Compositions and methods for treating retinal degenerative diseases

Abstract

The present invention relates to a combination of a nucleic acid encoding the short isoform of rod-derived cone survival factor (RdCVF), a nucleic acid encoding the long isoform of rod-derived cone survival factor (RdCVFL), and a nucleic acid encoding a mutant form of G protein-gated inwardly rectifying potassium channel subunit 1 (GIRK1) (GIRK1 F137S) or a mutant form of G protein-gated inwardly rectifying potassium channel subunit 4 (GIRK4) (GIRK4 S143T), where the three nucleic acids are expressed via one, two, or three viral vectors, which may be contained in a single pharmaceutical composition or in multiple (two or three) different pharmaceutical compositions. The present invention also relates to the treatment of retinal degenerative diseases, particularly retinitis pigmentosa, using the viral vectors or pharmaceutical compositions.

Description

Detailed Description of the Invention

[0001] [Technical field to which the invention belongs] The present invention relates to the treatment of retinal neurodegenerative diseases, and more particularly to treatment by maintaining the integrity of cone photoreceptors and reactivating cones that have already lost their outer segments.

[0002] [Background technology] The retina is the light-sensitive tissue of the eye, composed of three layers of neurons interconnected by synapses. The primary neurons in the retina are photoreceptors (PRs), which detect light. There are two types of photoreceptors: rods for night vision and cones for daytime vision. Cone-mediated vision is primarily supported by the fovea and provides central vision, which is most valuable for our everyday visual tasks. [1] G protein-coupled receptors that link photon capture to intracellular signaling, causing membrane hyperpolarization in photoreceptors, are called opsins. [2] In primate retinas, there is one rod opsin in rods and three cone opsins responsible for trichromatic vision. These opsins share similar structural properties and phototransduction cascades.

[0003] Photoreceptors, such as rods and cones, are light-sensitive sensory neurons located in the posterior layers of the retina. They are also called photoreceptor cells or photoreceptor neurons.

[0004] The phototransduction cascade is composed of several proteins and is concentrated in the photoreceptor outer segments in the normal retina (Figure 1A). The role of photoreceptors is to sense light through this phototransduction cascade and then induce electrical signals that are processed and transmitted to downstream neurons [3].

[0005] Absorption of a photon activates opsin, which contains two parts: a protein moiety and a light-absorbing moiety, retinal, a derivative of vitamin A. The latter isomerizes from 11-cis-retinal (dark-adapted state) to all-trans-retinal (light-adapted state). As a result, opsin becomes catalytically active and recruits the G protein transducin. The α-subunit of transducin is activated by the replacement of GDP with GTP. The α-subunit then dissociates from the βγ-subunit and binds to its two inhibitory γ-subunits, activating membrane-bound phosphodiesterase 6 (PDE). Activated PDE hydrolyzes cGMP to GMP. The decrease in cGMP closes the nucleotide-gated channel (CNG), which prevents cation entry, resulting in PR hyperpolarization and reduced glutamate release by photoreceptors [4].

[0006] To respond to another photon, this phototransduction cascade is inactivated by two mechanisms: (i) transducin inactivates itself by hydrolyzing bound GTP, and (ii) rhodopsin kinase (GRK) phosphorylates opsin, which interacts with the regulatory protein arrestin, inactivating the opsin. Retinal is then recycled by the retinal pigment epithelium (RPE) and Müller glia. Each and every protein in this cascade plays a key role in converting light signals into electrical signals that are transmitted to second- and third-order neurons [5].

[0007] Neurodegenerative diseases encompass a variety of severely debilitating conditions characterized by the degeneration of neurons.

[0008] Retinal neurodegenerative or degenerative diseases encompass various subgroups of conditions: rod-cone dystrophies, cone dystrophies, cone-rod dystrophies, and atrophic age-related macular degeneration.

[0009] Rod-cone dystrophies (RCDs), such as retinitis pigmentosa (RP), are genetically heterogeneous retinal neurodegenerative disorders characterized by the progressive death of rod photoreceptors followed by the sequential loss of cones. RP is one of the most common inherited retinal degenerations, affecting approximately 1 in 3,500 individuals worldwide [6], corresponding to 2 million patients worldwide. To date, RP-causing mutations have been identified in over 63 different genes, with a significant proportion of these mutations in rod-specific transcripts.

[0010] Cone dystrophy is characterized by decreased visual acuity (age of onset ranges from the late teens to the 60s), sensitivity to bright light, and poor color vision, which allows patients to see better at dusk. Visual acuity usually decreases gradually, but can rapidly decline to 20 / 200. Later, in severe cases, visual acuity declines to "exponent valve" visual acuity. Color vision testing using color vision testing plates (HRR series) reveals numerous errors in both the red-green and blue-yellow plates.

[0011] Cone-rod dystrophy (CRD) refers to a group of inherited retinal degenerations (1 in 30,000 people) that affect the photoreceptor (light-sensing) cells responsible for capturing images from the visual field. These cells line the back of the eyeball in an area known as the retina. Cone photoreceptor cells are found throughout the retina but are concentrated in the central area (macula). Cone photoreceptor cells are responsible for central (reading) vision. Rod photoreceptor cells are found throughout the retina except in the very center of the macula, called the fovea, where only cones are present. They are responsible for night vision.

[0012] In contrast to typical retinitis pigmentosa (known as rod-cone dystrophy), in which rod cells are lost followed by cone cell loss, cone-rod dystrophies can reflect the reverse order of events, with primarily cone cells affected first, followed by rod loss later. The degree of vision loss increases over time. There are multiple types of cone-rod dystrophies, determined by genetic causes and inheritance patterns.

[0013] Dry age-related macular degeneration (AMD), or advanced dry AMD, is a progressive form of AMD that can result in the progressive and irreversible loss of the retina (photoreceptors, retinal pigment epithelium, and chorion), potentially leading to loss of visual function over time.[27,28,29,30] Dry AMD is estimated to affect over 5 million people worldwide and approximately 1 million people in the United States.[31,32] This is roughly the same prevalence as the other progressive form, neovascular (wet) AMD.

[0014] In patients with RCD, particularly RP, vision loss progresses in three successive stages.

[0015] Patients with RP initially present with decreased vision in dim light conditions (poor night vision), which corresponds to the deterioration and degeneration of rods, while cone-mediated vision in the macula is relatively preserved. This is a mild impairment, allowing patients to lead a fairly normal life.

[24]

[0016] The disease then progresses through a more disabling second stage resulting from cone hypofunction and degeneration. In this late degeneration, cones degenerate in the periphery, leading to the well-known tunnel vision. In fact, the central retina accounts for 5% of all photoreceptors in humans and most mammals, and if this part is spared, patients maintain good visual acuity but have a limited visual field.

[25]

[0017] The final stage of the disease corresponds to the degeneration of the pit cone photoreceptors, resulting in complete loss of vision in patients. At this stage, despite the degeneration of the light-sensing outer segments, some cones still have viable cell bodies.

[0018] In modern society, where many environments are artificially lit and many activities depend on high-acuity color vision, preserving cone-mediated vision in patients with RP would significantly improve quality of life.

[0019] Cone loss in RP subsets caused by rod-specific mutations is not fully understood, but several mechanisms, not necessarily mutually exclusive, have been proposed. Some hypothesized mechanisms suggest a "bystander effect," whereby cone death occurs as a result of toxic by-products released from degenerating surrounding rods or loss of contact with rods, the retinal pigment epithelium (RPE), or Müller glia. Alternatively, Müller cell activation and release of toxic molecules may play a role. Another hypothesis is that the amount of oxygen or retinoids delivered by the RPE from the choroidal blood circulation to the photoreceptor layer becomes excessive and toxic due to the loss of metabolic load for rods [7]. Punzo et al. provided evidence in a mouse model of retinal degeneration that cones partially die as a result of starvation and nutrient imbalance driven by the insulin / mammalian target of rapamycin pathway [8]. Furthermore, it has been suggested that loss of survival factors secreted by rods and required for cone survival may contribute to cone loss [9,10].

[0020] Consistent with the last hypothesis, transplanted healthy retinal tissue has been shown to support cone survival in regions distant from the transplanted tissue in rd1 mice [11,12].

[0021] International patent application WO2008 / 148860A1 describes a family of trophic factors called rod-derived cone survival factors (RdCVF) and RdCVF2, which can enhance neuronal survival and are useful in the treatment and / or prevention of neurodegenerative diseases such as RP.

[0022] Rod-derived cone survival factor (RdCVF) was originally identified as a candidate molecule responsible for this rescue effect through high-throughput screening of cDNA libraries [9]. Because rods secrete RdCVF, rod death results in a loss of this paracrine source and a decrease in RdCVF levels. Therefore, loss of expression of RdCVF and such secreted factors may contribute to the second wave of cone degeneration observed in rod-cone dystrophies.

[0023] RdCVF has been shown to mediate cone survival both in culture

[13] and when injected subretinically into recessive and dominant mouse and rat models of retinitis pigmentosa [9,14]. In 2010, Leveillard and Sahel

[26] showed that expression of RdCVF preserves cone-mediated vision by allowing the maintenance of cone outer segments, thereby extending the functional lifespan of cones.

[0024] Furthermore, disruption of Nxnl1, the gene encoding RdCVF, has been shown to render mouse photoreceptors susceptible to photoreceptor dysfunction and cone loss over time

[15] .

[0025] Nxnl1 encodes two protein isoforms through alternative splicing. The isoform that mediates cone survival, RdCVF, is a truncated thioredoxin-fold protein of its longer isoform, RdCVFL, and contains a C-terminal extension that confers enzymatic thiol oxidoreductase activity

[16] . RdCVFL contains all amino acids of RdCVF and is encoded by exons 1 and 2 of the Nxnl1 gene. It is a member of the thioredoxin family

[17] . Thioredoxins have diverse functions, including maintaining an appropriate reductive environment within cells and participating in apoptotic pathways. These functions are achieved through a thiol oxidoreductase reaction mediated by a conserved CXXC catalytic site within the thioredoxin fold

[18] .

[0026] Byrne et al.

[19] demonstrated that the two isoforms encoded by Nxnl1 have complementary functions. Systemic administration of adeno-associated viruses (AAV) encoding RdCVF improved cone function and delayed cone loss, whereas RdCVFL increased rhodopsin mRNA and reduced oxidative stress. RdCVFL protects against photooxidative damage to rods

[21] .

