Bladder cancer detection reagent kit and detection method

Abstract

The present invention discloses a reagent kit and method for detecting bladder cancer. The reagent kit includes a DHFR PCR reaction mixture, Twist1 and TSC21 PCR reaction mixtures, a point mutation positive control, a methylation positive control, and a negative control. The present invention detects point mutations in the DHFR gene and the methylation levels in the promoter regions of the TSC21 and Twist1 genes in a sample, thereby achieving combined detection of gene point mutations and methylation and determining whether or not a sample has become cancerous. The present invention is easy to operate, simple to use, has high detection sensitivity, and good specificity, and is therefore of great significance in the detection of bladder cancer.

Description

[Technical Field]

[0001] The present invention relates to the technical field of biomedical testing, and more particularly to a reagent kit for detecting bladder cancer and a method for detecting bladder cancer. [Background technology]

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system, with approximately 80,000 new cases and approximately 33,000 deaths, both of which rank it 13th among malignant tumors. Furthermore, the incidence and mortality rates in men are significantly higher than in women, making it the second-highest incidence rate among genitourinary malignant tumors in men. In recent years, both the incidence and mortality rates of bladder cancer in Japan have been on the rise, making prevention and control a crucial issue. Globally, there are approximately 550,000 new cases and 200,000 deaths each year. Approximately 80% of bladder cancer patients have non-muscle-invasive bladder cancer (NMIBC), which is not life-threatening. However, after surgery, 70% of patients experience tumor recurrence, and 15% experience progression to advanced disease stage and malignancy. Therefore, bladder cancer patients typically require multiple re-examinations and intravesical instillation therapy after surgery, which can be costly.

[0003] The "Chinese Guidelines for the Diagnosis and Treatment of Bladder Cancer" and "Chinese Guidelines for the Diagnosis and Treatment of Urological and Andrological Diseases (2019 Edition)," published in 2021 by the Chinese Medical Association Urological Surgery Section (CUA), the Chinese Medical Association Urological Surgeons Section (CUDA), and the Chinese Anti-Cancer Association Urological and Male Reproductive Tumor Specialist Committee (CACA-GU), point out that detecting DNA methylation, the most common form of epigenetic modification in tumors, holds great promise for molecular tumor diagnosis. Furthermore, PCR detection of urinary DNA methylation sites specific to bladder cancer has been shown to have significantly higher sensitivity and better diagnostic results for low-grade and non-muscle-invasive bladder cancer than urine exfoliative cytology or FISH, raising hopes for its clinical application. This has significant advantages, particularly in diagnosing early, minimal, residual, and recurrent tumors, and is expected to be applied to the early diagnosis and recurrence monitoring of bladder cancer, thereby reducing invasive cystoscopy and providing a scientific basis for second TUR.

[0004] Conventional testing methods do not fully meet clinical needs. The standard treatment, "cystoscopy plus pathological biopsy," is an invasive testing method that increases patient discomfort and reduces compliance. Furthermore, molecular diagnostic techniques such as urinary exfoliative cytology and FISH, which have been used clinically for many years, are inferior in sensitivity and specificity and cannot meet clinical diagnostic needs. In contrast, gene methylation detection in exfoliated urinary cells enables non-invasive sample collection, improving patient compliance and reducing unnecessary invasive testing. This has a positive impact on clinical treatment decisions for bladder cancer and is of great clinical value. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Chinese Guidelines for Diagnosis and Treatment of Bladder Cancer [Non-patent document 2] China Guidelines for Diagnosis and Treatment of Urological and Andrological Diseases Summary of the Invention [Problem to be solved by the invention]

[0006] In response to the problems of the prior art, the object of the present invention is to provide a reagent kit and a detection method for detecting bladder cancer that combines the detection of point mutations in the DHFR gene in urine cells with the detection of methylation in the Twist1 gene and the TSC21 gene to determine whether a sample has become cancerous, thereby providing an easy-to-operate and accurate bladder cancer screening test method for clinical use.

[0007] The NCBI database number of the DHFR gene sequence according to the present invention is NC_000005.10, and the NCBI database numbers of the Twist1 gene and the TSC21 gene are NC_000005.10 and NC_000002.12, respectively. [Means for solving the problem]

[0008] In order to achieve the object of the invention, the technical means provided in the present invention are as follows:

[0009] The present invention provides a reagent kit for detecting bladder cancer, characterized by the following: Specifically, the reagent kit includes a DHFR PCR reaction solution, Twist1 and TSC21 PCR reaction solutions, a point mutation positive control, a methylation positive control, and a negative control. The DHFR PCR reaction solution is used to detect the presence or absence of point mutations in the DHFR gene (RS1650697). The Twist1 and TSC21 PCR reaction solutions are used to detect the degree of methylation in at least one target region in the promoter regions of the Twist1 gene and the TSC21 gene. The promoter region refers to a gene fragment near the promoter and is not limited to a region strictly located within the promoter fragment. The methylation detection regions of the Twist1 and TSC21 genes both contain multiple CpGs.

[0010] The sequence of the region of the DHFR gene to be tested for point mutation, which is the target of the DHFR PCR reaction solution, is CTGCAGGTACTTTGTGAGTTTTGTCCTGCAGTTCCAGTTCCATGAAGCCCTGTGCAAGGAGGCAGGCTATGAGGGCCCACTGCACCAGTGTGACATCTACCGGTCCACCAAGGCAGGGGCCAAGCTCCGGTGTGTGGTGGGAAGCCGGGGGAAGTGGGAGGCAGAGAGGAGCGGCTGGCAAAGGGTGTGGCAGGAGGTGTC.

