RNAi agents for inhibiting expression of DM1 protein kinase (DMPK), compositions thereof and methods of use

RNAi agents targeting the DMPK gene address the misregulation of RNA processing in DM1 by reducing mutant DMPK-CUG levels, thereby restoring normal muscle function and treating DM1 symptoms.

JP2025535376APending Publication Date: 2025-10-24ARROWHEAD PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025522581
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-09-21
Filing Date
2023-10-18
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

Current therapies are inadequate for treating the underlying cause of myotonic dystrophy type 1 (DM1), which is characterized by the misregulation of RNA processing due to nuclear accumulation of mutant DMPK-CUG transcripts, leading to muscle dysfunction and other systemic issues.

Method used

Development of RNA interference (RNAi) agents, specifically double-stranded RNAi agents such as small interfering RNAs (siRNAs), designed to selectively inhibit DMPK gene expression, reducing mutant DMPK-CUG protein levels and restoring normal mRNA splicing regulation.

Benefits of technology

The RNAi agents effectively reduce DMPK gene expression, alleviating DM1 pathology by normalizing muscle function and reducing the accumulation of mutant DMPK-CUG proteins, offering therapeutic potential for DM1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025535376000272
    Figure 2025535376000272
  • Figure 2025535376000273
    Figure 2025535376000273
  • Figure 2025535376000274
    Figure 2025535376000274
Patent Text Reader

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting the DM1 protein kinase (DMPK) gene are described. The DMPK RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the DMPK gene. Pharmaceutical compositions comprising one or more DMPK RNAi agents, optionally together with one or more additional therapeutic agents, are also described. Delivery of the described DMPK RNAi agents to skeletal muscle cells in vivo results in the inhibition of DMPK gene expression and a reduction in DMPK protein levels, more specifically, a reduction in mutant DMPK-CUG protein levels, which can provide therapeutic benefits to subjects, including human subjects suffering from certain skeletal muscle-related diseases or disorders, including myotonic dystrophy type 1.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 380,171, filed October 19, 2022, and U.S. Provisional Patent Application No. 63 / 584,283, filed September 21, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy is named 30712-WO_SeqListing.xml, was created on October 3, 2023, and is 9,007 kb in size.

[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference (RNAi) agents, eg, double-stranded RNAi agents, compositions comprising DMPK RNAi agents, for the inhibition of DM1 protein kinase (DMPK) gene expression, and methods of their use. [Background technology]

[0004] background Myotonic dystrophy protein kinase (DMPK), or DM1 protein kinase, is primarily expressed in muscle. Myotonic dystrophy type 1 (DM1) is an autosomal dominant multisystem disorder caused by a >50 CTG repeat expansion in the 3' untranslated region (3'UTR) of the DMPK gene (Legare et al., Neurology Genetics 2019:5(3)). Upon transcription, the expanded CTG repeat in the 3'UTR results in an mRNA transcript (DMPK-CUG) with an expanded CUG repeat sequence in the 3'UTR, preventing the transcript from passing through nuclear pores and entering the cytoplasm, resulting in nuclear accumulation. The accumulation of mutant DMPK-CUG results in the misregulation of several RNA-binding proteins, including CUGBP1 and MBNL1, which are known to be involved in the proper RNA processing of numerous gene products prior to translation. This misregulation of RNA processing can result in the expression of incorrect protein isoforms, protein mislocalization, or disruption of the synthesis of essential proteins, ultimately resulting in loss of cell function and viability.

[0005] DM1 affects all systems, including the muscles, heart, respiratory, endocrine, and central nervous system (CNS). A characteristic feature of DM1 is the presence of myotonia, which involves a distal-to-proximal pattern of progressive skeletal muscle dysfunction, which can affect muscles involved in breathing due to misregulation of RNA processing of gene products involved in normal muscle function.

[0006] Currently, there are no therapies to treat the underlying cause of DM1. Degradation of accumulated DMPK-CUG is believed to be a powerful approach for alleviating DM1 pathology. Reducing accumulated transcripts in muscle cell nuclei can reestablish proper mRNA splicing regulation and restore normal cellular function. RNA interference agents, such as those described herein, are effective in selectively reducing mRNA targets and are expected to reduce accumulated DMPK-CUG in DM1 patients and restore normal function to affected skeletal muscles. Summary of the Invention [Means for solving the problem]

[0007] overview There is a need for novel RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, e.g., small interfering RNAs (siRNAs), that can selectively and efficiently inhibit expression of the DM1 protein kinase (DMPK) gene, particularly in vivo. Furthermore, there is a need for novel DMPK-specific RNAi agent compositions for the treatment of diseases or disorders, such as myotonic dystrophy type 1, that can be alleviated, at least in part, by reducing mutant DMPK-CUG protein levels.

[0008] In general, the present disclosure features DMPK RNAi agents described herein, compositions comprising such RNAi agents, and methods for inhibiting DMPK gene expression in vitro and / or in vivo using the RNAi agents and compositions comprising the RNAi agents. The DMPK RNAi agents described herein can selectively and efficiently reduce, inhibit, or silence DMPK gene expression.

[0009] The described DMPK RNAi agents can be used in methods for therapeutic treatment (including preventative, intervention, or prophylactic treatment) of conditions and diseases, such as myotonic dystrophy type 1. The methods disclosed herein include administration of one or more DMPK RNAi agents to a subject, e.g., a human or animal subject, using any suitable method known in the art, such as, for example, subcutaneous (SQ) injection, intramuscular injection, or intravenous (IV) administration.

[0010] In one aspect, the disclosure features an RNAi agent for inhibiting expression of a DMPK gene, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand can be partially, substantially, or fully complementary to each other. The length of each of the sense strands of the RNAi agents described herein can be 15-49 nucleotides in length. The length of each of the antisense strands of the RNAi agents described herein can be 17-49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 17-26 nucleotides in length. The sense strand and the antisense strand can be either the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21-24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more DMPK gene transcripts in vivo and / or in vitro when delivered to cells that express DMPK, such as skeletal muscle cells (skeletal muscle fibers).

[0011] The DMPK RNAi agents disclosed herein target the DM1 protein kinase (DMPK) gene (see, e.g., SEQ ID NO: 1, Homo sapiens transcript variant 1). In some embodiments, the RNAi agents disclosed herein target a portion of the DMPK gene having a sequence of any of the sequences disclosed in Table 1.

[0012] In another aspect, the disclosure features pharmaceutical compositions containing one or more of the disclosed DMPK RNAi agents capable of selectively and efficiently reducing expression of the DMPK gene. Pharmaceutical compositions containing one or more DMPK RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including intervention or prophylactic treatment or inhibition) of symptoms and diseases that can be alleviated, at least in part, by reducing DMPK protein levels, more specifically, by reducing mutant DMPK-CUG protein levels. The pharmaceutical compositions described herein comprise an RNAi agent capable of inhibiting expression of the DMPK gene and at least one pharmaceutically acceptable excipient.

[0013] Examples of DMPK RNAi agent sense and antisense strands that can be used in DMPK RNAi agents are provided in Table 3 and Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. Examples of DMPK RNAi agent duplexes are provided in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7. Examples of 19-nucleotide core stretch sequences that can consist of or be included in the sense and antisense strands of certain DMPK RNAi agents disclosed herein are provided in Table 2.

[0014] One aspect described herein is (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by zero or one nucleotide from any one of the sequences presented in Table 3 or Table 5.4; (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; and a RNAi agent for inhibiting the expression of the DMPK gene, comprising:

[0015] In another aspect, (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by zero or one nucleotide from any one of the sequences presented in Table 3 or Table 5.4; (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; (iii) a targeting ligand linked to the sense strand that has affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells; (iv) a PK / PD modulator linked to the sense strand; Described herein are RNAi agents for inhibiting expression of the DMPK gene, including:

[0016] In yet a further aspect, (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by zero or one nucleotide from any one of the sequences presented in Table 3 or Table 5.4; (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; (iii) a targeting ligand linked to the sense strand, the targeting ligand having affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells, the targeting ligand being linked to the 5'-terminal end of the sense strand; (iv) a PK / PD modulator linked to the 3'-terminal end of the sense strand; Described herein are RNAi agents for inhibiting expression of the DMPK gene, including:

[0017] In another aspect, (i) an antisense strand comprising at least 17 contiguous nucleotides that differ by zero or one nucleotide from any one of the sequences presented in Table 3 or Table 5.4; (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; (iii) a targeting ligand comprising a chemical structure depicted in Table 6.2 or 6.3 herein, linked to the 5'-terminal end of the sense strand; (iv) a PK / PD modulator comprising a chemical structure shown in Table 6.5 or 6.7 herein, linked to the 3'-terminal end of the sense strand; Described herein are RNAi agents for inhibiting expression of the DMPK gene, including:

[0018] In another aspect, the disclosure features methods for delivering a DMPK RNAi agent to skeletal muscle cells in a subject, e.g., a mammal, e.g., a human subject, in vivo. Compositions for use in such methods are also described herein.

[0019] One or more DMPK RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. In some embodiments, a DMPK RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can comprise a cell receptor ligand. The targeting group can be linked to the 3' or 5' end of the sense or antisense strand of the DMPK RNAi agent, or can be linked via one or more internal nucleotides of the sense or antisense strand. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked internally to a nucleotide in the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker. Exemplary targeting ligands suitable for use that have affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells (e.g., integrin alpha-v-beta-6 (αvβ6)) are set forth in Tables 6.2 and 6.3 herein. The synthesis and conjugation of certain targeting ligands suitable for use with the DMPK RNAi agents disclosed herein are described in Example 1.

[0020] In some embodiments, a DMPK RNAi agent disclosed herein is conjugated to a targeting group or targeting ligand that directs the DMPK RNAi agent to skeletal muscle cells, whereby the RNAi agent can be selectively internalized, either by receptor-mediated endocytosis or other means.

[0021] In another aspect, the disclosure features a method for inhibiting DMPK gene expression in a subject, the method including administering to the subject an amount of a DMPK RNAi agent capable of inhibiting expression of the DMPK gene, the DMPK RNAi agent including a sense strand and an antisense strand, and the antisense strand including any one of the antisense strand nucleotide sequences in Table 2, Table 3, or Table 5.4. In a further aspect, the disclosure features a method for treating (including prophylactic, intervention, or preventative treatment) a disease or condition that can be alleviated, at least in part, by reducing DMPK protein levels (more specifically, reducing mutant DMPK-CUG protein levels), the method including administering to a subject in need thereof a DMPK RNAi agent including an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 5.4. Pharmaceutical compositions for use in such methods are also described.

[0022] In some embodiments, the DMPK RNAi agent is linked to one or more linking groups or other non-nucleotide groups or compounds, such as a pharmacokinetic / pharmacodynamic (PK / PD) modulator. The PK / PD modulator can increase the circulation time of the conjugated drug and / or increase the activity of the RNAi agent through improved cell receptor binding, improved cellular uptake, and / or other means. Examples of PK / PD modulators suitable for use with the DMPK RNAi agents disclosed herein can be found in Tables 6.5 and 6.7 herein.

[0023] In some embodiments, the DMPK RNAi agent is conjugated to a targeting group, a linking group, a PK / PD modulator, and / or another non-nucleotide group. In some embodiments, the DMPK RNAi agent is conjugated to a targeting group and a PK / PD modulator.

[0024] The use of DMPK RNAi agents provides a method for therapeutic (including preventive or interventional) treatment of diseases or disorders that can be at least partially alleviated by reducing DMPK protein levels, particularly by reducing mutant DMPK-CUG protein levels.Described herein is a composition for delivering DMPK RNAi agents to skeletal muscle cells of a subject.In some embodiments, the DMPK RNAi agents disclosed herein can reduce DMPK gene expression in the paraspinal, facial, trunk, abdominal and limb musculature of a subject, for example, in the triceps, biceps, quadriceps, pectoralis, gastrocnemius, soleus, masseter, EDL (extensor digitorum longus), TA (tibialis anterior), trapezius and / or diaphragm of a subject.

[0025] In some embodiments, disclosed herein are methods for the treatment (including preventative or interventional treatment) of a pathological condition mediated at least in part by DMPK expression, such as myotonic dystrophy type 1, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4 or Table 5.5.

[0026] In some embodiments, disclosed herein are methods for the treatment (including prophylactic or interventional treatment) of a pathological condition mediated at least in part by DMPK expression, the method comprising administering to a subject a therapeutically effective amount of a DMPK RNAi agent comprising a sense strand comprising any of the sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 or 5.5 herein and an antisense strand comprising any of the sequences in Table 3 or Table 5.4.

[0027] In some embodiments, disclosed herein are methods of inhibiting expression of the DMPK gene, the methods comprising administering to a subject a DMPK RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 herein, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 5.4. In other embodiments, disclosed herein are methods of inhibiting expression of the DMPK gene, the methods comprising administering to a subject a DMPK RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, 5.5 herein, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 5.4.

[0028] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[0029] As used herein, "RNAi agent" (also referred to as "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading messenger RNA (mRNA) transcripts of a target mRNA or inhibiting its translation (e.g., degrading or inhibiting under appropriate conditions) in a sequence-specific manner. As used herein, an RNAi agent can act via the RNA interference mechanism (i.e., inducing RNA interference by interacting with the machinery of the RNA interference pathway (RNA-induced silencing complex or RISC) in mammalian cells) or via any alternative mechanism(s) or pathway(s). While RNAi agents, as the term is used herein, are believed to act primarily via the RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., DMPK mRNA). The RNAi agent can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0030] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene is reduced as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated.

[0031] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides described by a sequence of letters using standard nomenclature.

[0032] As used herein, "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0033] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art, and thus refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linking group), such as a phosphate or phosphorothioate or phosphorodithioate internucleoside linking group, and encompasses both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides comprising modified sugar and / or base moieties, also referred to herein as nucleotide analogs or modified nucleotides. As used herein, a single nucleotide may be referred to as a monomer or unit.

[0034] As used herein, and unless otherwise indicated, the term "complementary" when used to refer to a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a duplex or double-helix structure with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions. Those skilled in the art will be able to select the most appropriate set of conditions for a hybridization test. A complementary sequence contains Watson-Crick base pairs or non-Watson-Crick base pairs, and natural or modified nucleotides or nucleotide mimics, at least to the extent that the above-mentioned hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, for purposes of determining identity or complementarity, a and Af are complementary to U (or T) and identical to A, as defined herein.

[0035] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0036] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70% but not all of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0037] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0038] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to matching nucleobases or nucleotides between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of a DMPK mRNA.

[0039] As used herein, the term "substantially identical" or "substantial identity" when applied to nucleic acid sequences means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, for example, at least 90%, at least 95% or at least 99% identity, compared with a reference sequence. The sequence identity percentage is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase exists in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the sequence identity percentage. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0040] As used herein, the terms "individual," "patient," and "subject" are used interchangeably to refer to members of any animal species, including, but not limited to, birds, humans and other primates, and other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cows, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0041] As used herein, the terms "treat," "treatment," and the like refer to methods or steps required to bring about a relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic or interventional treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0042] As used herein, the phrase "introducing into a cell" refers to functionally delivering an RNAi agent into a cell when referring to an RNAi agent. The phrase "functionally delivering" refers to delivering an RNAi agent into a cell in a manner that allows the RNAi agent to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0043] Unless otherwise stated, the symbol [ka] The use of as used herein means that any group or groups may be attached thereto in accordance with the scope of the invention described herein.

[0044] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of each other are termed "diastereoisomers," and stereoisomers that are non-superimposable mirror images are termed "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a "chiral center."

[0045] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass single stereoisomers as well as mixtures of diastereomers.

[0046] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel feature(s) of the claimed invention.