[0027] International patent application WO2016 / 185037 describes AAV vectors encoding both the short and long isoforms RdCVF and RdCVFL, and the use of said vectors to treat retinal neurodegenerative conditions such as retinitis pigmentosa.

[0028] Beneficial effects between RdCVF and RdCVFL have been demonstrated

[20] . On the one hand, RdCVF is produced and secreted by the retinal pigment epithelium (RPE) and protects cones by stimulating aerobic glycolysis via the RdCVF receptor on the cell surface of cones through a non-cell-autonomous mechanism

[22] . On the other hand, RdCVFL protects cones from oxidative damage in a cell-autonomous manner through its thiol oxidoreductase function.

[0029] Previous studies have shown that light activation of animal cone opsins induces G signaling in human kidney and neuronal cells in vitro and in vivo. i / oIt has been shown that opsins can stimulate signaling pathways involved in the rapid decay of neuronal activity and the inhibition of endogenous ion channels

[35] . However, animal cone opsins have also been shown to directly regulate G protein-gated inwardly rectifying potassium channels (GIRKs) when coexpressed in any cell [34,35]. GIRK channels consist of two subunits. There are four types of subunits: GIRK1, GIRK2, and GIRK3. GIRK1, GIRK4, and GIRK3 cannot form homotetramers and must associate with other subunits to function

[36] . Conversely, GIRK2 can form homotetramers by itself. A single-point mutant GIRK1 at position F137 has been suggested to form functional homomeric channels

[37] . GIRK channels are primarily closed at resting membrane potentials. G i / o After activation by the βγ subunit of the protein, potassium ions efflux from the cell, thereby hyperpolarizing the neuron (Figure 1B).

[0030] Recently, it has been shown that expression of the G protein-coupled inwardly rectifying potassium channel 2 (GIRK2) can delay visual loss and improve visual acuity by preserving cone light sensitivity in rd10 and RhoP347S mice

[23] (International Application WO2021 / 204407A1). GIRK2 expression restores the function of dormant cones, which are dysfunctional due to loss of outer segments.

[0031] Summary of the Invention The present invention relates to the following combination: - a nucleic acid encoding the short isoform of rod-derived cone survival factor (RdCVF), - a nucleic acid encoding the long isoform of rod-derived cone survival factor (RdCVFL), and - a nucleic acid encoding a mutant form of G protein-gated inwardly rectifying potassium channel subunit 1 (GIRK1) (GIRK1 F137S) or a mutant form of G protein-gated inwardly rectifying potassium channel subunit 4 (GIRK4) (GIRK4 S143T).

[0032] Indeed, we found that mutant GIRK1 channels, GIRK1 F137S (Examples 3 and 4), and mutant GIRK4 channels, GIRK4 S143T (Example 5), induced significantly more ion flux than GIRK2 in the context of a short GIRK / opsin phototransduction cascade. These results suggest that incorporating GIRK1 F137S or GIRK4 S143T into cones may provide improved gene therapy for RCD over GIRK2 gene therapy.

[0033] The nucleic acid encoding RdCVF, the nucleic acid encoding RdCVFL, and the nucleic acid encoding GIRK1 F137S or GIRK4 S143T may be expressed through one, two, or three viral vectors, which may be in a single pharmaceutical composition or in multiple (two or three) different pharmaceutical compositions.

[0034] According to a first aspect, the present invention relates to a pharmaceutical composition comprising one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0035] In particular, the pharmaceutical composition comprises a single viral vector.

[0036] A second aspect of the present invention deals with a viral vector comprising three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively.

[0037] A third aspect of the invention relates to a kit comprising two or three pharmaceutical compositions.

[0038] The present invention also relates to the above pharmaceutical composition, viral vector or kit for treating a retinal degenerative disease.

[0039] The combination of RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T can preserve cone cells while maintaining their light sensitivity, overcoming the reduced light sensitivity that occurs when trophic factors such as RdCVF and RdCVFL are used alone by implementing an additive approach to enhance light sensitivity.

[0040] Detailed Description of the Invention The present invention relates to single or multiple viral vectors containing a nucleic acid encoding the short isoform of rod-derived cone viability factor (RdCVF), a nucleic acid encoding the long isoform of rod-derived cone viability factor (RdCVFL), and a nucleic acid encoding a mutant form of G protein-gated inwardly rectifying potassium channel subunit 1 (GIRK1) (GIRK1 F137S) or a mutant form of G protein-gated inwardly rectifying potassium channel subunit 4 (GIRK4) (GIRK4 S143T), as well as uses thereof. In the case of multiple viral vectors, the viral vectors may be contained in a single pharmaceutical composition or may be contained in separate pharmaceutical compositions, such as distributed among two or three pharmaceutical compositions.

[0041] In one aspect, the present invention relates to a pharmaceutical composition comprising one or more viral vectors, wherein said one or more viral vectors comprise: - a nucleic acid encoding the short isoform of rod-derived cone survival factor (RdCVF), - a nucleic acid encoding the long isoform of rod-derived cone survival factor (RdCVFL), and - a nucleic acid encoding a mutant form of G protein-gated inwardly rectifying potassium channel subunit 1 (GIRK1) (GIRK1 F137S) or a mutant form of G protein-gated inwardly rectifying potassium channel subunit 4 (GIRK4) (GIRK4 S143T).

[0042] "One or more viral vectors" means that the nucleic acid encoding RdCVF, the nucleic acid encoding RdCVFL, and the nucleic acid encoding GIRK1 F137S or GIRK4 S143T may be contained in a single vector or may be contained in separate vectors, such as two or three vectors.

[0043] In a specific embodiment, the pharmaceutical composition comprises three viral vectors each comprising a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, respectively.

[0044] In a specific embodiment, the pharmaceutical composition comprises two viral vectors, a first viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and a second viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0045] In a specific embodiment, the pharmaceutical composition comprises two viral vectors, a first viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and a second viral vector comprising a nucleic acid encoding RdCVFL.

[0046] In a specific embodiment, the pharmaceutical composition comprises two viral vectors, a first viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T and a nucleic acid encoding RdCVFL, and a second viral vector comprising a nucleic acid encoding RdCVF.

[0047] In a specific embodiment, the pharmaceutical composition comprises a single viral vector, and the single viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively.

[0048] In another embodiment, the present invention relates to a kit comprising two or three pharmaceutical compositions.

[0049] When the kit comprises two pharmaceutical compositions, each pharmaceutical composition comprises one of the following viral vectors: - a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T; - a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and a viral vector comprising a nucleic acid encoding RdCVFL; or - a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T and a nucleic acid encoding RdCVFL, and a viral vector comprising a nucleic acid encoding RdCVF.

[0050] Thus, in a particular embodiment, the present invention relates to a kit comprising two pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL; and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0051] In certain embodiments, the present invention also relates to a kit comprising two pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF and a viral vector comprising a nucleic acid encoding RdCVFL; and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0052] In certain embodiments, the present invention also relates to a kit comprising two pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF and a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVFL.

[0053] In certain embodiments, the present invention also relates to a kit comprising two pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T and a viral vector comprising a nucleic acid encoding RdCVFL; and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF.

[0054] When the kit includes three pharmaceutical compositions, each pharmaceutical composition contains a single viral vector containing a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, respectively.

[0055] Thus, in a particular embodiment, the present invention relates to a kit comprising three pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding RdCVF; - the second pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding RdCVFL; and - a third pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0056] Pharmaceutical compositions according to the present disclosure may further comprise a pharmaceutically acceptable excipient.

[0057] According to the present disclosure, "pharmaceutically acceptable" means that the excipient is generally safe and well-tolerated for human or animal use after ocular administration and should not interfere with the efficacy of the active ingredient (i.e., the viral vector described in this disclosure). Exemplary pharmaceutically acceptable excipients include isotonic solutions such as mono- or di-sodium phosphate, sodium chloride, potassium chloride, calcium chloride, or magnesium chloride, sterile solutions, saline, or mixtures of these salts. These solutions may further contain non-ionic surfactants, such as Tween or Pluronic. In certain embodiments, the pharmaceutically acceptable excipient is a phosphate-buffered saline (PBS) solution or a balanced salt solution (BSS), more particularly to which 0.001% Pluronic has been added.

[0058] In another embodiment, the present invention relates to a viral vector comprising three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively.

[0059] As used herein, the term rod-derived cone viability factor (RdCVF) refers to the short isoform encoded by the thioredoxin-like 6 (TXNL6) gene or the nucleoredoxin-like 1 (NXNL1) gene. It encompasses the RdCVF proteins of any animal species. Typically, the RdCVF protein according to the present invention can be mammalian RdCVF proteins, including but not limited to, human, mouse, rat, non-human primate, cat, and dog.

[0060] Generally, in mice, the short isoform (RdCVF) is a 109 amino acid long protein and is referenced under Uniprot accession number Q91W38.

[0061] In the present application, the short isoform RdCVF is in particular the human short isoform (hRdCVF) set forth in SEQ ID NO:1.

[0062] In particular, the short isoform hRdCVF can be encoded by the nucleic acid set forth in SEQ ID NO:3.

[0063] Alternatively, the nucleic acid encoding the short isoform hRdCVF can be a nucleic acid that differs from SEQ ID NO:3 but encodes the same amino acid sequence of SEQ ID NO:1.

[0064] Suitable nucleic acid sequences include, but are not limited to: - polymorphisms in the cDNA encoding human RdCVF; - combinations of polymorphisms (rare haplotypes) in the cDNA encoding human RdCVF. An example of a rare haplotype cDNA is set forth as SEQ ID NO: 6; - "optimized" sequences in which certain codons have been replaced with codons encoding the same amino acids. Suitable codon-optimized sequences encoding human RdCVF include, but are not limited to, the sequence set forth in SEQ ID NO: 7; - Homologous sequences. For example, it has been found that the chimpanzee cDNA sequence encoding the short isoform of chimpanzee RdCVF encodes the same amino acid sequence as the human cDNA and can therefore be used. The chimpanzee cDNA has the sequence set forth in SEQ ID NO:4.

[0065] In particular, the short isoform hRdCVF is encoded by a nucleic acid corresponding to the codon-optimized cDNA set forth in SEQ ID NO:7.

[0066] As used herein, the term "RdCVFL" refers to the long isoform encoded by the thioredoxin-like 6 (TXNL6) gene or the nucleoredoxin-like 1 (NXNL1) gene. It encompasses RdCVFL proteins of any animal species. Typically, the RdCVFL protein according to the present invention may be a mammalian RdCVFL protein, including, but not limited to, human, mouse, rat, non-human primate, cat, and dog.