[0011] The sequence of the methylation test region of the Twist1 gene targeted by the Twist1 and TSC21 PCR reaction solution is TTCGTTTTTTAGTTTTTTTTTTTCGTTTTATTTTTTTTTTTCGGGGTTTAATAATTCGTTTTTTTAAATTATTTAAAAACGATTTGGTTCGGGCGGTCGGTTTTTTTATTCGTTTTTTAGTCGTTTTTTTTTTTTTTTTTTCGTCGTTTTTTTTCGGCGGGCGCGGGGCGATTTTTTTTTTCGTCGGAGCGTGCGGGTAGCGTTTTCGAATTTTAGCGTAGTTTAGGAAGCGGTCGGAGGAGATTGTTTTGGTCGCGGTGGTAGTTTTATTCGGAGTGGTTGTGATAGTAGTAATGGTAA. The sequence of the methylated region of the SC21 gene is TTTGACAATTTTGAGCCAGGCTTTCAGGCAGCAGAGGCCTGGGTGGCAGTCTGTGGTGTGAAGTGGATTTAGTCACACACAGTCTGATGTTGTAAACCACATGGGCTCTATTTACCTTCCTCTCCTAGGACTAGGAAGATTCTGTAGAGTATCGGAAAGCATTGGTTCATGTGCTGCCAGGATTCATGTTGGCTCTGGTGAGCCAGGGACAGGGAACTGACCTGCAGGCAGCCCAAGCAGCCACCTACTCACCTCACAATGACAGGGACCCTCATCATACAGGTCAGGGCTCAACTCAAAGACAGGCGTGGCAGTGGGACA.

[0012] The DHFR PCR reaction mixture contains DHFR forward and reverse primers, a DHFR probe, a reference ACTB forward and reverse primers, a reference ACTB probe, PCR buffer, MgCl2, dNTPs, and Taq polymerase. The Twist1 and TSC21 PCR reaction mixture contains Twist1 forward and reverse primers, a Twist1 probe, a TSC21 forward and reverse primers, a TSC21 probe, a reference ACTB forward and reverse primers, a reference ACTB probe, PCR buffer, MgCl2, dNTPs, and Taq polymerase.

[0013] The Taq polymerase in the DHFR PCR reaction solution and the Twist1 and TSC21 PCR reaction solution of the present invention may be any Taq DNA polymerase commonly used in the art.

[0014] The amounts of PCR buffer, MgCl2, and dNTPs in the DHFR PCR reaction solution and the Twist1 and TSC21 PCR reaction solutions of the present invention may be selected according to common methods in the art, or may be mixed manually by selecting appropriate amounts of each reagent, or a commercially available reaction system may be used as is. Differences in these components do not significantly affect the experimental results. The PCR buffer may be, for example, a buffer commonly used in the art, such as 30-60 mmol / L Tris and 10-50 mmol / L KCl, 30-600 mmol / L Tris and 10-50 mmol / L KAc, or 30-60 mmol / L Tris and 10-50 mmol / L CsCl. These differences do not significantly affect the reagents and detection results described in the present invention.

[0015] The nucleotide sequence of the DHFR forward primer was TGAGTTTTGTCCTGC, the nucleotide sequence of the DHFR reverse primer was ACACCGGAGCTTGGCCCCT, the nucleotide sequence of the DHFR probe was AGGCTATGAGGGCCCACT, the nucleotide sequence of the Twist1 forward primer was TTTTTTTTCGGCGGGCGCGGGGCGA, the nucleotide sequence of the Twist1 reverse primer was CCGAATAAAACTACCACCGCGACC, and the nucleotide sequence of the Twist1 probe was TCGTCGGAGCGTGCGGGTAGC. The base sequence of the forward primer for TSC21 is TTTGTAGAGTATCGGAAAGTATTGG, the base sequence of the reverse primer for TSC21 is CTATATAATAAAAATCCCTATCA, the base sequence of the probe for TSC21 is TTTGTAGAGTATCGGAAAGTATTGG, the base sequence of the forward primer for reference ACTB is TAGGATTTTTATTTAG, the base sequence of the reverse primer for reference ACTB is TGTGAATTTTTGTTAT, and the base sequence of the probe for reference ACTB is TTTTAAGGGAGGAGT.

[0016] The DHFR probe, Twist1 probe, TSC21 probe, and ACTB probe are each labeled at both ends with a fluorescent reporter selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, and CY5, and a quencher selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0017] In a specific embodiment of the present invention, the fluorescent reporter at the 5' end of the DHFR fluorescent probe is FAM and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the reference gene fluorescent probe is VIC and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the Twist1 fluorescent probe is FAM and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the TSC21 fluorescent probe is VIC and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the reference gene fluorescent probe is ROX and the quencher at the 3' end is BHQ1.

[0018] The contents of each component in the DHFR PCR reaction solution are 0.2 to 0.5 μmol / L of DHFR forward primer, 0.2 to 0.5 μmol / L of DHFR reverse primer, 0.1 to 0.5 μmol / L of DHFR probe, 0.2 to 0.5 μmol / L of reference ACTB forward primer, 0.2 to 0.5 μmol / L of reference ACTB reverse primer, 0.1 to 0.5 μmol / L of reference ACTB probe, PCR buffer, 2 to 8 mmol / L of MgCl2, 0.2 to 0.4 mmol / L of dNTP, and 200 to 1000 U / mL of Taq polymerase.