[0047] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein assume that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as would be readily understood by those skilled in the art. Correspondingly, compounds described herein having labile protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the present invention. A typical pharmaceutically acceptable salt of the disclosed DMPK RNAi agents is the sodium salt form.

[0048] As used herein, the term "linked" or "conjugated," when referring to a connection between two compounds or molecules, means that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated," as used herein, can refer to a connection between a first compound and a second compound, either with or without any intervening atom or group of atoms.

[0049] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly dictates otherwise.

[0050] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.In carrying out or testing the present invention, methods and materials similar or equivalent to those described herein can be used, and suitable methods and materials are described below.All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety.In the event of any discrepancy, the present specification, including definitions, will prevail.In addition, materials, methods and examples are merely illustrative and are not intended to be limiting.

[0051] Where a value is explicitly recited, it is understood that values ​​that are approximately the same content or amount as the recited value are also within the scope of the disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of a disclosure is disclosed as having multiple alternatives, examples of that disclosure in which each alternative is excluded, alone or in any combination with other alternatives, are also hereby disclosed; more than one element of a disclosure may have such an exclusion, and all combinations of elements with such an exclusion are hereby disclosed.

[0052] Other objects, features, aspects and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings and the claims. [Brief explanation of the drawings]

[0053] [Figure 1] Figure 1 shows normal splicing conditions and forward and reverse primer sets designed for exons flanking exons known to be excluded or included under normal transcript splicing conditions, and for transcripts known to be misspliced ​​upon accumulation of mutant DMPK-CUG transcripts in the nucleus, as described in Example 17.

[0054] [Figure 2] FIG. 2 shows the expression of hDMPK transcripts in mice under various administration conditions as described in Example 18.

[0055] [Figure 3] FIG. 3 shows the relative mis-splicing of mCacna1 in mice under various administration conditions as described in Example 18.

[0056] [Figure 4] FIG. 4 shows the relative mis-splicing of mLdb3 in mice under various administration conditions as described in Example 18.

[0057] [Figure 5] FIG. 5 shows the relative mis-splicing of mMbnl1 in mice under various administration conditions as described in Example 18.

[0058] [Figure 6] FIG. 6 shows the relative mis-splicing of mAtp2a1 in mice under various administration conditions as described in Example 18. DETAILED DESCRIPTION OF THE INVENTION

[0059] Detailed Description Described herein are RNAi agents (referred to herein as DMPK RNAi agents or DMPK RNAi triggers) for inhibiting expression of the DMPK gene. Each DMPK RNAi agent includes a sense strand and an antisense strand. The sense strand can be 15-49 nucleotides in length. The antisense strands can each be 17-49 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 17-27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19-21 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, sense strand is 23 nucleotides in length, and antisense strand is 21 nucleotides in length.In some embodiments, both sense strand and antisense strand are 21 nucleotides in length.In some embodiments, RNAi agent sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 or 49 nucleotides in length.In some embodiments, RNAi agent antisense strand is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0060] Examples of nucleotide sequences used in forming DMPK RNAi agents are provided in Tables 2, 3, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6 are provided in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7.

[0061] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense and antisense strands (sometimes referred to as the "duplex region") is 12 to 26 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect, substantially, or partially complementary).

[0062] The sense strand of the DMPK RNAi agent described herein comprises at least 12 contiguous nucleotides that are at least 85% identical to a core stretch sequence of the same number of nucleotides in DMPK mRNA (also referred to herein as a "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand. Thus, the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length present in a DMPK mRNA target (sometimes referred to as a target sequence, for example). In some embodiments, the sense strand core stretch is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length. In some embodiments, the sense strand core stretch is 21 nucleotides in length.

[0063] The antisense strand of a DMPK RNAi agent described herein comprises at least 17 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in DMPK mRNA and, in some embodiments, to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in a DMPK mRNA target (e.g., a target sequence). In some embodiments, the antisense strand core stretch is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. In some embodiments, the antisense strand core stretch is 21 nucleotides in length. In some embodiments, the antisense strand core stretch is 23 nucleotides in length. The sense strand core stretch sequence can be the same length as the corresponding antisense core sequence, or can be a different length.

[0064] The sense strand and antisense strand of the DMPK RNAi agent anneal to form a duplex.The sense strand and antisense strand of the DMPK RNAi agent can be partially, substantially, or completely complementary to each other.Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of a DMPK RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).

[0065] In some embodiments, the antisense strand of a DMPK RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, Table 3, or Table 5.4.

[0066] In some embodiments, the sense strand of a DMPK RNAi agent disclosed herein differs by 0, 1, 2 or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.1 or Table 4.2 or Table 4.3 or Table 4.4 or Table 4.5, Table 4.6, Table 5.4 or Table 5.5.

[0067] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the core stretch sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in the DMPK mRNA. The additional nucleotides of the sense strand, if present, may or may not be identical to the corresponding sequence in the DMPK mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

[0068] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to the nucleotides in the corresponding antisense strand that are either the core stretch sequence nucleotides or the extended nucleotides. Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the nucleotides in the corresponding sense strand that are either the core stretch nucleotides or the extended nucleotides. In some embodiments, both the sense strand and the antisense strand of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more of the 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, the DMPK RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotide(s) are unpaired and form an overhang. As used herein, "overhang" refers to a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of the RNAi agent disclosed herein.

[0069] In some embodiments, the DMPK RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the DMPK RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is complementary to the corresponding DMPK mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is not complementary to the corresponding DMPK mRNA sequence.

[0070] In some embodiments, the DMPK RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the DMPK mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).

[0071] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the DMPK RNAi agent includes a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides include nucleotides that correspond to or are identical to nucleotides in the DMPK mRNA sequence. In some embodiments, the sense strand 5' extension is one of, but is not limited to, the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (listed from 5' to 3', respectively).

[0072] Exemplary sequences for use in forming DMPK RNAi agents are provided in Tables 2, 3, and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, and 5.4. In some embodiments, a DMPK RNAi agent antisense strand comprises the sequence of any of the sequences in Table 2 or 3. In certain embodiments, a DMPK RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3 or Table 5.4. In some embodiments, a DMPK RNAi agent antisense strand comprises the sequence of nucleotides (5' end to 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2, 3, or 5.4. In some embodiments, a DMPK RNAi agent sense strand comprises the sequence of any of the sequences in Table 2, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4. In some embodiments, a DMPK RNAi agent sense strand comprises the sequence of nucleotides (5' to 3') 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4. In certain embodiments, a DMPK RNAi agent sense strand comprises or consists of any one of the modified sequences in Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.5.

[0073] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form a blunt end. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0074] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides can be present on the sense strand or the antisense strand, resulting in either a 3' or 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends.Typically, if present, the overhang is located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0075] The DMPK RNAi agent disclosed herein may be composed of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand of the DMPK RNAi agent are modified nucleotides. The DMPK RNAi agent disclosed herein may further be composed of one or more modified internucleoside linkages, for example, one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, the DMPK RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside linkages.

[0076] In some embodiments, the DMPK RNAi agent is prepared or provided as a salt, mixed salt or free acid.In some embodiments, the DMPK RNAi agent is prepared as a sodium salt.Such forms that are well known in the art are within the scope of the present invention disclosed herein. Modified Nucleotides

[0077] Modified nucleotides, when used in various oligonucleotide constructs, can preserve the activity of compounds in cells while simultaneously increasing the serum stability of such compounds, and can also minimize the potential for activating interferon activity in humans following administration of the oligonucleotide construct.

[0078] In some embodiments, the DMPK RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-methyl, 2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-(2-methoxylethyl)) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, more than one modification may be incorporated into a single DMPK RNAi agent or even into that single nucleotide. DMPK RNAi agent sense and antisense strands can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide. A variety of modified nucleotides are well known and described in the art.

[0079] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine (hypoxanthine), xanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-methyl-, 2-ethyl-, 2-isopropyl- or 2-n-butyl-, and other alkyl derivatives of adenine and guanine ...methyl-, 2-ethyl-, 2-iso uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0080] In some embodiments, the 5' and / or 3' end of the antisense strand can contain an abasic residue (Ab), sometimes referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. In some embodiments, the abasic residue can be located within the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0081] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand that are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. As used herein, an antisense sense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are shown in Table 6.1 herein. Modified internucleoside linkages

[0082] In some embodiments, one or more nucleotides of a DMPK RNAi agent are linked by a non-standard linkage or backbone (i.e., a modified internucleoside linkage or a modified backbone). The modified internucleoside linkage or backbone can be a phosphorothioate group (represented herein as a lowercase "s"), chiral phosphorothioate, thiophosphate, phosphorodithioate, phosphotriester, aminoalkyl-phosphotriester, diphosphorothioate, alkylphosphonate (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonate, phosphinate, phosphoramidate ( For example, modified internucleoside linkages include, but are not limited to, 3'-aminophosphoramidates, aminoalkylphosphoramidates, or thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with reversed polarity (adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'). In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 constituents.

[0083] In some embodiments, the sense strand of a DMPK RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a DMPK RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a DMPK RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a DMPK RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0084] In some embodiments, the DMPK RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and an optional inverted abasic residue end cap. In some embodiments, the targeting ligand is linked to the sense strand by a phosphorothioate linkage.

[0085] In some embodiments, the DMPK RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are positioned between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is positioned between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the DMPK RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand. Capping residues or moieties

[0086] In some embodiments, the sense strand can include one or more capping residues or moieties, sometimes referred to in the art as "caps," "end caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of a nucleotide sequence of an RNAi agent disclosed herein. Capping residues can provide certain beneficial properties to the RNAi agent, in some instances, such as protection from exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 6.1). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Pat. No. 5,998,203). Capping residues are generally known in the art, and include, for example, inverted abasic residues along with carbon chains, e.g., terminal C3H7 (propyl), C6H 13 (Hexyl) or C 12 H 25(dodecyl) group. In some embodiments, the capping residue is present at either the 5'-terminal end, the 3'-terminal end, or both the 5'- and 3'-terminal ends of the sense strand. In some embodiments, the 5'- and / or 3'-end of the sense strand can comprise two or more inverted abasic deoxyribose moieties as capping residues.

[0087] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the nucleotide sequences of the targeting ligand and the sense strand of the RNAi agent. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the nucleotide sequences of the PK / PD modulator and the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end(s) of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.

[0088] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the nucleotide sequences of the targeting ligand and the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphate, phosphorothioate (e.g., designated herein as (invAb)s) or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near the terminal end(s) of the sense strand of the RNAi agent can enable enhanced activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. The chemical structure of an inverted abasic deoxyribose residue is shown in Table 6.1 below. DMPK RNAi agent

[0089] The DMPK RNAi agent embodiments disclosed herein are designed to target specific positions on the DMPK gene (i.e., specific positions on the DMPK gene transcript). As defined herein, the antisense strand sequence is designed to target the DMPK gene at a specific position on the gene when the 5'-terminal nucleobase of the antisense strand aligns with a position 21 nucleotides downstream (toward the 3' end) from the position on the gene when base-pairing with the gene. For example, as described in Tables 1 and 2 herein, an antisense strand sequence designed to target the DMPK gene at position 820 requires that the 5'-terminal nucleobase of the antisense strand align with position 840 of the DMPK gene when base-pairing with the gene.

[0090] As provided herein, for specific embodiments disclosed herein, a DMPK RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity) of the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for a DMPK RNAi agent disclosed herein that is designed to target position 820 of the DMPK gene, the 5'-terminal nucleobase of the antisense strand of the DMPK RNAi agent must be aligned with position 840 of the gene; however, the 5'-terminal nucleobase of the antisense strand can be, but is not required to be, complementary to position 840 of the DMPK gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity) of the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as demonstrated by the various examples disclosed herein, the specific site of binding of the antisense strand of a DMPK RNAi agent to a gene (e.g., whether the DMPK RNAi agent is designed to target the DMPK gene at position 820, 865, or any other position) is important to the level of inhibition achieved by the DMPK RNAi agent.

[0091] In some embodiments, a DMPK RNAi agent disclosed herein targets a DMPK gene at or near the location of a DMPK sequence shown in Table 1. In some embodiments, the antisense strand of a DMPK RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target DMPK 19-mer sequence disclosed in Table 1. [Table 1-1] [Table 1-2]

[0092] Homo sapiens DM1 protein kinase (DMPK), transcript variant 1, GenBank NM_001081563.2, gene transcript (3243 bases): [ka] [ka] [ka]

[0093] In some embodiments, a DMPK RNAi agent comprises an antisense strand in which position 19 (5'→3') of the antisense strand is capable of base pairing with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a DMPK RNAi agent comprises an antisense strand in which position 1 (5'→3') of the antisense strand is capable of base pairing with position 19 of a 19-mer target sequence disclosed in Table 1.

[0094] In some embodiments, a DMPK RNAi agent comprises an antisense strand in which position 2 (5'→3') of the antisense strand is capable of base pairing with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a DMPK RNAi agent comprises an antisense strand in which positions 2 through 18 (5'→3') of the antisense strand are capable of base pairing with each of the complementary bases located at positions 18 through 2 of a 19-mer target sequence disclosed in Table 1.

[0095] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3') can be perfectly complementary to the DMPK gene or can be non-complementary to the DMPK gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') forms an A:U or U:A base pair with the sense strand.

[0096] In some embodiments, the DMPK RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, or Table 5.4. In some embodiments, the DMPK RNAi sense strand comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0097] In some embodiments, a DMPK RNAi agent is comprised of (i) an antisense strand that includes nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand that includes nucleotides 1-17 or 1-18 (5' to 3') of any of the sense strand sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0098] In some embodiments, the DMPK RNAi agent comprises a core 19-mer nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13]

[0099] DMPK RNAi agent sense and antisense strands comprising or consisting of the nucleotide sequences in Table 2 can be modified or unmodified nucleotides. In some embodiments, DMPK RNAi agents having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0100] In some embodiments, the antisense strand of a DMPK RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a DMPK RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0101] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase than the N nucleotide at the corresponding position on the other strand.

[0102] Certain modified DMPK RNAi agent sense and antisense strands are presented in Table 3 and Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. Modified DMPK RNAi agent antisense strands, along with their underlying unmodified nucleobase sequences, are presented in Table 3. Modified DMPK RNAi agent sense strands, along with their underlying unmodified nucleobase sequences, are presented in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. In forming DMPK RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Table 3 and Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5, and in Table 2 above, can be a modified nucleotide.

[0103] The DMPK RNAi agent described herein is formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 or 5.5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3 or Table 5.4, provided that the two sequences have a region of at least 85% complementarity over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0104] In some embodiments, the DMPK RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5.4.

[0105] In some embodiments, a DMPK RNAi agent comprises or consists of a duplex having sense and antisense strand nucleobase sequences of any of the sequences in Table 2, Table 3, or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0106] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 and 5.5.

