expressed in the same frame as a single polypeptide chain. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:38 or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55.

[0203] In some embodiments of the isolated nucleic acid molecules described herein, the CAR further comprises a leader sequence. The leader sequence may comprise the amino acid sequence of SEQ ID NO:25.

[0204] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an scFv comprising an anti-CD19 binding domain described herein. One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain as described herein. In some embodiments, the anti-CD19 binding domain is selected from a LC CDR1 of SEQ ID NO: 1, a LC CDR2 and a LC CDR3 of SEQ ID NO: 2, a HC CDR1 of SEQ ID NO: 4, a HC CDR2 of SEQ ID NO: 5, and a HC CDR3 of SEQ ID NO: 6, or a LC CDR1 of SEQ ID NO: 193, a LC CDR2 of SEQ ID NO: 194, a LC CDR3 of SEQ ID NO: 195, a HC CDR1 of SEQ ID NO: 196, a HC CDR2 of SEQ ID NO: 197, and a HC CDR3 of SEQ ID NO: 198, or any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2; the transmembrane domain is selected from a CD28 or CD8 transmembrane domain; the costimulatory domain comprises an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB, and the intracellular signaling domain comprises CD3-zeta or FcRgamma.

[0205] In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0206] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146. The transmembrane domain is selected from a CD28 or CD8 transmembrane domain, the costimulatory domain may comprise an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB, and the intracellular signaling domain comprises CD3-zeta or FcRγ.

[0207] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising an scFv comprising an anti-CD19 binding domain. One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain (e.g., scFv), a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; the transmembrane domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:29, 31, and 33; the costimulatory domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; and the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:54.

[0208] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 52 or 54.

[0209] One embodiment of the present disclosure provides an isolated nucleic acid comprising an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20, and / or an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0210] One embodiment of the present disclosure provides an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0211] One embodiment of the present disclosure provides an isolated polypeptide molecule encoded by the nucleic acid molecule described herein. The isolated polypeptide may comprise a sequence selected from the group consisting of SEQ ID NOs: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7. B. Expression Vectors

[0212] One aspect of the present disclosure provides a vector (e.g., an expression vector) comprising the isolated nucleic acid described. Another aspect of the present disclosure provides a vector comprising (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR) described herein, and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or functional derivative thereof that enhances immune cell function.

[0213] In some embodiments, the CAR comprises a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain (e.g., P1-P13), a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide.

[0214] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function may be selected from the group consisting of a cytokine, an interferon, a chemokine, an antibody or antibody fragment, a checkpoint inhibitor antagonist, a dominant negative receptor, a switch receptor, and combinations thereof.

[0215] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function may be a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, or a combination thereof. Alternatively, the polypeptide or functional derivative thereof that enhances immune cell function may be a cytokine selected from the group consisting of interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor, alpha, beta, or gamma interferon, erythropoietin, and a combination thereof. The polypeptide or functional derivative thereof that enhances immune cell function may also be a chemokine selected from CCL21, CCL19, or a combination thereof. In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is IL-18.

[0216] In some embodiments of the methods disclosed herein, the vector encodes a CAR comprising an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2. In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 226, 201, 179, 168, and 146.

[0217] In another embodiment, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216, or (b) a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0218] One embodiment of the present disclosure provides a method for producing an anti-CD19 chimeric antigen receptor (CAR), comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein said CAR comprises: (i) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and (ii) a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2. (ii) an anti-CD19 binding domain comprising a heavy chain variable domain comprising a CD3-ζ heavy chain variable domain (CDR3); (ii) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R).

[0219] In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and Furin-(G4S)2-T2A (F-GS2-T2A).

[0220] In some embodiments, the anti-CD19 binding domain comprises (1) an LC CDR1 of SEQ ID NO: 1, an LC CDR2 and an LC CDR3 of SEQ ID NO: 2, an HC CDR1 of SEQ ID NO: 4, an HC CDR2 of SEQ ID NO: 5, and an HC CDR3 of SEQ ID NO: 6, or (2) an LC CDR1 of SEQ ID NO: 193, an LC CDR2 of SEQ ID NO: 194, an LC CDR3 of SEQ ID NO: 195, an HC CDR1 of SEQ ID NO: 196, an HC CDR2 of SEQ ID NO: 197, and an HC CDR3 of SEQ ID NO: 198.

[0221] The vector may be selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

[0222] The lentiviral vector may be based on a virus selected from the group consisting of retrovirus, alpharetrovirus, betaretrovirus, gammaretrovirus, deltaretrovirus, and epsilonretrovirus. For example, the lentiviral vector may be based on human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), Visna-Medivirus (VMV), caprine arthritis-encephalitis virus (CAEV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Visna virus, and simian immunodeficiency virus (SIV). In some embodiments, lentiviral vectors may be pseudotyped with an envelope glycoprotein (Env) from a virus selected from the group consisting of murine leukemia virus (MLV), vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, Cocal virus, Chandipura virus, Piry virus, spring of carp virus (SVCV), Sigma virus, infectious hematopoietic necrosis virus (IHNV), Mokola virus, rabies virus CVS virus, Isfahan virus, Alagoas virus, Calchaqui virus, Jurona virus, La Joya virus, Maraba virus, feline endogenous retrovirus (RD114) envelope protein, Perinet virus, Yug Bugdanovac virus, prototype foamy virus (PFV), and gibbon ape leukemia virus (GaLV). In some embodiments, the lentiviral vector may be pseudotyped with an envelope glycoprotein (Env) selected from the group consisting of vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, and Cocal virus.

[0223] In some embodiments of the lentiviral vectors described herein, the viral envelope protein (Env) comprises a VSV-G glycoprotein selected from the group consisting of Indiana strain VSV-G, New Jersey strain VSV-G, Kokar virus envelope protein, Isfahan virus envelope protein, Chandipura virus envelope protein, Pili virus envelope protein, murine leukemia virus (MLV) envelope glycoprotein, SVCV virus envelope protein, and variants thereof. The lentiviral vector may also comprise a nucleotide sequence encoding a heterologous VSV-G envelope protein.

[0224] The heterologous VSV-G envelope protein may be codon-optimized for expression in humans. Alternatively, the heterologous VSV-G envelope protein may be a VSV-G protein variant. In some embodiments, the lentiviral vector comprises a nucleotide sequence encoding a VSV-G envelope protein or a VSV-G protein variant.

[0225] In some embodiments of the lentiviral vectors described herein, the heterologous envelope protein may be under the control of a transcriptional regulatory element, which may be a promoter selected from a eukaryotic promoter or a constitutive promoter.

[0226] The lentiviral vectors described herein can further comprise a transcriptional regulatory element, which can be upstream of the heterologous envelope glycoprotein (i.e., in the 5' direction of the nucleotide sequence encoding the heterologous envelope glycoprotein). For example, the transcriptional regulatory element can control the expression (i.e., transcription, and, accordingly, but optionally, translation) of the nucleic acid encoding the heterologous envelope glycoprotein. In some embodiments, the transcriptional regulatory element is constitutively active or is a constitutive promoter. In representative embodiments, the constitutively active transcriptional regulatory element or constitutive promoter may be a cytomegalovirus (CMV) promoter, such as the CMV major immediate early promoter (CMVIE1), murine stem cell virus promoter, elongation factor-1 alpha promoter (EF-1α), viral simian virus 40 (SV40) (e.g., early or late), Moloney murine leukemia virus (MoMLV), ubiquitin C promoter, phosphoglycerokinase (PGK) promoter, Rous sarcoma virus (RSV), or herpes simplex virus (HSV) (thymidine kinase) promoter.

[0227] In other embodiments, the activity of the transcriptional regulatory element may be inducible or the promoter may be an inducible promoter. In some embodiments, the transcriptional regulatory element may be a eukaryotic promoter, such as the phosphoglycerate kinase promoter. Other transcriptional regulatory elements, including prokaryotic and eukaryotic, constitutive and inducible promoters, and origins of replication, are known in the art.

[0228] In some embodiments, the lentiviral vectors described herein can be structured and arranged so that expression of proteins, enzymes, and viral elements (i.e., cis- and trans-acting genes) necessary to produce retroviral particles is under the control of transcriptional regulatory elements. In a preferred embodiment, the lentiviral vector may further comprise a transcriptional regulatory element upstream (i.e., in the 5' direction) of the proteins, enzymes, and viral elements (cis- and trans-acting genes) necessary to produce retroviral particles, and optionally, the transcriptional regulatory element controls the expression (i.e., transcription or translation) of nucleic acids encoding the proteins, enzymes, and viral elements necessary to produce retroviral particles (i.e., cis- and trans-acting genes). In some embodiments, the transcriptional regulatory element may be constitutively active or may be a constitutive promoter.

[0229] In some embodiments, nucleic acids encoding the lentiviral vectors and heterologous envelope proteins described herein may be amplified or produced prior to introduction into the producer cells and, accordingly, prior to production of viral particles. In some embodiments, nucleic acids encoding lentiviral vectors and other proteins, enzymes, and elements required for retroviral particle production can be amplified or produced prior to introduction into producer cells, and accordingly, prior to production of retroviral proteins.

[0230] In some embodiments, the lentiviral vector and the nucleic acid encoding the heterologous envelope protein may be structured and arranged such that transcriptional control elements drive transcription, and thus translation, of the heterologous envelope protein in the producer cell to facilitate production of lentiviral particles. In some embodiments, nucleic acids encoding proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol) necessary for lentiviral vector and retroviral particle production can be structured and arranged such that transcriptional control elements can drive transcription, and therefore translation, of the proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol) such that the producer cell produces retroviral particles.

[0231] In some embodiments, the retroviral or lentiviral vectors described herein comprise a transcriptional regulatory element. In some embodiments, the transcriptional regulatory element is a promoter selected from eukaryotic promoters or constitutive promoters.Physiological promoters (such as EF-1α promoters) are less likely to induce integration-dependent genotoxicity, and can negate the ability of retroviral vectors to transform stem cells.Other physiological promoters suitable for use in retroviral or lentiviral vectors are known to those skilled in the art and can be incorporated into representative embodiments of nucleic acid vectors. In some embodiments, the promoter is an elongation factor-1 alpha promoter (EF-1 alpha promoter). Use of the EF-1 alpha promoter can increase the efficiency of expression of downstream transgenes (e.g., nucleic acid sequences encoding TCRs and / or CARs).

[0232] In some embodiments, lentivirus or retrovirus vector further comprises non-essential cis-acting sequences that can improve titer and gene expression.One non-limiting example of non-essential cis-acting sequences is the central polypurine tract and central termination sequence (cPPT / CTS), which is important for efficient reverse transcription and nuclear import.Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into lentivirus or retrovirus vector particles.

[0233] In some embodiments, the lentiviral or retroviral vectors disclosed herein further comprise a post-transcriptional regulatory element. The post-transcriptional regulatory element can improve RNA translation, improve transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Thus, in some embodiments, the nucleic acid vector further comprises a WPRE sequence. A variety of post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into lentiviral or retroviral vectors.