[0019] The contents of each component in the Twist1 and TSC21 PCR reaction solution are as follows: Twist1 forward primer 0.2 to 0.5 μmol / L, Twist1 reverse primer 0.2 to 0.5 μmol / L, Twist1 probe 0.1 to 0.5 μmol / L, TSC21 forward primer 0.2 to 0.5 μmol / L, TSC21 reverse primer 0.2 to 0.5 μmol / L, TSC21 probe 0.1 to 0.5 μmol / L, PCR buffer, MgCl2 2 to 8 mmol / L, dNTP 0.2 to 0.4 mmol / L, and Taq polymerase 200 to 1000 U / ml.

[0020] The methylation positive control is selected from the DNA of human bladder cancer cell line 5637.

[0021] The point mutation positive control is selected from DHFR positive synthetic plasmids.

[0022] The negative control was sterile water.

[0023] To achieve the object of the invention, the present invention further provides a method for detecting bladder cancer, which comprises the following steps:

[0024] (1) Extract DNA1 as a detection sample from a human urine sample.

[0025] (2) A portion of DNA1 in the detection sample is subjected to bisulfite conversion to obtain purified Bis-DNA.

[0026] (3) The detection sample DNA1 is mixed with the DHFR PCR reaction solution in the reagent kit of the present invention, and PCR amplification is performed using the detection sample DNA1 as a template and the primer-probe combination in the DHFR PCR reaction solution. Based on the multichannel fluorescent probe labeling, simultaneous detection of the target gene DHFR and the reference gene ACTB is achieved.

[0027] (4) The purified Bis-DNA is mixed with the Twist1 and TSC21 PCR reaction mixture in the reagent kit of the present invention, and PCR amplification is performed using the purified Bis-DNA as a template and the primer-probe combination in the Twist1 and TSC21 PCR reaction mixture. Based on multichannel fluorescent probe labeling, simultaneous detection of the two target genes, Twist1 and TSC21, and the reference gene, ACTB, is achieved.

[0028] (5) Determine whether or not a mutation has occurred in the DHFR gene based on the Ct value of the DHFR gene obtained in step (3) above. If the Ct value of the DHFR gene is ≦32, it is determined that a mutation has occurred in the DHFR gene. If the Ct value of the DHFR gene is >32 or there is no Ct value, it is determined that a mutation has occurred in the DHFR gene.

[0029] The degree of methylation is determined based on the ΔCt values ​​(target Ct value - reference Ct value) of the Twist1 gene and the TSC21 gene obtained in step (4) above. X1 = the ΔCt value of Twist1, X2 = the ΔCt value of TSC21, and these are substituted into the regression equation Y = 3.227 - 0.463 * X1 - 0.059 * X2. If Y ≥ 0, the Twist1 gene and the TSC21 gene are determined to be positive for methylation in the detection sample. If Y < 0, the Twist1 gene and the TSC21 gene are determined to be negative for methylation in the detection sample.

[0030] If a point mutation occurs in the DHFR gene and / or methylation of the Twist1 and TSC21 genes is positive, the detection sample is judged to be cancer positive. If a point mutation does not occur in the DHFR gene and methylation of the Twist1 and TSC21 genes is negative, the detection sample is judged to be cancer negative. [Effects of the Invention]

[0031] The advantages of the present invention are as follows:

[0032] 1. The present invention provides a reagent kit for detecting bladder cancer. The reagent kit for detecting bladder cancer includes a DHFR PCR reaction solution for detecting the presence or absence of a point mutation in the DHFR gene (RS1650697), and a Twist1 and TSC21 PCR reaction solution for detecting the degree of methylation in at least one target region in the promoter region of the Twist1 gene and the TSC21 gene. The detection reagent kit of the present invention detects three target genes, DHFR, Twist1, and TSC21, in a detection sample. The DHFR gene, Twist1 gene, and TSC21 gene are all closely related to the progression of bladder cancer. For the DHFR gene, mutations at a site containing RS1650697 are detected. Furthermore, the methylation detection regions of the Twist1 and TSC21 genes both contain multiple CpGs. This reduces the randomness of base changes compared to detecting individual bases.

[0033] 2. ACTB is selected as the reference gene for the three target genes, and the simultaneous detection of the target genes and reference genes is realized based on multi-channel fluorescent probe labeling. Finally, the experimental results are judged based on the Ct values ​​of the three genes.

[0034] 3. The present invention also provides a method for detecting bladder cancer, which combines nucleic acid extraction from a sample with bisulfite conversion. This method uses the DNA obtained after nucleic acid extraction from the sample and the DNA obtained after bisulfite conversion as templates for PCR reactions, enabling simultaneous detection of three target genes: DHFR, Twist1, and TSC21. By combining detection of DHFR point mutations with detection of Twist1 and TSC21 methylation, the present invention effectively compensates for differences that may arise due to site selection and reaction system, thereby improving the accuracy of bladder cancer detection. [Brief explanation of the drawings]