[0107] As used in Table 3 and Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 and 5.5, the following notation is used to refer to modified nucleotides, targeting groups and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA s = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate, see Table 6.1 a_2Ns = 2'-O-methyl-2-aminoadenosine-3'-phosphorothioate, see Table 6.1 (invAb) = inverted abasic deoxyribonucleotide 5'-phosphate, see Table 6.1 (invAb)s = inverted abasic deoxyribonucleotide 5'-phosphorothioate, see Table 6.1 s = phosphorothioate linkage ss = phosphorodithioate linkage p = terminal phosphate (if synthesized) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6.1) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 6.1) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 6.1) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 6.1) aAlk = 2'-O-propargyl adenosine-3'-phosphate, see Table 6.1 aAlks = 2'-O-propargyl adenosine-3'-phosphorothioate, see Table 6.1 cAlk = 2'-O-propargylcytidine-3'-phosphate, see Table 6.1 cAlks = 2'-O-propargylcytidine-3'-phosphorothioate, see Table 6.1 gAlk = 2'-O-propargylguanosine-3'-phosphate, see Table 6.1 gAlks = 2'-O-propargylguanosine-3'-phosphorothioate, see Table 6.1 tAlk = 2'-O-propargyl-5-methyluridine-3'-phosphate, see Table 6.1 tAlks = 2'-O-propargyl-5-methyluridine-3'-phosphorothioate, see Table 6.1 uAlk = 2'-O-propargyluridine-3'-phosphate, see Table 6.1 uAlks = 2'-O-propargyluridine-3'-phosphorothioate, see Table 6.1 (Alk-SS-C6) = see table 6.1 (C6-SS-Alk) = see table 6.1 (C6-SS-C6) = see table 6.1 (6-SS-6) = See Table 6.1 (C6-SS-Alk-Me) = see Table 6.1 (NH2-C6) = See Table 6.1 (Alk-cyHex) = See Table 6.1 (Alk-cyHex)s = See Table 6.1 avb6-pep1 = αvβ6 peptide 1, see Table 6.3

[0108] As one of ordinary skill in the art will readily understand, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s" or a phosphorodithioate linkage "ss"), when present in an oligonucleotide, the nucleotide monomers are linked to one another by 5'-3'-phosphodiester linkages. As one of ordinary skill in the art will clearly understand, the inclusion of phosphorothioate linkages as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides. Furthermore, one of ordinary skill in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each of the given monomers ex vivo in place of a phosphate moiety. Furthermore, as one of ordinary skill in the art will readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., where the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless expressly indicated otherwise herein, such understanding of one of ordinary skill in the art will be used in describing the DMPK RNAi agents and compositions of DMPK RNAi agents disclosed herein.

[0109] Certain examples of targeting groups and linking groups used by the DMPK RNAi agents disclosed herein are included in the chemical structures presented below in Tables 6.1, 6.2, and 6.3. Each sense and / or antisense strand can have any targeting or linking group listed herein conjugated to the 5' and / or 3' end of the sequence, as well as other targeting or linking groups. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 4.1-1] [Table 4.1-2] [Table 4.1-3] [Table 4.1-4] [Table 4.1-5]

[0110] As shown in Table 4.1 above, exemplary DMPK RNAi agent sense strand nucleotide sequences are shown in some embodiments to further include reactive linkages at both the 5'- and 3'-ends of the sense strand. For example, certain DMPK RNAi agent sense strand sequences shown in Table 4.1 above have an (NH2-C6) linkage group at the 5'-end of the nucleotide sequence. Similarly, certain DMPK RNAi agent nucleotide sequences shown in Table 4.1 above have a (C6-SS-C6) linkage group near the 3'-end of the nucleotide sequence. Such reactive linkage groups are positioned to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the DMPK RNAi agents disclosed herein. Ligation or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Suitable conjugation reactions for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, and click chemistry cycloaddition reactions.

[0111] In some embodiments, the targeting ligand can be synthesized as a tetrafluorophenyl (TFP) ester, which reacts with an amino group (e.g., NH2-C6) to attach the targeting ligand to a DMPK RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, by a click chemistry cycloaddition reaction.

[0112] Additionally, the nucleotide sequences shown in Table 4.1 were synthesized with a dT nucleotide at the 3'-terminal end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6). Synthesis of the oligonucleotide strand can be initiated using a suitable, commercially available dT-loaded resin. The (C6-SS-C6) linker can then be used in some embodiments to facilitate linking to additional components, such as, for example, a PK / PD modulator or one or more targeting ligands. As described herein, the C6-SS-C6 can first be reduced to, among other things, cleave the dT residue from the molecule, which can then facilitate conjugation of the desired PK / PD modulator. Table 4.2 below shows the nucleotide sequences identified in Table 4.1 above, but without the 3'-terminal dT nucleotide, as this more accurately reflects the sequences of the DMPK RNAi agents disclosed herein when delivered in vivo.

[0113] Additionally, Table 4.3 below shows the nucleotide sequences identified in Table 4.1 above, but without the terminal linking group present (ie, nucleotide sequences having only a capping group). [Table 4.2-1] [Table 4.2-2] [Table 4.2-3]

Table 4.2-4

Table 4.2-5

Table 4.2-6

Table 4.3-1

Table 4.3-2

Table 4.3-3

Table 4.3-4

Table 4.3-5

Table 4.4-1

Table 4.4-2

Table 4.4-3

Table 4.4-4

Table 4.4-5

[0114] As described herein, in some embodiments, one or more targeting ligands and / or PK / PD modulators are linked or conjugated to an RNAi agent. In some embodiments, the targeting ligand (or targeting group) and / or PK / PD modulator is linked to the 5' end of the sense strand, the 3' end of the sense strand, and / or one or more internal nucleotides. Synthesis of the sense and / or antisense strands can be designed to provide readily accessible reactive groups to facilitate linking to additional components, such as targeting ligands or PK / PD modulators. Table 4.5 below depicts the sense strand of a DMPK RNAi agent disclosed above in Table 4.1 after linking to one or more targeting ligands and / or PK / PD modulators (collectively shown below as Z). A pharmacological moiety is linked to the DMPK RNAi agent using the reaction described in Example 1 below. Following conjugation to the targeting ligand, the linking group can have the structure (NH-C), (NH-C) or (C-S), the respective structures of which are shown in Table 6.1 below. [Table 4.5-1] [Table 4.5-2] [Table 4.5-3] [Table 4.5-4] [Table 4.6-1] [Table 4.6-2] [Table 4.6-3] [Table 4.6-4]

[0115] The DMPK RNAi agent described herein is formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 or 5.5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3 or Table 5.4, provided that the two sequences have a region of at least 85% complementarity over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0116] In some embodiments, the antisense strand of a DMPK RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of a DMPK RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0117] In some embodiments, the DMPK RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the DMPK RNAi agent antisense strand comprises a sequence of nucleotides (5' end to 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 5.4. In certain embodiments, the DMPK RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3.

[0118] In some embodiments, the DMPK RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5. In some embodiments, a DMPK RNAi agent sense strand comprises a sequence of nucleotides (5' end to 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5. In certain embodiments, the DMPK RNAi agent sense strand comprises or consists of any one of the modified sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0119] For the DMPK RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3') can be perfectly complementary to the DMPK gene, or can be non-complementary to the DMPK gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') is U, A, or dT (or modified versions thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') forms an A:U or U:A base pair with the sense strand.

[0120] In some embodiments, the DMPK RNAi agent antisense strand comprises the sequence of nucleotides (5' end to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the DMPK RNAi sense strand comprises the sequence of nucleotides (5' end to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0121] In some embodiments, a DMPK RNAi agent comprises (i) an antisense strand that includes a sequence of nucleotides (5' end to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand that includes a sequence of nucleotides (5' end to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4.

[0122] A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, a DMPK RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 5.4. Certain representative sequence pairings are illustrated by the duplex ID numbers shown in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7.

[0123] In some embodiments, the DMPK RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, the DMPK RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein. In some embodiments, the DMPK RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers presented herein, and a targeting ligand, targeting group, and / or linking group, wherein the targeting ligand, targeting group, and / or linking group are covalently linked (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, the DMPK RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, the DMPK RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein, and a targeting ligand, targeting group and / or linking group, wherein the targeting ligand, targeting group and / or linking group is covalently linked to the sense strand or the antisense strand.

[0124] In some embodiments, a DMPK RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5.1 (or Table 5.2, Table 5.3, Table 5.4, Table 5.6, or Table 5.7), and further comprises a targeting group. In some embodiments, a DMPK RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 5.1 (or Table 5.2 or 5.3, Table 5.4, Table 5.6, or Table 5.7), and further comprises an integrin receptor ligand targeting group.

[0125] In some embodiments, a DMPK RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 5.1, 5.2, 5.3, 5.4, 5.6, or 5.7, each comprising one or more linking groups selected from the group consisting of (NH2-C6), (C6-NH2), (C6-SS-C6), or (6-SS-6), as defined in Table 6.1.

[0126] In some embodiments, a DMPK RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0127] In some embodiments, a DMPK RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes in Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6, or 5.7), and further comprises an integrin targeting group.

[0128] In some embodiments, a DMPK RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6, or 5.7). [Table 5.1-1] [Table 5.1-2] [Table 5.1-3] [Table 5.1-4] [Table 5.2-1] [Table 5.2-2] [Table 5.2-3] [Table 5.2-4] [Table 5.2-5] [Table 5.3-1] [Table 5.3-2] [Table 5.3-3] [Table 5.3-4] [Table 5.3-5] [Table 5.3-6] As described herein, in some embodiments, the duplexed sense and antisense strand nucleotide sequences may be linked to certain targeting ligands and / or PK / PD modulators. Certain exemplary targeting ligands and / or PK / PD modulators are linked as shown in Table 5.4 below, which shows a fully conjugated duplex, and have the "AC" identifying prefix.

[0129] [Table 5.4-1] [Table 5.4-2] [Table 5.4-3] [Table 5.4-4]

[0130] [Table 5.5-1] [Table 5.5-2]

[0131] [Table 5.6-1] [Table 5.6-2]

[0132] [Table 5.7-1] [Table 5.7-2] [Table 5.7-3]

[0133] In some embodiments, the DMPK RNAi agent is prepared or provided as a salt, mixed salt, free acid, or free base. In some embodiments, the DMPK RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the DMPK RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein. The RNAi agents described herein inhibit or knock down the expression of one or more DMPK genes in vivo and / or in vitro after delivery to cells expressing the DMPK gene.

[0134] In some embodiments, the present disclosure provides a composition comprising a combination or cocktail of at least two DMPK RNAi agents with different sequences.In some embodiments, two or more DMPK RNAi agents are each separately and independently linked to targeting groups.In some embodiments, two or more DMPK RNAi agents are each linked to targeting groups that comprise or consist of targeting ligands.In some embodiments, two or more DMPK RNAi agents are each linked to targeting groups. Targeting Groups, Linking Groups and Delivery Vehicles

[0135] In some embodiments, the DMPK RNAi agent contains or is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of linking groups are provided in Table 6.1, and examples of targeting groups or targeting ligands are provided in Tables 6.2 and 6.3. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the DMPK RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the DMPK RNAi agent sense strand. The non-nucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0136] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0137] Targeting groups or targeting ligands enhance the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have higher valency with respect to the target to which they are directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands with affinity for cell surface molecules, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can function as linkers in some instances.

[0138] The DMPK RNAi agents described herein can be synthesized to have reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.

[0139] For example, in some embodiments, a DMPK RNAi agent disclosed herein is synthesized with an NH2-C6 group (represented as (NH2-C6) in modified sequences herein) at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with, for example, a group comprising a targeting ligand. In some embodiments, a DMPK RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne group(s) can then be reacted to form a conjugate with, for example, a group comprising a targeting ligand.

[0140] In some embodiments, an RNAi agent comprises a targeting group comprising two or more targeting ligands. In some embodiments, the targeting group may be conjugated at the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the targeting group may be conjugated to an internal nucleotide in the RNAi agent. In some embodiments, the targeting group may consist of two targeting ligands linked together, referred to as a "bidentate" targeting group. In some embodiments, the targeting group may consist of three targeting ligands linked together, referred to as a "tridentate" targeting group. In some embodiments, the targeting group may consist of four targeting ligands linked together, referred to as a "tetradentate" targeting group.

[0141] In some embodiments, the use of a targeting ligand facilitates cell-specific targeting to cells that have a desired receptor on their surface, and binding of the targeting ligand can facilitate entry of a therapeutic agent, such as an RNAi agent, to which it is linked into cells, such as skeletal muscle cells. The targeting ligand can be monomeric or monovalent (e.g., having a single targeting moiety) or multimeric or multivalent (e.g., having multiple targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art.

[0142] Embodiments of the present disclosure include pharmaceutical compositions for delivering a DMPK RNAi agent to a skeletal muscle cell in vivo. Such pharmaceutical compositions can include, for example, a DMPK RNAi agent conjugated to a targeting group that includes a targeting ligand.

[0143] In some embodiments, the DMPK RNAi agents disclosed herein can reduce DMPK gene expression in one or more of the following tissues: for example, paraspinal, facial, trunk, abdominal, and limb musculature, including triceps, biceps, quadriceps, pectoralis, gastrocnemius, soleus, masseter, EDL (extensor digitorum longus), TA (tibialis anterior), trapezius, and / or diaphragm.

[0144] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be attached to the 3' and / or 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalization groups, ribitol, and / or PEG groups.

[0145] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (such as an RNAi agent) to another chemical group or segment of interest (such as a targeting group, pharmacokinetic modulator, or delivery polymer) via one or more covalent bonds. A labile linkage contains a labile bond. The linkage can optionally include a spacer that increases the distance between the two connected atoms. The spacer can add additional flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of this specification.

[0146] In some embodiments, targeting group is linked to DMPK RNAi agent without using additional linker.In some embodiments, targeting group is designed so that linker is easily present, so as to facilitate linking to DMPK RNAi agent.In some embodiments, when two or more RNAi agents are contained in the composition, two or more RNAi agents can be linked to their respective targeting groups using the same linker.In some embodiments, when two or more RNAi agents are contained in the composition, two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0147] Any of the DMPK RNAi agent nucleotide sequences listed in Tables 2, 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 and 5.5, whether modified or unmodified, can contain 3' and / or 5' targeting group(s), linking group(s) and / or pharmacokinetic modulator(s). Any of the DMPK RNAi agent sequences listed in Tables 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 and 5.5 or otherwise described herein that contain a 3' or 5' targeting group, linking group or pharmacokinetic modulator may instead not contain a 3' or 5' targeting group, linking group or PK / PD modulator, or can contain a different 3' or 5' targeting group, linking group or PK / PD modulator, including but not limited to those depicted in Tables 6.1, 6.2, 6.3, 6.4, 6.5, 6.6 or 6.7. Any of the DMPK RNAi agent duplexes listed in Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6, or 5.7), whether modified or unmodified, can further comprise a targeting group, linking group, or PK / PD modulator, including but not limited to, those depicted in Tables 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, or 6.7, and in some embodiments, the targeting group, linking group, and / or PK / PD modulator can be attached to the 3' or 5' end of either the sense or antisense strand of the DMPK RNAi agent duplex.

[0148] Examples of certain modified nucleotides and linking groups are provided in Table 6.1. [Table 6.1-1] [Table 6.1-2] [Table 6.1-3] [Table 6.1-4] [Table 6.1-5] [Table 6.1-6] [Table 6.1-7] [Table 6.1-8]

[0149] Alternatively, other linking groups known in the art may be used. Often, the linking group can be obtained commercially or, alternatively, is incorporated into a commercially available nucleotide phosphoramidite.

[0150] In some embodiments, a targeting ligand is linked to a DMPK RNAi agent disclosed herein. Examples of certain targeting ligands are provided in Table 6.2: [Table 6.2-1] [Table 6.2-2] [Table 6.2-3] [Table 6.2-4] [Table 6.2-5] [Table 6.2-6] or a pharmaceutically acceptable salt thereof, [ka] indicates the point of attachment to the DMPK RNAi agent.) In some embodiments, a PEG or other linking group is incorporated between the RNAi agent and the targeting ligand.

[0151] In some embodiments, the targeting groups in Table 6.2 are synthesized with reactive groups that allow for efficient coupling of targeting ligands comprising one or more targeting groups to the RNAi agents disclosed herein. In some embodiments, the targeting groups identified in Table 6.2 are synthesized as azides to facilitate linkage to the RNAi agent.

[0152] In some embodiments, the DMPK RNAi agent is linked to a targeting ligand having a structure disclosed in Table 6.3: [Table 6.3-1] [Table 6.3-2] [Table 6.3-3] [Table 6.3-4] [Table 6.3-5] [Table 6.3-6] [Table 6.3-7] [Table 6.3-8] or a pharmaceutically acceptable salt thereof, [ka] indicates the connection point to the DMPK RNAi agent).