[0067] Generally in mice, the mouse long isoform (RdCVFL) is a 217 amino acid long protein and is referenced under Q8VC33.

[0068] In the present application, the long isoform RdCVFL is in particular the human long isoform (hRdCVFL) referenced under accession number Q96CM4 and having the sequence set forth in SEQ ID NO:2.

[0069] In particular, the short isoform hRdCVFL can be encoded by the nucleic acid set forth in SEQ ID NO:5.

[0070] Alternatively, the nucleic acid encoding the long isoform hRdCVFL can be a nucleic acid that differs from SEQ ID NO:5 but encodes the same amino acid sequence of SEQ ID NO:2.

[0071] Suitable nucleic acid sequences include, but are not limited to: - polymorphisms in the cDNA encoding human RdCVFL or combinations thereof; - "optimized" sequences in which certain codons have been replaced with codons encoding the same amino acids. Suitable codon-optimized sequences encoding human RdCVFL include, but are not limited to, the sequence set forth in SEQ ID NO: 8; - Homologous sequences in other species.

[0072] In particular, the short isoform hRdCVFL is encoded by a nucleic acid corresponding to the codon-optimized cDNA set forth in SEQ ID NO:8.

[0073] For purposes of the present invention, "GIRK1 F137S" refers to a nucleotide sequence encoding a mutant form of wild-type G protein-gated inwardly rectifying potassium channel subunit 1 (GIRK1) in which Phe137 is replaced with Ser, and which retains the ability to respond to light when co-expressed with opsin. In particular, the mutant form is a human wild-type GIRK1 (SEQ ID NO: 9) or a mouse wild-type GIRK1 (SEQ ID NO: 12).

[0074] GIRK1 F137S may differ from wild-type GIRK1 only by the substitution of Phe137 with Ser (e.g., as in SEQ ID NO: 11) or by a limited number of mutations, for example, by the substitution and / or deletion and / or insertion of at most 1, 2, 3, 4, or 5 amino acids in addition to the substitution of Phe137 with Ser.

[0075] For example, the nucleotide sequence encoding GIRK1 F137S comprises or consists of a nucleotide sequence encoding a polypeptide of the sequence of SEQ ID NO: 11; or comprises or consists of a nucleotide sequence of SEQ ID NO: 10; or comprises or consists of a nucleotide sequence encoding a polypeptide of the sequence of SEQ ID NO: 13.

[0076] For purposes of the present invention, "GIRK4 S143T" refers to a nucleotide sequence encoding a mutant form of wild-type G protein-gated inwardly rectifying potassium channel subunit 4 (GIRK4) in which Ser143 is replaced by Thr, and which retains the ability to respond to light when co-expressed with opsin. Specifically, this is a mutant form of human wild-type GIRK4 (SEQ ID NO: 38).

[0077] GIRK4 S143T may differ from wild-type GIRK4 only by the substitution of Ser143 with Thr (e.g., as in SEQ ID NO: 38) or by a limited number of mutations, e.g., the substitution of Ser143 with Thr plus substitutions and / or deletions and / or insertions of at most 1, 2, 3, 4, or 5 amino acids.

[0078] For example, the nucleotide sequence encoding GIRK4 S143T comprises or consists of a nucleotide sequence encoding a polypeptide of the sequence of SEQ ID NO: 40; or comprises or consists of the nucleotide sequence of SEQ ID NO: 39.

[0079] Examples of the cDNA and amino acid sequences of the transgenes RdCVF, RdCVFL, GIRK1 F137S, or GIRK4 S143T are provided in Tables 1 to 4 below.

[0080] [Table 1] [Table 2] [Table 3] JPEG2025538863000004.jpg160169 [Table 4]

[0081] Typically, the nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively, are under the control of a promoter that allows expression of said proteins in the target cell.

[0082] Suitable promoters include ubiquitous promoters, such as chicken beta actin (CBA) promoter, chicken beta hybrid (CBh) promoter, cytomegalovirus (CMV) promoter, CMV / CBA promoter, and CAG promoter.

[0083] In particular, the CBh promoter is as set forth in SEQ ID NO:14.

[0084] A suitable promoter may be one that allows expression in the retina, preferably in retinal pigment epithelial cells and photoreceptor cells such as cones and rods.

[0085] In one embodiment, the promoter allows expression of the nucleic acid in retinal pigment epithelial cells and / or photoreceptor cells. Non-limiting examples include rhodopsin kinase (GRK) promoters that target expression in cones and rods, such as the GRK1 promoter, GRK1-93 promoter, IRBP promoter, and mCAR promoter.

[0086] In particular, the GRK1 promoter is as set forth in SEQ ID NO:15.

[0087] In particular, the GRK1-93 promoter is as set forth in SEQ ID NO:16.

[0088] In one embodiment, the promoter enables nucleic acid expression in cone photoreceptors. Non-limiting examples include the cone opsin PR1.7 promoter and the ProA7 promoter. In one embodiment, the promoter enables nucleic acid expression in cone photoreceptors. Non-limiting examples include the cone opsin PR1.7 promoter or the ProA7 promoter.

[0089] In particular, the PR1.7 promoter is as set forth in SEQ ID NO:17.

[0090] In particular, the ProA7 promoter is as set forth in SEQ ID NO:18.

[0091] Table 5 provides the specific nucleic acid sequences of the promoters.

[0092] [Table 5] JPEG2025538863000007.jpg216169

[0093] Typically, the short isoform of the NXNL1 gene is expressed by at least retinal pigment epithelial cells, and the long isoform of the NXNL1 gene, as well as GIRK1 F137S or GIRK4 S143T, are expressed by at least cone photoreceptors.

[0094] Typically, expression of the nucleic acid encoding RdCVF is driven by the CBh promoter, particularly as set forth in SEQ ID NO:14.

[0095] Typically, expression of the nucleic acid encoding RdCVFL is driven by the ProA7 promoter set forth in SEQ ID NO:18 or the GRK1 promoter set forth in SEQ ID NO:15.

[0096] Typically, expression of a nucleic acid encoding GIRK1 F137S or GIRK4 S143T is driven by the GRK1-93 promoter set forth in SEQ ID NO:16.

[0097] In a specific embodiment, when the viral vector described above comprises two or three nucleic acids encoding RdCVF, RdCVFL and / or GIRK1 F137S or GIRK4 S143T, each nucleic acid is under the control of a different promoter.

[0098] Typically, when the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively, the nucleic acid encoding RdCVF is under the control of the CBh promoter, the nucleic acid encoding RdCVFL is under the control of the ProA7 promoter or the GRK1 promoter, and the nucleic acid encoding GIRK1 F137S or GIRK4 S143T is under the control of the GRK1-93 promoter.

[0099] In a specific embodiment, when the above-mentioned viral vector comprises two or three nucleic acids encoding RdCVF, RdCVFL, and / or GIRK1 F137S or GIRK4 S143T, at least two nucleic acids may be under the control of the same promoter and may be linked by a nucleic acid sequence encoding a 2A self-cleaving peptide.

[0100] 2A self-cleaving peptides, or 2A peptides, are a class of 18-22 amino acid long peptides that can induce ribosomal skipping during protein translation in cells. These peptides share the core sequence motif of DxExNPGP (SEQ ID NO: 19).

[0101] Examples of 2A self-cleaving peptides include P2A (SEQ ID NO: 20), T2A (SEQ ID NO: 21), E2A (SEQ ID NO: 22) and F2A (SEQ ID NO: 23). The sequences are provided in Table 6.

[0102] [Table 6]

[0103] In particular, the P2A self-cleaving peptide is the P2A peptide set forth in SEQ ID NO: 20. In a particular embodiment, the P2A peptide is encoded by the nucleic acid sequence set forth in SEQ ID NO: 24.

[0104] In a specific embodiment, the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively, wherein the nucleic acid encoding RdCVF is under the control of a promoter, particularly the CBh promoter, and the nucleic acid encoding RdCVFL is under the control of a promoter, particularly the GRK1 promoter, and is linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, particularly a P2A peptide.

[0105] In a specific embodiment, the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively, wherein the nucleic acid encoding RdCVF is under the control of a promoter, particularly the CBh promoter, and is linked to the nucleic acid encoding RdCVFL by a nucleic acid sequence encoding a 2A self-cleaving peptide, which is linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, particularly a P2A peptide.

[0106] In a specific embodiment, the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively, wherein the nucleic acid encoding RdCVF is under the control of a promoter, particularly the CBh promoter, and is linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, particularly a P2A peptide, which is linked to the nucleic acid encoding RdCVFL by a nucleic acid sequence encoding a 2A self-cleaving peptide, particularly a P2A peptide.

[0107] Like all AAV vectors, the viral vector according to the invention contains 5' and 3' ITR sequences.

[0108] In certain embodiments, the viral vector comprises two or three nucleic acids encoding RdCVF, RdCVFL, and / or GIRK1 F137S or GIRK4 S143T, and at least two nucleic acids are linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, and the nucleic acids are in any order following the 5' ITR. More specifically, the first nucleic acid following the 5' ITR is a nucleic acid encoding RdCVF.

[0109] In certain embodiments in which the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and / or GIRK1 F137S or GIRK4 S143T, all of which are linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, the first nucleic acid following the 5' ITR is the nucleic acid encoding RdCVF, and the second nucleic acid is the nucleic acid encoding RdCVFL.

[0110] In certain embodiments in which the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and / or GIRK1 F137S or GIRK4 S143T, all of which are linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, the first nucleic acid following the 5' ITR is the nucleic acid encoding RdCVF, and the second nucleic acid is the nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[0111] In certain embodiments, the viral vector described in the present disclosure further comprises post-transcriptional regulatory element (PRE).This is a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression.This kind of sequence is commonly used in molecular biology to increase the expression of the gene delivered by viral vector.

[0112] In a more particular embodiment, it is the Woodchuck Hepatitis Virus PRE (WPRE), more particularly as set forth in SEQ ID NO:25. SEQ ID NO: 25 cgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgt ataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccc tccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctg cgcgggagtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgg

[0113] As used herein, the term "viral vector" has its general meaning in the art, and in particular includes vectors derived from adeno-associated viruses (AAV), herpes viruses (e.g., herpes simplex viruses (HSV)), adenoviruses, retroviruses, lentiviruses, or vaccinia / pox viruses.

[0114] In this disclosure, the term "adeno-associated viral vector" or "AAV vector" has its general meaning in the art.