[0035] [Figure 1]Figure 1 is a schematic diagram of the overall structure of the reagent kit of the present invention. (Symbols in the figure: 1. DHFR PCR reaction mixture, 2. Twist1 and TSC21 PCR reaction mixture, 3. methylation positive control, 4. point mutation positive control, 5. negative control) [Figure 2] Figure 2 shows PCR amplification curves of the DHFR, Twist1, and TSC21 genes detected in a representative bladder cancer urine cell sample in the present invention (reagent kit with primer-probe combinations of DHFR (F / R / P), Twist1 (F / R / P), and TSC21 (F / R / P)). [Figure 3] Figure 3 shows PCR amplification curves of the DHFR, Twist1, and TSC21 genes detected in a representative urine cell sample from a healthy individual in the present invention (reagent kit with primer-probe combinations of DHFR (F / R / P), Twist1 (F / R / P), and TSC21 (F / R / P)). [Figure 4] Figure 4 shows the pathological and clinical diagnostic results for 40 urine cell samples. [Figure 5] FIG. 5 shows ROC curves for subjects when bladder cancer was detected using the detection reagent kit and detection method of the present invention, and when bladder cancer was pathologically and clinically diagnosed. DETAILED DESCRIPTION OF THE INVENTION

[0036] The present invention will be described in more detail below in combination with the drawings and examples. [Example]

[0037] As shown in FIG. 1, the present invention provides a reagent kit for detecting bladder cancer, characterized by the following: The reagent kit includes a DHFR PCR reaction solution, Twist1 and TSC21 PCR reaction solutions, a point mutation positive control, a methylation positive control, and a negative control. The DHFR PCR reaction solution is used to detect the presence or absence of a point mutation in the DHFR gene (RS1650697). The Twist1 and TSC21 PCR reaction solutions are used to detect the degree of methylation in at least one target region in the promoter region of the Twist1 gene and the TSC21 gene. The promoter region refers to a gene fragment near the promoter and is not limited to a region strictly located within the promoter fragment. The methylation detection regions of the Twist1 and TSC21 genes both contain multiple CpGs.

[0038] For the nucleotide sequences of the primers and probes for the bladder cancer detection genes DHFR, Twist1, and TSC21, and the reference gene ACTB, in this example, see Table 1 below.

[0039] The sequence of the region of the DHFR gene to be tested for point mutation, which is the target of the DHFR PCR reaction solution, is CTGCAGGTACTTTGTGAGTTTTGTCCTGCAGTTCCAGTTCCATGAAGCCCTGTGCAAGGAGGCAGGCTATGAGGGCCCACTGCACCAGTGTGACATCTACCGGTCCACCAAGGCAGGGGCCAAGCTCCGGTGTGTGGTGGGAAGCCGGGGGAAGTGGGAGGCAGAGAGGAGCGGCTGGCAAAGGGTGTGGCAGGAGGTGTC.

[0040] The sequence of the methylation test region of the Twist1 gene targeted by the Twist1 and TSC21 PCR reaction solution is TTCGTTTTTTAGTTTTTTTTTTTCGTTTTATTTTTTTTTTTCGGGGTTTAATAATTCGTTTTTTTAAATTATTTAAAAACGATTTGGTTCGGGCGGTCGGTTTTTTTATTCGTTTTTTAGTCGTTTTTTTTTTTTTTTTTTCGTCGTTTTTTTTCGGCGGGCGCGGGGCGATTTTTTTTTTCGTCGGAGCGTGCGGGTAGCGTTTTCGAATTTTAGCGTAGTTTAGGAAGCGGTCGGAGGAGATTGTTTTGGTCGCGGTGGTAGTTTTATTCGGAGTGGTTGTGATAGTAGTAATGGTAA. The sequence of the methylated region of the SC21 gene is TTTGACAATTTTGAGCCAGGCTTTCAGGCAGCAGAGGCCTGGGTGGCAGTCTGTGGTGTGAAGTGGATTTAGTCACACACAGTCTGATGTTGTAAACCACATGGGCTCTATTTACCTTCCTCTCCTAGGACTAGGAAGATTCTGTAGAGTATCGGAAAGCATTGGTTCATGTGCTGCCAGGATTCATGTTGGCTCTGGTGAGCCAGGGACAGGGAACTGACCTGCAGGCAGCCCAAGCAGCCACCTACTCACCTCACAATGACAGGGACCCTCATCATACAGGTCAGGGCTCAACTCAAAGACAGGCGTGGCAGTGGGACA.

[0041] The DHFR PCR reaction mixture contains DHFR forward and reverse primers, a DHFR probe, a reference ACTB forward and reverse primers, a reference ACTB probe, PCR buffer, MgCl2, dNTPs, and Taq polymerase. The Twist1 and TSC21 PCR reaction mixture contains Twist1 forward and reverse primers, a Twist1 probe, a TSC21 forward and reverse primers, a TSC21 probe, a reference ACTB forward and reverse primers, a reference ACTB probe, PCR buffer, MgCl2, dNTPs, and Taq polymerase.

[0042] The Taq polymerase in the DHFR PCR reaction solution and the Twist1 and TSC21 PCR reaction solution of the present invention may be any Taq DNA polymerase commonly used in the art.

[0043] The amounts of PCR buffer, MgCl2, and dNTPs in the DHFR PCR reaction solution and the Twist1 and TSC21 PCR reaction solutions of the present invention may be selected according to common methods in the art, or may be mixed manually by selecting appropriate amounts of each reagent, or a commercially available reaction system may be used as is. Differences in these components do not significantly affect the experimental results. The PCR buffer may be, for example, a buffer commonly used in the art, such as 30-60 mmol / L Tris and 10-50 mmol / L KCl, 30-600 mmol / L Tris and 10-50 mmol / L KAc, or 30-60 mmol / L Tris and 10-50 mmol / L CsCl. These differences do not significantly affect the reagents and detection results described in the present invention.