[0153] In some embodiments, RNAi agent can be delivered to cells or tissue using delivery vehicle.Delivery vehicle is a compound that improves the delivery of RNAi agent to cells or tissue.Delivery vehicle can comprise or consist of, but is not limited to, polymer, for example, amphiphilic polymer, membrane active polymer, peptide, melittin peptide, melittin-like peptide (MLP), lipid, reversibly modified polymer or peptide or reversibly modified membrane active polyamine.

[0154] In some embodiments, RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery system available in the art for nucleic acid delivery.RNAi agent can be chemically conjugated to targeting group, lipid (including but not limited to cholesteryl and cholesteryl derivative), encapsulated in nanoparticle, liposome, micelle, conjugated to polymer or DPC (see, for example, WO2000 / 053722, WO2008 / 022309, WO2011 / 104169 and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference), or can be carried out by iontophoresis or by being incorporated into other delivery vehicles or systems available in the art, such as hydrogel, cyclodextrin, biodegradable nanocapsules, bioadhesive microspheres or proteinaceous vectors. In some embodiments, the RNAi agent can be conjugated to an antibody that has affinity for skeletal muscle cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for skeletal muscle cells or a receptor present on skeletal muscle cells. Pharmacokinetic / Pharmacodynamic (PK / PD) Modulators

[0155] In some embodiments, the DMPK RNAi agents disclosed herein are additionally or alternatively linked to one or more PK / PD modulators. Examples of certain pharmacodynamic / pharmacokinetic (PK / PD) modulators suitable for use with the RNAi agents disclosed herein are provided in Table 6.4. In Table 6.4, the PK / PD modulators were obtained from commercial suppliers where indicated, or were otherwise synthesized using commercially available materials: [Table 6.4-1] [Table 6.4-2] [Table 6.4-3] [Table 6.4-4] [Table 6.4-5] [Table 6.4-6] [Table 6.4-7]

[0156] In some embodiments, a PK / PD modulator in Table 6.4 has the following structure after conjugation to a DMPK RNAi agent, as shown in Table 6.5: [Table 6.5-1] [Table 6.5-2] [Table 6.5-3] [Table 6.5-4] [Table 6.5-5] [Table 6.5-6] or a pharmaceutically acceptable salt thereof, [ka] indicates the connection point to the DMPK RNAi agent).

[0157] In other embodiments, the PK / PD modulator that can be conjugated to the DMPK RNAi agents described herein can be selected from the group consisting of the PK / PD modulators in Table 6.6: [Table 6.6-1] [Table 6.6-2] [Table 6.6-3] [Table 6.6-4] [Table 6.6-5] [Table 6.6-6] [Table 6.6-7] [Table 6.6-8] [Table 6.6-9] [Table 6.6-10] [Table 6.6-11] [Table 6.6-12]

[0158] In some embodiments, a PK / PD modulator in Table 6.6 has the following structure after conjugation to a DMPK RNAi agent, as shown in Table 6.7: [Table 6.7-1] [Table 6.7-2] [Table 6.7-3] [Table 6.7-4] [Table 6.7-5] [Table 6.7-6] [Table 6.7-7] [Table 6.7-8] [Table 6.7-9] [Table 6.7-10] [Table 6.7-11] [Table 6.7-12] (In the formula, R Zrepresents the remainder of the DMPK RNAi agent).

[0159] In some embodiments, a DMPK RNAi agent can include one or more PK / PD modulators, hi some embodiments, a DMPK RNAi agent disclosed herein includes 1, 2, 3, 4, 5, 6, 7 or more PK / PD modulators.

[0160] The PK / PD modulator can be conjugated to a DMPK RNAi agent using any method known in the art. Many PK / PD modulators, including some listed above, are commercially available. In some embodiments, such as some of the compounds shown in Table 6.4, the PK / PD modulator can contain a maleimide moiety and can be reacted with an RNAi agent containing a disulfide linkage to form an RNAi agent containing the PK / PD modulator. The disulfide can be reduced and added to the maleimide via a Michael addition reaction. An example reaction scheme is shown below: [ka] (In the formula, R ZZ comprises an RNAi agent, [ka] indicates the point of attachment to any suitable group known in the art). In some examples of the reaction schemes above, [ka] is hexyl (C6H 13 ) and other alkyl groups.

[0161] In some embodiments, the PK / PD modulator precursor may contain a sulfone moiety and may react with a disulfide. An example reaction scheme is shown below: [ka] (In the formula, RZZ comprises an RNAi agent, [ka] indicates the point of attachment to any suitable group known in the art). In some examples of the reaction schemes above, [ka] is hexyl (C6H 13 ) and other alkyl groups.

[0162] In some embodiments, a PK / PD modulator precursor can include an azide moiety and can be reacted with an alkyne-containing RNAi agent to form a compound comprising a PK / PD modulator conjugated to an RNAi agent according to the general reaction scheme below: [ka] (In the formula, R ZZ contains RNAi agents).

[0163] In some embodiments, a PK / PD modulator precursor can include an alkyne moiety and can be reacted with a disulfide-containing RNAi agent to form a compound comprising a PK / PD modulator conjugated to an RNAi agent according to the general reaction scheme below: [ka] (In the formula, R ZZ comprises an RNAi agent, [ka] indicates the point of attachment to any suitable group known in the art). In some examples of the reaction schemes above, [ka] is hexyl (C6H 13 ) and other alkyl groups.

[0164] In some embodiments, the PK / PD modulator can be conjugated to the 5'-end of the sense or antisense strand of a DMPK RNAi agent, the 3'-end of the sense or antisense strand, or an internal nucleotide. In some embodiments, the DMPK RNAi agent is synthesized with a disulfide-containing moiety at the 3'-end of the sense strand, and the PK / PD modulator can be conjugated to the 3'-end of the sense strand using the general synthetic scheme shown above. Pharmaceutical Compositions and Formulations

[0165] The DMPK RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medications"). In some embodiments, the pharmaceutical composition comprises at least one DMPK RNAi agent. Such pharmaceutical compositions are particularly useful in inhibiting expression of DMPK mRNA in a target cell, group of cells, tissue, or organism. The pharmaceutical composition can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in the level of a target mRNA or inhibition of expression of a target gene. In some embodiments, the disease to be treated is myotonic dystrophy type 1. The pharmaceutical composition can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in the level of a target mRNA or inhibition of expression of a target gene. In one embodiment, a method comprises administering to a subject to be treated a DMPK RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising a DMPK RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0166] In some embodiments, one or more of the described DMPK RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human. Pharmaceutical compositions containing one or more DMPK RNAi agents can be administered in a number of ways, depending on whether local or systemic treatment is desired. Administration can be, for example, but is not limited to, intravenous, intraarterial, subcutaneous (SQ), intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration.

[0167] Pharmaceutical compositions and methods including the DMPK RNAi agents disclosed herein comprise administering to a subject a therapeutically effective amount of a DMPK RNAi agent described herein, thereby reducing the level of a target mRNA in a cell, group of cells, tissue, organ, or subject, including by inhibiting expression of DMPK mRNA in the subject. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder mediated, at least in part, by DMPK expression. In some embodiments, the subject has previously been identified or diagnosed with a condition, disease, or disorder that would benefit from reduced DMPK protein levels, more particularly, reduced mutant DMPK-CUG protein levels, in one or more cells or tissues. In some embodiments, the subject has previously been diagnosed with one or more skeletal muscle diseases, such as myotonic dystrophy type 1. In some embodiments, the subject suffers from symptoms associated with one or more skeletal muscle diseases.

[0168] In some embodiments, the described pharmaceutical compositions comprising DMPK RNAi agents are used to treat or manage clinical symptoms in subjects who would benefit from inhibition of DMPK expression. In some embodiments, a therapeutically or prophylactically effective amount of one or more of the pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed DMPK RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0169] The described pharmaceutical compositions comprising a DMPK RNAi agent can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting the expression of DMPK mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a DMPK RNAi agent, thereby treating the symptom.

[0170] The route of administration is the passageway through which the DMPK RNAi agent is brought into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The DMPK RNAi agent disclosed herein can be administered by any suitable route in a preparation appropriately tailored for a particular route. In some embodiments, the pharmaceutical composition can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally, or topically.

[0171] Pharmaceutical compositions containing the DMPK RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered by subcutaneous injection, intramuscular injection, or intravenous administration.

[0172] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0173] In some embodiments, pharmaceutical formulations comprising a DMPK RNAi agent disclosed herein suitable for SQ or IV administration can be prepared in an aqueous sodium phosphate buffer (e.g., a DMPK RNAi agent formulated in 0.5 mM monosodium phosphate, 0.5 mM disodium phosphate in water). In some embodiments, pharmaceutical formulations comprising a DMPK RNAi agent disclosed herein suitable for SQ or IV administration can be prepared in water for injection.

[0174] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., DMPK RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can a) aid in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) assist in product identification; and / or d) act to enhance the overall safety, efficacy, or other attributes of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0175] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline solutions, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0176] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0177] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of the ingredients listed above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredients from their previously sterile-filtered solutions.

[0178] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to deliver drugs for both intra-articular and ophthalmic administration.

[0179] The active compound can be prepared with a carrier that protects the compound from rapid excretion from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid.Methods for preparing such formulations are clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.They can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0180] DMPK RNAi agent can be formulated in the composition in unit dosage form to facilitate administration and uniformity of dosage.Unit dosage form refers to a physically separate unit that is suitable as a unit dose for the subject to be treated; each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.The specification of unit dosage form of the present disclosure is determined and directly depends on the specific characteristics of active compound and the therapeutic effect to be achieved, and the inherent limitations of the technical field of compounding such active compound for individual treatment.

[0181] Pharmaceutical compositions can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as a "pharmaceutical composition." As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces pharmacological, therapeutic, or preventive results.

[0182] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another DMPK RNAi agent (e.g., a DMPK RNAi agent that targets a different sequence within the DMPK target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0183] Generally, an effective amount of a DMPK RNAi agent disclosed herein will be in the range of about 0.0001 to about 20 mg / kg body weight per dose, e.g., about 0.5 to about 10 mg / kg body weight per dose. The amount administered and the frequency of administration (e.g., daily, biweekly, weekly, monthly, quarterly, or twice yearly) may depend on variables such as the patient's overall health, the relative biological effectiveness of the compound being delivered, the drug formulation, the presence and type of additives in the formulation, and the route of administration. It should also be understood that the initial dose administered may be increased beyond the upper levels noted above to rapidly achieve desired blood or tissue levels, or the initial dose may be less than optimal.

[0184] In some embodiments, an effective amount of a DMPK RNAi agent disclosed herein can be administered as a fixed dose of about 0.0001 mg to about 2,500 mg of DMPK RNAi agent. In some embodiments, an effective amount of a DMPK RNAi agent disclosed herein can be administered as a fixed dose of about 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 750 mg, 800 mg, 900 mg, or 1,000 mg.

[0185] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising a DMPK RNAi agent can be combined with an additive or with a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0186] The described DMPK RNAi agents, when added to a pharmaceutically acceptable excipient or adjuvant, can be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein can be packaged, for example, in pre-filled syringes or vials. Methods of Treatment and Inhibition of Expression

[0187] The DMPK RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) that would benefit from reducing and / or inhibiting the expression of DMPK mRNA.

[0188] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) with a disease or disorder in which the subject would benefit from a reduction in DMPK protein levels, more specifically, a reduction in mutant DMPK-CUG protein levels, including, but not limited to, myotonic dystrophy type 1. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more DMPK RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein can be to a human or an animal.

[0189] In some embodiments, the described DMPK RNAi agents are used to treat at least one symptom in a subject that is mediated, at least in part, by DMPK protein levels. The subject is administered a therapeutically effective amount of any one or more of the described DMPK RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0190] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by DMPK gene expression in a patient in need thereof, the method comprising administering to the patient any of the DMPK RNAi agents described herein.

[0191] In some embodiments, the DMPK RNAi agent is used to treat or manage a clinical picture or pathological condition in a subject, wherein the clinical picture or pathological condition is mediated, at least in part, by DMPK expression. The subject is administered a therapeutically effective amount of one or more of the DMPK RNAi agents or DMPK RNAi agent-containing compositions described herein. In some embodiments, the method includes administering a composition containing a DMPK RNAi agent described herein to the subject to be treated.

[0192] In some embodiments, the gene expression level or mRNA level of a DMPK gene in certain skeletal muscle cells of a subject to which a described DMPK RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99% compared to the subject before administration of the DMPK RNAi agent or a subject not receiving the DMPK RNAi agent. In some embodiments, the DMPK protein level (including mutant DMPK-CUG protein level) of a subject administered a described DMPK RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99% compared to the subject before administration of the DMPK RNAi agent or a subject not receiving the DMPK RNAi agent. Gene expression levels, protein levels and / or mRNA levels in a subject may be reduced in cells, cell groups, tissues and / or other bodily fluids of the subject. In some embodiments, DMPK mRNA levels in certain skeletal muscle cells or skeletal muscle tissue of a subject administered a described DMPK RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the DMPK RNAi agent or a subject not receiving the DMPK RNAi agent. In some embodiments, DMPK protein levels (including mutant DMPK-CUG protein levels) in skeletal muscle cells and / or skeletal muscle tissue of a subject administered a described DMPK RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the DMPK RNAi agent or a subject not receiving the DMPK RNAi agent.

[0193] As noted herein, DMPK protein levels (including mutant DMPK-CUG protein levels) and / or DMPK mRNA levels in a subject can be reduced in the subject's cells, cell populations, tissues, blood, and / or other bodily fluids (e.g., serum), as will be understood by those skilled in the art. For example, in some embodiments, the level of DMPK mRNA in a subject administered a described DMPK RNAi agent is reduced in one or more skeletal muscle cells or skeletal muscle tissues by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the DMPK RNAi agent or a subject not receiving the DMPK RNAi agent. In some embodiments, the levels of DMPK mRNA and / or DMPK protein in a subset of skeletal muscle cells of a subject administered a described DMPK RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99% compared to the subject before administration of the DMPK RNAi agent or compared to a subject not receiving the DMPK RNAi agent.

[0194] In some embodiments, the DMPK RNAi agent is capable of reducing DMPK gene expression in one or more of the following muscle tissues: triceps, biceps, quadriceps, gastrocnemius, soleus, masseter, EDL (extensor digitorum longus), TA (tibialis anterior), trapezius, and / or diaphragm.

[0195] The reduction of gene expression, mRNA and protein levels can be assessed by any method known in the art. For example, the examples provided herein provide suitable ways to measure DMPK protein levels (including mutant DMPK-CUG protein levels) and DMPK mRNA levels in a subject. Reduction or decrease in DMPK mRNA levels and / or DMPK protein levels (including mutant DMPK-CUG protein levels) is collectively referred to herein as reduction or decrease of DMPK or inhibition or reduction of the expression of the DMPK gene. The examples provided herein describe known methods for assessing the inhibition of DMPK gene expression. Cells, tissues, organs and non-human organisms

[0196] Contemplated herein are cells, tissues, organs, and non-human organisms that contain at least one of the DMPK RNAi agents described herein. The cells, tissues, organs, or non-human organisms are produced by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.