[0115] AAV and AAV vectors have been widely described in the art as suitable vectors for gene transfer.

[0116] In fact, AAV is non-pathogenic and exhibits broad tissue specificity depending on the serotype. Typically, the AAV according to the present invention is an AAV that can target retinal cells. More specifically, the AAV according to the present invention is an AAV that can efficiently transduce retinal cells by intravitreal injection.

[0117] For example, the AAV may be AAV2 or an improved version thereof, which efficiently transduces retinal cells via intravitreal injection. For example, the AAV may be an AAV containing an inserted peptide within the capsid protein, such as the AAV2-7M8 capsid variant, as described in International Patent Application WO2012 / 145601 and Dalkara et al. (2013)

[38] . The AAV2-7M8 capsid variant is an AAV2 containing an inserted peptide called 7m8 within the capsid protein. Other modified forms may be NHP26

[39] , NHP9, R100

[40] , or other similar variants designed by directed evolution, rational design, and / or machine learning approaches commonly known in the art.

[0118] The AAV may also be an AAV serotype or variant that efficiently transduces retinal cells by subretinal injection, such as AAV8 (also called AAV2 / 8), AAV5, or the AAV9-7M8 capsid variant described in International Patent Application WO 2012 / 145601. The AAV9-7M8 capsid variant is an AAV9 that contains an inserted peptide called 7m8 within the capsid protein.

[0119] The above-mentioned AAVs, AAV2, AAV5, AAV8, and AAV9 may be modified by an inserted peptide in the capsid protein, and in fact may contain a variant VP1 capsid protein, which contains an inserted peptide of 7 to 11 amino acids in the GH loop of the capsid protein relative to the corresponding parent AAV capsid protein.

[0120] The inserted peptide may be as set forth in SEQ ID NO: 26 (nickname of 7m8), SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, as described in WO2019 / 077159 and Table 7 below.

[0121] The inserted peptide may also be as set forth in SEQ ID NO: 35

[33] or SEQ ID NO: 41.

[0122] [Table 7]

[0123] The inserted peptide may also be as set forth in SEQ ID NO: 36 (LAISDQTKHA). Thus, the AAV serotypes described above may comprise an inserted peptide as set forth in SEQ ID NO: 36.

[0124] Thus, further examples of AAV are AAV serotypes as described above, namely AAV2, AAV5, AAV8 or AAV9, and include an inserted peptide as described above.

[0125] In certain embodiments, the above-cited AAV may comprise a variant AAV capsid protein such as that set forth in SEQ ID NO:37.

[0126] In certain embodiments, the above-cited AAV may comprise a variant AAV capsid protein as set forth in SEQ ID NO: 42 of WO2019104279A1.

[0127] In one embodiment, the AAV and AAV vectors according to the invention are obtained according to the methods described in International Patent Application WO2012 / 158757.

[0128] In a particular embodiment, said AAV capsid is obtained according to the method described in patent application US9193956B2.

[0129] In another aspect, the present invention features the pharmaceutical composition described above, the kit described above, or the viral vector described above, for use in treating a retinal degenerative disease.

[0130] In the context of the present invention, the terms "treat" or "treatment" as used herein mean to reverse, alleviate, inhibit the progression of, or prevent the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition (e.g., retinal degenerative disease).

[0131] In this application, the term "retinal degenerative disease" includes all diseases associated with the degeneration of rods and cones, including different subgroups of pathologies: rod-cone dystrophies, cone dystrophies, cone-rod dystrophies, and atrophic age-related macular degeneration.

[0132] Thus, in certain embodiments, the present invention relates to the above-described pharmaceutical composition, the above-described kit, or the above-described viral vector for the treatment of a retinal degenerative disease, wherein the retinal degenerative disease is rod-cone dystrophy (RCD), cone dystrophy (CD), cone-rod dystrophy (CRD), or atrophic age-related macular degeneration (AMD).

[0133] Retinal degenerative diseases include, but are not limited to, retinitis pigmentosa, age-related macular degeneration, Bardet-Biedl syndrome, Bassen-Kornzweig syndrome, Best disease, choroideremia, cyclotrophy, Leber's congenital amaurosis, Refsum's disease, Stargardt's disease, or Usher syndrome.

[0134] In certain embodiments, the retinal degenerative disease is a rod-cone dystrophy, more particularly retinitis pigmentosa, in particular non-syndromic X-linked retinitis pigmentosa (XLRP), autosomal recessive RP or autosomal dominant RP.

[0135] In certain embodiments, the retinal degenerative disease is a cone-rod dystrophy, more particularly Stargardt disease, X-linked cone dystrophy, and Bardet-Biedl syndrome.

[0136] In certain embodiments, the pharmaceutical composition, kit, or viral vector is administered to a patient in need thereof by subretinal, intravitreal, and suprachoroidal injection. Delivery of the vector may be submacular or subfoveal, or to the bleb distal to the fovea without isolating said area.

[0137] When the kit is administered to a patient for the treatment of a retinal degenerative disease, the pharmaceutical compositions of the kit may be administered simultaneously or separately over time.

[0138] By "concurrently" it is meant that the compositions of the kit are administered at the same time or one after the other within a time limit of 1 hour, more preferably within a time limit of 15 minutes.

[0139] "Separately over time" can mean that the time between administration of the two compositions occurs at two time points, and the time between the two time points is greater than one day. In one embodiment, this can be within a period of one to six months. In another embodiment, this can be within a time span of six months to one year. In a further embodiment, this can be within a time span of one year to ten years.

[0140] "Separately over time" may mean that each composition is administered at a different stage of the disease. In a preferred embodiment, the nucleic acids encoding RdCVF and RdCVFL are administered at an earlier stage of disease progression than the nucleic acids encoding GIRK1 F137S or GIRK4 S143T. In a further embodiment, the nucleic acids encoding RdCVF and RdCVFL are administered at a time point in disease progression when rod cell loss is moderate to severe, while the nucleic acids encoding GIRK1 F137S or GIRK4 S143T are administered at a time point in further disease progression when cone cell outer segments show moderate to severe degeneration.

[0141] The stoichiometry between the pharmaceutical compositions of the kit can be varied to obtain optimal protection and functional recovery.

[0142] In particular, the compositions of the kit containing nucleic acids encoding RdCVF and RdCVFL are administered at a time point of disease progression accompanied by moderate to severe loss of rod cells, and the compositions of the kit containing nucleic acids encoding GIRK1 F137S or GIRK4 S143T are administered at a time point of further disease progression accompanied by moderate to severe degeneration of the outer segments of cone cells.

[0143] In particular, when the kit comprises two pharmaceutical compositions: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, Or, when the kit comprises three pharmaceutical compositions: - the first pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding RdCVF; - the second pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding RdCVFL; and - a third pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T; the composition of the kit comprising a vector comprising a nucleic acid encoding RdCVF and / or RdCVFL is administered at a time of disease progression with moderate to severe loss of rod cells; And, the composition of the kit, which comprises a vector containing a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, is administered at a time point of further disease progression when the outer segments of cone cells show moderate to severe degeneration. Therefore, the compositions of the kit containing a vector comprising a nucleic acid encoding RdCVF and / or RdCVFL are administered at an earlier stage in the progression of the disease than the compositions of the kit containing a vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T. Depending on the onset of the disease, the time between administration of the composition of the kit containing a vector comprising a nucleic acid encoding RdCVF and / or RdCVFL and administration of the composition of the kit containing a nucleic acid encoding GIRK1 F137S or GIRK4 S143T is 1 day, 1 to 6 months, 6 months to 1 year, or 1 year to 10 years.

[0144] The present invention also relates to a method for treating a retinal degenerative disease, comprising the step of administering a therapeutically effective amount of the pharmaceutical composition, the viral vector, or the pharmaceutical composition included in the kit to a patient in need thereof.

[0145] As used herein, the term "therapeutically effective amount" refers to an amount sufficient to achieve a desired biological effect, in this case, an amount sufficient to increase neuronal survival and thereby inhibit the progression of symptoms or disease in a patient in need thereof. It is understood that the effective amount will depend on the recipient's age, sex, health, and weight, the type of concurrent treatment, if any, the frequency of treatment, and the nature of the desired effect. However, preferred dosages can be tailored to individual subjects without undue experimentation, as is understood and determinable by those skilled in the art.

[0146] The present invention also relates to the use of the above pharmaceutical composition, the above kit, or the above viral vector in the treatment of a retinal degenerative disease.

[0147] BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 Figure 1 shows the phototransduction cascade: (A) a typical phototransduction cascade, and (B) a short phototransduction cascade using animal opsin and the GIRK2 channel. PDE: phosphodiesterase. CNG: cyclic nucleotide-gated channel. cGMP: cyclic guanosine monophosphate.

[0148] Figure 2 [Figure 2] shows the plasmids: (A) CMV-GIRK2-GFP, and (B) CMV-SWO-mCherry.

[0149] Figure 3 Figure 3 shows the remaining phototransduction cascade in rd10 mice using immunohistochemistry. (A-D) Retinal cross-sections from control WT mice stained for (A) opsin, (B) transducin, (C) PDE, and (D) cone arrestin. (E-H) Retinal cross-sections from rd10 mice at P14 stained for (E) opsin, (F) transducin, (G) PDE, and (H) cone arrestin. (I-L) Retinal cross-sections from rd10 mice at P150 stained for (I) opsin, (J) transducin, (K) PDE, and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cell. Scale bar: 50 μm. Inset: 25 μm.

[0150] Figure 4 Figure 4 shows preliminary data. (A) Fundus of GIRK2-GFP expression in rd10 mice 1 week after injection (* injection site). (B) Photopic ERG amplitude in rd10 mice at P33 injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice were injected with AAV-GFP (n=12). P=0.0002. (C) Representative flicker ERG at P33. (D) Measurement of visual acuity by optokinetic testing in rd10 mice injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice were injected with AAV-GFP. Control mice were injected with AAV-GFP (n=8).

[0151] Figure 5 Figure 5 shows GIRK2-mediated vision. (A) Photopic ERG amplitude in rd10 mice at P41 injected with AAV-SWO-tdTomato and / or AAV-GIRK2-GFP. Control mice were injected with AAV-GFP (n=12). PSWO+GIRK2=0.0381 and PGIRK2=0.0021. (B) Measurement of visual acuity by optokinetic testing in rd10 mice injected with AAV-SWO-tdTomato and / or AAV-GIRK2-GFP. Control mice were injected with AAV-GFP. Control mice were injected with AAV-GFP (n=7). (C) Representative flicker ERG at P41.

[0152] Figure 6 Figure 6 shows long-term efficacy. (A) Photopic ERG amplitude in rd10 mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (B) Visual acuity measured by optokinetic testing in rd10 mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (C) Cone number over time in wild-type and uninjected rd10 mice (n=6). P value (P50-P365) = 0.0022. (D) Linear regression correlation between ERG amplitude and cone number in rd10 mice (n=6). P value uninjected = 0.0482. P value AAV-GIRK2-GFP = 0.0007. P value PBS = 0.0104.

[0153] Figure 7 Figure 7 shows the remaining phototransduction cascade in huP347S+ / - mice using immunohistochemistry. (A-D) Retinal cross-sections from control WT mice stained for (A) opsin, (B) transducin, (C) PDE, and (D) cone arrestin. (E-H) Retinal cross-sections from huP347S+ / - mice at P14 stained for (E) opsin, (F) transducin, (G) PDE, and (H) cone arrestin. (I-L) Retinal cross-sections from huP347S+ / - mice at P150 stained for (I) opsin, (J) transducin, (K) PDE, and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cell. Scale bar: 50 μm. Inset: 25 μm.

[0154] Figure 8 Figure 8 demonstrates the generality of the approach. (A) Photopic ERG amplitude in huP347S+ / - mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (B) Visual acuity measured by optokinetic testing in huP347S+ / - mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (C) Cone number over time in wild-type and uninjected huP347S+ / - mice (n=6). P value (P50-P365) = 0.0022. (D) Linear regression correlation between ERG amplitude and cone number in huP347S+ / - mice (n=5). P value uninjected = 0.0313. P value AAV-GIRK2-GFP = 0.0146. P value PBS = 0.0497.

[0155] Figure 9 [Figure 9] shows the efficiency of mouse GIRK2 in HEK cells transfected with two plasmids: CMV-SWO-mCherry and CMV-GIRK2-GFP.

[0156] Figure 10 Figure 10 shows cone opsin and arrestin expression in normal retinal tissue and human retinal tissue from RCD. (A) Retinal cross-section (40x magnification) from a 91-year-old with no visual impairment. 5B-E) Retinal cross-sections (40x magnification) from the macula of human RCD from four different donors.

[0157] Figure 11 Figure 11 shows the characteristics of GIRK1 F137S currents induced by mOpn4L activation in HEK293 cells. A) When activated with blue light (471 nm, 10 to 20 seconds on the horizontal axis), mOpn4L induces robust GIRK1 F137S-mediated currents that are terminated by stimulation with lime light (560 nm, 20 to 60 seconds on the horizontal axis), resulting in statistically significant differences in B) ion flux across the HEK293 membrane and C) current density per capacitance.

[0158] Figure 12 [Figure 12] shows the characteristics of GIRK1 or GIRK2 currents induced by mOpn4L activation in HEK293 cells when activated with blue light (471 nm, 10 to 20 seconds of illumination on the horizontal axis) and terminated by stimulation with lime light (560 nm, 20 to 60 seconds of illumination on the horizontal axis).

[0159] Figure 13 Figure 13 shows the current density per capacitance of HEK293 cells expressing A1) hGIRK1 F137S, B1) hGIRK2, or C1) truncated rGIRK2. Current responses evoked by mOpn4 activation are shown compared to c-terminal eGFP fusion constructs and untransfected cells. Individual cell current densities are represented by individual data points. Significant differences between conditions are indicated by * (one-way ANOVA based on Kruskal-Wallis ranks (Dunn's method) with all pairwise multiple comparison procedures, P < 0.05). D1) Cells expressing hGIRK4 S143T are shown compared to untransfected cells. Significant differences between conditions are indicated by * (Mann-Whitney rank sum test; P = 0.002). When activated with blue light, mOpn4 induces a current through GIRK that is terminated upon stimulation with lime light, as seen in the exemplary traces of A2) hGIRK1 F137S, B2) hGIRK2, C2) truncated rGIRK2, and D2) hGIRK4 S143T constructs.

[0160] Figure 14 Figure 14. A) Stimulation of HEK293 cells expressing either hGIRK1 F137S, hGIRK1 F137S-eGFP, hGIRK4 S143T, or hGIRK2 with mOpn4 produces reliably observable currents in whole-cell patch-clamp recordings, whereas hGIRK2-eGFP, rGIRK2, or rGIRK2-eGFP currents following mOpn4 activation are unlikely to be observed. The top of each bar indicates the results for which no induced current was observed. The bottom of each bar indicates the results for which an induced current was observed. B) Current density per capacitance of HEK293 cells expressing different GIRK constructs (top) or their eGFP-tagged versions (bottom). Current densities of individual cells are represented by individual data points. Significant differences between conditions are indicated by * (one-way ANOVA based on Kruskal-Wallis ranks with Dunn's method, all pairwise multiple comparisons, P < 0.05).

[0161] Figure 15 [Figure 15] shows visual acuity in rd10 mice after bilateral subretinal injection of AAV8-pR1.7-hGIRK1F137S at 5E6 or 5E5vg / eye at P15, compared with vehicle-injected rd10 mice or naive (uninjected) rd10 mice.

[0162] [Example] Example 1: Materials and Methods

[0163] 1.Animals

[0164] C57BL / 6jrd10 / rd10 (rd10) mice were used in these experiments. These mice have a mutation in the rod PDE gene, which causes dysfunction of the phototransduction cascade and rod-cone dystrophy. The second model used was the huRhoP347S+ / - mouse. Homozygotes of this mouse exhibit a knockout of the mouse rhodopsin (mRho) gene and a knockout of human rhodopsin (huRho) with a mutation (P347S) (Millington-Ward et al., 2011)

[30] . Homozygous males were crossed with C57BL / 6j (wild-type) females to obtain heterozygous mice. These mice have a similar phenotype to rd10 mice, but at a lower rate of degeneration.

[0165] 2.AAV injection

[0166] Mice were first anesthetized with an intraperitoneal injection of 0.2 ml / 20 g of ketamine (Ketamine 500, Vibrac France) and xylazine (Xylazine 2%, Rompun) diluted in 0.9% NaCl. Eyes were dilated with 8% neosynephrine (Neosynephrine Faure 10%, Europhta) and 42% mydriaticum (Mydriaticum 0.5%, Thea) diluted in 0.9% NaCl.

[0167] A total volume of 1 μl of vector solution was injected subretinal. After injection, ophthalmic ointment, furadexam, was applied. The list of injected viral vectors is as follows:

[0168] [Table 8]

[0169] 3. Fundus examination

[0170] One week after subretinal injection, mice were anesthetized by isofluorane inhalation. Eyes were dilated and protected with Lubrital Eye Gel (VetXX). Fundus photography was performed using a fundus camera (Micron III; Phoenix Research Lab) equipped with specific filters to monitor GFP or tdTomato expression in live anesthetized mice.

[0171] 4. Electroretinogram (ERG) Recording

[0172] To assess retinal function, electroretinography (ERG) was recorded (Espion E2 ERG system; Diagnosys). Several tests were performed at different time points after viral vector injection. Mice were anesthetized with an intraperitoneal injection of 0.2 ml / 20 g of ketamine (Ketamine 500, Vibrac France) and xylazine (Xylazine 2%, Rompun) diluted in 0.9% NaCl. The mice were then placed on a 37°C heating pad. The eyes were dilated with neosynephrine (Neosynephrine Fore 10%, Europhta) and mydriaticum (Mydriaticum 0.5%, Thea) diluted in 0.9% NaCl. The eyes were protected with Lubrital eye gel before applying electrodes to the corneal surface of each eye. A reference electrode was inserted subcutaneously on the forehead, and a ground electrode was inserted subcutaneously on the back.

[0173] ERG recordings were performed under two conditions: (i) a photophotic condition reflecting cone-driven light responses—6-ms light flashes every 1 second for 60 seconds at increasing light intensities (0.1 / 1 / 10 / 50 cd s / m) after 5 minutes of adaptation at 20 cd s / m—and (ii) a flicker condition (70 flashes at 10 Hz and 1 cd s / m), a fast-frequency light stimulus reflecting cone function.

[0174] Graphical and statistical analyses were performed using GraphPad.

[0175] 5. Optokinetic Test

[0176] Visual acuity was measured using an optokinetic test, in which mice were scored for head rotation when placed in front of a moving bar. The test was performed using a computer-based machine consisting of four computer monitors arranged in a square to form an optokinetic chamber. A computer program was designed to generate alternating black and white stripes to generate the optokinetic stimuli. The spatial frequency ranged from 0.03 to 0.6 cycles per degree. The program allowed adjustment of the width of the stripes and the direction of the moving bar.

[0177] 6. Immunohistochemistry and Confocal Imaging

[0178] Animals were sacrificed by CO2 inhalation, and the eyes were enucleated and fixed in 4% paraformaldehyde-PBS at room temperature for 1 hour. The eyes were either dissected into eyecups for immunohistochemistry or prepared as flat mounts for cell counting. The eyecups were then cryoprotected in a 10% PBS-sucrose gradient for 1 hour, followed by 30% PBS-sucrose overnight. The eyecups were embedded in OCT, and 12-μm-thick cryostat sections (ThermoFisher) were cut and mounted on glass slides. The sections were washed in PBS (3 × 5 min) and stained with different antibodies (see table below) and DAPI (1:2000). Finally, the sections were washed in PBS, mounted in Fluoromount Vactashield (Vector Laboratories), and coverslipped for imaging using a laser confocal microscope (Olympus IX81). For flat-mount retinal staining, the protocol was the same except that the tissue was not cryoprotected. Images were analyzed using FIJI software.

[0179] [Table 9]

[0180] 7. Cell Counting

[0181] Flat-mounted retinas from rd10 and huRhoP347S+ / - mice were stained with the antibody mCAR (1:10,000) against mouse cone arrestin and DAPI (1:2,000). Double-stained cells were counted at different ages. Retinas from five animals (n = 10) were used for each age, oriented dorsoventrally and nasotemporally. Serial optical sections were obtained covering the entire thickness of the outer nuclear layer (ONL). Two scans measuring 211.97 × 211.97 μm were created in each of the four regions of every retina. Cone cell counts were performed manually using FIJI software by reconstructing images (z-stacks) covering the entire thickness of the ONL. Average density values ​​for each retina were calculated to determine the number of cone cells per mm² at different ages.