[0044] Referring to Table 1, the nucleotide sequence of the DHFR forward primer is TGAGTTTTGTCCTGC (SEQ ID No. 4), the nucleotide sequence of the DHFR reverse primer is ACACCGGAGCTTGGCCCCT (SEQ ID No. 5), and the nucleotide sequence of the DHFR probe is AGGCTATGAGGGCCCACT (SEQ ID No. 6). The nucleotide sequence of the Twist1 forward primer is TTTTTTTTCGGCGGGCGCGGGGCGA (SEQ ID No. 7), the nucleotide sequence of the Twist1 reverse primer is CCGAATAAAACTACCACCGCGACC (SEQ ID No. 8), and the nucleotide sequence of the Twist1 probe is TCGTCGGAGCGTGCGGGTAGC (SEQ ID No. 9). The nucleotide sequence of the forward primer for TSC21 is TTTGTAGAGTATCGGAAAGTATTGG (SEQ ID No. 10), the nucleotide sequence of the reverse primer for TSC21 is CTATATAATAAAAATCCCTATCA (SEQ ID No. 11), and the nucleotide sequence of the probe for TSC21 is TTTGTAGAGTATCGGAAAGTATTGG (SEQ ID No. 12). The nucleotide sequence of the forward primer for reference ACTB is TAGGATTTTTATTTAG (SEQ ID No. 13), the nucleotide sequence of the reverse primer for reference ACTB is TGTGAATTTTTGTTAT (SEQ ID No. 14), and the nucleotide sequence of the probe for reference ACTB is TTTTAAGGGAGGAGT (SEQ ID No. 15).

[0045] The DHFR probe, Twist1 probe, TSC21 probe, and ACTB probe are each labeled at both ends with a fluorescent reporter selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, and CY5, and a quencher selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0046] In a specific embodiment of the present invention, the fluorescent reporter at the 5' end of the DHFR fluorescent probe is FAM and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the reference gene fluorescent probe is VIC and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the Twist1 fluorescent probe is FAM and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the TSC21 fluorescent probe is VIC and the quencher at the 3' end is BHQ1. Furthermore, the fluorescent reporter at the 5' end of the reference gene fluorescent probe is ROX and the quencher at the 3' end is BHQ1.

[0047] For the nucleotide sequences of the primers and probes for the bladder cancer detection genes DHFR, Twist1, and TSC21, and the reference gene ACTB, in this example, see Table 1 below.

[0048] [Table 1]

[0049] In the reagent kit of the present invention, the methylation positive control is selected from the DNA of human bladder cancer cell line 5637, the point mutation positive control is selected from a DHFR-positive artificially synthesized plasmid, and the negative control is sterile water.

[0050] For specific components of the reagent kit of the present invention, see Table 2 below.

[0051] [Table 2]

[0052] In the reagent kit of the present invention, the contents of each component in the DHFR PCR reaction solution are as follows: 0.2 to 0.5 μmol / L of DHFR forward primer, 0.2 to 0.5 μmol / L of DHFR reverse primer, 0.1 to 0.5 μmol / L of DHFR probe, 0.2 to 0.5 μmol / L of reference ACTB forward primer, 0.2 to 0.5 μmol / L of reference ACTB reverse primer, 0.1 to 0.5 μmol / L of reference ACTB probe, PCR buffer, 2 to 8 mmol / L of MgCl2, 0.2 to 0.4 mmol / L of dNTP, and 200 to 1,000 U / mL of Taq polymerase.

[0053] In the reagent kit of the present invention, the contents of each component in the Twist1 and TSC21 PCR reaction solution are as follows: Twist1 forward primer 0.2 to 0.5 μmol / L, Twist1 reverse primer 0.2 to 0.5 μmol / L, Twist1 probe 0.1 to 0.5 μmol / L, TSC21 forward primer 0.2 to 0.5 μmol / L, TSC21 reverse primer 0.2 to 0.5 μmol / L, TSC21 probe 0.1 to 0.5 μmol / L, PCR buffer solution, MgCl2 2 to 8 mmol / L, dNTP 0.2 to 0.4 mmol / L, and Taq polymerase 200 to 1000 U / ml. [Example]

[0054] The present invention further provides a method for detecting bladder cancer, comprising the steps of:

[0055] (1) Extract DNA1 from the detection sample. That is, extract cellular DNA1 from a human urine sample. After extraction is complete, measure the DNA concentration and OD260 / OD280 using a Nano-500 microspectrophotometer, and ensure that the OD260 / OD280 is between 1.6 and 2.0.

[0056] (2) A portion of the DNA1 sample for detection is bisulfite converted to obtain purified Bis-DNA. After the cell DNA is extracted, the extracted DNA is bisulfite converted, converting unmethylated cytosine c to uracil (U) while leaving methylated cytosine (C) unconverted, yielding purified Bis-DNA. The obtained Bis-DNA should be detected immediately, but can also be stored at -20°C until detection. Generally, the storage period should not exceed four months, and for long-term storage, it should be stored at -80°C.

[0057] (3) Using DNA1 from the detection sample extracted in step (1) as a template, PCR amplification is performed using the primer-probe combination in the DHFR PCR reaction solution. ACTB is selected as the reference gene for the target gene DHFR, and simultaneous detection of the target gene and reference gene is achieved based on multi-channel fluorescent probe labeling.

[0058] The specific operations are as follows:

[0059] S3.1. Preparation of reagents: Prepare the DHFR PCR reaction solution and DNA1, a detection sample, included in the reagent kit of the present invention.

[0060] S3.2. Sample loading: Add 2-5 μL of the detection sample DNA1 and 15 μL of DHFR PCR reaction mixture to each of the 8 PCR tubes, add sterile water to bring the volume to 20 μL, tightly cap each tube, perform flash low-speed centrifugation, and then perform detection in the PCR device.

[0061] S3.3. PCR amplification: Select the fluorescence detection channel and set the amplification cycle parameters according to Table 3. Note: Do not select ROX compensation and select None for quencher. After completing the settings, save the file and run the reaction process.

[0062] (4) Using the purified Bis-DNA as a template, PCR amplification reactions were performed using the primer-probe combinations in the Twist1 and TSC21 PCR reaction mixtures. ACTB was selected as the reference gene for the two target genes Twist1 and TSC21, and simultaneous detection of the target and reference genes was achieved based on multichannel fluorescent probe labeling.

[0063] The specific operations are as follows:

[0064] S4.1. Preparation of reagents: Prepare the Twist1 and TSC21 PCR reaction mixtures and purified Bis-DNA template in the reagent kit of the present invention.

[0065] S4.2. Sample loading: Add 2-5 μL of purified Bis-DNA template and 15 μL of Twist1 and TSC21 PCR mixture to each of the 8 PCR tubes, add sterile water to bring the volume to 20 μL, tightly cap each tube, flash centrifuge at low speed, and run in a PCR machine.

[0066] S4.3. PCR amplification: Select the fluorescence detection channel and set the amplification cycle parameters according to Table 3. Note: Do not select ROX compensation and select None for quencher. After completing the settings, save the file and run the reaction process.

[0067] (5) Determine whether or not a mutation has occurred in the DHFR gene based on the Ct value of the DHFR gene obtained in step (3) above. If the Ct value of the DHFR gene is ≦32, it is determined that a mutation has occurred in the DHFR gene. If the Ct value of the DHFR gene is >32 or there is no Ct value, it is determined that a mutation has occurred in the DHFR gene.

[0068] The degree of methylation is determined based on the ΔCt values ​​(target Ct value - reference Ct value) of the Twist1 gene and the TSC21 gene obtained in step (4) above. X1 = the ΔCt value of Twist1, X2 = the ΔCt value of TSC21, and these are substituted into the regression equation Y = 3.227 - 0.463 * X1 - 0.059 * X2. If Y ≥ 0, the Twist1 gene and the TSC21 gene are determined to be positive for methylation in the detection sample. If Y < 0, the Twist1 gene and the TSC21 gene are determined to be negative for methylation in the detection sample.

[0069] If a point mutation occurs in the DHFR gene and / or methylation of the Twist1 and TSC21 genes is positive, the detection sample is judged to be cancer positive. If a point mutation does not occur in the DHFR gene and methylation of the Twist1 and TSC21 genes is negative, the detection sample is judged to be cancer negative.

[0070] [Table 3]

[0071] The logistic regression analysis of the present invention is as follows.

[0072] Experiments were conducted to obtain detection results for three target genes, DHFR, Twist1, and TSC21, in normal and bladder cancer samples. The logistic regression equation for determining gene methylation for Twist1 and TSC21 was Y = A0-A1*X1-A2*X2, where A0, A1, and A2 are clinical coefficients. The weighting relationship of the clinical coefficients was as follows: Twist1 proportional coefficient A1 = -0.463, TSC21 proportional coefficient A2 = -0.059, and constant proportional coefficient A0 = 3.227.

[0073] The differences in amplification cycle numbers between the Twist1 and TSC21 genes and the reference gene ACTB are X1 and X2, respectively. X1 = Ct value of Twist1 - Ct value of ACTB, and X2 = Ct value of TSC21 - Ct value of ACTB. These are substituted into the regression equation Y = 3.227 - 0.463 * X1 - 0.059 * X2 to determine the degree of methylation. If Y ≥ 0, the test sample is determined to be positive for bladder cancer methylation, and if Y < 0, the test sample is determined to be negative for bladder cancer methylation.

[0074] The combined detection of bladder cancer lesions by adaptive regression analyzing the methylation of the Twist1 and TSC21 genes and point mutations in DHFR significantly improves sensitivity and specificity compared with the detection and analysis of individual genes DHFR, Twist1, and TSC21.

[0075] The accuracy of bladder cancer detection using the bladder cancer detection reagent kit and detection method of the present invention was verified as follows.

[0076] The results of combined detection of gene point mutations and methylation (DHFR, Twist1, TSC21) for 40 urine cell samples are shown in Figures 2 and 3. Figure 2 shows PCR amplification curves for the DHFR, Twist1, and TSC21 genes detected in a representative bladder cancer urine cell sample of the present invention. The primer-probe combinations used in the DHFR PCR reaction solution, Twist1, and TSC21 PCR reaction solution in the reagent kit of the present invention are DHFR (F / R / P), Twist1 (F / R / P), and TSC21 (F / R / P). Detection of representative bladder cancer urine cell samples using the reagent kit of the present invention showed that the Ct value of at least one of the DHFR, Twist1, and TSC21 genes in the bladder cancer sample was ≦32.

[0077] 3 shows PCR amplification curves of the DHFR, Twist1, and TSC21 genes detected in a representative healthy subject urine cell sample according to the present invention. The primer-probe combinations used in the DHFR PCR reaction solution, Twist1, and TSC21 PCR reaction solutions in the reagent kit of the present invention are DHFR (F / R / P), Twist1 (F / R / P), and TSC21 (F / R / P). Detection of a representative healthy subject urine cell sample using the reagent kit of the present invention showed that the Ct values ​​of the DHFR gene, Twist1 gene, and TSC21 gene in the healthy subject urine cell sample were all >32.