[0197] The embodiments and clauses provided above will now be illustrated by the following non-limiting examples. [Example]

[0198] Example 1 Synthesis of DMPK RNAi agents. The DMPK RNAi agents disclosed herein were synthesized according to the following description:

[0199] A. Synthesis. The sense and antisense strands of the DMPK RNAi agent were synthesized according to the solid-phase phosphoramidite technique used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) was used. Synthesis was performed on a solid support made of controlled-pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N 2-(Isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite possessed the same protecting groups as the 2'-O-methyl RNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). UNA phosphoramidites were 5'-(4,4'-dimethoxytrityl)-N-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2', These include 3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.Cyclopropyl phosphonate phosphoramidites were synthesized according to International Patent Application Publication No. WO2017 / 214112 and Erich F. Altenhofer et al., Synthesis of a novel cyclopropyl phosphonate nucleotide as a phosphate mimic, Chemical Communications (June 2021) (DOI:10.1039 / d1cc02328d). TFA aminolink phosphoramidites were also purchased commercially (ThermoFisher).

[0200] B. Cleavage and deprotection of support-bound oligomers. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume of 40 wt.% methylamine solution and 28%-31% ammonium hydroxide solution (Aldrich) in water for 1.5 hours at 30° C. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0201] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then subjected to size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine, with a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system by tangential flow filtration.

[0202] D. Annealing. RNAi agents were formed by mixing complementary strands by combining equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentrations were determined by measuring the solution absorbance in a UV-Vis spectrometer in 1x PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL·cm) or experimentally determined.

[0203] E. Synthesis of SM45-p for conjugation to RNAi agents; (S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(5-((4-methylpyridin-2-yl)amino)pentanamido)acetamido)propanoic acid [ka]

[0204] To a solution of compound 1 (0.50 g) in DMF was added CsCO (0.94 g) at room temperature under N2 (g). Compound 2 (0.49 g) was then slowly added dropwise. The reaction was stirred overnight. LC-MS then confirmed approximately 50% conversion to the desired product. The reaction mixture was quenched with NaHCO (10 mL). The product was extracted with EtOAc (3 × 15 mL) and then washed with water (3 × 10 mL) and brine (10 mL). The combined organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient from hex to EtOAc (0-70%), in which the product eluted at 16% B. The product was concentrated in vacuo to give a clear oil (0.35 g, 45.0% yield). LC-MS: calculated [M+H]+ 323.19 m / z, observed 328.38 m / z. [ka]

[0205] To a solution of compound 1 (0.35 g) in 1:1 THF / water was added LiOH (0.078 g) at room temperature under normal atmosphere. The reaction was stirred at room temperature until complete conversion was observed by LC-MS. After 1 h, the reaction mixture was acidified with 6 N HCl to a pH of approximately 3. The product was extracted with EtOAc (3 x 15 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to give a clear, colorless oil (0.32 g, 94.9% yield). No isolation was required. LC-MS: calculated [M+H]+ 309.17 m / z, found 309.24 m / z. [ka]

[0206] To a solution of compounds 1 (0.10 g) and 2 (0.049 g) in DMF, TBTU (0.058 g) and then DIPEA (0.079 mL) were added under ambient conditions. The reaction was stirred for 1 h until complete conversion was observed by LC-MS. The reaction mixture was then quenched with NaHCO (10 mL). The product was extracted with EtOAc (3 × 15 mL) and then washed with water (3 × 10 mL) and brine (10 mL). The combined organic phase was dried over NaSO, filtered, and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient from DCM to 20% MeOH in DCM (0-70%), in which case the product eluted at 23% B. The product was concentrated in vacuo to give a clear, colorless oil (0.088 g, 63.6% yield). [ka]

[0207] To a solution of compound 1 (0.088 g) in DCM was added TFA (0.22 mL) at room temperature. The reaction was stirred under ambient conditions. The reaction was stirred for 5 hours until complete conversion was confirmed by LC-MS. The reaction mixture was azeotroped with PhMe and concentrated under vacuum. No isolation was necessary. Concentration resulted in a clear, colorless oil (0.10 g, 113% yield). LC-MS: calculated [M+H]+ 814.41 m / z, found 814.63 m / z. [ka]

[0208] To a solution of compound 1 (0.10 g) in 1:1 THF / water, LiOH (0.0078 g) was added at room temperature under normal atmosphere. The reaction was stirred at room temperature until complete conversion was observed by LC-MS. After 4 hours, the reaction mixture was acidified with 6 N HCl to a pH of approximately 3. The product was extracted with 20% CF3CH2OH / DCM (3 x 15 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to give a pale yellow solid (0.104 g, 119% yield). LC-MS: calculated [M+H]+ 800.39 m / z, found 800.76 m / z.

[0209] F. Synthesis of an activated ester skeletal muscle cell receptor peptide (αvβ6 peptide 1 / avb6-pep1) for conjugation to RNAi agents [ka]

[0210] Peptide 1 was prepared by modification of Arg-Gly-Asp(tBu)-Leu-Ala-Abu-Leu-Cit-Aib-Leu-Peg5-CO2-2-Cl-Trt resin 1, obtained using general Fmoc peptide chemistry on a CS Bio peptide synthesizer utilizing Fmoc-Peg5-CO2H-preloaded 2-Cl-Trt resin at a 4.1 mmol scale (0.79 mmol / g) as described above. After cleavage from the resin, peptide 6-2 was converted to the tetrafluorophenyl ester 6-3, and the crude product was used in the next step without purification.

[0211] Final deprotection was achieved by treating crude peptide 6-3 with the deprotection cocktail TFA / TIS / HO = 90:5:5 (80 mL) for 1.5 h. The reaction mixture was added dropwise to methyl tert-butyl ether (700 mL), and the resulting precipitate was collected by centrifugation. The pellet was washed with additional methyl tert-butyl ether (500 mL). The residue was purified by RP-HPLC (Phenomenex Gemini C18 250 × 50 mm, 10 microns, 60 mL / min, 30–45% ACN gradient in water containing 0.1% TFA, approximately 1 gram of crude product per run) to yield 4.25 g of pure peptide 6-4.

[0212] G. Conjugation of Targeting Ligands. Either before or after annealing, the 5' or 3' amine-functionalized sense strand is conjugated to a targeting ligand either directly or through the use of a linker such as an alkyne-functionalized linker (e.g., DBCO or linkers 1-10 shown in Table 6.1), which can then be used to facilitate conjugation to the targeting ligand(s).

[0213] The following description generally describes the conjugation of activated ester-functionalized linkers, including DBCO and linkers 1-10, to single strands or annealed duplexes: Amine-functionalized duplexes were dissolved in 90% DMSO / 10% HO at approximately 50-70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents (L4). The reaction was monitored by RP-HPLC. Upon completion, the conjugates were precipitated twice in a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.

[0214] i. Conjugation of a targeting ligand to a propargyl linker

[0215] Either before or after annealing, the 5' or 3' tridentate alkyne-functionalized sense strand is conjugated to an αvβ6 integrin ligand. The following example describes the conjugation of an αvβ6 integrin ligand to an annealed duplex: 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M stock solutions of Cu(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and a 2 M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution of the αvβ6 integrin ligand in DMSO was made. In a 1.5 mL centrifuge tube containing the tri-alkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol), 25 μL of 1 M Hepes pH 8.5 buffer was added. After vortexing, 35 μL of DMSO was added and the solution was vortexed. The αvβ6 integrin ligand was added to the reaction (6 equivalents per duplex, 2 equivalents per alkyne, approximately 15 μL) and the solution was vortexed. The pH was checked using pH paper to confirm it was approximately pH 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) was added to the reaction vial and vortexed. 2 M ascorbate (5 μL, 50 equivalents per duplex, 16.7 per alkyne) was then added to the reaction vial and vortexed. Upon reaction completion (typically within 0.5–1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography.

[0216] ii. Conjugation of targeting ligands to the amine-functionalized sense strand

[0217] The following procedure can be used to conjugate an activated ester-functionalized targeting ligand, such as αβpeptide 1, to an amine-functionalized RNAi agent containing an amine, such as C-NH, NH-C, or (NH-C), as shown in Table 6.1 above.

[0218] The annealed, lyophilized RNAi agent was dissolved at 25 mg / mL in DMSO and 10% water (v / v%). Next, 50–100 equivalents of TEA and 3 equivalents of activated ester targeting ligand were added to the mixture. The reaction was stirred for 1–2 hours while being monitored by RP-HPLC-MS (Mobile Phase A: 100 mM HFIP, 14 mM TEA; Mobile Phase B: acetonitrile; Column: XBridge C18). After the reaction was complete, 12 mL of acetonitrile was added, followed by 0.4 mL of PBS, and the mixture was then centrifuged. The solid pellet was collected and dissolved in 0.4 mL of 1x PBS, followed by the addition of 12 mL of acetonitrile. The resulting pellet was collected and dried under high vacuum for 1 hour.

[0219] H. Synthesis of PK / PD modulators

[0220] PEG48+C22 [ka]

[0221] To a solution of compound 1 (350 mg, 1.027 mmol, 1.0 equiv.), compound 2 (181 mg, 1.130 mmol, 1.1 equiv.), and diisopropylethylamine (0.537 mL, 3.082 mmol, 3.0 equiv.) in anhydrous DMF (3 mL) was added TBTU (396 mg, 1.233 mmol, 1.2 equiv.) at room temperature. The reaction was maintained at room temperature for 2 h. The reaction was quenched with saturated aqueous NaHCO3 (20 mL), and the aqueous phase was extracted with dichloromethane (3 × 10 mL). The organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was purified by CombiFlash® eluting with 4-5% methanol in dichloromethane. LC-MS: calculated [M+H]+ 483.44, found 483.67. [ka]

[0222] To a solution of compound 1 (290 mg, 0.600 mmol, 1.0 equiv.) in anhydrous 1,4-dioxane (1 mL) was added a solution of HCl in dioxane (0.751 mL, 3.003 mmol, 5.0 equiv.) at room temperature. The reaction was kept at room temperature for 3 hours and the solvent was concentrated. The product was used directly without further purification. LC-MS: calculated [M+H]+ 383.39, found 383.57. [ka]

[0223] To a solution of compound 1 (83 mg, 0.0322 mmol, 1.0 equiv.) and compound 2 (13.5 mg, 0.322 mmol, 1.0 equiv.) in anhydrous DMF (2 mL) was added triethylamine (0.014 mL, 0.0967 mmol, 3.0 equiv.) at room temperature. The reaction was kept at room temperature for 3 h, and the solvent was concentrated. The product was isolated by CombiFlash® and eluted with 10-15% methanol in dichloromethane. LC-MS: calculated [M+4H]+ / 4 698.18, found 698.49, calculated [M+3H]+ / 3 930.58, found 930.61.

[0224] Synthesis of LP29-p [ka]

[0225] To a solution of compounds 1 (40 mg) and 2 (334 mg) in DMF, TBTU (50.1 mg) and then DIPEA (0.082 mL) were added under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then directly concentrated for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient from DCM to 20% MeOH in DCM (0-80%) over 20-30 min, where the product eluted at 71% B. The product was concentrated under vacuum to give a white oily residue. LC-MS: calculated [M+H]+ 2539.62 m / z, found 1288.21 (+2 / 2, +H2O) m / z. [ka]

[0226] To compound 1 (147 mg) was added 4M HCl / dioxane (21.2 mg) at room temperature. The reaction was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotroped with PhMe and concentrated under vacuum overnight to give an oil. LC-MS: calculated [M+H]+ 2439.57 m / z, found 611.16 (+4 / 4) m / z. [ka]

[0227] A solution of compound 1 (143 mg) and NEt (0.024 mL) in anhydrous DCM was prepared and stirred under a nitrogen sparging atmosphere. Compound 2 (23.4 mg) was then added to the reaction mixture. The reaction mixture was stirred at room temperature until complete conversion was observed by LC-MS.

[0228] The reaction mixture was concentrated directly for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase and eluted with a gradient from DCM to 20% MeOH in DCM (0-100% B). The product eluted at 54% B. LC-MS: calculated [M+H]+ 5506.42 m / z, found 1854.41 (+3 / 3, +H2O) m / z.

[0229] Synthesis of LP38-p [ka]

[0230] To a solution of compounds 1 (35 mg) and 2 (299 mg) in DMF, TBTU (43.8 mg) and then DIPEA (0.071 mL) were added under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then directly concentrated for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient (0-100%) from DCM to 20% MeOH in DCM over 20-30 min, where the product eluted at 56% B. The product was concentrated under vacuum to give a white oily residue. LC-MS: calculated [M+H]+ 2539.62 m / z, found 1288.07 (+2 / 2, +H2O) m / z. [ka]

[0231] To compound 1 (186 mg) was added 4M HCl / dioxane (26.7 mg) at room temperature. The reaction was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotroped with PhMe and concentrated under vacuum overnight to give an oil. LC-MS: calculated [M+H]+ 2439.57 m / z, found 1220.97 (+2 / 2) m / z. [ka]

[0232] To a solution of compound 1 (181 mg), TBTU (24 mg), and DIEA (0.033 mL) in DMF was added 2 (8.7 mg) under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then directly concentrated for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient (0-100%) from DCM to 20% MeOH in DCM over 20-30 min, where the product eluted at 65% B. The product was concentrated under vacuum to give a white oily residue. LC-MS: calculated [M+H]+ 5089.22 m / z, found 1036.24 (+5 / 5, +H2O) m / z. [ka]

[0233] To compound 1 (130 mg) was added 4M HCl / dioxane (9.3 mg) at room temperature. The reaction was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotroped with PhMe and concentrated under vacuum overnight to give an oil. LC-MS: calculated [M+H]+ 4989.17 m / z, found 1248.58 (+4 / 4) m / z. [ka]

[0234] A solution of compound 1 (128 mg) and NEt (0.018 mL) in anhydrous DCM was prepared at room temperature under N2(g) sparging. Compound 2 (10.3 mg) was then added slowly. The reaction mixture was stirred until complete conversion was observed by LC-MS. The reaction mixture was then directly concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient of DCM to 20% MeOH / DCM (0-100%) over 30 min, where the product eluted at 100% B. The product was concentrated to give a white solid. LC-MS: calculated [M+H]+ 5299.28 m / z, found 1786.62 (+3 / 3, +H2O) m / z.