[0234] The lentiviral or retroviral vectors disclosed herein can further comprise additional elements such as a rev response element (RRE) for RNA transport, a packaging sequence, and 5' and 3' long terminal repeats (LTRs). The term "long terminal repeat" or "LTR" refers to a domain of base pairs located at the ends of retroviral DNA, including the U3, R, and U5 regions. LTRs generally provide functions necessary for retroviral gene expression (e.g., promotion, initiation, and polyadenylation of gene transcripts) and viral replication. In one embodiment, the lentivirus or retrovirus vector comprises a 3'U3 deleted LTR, a non-functional LTR, and / or a missing functional 3' or 5' LTR.Therefore, the lentivirus or retrovirus vector disclosed herein can comprise any combination of the elements described herein to enhance the efficiency of functional expression of the transgene.For example, the lentivirus or retrovirus vector can comprise a WPRE sequence, a cPPT sequence, an RRE sequence, a 5'LTR, a 3'U3 deleted LTR' in addition to the nucleic acid encoding the TCR or CAR.

[0235] In some embodiments, the promoter further comprises a rev response element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and / or a cPPT sequence. The promoter may be a constitutive promoter. In some embodiments, the promoter is selected from the group consisting of the EF-1α promoter, the PGK-1 promoter, the truncated PGK-1 promoter, the UBC promoter, the CMV promoter, the CAGG promoter, and the SV40 promoter. However, other constitutive promoter sequences can also be used, including the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV), the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr virus immediate early promoter, the Rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, the actin promoter, the myosin promoter, the elongation factor Ia promoter, the hemoglobin promoter, and the creatine kinase promoter. Furthermore, the present disclosure should not be limited to the use of constitutive promoters.Inducible promoters are also envisioned as part of the present disclosure.The use of inducible promoters provides a molecular switch that can turn on the expression of the polynucleotide sequence that is operably linked when such expression is desired, or turn off expression when expression is not desired.Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters. In some embodiments, the promoter is the EF-1 promoter. The promoter may comprise the sequence of SEQ ID NO: 101.

[0236] In some embodiments, the vector comprises an isolated nucleic acid molecule comprising a CAR described herein operably linked via a linker peptide to a nucleic acid sequence encoding a switch receptor, a dominant negative receptor, or a polypeptide or functional derivative that can enhance immune cell function.

[0237] In some embodiments, the linker peptide is selected from F2A, E2A, P2A, T2A, or Furin-(GS)2-T2A (F-GS2-T2A). Alternatively, the linker comprises the amino acid sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, or SEQ ID NO: 99. The linker comprises the nucleic acid sequence of SEQ ID NO: 93, 95, 97, or 98. C. Methods for Introducing Nucleic Acids into Cells

[0238] Methods for introducing nucleic acids into cells include physical methods, biological methods, chemical methods, and combinations thereof. An expression vector containing a nucleic acid of the present disclosure can be introduced into a host cell by any means known to those skilled in the art. The expression vector may optionally contain a viral sequence for transfection. Alternatively, the expression vector may be introduced by fusion, electroporation, biolistics (e.g., gene gun), transfection, lipofection (e.g., cationic liposomes), polymer encapsulation, etc. Host cells (e.g., immune cells or CD4 + and CD8 + The host cells (e.g., immune cells) may be grown and expanded in culture before introduction of the expression vector, and then treated appropriately for vector introduction and integration. The host cells (e.g., immune cells) may then be expanded and screened for markers present in the vector. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art.

[0239] In some embodiments, host cells (e.g., immune cells, CD4 + and CD8 + cells) or a population of host cells (e.g., a population of immune cells, or CD4+ and CD8 + The cells can be modified using any method known in the art, such as activation, expansion, induction of apoptosis, genetic manipulation, induction of antigen specificity, etc. In some embodiments, host cells (e.g., immune cells, CD4 + and CD8 + cells) or a population of host cells (e.g., a population of immune cells, CD4 + and CD8 + The cells may be modified by the addition of cytokines, cross-linking of specific receptors, addition of antigens, introduction of nucleic acid molecules (DNA, RNA, and / or modified versions thereof), addition of protein agents, drugs or small molecules, or any combination thereof. In some embodiments, introduction of exogenous nucleic acid molecules comprises viral transfection, non-viral transfection, electroporation, lipofection, cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or biolistec particle delivery systems such as "gene guns."

[0240] Regardless of the method used to introduce the isolated nucleic acid molecule described herein into a host cell or to otherwise expose the cell to the CD19CAR of the present invention, various assays can be performed to confirm the presence of the nucleic acid in the host cell. Such assays include, for example, molecular biological assays well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR, biochemical assays such as detecting the presence or absence of specific peptides (e.g., immunological means (ELISA and Western blot)), or assays described herein to identify agents within the scope of the present invention.

[0241] Furthermore, the nucleic acid can be introduced by any means, such as transducing the expanded host cells (e.g., immune cells), transfecting the expanded host cells (e.g., immune cells), electroporating the expanded host cells (e.g., immune cells), etc. One isolated nucleic acid molecule may be introduced by one method and another nucleic acid may be introduced by another method into the host cells (e.g., immune cells). 1. Biological methods

[0242] Biological methods for introducing a target polynucleotide into host cells (e.g., immune cells) include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors (viral transfection), are the most widely used method for gene insertion into mammalian (e.g., human) cells. Viral vectors are derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, etc.

[0243] In some embodiments, nucleic acids encoding a subject CAR, a subject engineered TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) can be introduced into cells using an expression vector (viral transfection). Provided herein are expression vectors (e.g., lentiviral or retroviral vectors) comprising nucleic acids encoding a subject CAR, a subject engineered TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration). Suitable expression vectors include lentiviral vectors, gammaretroviral vectors, foamy viral vectors, adeno-associated viral (AAV) vectors, adenoviral vectors, engineered hybrid viruses, naked DNA, including, but not limited to, transposon-mediated vectors such as Sleeping Beauty, PiggyBac, and integrase vectors such as Phi31. Other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0244] In some embodiments, nucleic acids encoding a subject CAR (e.g., a CD-19 CAR), a subject engineered TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) are introduced into immune cells by viral transduction. In some embodiments, the viral vector is selected from the group consisting of a retroviral vector, a Sendai virus vector, an adenoviral vector, an adeno-associated virus vector, and a lentiviral vector. Various markers that can be used are known in the art and can include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc.

[0245] The modified immune cells of the present disclosure, CD4 + and CD8 + cells, or populations of immune cells, or CD4 + and CD8 +Cells (e.g., a subject CAR, a subject engineered TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or an immune function (e.g., T cell priming or T cell infiltration)) can be produced by stably transfecting a host cell (e.g., an immune cell) with an expression vector comprising a nucleic acid of the present disclosure.

[0246] Transfected cells (i.e., immune cells) expressing nucleic acids encoding a CAR, KIR, TCR, KIR, antigen-binding polypeptide, cell surface receptor ligand, tumor antigen, target switch receptor, target dominant negative receptor, and / or target polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) of the present disclosure can be expanded ex vivo. In some embodiments, transfected cells (i.e., immune cells) expressing nucleic acids encoding a CAR, KIR, TCR, KIR, antigen-binding polypeptide, cell surface receptor ligand, tumor antigen, subject switch receptor, subject dominant-negative receptor, and / or subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) of the present disclosure are not expanded ex vivo.

[0247] Additional methods for generating modified cells of the present disclosure include, but are not limited to, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes, and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, phototransformation, gene electrotransfer and / or hydrodynamic delivery), and / or particle-based methods (e.g., imparefection, gene gun and / or magnetofection). 2.Physical method

[0248] Physical methods for introducing polynucleotides (RNA or DNA) or expression vectors into host cells (e.g., immune cells) include lipofection, particle gun, microinjection, electroporation, etc. Expression vectors or polynucleotides can be introduced into target cells using commercially available methods, including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM830(BTX) (Harvard Instruments, Boston, Massachusetts) or Gene Pulser II (BioRad, Denver, Colorado)), Multiporator (Eppendorf, Hamburg, Germany), etc.

[0249] Regardless of the method used to introduce the isolated nucleic acid molecule described herein into host cells or to otherwise expose cells to the CD19CAR of the present invention, various assays can be performed to confirm the presence of nucleic acid in host cells. Such assays include, for example, molecular biological assays well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR, biochemical assays such as detecting the presence or absence of specific peptides (e.g., immunological means (ELISA and Western blot)), or assays described herein to identify candidate substances within the scope of the present invention.

[0250] Furthermore, the nucleic acid can be introduced by any means, such as transducing the expanded host cells (e.g., immune cells), transfecting the expanded host cells (e.g., immune cells), electroporating the expanded host cells (e.g., immune cells), etc. Some isolated nucleic acid molecules may be introduced by one method, and other nucleic acids may be introduced into the host cells (e.g., immune cells) by another method. IV.CAR T cells

[0251] One aspect of the present disclosure is a modified cell, modified immune cell, or modified CD4 + and CD8 + The modified cells are modified immune cells, modified natural killer (NK) cells, modified natural killer T (NKT) cells, or modified T cells. The modified cells are modified T cells or modified human T cells. The modified T cells are CD8 + It may be a T cell. Modified cells as contemplated herein may be autologous, heterologous, or allogeneic cells.

[0252] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The CAR comprises a chimeric antigen receptor (CAR) comprising a single-chain antibody or a single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0253] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cells contain the isolated nucleic acid molecules described herein. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0254] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cell) comprises an isolated polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0255] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cells comprise a CAR comprising a single-chain antibody or a single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In that embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0256] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199, and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200.

[0257] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The cell) comprises a CAR comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7, and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8. Alternatively, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199, and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200. In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0258] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cell) comprises a CAR comprising an anti-CD19 binding domain encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, and SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain is encoded by a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, or 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0259] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cell) comprises a CAR comprising an anti-CD19 binding domain comprising a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, and SEQ ID NO:23, and SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. Alternatively, the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 19-24, 102, 103, 104, 114, 115, 116, 117, 118, 119, 120, 225, or 216.

[0260] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +and a T-cell receptor α, β, or ζ chain, CD2, C, or D, wherein the T-cell receptor α, β, or ζ chain is a T-cell receptor α, β, or D, and the T-cell receptor α, β, or D, and the T-cell receptor α, β, or D, and the T-cell receptor ζ ... and a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of D28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In that embodiment, the transmembrane domain may comprise an amino acid sequence selected from SEQ ID NO:29, 31, or 33, or an amino acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29, 31, or 33. Alternatively, the transmembrane domain may comprise a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34. The transmembrane domain may comprise a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO: 29, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29. The transmembrane domain may comprise a nucleic acid sequence of SEQ ID NO: 30, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 30.

[0261] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The cell) comprises a CAR comprising an anti-CD19 binding domain comprising a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216, wherein the anti-CD19 binding domain may be linked to the transmembrane domain by a hinge region. The hinge region may be from a protein selected from the group consisting of an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge region, a CD8 hinge, and any combination thereof. The hinge may comprise the amino acid sequence of SEQ ID NO:27 or SEQ ID NO:35, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27 or 35. The hinge region may comprise the CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27. In that embodiment, the CAR further comprises a functional signaling domain (e.g., a costimulatory domain) of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, 4-1BB (CD137).

[0262] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + Cells) include CD19-4BBzCAR, CD19CD2z, CD19CD2zCAR, CD19CD27zCAR, CD19Ox40zCAR, CD1928zYMFM, CD19ICOSz, and CD19ICOS-1z.

[0263] One embodiment of the present disclosure provides a modified cell, modified immune cell, or modified CD4 receptor agonist, comprising a chimeric antigen receptor (CAR) comprising an anti-CD19 binding domain, a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune cell function. + and CD8 + Provide the cells. In some embodiments, the switch receptor comprises a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, bound to a second polypeptide comprising a positive signal from an intracellular signaling domain selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB. In some embodiments, the switch receptor is PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-C D27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2.

[0264] In some embodiments, the dominant negative receptor comprises a truncated variant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor.

[0265] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, or a combination thereof. In some embodiments, a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CC motif chemokine ligand 21 (CCL21), or CC motif chemokine ligand 19 (CCL19) is an immune function enhancer that improves the fitness of the claimed modified immune cells. Without wishing to be bound by theory, the addition of a nucleic acid encoding a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, or CCL19 to the modified immune cells of the present disclosure enhances the immune inductive effect and anti-tumor activity of the modified immune cells.

[0266] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, selected from the group consisting of interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, and combinations thereof.

[0267] In some embodiments, modified cells, modified immune cells, or modified CD4 + and CD8 + The cells comprise a CAR (e.g., CD19CAR), an engineered TCR (e.g., CD19TCR), a KIR (CD19KIR), an antigen-binding polypeptide, a cell surface receptor ligand, a tumor antigen, a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration).

[0268] In some embodiments, the polypeptide that enhances immune function is selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, CCL19, or a combination thereof.

[0269] Another aspect of the present disclosure is a population of modified cells, a population of modified immune cells, or a modified CD4 + and CD8 + A population of cells is provided. In some embodiments, the engineered modified CD4 + and CD8 + The cells are for use in the production of a protein of interest (e.g., CD19CAR).

[0270] The engineered modified CD4 described herein + and CD8 + In some embodiments of the cell, the protein of interest may be selected from the group consisting of an industrial protein or a therapeutic protein. In some embodiments, the protein of interest may be selected from the group consisting of an enzyme, a regulatory protein, a receptor, a peptide, a peptide hormone, a cytokine, a membrane protein or transport protein, a vaccine antigen, an antigen binding protein, an immunostimulatory protein, an allergen, a full-length antibody or antibody fragment or derivative, a single chain antibody (scFv), a Fab fragment, an Fv fragment, a single domain antibody (VH or VL fragment), a domain antibody, a camelid single domain antibody (VHH), a nanobody, and combinations thereof.

[0271] One aspect of the present disclosure provides a method of making a modified cell comprising transfecting a cell with an isolated nucleic acid molecule described herein. In some embodiments, the isolated nucleic acid molecule encodes a CAR described herein. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0272] In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0273] One aspect of the present disclosure provides a method of making a modified cell comprising transfecting a cell with a vector comprising a nucleic acid encoding an anti-CD19 binding domain described herein, or an isolated nucleic acid described herein. V. Methods for generating modified T cells

[0274] One aspect of the present disclosure provides a method for producing an engineered modified immune cell population comprising the novel CD19 binders disclosed herein. Another aspect of the present disclosure provides a method for producing the modified cells, comprising transfecting cells with any of the vectors described herein. In some embodiments, the vector comprises (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR), and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or functional derivative thereof that enhances immune cell function. In some embodiments, the CAR comprises a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide.

[0275] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function may be selected from the group consisting of a cytokine, an interferon, a chemokine, an antibody or antibody fragment, a checkpoint inhibitor antagonist, a dominant negative receptor, a switch receptor, and combinations thereof.

[0276] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function can be a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, and combinations thereof. Alternatively, the polypeptide or functional derivative thereof that enhances immune cell function can be a cytokine selected from the group consisting of interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor, alpha, beta, or gamma interferon, erythropoietin, and combinations thereof. The polypeptide or functional derivative thereof that enhances immune cell function can also be a chemokine selected from CCL21, CCL19, or a combination thereof. In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is IL-18.

[0277] In some embodiments of the methods disclosed herein, the vector encodes a CAR comprising an anti-CD19 binding domain, comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2, and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2. In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 14. In another embodiment, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216, or (b) a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. VI. Composition

[0278] One aspect of the present disclosure is a modified cell, modified lymphocyte, modified immune cell, or modified CD4 + and CD8 + A composition comprising the cells is provided. Another aspect of the present disclosure is a population of modified lymphocytes, a population of modified cells, a population of modified immune cells, or a modified CD4 + and CD8 + A composition comprising a population of cells is provided. Another aspect of the present disclosure provides a composition comprising the lentiviral vector described herein. In some embodiments, the composition further comprises one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients.

[0279] In some embodiments, the compositions described herein are used in medicaments for use in treating a disease or disorders described herein (e.g., cancer, any malignant tumor, autoimmune disease involving cells or tissues that express a tumor antigen described herein). In some embodiments, the compositions described herein are used in methods for treating or curing a disease or a disorder described herein (e.g., cancer, any malignant tumor, an autoimmune disease involving cells or tissues that express a tumor antigen described herein). In some embodiments, provided herein is a pharmaceutical composition comprising a CAR-expressing cell, e.g., a plurality of CAR-expressing cells, made by a manufacturing process described herein (e.g., a cytokine process described herein, or an activation process described herein). VII. Treatment method

[0280] In one aspect, the present disclosure provides a method of adoptive cell transfer therapy comprising administering modified immune cells engineered by the methods described herein to a subject in need thereof. In some embodiments, disclosed herein is a method of treating a disease or condition in a subject, the method comprising administering to the subject a population of modified T cells described herein, e.g., a population of modified unstimulated T cells or a population of modified stimulated T cells described herein. In some embodiments, the present disclosure includes a method of treating a disease or condition in a subject comprising administering to a subject in need thereof a composition comprising a modified immune cell described herein.

[0281] One aspect of the present disclosure provides a method of treating a disease or condition in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of modified cells, modified immune cells, or modified CD4 + and CD8 +The method of treating a disease or condition in a subject also includes administering a population of modified cells, a population of modified immune cells, or a modified CD4 + and CD8 + The method of treating a disease or condition in a subject can also include administering a therapeutically effective amount of a composition described herein to a subject in need thereof.

[0282] In some embodiments, modified immune cells or modified CD4 + and CD8 + In some embodiments, modified immune cells, or CD4 + and CD8 + The cells are allogeneic to the subject. In some embodiments, modified immune cells, or modified CD4 + and CD8 + The cells are xenogeneic to the subject. In some embodiments, the subject is human. A. Illnesses and Conditions

[0283] One aspect of the present disclosure provides a method of providing anti-tumor immunity in a mammal, comprising administering to the mammal an effective amount of a composition or modified cells described herein. In some embodiments, the composition comprises a modified cell that expresses a CAR described herein. The composition may also comprise a modified cell or a population of modified cells.

[0284] Another aspect of the present disclosure provides a method of treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of a composition or modified cells described herein. In some embodiments, the composition comprises modified cells that express a CAR described herein.

[0285] The modified cells can be autologous modified T cells or allogeneic modified T cells. In one embodiment, the mammal is a human.

[0286] In some embodiments, the disease associated with CD19 expression is selected from a proliferative disease, a malignancy, a precancerous condition, or a non-cancer related indication associated with CD19 expression. In some embodiments, the disease associated with expression of CD19 is cancer, atypical and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

[0287] In some embodiments, the disease is a hematological cancer selected from the group consisting of acute leukemia, chronic leukemia, a hematological condition, and combinations thereof. The disease may also be B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell lymphoma or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, inefficient production (or dysplasia) of myeloid blood cells, and combinations thereof.

[0288] In some embodiments, the modified cells or compositions are administered in combination with an agent that increases the potency of cells expressing the CAR molecule. In some embodiments, the modified cells or compositions are administered in combination with an agent that ameliorates one or more side effects associated with the administration of cells expressing a CAR molecule. In some embodiments, the modified cells or compositions are administered in combination with an agent that treats a CD19-associated disease.

[0289] One aspect of the present disclosure provides an adoptive cell transfer therapy for a disease or condition. In some embodiments, the disease or condition may be selected from the group consisting of cancer, autoimmune disease, systemic lupus erythematosus, neurodegenerative disease or condition, Alzheimer's disease, multiple sclerosis, infectious disease, fibrotic condition, liver fibrosis, pulmonary fibrosis, post-ischemic fibrosis, genetic disease, sickle cell anemia, hemophilia, and / or β-thalassemia. In some embodiments, the disease or condition is selected from cancer, any malignancy, an autoimmune disease involving cells or tissues that express a tumor antigen described herein. B. Combination Therapy

[0290] In some embodiments, the method of treating a disease further comprises administering to the subject an additional therapeutic agent or therapy. In some embodiments, the additional therapeutic agent disclosed herein comprises a chemotherapeutic agent, an immunotherapeutic agent, a targeted therapy, a radiation therapy, or a combination thereof. Representative additional therapeutic agents include alkylating agents such as altretamine, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, lomustine, melphalan, oxaliplatin, temozolomide, or thiotepa; antimetabolites such as 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, or pemetrexed; daunorubicin; and doxorubicin. Examples of additional therapeutic agents include, but are not limited to, anthracyclines such as fluconazole, epirubicin, and idarubicin; topoisomerase I inhibitors such as topotecan and irinotecan (CPT-11); topoisomerase II inhibitors such as etoposide (VP-16), teniposide, and mitoxantrone; mitotic inhibitors such as docetaxel, estramustine, ixabepilone, paclitaxel, vinblastine, vincristine, or vinorelbine; or corticosteroids such as prednisone, methylprednisolone, or dexamethasone. In some cases, the additional therapeutic agent comprises a first-line therapy. As used herein, "first-line therapy" refers to a primary treatment for a subject with cancer. In some embodiments, the cancer is a primary cancer. In other embodiments, the cancer is a metastatic or recurrent cancer. In some cases, the first-line treatment comprises chemotherapy. In other examples, the first-line treatment comprises radiation therapy. One skilled in the art will readily appreciate that different first-line treatments may be applied to different types of cancer. In some cases, the additional therapeutic agent comprises an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor comprises an inhibitor such as an antibody or fragment thereof (e.g., a monoclonal antibody, a human antibody, a humanized antibody, or a chimeric antibody), an RNAi molecule, or a small molecule against PD-1, PD-L1, CTLA4, PD-L2, LAG3, B7-H3, KIR, CD137, PS, TFM3, CD52, CD30, CD20, CD33, CD27, OX40, GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM. Exemplary checkpoint inhibitors include pembrolizumab, nivolumab, tremelimumab, or ipilimumab. In some embodiments, the additional therapy comprises radiation therapy.

[0291] In some embodiments, the additional therapy comprises surgery. VIII. Kit

[0292] One embodiment of the present disclosure is a population of modified immune cells, or modified CD4 + and CD8 + Kits are provided that include a population of cells, or a population engineered by the methods described herein. Another aspect of the present disclosure provides kits that include a lentiviral vector that includes a CAR as described herein. IX.Definitions

[0293] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0294] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described herein. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting.

[0295] The practice of the present disclosure employs, unless otherwise specified, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of those in the art. See, for example, Green and Sambrook (eds.) (2012) "Molecular Cloning: A Laboratory Manual," 4th Edition; Ausubel et al. (eds.) (2015) "Current Protocols in Molecular Biology" series, Methods in Enzymology series (Academic Press, Inc., NY); Greenfield (eds.) (2014) "Antibodies, A Laboratory Manual"; Freshney (2010), Lundblad and Macdonald (eds.) (2010) "Handbook of Biochemistry and Molecular Biology," 4th Edition.

[0296] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" means one cell or more than one cell, including a plurality of cells, including mixtures thereof.

[0297] As used herein, the term "about" refers to a value that includes the standard deviation of error for the device or method employed to determine the value. When used before numerical designations, such as temperature, time, amount, and concentration (including ranges), the term "about" indicates an approximation that may vary (+) or (-) (±) 20%, 15%, 10%, 5%, 3%, 2%, or 1%. Preferably, the range is ±5%, more preferably ±1%, and even more preferably ±0.1% from the designated value, and such variations are appropriate for carrying out the methods of the present disclosure.

[0298] As used herein, the term "activated" refers to a state in which T cells have been stimulated sufficiently to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cells" particularly refers to T cells undergoing cell division.

[0299] As used herein, the term "affinity" refers to the measure of binding strength between an antibody and a simple hapten or antigenic determinant. Without being bound by theory, affinity depends on the closeness of the stereochemical fit between the antibody binding site and the antigenic determinant, the size of the contact area between them, and the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity," which refers to the strength of antigen-antibody binding after reversible complex formation. Methods for calculating the affinity of an antibody for an antigen are known in the art and include the use of binding experiments to calculate affinity. When an antibody (Ab) binds to an antigen (Ag), an affinity constant (expressed as the inverse dissociation constant) is used.

[0300] Ab+Ag=AbAgKa=i[AbAg][Ab][Ag]=1K a

[0301] The chemical equilibrium of antibody binding is determined by the on-rate constant (k forward ) and the off-rate constant (k back) Two antibodies may have the same affinity, but one may have both a high on-rate constant and a high off-rate constant, while the other may have both a low on-rate constant and a low off-rate constant.

[0302] Antibody activity in functional assays (e.g., cytolytic assays) can also reflect antibody affinity. In some embodiments, the antigen-recognizing receptor has low affinity. Low affinity includes micromolar and nanomolar affinities. Low affinity is defined as an affinity below 10 -3 , 10 -4 , 10 -5 , 5×10 -5 , 5×10 -6 , 10 -6 , 5×10 -7 , 10 -7 , 5×10 -8 , 10 -8 , 5×10 -9 , or 10 -9 M may be included. Antibodies and affinities can be phenotypically characterized and compared using functional assays (e.g., cytolytic assays). A wide variety of methods for determining binding affinity are known in the art. A representative method for determining binding affinity uses surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows for the analysis of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix, for example, using a BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, NJ).

[0303] As used herein, the term "allogeneic" refers to material derived from a different animal of the same species as the individual into which it is introduced. Two or more individuals are said to be allogeneic to one another if the genes at one or more loci are not identical. In certain embodiments, allogeneic material from individuals of the same species may be sufficiently genetically distinct to interact antigenically.

[0304] As used herein, the term "analog" in reference to a polypeptide or polynucleotide includes any mimetic, i.e., a chemical compound that retains at least one of the intrinsic functions of the analogous polypeptide or polynucleotide. Typically, amino acid substitutions can be made, for example, from 1, 2, or 3 to 10 or 20 substitutions, provided that the modified sequence retains the desired activity or ability. Amino acid substitutions include the use of non-naturally occurring analogs.

[0305] The proteins used in the present disclosure may have deletions, insertions, or substitutions of amino acid residues, which may result in silent mutations and result in functionally equivalent proteins. Deliberate amino acid substitutions may be made based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the residues, so long as the intrinsic function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine, and tyrosine. Conservative substitutions may also be made.

[0306] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be an intact immunoglobulin from natural or recombinant sources, or an immunoreactive portion of an intact immunoglobulin. An antibody is typically a tetramer of an immunoglobulin molecule. Antibodies in this disclosure can exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies (scFv) and humanized antibodies. In some embodiments, an antibody refers to such an aggregate (e.g., an intact antibody molecule, immunoadhesin, or variant thereof) that has significant known specific immunoreactive activity against an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins consist of light and heavy chains, with or without interchain covalent bonds between them. The basic structure of immunoglobulins in vertebrate systems is relatively well understood.

[0307] The term "antibody fragment" refers to a portion of an intact antibody, and refers to the antigen-determining variable region of the intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.

[0308] In some embodiments, the term "antibody fragment" refers to at least a portion of an intact antibody or a recombinant variant thereof, including an antigen-binding domain, e.g., the antigenic variable region of the intact antibody, sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab'), and Fv fragments, scFv antibody fragments, linear antibodies, single-domain antibodies such as sdAbs (either VL or VH), camelid VHH domains, and multispecific antibodies formed from antibody fragments. The term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light and heavy chain variable regions are contiguously linked via a short, flexible polypeptide linker, allowing expression as a single polypeptide chain, and wherein the scFv retains the specificity of the intact antibody from which it is derived. As used herein, an scFv may have the VL and VH variable regions in either order; for example, with respect to the N-terminus and C-terminus of the polypeptide, an scFv may comprise VL-linker-VH or VH-linker-VL.

[0309] The portion of the CAR composition of the present disclosure that comprises an antibody or antibody fragment thereof can exist in various forms in which the antigen-binding domain is expressed as part of a continuous polypeptide chain, including, for example, a single-domain antibody fragment (sdAb), a single-chain antibody (scFv), a human-derived antibody, and a humanized antibody. In one embodiment, the antigen-binding domain of the CAR composition of the present disclosure comprises an antibody fragment. In a further embodiment, the CAR comprises an antibody fragment that comprises an scFv.

[0310] As used herein, the term "antibody heavy chain" refers to the larger of the two polypeptide chains present in all antibody molecules in their naturally occurring conformation.

[0311] As used herein, "antibody light chain" refers to the smaller of the two types of polypeptide chains naturally present in all antibody molecules. The α and β light chains refer to the two major antibody light chain isotypes. The antigen-binding domain of (e.g., chimeric antigen receptor) antibodies includes antibody variants. As used herein, the term "antibody variant" includes synthetic and engineered forms of antibodies that have been modified to be non-naturally occurring, such as antibodies that contain at least two heavy chain portions rather than two complete heavy chains (e.g., domain-deleted antibodies or minibodies), multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) that have been modified to bind to two or more different antigens or different epitopes on a single antigen, and heavy chain molecules bound to scFv molecules. Furthermore, the term "antibody variant" includes multivalent antibodies (e.g., trivalent, tetravalent, etc., antibodies that bind to three, four, or more copies of the same antigen).

[0312] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may include antibody production, activation of specific immunologically competent cells, or both. Those skilled in the art will understand that any macromolecule, including virtually all proteins and peptides, can function as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or partial nucleotide sequence that encodes a protein that elicits an immune response encodes an "antigen," as used herein. Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It will be readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of one or more genes, and that these nucleotide sequences may be arranged in various combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that an antigen need not be encoded by a "gene" at all. It will be readily apparent that antigens can be synthetically produced or derived from biological samples, including, but not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0313] As used herein, the term "antigen-presenting cell" or "APC" refers to a cell of the immune system, such as an accessory cell (e.g., B cell, dendritic cell, etc.), that presents foreign antigens on its surface complexed with major histocompatibility complexes (MHC). T cells can recognize these complexes using the T cell receptor (TCR). APCs process and present antigens to T cells.

[0314] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. In some embodiments, an "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present disclosure to prevent the development of tumors in the first place.

[0315] The term "autoimmune disease" as used herein is defined as a disease caused by an autoimmune response. Autoimmune diseases are the result of an inappropriate and excessive response to self-antigens. Examples of autoimmune diseases include Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, cancer, Crohn's disease, diabetes mellitus (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

[0316] As used herein, the term "autologous" is meant to refer to any material derived from the same individual to which that material may later be reintroduced.

[0317] As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream or lymphatic system. As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream or lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain tumors, lymphoma, leukemia, lung cancer, metastatic castration-resistant prostate cancer, melanoma, synovial sarcoma, advanced TnMuc1-positive solid tumors, neuroblastoma, neuroendocrine tumors, and the like. In certain embodiments, the tumor is a CD19-positive tumor, and the cancer is medullary thyroid carcinoma. In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is mesothelioma or a mesothelin-expressing cancer. In some embodiments, the cancer is metastatic castration-resistant prostate cancer. The terms "cancer" and "tumor" are used interchangeably herein, and both terms encompass solid tumors and liquid tumors, diffuse tumors, or circulating tumors. In some embodiments, cancer or tumor includes pre-malignant as well as malignant cancers and tumors.

[0318] As used herein, the terms "cancer-associated antigen" or "tumor antigen" refer interchangeably to a molecule (typically a protein, carbohydrate, or lipid) that is expressed on the surface of cancer cells, either in whole or as fragments (e.g., MHC / peptides), and that is useful for preferential targeting of pharmacological agents to cancer cells. In some embodiments, a tumor antigen is a marker expressed by both normal and cancer cells (e.g., a lineage marker such as CD19 on B cells). In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed in cancer cells compared to normal cells, e.g., by 1-fold overexpression, 2-fold overexpression, 3-fold overexpression, or more compared to normal cells. In some embodiments, tumor antigens are cell surface molecules that are inappropriately synthesized in cancer cells, e.g., molecules that contain deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, tumor antigens are expressed entirely or only as fragments (e.g., MHC / peptides) on the cell surface of cancer cells, and are not synthesized or expressed on the surface of normal cells. In some embodiments, the CARs of the present disclosure include CARs that include an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to an MHC-presented peptide. Typically, peptides derived from endogenous proteins fill the pocket of a major histocompatibility complex (MHC) class I molecule and are expressed by CD8 + MHC class I complexes are recognized by T cell receptors (TCRs) on T lymphocytes. MHC class I complexes are constitutively expressed on all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibodies have been reported that target peptides derived from viral or tumor antigens associated with human leukocyte antigen (HLA)-1 or HLA-A2. For example, TCR-like antibodies can be identified by screening libraries such as human scFv phage display libraries.

[0319] As used herein, the terms "cancer-supporting antigen" and "tumor-supporting antigen" refer interchangeably to molecules (typically proteins, carbohydrates, or lipids) expressed on the surface of cells that are not themselves cancerous but that support cancer cells by promoting their growth or survival (e.g., resistance to immune cells). Examples of this type of cell include stromal cells and myeloid-derived suppressor cells (MDSCs). As long as the antigen is present on a cell that supports cancer cells, the tumor-supporting antigen itself does not necessarily play a role in supporting tumor cells.

[0320] As used herein, "cell surface marker" refers to a molecule that is expressed on the cell surface. Cell surface expression usually requires that the molecule have a transmembrane domain. Many naturally occurring cell surface markers are referred to as "CD" or "cluster of differentiation" molecules. Cell surface markers often provide antigenic determinants to which antibodies can bind.

[0321] As used herein, the term "chimeric antigen receptor" or alternatively "CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") that comprises a functional signaling domain derived from a stimulatory molecule, as defined below.

[0322] In one embodiment, CAR refers to an artificial T cell receptor that is expressed on immune effector cells or their precursor cells and engineered to specifically bind to an antigen. CARs can be used in adoptive cell therapy using adoptive cell transfer. In some embodiments, adoptive cell transfer (or treatment) involves removing T cells from the patient and modifying the T cells to express a receptor specific for a particular antigen. In some embodiments, the CAR is specific for a selected target, such as CD19, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), or interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2).

[0323] In some embodiments, the stimulatory molecule is the zeta chain associated with the T cell receptor complex. In some embodiments, the cytoplasmic signaling domain further comprises one or more functional signaling domains from at least one costimulatory molecule as defined below. In some embodiments, the costimulatory molecule is selected from 4-1BB (ie, CD137), CD27 and / or CD28. In some embodiments, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule.

[0324] As used herein, the term "signaling domain" refers to a functional portion of a protein that acts by transmitting information within the cell to regulate cellular activity through a defined signaling pathway, either by producing second messengers or by functioning as an effector that responds to such messengers.

[0325] As used herein, the term "CD19" refers to the cluster of differentiation 19 protein, an antigenic determinant detectable on leukemia precursor cells. Human and mouse amino acid and nucleic acid sequences can be found in public databases such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human CD19 can be found under UniProt / Swiss-Prot Accession No. P15391, and the nucleotide sequence encoding human CD19 can be found under Accession No. NM_001178098. CD19 is expressed in most B-lineage cancers, such as acute lymphoblastic leukemia, chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. Other cells that express CD19 are described below in the definition of "diseases associated with CD19 expression." It is also an early marker of B-cell precursor cells. See, for example, Nicholson et al., Mol. Immun. 34(16-17):1157-1165 (1997). In some embodiments, the antigen-binding portion of the CART recognizes and binds to an antigen within the extracellular domain of the CD19 protein. In some embodiments, the CD19 protein is expressed on cancer cells.

[0326] As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the present disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those that replace an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues in the CDR regions of an antibody can be substituted with other amino acid residues from the same side chain family, and the resulting antibodies can be tested for antigen-binding ability using the functional assays described herein.

[0327] As used herein, the term "costimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing signals that mediate T cell responses, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided, for example, by binding of a peptide-loaded MHC molecule to the TCR / CD3 complex. Costimulatory ligands include, but are not limited to, CD2, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, but are not limited to, antibodies that specifically bind to costimulatory molecules present on T cells, such as CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0328] As used herein, the term "costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand and thereby mediates a costimulatory response (such as proliferation) by the T cell. A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand that contributes to an efficient immune response. Costimulatory molecules include, but are not limited to, intracellular domains derived from MHC class I molecules, BTLA, Toll ligand receptor, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and killer immunoglobulin-like receptors (KIR). In some embodiments, costimulatory molecules include OX40, CD27, CD2, CD28, ICOS (CD278), and 4-1BB (CD137). Further examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, and TRANCE. These include RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and ligands that specifically bind to CD83.

[0329] As used herein, the term "costimulatory signal" refers to a signal that, in combination with a primary signal such as TCR / CD3 ligation, causes T cell proliferation and / or up-regulation or down-regulation of key molecules. A costimulatory intracellular signaling domain can be the intracellular portion of a costimulatory molecule. Costimulatory molecules may be classified into the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), and activating NK cell receptors. Examples of such molecules include CD27, CD28, 4-lBB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and ligands that specifically bind to CD83.

[0330] As used herein, the term "derived from" refers to the relationship between a first molecule and a second molecule. This generally refers to the structural similarity between the first molecule and the second molecule and does not imply or imply a limitation on the process or source by which the first molecule is derived from the second molecule. For example, in the case of an intracellular signaling domain derived from the CD3ζ molecule, the intracellular signaling domain retains sufficient CD3ζ structure so that it has the required function, i.e., the ability to generate a signal under appropriate conditions. This does not imply or imply a limitation on the specific process by which the intracellular signaling domain is produced; for example, it does not imply that one must start with the sequence of CD3ζ and delete or add mutations to arrive at the intracellular signaling domain to provide the intracellular signaling domain.

[0331] As used herein, the term "disease" refers to a state of health in an animal in which the animal is unable to maintain homeostasis and the animal's health will continue to deteriorate unless the disease is ameliorated. In contrast, the term "disorder" in an animal refers to a state in which the animal is able to maintain homeostasis, but the animal's health is not better than it would be without the disorder. Ignoring the disorder does not necessarily result in a further decline in the animal's health.

[0332] As used herein, "diseases associated with expression of tumor antigens" include, but are not limited to, diseases associated with expression of tumor antigens or conditions associated with cells expressing tumor antigens, including, but not limited to, proliferative diseases such as cancer or malignancies, or precancerous conditions such as myelodysplasia, myelodysplastic syndrome or preleukemia, or non-cancer related indications associated with cells expressing tumor antigens. In some embodiments, the cancer associated with tumor antigen expression is a hematological cancer. In some embodiments, the cancer associated with tumor antigen expression is a solid cancer. Additional diseases associated with tumor antigen expression include, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions, or proliferative disorders associated with tumor antigen expression. Non-cancer-related indications associated with tumor antigen expression include, but are not limited to, autoimmune diseases (e.g., lupus), inflammatory diseases (allergies and asthma), and transplantation. In some embodiments, tumor antigen-expressing cells express or have previously expressed mRNA encoding a tumor antigen, hi some embodiments, tumor antigen-expressing cells produce tumor antigen proteins (e.g., wild-type or mutant), which may be present at normal or reduced levels. In some embodiments, the tumor antigen-expressing cells produce detectable levels of the tumor antigen protein at one time, and then subsequently cease to produce substantially detectable levels of the tumor antigen protein.

[0333] As used herein, the term "disease associated with CD19 expression" includes, but is not limited to, a disease associated with CD19 expression or a condition associated with cells expressing CD19, including a proliferative disease such as a cancer or malignancy, or a precancerous condition such as myelodysplasia, myelodysplastic syndrome, or preleukemia, or a non-cancer related indication associated with cells expressing CD19. In some embodiments, the cancer associated with CD19 expression is a hematological cancer. In one embodiment, the hematological cancer is leukemia or lymphoma. In one embodiment, cancers associated with expression of CD19 include cancers and malignancies including, but not limited to, one or more acute leukemias, including, but not limited to, B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), and one or more chronic leukemias, including, but not limited to, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL). Additional cancers or hematological conditions associated with CD19 expression include, but are not limited to, B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, and "preleukemias," which are diverse hematological conditions associated with inefficient production (or dysplasia) of myeloid blood cells. Additional diseases associated with CD19 expression include, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions, or proliferative disorders associated with CD19 expression. Non-cancer related indications associated with CD19 expression include, but are not limited to, autoimmune diseases (eg, lupus), inflammatory diseases (allergies and asthma), and transplantation.

[0334] As used herein, the term "downregulation" means the reduction or elimination of gene expression of one or more genes.

[0335] As used herein, the term "encoding" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide (such as a gene, cDNA, or mRNA) to serve as a template for the synthesis of other polymers and macromolecules in biological processes, either with a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, thereby expressing a biological property. Thus, a gene, cDNA, or RNA encodes a protein when transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing) and the non-coding strand (used as a template for transcription of the gene or cDNA) can be said to encode the protein or other product of that gene or cDNA. Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA may contain introns, to the extent that a nucleotide sequence encoding a protein may, in some version, contain introns.

[0336] As used herein, the terms "effective amount" and "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material, pharmaceutical agent, or composition described herein that is effective to achieve a desired physiological, therapeutic, or prophylactic result in a subject in need thereof. Such a result may include, but is not limited to, an amount that, when administered to a mammal, elicits a detectable level of immune response compared to an immune response detected in the absence of the disclosed composition. The immune response can be readily assessed by numerous art-recognized methods. Those skilled in the art will understand that the amount of a composition administered herein will vary and can be readily determined based on many factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like. The effective amount may vary from subject to subject, depending on the health and physical condition of the subject being treated, the taxonomic group of the subject being treated, the formulation of the composition, an evaluation of the subject's medical condition, and other relevant factors.

[0337] As used herein, the term "endogenous" refers to a substance that originates from or is produced within an organism, cell, tissue, or system.

[0338] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0339] As used herein, the term "exogenous" refers to a substance introduced or produced from outside an organism, cell, tissue, or system.

[0340] As used herein, the term "expression vector" refers to a vector containing a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied in a host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) that incorporate a recombinant polynucleotide.

[0341] As used herein, the term "extended packaging signal" or "extended packaging sequence" refers to the use of sequences surrounding the psi sequence that extend further into the gag gene. The inclusion of such additional packaging sequences can increase the efficiency of vector RNA insertion into viral particles. As an example, the minimal core packaging signal of murine leukemia virus (MoMLV) is encoded by the sequence from approximately nucleotide 144 to the Pst I site (nucleotide 567) (counting from the 5' LTR cap site). The MoMLV extended packaging signal includes the sequence from nucleotide 567 to the start of the gag / pol gene (nucleotide 621) and the sequence from nucleotide 1040 onward. These sequences comprise approximately one-third of the gag gene sequence.

[0342] As used herein, "ex vivo" refers to cells removed from a living organism (e.g., a human) and grown outside the body (e.g., in a culture dish, test tube, or bioreactor).

[0343] As used herein, "Fab" refers to the fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc portion; for example, an antibody digested with the enzyme papain produces two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region, an Fc region that does not bind to an antigen).

[0344] As used herein, the term "flexible polypeptide linker" or "linker" used in the context of an scFv refers to a peptide linker consisting of amino acids such as glycine and / or serine residues, used alone or in combination, to link the variable heavy and variable light chain regions. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker, having the amino acid sequence (Gly-Gly-Gly-Ser) n where n is a positive integer equal to or greater than 1. For example, n=1, n=2, n=3, n=4, n=5, and n=6, n=7, n=8, n=9, and n=10. Representative linkers are shown in Table 1.

[0345] As used herein, a "fragment" is also a variant, and the term generally refers to a selected region of a polypeptide or polynucleotide that is of functional or other interest, for example, in an assay. Thus, a "fragment" refers to an amino acid sequence or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0346] As used herein, "functional variant" refers to a polypeptide that has an amino acid sequence substantially identical to a reference amino acid sequence, or is encoded by a nucleotide sequence that is substantially identical, and that can have one or more activities of the reference amino acid sequence.

[0347] As used herein, the term "host cell" includes cells transfected, infected, or transduced in vivo, ex vivo, or in vitro with a recombinant vector or polynucleotide of the present disclosure. Host cells may include packaging cells, producer cells, and cells infected with a viral vector. In some embodiments, host cells infected with a lentiviral vector of the present disclosure are administered to a subject in need of treatment. In some embodiments, the term "target cell" is used interchangeably with host cell and refers to a transfected, infected, or transduced cell of a desired cell type. In a preferred embodiment, the target cell is a T cell.

[0348] As used herein, the term "homologous" refers to the identity of subunit sequences between two polymer molecules (e.g., between two nucleic acid molecules, such as two DNA molecules or two RNA molecules) or between two polypeptide molecules. Two molecules are homologous at a subunit position if that position is occupied by the same monomer subunit. For example, two DNA molecules are homologous if every position in each is occupied by adenine. The homology between two sequences is a direct function of the number of matching or homologous positions. For example, if half the positions in two sequences (e.g., five positions in a polymer 10 subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matching or homologous, the two sequences are 90% homologous.

[0349] As used herein, the term "homologue" refers to an entity that has a certain degree of homology with a wild-type amino acid sequence and a wild-type nucleotide sequence. The term "homology" can be equated with "identity." As used herein, a homologous sequence is intended to include an amino acid sequence that may be at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the subject sequence, preferably at least 95%, 97%, or 99% identical. Typically, a homologue contains the same active site, etc., as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present disclosure, it is preferred to express homology in terms of sequence identity.

[0350] A homologous sequence is intended to include a nucleotide sequence that may be at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the subject sequence, preferably at least 95%, 97%, or 99% identical. Although homology can also be considered in terms of similarity, in the context of the present disclosure, it is preferred to express homology in terms of sequence identity. Homology comparisons can be performed visually or, more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percentage of homology or identity between two or more sequences.

[0351] Percentages of homology can be calculated for consecutive sequences by aligning one sequence with the other and directly comparing each amino acid in one sequence with the corresponding amino acid in the other sequence, residue by residue. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed over a relatively short number of residues. While this is a very simple and consistent method, it does not take into account that, for example, in a pair of identical sequences, a single insertion or deletion of a nucleotide sequence may cause the following codon to be out of alignment, resulting in a significant decrease in the percent homology when a global alignment is performed. As a result, most sequence comparison methods are designed to produce an optimal alignment that takes into account possible insertions and deletions without unduly reducing the overall homology score. This is achieved by inserting "gaps" into the sequence alignment to maximize local homology.

[0352] However, these complex methods assign a "gap penalty" to each gap that occurs in the alignment, so that for the same number of identical amino acids, a sequence alignment with as few gaps as possible will achieve a higher score than one with many gaps, reflecting a higher relatedness between the two sequences being compared. Affine gap costs, which impose a relatively high cost for the presence of a gap and a smaller penalty for each residue in the gap, are commonly used. This is the most commonly used gap scoring system. Higher gap penalties, of course, produce optimized alignments with fewer gaps. Most alignment programs allow you to change the gap penalty; however, it is preferable to use the default values ​​when using such software for sequence comparison. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

[0353] Therefore, calculation of the percentage of maximum homology first requires the creation of an optimal alignment, taking into account gap penalties. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12:387). Other examples of software capable of performing sequence comparisons include, but are not limited to, the BLAST package (FASTA) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching. However, for some applications, it may be preferable to use the GCG Bestfit program. Another tool, called BLAST2Sequences, is also available for comparing protein and nucleotide sequences.

[0354] Although the final homology percentage can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pairwise comparison. Instead, a scaled similarity score matrix is ​​commonly used, assigning scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix is ​​the BLOSUM62 matrix (the default matrix for the BLAST suite of programs). GCG Wisconsin programs typically use either the published default values ​​or a custom symbol comparison table, if provided (see the user manual for details). Depending on the application, it may be preferable to use the published default values ​​of the GCG package or a default matrix such as BLOSUM62 for other software. Once the software has produced an optimal alignment, the percentage of homology, preferably percentage sequence identity, can be calculated. The software typically does this as part of the sequence comparison, generating a numerical result.

[0355] As used herein, the term "hybrid vector" refers to a vector, LTR, or other nucleic acid that contains both retroviral sequences (e.g., lentivirus) and non-retroviral sequences (e.g., lentivirus sequences). In one embodiment, a hybrid vector refers to a vector or transfer plasmid that contains retroviral (e.g., lentivirus) sequences for reverse transcription, replication, integration, and / or packaging.

[0356] Such variants can be prepared using standard recombinant DNA techniques, such as site-directed mutagenesis. If an insertion is to be made, synthetic DNA can be generated that encodes the insertion, along with 5' and 3' flanking regions that correspond to the naturally occurring sequence on either side of the insertion site. The flanking regions contain convenient restriction sites that correspond to those in the naturally occurring sequence, allowing the sequence to be cleaved with an appropriate enzyme and the synthetic DNA to be ligated into the cleavage site. The DNA can then be expressed according to the present disclosure to produce the encoded protein. These methods are merely illustrative of the many standard techniques known in the art for manipulating DNA sequences; other known techniques can also be used.

[0357] As used herein, the term "identity" refers to the identity of the subunit sequences between two polymer molecules, particularly between two amino acid molecules, for example, between two polypeptide molecules. If two amino acid sequences have the same residue at the same position, they are identical at that position. For example, if each position in two polypeptide molecules is occupied by arginine, the two polypeptides are identical. The identity or degree to which two amino acid sequences have the same residue at the same position in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions. For example, if half of the positions in two sequences (e.g., five positions in a polymer 10 amino acids long) are identical, the two sequences are 50% identical, and if 90% of the positions (e.g., 9 out of 10) are matching or identical, the two amino acid sequences are 90% identical.

[0358] As used herein, the term "immunoglobulin" or "Ig" defines a group of proteins that function as antibodies. Antibodies expressed by B cells are sometimes called BCRs (B cell receptors) or antigen receptors. There are five types of proteins in this class: IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody and is present in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and respiratory and genitourinary mucus. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response of most subjects. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses and is important for defense against bacteria and viruses. IgD is an immunoglobulin with no known antibody function but may function as an antigen receptor. IgE is an immunoglobulin that mediates immediate hypersensitivity by inducing the release of mediators from mast cells and basophils upon exposure to allergens.

[0359] As used herein, the term "immune response" is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigen molecule as foreign and induce the formation of antibodies and / or activate lymphocytes to eliminate the antigen.

[0360] As used herein, the term "immune effector cell" refers to a cell that is involved in an immune response, e.g., promoting an immune effector response. Examples of immune effector cells include T cells (e.g., α / β T cells and γ / δ T cells), B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes.

[0361] As used herein, the term "immune effector function or immune effector response" refers to a function or response that enhances or promotes an immune attack against a target cell. In one embodiment, an immune effector function or immune effector response refers to a property of a T cell or NK cell that promotes killing or inhibiting the growth or proliferation of a target cell. In the case of T cells, primary stimulation and costimulation are examples of immune effector functions or responses.

[0362] As used herein, the term "inhibitory molecule" refers to a molecule that, when activated, causes or contributes to the inhibition of cell survival, activation, proliferation and / or function, as well as the gene encoding such a molecule and its associated regulatory elements (e.g., promoter). In some embodiments, the inhibitory molecule is a molecule expressed on immune effector cells (e.g., T cells). Non-limiting examples of inhibitory molecules are PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, TGFβIIR, VSIG3, VSIG8, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ. The term inhibitory molecule, when used in connection with a target sequence or a gRNA molecule, may be understood to refer to the gene (and its associated regulatory elements) that encodes the inhibitory molecule protein. In some embodiments, the gene encoding the inhibitory molecule is BTLA, PD-1, TIM-3, VSIG3, VSIG8, CTLA4, or TGFβIIR. In some embodiments, the gene encoding the inhibitory molecule is VSIG3. In some embodiments, the gene encoding the inhibitory molecule is PD-1. In some embodiments, the gene encoding the inhibitory molecule is TGFβIIR.

[0363] As used herein, the term "induced pluripotent stem cells" or "iPS cells" refers to pluripotent stem cells generated from adult cells, such as immune cells (i.e., T cells). Expression of reprogramming factors, such as Klf4, Oct3 / 4, and Sox2, in adult cells transforms them into pluripotent cells capable of proliferation and differentiation into multiple cell types.

[0364] As used herein, the term "isolated" means changed or removed from its natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is. An isolated nucleic acid or protein can exist in a substantially purified form, or it can exist in a non-native environment, such as a host cell.

[0365] As used herein, "in vitro transcribed RNA" refers to RNA synthesized in vitro. In some embodiments, the RNA is mRNA. Generally, in vitro transcribed RNA is generated from an in vitro transcription vector. The in vitro transcription vector comprises a template used to generate the in vitro transcribed RNA.

[0366] As used herein, the term "knockout" refers to the ablation of gene expression of one or more genes.

[0367] As used herein, "K D The term "K" refers to the equilibrium dissociation constant between an antibody and its antigen. D is the equilibrium dissociation constant between the antibody and its antigen, K off / K on It is the ratio of K D and affinity are inversely proportional. D The K value is related to the antibody concentration (the amount of antibody needed for a particular experiment). D The lower the value (lower the concentration), the higher the affinity of the antibody. DValues ​​are low micromolar (10 -6 ) to nanomoles (10 -7 From 10 -9 ) range. High affinity antibodies are generally in the low nanomolar (10 -9 ) range, whereas very high affinity antibodies are thought to be in the picomolar (10 -12 ) range.

[0368] "K on " or "binding response" refers to the "on-rate," a constant that describes how quickly an antibody binds to its target.

[0369] "K off " or "dissociation rate" refers to the "off-rate," a constant used to characterize how quickly an antibody dissociates from its target. The experimentally measured ratio of the off-rate to the on-rate (K off / K on ) to find K D The value is calculated.

[0370] As used herein, the term "lentiviral vector" refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, primarily comprising LTRs derived from a lentivirus. In some embodiments, the terms "lentiviral vector" and "lentiviral expression vector" can be used to refer to lentiviral transcription plasmids and / or infectious lentiviral particles. Elements such as cloning sites, promoters, regulatory elements, and heterologous nucleic acids are referred to herein. In some embodiments, the sequences of these elements are present in the form of RNA in the lentiviral particles of the present disclosure and in the form of DNA in the DNA plasmids of the present disclosure.

[0371] As used herein, a lentivirus-derived or lentiviral vector refers to a vector that contains at least one component derived from a lentivirus. Preferably, that component is involved in the biological mechanisms by which the vector infects cells, expresses genes, or replicates. Lentiviral vectors may be "non-primate" vectors, i.e., derived from viruses that do not primarily infect primates, particularly humans. Non-primate lentiviruses may be any member of the lentiviridae family that does not naturally infect primates, including feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), caprine arthritis-encephalitis virus (CAEV), Maedi-Visna virus (MVV), or equine infectious anemia virus (EIAV).

[0372] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in that they can infect non-dividing cells, and because they can deliver significant amounts of genetic information into the DNA of host cells, they are one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.

[0373] As used herein, the term "modified" refers to an altered state or structure of a molecule or cell of the present disclosure. Molecules can be modified in various ways, including chemically, structurally, and functionally. Cells can be modified by the introduction of nucleic acids.

[0374] As used herein, the term "modulate" means to cause a detectable increase or decrease in the level of a response in a subject compared to the level of the response in the subject in the absence of a treatment or compound, and / or compared to the level of the response in another identical but untreated subject. This term encompasses perturbing and / or influencing a negative signal or response by causing a beneficial therapeutic response in a subject, preferably a human.

[0375] In the context of the present disclosure, the following abbreviations are used for commonly occurring nucleobases: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0376] As used herein, "naive T cells" refer to antigen-naive T cells. In some embodiments, antigen-naive T cells have encountered their cognate antigen in the thymus but not in the periphery. In some embodiments, naive T cells are precursors of memory cells. In some embodiments, naive T cells express both CD45RA and CCR7, but do not express CD45RO. In some embodiments, naive T cells may be characterized by expression of CD62L, CD27, CCR7, CD45RA, CD28, and CD127, and non-expression of CD95 or CD45RO isoforms. In some embodiments, naive T cells express CD62L, IL-7 receptor a, IL-6 receptor, and CD132, but do not express CD25, CD44, CD69, or CD45RO. In some embodiments, naive T cells express CD45RA, CCR7, and CD62L, but do not express CD95 or IL-2 receptor beta. In some embodiments, the surface expression level of the marker is assessed using flow cytometry.

[0377] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" can also include introns, to the extent that the nucleotide sequence encoding the protein contains introns.

[0378] As used herein, the term "operably linked" refers to a functional linkage between a regulatory sequence and a heterologous nucleic acid sequence that results in expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

[0379] As used herein, the term "overexpressed" or "overexpression" of a tumor antigen refers to an abnormal level of expression of the tumor antigen in cells from a diseased area, such as a solid tumor, within a particular tissue or organ of a patient relative to the expression level in normal cells from that tissue or organ. Patients with solid tumors or hematological malignancies characterized by overexpression of tumor antigens can be determined by standard assays known in the art.

[0380] As used herein, the term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection or infusion techniques.