[0078] Figure 4 shows the pathological and clinical diagnostic results for 40 urine cell samples.

[0079] Figure 5 shows ROC curves for subjects when bladder cancer was detected using the detection reagent kit and detection method of the present invention, and when bladder cancer was pathologically and clinically diagnosed. As is clear from Figure 5, when detection was performed using the detection reagent kit of the present invention, bladder cancer patients could be clearly distinguished from healthy subjects. The area under the ROC curve (AUC) was 0.89 (95% CI 0.751-0.961, P<0.001).

[0080] As is clear from the experimental data, when bladder cancer screening was performed using the detection reagent kit of the present invention and the clinical diagnosis results were compared, the accuracy of the bladder cancer detection reagent kit provided by the present invention reached 87.5%, and the detection sensitivity and specificity were 90% and 85%, respectively.

[0081] In summary, the bladder cancer detection reagent kit disclosed in the present invention includes a DHFR PCR reaction mixture, Twist1 and TSC21 PCR reaction mixtures, a point mutation positive control, a methylation positive control, and a negative control. It can detect the presence or absence of point mutations in the DHFR gene (RS1650697) and detect the degree of methylation within at least one target region in the promoter region of the Twist1 gene and the TSC21 gene. The DHFR gene, Twist1 gene, and TSC21 gene are all closely related to the progression of bladder cancer. In the present invention, the detection of DHFR point mutations and the methylation of Twist1 and TSC21 are combined, effectively compensating for differences that may arise due to site selection and reaction system, thereby improving the accuracy of bladder cancer detection. This detection method is easy to operate, simple, has high detection sensitivity, and good specificity, and is therefore of great significance in the detection of bladder cancer. [Explanation of symbols]

[0082] 1 DHFR PCR reaction mixture 2. Twist1 and TSC21 PCR reaction mixture 3. Methylation positive control 4 Point mutation positive controls 5. Point mutation negative control

Claims

1. A reagent kit for detecting bladder cancer, comprising a DHFR PCR reaction solution, a Twist1 and TSC21 PCR reaction solution, a point mutation positive control, a methylation positive control, and a negative control, wherein the DHFR PCR reaction solution is used to detect the presence or absence of a point mutation in the DHFR gene (RS1650697), and the Twist1 and TSC21 PCR reaction solution is used to detect the degree of methylation in at least one target region in the promoter region of the Twist1 gene and the TSC21 gene, wherein the promoter region is a gene fragment in the promoter vicinity region and is not limited to a region strictly located within the promoter fragment, and wherein the methylation detection regions of the Twist1 and TSC21 genes both contain multiple CpGs.

2. 2. The reagent kit for detecting bladder cancer according to claim 1, wherein the sequence of the region of the DHFR gene to be tested for point mutation, which is the target of the DHFR PCR reaction solution, is CTGCAGGTACTTTGTGAGTTTTGTCCTGCAGTTCCAGTTCCATGAAGCCCTGTGCAAGGAGGCAGGCTATGAGGGCCCACTGCACCAGTG TGACATCTACCGGTCCACCAAGGCAGGGGCCAAGCTCCGGTGTGTGGTGGGAAGCCGGGGGAAGTGGGAGGCAGAGAGGAGCGGCTGGCAAAGGGTGTGGGCAGGAGGTGTC.

3. The sequence of the methylation test region of the Twist1 gene targeted by the Twist1 and TSC21 PCR reaction solution is: TTCGTTTTTTTAGTTTTTTTTTTTCGTTTTTATTTTTTTTTTCGGGGGTTTAATAATTCGTTTTTTTTAAATTATTTTAAAAACGATTTGGTTCGGGCGGTCGGTTTTTTTTATTCGTTTTTTAGTCGTTTTTTTTTTTTTTTTTTTCGT CGTTTTTTTTCGGCGGGCGCGGGGCGATTTTTTTTTTCGTCGGAGCGTGCGGGTAGCGTTTTTCGAATTTTAGCGTAGTTTAGGAAGCGGTCGGAGGAGATTGTTTTGGTCGCGGTGGTAGTTTTATTCGGAGTGGTTGTGATAGTAGTAATGGTAA, and the target TSC21 gene methylation test The sequence of the region is TTTGACAATTTTGAGCCAGGCTTTCAGGCAGCAGAGGCCTGGGTGGCAGTCTGTGGTGTGAAGTGGATTTAGTCACACACAG TCTGATGTTGTAAACCACATGGGCTCTATTTACCTTCCTCTCCTAGGACTAGGAAGATTCTGTAGAGTATCGGAAAGCATTGGTTCATGT 2. The reagent kit for detecting bladder cancer according to claim 1, wherein the antibody is GCTGCCAGGATTCATGTTGGCTCTGGTGAGCCAGGGACAGGGAACTGACCTGCAGGGCAGCCCAAGCAGCCACCTACTCACCTCACAATGACAGGGACCCTCATCATACAGGTCAGGGCTCAACTCAAAGACAGGCGTGGCAGTGGGACA.

4. The DHFR PCR reaction mixture contained DHFR forward and reverse primers, a DHFR probe, a reference ACTB forward and reverse primers, a reference ACTB probe, PCR buffer, MgCl ２ , dNTPs and Taq polymerase, The Twist1 and TSC21 PCR reaction mixture contained Twist1 forward and reverse primers, Twist1 probe, TSC21 forward and reverse primers, TSC21 probe, reference ACTB forward and reverse primers, reference ACTB probe, PCR buffer, MgCl ２ 2. The reagent kit for detecting bladder cancer according to claim 1, further comprising: dNTPs and Taq polymerase.

5. The base sequence of the DHFR forward primer was TGAGTTTTGTCCTGC, the base sequence of the DHFR reverse primer was ACACCGGAGCTTGGCCCCT, the base sequence of the DHFR probe was AGGCTATGAGGGCCCACT, the base sequence of the Twist1 forward primer was TTTTTTTTCGGCGGGCGCGGGGCGA, the base sequence of the Twist1 reverse primer was CCGAATAAAACTACCACCGCGACC, and the base sequence of the Twist1 probe was TCGTCGGAGCGTGCGGGTAGC. The reagent kit for detecting bladder cancer according to claim 1, characterized in that the base sequence of the forward primer of TSC21 is TTTGTAGAGTATCGGAAAGTATTGG, the base sequence of the reverse primer of TSC21 is CTATATAATAAAAATCCCTATCA, the base sequence of the probe of TSC21 is TTTGTAGAGTATCGGAAAGTATTGG, the base sequence of the forward primer of the reference ACTB is TAGGATTTTTTATTAG, the base sequence of the reverse primer of the reference ACTB is TGTGAATTTTTGTTAT, and the base sequence of the probe of the reference ACTB is TTTTAAGGGAGGAGT.

6. The reagent kit for detecting bladder cancer described in claim 4, characterized in that both ends of the DHFR probe, Twist1 probe, TSC21 probe, and ACTB probe are labeled with a fluorescent reporter and a quencher, respectively, the fluorescent reporter being selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5, and the quencher being selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

7. The contents of each component in the DHFR PCR reaction solution were as follows: DHFR forward primer 0.2 to 0.5 μmol / L, DHFR reverse primer 0.2 to 0.5 μmol / L, DHFR probe 0.1 to 0.5 μmol / L, reference ACTB forward primer 0.2 to 0.5 μmol / L, reference ACTB reverse primer 0.2 to 0.5 μmol / L, reference ACTB probe 0.1 to 0.5 μmol / L, PCR buffer, MgCl ２ 2 to 8 mmol / L, dNTP 0.2 to 0.4 mmol / L, and Taq polymerase 200 to 1000 U / ml; The contents of each component in the Twist1 and TSC21 PCR reaction solution are as follows: Twist1 forward primer 0.2 to 0.5 μmol / L, Twist1 reverse primer 0.2 to 0.5 μmol / L, Twist1 probe 0.1 to 0.5 μmol / L, TSC21 forward primer 0.2 to 0.5 μmol / L, TSC21 reverse primer 0.2 to 0.5 μmol / L, TSC21 probe 0.1 to 0.5 μmol / L, PCR buffer, MgCl ２ 5. The reagent kit for detecting bladder cancer according to claim 4, wherein the concentration of the reagent is 2 to 8 mmol / L, dNTP is 0.2 to 0.4 mmol / L, and Taq polymerase is 200 to 1000 U / ml.

8. The reagent kit for detecting bladder cancer described in claim 1, characterized in that the methylation positive control is selected from the DNA of human bladder cancer cell 5637, the point mutation positive control is selected from a DHFR positive artificially synthesized plasmid, and the negative control is sterile water.

9. (1) extracting DNA1 as a detection sample from a human urine sample; (2) subjecting a portion of DNA1 of the detection sample to bisulfite conversion treatment to obtain purified Bis-DNA; (3) Mixing the DNA1 of the detection sample with the DHFR PCR reaction solution in the reagent kit of claim 1, and using the DNA1 of the detection sample as a template to carry out a PCR amplification reaction using the primer-probe combination in the DHFR PCR reaction solution, thereby realizing simultaneous detection of the target gene DHFR and the reference gene ACTB based on multi-channel fluorescent probe labeling; (4) Mixing the purified Bis-DNA with the Twist1 and TSC21 PCR reaction solution of claim 1, and using the purified Bis-DNA as a template to perform PCR amplification using the primer-probe combination in the Twist1 and TSC21 PCR reaction solution, thereby achieving simultaneous detection of the two target genes Twist1 and TSC21 and the reference gene ACTB based on multi-channel fluorescent probe labeling; (5) Based on the Ct value of the DHFR gene obtained in step (3), determine whether or not a mutation has occurred in the DHFR gene. If the Ct value of the DHFR gene is ≦32, determine that a mutation has occurred in the DHFR gene. If the Ct value of the DHFR gene is >32 or there is no Ct value, determine that a mutation has occurred in the DHFR gene. The degree of methylation is determined based on the ΔCt values ​​(target Ct value−reference Ct value) of the Twist1 gene and the TSC21 gene obtained in step (4) above, and substituted into the regression equation Y=3.227−0.463*X1−0.059*X2, where X1=the ΔCt value of Twist1 and X2=the ΔCt value of TSC21. If Y≧0, the methylation of the Twist1 gene and the TSC21 gene is determined to be positive for the detection sample, and if Y<0, the methylation of the Twist1 gene and the TSC21 gene is determined to be negative for the detection sample. determining the detection sample as cancer positive if a point mutation has occurred in the DHFR gene and / or methylation of the Twist1 and TSC21 genes is positive, and determining the detection sample as cancer negative if a point mutation has not occurred in the DHFR gene and methylation of the Twist1 and TSC21 genes is negative at the same time; A method for detecting bladder cancer, comprising:

Images