[0235] Synthesis of LP238-p [ka]

[0236] To a suspension of compound 1 (5.00 g, 22.50 mmol) and Cs2CO3 (25.66 g, 78.75 mmol) in anhydrous DMF (80 mL) was added methyl iodide (4.20 mL, 67.50 mmol) at room temperature. The reaction mixture was stirred at room temperature for 48 hours. The reaction was quenched with water (200 mL), and the mixture was extracted with EtOAc (3 x 100 mL). The organic phases were combined and washed with water and brine. The organic layer was dried over anhydrous Na2SO4 and concentrated. Compound 2 was obtained as a pale yellow solid, 5.41 g, 96%. Compound 2 was used directly without further purification. LC-MS: [M+H] calculated 251.05, found 251.18. [ka]

[0237] To a solution of compound 2 (5.41 g, 21.62 mmol) in THF / HO (50 mL / 50 mL) was added LiOH (2.59 g, 108.08 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour. After removing THF under vacuum, the pH was adjusted to about 2 with [C]HCl. Then, EtOAc (3 × 60 mL) was used for extraction. The organic layers were combined and washed with brine, then dried over anhydrous NaSO and concentrated. Compound 3 was obtained as an off-white solid, 5 g, 98%. Compound 3 was used directly without further purification. LC-MS: calculated [M+H] 237.03, found 237.26. [ka]

[0238] To a solution of compound 3 (5.81 g, 24.60 mmol) in THF / DMF (80 mL / 20 mL) was added EDC (7.07 g, 36.90 mmol), DMAP (0.30 g, 2.46 mmol), and compound 4 (6.13 g, 36.90 mmol) at room temperature. The reaction mixture was stirred at room temperature overnight. After removing the solvent under vacuum, the residue was loaded onto a 120 g column and compound 5 was eluted with 0-50% EtOAc in hexane. Compound 5 was obtained as a white solid, 9.36 g, 99% yield. LC-MS: calculated [M+H] 385.03, found 385.46. [ka]

[0239] To a solution of compound 5 (2.29 g, 5.96 mmol) in DCM (110 mL) was added 70% m-CPBA (5.14 g, 27.79 mmol) at 0° C. The reaction mixture was stirred at room temperature for 6 h. An additional 1.8 g of m-CPBA was added at room temperature. The reaction mixture was stirred at room temperature overnight. After filtration, the solvent was removed under vacuum. The residue was recrystallized twice from DCM / EtOAc (50 mL / 50 mL). Compound 6 was obtained as white needles, 1.93 g, 78% yield. LC-MS: calculated [M+H] 417, found 417. [ka] [ka]

[0240] To a solution of compound 7 (10.00 g, 4.34 mmol) in DCM (100 mL) was added palmitoyl chloride (1.31 g, 4.78 mmol) and TEA at 0 °C. The reaction mixture was stirred at room temperature overnight, and then the solvent was removed under vacuum. The residue was purified by silica gel chromatography using 0-20% MeOH in DCM. Compound 8 was obtained as a white solid, 10.0 g, 90% yield. [ka]

[0241] Compound 8 (9.56 g, 3.76 mmol) was dissolved in 25 mL of 4 N HCl / dioxane and stirred at room temperature for 1 h. All solvent was removed, and the residue was dried under vacuum for 2 h. The residue was redissolved in 150 mL of DCM, and TEA was added, followed by compound 9 (1.10 g, 1.79 mmol) and COMU (1.69 g, 3.94 mmol). The reaction mixture was stirred overnight at room temperature. After standard workup (1 N HCl, saturated bicarb, brine wash), the DCM was removed. Compound 10 was purified by a 120 g column using 0-20% MeOH in DCM to give 5.90 g, 60% yield. [ka]

[0242] Compound 10 (4.50 g, 0.82 mmol) was dissolved in 20 mL of 4N HCl / dioxane and stirred at room temperature for 1 h. All solvent was removed, and the residue was dried under vacuum for 2 h. The residue was redissolved in 100 mL of DCM, and TEA was added, followed by compound 6 (0.69 g, 1.65 mmol). The reaction mixture was stirred at room temperature overnight. TEA was removed by 1H HCl washing, and the organic layer was concentrated. Crude LP238-p was purified by silica gel chromatography using 0-20% MeOH in DCM. 2.80 g (60%) of LP238-p was obtained as a pale yellow solid.

[0243] I. Conjugation of PK / PD Modulators to RNAi Agents

[0244] One or more lipid PK / PD modulator precursors can be linked to the RNAi agents disclosed herein either before or after annealing, and before or after conjugation of one or more targeting ligands. The following description describes the general conjugation process used to link lipid PK / PD modulator precursors to the constructs shown in the examples depicted herein.

[0245] A. Conjugation of Maleimide-Containing Lipid PK / PD Modulator Precursors

[0246] The following describes the general process used to link maleimide-containing lipid PK / PD modulator precursors to (C6-SS-C6) or (6-SS-6) functionalized sense strands of RNAi agents by dithiothreitol reduction of the disulfide followed by thiol-Michael addition of the respective maleimide-containing lipid PK / PD modulator precursors: In a vial, the functionalized sense strand was dissolved in sterile water at 50 mg / mL. Next, 20 equivalents each of 0.1 M Hepes pH 8.5 buffer and dithiothreitol were added. The mixture was allowed to react for 1 hour, and then the conjugate was precipitated in acetonitrile and PBS, and the solid was centrifuged to pellet.

[0247] The pellet was brought up in a 70 / 30 mixture of DMSO / water at a solid concentration of 30 mg / mL. Then, 1.5 equivalents of maleimide-containing lipid PK / PD modulator precursor was added. The mixture was allowed to react for 30 minutes. The product was purified by AEX-HPLC (mobile phase A: 25 mM Tris pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM Tris pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; solid phase TSKgel-30; 1.5 cm x 10 cm). The solvent was removed by rotary evaporation and desalted on a 3K spin column using 2 x 10 mL exchanges with sterile water. The solid product was dried using lyophilization and stored for later use.

[0248] B. Conjugation of Sulfone-Containing Lipid PK / PD Modulator Precursors

[0249] The functionalized sense strand was dissolved in sterile water at 50 mg / mL in a vial. 20 equivalents of 0.1 M Hepes pH 8.5 buffer and dithiothreitol were then added. The mixture was allowed to react for 1 hour, and the conjugate was then precipitated in acetonitrile and PBS, and the solid was centrifuged to pellet.

[0250] The pellet was placed in a 70 / 30 mixture of DMSO / water at a solid concentration of 30 mg / mL. Then, 1.5 equivalents of sulfone-containing lipid PK / PD modulator precursor was added. The vial was purged with N2 and heated to 40 °C with stirring. The mixture was allowed to react for 1 hour. The product was purified by AEX-HPLC (mobile phase A: 25 mM Tris pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM Tris pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; solid phase TSKgel-30; 1.5 cm × 10 cm). The solvent was removed by rotary evaporation and desalted on a 3K spin column using 2 × 10 mL exchanges with sterile water. The solid product was dried using lyophilization and stored for later use.

[0251] C. Conjugation of Azide-Containing Lipid PK / PD Modulator Precursors

[0252] One molar equivalent of Cu(I)-loaded TG-TBTA resin was weighed into a glass vial. The vial was purged with N2 for 15 minutes. The functionalized sense strand was then dissolved in a separate vial in sterile water at a concentration of 100 mg / mL. Two equivalents of an azide-containing lipid PK / PD modulator precursor (50 mg / mL in DMF) were then added to the vial. TEA, DMF, and water were then added until the final reaction conditions were 33 mM TEA, 60% DMF, and 20 mg / mL of conjugated product. The solution was then transferred via syringe to the vial containing the resin. The N2 purge was removed, the vial was sealed, and the mixture was placed on a stir plate at 40 °C. The mixture was allowed to react for 16 hours. The resin was removed by filtration using a 0.45 μm filter.

[0253] The product was purified using AEX purification (mobile phase A: 25 mM Tris pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM Tris pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile solid phase TSKgel-30; 1.5 cm x 10 cm). The acetonitrile was removed using a rotary evaporator and desalted on a 3K spin column using 2 x 10 mL exchanges with sterile water. The solid product was dried using lyophilization and stored for later use.

[0254] D. Conjugation of Alkyne-Containing Lipid PK / PD Modulator Precursors

[0255] The following describes a general process used to link activated alkyne-containing lipid PK / PD modulator precursors to a (C6-SS-C6) or (6-SS-6)-functionalized sense strand of an RNAi agent by dithiothreitol reduction of the disulfide followed by addition to the alkyne-containing PK / PD modulator precursor: 10 mg of siRNA containing a (C6-SS-C6) or (6-SS-6)-functionalized sense strand was dissolved in sterile water at 50 mg / mL in a vial. Next, 20 equivalents each of 0.1 M Hepes pH 8.5 buffer and dithiothreitol (1 M in sterile water) were added. The mixture was reacted for 1 hour and then purified on an XBridge BEH C4 column using a mobile phase A of 100 mM HFIP, 14 mM TEA, and acetonitrile as mobile phase B, using the following formula (where %B indicates the amount of mobile phase B, while the remainder is mobile phase A). [Table 46]

[0256] The product was precipitated once by adding 12 mL of acetonitrile and 0.4 mL of 1x PBS, and the resulting solid was centrifuged to pellet. The pellet was redissolved in 0.4 mL of 1x PBS and 12 mL of acetonitrile. The pellet was dried under high vacuum for 1 hour.

[0257] The pellet was placed in a vial containing a 70 / 30 mixture of DMSO / water at a solid concentration of 30 mg / mL. Next, an alkyne-containing lipid PK / PD modulator precursor was added at 2 equivalents relative to the siRNA. Next, 10 equivalents of TEA were added. The vial was purged with N2, and the reaction mixture was heated to 40 °C with stirring. The mixture was allowed to react for 1 hour. The product was purified using anion-exchange HPLC on a 1.5 cm x 10 cm TSKgel-30 packed column with the following composition: mobile phase A: 25 mM Tris pH = 7.2, 1 mM EDTA, 50% acetonitrile; and mobile phase B: 25 mM Tris pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile, with the following composition (where %B indicates the amount of mobile phase B, while the remainder is mobile phase A). [Table 47]

[0258] The product-containing fractions were collected and the acetonitrile was removed using a rotary evaporator. The product was desalted on a 3K spin column using 2 x 10 mL exchanges of sterile water. The product was then dried using lyophilization and stored for later use.

[0259] J. Synthesis of Linker 4 [ka]

[0260] To a solution of compound 1 (3.00 g) in DMF, Cs2CO3 (7.71 g) was added at room temperature. Compound 2 (1.85 mL) was then added slowly. The reaction was stirred overnight under N2 (g). LC-MS then confirmed nearly complete conversion to the desired product. The reaction mixture was quenched with NaHCO3 (10 mL). The product was extracted with EtOAc (5 × 10 mL) and then washed with water (3 × 8 mL) and brine (8 mL). The combined organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient from hex to EtOAc (0-30%), where the product eluted at 14% B. The product was concentrated in vacuo to give a white solid. LC-MS: calculated [M+H]+ 191.06 m / z, found 191.23 m / z. [ka]

[0261] To a 1:1 THF / water solution of compound 1 (2.87 g) was added LiOH (1.08 g) at room temperature under normal atmosphere. The reaction was stirred until complete conversion was observed by LC-MS. The remaining starting material was extracted with EtOAc, and the aqueous phase was then acidified with 6 N HCl to a pH of approximately 3. The product crashed out as a white solid, filtered under vacuum, and washed with water. Due to its moist / sticky nature, solvent was required to transfer the solid to a round-bottom flask; the material was transferred with MeOH and DCM. Due to insufficient solvation in either solution and the combination, the material could not be dried with NaSO and, correspondingly, was simply concentrated under vacuum to give a white, fluffy, crystalline solid. No isolation was required. LC-MS: calculated [M+H]+ 177.05 m / z, found 177.19 m / z. [ka]

[0262] To a solution of compounds 1 (1.00 g) and 2 (1.04 g) in DMF (10.0 mL) was added EDC (1.20 g) at room temperature under N2 (g). The reaction mixture was stirred until complete conversion was observed by LC-MS. Since no product could be successfully observed after overnight stirring, the reaction mixture was quenched with NaHCO3, which was followed by rapid precipitation. The precipitate, confirmed by LC-MS to contain starting material, was filtered under vacuum, resuspended in MeOH / DCM, and then concentrated under vacuum. The mixture was then resolvated in DMF, dried over Na2SO4, filtered under vacuum, and rinsed with DMF. EDC was added back to the filtrate (reaction mixture), and the mixture was stirred overnight at room temperature. The reaction mixture was directly concentrated and azeotroped with MeOH and PhMe for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase and eluted with a gradient of DCM to 20% MeOH / DCM (0-15% B). The product eluted at 0% B to give a white solid. LC-MS: calculated [M+H]+ 325.04 m / z, found 325.35 m / z. Example 2 hDMPK-GLuc AAV mouse model

[0263] To evaluate certain DMPK RNAi agents, we used a DMPK-GLuc (Gaussia luciferase) AAV (adeno-associated virus) mouse model. Six- to eight-week-old male C57BL / 6 mice were transduced with DMPK-GLuc AAV serotype 8, administered at least 14 days before administration of the DMPK RNAi agent or control. Two types of DMPK-GLuc AAV were used. The genome of the first DMPK-GLuc AAV contains the 548-1918 region of the human DMPK cDNA sequence (GenBank NM_001081563.2) inserted into the 3' UTR of the GLuc reporter gene sequence. The genome of the second DMPK-GLuc AAV contains the 1891-3243 region of the human DMPK cDNA sequence (GenBank NM_001081563.2) inserted into the 3' UTR of the GLuc reporter gene sequence. Mice were injected via the tail vein with 4.8E12 to 5.0E12 GC / kg of each virus in PBS in a total volume of 10 mL / kg (animal body weight) to generate hDMPK-GLuc AAV model mice. Inhibition of DMPK expression by the DMPK RNAi agent resulted in a concomitant inhibition of GLuc expression, which was measured. Prior to treatment administration (between day -7 and day 1 before administration), GLuc expression levels were measured in serum using the Pierce™ Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific), and mice were grouped according to their average GLuc levels.

[0264] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the mandibular region into serum separator tubes (Sarstedt AG & Co., Nuembreech, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. The tubes were centrifuged at 8,000 × g for 3 minutes to separate serum, which was then stored at 4°C. Serum was collected and measured using the Pierce™ Gaussia Luciferase Glow Assay Kit according to the manufacturer's instructions. To account for non-treatment-related shifts in DMPK expression in this model, serum GLuc levels for each animal were normalized to a control group of mice injected with a vehicle control. To do this, the GLuc level for each animal at a given time point was first divided by the pre-treatment level of expression in that animal (day 1) to determine the "normalized to pre-treatment" expression ratio. Expression at a particular time point was then normalized to the control group by dividing the "normalized to pre-treatment" ratio for an individual animal by the average "normalized to pre-treatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pre-treatment levels.

[0265] To evaluate the activity of DMPK RNAi agents in the DMPK-AAV model described in the Examples below, certain DMPK RNAi agents were conjugated to an N-acetyl-galactosamine-containing targeting ligand with a chemical structure designated NAG37 (see Table 6.3). NAG37 is known to have high affinity for binding to the asialoglycoprotein receptor, which is abundantly expressed on the surface of liver cells, including hepatocytes (see, e.g., International Patent Application Publication No. WO2018044350A1). The use of the NAG37-conjugated DMPK RNAi agent was to evaluate AAV-DMPK expression in the liver. Example 3 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0266] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 2.0 mg / kg (mpk), 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent used as a control, according to Table 7 below.

[0267] [Table 7-1] [Table 7-2]

[0268] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0269] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 8 below.

[0270] [Table 8-1] [Table 8-2]

[0271] DMPK RNAi agents in groups 2-4 and 5-11 showed a reduction in DMPK-AAV compared to saline control (group 1) on day 8, a reduction for all groups on day 15, and a reduction for all groups on day 22. Group 9 showed particularly robust knockdown at 2.0 mg / kg on day 22. Additionally, a dose response for the DMPK RNAi agent AD09699 was observed. Example 4 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0272] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 1.0 mg / kg (mpk), 2.0 mg / kg (mpk), 4.0 mg / kg (mpk) of a DMPK RNAi agent, or saline without a DMPK RNAi agent, used as a control, according to Table 9 below.

[0273] [Table 9-1] [Table 9-2]

[0274] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0275] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 10 below.

[0276] [Table 10-1] [Table 10-2]

[0277] DMPK RNAi agents in groups 2, 3, 4, 9, 10, and 12 showed a reduction in DMPK-AAV compared to saline control (group 1) on day 8, a reduction for groups 2, 3, 5, 9, 10, and 12 on day 15, and a reduction for groups 2, 5, 7, 10, and 12 on day 22. Example 5 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0278] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 1.0 mg / kg (mpk), 3.0 mg / kg (mpk), 5.0 mg / kg (mpk) of a DMPK RNAi agent, or saline without a DMPK RNAi agent used as a control, according to Table 11 below.

[0279] [Table 11-1] [Table 11-2]

[0280] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0281] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 12 below.

[0282] [Table 12-1] [Table 12-2]

[0283] The DMPK RNAi agents in each of the treatment groups (i.e., groups 2 through 12) showed a reduction in DMPK-AAV compared to the saline control (group 1) across all time points measured, with AD09699 showing greater knockdown at higher doses (i.e., a dose response). Example 6 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0284] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 3.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 13 below.