[0381] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds containing amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides, and oligomers, and the many types of longer chains, commonly referred to in the art as proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. A polypeptide includes natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0382] As used herein, "poly(A)" refers to a series of adenosines attached to mRNA by polyadenylation. In some embodiments of constructs for transient expression, the poly(A) is between 50 and 5,000. In some embodiments, the poly(A) is greater than 64. In some embodiments, the poly(A) is greater than 100. In some embodiments, the poly(A) is greater than 300. In some embodiments, the poly(A) is 400 or greater. The poly(A) sequence can be modified chemically or enzymatically to regulate mRNA functionality, such as localization, stability, and translation efficiency.

[0383] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylated moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at their 3' ends. The 3' poly(A) tail is a long sequence (often several hundred) of adenine nucleotides added to pre-mRNA by the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence known as a polyadenylation signal. The poly(A) tail and its associated proteins help protect the mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but also occurs later in the cytoplasm. After transcription is completed, the mRNA strand is cleaved by the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0384] As used herein, the term "transient" refers to expression of a non-integrated exogenous gene for a period of hours, days, or weeks, which period of expression is shorter than the period of expression of the gene when integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0385] The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore, a nucleic acid is a polymer of nucleotides. Therefore, as used herein, nucleic acid and polynucleotide are interchangeable. Those skilled in the art have the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. Polynucleotides as used herein include, but are not limited to, those derived from recombinant means, i.e., conventional cloning techniques and PCR. TMThe term "nucleic acid sequences" includes all nucleic acid sequences obtained by any means available in the art, including cloning of nucleic acid sequences from recombinant libraries or cell genomes, using techniques such as those described above, and synthetic means.

[0386] As used herein, the term "promoter" is defined as a DNA sequence recognized by the synthetic machinery of a cell or introduced synthetic machinery necessary to initiate the specific transcription of a polynucleotide sequence.

[0387] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some embodiments, this sequence may be the core promoter sequence, and in other embodiments, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, confer tissue-specific expression of the gene product.

[0388] As used herein, the term "constitutive promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0389] As used herein, the term "inducible promoter" refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes that gene product to be produced in a cell substantially only when an inducer corresponding to that promoter is present in the cell.

[0390] As used herein, the term "tissue-specific promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoded or specified by a gene, causes that gene product to be produced in a cell substantially only if that cell is a cell of the tissue type corresponding to the promoter.

[0391] As used herein, the term "pseudotype" or "pseudotyping" refers to a virus in which viral envelope proteins have been replaced with those of another virus that has favorable properties. For example, HIV can be pseudotyped with the vesicular stomatitis virus G protein (VSV-G) envelope protein, such that the HIV envelope protein (encoded by the env gene) normally binds to the CD4 + By targeting the virus to presentation cells, HIV can infect a wider range of cells. In a preferred embodiment of the present disclosure, the lentivirus envelope protein is pseudotyped with VSV-G. In one embodiment, the present disclosure provides a packaging cell that produces a recombinant retrovirus, such as a lentivirus, pseudotyped with VSV-G envelope glycoprotein.

[0392] As used herein, the term "recombinant antibody" refers to an antibody made using recombinant DNA techniques, such as, for example, antibodies expressed in bacteriophage or yeast expression systems. The term should also be construed to mean an antibody produced by synthesis of a DNA molecule that expresses and encodes the antibody protein or amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence is obtained using recombinant DNA or amino acid sequence techniques available and well known in the art.

[0393] As used herein, the term "recombinant viral vector" (RRV) refers to a vector that contains sufficient viral genetic information to package an RNA genome into viral particles capable of infecting target cells in the presence of packaging components. RRVs have non-viral coding sequences that are delivered to target cells by the vector. RRVs are incapable of independent replication to produce infectious viral particles within the final target cell. RRVs typically lack functional gag-pol and / or env genes and / or other genes essential for replication. Vectors of the present disclosure can be configured as split-intron vectors. Preferably, the RRV vectors of the present disclosure have a minimal viral genome.

[0394] As used herein, the term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof derived primarily from a retrovirus.

[0395] In some embodiments, further safety improvements are provided by replacing the U3 region of the 5' LTR with a heterologous promoter to drive transcription of the viral genome during viral particle production. The heterologous promoter may be selected from the group consisting of the viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Ras sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters. Typical promoters are capable of driving high levels of transcription in a Tat-independent manner. This substitution reduces the possibility of recombination to generate replicative virus due to the absence of the complete U3 sequence in the viral production system. In some embodiments, a heterologous promoter has the added advantage of controlling the manner in which the viral genome is transcribed. For example, the heterologous promoter may be inducible, such that transcription of all or part of the viral genome occurs only in the presence of an inducer. Inducers include, but are not limited to, one or more chemical compounds or physiological conditions, such as temperature and pH, under which the host cells are cultured.

[0396] As used herein, the term "signal transduction pathway" refers to the biochemical relationships between various signaling molecules that play a role in transmitting a signal from one part of a cell to another. "Cell surface receptor" includes molecules and complexes of molecules that can receive a signal and transmit the signal across the plasma membrane of a cell.

[0397] As used herein, the term "single chain antibody" refers to an antibody formed by recombinant DNA techniques in which immunoglobulin heavy and light chain fragments are linked together into an Fv region with an engineered range of amino acids. Various methods for producing single chain antibodies are known in the art.

[0398] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein in which the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., mouse or human) are covalently linked to form a VH::VL heterodimer. The heavy (VH) and light (VL) chains are either directly linked or linked via a peptide-encoding linker or spacer that connects the N-terminus of the VH to the C-terminus of the VL, or the C-terminus of the VH to the N-terminus of the VL. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1-binding domain, PSMA-binding domain, or mesothelin-binding domain) comprises an scFv having the following structure from N- to C-terminus: VH-linker-VL. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1-binding domain, the PSMA-binding domain, or the mesothelin-binding domain) comprises an scFv having, from N- to C-terminus, the configuration VL-linker-VH. One of skill in the art would be able to select an appropriate configuration for use in the present disclosure.

[0399] Linkers typically contain a glycine-rich residue for flexibility and a serine or threonine-rich residue for solubility. The linker can connect the heavy and light chain variable regions of the extracellular antigen-binding domain. Various linker sequences are known in the art, including, but not limited to, glycine-serine (GS) linkers such as (GS)n, (GSGGS)n, (GGGS)n, and (GGGGS)n, where n represents an integer of at least 1. Representative linker sequences may include, but are not limited to, amino acid sequences such as GGSG (SEQ ID NO: 121), GGSGG (SEQ ID NO: 122), GSGSG (SEQ ID NO: 123), GSGGG (SEQ ID NO: 124), GGGSG (SEQ ID NO: 125), GSSSG (SEQ ID NO: 126), GGGGS (SEQ ID NO: 127), or GGGGSGGGGSGGGGS (SEQ ID NO: 128). Those skilled in the art would be able to select an appropriate linker sequence for use in the present disclosure. In one embodiment, an antigen-binding domain (e.g., a CD19-binding domain) of the present disclosure comprises a heavy chain variable region (VH) and a light chain variable region (VL). In some embodiments, the VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGSGGGGS (SEQ ID NO: 128). In some embodiments, the linker nucleic acid sequence comprises the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO: 129).

[0400] Even after the constant region is removed and a linker is introduced, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids containing sequences encoding the VH and VL. Antagonistic scFvs with inhibitory activity have been described.

[0401] As used herein, the term "specificity" refers to the ability to specifically bind (e.g., immunoreact) with a given target antigen (e.g., a human target antigen). A chimeric antigen receptor may be monospecific, containing one or more binding sites that specifically bind a target, or it may be multispecific, containing two or more binding sites that specifically bind the same or different targets. In certain embodiments, a chimeric antigen receptor is specific for two different (e.g., non-overlapping) portions of the same target. In certain embodiments, a chimeric antigen receptor is specific for two or more targets.

[0402] As used herein, the term "spacer domain" generally refers to an oligo- or polypeptide that functions to link a transmembrane domain to the extracellular or intracellular domain of a polypeptide chain. The spacer domain may contain up to about 300 amino acids, for example, about 10 to about 100 amino acids, or about 25 to about 50 amino acids.

[0403] As used herein, the term "specifically binds" with respect to an antibody refers to an antibody or binding fragment thereof (e.g., scFv) that recognizes a specific antigen but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen of one species may also bind to the antigen of one or more species. However, such cross-species reactivity does not, in and of itself, change the specific classification of the antibody. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of that antigen. However, such cross-reactivity does not, in and of itself, change the specific classification of the antibody. In some cases, the terms "specific binding" or "specifically binds" are used in reference to the interaction of an antibody, protein, chimeric antigen receptor, or peptide with a second chemical species, implying that the interaction is dependent on the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species. For example, a chimeric antigen receptor recognizes and binds to a specific protein structure rather than to proteins in general. If an antibody is specific for epitope "A," then in a reaction involving labeled "A" and the antibody, the presence of a molecule containing epitope "A" (or free, unlabeled "A") will reduce the amount of labeled "A" that binds to the antibody.

[0404] As used herein, the term "stimulation" refers to a primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event, such as, but not limited to, signal transduction through the TCR / CD3 complex. Stimulation can result in changes in the expression of specific molecules, such as downregulation of TGF-β, rearrangement of cytoskeletal structure, clonal expansion, or differentiation into distinct subsets.

[0405] As used herein, the term "stimulatory molecule" refers to a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen-presenting cell. A stimulatory molecule can be expressed by a T cell and provides a primary cytoplasmic signal sequence that controls primary activation of the TCR complex in a stimulatory manner for at least some aspects of the T cell signaling pathway. For example, a primary signal is initiated, e.g., by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, leading to transduction of a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. Primary cytoplasmic signaling sequences (also called "primary signaling domains") that act in a stimulatory manner may contain signaling motifs known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAMs containing primary cytoplasmic signal sequences that find particular use in this disclosure include, but are not limited to, those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), and CD66d. In certain CARs of the present disclosure, the intracellular signaling domain in any one or more CARS of the present disclosure comprises an intracellular signaling sequence, e.g., the primary signaling sequence of CD3-zeta. In particular CARs of the present disclosure, the primary signaling sequence of CD3-zeta is the sequence provided as SEQ ID NO: 52, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc. In particular CARs of the present disclosure, the primary signal sequence of CD3-zeta is the sequence provided as SEQ ID NO: 54, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc.

[0406] As used herein, the term "stimulatory ligand" refers to a ligand that, when present on an antigen-presenting cell (e.g., aAPC, dendritic cell, B cell, etc.), is capable of specifically binding to a cognate binding partner (referred to herein as a "stimulatory molecule") on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, etc. Stimulatory ligands are well known in the art and include, among others, peptide-loaded MHC class I molecules, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0407] As used herein, the term "subject" refers to a vertebrate. A vertebrate can be a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). Mammals can include, but are not limited to, humans, non-human primates, wild animals, feral animal...

Claims

1. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a single-chain antibody or a single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain; and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or a functional derivative thereof that enhances immune cell function; wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide; wherein the anti-CD19 binding domain is (a) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6; or (b) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

2. 2. The vector of claim 1, wherein the polypeptide or functional derivative thereof that enhances the function of the immune cell is selected from the group consisting of a cytokine, an interferon, a chemokine, an antibody or antibody fragment, a checkpoint inhibitor antagonist, a dominant negative receptor, a switch receptor, and combinations thereof.

3. The polypeptide or its functional derivative that enhances the function of the immune cell is (a) chemokines, chemokine receptors, cytokines, cytokine receptors, and combinations thereof; (b) a cytokine selected from the group consisting of interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte-macrophage colony-stimulating factor, alpha, beta, or gamma interferon, erythropoietin, and combinations thereof; or (c) a chemokine selected from CCL21, CCL19, or a combination thereof; The vector according to claim 1 or 2.

4. The vector according to any one of claims 1 to 3, wherein the polypeptide or functional derivative thereof that enhances the function of an immune cell further comprises a leader sequence selected from the group consisting of an IL-2 signal sequence, an IL-12 signal sequence, a κ leader sequence, a CD8 leader sequence, or an equivalent thereof.

5. 5. The vector of any one of claims 1 to 4, wherein the polypeptide that enhances the function of an immune cell or a functional derivative thereof comprises an IL-18 polypeptide, or a polypeptide having an amino acid sequence of SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106, SEQ ID NO: 107, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106, or SEQ ID NO:

107.

6. 6. The vector of claim 5, wherein the IL-18 polypeptide further comprises a CD8 leader sequence, or the amino acid sequence of SEQ ID NO:25, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

25.

7. 7. The vector of claim 5 or 6, wherein the IL-18 polypeptide comprises a mutation at a position selected from the group consisting of positions 42, 74, 85, 87, 89, 104, 112, 10, 132, 143, 149, 163, and 189 of SEQ ID NO:

107.

8. 8. The vector of any one of claims 5 to 7, wherein the IL-18 polypeptide comprises E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S, and C112S; E42A, C74S, C112S, and C112S; E42A, K89A, C74S, C112S, and C112S of SEQ ID NO:

107.

9. the IL-18 polypeptide (a) exhibits at least about 2-fold greater activity than WT IL-18; (b) is resistant to IL18BP inhibition compared to WT IL-18, and / or (c) at least about four-fold higher concentrations of IL-18BP are required for neutralization compared to WT IL-18; The vector according to claim 7 or 8.

10. The vector of claim 1 , wherein the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

11. The vector of claim 1 , wherein the vector is a lentiviral vector.

12. The vector according to any one of claims 1 to 11, wherein the vector is an in vitro transcription vector.

13. The vector of any one of claims 1 to 12, wherein the constitutive promoter comprises a promoter selected from the group consisting of an EF-1α promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter.

14. The constitutive promoter is (a) is the EF-1 promoter, or (b) comprising the sequence of SEQ ID NO: 101; A vector according to any one of claims 1 to 13.

15. 15. The vector of claim 1, further comprising a rev response element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and / or a cPPT sequence.

16. 16. The vector of claim 15, wherein WPRE comprises the sequence of SEQ ID NO:

100.

17. The anti-CD19 binding domain is a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and 17. The vector of any one of claims 1 to 16, comprising a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:

6.

18. 18. The vector of claim 17, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199.

19. 19. The vector of claim 17 or 18, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200.

20. 20. The vector of any one of claims 17 to 19, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

8.

21. 21. The vector of any one of claims 17 to 20, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

200.

22. 22. The vector of claim 1, wherein the CD19 binding domain is an scFv.

23. 23. The vector of any one of claims 1 to 22, wherein the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 226, 201, 179, 168, and 146.

24. the anti-CD19 binding domain is (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) the vector of any one of claims 1 to 23, comprising a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216,

25. the anti-CD19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) The vector of any one of claims 1 to 24, comprising a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 19-24, 102, 103, 104, 114, 115, 116, 117, 118, 119, 120, 225, or 216.

26. 26. The vector of any one of claims 1 to 25, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the α, β, or ζ chain of a T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

27. 27. The vector of any one of claims 1 to 26, wherein the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29, 31, or 33.

28. 28. The vector of any one of claims 1 to 27, wherein the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34.

29. 29. The vector of any one of claims 1 to 28, wherein the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

29.

30. 30. The vector of any one of claims 1 to 29, wherein the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 30 or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

30.

31. 31. The vector of any one of claims 1 to 30, wherein the encoded anti-CD19 binding domain is linked to the transmembrane domain by a hinge region.

32. The hinge region is (a) derived from a protein selected from the group consisting of an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) the vector of claim 31 , comprising an amino acid sequence of SEQ ID NO:27 or SEQ ID NO:35, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27 or SEQ ID NO:

35.

33. 33. The vector of any one of claims 1 to 32, wherein the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

27.

34. 34. The vector of any one of claims 1 to 33, wherein the hinge region comprises a nucleic acid sequence selected from SEQ ID NO: 28 or SEQ ID NO: 36, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 28 or 36.

35. 35. The vector of any one of claims 1 to 34, wherein the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

36. 36. The vector of any one of claims 1-35, wherein the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50.

37. 37. The vector of any one of claims 1-36, wherein the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

38. 38. The vector of any one of claims 1 to 37, wherein the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcεRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

39. 39. The vector of any one of claims 1-38, wherein the intracellular signaling domain comprises the intracellular signaling domain of CD3ζ, an amino acid sequence of SEQ ID NO: 52 or 54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 52 or 54.

40. 40. The vector of any one of claims 1 to 39, wherein the intracellular signaling domain comprises a nucleic acid sequence of SEQ ID NO: 53 or 55, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

41. The vector of any one of claims 1 to 40, wherein the CAR comprises a functional signal transduction 4-1BB costimulatory domain and a functional CD3ζ intracellular signaling domain.

42. 42. The vector of any one of claims 1 to 41, wherein the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:

54.

43. the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO:37 and the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:54, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54; 43. The vector of any one of claims 1 to 42, wherein the sequences are expressed in the same frame as a single polypeptide chain.

44. (a) the nucleic acid sequence comprises the sequence of SEQ ID NO: 38 or a nucleic acid sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38; and / or (b) the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55.

45. 45. The vector of any one of claims 1 to 44, wherein the CAR further comprises a leader sequence.

46. 46. ​​The vector of claim 45, wherein the leader sequence comprises SEQ ID NO:

25.

47. The linker peptide (a) selected from F2A, E2A, P2A, T2A, or furin-(GS)2-T2A (F-GS2-T2A), and / or (b) comprising the amino acid sequence of SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, or SEQ ID NO:99; and / or (c) a vector described in any one of claims 1 to 46, comprising the nucleic acid sequence of SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, or SEQ ID NO:

98.

48. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR); wherein the CAR is (i) an anti-CD19 binding domain comprising: (1) LC CDR1 of SEQ ID NO: 1, LC CDR2 and LC CDR3 of SEQ ID NO: 2, HC CDR1 of SEQ ID NO: 4, HC CDR2 of SEQ ID NO: 5, and HC CDR3 of SEQ ID NO: 6, or (2) LC CDR1 of SEQ ID NO: 193, LC CDR2 of SEQ ID NO: 194, LC CDR3 of SEQ ID NO: 195, HC CDR1 of SEQ ID NO: 196, HC CDR2 of SEQ ID NO: 197, and HC CDR3 of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2, and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2; ii) a transmembrane domain selected from the CD28 or CD8 transmembrane domain; iii) a costimulatory domain comprising the intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R); wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

49. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR); wherein the CAR is (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain selected from a CD28 or CD8 transmembrane domain; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R); wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, or furin-(G4S)2-T2A (F-GS2-T2A).

50. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR); wherein the CAR is (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 31, and 33; (iii) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50; and (iv) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54; and (b) (i) a nucleic acid encoding the amino acid of SEQ ID NO: 105, 215, 106, or 107; and / or (ii) a second polynucleotide comprising an IL-18 polypeptide comprising: E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S, and K89A; C74S, C112S, and C112S; E42A, C74S, C112S, and C112S; E42A, K89A, C74S, C112S, C112S of SEQ ID NO: 107; wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

51. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR); wherein the CAR is (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (iii) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37, and (iv) an intracellular signaling domain of SEQ ID NO: 52 or SEQ ID NO: 54, and (b) (i) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 105, 215, 106, or 107; and / or (ii) a second polynucleotide comprising an IL-18 polypeptide comprising: E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S, and K89A; C74S, C112S, and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S, C112S of SEQ ID NO: 107; wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

52. the first polynucleotide is (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or (b) the vector of any one of claims 1 to 51, comprising an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

53. 53. A modified cell comprising the vector of any one of claims 1 to 52.

54. The modified cell of claim 53, wherein the modified cell is an immune cell or a precursor cell thereof.

55. 55. The modified cell of claim 53 or 54, wherein the modified cell is selected from the group consisting of T cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, natural killer T (NKT) cells, dendritic cells, macrophages, human embryonic stem cells, and pluripotent stem cells from which lymphoid cells can be differentiated.

56. 56. The modified cell of any one of claims 53-55, wherein the modified cell is an autologous cell, a xenogeneic cell, or an allogeneic cell.

57. 57. The modified cell of any one of claims 53 to 56, wherein the cell is a modified T cell or a modified human T cell.

58. 56. The modified cell of any one of claims 53 to 55, wherein the modified T cell is a CD8+ T cell.

59. The modified cell of any one of claims 53 to 58, wherein the modified cell is a CD8+ T cell with a central memory phenotype (CD44-; Ly6C+), a macrophage with an M1 phenotype (MHC-II+), or a dendritic cell with a mature and activated phenotype (CD86+; MHC-II+).

60. the modified cells (a) a switch receptor comprising a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, and a second polypeptide comprising an intracellular signaling domain of a molecule selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB, bound thereto; (b) a dominant-negative receptor comprising a truncated variant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA; and / or 60. The modified cell of any one of claims 53-59, further comprising (c) a polypeptide that enhances immune cell function or a functional derivative thereof selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), CCL21, CCL19, and combinations thereof.

61. 61. A composition comprising the modified cell or modified cell population of any one of claims 53 to 60.

62. 53. A method of producing a modified cell, comprising transfecting a cell with a vector according to any one of claims 1 to 52.

63. (a) a composition comprising the modified cells of any one of claims 53 to 60 or the modified cells produced by the method of claim 62; (b) a modified cell according to any one of claims 53 to 60, or a modified cell produced by the method of claim 62; or (c) the composition of claim 61; A method for conferring anti-tumor immunity in a mammal, comprising administering to the mammal an effective amount of

64. (a) a composition comprising the modified cells of any one of claims 53 to 60 or the modified cells produced by the method of claim 62; (b) a modified cell according to any one of claims 53 to 60, or a modified cell produced by the method of claim 62; or (c) the composition of claim 61; 20. A method for treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of

65. 65. The method of claim 63 or 64, wherein the modified cells are autologous modified T cells.

66. 66. The method of any one of claims 63-65, wherein the modified cells are allogeneic modified T cells.

67. 67. The method of any one of claims 63 to 66, wherein the mammal is a human.

68. A disease associated with CD19 expression, (a) a proliferative disorder, malignancy, precancerous condition, or non-cancer-related indication associated with expression of CD19; or 68. The method of any one of claims 63 to 67, wherein (b) the disease is selected from cancer, atypical cancer and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

69. The disease, (a) acute leukemia, chronic leukemia, blood disorders, and combinations thereof; or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoma 69. The method of any one of claims 63 to 68, wherein the cancer is a blood cancer selected from the group consisting of myeloproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective myeloid blood cell production (or dysplasia), and combinations thereof.

70. the modified cells or compositions are (a) an agent that enhances the efficacy of a modified cell comprising the vector of any one of claims 1-52, the modified cell of any one of claims 53-60, or a modified cell produced by the method of claim 62; (b) a medicament that ameliorates one or more side effects associated with the administration of a modified cell comprising the vector of any one of claims 1-52, a modified cell of any one of claims 53-60, or a modified cell produced by the method of claim 62; or 70. The method of any one of claims 63 to 69, administered in combination with (c) a drug for treating a disease associated with CD19.

Images