[0182] 8. In vitro testing of mouse GIRK2 efficiency

[0183] HEK cells were transfected with two plasmids: CMV-SWO-mCherry and CMV-GIRK2-GFP (Figure 2) according to techniques well known in the art. After transfection, HEK293 cells were cultured and recorded under dark conditions. Cells were placed in the recording chamber of a microscope equipped with a 25x water-immersion objective (XLPlanN-25x-W-MP / NA1.05, Olympus) at 36°C in oxygenated (95% O2 / 5% CO2) Ames medium (Sigma-Aldrich) supplemented with 1 mM 9-cis-retinal. To obtain a high extracellular potassium concentration, K-gluconate was added to the external solution, resulting in a cellular potassium reversal potential of -40 mV.

[0184] For whole-cell recordings, GIRK-mediated K+ currents were recorded in the voltage-clamp configuration at −80 mV using an Axon Multiclamp 700B amplifier (Molecular Device Cellular Neurosciences) using borosilicate glass pipettes (BF100-50-10, Sutter Instrument) stretched to 5 MΩ and filled with 115 mM K-gluconate, 10 mM KCl, 1 mM MgCl, 0.5 mM CaCl, 1.5 mM EGTA, 10 mM HEPES, and 4 mM ATP-Na (pH 7.2).

[0185] During the experiments, cells were visualized using transmitted infrared light with a CCD camera (Hamamatsu Corp.). A monochromatic light source (Polychrome V, TILL photonics) was used to stimulate cells with a 400 nm light flash during electrophysiological experiments.

[0186] 9. Fundus photography of the patient

[0187] We imaged the cone photoreceptor mosaic at cellular resolution using adaptive optics scanning laser ophthalmoscope (AOSLO) (Roorda et al. Opt Exp 2002). The AOSLO device (MAORI, PSI, Andover, MA, USA) allows simultaneous imaging of intact cones with both inner and outer segments (IS, OS) from light scattered along the optical axis (confocal mode) over a 2-degree field of view, and imaging of the inner segment (IS) from multiply scattered light scattered off-axis (split detection mode). This allows differential imaging of IS vs. IS+OS for each cone to assess the presence and integrity of the cone.

[0188] Example 2: Results

[0189] 1. Changes in the phototransduction cascade in degenerated cones

[0190] We first analyzed the phototransduction cascade by examining its components using immunohistochemistry in the rd10 mouse model at different time points of retinal degeneration. We performed immunofluorescence staining for cone opsin, transducin, phosphodiesterase, and cone arrestin proteins that directly interact with cone opsin in the phototransduction cascade.

[0191] FIG. 3 shows that only cone opsins and arrestins are expressed and localized around the cone cell bodies, even at late stages of the disease.

[0192] 2. Vision restoration via cone opsin and GIRK2

[0193] Based on immunohistochemistry and previous findings regarding neuronally expressed cone opsins, we first investigated why delivery of two AAV vectors, consisting of an equimolar mixture of mouse short-wavelength cone opsin (SWO) fused to tdTomato and a truncated rat GIRK2 fused to GFP, enhances the cone cell response to light. Therefore, we subretinal injected the two AAV vectors into rd10 mouse retinas undergoing p15 degeneration (Figure 4A). Light-evoked ERG amplitude in treated eyes was significantly increased compared to controls (Figure 4B). Flicker ERG confirmed that recovery mechanisms were still active in these GIRK2-expressing cone cells, allowing them to follow fast stimuli (Figure 4C). GIRK2-treated rd10 animals also exhibited improved optokinetic reflexes compared to controls (Figure 4D).

[0194] Next, we investigated whether the endogenous cone opsin still present in the degenerating cones in this mouse model was functional and sufficient to activate the GIRK2 channel. To this end, we administered a single AAV8 vector encoding GIRK2 fused to GFP. Treated eyes showed similar increases in photopic ERG amplitude and optokinetic reflex compared to controls, confirming that GIRK2 alone is sufficient to increase light sensitivity via G protein-coupled signaling involving cone opsin (Figure 5A-B). Flicker ERGs were also robustly amplified by this approach (Figure 5C).

[0195] 3. GIRK2-mediated vision restoration: Long-term efficacy

[0196] To monitor cone responses to light stimuli, photopic ERG recordings were performed at different time points after and without GIRK2 treatment. These ERGs were performed under two conditions: (i) photopic, in which light flashes were delivered every 1 second for 60 seconds with increasing light intensity, and (ii) flicker, in which repeated flashes were delivered over 60 seconds. Data were collected weekly until p50 and then every 10–13 days until 11 weeks of age, demonstrating a gradual decline in ERG amplitude for both control and treated eyes (Figure 6A). Furthermore, these results were consistent with optokinetic testing, showing a decline in the optokinetic reflex over time in both control and GIRK2-treated eyes (Figure 6B). This decline was expected, as cone number also decreased over time in rd10 mice (Figure 6C). The number of remaining cone photoreceptors in rd10 retinas was counted to correlate the decrease in cone number with the decrease in ERG amplitude. Indeed, the decrease in light response was proportional to the number of remaining photoreceptors (Fig. 6D).We therefore concluded that GIRK2 increased the light response of remaining cones as long as the cones remained viable, but, as expected, failed to delay cone cell loss.

[0197] 4. GIRK2-mediated visual recovery in a mutant rhodopsin-induced RCD model

[0198] With the goal of developing a mutation-independent therapy in mind, this approach was tested in another mouse model harboring a different causative mutation. To this end, experiments were performed in a heterozygous mouse model called mRho- / -huRhoP347S+ / -, which harbors a knock-in for the P347S mutant human rhodopsin. In this complementation model, deletion of mutant human rhodopsin and mouse rhodopsin led to rod-cone dystrophy. Here, we repeated the same series of experiments performed in the rd10 mouse model. First, we analyzed the phototransduction cascade proteins that interact with cone opsin at different time points (Figure 7). We confirmed that (i) the degeneration rate was slower than in the rd10 model, and (ii) similar to the rd10 model, only opsin and arrestin remained in the cone cell bodies at P150.

[0199] Next, we injected the same AAV vector encoding GIRK2 fused to GFP into mice at P15, and ERG recordings were performed to monitor cone responses to light stimulation at various time points (Figure 8A). The response amplitude of the treated eye was significantly higher than that of the control eye until P100. Furthermore, flicker ERG responses were also similarly improved in this mouse model. Similar to rd10 mice, this mouse model also exhibited improved optokinetic reflexes, which decreased over time in both control and treated conditions (Figure 8B). This decrease is expected, as cone number in this RCD mouse model also decreases over time (Figure 8C). The temporal decrease in ERG amplitude also correlated with the decrease in cone number in this model (Figure 8D). This is again consistent with the fact that the approach did not halt degeneration but was able to enhance GIRK2-mediated light sensitivity.

[0200] 5. Efficacy of mouse GIRK2 in in vitro studies

[0201] In HEK cells expressing both GIRK and SWO (short-wavelength opsin), light stimulation (400 nm, 5 seconds, full field) activated GIRK currents (Figure 9). GIRK channels are regulated in a membrane-restricted and rapid manner via the Gi / o pathway, and expression of mouse GIRK channels was membrane-bound. The amplitude and kinetics of light-induced activation and inactivation of GIRK channels by SWO induce large GIRK current amplitudes during a 5-second light pulse.

[0202] Example 3: GIRK1 F137S induces stronger currents than GIRK2 upon stimulation with blue light (471 nm).

[0203] Human embryonic kidney 293 (HEK293) cells stably expressing mouse Opn4L-mCherry are maintained in Dulbecco's modified Eagle's medium (DMEM), 4.5 g / L D-glucose, supplemented with 10% fetal bovine serum (Gibco) and penicillin / streptomycin, at 37 °C in a humidified incubator under 5% CO. HEK293 cells are transfected using FuGENE® HD (Promega) according to the manufacturer's protocol and incubated for 18–24 h before recording. Retinaldehyde is added to a final medium concentration of 1 μM.

[0204] For recording of GIRK channels, GIRK constructs were expressed in HEK293 cells stably expressing Opn4L-mCherry. After transfection, cells were cultured and recorded in the dark. GIRK-mediated K currents were measured and analyzed as described below. The external solution was: 20 mM NaCl, 120 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES-KOH, pH 7.3 (KOH). Patch pipettes (2–5 MΩ) were filled with the internal solution: 100 mM potassium aspartate, 40 mM KCl, 5 mM MgATP, 10 mM HEPES-KOH, 5 mM NaCl, 2 mM EGTA, 2 mM MgCl2, 0.01 mM GTP, pH 7.3 (KOH). Cells were recorded in an external solution containing 1 μM 9-cis retinal (Sigma). During the experimental procedure, cells were visualized using a transmitted red (590 nm) or green (480 nm) light filter. Whole-cell patch-clamp recordings of HEK293 cells were performed using an EPC10 amplifier (HEKA). Currents were digitized and filtered with an internal 10 kHz 3-pole Bessel filter (filter 1) connected in series with the EPC10 amplifier's 2.9 kHz 4-pole Bessel filter (filter 2). Series resistance was partially compensated between 70 and 90%.

[0205] To analyze and compare GIRK currents, HEK293 cells are voltage-clamped at -60 mV. To determine baseline currents, a 500 ms voltage ramp from -100 to +50 mV is applied before light exposure. A 10 s, 471 nm light pulse at -60 mV is then applied. The magnitude of the GIRK current is related to the conductance of the cells before and after light activation.

[0206] To analyze possible differences in the efficiency of G protein modulation and desensitization between different GIRK currents, we applied light pulses ranging from 0.1 to 60 seconds and varied the light intensity as described in our publications (Eickelbeck, D. et al. Commun. Biol. 2, (2019); Spoida, K. et al. Melanopsin Curr. Biol. 26, 1206-1212 (2016); Masseck, O. a. OA et al. Neuron 81, 1263-1273 (2014)).

[0207] As is evident from a comparison of Figures 11 and 12, GIRK1 F137S induces significantly more ion efflux than truncated rat GIRK2 (approximately 17-fold higher) in the context of the short GIRK / opsin phototransduction cascade in HEK cells, whereas wild-type GIRK1 is ineffective at inducing ion efflux. This result suggests that integration of GIRK1 F137S in cones may provide improved gene therapy over GIRK2 gene therapy for RCD.

[0208] Figures 13 and 14 also confirm that GIRK1 F137S (with or without GFP tag) induces significant ion flux compared to human or rat GIRK2 (with or without GFP tag).

[0209] Example 4: Vision restoration in GIRK1 F137S RCD model due to mutant rhodopsin

[0210] Using the same experimental model as in Example 2.2, we demonstrated that AAV-mediated expression of human GIRK1 F137S in the eyes of rd10 mice led to improved visual acuity at P37 as determined by optomotor testing. The results are shown in Figure 15.

[0211] P15 rd10 / rd10 mice received subretinal injections of AAV8-PR1.7-hGIRK1 F137S at a dose of 5e8vg / eye or 5e7vg / eye. At P30 and P37, OKT measurements were performed to assess visual function. Significant improvement in visual acuity was observed at P37, 3 weeks after administration of 5e8vg / eye.

[0212] Example 5: GIRK4 S143T induces significant ion flux compared to human or rat GIRK2.

[0213] The same method as in Example 3 was carried out.

[0214] Figures 13 and 14 show that GIRK4 S143T (with or without a GFP tag) induces significant ion flux compared to human or rat GIRK2 (with or without a GFP tag).

[0215] [Cited documents] 1. Sinha R, Hoon M, Baudin J, Okawa H, Wong ROL, Rieke F. 2017. Cellular and Circuit Mechanisms Shaping the Perceptual Properties of the Primate Fovea. Cell. 168(3):413-426.e12 2. Yau KW, Hardie RC. 2009. Phototransduction motifs and variations. Cell. 139(2):246-64 3. Ebrey T, Koutalos Y. 2001. Vertebrate photoreceptors. Prog Retin Eye Res. 20(1):49-94 4. Larhammar D, Nordstrom K, Larsson T a. 2009. Evolution of vertebrate rod and cone phototransduction genes. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 364(1531):2867-80 5. Maeda T, Imanishi Y, Palczewski K. 2003. Rhodopsin phosphorylation: 30 Years later. Prog. Retin Eye Res. 22(4): 417-434 6. Buch H et al. Prevalence and causes of visual impairment and blindness among 9980 Scandinavian adults: the Copenhagen City Eye Study. Ophthalmology. 2004;111(1):53-61. 7. Bramall AN, Wright AF, Jacobson SG, McInnes RR. The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Annu Rev Neurosci. 2010;33(1):441-472. 8. Punzo C, Kornacker K, Cepko CL. Stimulation of the insulin / mTOR pathway delays cone death in a mouse model of retinitis pigmentosa. Nat Neurosci. 2009;12(1):44-52. 9. Leveillard T et al. Identification and characterization of rod-derived cone viability factor. Nat Genet. 2004;36(7):755-759. 10. Mohand-Said S et al. Normal retina releases a diffusible factor stimulating cone survival in the retinal degeneration mouse. Proc Natl Acad Sci U S A. 1998;95(14):8357-8362. 11. Mohand-Said S et al. Photoreceptor transplants increase host cone survival in the retinal degeneration (rd) mouse. Ophthalmic Res. 1997;29(5):290-297. 12. Mohand-Said S, Hicks D, Dreyfus H, Sahel J-A. Selective transplantation of rods delays cone loss in a retinitis pigmentosa model. Arch Ophthalmol. 2000;118(6):807-811. 13. Wang XW, Tan BZ, Sun M, Ho B, Ding JL. Thioredoxin-like 6 protects retinal cell line from photooxidative damage by upregulating NF-kappaB activity. Free Radic Biol Med. 2008;45(3):336-344. 14. Yang Y et al. Functional Cone Rescue by RdCVF Protein in a Dominant Model of Retinitis Pigmentosa. Mol Ther. 2009;17(5):787-795. 15. Cronin T et al. The disruption of the rod-derived cone viability gene leads to photoreceptor dysfunction and susceptibility to oxidative stress. Cell Death Differ. 2010;17(7):1199-1210. 16. Brennan LA, Lee W, Kantorow M. TXNL6 is a novel oxidative stress-induced reducing system for methionine sulfoxide reductase a repair of α-crystallin and cytochrome C in the eye lens. PLoS ONE. [published online ahead of print: 2010]. 17. Funato Y, Miki H. Nucleoredoxin, a Novel Thioredoxin Family Member Involved in Cell Growth and Differentiation. Antioxid Redox Signal. 2007;9(8):1035-1058. 18. Lillig CH, Holmgren A. Thioredoxin and Related Molecules-From Biology to Health and Disease. Antioxid Redox Signal. 2007;9(1):25-47. 19. Byrne LC, Dalkara D, Luna G, Fisher SK, Clerin E, Sahel JA, Leveillard T, Flannery JG. Viral-mediated RdCVF and RdCVFL expression protects cone and rod photoreceptors in retinal degeneration. J Clin Invest. 2015 125(1):105-16. 20. Mei X., Chaffiol, A., Kole, C., Yang Y., Millet-Puel G., Clerin E., Ait-Ali N., Bennett, J., Dalkara D., Sahel JA, Duebel, J., Leveillard T., The thioredoxin encoded by the Rod-derived Cone Viability Factor gene protects cone photoreceptors against oxidative stress. Antioxid Redox Signal. 2016 May 12. 21. Elachouri G, Lee-Rivera I, Clerin E, Argentini M, Fridlich R, Blond F, Ferracane V, Yang Y, Raffelsberger W, Wan J, Bennett J, Sahel JA, Zack DJ, Leveillard T: Thioredoxin rod-derived cone viability factor protects against photooxidative retinal damage. Free radical biology & medicine 2015, 81:22-29. 22. Ait-Ali N, Fridlich R, Millet-Puel G, Clerin E, Delalande F, Jaillard C, Blond F, Perrocheau L, Reichman S, Byrne LC, Olivier-Bandini A, Bellalou J, Moyse E, Bouillaud F, Nicol X, Dalkara D, van Dorsselaer A, Sahel JA, Leveillard T: Rod-derived cone viability factor promotes cone survival by stimulating aerobic glycolysis. Cell 2015, 161(4):817-832. 23. Simon C.-J. et al. Poster entitled G-protein gated K+ channel-mediated vision restoration in Rod-Cone dystrophy. ESGCT Barcelona, 24 October 2019. 24. Dryja et al., Gene-based approach to human gene-phenotype correlations. Proc Natl Acad Sci U S A. 1997 Oct 28;94(22):12117-21. 25. Sinha R, Hoon M, Baudin J, Okawa H, Wong ROL, Rieke F. 2017. Cellular and Circuit Mechanisms Shaping the Perceptual Properties of the Primate Fovea. Cell. 168(3):413-426. 26. Leveillard, T and Sahel, JA (2010). "Rod-derived cone viability factor for treating blinding diseases: from clinic to redox signaling." Sci Transl Med 2(26): 26ps16. 27. Lindblad, AS; Lloyd, PC; Clemons, TE; Gensler, GR; Ferris FL, 3rd; Klein, ML; Armstrong, JR; Age-Related Eye Disease Study Research, Group. (September 2009). "Change in area of geographic atrophy in the Age-Related Eye Disease Study: AREDS report number 26" (PDF). Archives of Ophthalmology. 127 (9): 1168-74. doi:10.1001 / archophthalmol.2009.198. 28. Sunness, JS (3 November 1999). "The natural history of geographic atrophy, the advanced atrophic form of age-related macular degeneration". Molecular Vision. 5: 25. 29. Bonilha, Vera L (2008). "Age and disease-related structural changes in the retinal pigment epithelium". Clinical Ophthalmology (Auckland, N.Z.). 2 (2): 413-424. 30. Lindner, Moritz; Fleckenstein, Monika; Schmitz-Valckenberg, Steffen; Holz, Frank G. (2018), "Atrophy, Geographic", Encyclopedia of Ophthalmology, Springer Berlin Heidelberg, pp. 207-209. 31. Wong, Wan Ling; Su, Xinyi; Li, Xiang; Cheung, Chui Ming G; Klein, Ronald; Cheng, Ching-Yu; Wong, Tien Yin (February 2014). "Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis". The Lancet Global Health. 2 (2): e106-e116. 32. Rudnicka, Alicja R.; Kapetanakis, Venediktos V.; Jarrar, Zakariya; Wathern, Andrea K.; Wormald, Richard; Fletcher, Astrid E.; Cook, Derek G.; Owen, Christopher G. (July 2015). "Incidence of Late-Stage Age-Related Macular Degeneration in American Whites: Systematic Review and Meta-analysis". American Journal of Ophthalmology. 160 (1): 85-93.e3. 33. Dalkara et al., 2013. “In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery form the vitreous”. Science Translational Medecine, Vol 5, issue 189. 34. Berry MH, Holt A, Levitz J, Visel M, Aghi K, et al. Restoration of high-sensitivity , adapting , patterned vision with a cone opsin. Nature Communications. (2019):1-12 35. Masseck OA, Spoida K, Dalkara D, Maejima T, Rubelowski JM, et al. 2014. Vertebrate Cone Opsins Enable Sustained and Highly Sensitive Rapid Control of G i / o Signaling in Anxiety Circuitry. Neuron. 81(6):1263-73 36. Mark MD, Herlitze S. 2000. G-protein mediated gating of inward-rectifier K+ channels. Eur. J. Biochem. 267(19): 5830-5836 37. Kim W. Chan, Jin-Liang Sui, Michel Vivaudou, Diomedes E. Logothetis, 1996, Control of channel activity through a unique amino acid residue of a G protein-gated inwardly rectifying K +channel subunit, Proc Natl Acad Sci US A.; 93(24): 14193-14198 38. Dalkara et al., 2013. In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous. SCIENCE TRANSLATIONAL MEDICINE, Vol 5, Issue 189, p. 189ra76 39. Byrne et al. 2020, In vivo-directed evolution of adeno-associated virus in the primate retina. JCI Insight. 5(10) 40. Kotterman et al. 2021, Directed Evolution of AAV Targeting Primate Retina by Intravitreal Injection Identifies R100, a Variant Demonstrating Robust Gene Delivery and Therapeutic Efficacy in Non-Human Primates. BioRxiv. [Brief explanation of the drawings]

[0216] [Figure 1] Figure 1 shows the phototransduction cascade: (A) a typical phototransduction cascade, and (B) a short phototransduction cascade using animal opsin and the GIRK2 channel. PDE: phosphodiesterase. CNG: cyclic nucleotide-gated channel. cGMP: cyclic guanosine monophosphate. [Figure 2] [Figure 2] shows the plasmids: (A) CMV-GIRK2-GFP, and (B) CMV-SWO-mCherry. [Figure 3]Figure 3 shows the remaining phototransduction cascade in rd10 mice using immunohistochemistry. (A-D) Retinal cross-sections from control WT mice stained for (A) opsin, (B) transducin, (C) PDE, and (D) cone arrestin. (E-H) Retinal cross-sections from rd10 mice at P14 stained for (E) opsin, (F) transducin, (G) PDE, and (H) cone arrestin. (I-L) Retinal cross-sections from rd10 mice at P150 stained for (I) opsin, (J) transducin, (K) PDE, and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cell. Scale bar: 50 μm. Inset: 25 μm. [Figure 4] Figure 4 shows preliminary data. (A) Fundus of GIRK2-GFP expression in rd10 mice 1 week after injection (* injection site). (B) Photopic ERG amplitude in rd10 mice at P33 injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice were injected with AAV-GFP (n=12). P=0.0002. (C) Representative flicker ERG at P33. (D) Measurement of visual acuity by optokinetic testing in rd10 mice injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice were injected with AAV-GFP. Control mice were injected with AAV-GFP (n=8). [Figure 5] Figure 5 shows GIRK2-mediated vision. (A) Photopic ERG amplitude in rd10 mice at P41 injected with AAV-SWO-tdTomato and / or AAV-GIRK2-GFP. Control mice were injected with AAV-GFP (n=12). PSWO+GIRK2=0.0381 and PGIRK2=0.0021. (B) Measurement of visual acuity by optokinetic testing in rd10 mice injected with AAV-SWO-tdTomato and / or AAV-GIRK2-GFP. Control mice were injected with AAV-GFP. Control mice were injected with AAV-GFP (n=7). (C) Representative flicker ERG at P41. [Figure 6]Figure 6 shows long-term efficacy. (A) Photopic ERG amplitude in rd10 mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (B) Visual acuity measured by optokinetic testing in rd10 mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (C) Cone number over time in wild-type and uninjected rd10 mice (n=6). P value (P50-P365) = 0.0022. (D) Linear regression correlation between ERG amplitude and cone number in rd10 mice (n=6). P value uninjected = 0.0482. P value AAV-GIRK2-GFP = 0.0007. P value PBS = 0.0104. [Figure 7] Figure 7 shows the remaining phototransduction cascade in huP347S+ / - mice using immunohistochemistry. (A-D) Retinal cross-sections from control WT mice stained for (A) opsin, (B) transducin, (C) PDE, and (D) cone arrestin. (E-H) Retinal cross-sections from huP347S+ / - mice at P14 stained for (E) opsin, (F) transducin, (G) PDE, and (H) cone arrestin. (I-L) Retinal cross-sections from huP347S+ / - mice at P150 stained for (I) opsin, (J) transducin, (K) PDE, and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cell. Scale bar: 50 μm. Inset: 25 μm. [Figure 8]Figure 8 demonstrates the generality of the approach. (A) Photopic ERG amplitude in huP347S+ / - mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (B) Visual acuity measured by optokinetic testing in huP347S+ / - mice injected with AAV-GIRK2-GFP. Control mice were injected with PBS (n=6). (C) Cone number over time in wild-type and uninjected huP347S+ / - mice (n=6). P value (P50-P365) = 0.0022. (D) Linear regression correlation between ERG amplitude and cone number in huP347S+ / - mice (n=5). P value uninjected = 0.0313. P value AAV-GIRK2-GFP = 0.0146. P value PBS = 0.0497. [Figure 9] [Figure 9] shows the efficiency of mouse GIRK2 in HEK cells transfected with two plasmids: CMV-SWO-mCherry and CMV-GIRK2-GFP. [Figure 10] Figure 10 shows cone opsin and arrestin expression in normal retinal tissue and human retinal tissue from RCD. (A) Retinal cross-section (40x magnification) from a 91-year-old with no visual impairment. 5B-E) Retinal cross-sections (40x magnification) from the macula of human RCD from four different donors. [Figure 11] Figure 11 shows the characteristics of GIRK1 F137S currents induced by mOpn4L activation in HEK293 cells. A) When activated with blue light (471 nm, 10 to 20 seconds on the horizontal axis), mOpn4L induces robust GIRK1 F137S-mediated currents that are terminated by stimulation with lime light (560 nm, 20 to 60 seconds on the horizontal axis), resulting in statistically significant differences in B) ion flux across the HEK293 membrane and C) current density per capacitance. [Figure 12] [Figure 12] shows the characteristics of GIRK1 or GIRK2 currents induced by mOpn4L activation in HEK293 cells when activated with blue light (471 nm, 10 to 20 seconds of illumination on the horizontal axis) and terminated by stimulation with lime light (560 nm, 20 to 60 seconds of illumination on the horizontal axis). [Figure 13] Figure 13 shows the current density per capacitance of HEK293 cells expressing A1) hGIRK1 F137S, B1) hGIRK2, or C1) truncated rGIRK2. Current responses evoked by mOpn4 activation are shown compared to c-terminal eGFP fusion constructs and untransfected cells. Individual cell current densities are represented by individual data points. Significant differences between conditions are indicated by * (one-way ANOVA based on Kruskal-Wallis ranks (Dunn's method) with all pairwise multiple comparison procedures, P < 0.05). D1) Cells expressing hGIRK4 S143T are shown compared to untransfected cells. Significant differences between conditions are indicated by * (Mann-Whitney rank sum test; P = 0.002). When activated with blue light, mOpn4 induces a current through GIRK that is terminated upon stimulation with lime light, as seen in the exemplary traces of A2) hGIRK1 F137S, B2) hGIRK2, C2) truncated rGIRK2, and D2) hGIRK4 S143T constructs. [Figure 14] Figure 14. A) Stimulation of HEK293 cells expressing either hGIRK1 F137S, hGIRK1 F137S-eGFP, hGIRK4 S143T, or hGIRK2 with mOpn4 produces reliably observable currents in whole-cell patch-clamp recordings, whereas hGIRK2-eGFP, rGIRK2, or rGIRK2-eGFP currents following mOpn4 activation are unlikely to be observed. The top of each bar indicates the results for which no induced current was observed. The bottom of each bar indicates the results for which an induced current was observed. B) Current density per capacitance of HEK293 cells expressing different GIRK constructs (top) or their eGFP-tagged versions (bottom). Current densities of individual cells are represented by individual data points. Significant differences between conditions are indicated by * (one-way ANOVA based on Kruskal-Wallis ranks with Dunn's method, all pairwise multiple comparisons, P < 0.05). [Figure 15][Figure 15] shows visual acuity in rd10 mice after bilateral subretinal injection of AAV8-pR1.7-hGIRK1F137S at 5E6 or 5E5vg / eye at P15, compared with vehicle-injected rd10 mice or naive (uninjected) rd10 mice.

Claims

1. 1. A pharmaceutical composition containing one or more viral vectors, The pharmaceutical composition, wherein the one or more viral vectors comprise a nucleic acid encoding a short isoform of rod-derived cone survival factor (RdCVF), a nucleic acid encoding a long isoform of rod-derived cone survival factor (RdCVFL), and a nucleic acid encoding a mutant form of G protein-gated inward rectifier potassium channel subunit 1 (GIRK1) (GIRK1 F137S) or a mutant form of G protein-gated inward rectifier potassium channel subunit 4 (GIRK4) (GIRK4 S143T).

2. The pharmaceutical composition of claim 1, wherein the composition comprises a first viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and a second viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

3. The pharmaceutical composition of claim 1, wherein the composition comprises three viral vectors, each of which comprises a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

4. The pharmaceutical composition comprises a single viral vector, The pharmaceutical composition of claim 1 , wherein the single viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively.

5. A viral vector comprising three nucleic acids encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, respectively.

6. A kit comprising two pharmaceutical compositions, - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and - the second pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, kit.

7. A kit comprising three pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding RdCVF; - the second pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding RdCVFL; and - the third pharmaceutical composition comprises a viral vector, the viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T; kit.

8. The RdCVF is the human short isoform hRdCVF set forth in SEQ ID NO: 1; The pharmaceutical composition according to any one of claims 1 to 4, the viral vector according to claim 5, or the kit according to claim 6 or 7.

9. The pharmaceutical composition of any one of claims 1 to 4 or 8, or the viral vector of claim 5 or 8, or the kit of any one of claims 6 to 8, wherein the RdCVFL is the human long isoform hRdCVFL set forth in SEQ ID NO:

2.

10. The pharmaceutical composition of any one of claims 1 to 4 or 8 to 9, or the viral vector of any one of claims 5, 8 or 9, or the kit of any one of claims 6 to 9, wherein the GIRK1 F137S or GIRK4 S143T is the sequence set forth in SEQ ID NO: 11 and SEQ ID NO: 40, respectively.

11. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, or a viral vector according to any one of claims 5 or 8 to 10, or a kit according to any one of claims 6 to 10, for use in treating a retinal degenerative disease.

12. The pharmaceutical composition of any one of claims 1 to 4 or 8 to 10, or the viral vector of any one of claims 5 or 8 to 10, or the kit of any one of claims 6 to 10, for use according to claim 11, wherein the retinal degenerative disease is rod-cone dystrophy, cone dystrophy, cone-rod dystrophy or atrophic age-related macular degeneration.

13. The pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, or the viral vector according to any one of claims 5, 8 to 10, or the kit according to any one of claims 6 to 10, for use according to claim 11, wherein the retinal degenerative disease is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, Bardet-Biedl syndrome, Bassen-Kornzweig syndrome, Best disease, choroideremia, cyclotrophy, Leber's congenital amaurosis, Refsum's disease, Stargardt disease, or Usher syndrome.

14. The pharmaceutical composition of any one of claims 1 to 4 or 8 to 10, or the viral vector of any one of claims 5 or 8 to 10, or the kit of any one of claims 6 to 10, for use according to claim 11, wherein the retinal degenerative disease is retinitis pigmentosa.

15. The pharmaceutical composition of any one of claims 1 to 4 or 8 to 10, or the viral vector of any one of claims 5 or 8 to 10, or the kit of any one of claims 6 to 10, for the use according to any one of claims 11 to 14, wherein the pharmaceutical composition or the viral vector is administered by subretinal injection, intravitreal injection or suprachoroidal injection.

16. 15. The kit according to any one of claims 6 to 10, for the use according to any one of claims 11 to 14, wherein the pharmaceutical compositions of the kit are administered simultaneously or separately over a period of time, such as in the range of 1 day, in the range of 1 month to 6 months, in the range of 6 months to 1 year, or in the range of 1 year to 10 years.

Images