[0285] [Table 13-1] [Table 13-2]

[0286] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0287] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 14 below.

[0288] [Table 14-1] [Table 14-2]

[0289] The DMPK RNAi agents in each of the treatment groups (i.e., groups 2 through 14) showed a reduction in DMPK-AAV compared to the saline control (group 1) across all time points. Groups 6 and 9 showed greater than 40% knockdown at day 22. Example 7 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0290] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 3.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 15 below.

[0291] [Table 15]

[0292] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0293] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 16 below.

[0294] [Table 16-1] [Table 16-2]

[0295] The DMPK RNAi agents in each of the treatment groups (i.e., groups 2 through 11) showed a reduction in DMPK-AAV compared to the saline control (group 1) on days 8 and 22. The DMPK RNAi agents in groups 2 through 8, 10, and 11 showed a reduction in DMPK-AAV compared to the saline control (group 1) on day 15. Group 5 showed particularly robust (>50%) knockdown on days 15 and 22. Example 8 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0296] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 4.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 17 below.

[0297] [Table 17]

[0298] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0299] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 18 below.

[0300] [Table 18-1] [Table 18-2]

[0301] The DMPK RNAi agents in each of the treatment groups (i.e., groups 2 through 14) showed a reduction in DMPK-AAV compared to the saline control (group 1) across all time points. Groups 2 and 13 averaged greater than 50% knockdown at day 15. Example 9 In vivo testing of DMPK RNAi agents in cynomolgus monkeys.

[0302] Cynomolgus monkeys were weighed and administered the RNAi agent by intravenous injection on day 1. Muscle biopsies were collected on days -14 (before treatment), 29, and 57. At each time point, cynomolgus monkey study animals were fasted overnight (at least 12 hours but not more than 18 hours). Animals were dosed according to Table 19.

[0303] [Table 19]

[0304] Individual doses were calculated based on body weight recorded on each dosing day. Test articles were administered as a single intravenous (iv) injection using the cephalic vein. The IV injection volume was administered gradually over 1 minute. The cephalic vein was selected and prepared, and a 0.5 ml saline flush was administered immediately prior to IV administration and a 1.0 ml saline flush was administered after test article administration.

[0305] Muscle biopsies were collected while study animals were sedated. Animals were sedated using Telazol (4-6 mg / kg) and supplemented with ketamine (approximately 5 mg / kg) as needed to maintain an adequate level of sedation. Biopsy collection included at least 100 mg each from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, and 57. Biopsies were collected from alternate limbs. Biopsies collected on days -14 and 57 were collected from sites 1-2 cm apart. Table 20 shows mRNA expression samples from cynomolgus monkey quadriceps. Table 21 shows mRNA expression samples from cynomolgus monkey triceps. Cynomolgus monkey DMPK mRNA expression was quantified by probe-based quantitative PCR and normalized to day -14 pre-treatment for each study group (geometric mean, + / - geometric SD).

[0306] [Table 20]

[0307] [Table 21-1] [Table 21-2]

[0308] As shown in Tables 20 and 21 above, the DMPK RNAi agents demonstrated inhibition in both the quadriceps and triceps muscles, demonstrating their ability to silence DMPK expression in non-human primates. More specifically, the RNAi agent AC001890 achieved approximately 84% inhibition at 20 mg / kg in the triceps muscle on day 29. Example 10 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0309] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 3.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 22 below.

[0310] [Table 22]

[0311] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0312] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 23 below.

[0313] [Table 23-1] [Table 23-2]

[0314] The DMPK RNAi agents in each of the treatment groups (i.e., Groups 2 to 11) demonstrated a reduction in DMPK-AAV compared to the saline control (Group 1) across all time points. More specifically, AD10875 achieved approximately 51% inhibition at 3.0 mg / kg on Day 22. Example 11 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0315] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 2.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 24 below.

[0316] [Table 24]

[0317] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0318] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 25 below.

[0319] [Table 25-1] [Table 25-2]

[0320] DMPK RNAi agents in groups 2, 3, 4, 5, 6, 7, 11, and 12 showed a reduction in DMPK-AAV compared to saline control (group 1) on day 8, on day 15 for groups 2, 3, and 11, and on day 22 for groups 2, 4, 6, 11, and 12. Example 12 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0321] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 1.0 mg / kg (mpk), 2.0 mg / kg (mpk), or 4.0 mg / kg (mpk) of a DMPK RNAi agent, according to Table 26 below, or saline without a DMPK RNAi agent, used as a control.

[0322] [Table 26-1] [Table 26-2]

[0323] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0324] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 27 below.

[0325] [Table 27-1] [Table 27-2]

[0326] The DMPK RNAi agents in each of the treatment groups (i.e., Groups 2 through 12) showed a reduction in DMPK-AAV compared to the saline control (Group 1) across all measurement time points, except for Group 10 on Days 15 and 22. More specifically, AD09721 achieved approximately 56% inhibition at 4.0 mg / kg on Day 8. Example 13 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0327] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 4.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 28 below.

[0328] [Table 28-1] [Table 28-2]

[0329] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0330] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 29 below.

[0331] [Table 29-1] [Table 29-2]

[0332] DMPK RNAi agents in Groups 2, 3, 4, 5, and 6 showed a reduction in DMPK-AAV compared to saline control (Group 1) across at Day 8, a reduction for Groups 2, 3, 5, 6, 8, and 11 at Day 15, and a reduction for Groups 2, 3, 6, 8, and 11 at Day 22. Example 14 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0333] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 3.0 mg / kg (mpk), 6.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent used as a control, according to Table 30 below.

[0334] [Table 30-1] [Table 30-2]

[0335] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0336] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 31 below.

[0337] [Table 31-1] [Table 31-2]

[0338] The DMPK RNAi agents in each of the treatment groups (i.e., Groups 2 to 13) demonstrated a reduction in DMPK-AAV compared to the saline control (Group 1) across all time points. More specifically, AD11953 achieved approximately 69% inhibition at 6.0 mg / kg on Day 15. Example 15 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0339] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 2.0 mg / kg (mpk), 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent used as a control, according to Table 32 below.

[0340] [Table 32-1] [Table 32-2]

[0341] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0342] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 33 below.

[0343] [Table 33-1] [Table 33-2]

[0344] The DMPK RNAi agents in each of the treatment groups (i.e., Groups 2 to 11) demonstrated a reduction in DMPK-AAV compared to the saline control (Group 1) across all time points. More specifically, AD10560 achieved approximately 71% inhibition at 4.0 mg / kg on Day 22. Example 16 In vivo testing of DMPK RNAi agents in DMPK-AAV mice.

[0345] The DMPK-AAV mouse model described above in Example 2 was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl per 25 g of body weight containing either 3.0 mg / kg (mpk) of a DMPK RNAi agent or saline without a DMPK RNAi agent used as a control, according to Table 34 below.

[0346] [Table 34-1] [Table 34-2]

[0347] Serum was collected on days 1, 8, 15, and 22, and a Gaussia luciferase glow assay was performed to quantify GLuc expression levels. GLuc expression at a particular time point was then normalized to the control group by dividing the "normalized to pretreatment" ratio for an individual animal by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Instead, serum GLuc levels for each animal were assessed simply by normalizing to pretreatment levels.

[0348] Four mice were examined in each group (n=4). DMPK expression levels were determined according to the procedure described above. The data obtained from the experiment are shown in Table 35 below.

[0349] [Table 35-1] [Table 35-2]

[0350] The DMPK RNAi agents in each of the treatment groups showed a reduction in DMPK-AAV compared to saline controls on days 8 and 22, and for all groups except group 3 on day 15. More specifically, AD11670 achieved approximately 43% inhibition at 3.0 mg / kg on day 8. Example 17 TREDT960I / HSA-rtTA mouse model

[0351] To evaluate DMPK RNAi agents in vivo, we used a transgenic model of myotonic dystrophy type 1. TREDT960I (FVB / NJ-Tg(tetO-DMPK*)A2352Coop / J) was commercially obtained and crossed with HSA-rtTA mice (B6;C3-Tg(ACTA1-rtTA,tetO-cre)102Monk / J) from Jackson Laboratories (JAX) to generate homozygous offspring expressing human DMPK exons 11–15, the UTR, and 960 interrupted CTG repeats in skeletal muscle after tetracycline administration.

[0352] TREDT960I Mouse Background: TREDT960I mice were generated using standard techniques on an FVB background. The TREDT960I transgene contains a human genomic segment containing exons 11-15 of DMPK with 960 interrupted CTG repeats at the repeat's natural site. Each interrupted CTG repeat contains 20 CTGs separated by a 5-nucleotide spacer formed by ligation of SalI and XhoI restriction sites. Additionally, the transgene contains 307 bp of the DMPK 3' flanking region, which contains the natural polyadenylation signal, as well as two copies of the cHS4 insulator flanking the 5' and 3' ends of the expression construct to prevent chromosomal insertion site effects. The mutant DMPK gene is under the direction of the tetO (tet-responsive element) promoter. The transgenic construct was microinjected into the pronuclei of FVB / NJ fertilized eggs. The TREDT960I transgenic founder line A2352 was subsequently established and maintained for at least 20 generations in the FVB / NJ background.

[0353] Because this mutant DMPK construct is under the direction of the tetO promoter, expression is determined by which tissue(s) express the tetracycline transactivator (rtTA). When bred to mice that express rtTA in a particular tissue, the resulting offspring will have the DMPK transgene expressed in that tissue in the presence of tetracycline.

[0354] HSA-rtTA / TRE-Cre Mouse Background: HSA-rtTA / TRE-Cre mice. These transgenic mice possess a tetracycline (doxycycline)-inducible Cre-mediated recombination system specific for skeletal muscle myocytes. To achieve this, a transgenic construct containing cre, a cre recombinase under the control of tetO, a tetracycline-responsive regulatory element, and a second transgenic construct containing rtTA, a reverse tetracycline-controlled transactivator, under the control of human ACTA1, actin alpha 1, were co-injected into fertilized (C57BL / 6 x C3H)F2 mouse eggs and then backcrossed to C57BL / 6J for three generations.

[0355] Progeny obtained from mating TREDT960I and HSA-rtTA / TRE-Cre mice used in studies supporting this application were either bi-transgenic homozygous for the TREDT960I transgene and hemizygous HSA-rtTA / TRE-Cre, or homozygous TREDT960I and non-carriers for HSA-rtTA / TRE-Cre. Cre-recombinase expression had no effect on transgene expression in TREDT960I animals and was considered an inactive by-product of the model.

[0356] Doxycycline induction of DMPK expression: Doxycycline, a stable antibiotic of the tetracycline class, was administered to animals via a rodent chow supplemented with doxycycline. In some studies, doxycycline administration began at birth (via lactating females fed a rodent chow supplemented with doxycycline) and continued until weaning. Animals were then fed ad libitum until termination, unless the doxycycline-supplemented rodent chow was replaced with a standard rodent chow as part of the study procedures. The doxycycline-supplemented chow contained 2 grams of doxycycline hyclate per kilogram of rodent chow. In some studies, doxycycline administration did not begin until 4 weeks before the start of the study, at which time the standard rodent chow was replaced with a doxycycline-supplemented rodent chow as part of the study procedures. The doxycycline-spiked chow contained 2 grams of doxycycline hyclate per kilogram of rodent diet.

[0357] Body weight assessment: Body weights were recorded on all RNAi agent administration days and on the day of tissue collection. Body weights were normalized to the mean body weight on the first day of tamoxifen administration and either a homozygous TREDT960I / HSA-rtTA / TRE-Cre non-carrier control group or a homozygous TREDT960I transgene / hemizygous HSA-rtTA / TRE-Cre control group fed a standard rodent diet (without doxycycline) and administered saline (containing no RNAi agent).

[0358] Tissue collection: Mice were anesthetized with 3-4% isoflurane and euthanized by exsanguination. Tissues intended for gene expression analysis were collected, snap-frozen in liquid nitrogen, and subsequently stored at -80°C. Tissues intended for histological examination were fixed in formalin, embedded in paraffin wax, and stained using histochemical or immunohistochemical protocols.

[0359] Gene expression analysis: Whole frozen tissues were homogenized using a tissue homogenization system (Precellys), and RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction. The extracted RNA was used to synthesize complementary DNA using the SuperScript™ VILO™ cDNA Synthesis Kit (Thermo). Gene expression was measured using either a QX200 droplet digital PCR (Bio-Rad) or QuantFlex7 qRT-PCR (Applied Biosystems) system with Taqman primer / probe sets (Thermo-Fisher) designed to detect the gene of interest. Gene expression was normalized to the mean of doxycycline-induced control groups receiving doxycycline-supplemented rodent chow and saline (containing no RNAi agent).

[0360] Competitive missplicing analysis: Primer sets were designed for transcripts known to be misspliced ​​upon accumulation of mutant DMPK-CUG in muscle cell nuclei. Forward and reverse primers were designed for exons adjacent to exons known to be excluded or included under normal transcript splicing conditions and that are misspliced ​​and incorrectly included or excluded, respectively, upon accumulation of mutant DMPK-CUG transcripts in the nucleus. FAM-labeled probes were designed for junctions between flanking exons that only join when the excluded exon is absent. HEX-labeled probes were designed for the excluded exon. Figure 1 shows a graphical depiction of the primer design.

[0361] Complementary DNA was generated from RNA isolated from collected tissues. For each transcript of interest, a primer set and a mixture of FAM and HEX-labeled probes were used to assay the percentage of mis-spliced ​​transcripts isolated from tissues treated with or without doxycycline and / or RNAi agents. Examples of transcripts of interest include Atp2a1 exon 22, Cacna1 exon 28, Ldb3 exon 8, and Mbnl1 exon 7. Example 18 In vivo testing of DMPK RNAi agents in the TREDT960I / HSA-rtTA mouse model.

[0362] The DMPK TREDT960I / HAS-rtTA mouse model described in Example 17 above was used. On days 1, 8, 15, 22, and 29, each mouse received a single intravenous (iv) injection of 200 μl per 20 g of body weight containing either 20.0 mg / kg (mpk), 40.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent used as a control. The dosing groups are shown in Table 36 below. Eight mice (n=8) were injected per group, with each group containing four male and four female mice.

[0363] Test groups were also fed either normal or doxycycline-supplemented rodent diet chow. All animals were maintained on doxycycline chow from the time of receipt until the start of the study. At the start of the study, Group 1 was switched to normal chow, while all other groups remained on doxycycline chow.

[0364] On day 36, tissues were harvested. Tibialis anterior (TA), triceps (Tri), and gastrocnemius (Gas) muscle tissues were collected using transverse and longitudinal / oblique sections. Tissue samples were processed for RNAscope staining of CUG-(ISH) / mouse MBNL1 (Ab) and DMPK. Tissue samples were then processed for RNA isolation and cDNA generation. Quantitative polymerase chain reaction (qPCR) analysis was then performed for human DMPK and mouse Arl1, and mis-splicing analysis of mSerca1 (Atp2A1), mMbnl1, mCac1.1 (Cacna1), and mLdb3.

[0365] [Table 36]

[0366] Figure 2 shows the relative hDMPK transcript levels of the test groups. hDMPK transcript levels are shown normalized to Group 2. Figure 2 shows that introduction of AC002324 inhibits hDMPK transcript levels.

[0367] Figures 3 to 7 show the relative missplicing of mCacna1, mLdb3, mMbnl1, and mAtp2a1 in the test groups. Relative missplicing levels are normalized to Group 2. Figures 3 to 6 show that introduction of the DMPK RNAi agent AC002324 prevents splicing of these measured genes.

[0368] For Figures 2 to 6, statistical significance is expressed as follows: * is p<0.05, ** is p<0.01, *** is p<0.001, **** is p<0.0001. Example 19 In vivo testing of DMPK RNAi agents in cynomolgus monkeys.

[0369] Cynomolgus monkey study animals were weighed and dosed by intravenous injection on Day 1. Muscle biopsies were collected on Days -14 (pre-treatment), 29, and 57. At each time point, cynomolgus monkey study animals were fasted overnight (at least 12 hours but not more than 18 hours). Animals were dosed according to Table 37.

[0370] [Table 37]

[0371] Individual doses were calculated based on body weight recorded on each dosing day. Test articles were administered as a single intravenous (iv) injection using the cephalic vein. For Groups 1-3, the IV injection volume was administered gradually over 1 minute. The cephalic vein was selected and prepared, and a 0.5 ml saline flush was administered immediately prior to IV administration and a 1.0 ml saline flush was administered after test article administration.

[0372] Muscle biopsies were collected during the sedation procedure. Animals were sedated using Telazol (4-6 mg / kg) and supplemented with ketamine (approximately 5 mg / kg) as needed to maintain an adequate level of sedation. Biopsy collection included at least 100 mg each from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternate limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1-2 cm apart. Table 38 shows mRNA expression samples from cynomolgus monkey quadriceps. Table 39 shows mRNA expression samples from cynomolgus monkey triceps. Cynomolgus monkey DMPK mRNA expression was quantified by probe-based quantitative PCR and normalized to day -14 pre-treatment for each test group (geometric mean, + / - geometric SD).

[0373] [Table 38]

[0374] [Table 39]

[0375] As shown in Tables 38 and 39 above, the DMPK RNAi agents demonstrated inhibition in both quadriceps and triceps, demonstrating their ability to silence DMPK expression in non-human primates. More specifically, RNAi agent AC002691 achieved approximately 89% inhibition at 10 mg / kg in triceps on day 29 and approximately 88% inhibition at 10 mg / kg in triceps on day 85. Example 20 In vivo testing of DMPK RNAi agents in cynomolgus monkeys.

[0376] Cynomolgus monkey study animals were weighed and dosed by subcutaneous (SQ) route of injection on Day 1 (for Group 1) and Days 1 and 29 (for Group 2). Muscle biopsies were collected on Days -14 (pre-treatment), 29, 57, and 85. Animals were dosed according to Table 40.

[0377] [Table 40]

[0378] Individual doses were calculated based on body weights recorded on each dosing day. Test articles were administered as a single subcutaneous (SQ) injection in the mid-scapular region on Day 1 for Group 1 and Days 1 and 29 for Group 2. Prior to injection, the injection site was shaved and prepared per standard safety procedures.

[0379] Muscle biopsies were collected during the sedation procedure. Animals were sedated using Telazol (5-8 mg / kg) and supplemented with ketamine (approximately 5 mg / kg) as needed to maintain an adequate level of sedation. Biopsy collection included at least 100 mg each from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternate limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1-2 cm apart. Table 41 shows mRNA expression samples from cynomolgus monkey quadriceps. Table 42 shows mRNA expression samples from cynomolgus monkey triceps. Cynomolgus monkey DMPK mRNA expression was quantified by probe-based quantitative PCR and normalized to day -14 pre-treatment for each test group (geometric mean, + / - geometric SD).

[0380] [Table 41-1] [Table 41-2]

[0381] [Table 42]

[0382] As shown in Tables 41 and 42 above, AC002691 demonstrated its ability to silence DMPK expression in non-human primates, showing significant inhibition in both quadriceps and triceps muscles that persisted to at least day 85. More specifically, RNAi agent AC002691 achieved approximately 90% inhibition at 10 mg / kg in triceps muscles at day 29 and approximately 87% inhibition at 10 mg / kg in quadriceps muscles at day 85. Example 21 In vivo testing of DMPK RNAi agents in cynomolgus monkeys.

[0383] Cynomolgus monkey study animals were weighed and dosed by intravenous (IV) injection on Days 1 and 29 (for Groups 1-3). Muscle biopsies and blood were collected on Days -14 (pre-treatment), 29, 57, and 85 for Groups 1-3. Animals were dosed according to Table 43.

[0384] [Table 43]

[0385] Individual doses were calculated based on body weights recorded on each dosing day. Test articles were administered as a single intravenous (IV) injection on days 1 and 29 for Groups 1-3. Prior to injection, the injection site was shaved and prepared according to standard safety procedures.

[0386] Muscle biopsies were collected during the sedation procedure. Animals were sedated using Telazol (5–8 mg / kg), supplemented with ketamine (approximately 5 mg / kg) if necessary to maintain an adequate level of sedation.

[0387] Group 1-3 muscle biopsy collections included at least 100 mg each from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternate limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1-2 cm apart. Table 44 shows mRNA expression sampled from cynomolgus monkey quadriceps. Table 45 shows mRNA expression sampled from cynomolgus monkey triceps. Cynomolgus monkey DMPK mRNA expression was quantified by probe-based quantitative PCR and normalized to day -14 pre-treatment for each test group (geometric mean, + / - geometric SD).

[0388] [Table 44-1] [Table 44-2]

[0389] [Table 45]

[0390] As shown in Tables 44 and 45 above, AC002691 demonstrated its ability to silence DMPK expression in non-human primates, showing significant inhibition in both quadriceps and triceps muscles that persisted to at least day 85. More specifically, RNAi agent AC002691 achieved approximately 93% inhibition in triceps at 10.0 mg / kg on day 29 and approximately 90% inhibition in quadriceps at 5.0 mg / kg on day 29.

[0391] Other embodiments Although the present invention has been described in conjunction with the detailed description thereof, it is to be understood that the foregoing description is intended to illustrate, but not limit, the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. i. an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences presented in Table 2, Table 3, or Table 5.4; ii. a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; 1. An RNAi agent for inhibiting expression of the DM1 protein kinase (DMPK) gene, comprising:

2. 2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences presented in Table 2, Table 3, or Table 5.

4.

3. 3. The RNAi agent of Claim 1 or Claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences presented in Table 2, Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.5, and wherein the sense strand has a region of at least 85% complementarity to the antisense strand over the 17 contiguous nucleotides.

4. The RNAi agent of any one of claims 1 to 3, wherein at least one nucleotide of the DMPK RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1 to 3, wherein all or substantially all of the nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4 to 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

7. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

8. The RNAi agent of any one of claims 1 to 7, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences presented in Table 3.

9. 9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences presented in Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.

5.

10. 2. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences presented in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences presented in Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.

5.

11. The RNAi agent of any one of claims 1 to 10, which is linked to a targeting ligand.

12. The RNAi agent of claim 11 , wherein the targeting ligand is linked to the sense strand.

13. The RNAi agent of claim 12, wherein the targeting ligand is linked to the 5'-terminal end of the sense strand.

14. The RNAi agent of any one of claims 11 to 13, wherein the targeting ligand has affinity for skeletal muscle cells and / or for a cellular receptor expressed on skeletal muscle cells.

15. the targeting ligand is 【Table 48-1】 【Table 48-2】 【Table 48-3】 【Table 48-4】 【Table 48-5】 【Table 48-6】 【Table 48-7】 or a pharmaceutically acceptable salt thereof, 【Chemistry 46】 indicates a point of attachment to the RNAi agent.

16. The RNAi agent of any one of claims 1 to 15, further linked to a pharmacokinetic / pharmacodynamic (PK / PD) modulator.

17. The RNAi agent of claim 16 , wherein the PK / PD modulator is linked to the sense strand.

18. The RNAi agent of claim 17 , wherein the PK / PD modulator is linked to the 3′-terminal end of the sense strand.

19. the PK / PD modulator is 【Table 49-1】 【Table 49-2】 【Table 49-3】 【Table 49-4】 【Table 49-5】 【Table 49-6】 or a pharmaceutically acceptable salt thereof, 【Chemistry 47】 indicates a point of attachment to the RNAi agent.

20. the PK / PD modulator is 【Table 50-1】 【Table 50-2】 【Table 50-3】 【Table 50-4】 【Table 50-5】 【Table 50-6】 【Table 50-7】 【Table 50-8】 【Table 50-9】 【Table 50-10】 【Table 50-11】 (In the formula, R Z The RNAi agent of any one of claims 17 to 18, wherein the RNAi agent is selected from the group consisting of:

21. 21. The RNAi agent of any one of claims 1 to 20, wherein the sense strand is 15 to 49 nucleotides in length and the antisense strand is 17 to 30 nucleotides in length.

22. 22. The RNAi agent of claim 21, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

23. 23. The RNAi agent of claim 22, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

24. 24. The RNAi agent of claim 23, having two blunt ends.

25. The RNAi agent of any one of claims 1 to 24, wherein the sense strand comprises one or two terminal caps.

26. The RNAi agent of any one of claims 1 to 25, wherein the sense strand comprises one or two inverted abasic deoxyribose residues.

27. 2. The RNAi agent of claim 1, comprising a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5.1, Table 5.2, Table 5.3, Table 5.4, Table 5.6, or Table 5.

7.

28. 28. The RNAi agent of claim 27, wherein the sense strand further comprises an inverted abasic deoxyribose residue at the 3' end and / or the 5' end of the nucleotide sequence.

29. 29. The RNAi agent of claim 28, wherein all or substantially all of the nucleotides are modified nucleotides.

30. The antisense strand is UCGUAAUACUCCAUGACCAGG (SEQ ID NO: 1507); UUGUAGUGGACGAUCUUGCCA (SEQ ID NO: 1457); and UAGACAAUAAAUACCGAGGAA (SEQ ID NO: 1468) 30. The RNAi agent of any one of claims 1 to 29, comprising, consisting of, or consisting essentially of a nucleobase sequence that differs by 0 or 1 nucleotide from a sequence selected from the group consisting of:

31. 32. The RNAi agent of claim 31 , wherein all or substantially all of the nucleotides are modified nucleotides.

32. The antisense strand is cPrpusCfsGfuAfauacUfcCfaUfgAfccagsg (SEQ ID NO: 757); cPrpusUfsgsuAfguggacGfaUfcUfugccsa (SEQ ID NO: 759); and cPrpusAfsgacaauaAfaUfaCfcGfaggasa (SEQ ID NO: 724); 32. The RNAi agent of any one of claims 1-31, comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by zero or one nucleotide from a nucleotide sequence selected from the group consisting of: (wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; and s represents a phosphorothioate linkage).

33. the sense strand is CCUGGUCAUGGAGUAUUACGA (SEQ ID NO: 1579); UGGCAAGAUCGUCCACUACAA (SEQ ID NO: 1525); and UUCCUCGGUAUUUAUUGUCUA (SEQ ID NO: 1543) 33. The RNAi agent of any one of claims 1 to 32, comprising, consisting of, or consisting essentially of a nucleobase sequence that differs by 0 or 1 nucleotide from a sequence selected from the group consisting of:

34. the sense strand is ccuggucaUfgGfAfguauuacga (SEQ ID NO: 1162); uggcaagaUfcGfuccacuacaa (SEQ ID NO: 1127); and uuccucggUfaUfUfuauugucua (SEQ ID NO: 1130); 34. The RNAi agent of any one of claims 1-33, comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by zero or one nucleotide from a nucleotide sequence selected from the group consisting of: (wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine).

35. (i) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence cPrpusCfsGfuAfauacUfcCfaUfgAfccagsg (SEQ ID NO:757); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence ccuggucaUfgGfAfguauuacga (SEQ ID NO:1162); (ii) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence cPrpusUfsgsuAfguggacGfaUfcUfugccsa (SEQ ID NO:759); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence uggcaagaUfcGfuccacuacaa (SEQ ID NO:1127); or (iii) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence cPrpusAfsgacaauaAfaUfaCfcGfaggasa (SEQ ID NO: 724); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence uuccucggUfaUfUfuauugucua (SEQ ID NO: 1130).

35. The RNAi agent of any one of claims 1 to 34, comprising: (wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; and s represents a phosphorothioate linkage.

36. 30. The RNAi agent of any one of claims 27-29, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

37. 37. The RNAi agent of claim 36, wherein the targeting ligand has affinity for a cellular receptor expressed on skeletal muscle cells.

38. 38. The RNAi agent of any one of claims 36-37, wherein the targeting ligand comprises a compound having a structure shown in Table 6.2 or Table 6.

3.

39. The RNAi agent of any one of claims 1 to 38, which is a pharmaceutically acceptable salt.

40. 40. The RNAi agent of claim 39, which is a sodium salt.

41. 40. A pharmaceutical composition comprising the RNAi agent of any one of claims 1 to 39, wherein the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

42. A method for inhibiting expression of the DMPK gene in a cell, comprising the step of introducing into the cell an effective amount of an RNAi agent described in any one of claims 1 to 39 or a pharmaceutical composition described in claim 41.

43. 43. The method of claim 42, wherein the cell is in a subject.

44. 44. The method of claim 43, wherein the subject is a human subject.

45. The method of any one of claims 42 to 44, wherein the DMPK gene expression is inhibited by at least about 40%.

46. The method of any one of claims 42 to 45, wherein the DMPK protein level is reduced by at least about 40%.

47. The method of any one of claims 42 to 46, wherein the mutant DMPK protein level is reduced by at least 40%.

48. A method for treating one or more symptoms or diseases that can be alleviated at least in part by reducing DMPK protein levels and / or reducing DMPK mRNA levels, comprising administering a therapeutically effective amount of the pharmaceutical composition described in claim 41 to a human subject in need thereof.

49. 49. The method of claim 48, wherein the disease is myotonic dystrophy type 1.

50. 50. The method of any one of claims 42 to 49, wherein the DMPK gene expression is reduced in one or more of the paraspinal, facial, trunk, abdominal and limb musculature of the subject.

51. 51. The method of any one of claims 42-50, wherein the DMPK gene expression is reduced in one or more of the subject's triceps, biceps, quadriceps, gastrocnemius, soleus, EDL (extensor digitorum longus), TA (tibialis anterior), or diaphragm.

52. 52. The method of any one of claims 42-51, wherein the RNAi agent is administered at a dose of about 0.5 mg / kg body weight to about 10.0 mg / kg body weight.

53. 53. The method of claim 52, wherein the RNAi agent is administered by subcutaneous (SQ) injection.

54. 42. The RNAi agent of any one of claims 1 to 40 or the pharmaceutical composition of claim 41 for use in the treatment of a disease, disorder or condition mediated at least in part by a reduction in DMPK protein levels or a reduction in DMPK mRNA levels, or both.

55. 42. The pharmaceutical composition of claim 41 for use in the manufacture of a medicament for the treatment of a disease, disorder or condition mediated at least in part by reduced DMPK protein levels or reduced DMPK mRNA levels or both.

56. 1. A composition for inhibiting expression of the DM1 protein kinase (DMPK) gene, comprising: i. an RNAi agent comprising an antisense strand 18-49 nucleotides in length that is at least partially complementary to a portion of SEQ ID NO:1; ii. a targeting ligand linked to the RNAi agent, wherein the targeting ligand has affinity for skeletal muscle cells; iii. a PK / PD modulator linked to the RNAi agent; A composition comprising:

57. i. a sense strand comprising a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from a stretch of 15 contiguous nucleotides of SEQ ID NO: 1; ii. an antisense strand comprising a nucleotide sequence that is at least partially complementary to the sense strand; 1. An RNAi agent for inhibiting expression of the DM1 protein kinase (DMPK) gene, comprising:

58. i. an antisense strand comprising a nucleotide sequence comprising at least 15 consecutive nucleotides that are at least partially complementary to a stretch of 15 consecutive nucleotides of SEQ ID NO: 1; ii. a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; 1. An RNAi agent for inhibiting expression of the DM1 protein kinase (DMPK) gene, comprising: