Ministring DNA for producing adeno-associated virus

Abstract

Provided herein are expression vectors, vector production systems, bacterial sequence-free vectors, and methods for producing adeno-associated viruses (AAV). Also provided are AAV and pharmaceutical compositions and uses thereof.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 382,070, filed November 2, 2022, which is incorporated herein by reference in its entirety.

[0002] Reference to an electronically submitted sequence listing The contents of the electronically submitted sequence listing (Name: 4471_003PC03_Seqlisting_ST26; Size: 155,348 bytes; and Creation Date: October 31, 2023) are incorporated herein by reference in their entirety.

[0003] The present disclosure provides vectors and methods for producing adeno-associated virus (AAV) from ministring DNA. [Background technology]

[0004] AAV is a small, non-pathogenic virus containing a linear, single-stranded DNA genome packaged in a non-enveloped viral capsid. AAV is a member of the Parvoviridae family of parvoviruses and the Dependoparvovirus genus, which requires functions provided by a co-infecting helper virus for efficient replication. See, for example, Daya and Berms, Clin. Microbiol. Rev. 21(4):583-593 (2008); Lisowski et al., Curr. Opin. Pharmacol. 24:59-67 (2015); Mary et al., Adeno-associated Virus Vectors in Gene Therapy, in Gene and Cell Therapy: Biology and Applications (Jayandharan G. eds, 2018).

[0005] The wild-type AAV genome is approximately 5 kilobases long and encodes eight proteins derived from the replication (rep) and capsid (cap) genes. Four Rep proteins (Rep40, Rep52, Rep68, and Rep78) and three Cap proteins (VP1, VP2, and VP3) and an assembly-activating protein (AAP) are expressed as splice variants derived from the rep and cap genes under alternative promoters. The Rep proteins are involved in replication and packaging, while the Cap proteins and AAP are involved in the formation of the viral capsid. See, for example, Lisowski et al.; Salganik et al., Microbiol. Spectrum 3(4):MDNA3-0052-2014 (2015).

[0006] Two inverted terminal repeats (ITRs) flank the coding sequence of the AAV genome and are required for replication and packaging. The ends of each wild-type ITR contain self-annealing palindromic regions, resulting in a double-stranded T-shaped hairpin structure at each end of the AAV genome. The hairpin serves as the origin of AAV DNA replication and complementary strand synthesis using the DNA polymerase complex of infected cells. The sense or antisense strand of the double-stranded replication intermediate can be packaged into the viral capsid as a single-stranded genome. See, for example, Daya and Berns, Lisowski et al.; Ling et al., J. Mol. Genet. Med. 9(3):175 (2015); Salganik et al.

[0007] Recombinant AAV can be produced by replacing the AAV genome between the ITRs with a nucleic acid sequence of interest and has been widely used in clinical and research studies. The standard method for producing recombinant AAV involves transfecting mammalian or insect AAV-producing cells with a vector containing the nucleic acid sequence of interest flanked by ITRs and a separate helper vector or virus that provides the necessary AAV rep / cap and helper virus functions. For example, a typical production method involves transfecting three plasmids: one containing the nucleic acid sequence between the two ITRs, one containing the AAV rep and cap genes, and one containing the adenovirus helper genes, into embryonic kidney 293 (HEK293) cells. By providing the rep / cap and helper sequences in trans, the nucleic acid of interest between the ITRs is packaged into capsids to form recombinant AAV.

[0008] AAV production using existing methods is highly variable, inefficient, and often results in the encapsidation of unwanted DNA. See, e.g., Wright, JF, Gene Therapy 15:840-848 (2008). For example, 50-95% of AAV particles produced by standard methods are empty AAV capsids that contain no packaged DNA. See, e.g., Sommer et al., Mol. Ther. 7(1):122-128 (2003). Even when capsids are packaged, they may contain nucleic acids other than or in addition to the desired nucleic acid sequence of interest, such as helper sequences from ITR-containing plasmids, producer cell sequences, and / or bacterial sequences. These contaminating sequences can represent 1% to 8% of the total DNA in purified AAV particles and may result in potential immunogenic and / or oncogenic effects. See, e.g., Wright, JF. To date, state-of-the-art purification strategies have been unable to remove these contaminating sequences from AAV vector preparations. Summary of the Invention [Problem to be solved by the invention]

[0009] There is a need for improved AAV vectors and production systems. [Means for solving the problem]

[0010] The present disclosure is directed to an expression vector (i.e., "Expression Vector A") for generating a bacteria-free sequence-free vector with linear covalent ends, comprising: (a) a first sequence comprising an inverted terminal repeat (ITR) and a multiple cloning site (MCS), the ITRs flanking at least one end of the MCS, the ITRs comprising a sequence for adeno-associated virus (AAV) replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase. In some embodiments, the ITRs flank only one end of the MCS. In some embodiments, the ITRs flank each end of the MCS. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides long. In some embodiments, the expression vector further comprises an expression cassette comprising an AAV replication (rep) gene and an AAV capsid (cap) gene flanked on one end by a target sequence for a first recombinase and on the other end by the first sequence.

[0011] The present disclosure is directed to an expression vector (i.e., "Expression Vector B") for generating a bacteria-free sequence-free vector with linear covalent ends, comprising: (a) a first sequence comprising an expression cassette comprising ITRs and a nucleic acid sequence of interest, wherein the ITRs flank at least one end of the expression cassette comprising the nucleic acid sequence of interest, and the ITRs comprise sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding regions of the target sequence for the first recombinase.

[0012] In some embodiments, the ITRs flank only one end of the expression cassette containing the nucleic acid sequence of interest in expression vector B (i.e., "expression vector B1"). In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0013] In some embodiments, expression vector B1 further comprises an expression cassette comprising the AAVrep gene and the AAVcap gene flanked on one end by a target sequence for the first recombinase and on the other end by the first sequence (i.e., "expression vector B2").

[0014] In some embodiments, the ITRs flank each end of an expression cassette containing a nucleic acid sequence of interest in expression vector B (i.e., "expression vector B3"). In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0015] In some embodiments, expression vector B3 further comprises an expression cassette comprising the AAVrep gene and the AAVcap gene flanked on one end by a target sequence for the first recombinase and on the other end by the first sequence (i.e., "expression vector B4").

[0016] The present disclosure is directed to an expression vector (i.e., "expression vector C") for generating a bacteria-free sequence-free vector having linear covalent ends, the expression vector comprising: (a) a first sequence comprising an ITR and a palindromic sequence, the ITRs flanking each end of the palindromic sequence, an expression cassette comprising a nucleic acid sequence of interest, and the complement of the expression cassette, the ITRs comprising a sequence for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding regions of the target sequence for the first recombinase. In some embodiments, the complement is separated from the expression cassette comprising the nucleic acid sequence of interest by a non-complementary spacer sequence. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0017] In some embodiments, expression vector C further comprises an expression cassette comprising the AAVrep gene and the AAVcap gene flanked on one end by a target sequence for a first recombinase and on the other end by a first sequence (i.e., "expression vector C1").

[0018] The present disclosure is directed to an expression vector (i.e., "Expression Vector D") for generating a bacteria-free sequence vector with linear covalent ends, the expression vector comprising: (a) a portion of an expression cassette comprising a nucleic acid sequence of interest flanked on one end by a splicing sequence; a first sequence comprising ITRs flanking each end of the first sequence, the ITRs comprising sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each ITR; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-junction regions of the target sequence for the first recombinase. In some embodiments, the portion of the expression cassette comprises a 5' portion that, when combined with the remainder of the expression cassette, provides the complete sequence of the expression cassette, and the splicing sequence is adjacent to the 3' end of the 5' portion. In some embodiments, the portion of the expression cassette comprises a 3' portion that, when combined with the remainder of the expression cassette, provides the complete sequence of the expression cassette, and the splicing sequence is adjacent to the 5' end of the 3' portion. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence, hi some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0019] In some embodiments, the sequences for AAV replication in any of the above expression vectors include an AAV ITR replication (Rep) protein binding element (RBE) and a terminal resolution site (TRS).

[0020] In some embodiments, the AAV packaging signal in any of the above expression vectors comprises an AAV ITR D-sequence.

[0021] The present disclosure is directed to an expression vector (i.e., "Expression Vector E") for generating a bacteria-sequence-free vector having linear covalent ends, the expression vector comprising: (a) an expression cassette comprising AAVrep and AAVcap genes; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-junction regions of the target sequence for the first recombinase.

[0022] The present disclosure is directed to an expression vector (i.e., "expression vector F") for generating a bacterial sequence-free vector with linear covalent ends, comprising: (a) an expression cassette containing one or more helper virus genes for AAV production; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding regions of the target sequence for the first recombinase. In some embodiments, the one or more helper virus genes are derived from adenovirus, herpesvirus, retrovirus, poxvirus, and / or lentivirus. In some embodiments, the one or more helper virus genes include the adenovirus Early 4 (E4) gene, the adenovirus Early 2A (E2A) gene, and the adenovirus Viral Associated (VA) gene.

[0023] In some embodiments, the target sequence for the first recombinase and the one or more additional target sequences for the one or more additional recombinases in any of the above expression vectors are selected from the group consisting of a PY54 pal site, an N15 telRL site, and a φK02 telRL site. In some embodiments, any of the above expression vectors contain each of the target sequences. In some embodiments, any of the expression vectors contain a Tel recombinase pal site and a telRL recombinase target binding sequence integrated within the pal site.

[0024] In some embodiments, the target sequence for the first recombinase in any of the above expression vectors is the phage PY54 Tel 142 base pair target site.

[0025] The present disclosure is directed to a vector production system comprising a recombinant cell engineered to encode at least a first recombinase under the control of an inducible promoter, the cell comprising any of the expression vectors B to F described above. In some embodiments, the inducible promoter is thermally regulated, chemically regulated, IPTG-regulated, glucose-regulated, arabinose-inducible, T7 polymerase-regulated, cold shock-inducible, pH-inducible, or a combination thereof. In some embodiments, the first recombinase is selected from TelN and Tel, and the expression vector incorporates a target sequence for at least the first recombinase. In some embodiments, the recombinant cell is further engineered to encode a nuclease genome editing system, the expression vector further comprising a backbone sequence containing a cleavage site for the nuclease genome editing system. In some embodiments, the nuclease genome editing system is a CRISPR nuclease system comprising a Cas nuclease and a gRNA, and the expression vector comprises a target sequence for the gRNA within the backbone sequence.

[0026] The present disclosure is directed to a method for producing a bacterial sequence-free vector having linear covalent ends, the method comprising incubating any of the vector production systems described above under conditions suitable for expression of a first recombinase.

[0027] The present disclosure is directed to a method for producing a bacteria-free sequence vector having linear covalent ends, comprising incubating any of the vector production systems described above under conditions suitable for expression of a first recombinase and a nuclease genome editing system. In some embodiments, the method further comprises recovering the bacteria-free sequence vector.

[0028] The present disclosure is directed to a bacteria-free sequence vector produced by any of the above methods for producing a bacteria-free sequence vector with linear covalent ends. In some embodiments, the bacteria-free sequence vector is produced from expression vector B1. In some embodiments, the bacteria-free sequence vector is produced from expression vector B2. In some embodiments, the bacteria-free sequence vector is produced from expression vector B3. In some embodiments, the bacteria-free sequence vector is produced from expression vector B4. In some embodiments, the bacteria-free sequence vector is produced from expression vector C. In some embodiments, the bacteria-free sequence vector is produced from expression vector C1. In some embodiments, the bacteria-free sequence vector is produced from expression vector D. In some embodiments, the bacteria-free sequence vector is produced from expression vector E. In some embodiments, the bacteria-free sequence vector is produced from expression vector F.

[0029] The present disclosure is directed to methods for producing single-stranded AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector B3, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising the AAVrep gene and the AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0030] The present disclosure is directed to methods for producing single-stranded AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector generated from expression vector B4, (ii) a bacteria-free sequence vector generated from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0031] The present disclosure is directed to a method for producing single-stranded AAV, the method comprising: (a) transfecting a cell capable of producing AAV with a bacteria-free sequence vector generated from expression vector B3, wherein the AAVrep gene, the AAVcap gene, and one or more helper virus genes for the production of AAV are each encoded by the cell or the vector; and (b) incubating the cell under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes for the production of AAV.

[0032] The present disclosure is directed to methods for producing self-complementary AAV, the method comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector B1, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising the AAVrep gene and the AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0033] The present disclosure is directed to a method for producing self-complementary AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector generated from expression vector B2, (ii) a bacteria-free sequence vector generated from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0034] The present disclosure is directed to methods for producing self-complementary AAV, the method comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector C, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising the AAVrep gene and the AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0035] The present disclosure is directed to methods for producing self-complementary AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-sequence vector generated from expression vector C1, (ii) a bacteria-sequence vector generated from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0036] The present disclosure is directed to a method for producing self-complementary AAV, the method comprising: (a) transfecting a cell capable of producing AAV with a bacteria-sequence-free vector generated from expression vector B1 or C, wherein the AAVrep gene, the AAVcap gene, and one or more helper virus genes for the production of AAV are each encoded by the cell or the vector; and (b) incubating the cell under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes for the production of AAV.

[0037] In some embodiments, the cells in any of the above methods for producing single-stranded or self-complementary AAV are HEK293T cells.

[0038] In some embodiments, any of the above methods for producing single-stranded or self-complementary AAV further include recovering the AAV.

[0039] The present disclosure is directed to AAV produced by any of the above methods for producing single-stranded or self-complementary AAV.

[0040] The present disclosure is directed to pharmaceutical compositions comprising the AAV.

[0041] The present disclosure is directed to a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject the AAV or the pharmaceutical composition. [Brief explanation of the drawings]

[0042] [Figure 1] FIG. 1 shows a map of a representative expression vector containing inverted terminal repeat (ITR) sequences flanking each end of an expression cassette encoding green fluorescent protein (GFP) and special Super sequence sites (interchangeably named in the figure as SS or SSeq) containing recombinase target sequences flanking each end of the ITR-expression cassette-ITR sequences. [Figure 2] FIG. 2 shows a map of a representative ministring DNA (msDNA) encoding GFP produced from the expression vector shown in FIG. [Figure 3] Figure 3 shows a map of a representative msDNA in which only the 3' end of the expression cassette is flanked by ITRs. [Figure 4] FIG. 4 shows a map of a representative expression vector containing an SS flanking each end of an expression cassette encoding AAV replication (Rep) and capsid (Cap) sequences. [Figure 5] FIG. 5 shows a map for a representative msDNA encoding the Rep and Cap sequences generated from the expression vector shown in FIG. [Figure 6] FIG. 6 shows a map for a representative msDNA encoding a helper sequence. [Figure 7] FIG. 7 shows a map of a representative expression vector containing ITR sequences flanking each end of an expression cassette encoding GFP, and SSeq flanking each end of the ITR-expression cassette-ITR sequence. [Figure 8] FIG. 8 shows a map of a representative msDNA generated from the expression vector shown in FIG. [Figure 9] Figures 9A-9D show bar graphs of transfection efficiency (TE) (Figures 9A and 9C), median fluorescence intensity (Figure 9B), and cell viability (Figure 9D) on days 2 (Figures 9A and 9B) and 6 (Figures 9C and 9D) after transfection of HEK293 cells with the expression vector (AAV ITR pDNA) from Figure 7 or the msDNA (AAV ITR msDNA) from Figure 8. Arrows in Figures 9A-9C indicate the highest value observed for msDNA. * = P < 0.05, ** = P < 0.01, *** = P < 0.001, and ns = not significant. [Figure 10] Figure 10 shows photomicrographs of GFP expression in the transfected cells described in Figures 9A-9D, with nuclei revealed by staining with diamidino-2-phenylindole (DAPI). [Figure 11] FIG. 11 shows a map of a representative ITR-SacB-CmR-ITR expression cassette encoding the SacB protein and chloramphenicol acetyltransferase. [Figure 12] Figures 12A-12B show representative images (Figure 12A) of sucrose plates and bar graphs (Figure 12B) of mutation rates in cells transfected with ITR-sacB-CmR-ITR LCC DNA generated in vitro by PCR (Taq and Q5) or RCA (Phi29), or with msDNA generated in vivo in E. coli (MBI2). Bars in (Figure 9B) represent the mean of three biological replicates, and error bars represent one standard deviation. One-way ANOVA with Dunnett's test (compared to MBI2): **** = p < 0.0001. [Figure 13] Figure 13 shows a diagram of AAV production in which the conventional GOI-containing plasmid is replaced with msDNA. [Figure 14] FIG. 14 shows a map of a representative plasmid lacking SSeq that contains the sequences of the ITRs flanking each end of the expression cassette encoding GFP. [Figure 15] Figure 15 shows photomicrographs of GFP expression in samples from 35 mL cultures 72 hours after transfection with mixtures of a conventional helper plasmid, a conventional Rep2 / Cap2 plasmid, and the msDNA shown in Figure 8 ("msDNA") or the plasmid shown in Figure 14 ("pDNA") in molar ratios of 1:2:1, 2:1.5:1, or 1.4:1.5:1. [Figure 16] Figure 16 shows a photomicrograph of GFP expression in samples from 150 mL cultures for producing AAV1 or AAV2 72 hours after transfection with a mixture of a conventional helper plasmid, a conventional Rep2 / Cap1 plasmid (for AAV1 production) or a conventional Rep2 / Cap2 plasmid (for AAV2 production), and the msDNA shown in Figure 8 ("msDNA") or the plasmid shown in Figure 14 ("pDNA") at a molar ratio of 1.4 to 1.5 to 1 for transfectants containing msDNA or a molar ratio of 2 to 1.5 to 1 for transfectants containing pDNA. [Figure 17] 17A and 17B show cell viability for the samples described in FIG. 16 as % viable cells (FIG. 17A) and viable cell density (VCD) as a concentration of 10 6 cells / mL (FIG. 17B). [Figure 18] Figure 18 shows the titer of AAV2 vector genomes / mL (VG / mL) determined by droplet digital PCR (ddPCR) of the GOI after harvesting the cultures described in Figure 15 72 hours after transfection. [Figure 19]Figures 19A and 19B show chromatograms from affinity chromatography of msDNA-transfected cultures for AAV1 (Figure 19A) and AAV2 (Figure 19B) production described in Figure 16 following 72 hours of recovery. The top line in each figure is absorbance at 280 nm, and the bottom line is absorbance at 260 nm. The amount "VP / mL" indicates the concentration of vector particles per milliliter of eluate, and the percentage indicates the fraction of particles that are packaged with DNA. [Figure 20] Figures 20A and 20B show chromatograms from affinity chromatography of pDNA-transfected cultures for the production of AAV1 (Figure 20A) and AAV2 (Figure 20B) described in Figure 16 following 72 hours of recovery. Lines, "VP / mL," and percentages are as described for Figures 19A and 19B. [Figure 21] Figure 21A shows a micrograph of an electrophoresis gel showing capsid proteins VP1, VP2, and VP3 as three respective bands from top to bottom in each lane detected by ddPCR following affinity chromatography of the msDNA and pDNA AAV2 cultures shown in Figures 19B and 20B, respectively. [Figure 21] Figure 21B shows a bar graph of AAV1 and AAV2 titers in vector genomes / mL (VG / mL) following affinity chromatography of msDNA and pDNA AAV cultures described in Figures 19A-19B and Figures 20A-20B. [Figure 22-23] Figures 22-23 show chromatographs from anion exchange (AEX) chromatography of the affinity chromatography captures shown in Figures 19A and 20A, respectively. VP / mL and percentages are as described for Figures 19A-19B. Peak #1 in each figure contains primarily DNA-packaged particles, while peak #2 contains particles with packaged DNA as well as empty particles. [Figure 24]Figure 24A shows a photomicrograph of an electrophoresis gel with the bands described for Figure 21A following AEX chromatography as described for Figures 22-23, where pK#1 and pK#2 correspond to peaks #1 and #2, respectively, in the AEX chromatogram. [Figure 24] Figures 24B and 24C show bar graphs of AAV1 titers (VG / mL) determined by ddPCR from peaks #1 and #2 of the chromatograms in Figures 22-23, respectively, associated with GOI or backbone elements derived from conventional Rep / Cap and helper plasmids [origin of replication (Ori), kanamycin resistance gene (KanR), and ampicillin resistance gene (AmpR)]. [Figure 25] Figure 25 shows a bar graph of AAV2 titers (VG / mL) determined by ddPCR for GOI and backbone (Ori) sequences after harvesting the cultures described in Figure 15 at 72 hours after transfection with different ratios of msDNA or pDNA and conventional Rep / Cap and helper plasmids. [Figure 26] Figure 26 shows next-generation sequencing (NGS) coverage maps of packaged genomes with respect to plasmid map locations from msDNA and pDNA AAV cultures after affinity chromatography capture described in Figures 19A-19B and 20A-20B, respectively. [Figure 27] FIG. 27 shows a map of a representative msDNA containing expression cassettes encoding Rep2 and Cap2 and SSeq flanking each end of the expression vector. [Figure 28]Figures 28A and 28B show chromatograms from affinity chromatography of cultures transfected with a 1.4 to 1.5 to 1 molar ratio (Figure 28A) of a conventional helper plasmid ("pDNA-Helper"), the msDNA shown in Figure 27 ("msDNA-Rep2Cap2"), and the msDNA shown in Figure 8 ("msDNA-Cis"), as well as a 1 to 2 to 1 molar ratio (Figure 29A) of a conventional helper plasmid, a conventional Rep2 / Cap2 plasmid ("pDNA-Rep2Cap2"), and the plasmid shown in Figure 14 ("pDNA-Cis"). Overlines, underlines, VP / mL, and percentages are as described for Figures 19A-19B. VG / mL indicates the number of particles / mL of DNA-packaged in the eluate. [Figure 29] Figures 29A-29C show chromatograms from affinity chromatography. Figures 29A and 29C show chromatograms from affinity chromatography from separate repeats of the culture described in Figures 28A and 28B, respectively. Figure 29B shows a chromatogram from affinity chromatography of a culture transfected with a 1.4 to 1.5 to 1 molar ratio of pDNA-helper to pDNA-RepCap2 to msDNA-cis described in Figures 28A and 28B. Overlines, underlines, VP / mL, and percentages are as described for Figures 19A-19B. VG / mL is as described for Figures 28A and 28B. VP is the total number of viral particles calculated by multiplying the value VP / mL by the total volume of the eluate. [Figure 29] FIG. 29D shows a micrograph of an electrophoresis gel with the bands described for FIG. 21A, where lanes (a)-(c) correspond to the eluates from the chromatograms described for FIGS. 29A-29C, respectively. [Figure 30-32] Figures 30-32 show chromatograms from AEX chromatography of the affinity chromatography captures shown in Figures 29A-29C, respectively. Percentages are as described for Figures 19A-19B. VG / mL is as described for Figures 28A and 28B. [Figure 33] Figure 33A shows the titer of AAV2 vector genomes / mL (VG / mL) based on the presence of the GOI as determined by ddPCR ("harvest"), affinity chromatography ("capture"), and AEX chromatography ("AEX") for samples derived from the initial harvest of AAV2 after lysis of the cell culture. The two harvest and two capture values ​​for the msDNA and pDNA samples are from separate repeats on different days, as described in Figures 28A-28B and 29A-C, respectively. msDNA = transfection of pDNA-helper, msDNA-Rep2Cap2, and msDNA-cis; pDNA = transfection of pDNA-helper, pDNA-Rep2Cap2, and pDNA-cis; mixed-msDNA = transfection of pDNA-helper, pDNA-Rep2Cap2, and msDNA-cis. [Figure 33] Figure 33B shows the AAV2 titer (VG, mass balance) determined for each sample from the corresponding VG / mL titer in Figure 33A. [Figure 34] Figure 34A shows a bar graph of the full particle percentage determined from the A260 / A280 ratio for the samples described in Figure 33A calculated from the affinity chromatography captures shown in Figures 28A-28B (first "msDNA" and "pDNA" bar graphs on the x-axis) and from the affinity chromatography captures shown in Figures 29A-29C and the AEX chromatography peaks shown in Figures 30-32 (followed by "msDNA," "mixed-msDNA," and "pDNA" bar graphs). [Figure 34] FIG. 34B shows a bar graph of the percentage of full particles determined by molecular weight spectrophotometry for the samples described in FIG. 33A from the affinity chromatography captures shown in FIGS. 28A-28B and the AEX chromatography peaks shown in FIGS. 30-32. [Figure 35] Figure 35 shows a diagram of AAV production in which all three conventional plasmids are replaced with msDNA. [Figure 36]FIG. 36 shows a map of a representative msDNA containing an expression cassette encoding helper virus genes for AAV production. [Figure 37] Figures 37A-37D show chromatograms from affinity chromatography of cultures transfected with all msDNA (Figures 37A-37C) or all pDNA (Figure 37D). msDNA cultures were transfected with the msDNAs of Figures 8, 27, and 36 at a 1:2:1 molar ratio and a 1:1 ratio of transfection agent to total DNA (Figure 37A), a 1:2:1 molar ratio and a 2:1 molar ratio of transfection agent to total DNA (Figure 37B), and a 1:1:1 molar ratio and a 2:1 molar ratio of transfection agent to total DNA (Figure 37C). Figure 37D shows a chromatogram of the all pDNA sample from Figure 29C. Overlines, underlines, VP / mL, and percentages are as described for Figures 19A-19B. VG / L is the concentration of vector genomes in the culture. [Figure 38] Figure 38 includes a summary of the sample characteristics and data from Figures 37A-37D, along with a photomicrograph of an electrophoresis gel showing capsid proteins VP1, VP2, and VP3 with the bands described for Figure 21A. [Figure 39-42] Figures 39-42 show chromatograms from AEX chromatography of the affinity chromatography captures shown in Figures 37A-37D, respectively. Percentages and VG / mL are as described for Figures 19A-19B and 28A-28B, respectively. The photomicrographs inserted in each figure show electrophoresis gels showing capsid proteins VP1, VP2, and VP3 with bands as described for Figure 21A. [Figure 43] FIG. 43A shows a bar graph of the full particle percentage determined from the A260 / A280 ratio calculated from the affinity chromatography captures shown in FIGS. 37A-37D and the AEX chromatography peaks shown in FIGS. 39-42. [Figure 43]FIG. 43B shows a bar graph of the percentage of full particles determined by molecular weight spectrophotometry from the affinity chromatography captures shown in FIGS. 37A-37D and the AEX chromatography peaks shown in FIGS. 39-42. [Figure 44] Figure 44A shows the AAV2 titer vector genomes / (VG / mL) based on the presence of the GOI as determined by ddPCR from the initial harvest after lysis of the culture described in Figures 37A-37D ("Harvest"), the affinity chromatography shown in Figures 37A-37D ("Capture"), and AEX chromatography peak #1 ("AEX") shown in Figures 39-42. [Figure 44] Figures 44B and 44C show the AAV2 titers determined for each sample from the corresponding VG / mL titers in Figure 44A (VG, mass balance), with Figure 44C including the sum of both AEX chromatography peaks #1 and #2. [Figure 45] Figure 45 shows the NGS coverage map of the packaged genome in relation to the plasmid map location from AAV cultures containing 1, 2, or 3 msDNA for AAV production compared to all pDNA for AAV production as described in the preceding figures. [Figure 46]Figure 46 shows a bar graph of transfection efficiency at 48 or 72 hours after transfection of the msDNA of Figure 8 (msDNA) or the plasmid of Figure 14 (AAV PP) at a 1:1:1 molar ratio with bacterial sequence-minimized / reduced plasmids for Rep2 / Cap9 and helper sequences for AAV9 production. The msDNAs were as follows: (msDNA1) 1.0 μg / mL DNA and 1.5:1 PEI to DNA, (msDNA2) 1.0 μg / mL DNA and 2:1 PEI to DNA, (msDNA3) 1.0 μg / mL DNA and 2.5:1 PEI to DNA, (msDNA4) 1.75 μg / mL DNA and 1.5:1 PEI to DNA, (msDNA5) 1.75 μg / mL DNA and 2:1 PEI to DNA. Varying amounts of total transfected DNA and transfecting agent (PEI) to DNA ratios are shown for (msDNA6) 1.75 μg / mL DNA and 2.5:1 PEI to DNA, (msDNA7) 2.5 μg / mL DNA and 1.5:1 PEI to DNA, (msDNA8) 2.5 μg / mL DNA and 2:1 PEI to DNA, and (msDNA9) 2.5 μg / mL DNA and 2.5:1 PEI to DNA. [Figure 47] FIG. 47 shows bar graphs of cell viability as viable cell density (VCD, cells / mL) and % viable cells at 48 or 72 hours following the transfections described in FIG. [Figure 48] Figure 48 shows a bar graph of capsid titers for the samples described in Figure 46 as determined by AAV9-specific ELISA 72 hours post-transfection. [Figure 49] FIG. 49 shows a bar graph of AAV titers determined for the samples described in FIG. 46 by ddPCR using primers specific for the ITR region 72 hours post-transfection. [Figure 50] Figure 50 shows a bar graph of total AAV9 titers determined by ddPCR after AEX chromatography for 10 L cultures of transfectants msDNA5 ("msDNA") and AAV PP ("pDNA") described in Figure 46. DETAILED DESCRIPTION OF THE INVENTION

[0043] The present disclosure provides expression vectors, vector production systems, methods of producing bacteria-free sequence vectors, and bacteria-free sequence vectors for producing AAV, as well as methods for producing AAV, AAV, compositions comprising AAV, and methods of using AAV.

[0044] All publications cited herein, including but not limited to all journal articles, books, handbooks, patent applications, and patents, are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0045] I. Terminology In order that this disclosure may be more readily understood, certain terms will first be defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning indicated below. Additional definitions are set forth throughout this application.

[0046] It should be noted that the term "a" or "an" entity refers to one or more of that entity, e.g., "a nucleotide sequence" is understood to refer to one or more nucleotide sequences. Thus, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0047] The term "and / or," when used herein, should be interpreted as a specific disclosure of two specified features or components, each with or without the other feature or component. Thus, the term "and / or" used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0048] Wherever embodiments are described herein using the language "comprising," it is understood that other similar embodiments described with the terms "consisting of" and / or "consisting essentially of" are also provided.

[0049] The terms "about" or "comprising essentially of" refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, where the acceptable error range depends in part on the method by which the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, "about" or "essentially comprising" can mean within 1 or more standard deviations per the practice of the art. Alternatively, "about" or "essentially comprising" can mean a range of up to 10%. Furthermore, particularly with respect to biological systems or processes, the term can mean up to an order of magnitude or up to 5 times the value. When a particular value or composition is provided in the application and claims, unless otherwise specified, the meaning of "about" or "essentially comprising" should be assumed to be within an acceptable error range for that particular value or composition.

[0050] As used herein, any concentration range, percentage range, ratio range, or integer range, unless otherwise indicated, should be understood to include any integer value within the recited range, and, where appropriate, fractions thereof (such as tenths and hundredths of integers). Numeric ranges are inclusive of the numbers limiting the range.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, Abridged Dictionary of Biomedical and Molecular Biology, Juo, Pei-Show, 2nd Edition, 2002, CRC Press; Dictionary of Cellular and Molecular Biology, 5th Edition, 2013, Academic Press; and Oxford Dictionary of Biochemistry and Molecular Biology, 2006, Oxford University Press provide those of ordinary skill in the art with a general dictionary of many of the terms used in this disclosure.

[0052] Units, prefixes, and symbols are displayed in their International System of Units (SI) approved form.

[0053] Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation, and amino acid sequences are written left to right in amino to carboxy orientation.

[0054] The headings provided herein are not intended to limit the various aspects of the disclosure, which can be obtained by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0055] "Adeno-associated virus" or "AAV," as used herein, refers to a parvovirus of the Parvoviridae family, a member of the genus Dependoparvovirus (formerly Dependovirus). An AAV containing a nucleic acid sequence of interest disclosed herein can be referred to interchangeably as an "AAV," "recombinant AAV," "rAAV," or "AAV vector."

[0056] "Inverted terminal repeat sequences" or "ITRs," as used herein, refer to the sense or antisense strand (i.e., the + or - strand, respectively) of a single- or double-stranded polynucleotide that contains sequences for AAV replication and non-palindromic packaging signals. "ITRs" disclosed herein include wild-type AAV 5' and / or 3' ITR sequences, portions thereof, or artificial sequences.

[0057] As used herein, "sequences for AAV replication" refer to sequences within the AAV ITRs that are involved in AAV replication, and include Rep protein binding elements (RBEs), RBEs', terminal resolution sites (TRSs), or any combination thereof. RBEs may also be referred to interchangeably herein as Rep protein binding sites (RBSs).

[0058] As used herein, an "AAV packaging signal" refers to a non-palindromic sequence in the ITRs that is involved in AAV encapsidation, and includes the "D region" of the 5' or 3' AAV ITR, or a functional portion thereof.

[0059] A "protein" or "polypeptide" refers to any polymer of two or more individual amino acids (whether naturally occurring or non-naturally occurring) linked via peptide bonds, which occurs when the carboxyl carbon atom of the carboxylic acid group attached to the alpha carbon of one amino acid (or amino acid residue) is covalently bonded to the amino nitrogen atom of the amino group attached to the non-alpha carbon of an adjacent amino acid. The term "protein" is understood to include within its meaning the terms "polypeptide" and "peptide" (which may sometimes be used interchangeably herein). Furthermore, proteins comprising multiple polypeptide subunits are also understood to be included within the meaning of "protein" as used herein. Similarly, fragments of proteins and polypeptides are within the scope of the present disclosure and may be referred to herein as "proteins." In one aspect of the present disclosure, a polypeptide comprises a chimera of two or more parent peptide segments. The term "polypeptide" is also intended to refer to and encompass products of post-translational modifications ("PTMs") of polypeptides, including, but not limited to, disulfide bond formation, glycosylation, carbamylation, lipid-modification, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, modification with non-naturally occurring amino acids, or any other manipulation or modification, such as conjugation with a labeling component. Polypeptides can be derived from natural biological sources or produced by recombinant technology, but are not necessarily translated from a designated nucleic acid sequence. Polypeptides can be produced in any manner, including by chemical synthesis. An "isolated" polypeptide, or a fragment, variant, or derivative thereof, is a polypeptide that is not found in its natural environment. No particular level of purification is required. For example, an isolated polypeptide can simply be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposes of this disclosure, as are natural or recombinant polypeptides that have been separated, resolved, or partially or substantially purified by any suitable technique.

[0060] As used herein, "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides. In some instances, a polynucleotide contains sequences that are not immediately adjacent to or immediately adjacent to (at the 5' or 3' end) a coding sequence in the naturally occurring genome of the organism from which the polynucleotide is derived. Thus, the term includes recombinant DNA present, for example, in a vector, a self-replicating plasmid or virus, or integrated into the genomic DNA of a prokaryote or eukaryote, or as a separate molecule (e.g., cDNA) independent of other sequences. The nucleotides of the present disclosure can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. As used herein, polynucleotide refers to, inter alia, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded, or a mixture of single- and double-stranded regions. The term polynucleotide encompasses genomic DNA or RNA (depending on the organism, i.e., viral RNA genomes), as well as mRNA and cDNA encoded by genomic DNA. In certain embodiments, polynucleotides contain conventional phosphodiester bonds or unconventional bonds (e.g., amide bonds, such as those found in peptide nucleic acids (PNAs)). By "isolated" nucleic acid or polynucleotide is intended a nucleic acid molecule, e.g., DNA or RNA, that has been removed from its natural environment. For example, a nucleic acid molecule comprising a polynucleotide encoding a recombinant polypeptide contained in a vector is considered "isolated" for purposes of this disclosure. Further examples of isolated polynucleotides include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) from other polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the polynucleotides of the present disclosure.Isolated polynucleotides or nucleic acids according to this disclosure further include synthetically produced polynucleotides and nucleic acids (eg, nucleic acid molecules).

[0061] As used herein, an "expression cassette" comprises a nucleic acid sequence of interest (eg, a nucleic acid sequence, DNA, or RNA, for expression of a polypeptide) and an expression control region.

[0062] As used herein, "transgene" can be used interchangeably with "gene of interest" or "GOI" to refer to a portion of a polynucleotide that contains codons translatable into amino acids. Although a "stop codon" (TAG, TGA, or TAA) is typically not translated into an amino acid, the stop codon may be considered part of the transgene, but any adjacent sequences, such as promoters, ribosome binding sites, transcription terminators, introns, and the like, are not part of the transgene. The boundaries of a transgene are typically determined by a start codon at the 5' end, which encodes the amino terminus of the resulting polypeptide, and a translation stop codon at the 3' end, which encodes the carboxyl terminus of the resulting polypeptide.

[0063] As used herein, the term "expression control region" refers to a transcriptional control element that is operably associated with a nucleic acid sequence of interest and directs or controls the expression of an expression product of the nucleic acid sequence of interest, including, for example, a cis-regulatory module (CRM), a promoter (e.g., a tissue-specific promoter and / or an inducible promoter), an enhancer, an operator, a repressor, a ribosome binding site, a translation leader sequence, an intron, a post-transcriptional element, a polyadenylation recognition sequence, an RNA processing site, an effector binding site, a stem-loop structure, a transcription termination signal, an miRNA binding site, and combinations thereof. Expression control regions are located upstream (5'), within, or downstream (3') of the nucleic acid sequence of interest and include nucleotide sequences that affect the transcription, RNA processing, stability, or translation of the associated nucleic acid sequence of interest. When a transgene is intended for expression in eukaryotic cells, a polyadenylation signal and a transcription termination sequence are usually located 3' of the transgene.

[0064] As used herein, the terms "host cell" and "cell" can be used interchangeably and can refer to any type of cell or population of cells, e.g., primary cells, cells in culture, or cells from a cell line, that harbor or are capable of harboring a nucleic acid molecule (e.g., a recombinant nucleic acid molecule). Host cells can be prokaryotic cells, or alternatively, host cells can be eukaryotic, e.g., fungal cells such as yeast cells, and various animal cells such as insect cells or mammalian cells.

[0065] "Culture," "to culture," and "culturing," as used herein, refer to the incubation of cells under in vitro conditions that allow cell growth or division or that maintain the cells in a viable state. "Cultured cells," as used herein, refer to cells that are propagated in vitro.

[0066] A "subject" includes any human or non-human animal. The term "non-human animal" includes, but is not limited to, vertebrates such as non-human primates, sheep, dogs, and rodents such as mice, rats, and guinea pigs. In a preferred embodiment, the subject is a human. The terms "subject" and "patient" are used interchangeably herein.

[0067] "Administering" refers to the physical introduction of a composition containing a therapeutic agent into a subject using any of a variety of methods and delivery systems known to those skilled in the art.

[0068] "Treatment" or "treatment" of a subject refers to any type of intervention or process performed on a subject, or administration of an active agent to a subject, for the purpose of ameliorating, alleviating, ameliorating, suppressing, or slowing the progression, onset, severity, or recurrence of symptoms, complications, or conditions, or biochemical manifestations associated with a disease, condition, or disorder.

[0069] As used herein, "effective treatment" refers to a treatment that produces a beneficial effect, for example, an alleviation of at least one symptom of a disease, condition, or disorder. A beneficial effect can take the form of an improvement over baseline, i.e., an improvement over measurements or observations made prior to the initiation of treatment according to the method. A beneficial effect can also take the form of halting, slowing, delaying, or stabilizing the adverse progression of markers of a disease, condition, or disorder. Effective treatment can refer to the alleviation of at least one symptom of a disease, condition, or disorder.

[0070] The term "effective amount" refers to the amount of an agent that produces a desired biological, therapeutic, and / or prophylactic result. The result can be a reduction, alleviation, relief, reduction, delay, and / or alleviation of one or more of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. In some embodiments, an effective amount is an amount sufficient to prevent or delay the recurrence of symptoms of a disease, condition, or disorder. An effective amount can be administered in one or more doses.

[0071] Various aspects of the invention are described in further detail in the following subsections.

[0072] II. Production of AAV from msDNA Ministring DNA vectors (interchangeably referred to herein as "msDNA vectors" or "msDNA") are bacterial sequence-free vectors with linear covalently linked (LCC) termini. See U.S. Patent No. 9,290,778, U.S. Patent No. 9,862,954, and International Application No. WO2022 / 264095; Nafissi and Slavcev, Microbial Cell Factories 11:154 (2012); and Nafissi et al., Nucleic Acids 3(6):e165 (2014), which are incorporated herein by reference in their entirety. msDNA is a "bacterial sequence-free vector" because it lacks any bacterial backbone sequences, such as antibiotic resistance genes, bacterial replication origins, or immunostimulatory unmethylated CpG motifs typical of plasmid-based vectors. Integration of msDNA into cellular chromosomes results in chromosome cleavage and cell death through apoptotic cell death. Thus, msDNA eliminates any risk of insertional mutagenesis and avoids potential genotoxic and oncogenic events associated with integration when using other delivery vectors. See Nafissi et al.

[0073] The msDNA is generated from an expression vector (e.g., a plasmid) containing specialized "super sequence" ("SS" or "SSeq" used interchangeably herein) sites that contain target sequences for recombinases. The SS sites flank an expression cassette containing a nucleic acid of interest. When the expression vector is present in a recombinant cell that expresses the appropriate recombinase, the msDNA containing the expression cassette is separated from the backbone DNA of the expression vector. The msDNA can then be purified and used directly as a delivery vector. See U.S. Patent No. 9,290,778, U.S. Patent No. 9,862,954, and International Application No. WO2022 / 264095; Nafissi and Slavcev, and Nafissi et al.

[0074] A. Expression Vectors, Vector Construction Systems, and msDNA Provided herein are expression vectors for generating msDNA containing sequences that can be used to produce AAV.

[0075] In one embodiment, the expression vector comprises (a) a first sequence comprising inverted terminal repeats (ITRs) flanking at least one end of a desired sequence, the ITRs comprising sequences for adeno-associated virus (AAV) replication and an AAV packaging signal, (b) target sequences for a first recombinase flanking each end of the first sequence, and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding regions of the target sequence for the first recombinase, the expression vector intended to generate a bacterial sequence-free vector (i.e., msDNA) with linear covalently linked ends. In some embodiments, the desired sequence is a multiple cloning site (MCS), an expression cassette comprising the nucleic acid sequence of interest, a palindromic sequence comprising an expression cassette comprising the nucleic acid sequence of interest and the complement of the expression cassette, or a portion of an expression cassette comprising the nucleic acid sequence of interest flanked at one end by a splicing sequence.

[0076] Any ITR sequence containing the sequences for AAV replication and AAV packaging signal disclosed herein can be used in the embodiments of the invention disclosed herein.

[0077] Each end of a wild-type AAV ITR contains palindromic regions (A and A', B and B', and C and C') that self-anneal to form a double-stranded T-shaped hairpin structure. The self-annealed B-B' and C-C' palindromes form the crossarms of the hairpin, and the self-annealed A-A' palindromic region forms the stem of the hairpin. The hairpin is followed by a short non-palindromic region (D) in the ITR that provides a packaging signal. A, A', B, B', C, C', and D may be referred to interchangeably herein as "sequences" or "regions" (e.g., A sequence, sequence A, A region, region A, etc.). Studies have shown that AAV packaging and replication can occur in ITRs lacking the B-B' and C-C' regions. See, e.g., Zhou et al., Scientific Reports 7:5432 (2017).

[0078] The ITRs contain sequences related to Rep protein function. Rep68 / Rep78 bind to 16-nucleotide tetrameric repeats within A-A', known as Rep protein-binding elements (RBEs), which have helicase activity and unwind the RBE sequences. As used herein, RBE refers to the double-stranded structure formed when the palindromic A-RBE and A'-RBE sequences self-anneal. A sequence at one end of one of the internal palindromic B-B' regions, designated RBE', directs Rep68 / Rep78 toward the terminal resolution site (TRS). Rep68 / Rep78 endonuclease activity cleaves the TRS during replication, degrading the double-stranded sequence and generating a single-stranded genome for packaging. See, for example, Daya and Berns, Lisowski et al.; Ling et al., J. Mol. Genet. Med. 9(3):175 (2015); Salganik et al., Microbiol. Spectrum 3(4):MDNA3-0052-2014.

[0079] To date, over 100 human and non-human primate AAVs have been identified, including 13 serotypes. See, for example, Daya and Berns; Lisowski et al.; and Mary et al. The ITR sequences for each serotype are known in the art or are listed in Table 1. The ITR sequences for each serotype ... The origin of representative accession numbers for V6 (AF028704.1), AAV7 (NC_006260.1), AAV8 (NC_006261.1), AAV9 (AX753250.1), AAV10 (AY631965.1), AAV11 (AY631966.1), AAV12 (DQ813647.1), and AAV13 (EU285562.1) can be readily determined by one of skill in the art.

[0080] In some embodiments, the ITRs flank only one end (i.e., the 5' ITR or the 3' ITR) of an MCS, expression cassette, palindromic sequence, or portion of an expression cassette in an expression vector disclosed herein.

[0081] In some embodiments, an ITR flanks each end (i.e., the 5'ITR and 3'ITR) of an MCS, expression cassette, palindromic sequence, or portion of an expression cassette in an expression vector disclosed herein.

[0082] In some embodiments, the expression vectors, msDNA, or AAV disclosed herein comprise wild-type AAV 5'ITR and / or 3'ITR sequences. In some embodiments, the expression vectors, msDNA, or AAV disclosed herein comprise a portion of the wild-type AAV ITR sequence or an artificial sequence containing sequences for AAV replication and an AAV packaging signal.

[0083] In some embodiments, the ITRs are wild-type AAV ITRs.

[0084] In some embodiments, the ITRs are portions of the wild-type AAV ITRs that contain sequences for AAV replication and the AAV packaging signal.

[0085] In some embodiments, the ITRs are artificial ITRs that contain sequences for AAV replication and an AAV packaging signal.

[0086] In some embodiments, the ITRs comprise an A, A', and D sequence.

[0087] In some embodiments, the ITRs comprise the RBE and D sequences of an AAV ITR.

[0088] In some embodiments, an ITR flanks each end of the MCS, expression cassette, palindromic sequence, or portion of an expression cassette, and the ITRs at each end are identical.

[0089] In some embodiments, an ITR flanks each end of the MCS, expression cassette, palindromic sequence, or portion of an expression cassette, and the ITRs at each end are different.

[0090] In some aspects, any of the expression vectors, msDNA, or AAV disclosed herein comprises 5' ITR and 3' ITR sequences flanking the MCS, expression cassette, palindromic sequence, or portion of the expression cassette, wherein the 5' and 3' ITRs are from the same serotype or different serotypes.

[0091] In some aspects, the ITRs disclosed herein are chimeric ITRs comprising sequences from different AAV serotypes.

[0092] Representative AAV ITR sequences are shown in Table 1.

[0093] [Table 1]

[0094] In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise one or more sequences from Table 1.

[0095] In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise one or more sequences from the negative strand (i.e., negative or antisense strand) AAV genome that correspond to the positive strand (i.e., positive or sense strand) AAV genome sequences in Table 1.

[0096] In some embodiments, the ITR sequences of any of the expression vectors, msDNA, or AAV disclosed herein comprise one or more 5'ITR, 3'ITR, A, A', B, B', C, C', D, A-RBE, A'-RBE, RBE', 5'ITR D, 3'ITR D, 5'ITR TRS, or 3'ITR TRS sequences that are at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the corresponding sequences in Table 1.

[0097] In some embodiments, the ITR sequences of any of the expression vectors, msDNA, or AAVs disclosed herein comprise one or more 5'ITR, 3'ITR, A, A', B, B', C, C', D, A-RBE, A'-RBE, RBE', 5'ITR D, 3'ITR D, 5'ITR TRS, or 3'ITR TRS sequences that are at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the negative strand (i.e., antisense strand) AAV genomic sequence corresponding to the positive strand (i.e., sense strand) AAV genomic sequence in Table 1.

[0098] In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise a 5' ITR having the polynucleotide sequence of SEQ ID NO: 16 and / or a 3' ITR having the polynucleotide sequence of SEQ ID NO: 17. In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise a 5' ITR having the polynucleotide sequence of SEQ ID NO: 16 and a 3' ITR having the polynucleotide sequence of SEQ ID NO: 17.

[0099] In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise a 5' ITR having the polynucleotide sequence of SEQ ID NO: 38 and / or a 3' ITR having the polynucleotide sequence of SEQ ID NO: 39. In some embodiments, the ITRs of any of the expression vectors, msDNA, or AAV disclosed herein comprise a 5' ITR having the polynucleotide sequence of SEQ ID NO: 38 and a 3' ITR having the polynucleotide sequence of SEQ ID NO: 39.

[0100] In some embodiments, the expression vectors disclosed herein further comprise a spacer sequence between the target sequence for the first recombinase and the first sequence (e.g., between the target sequence for the first recombinase and the ITR, such as between the 5' target sequence for the first recombinase and the 5' ITR and / or between the 3' target sequence for the first recombinase and the 3' ITR). In some embodiments, the msDNA or AAV described herein further comprises a spacer sequence between a portion of the SSeq (e.g., the portion remaining after Tel recombination of an expression vector described herein containing the SSeq, e.g., the portion provided in the polynucleotide sequence of SEQ ID NO: 37) and the ITR (i.e., the 5' ITR and / or the 3' ITR). In some embodiments, the spacer sequence is about 10 to about 500 nucleotides. In some embodiments, the spacer sequence is about 1 to about 10 nucleotides, about 10 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 250 nucleotides, or about 250 to about 500 nucleotides.

[0101] In some embodiments, the 5' spacer sequence is the polynucleotide sequence of SEQ ID NO:40.

[0102] In some embodiments, the 3' spacer sequence is the polynucleotide sequence of SEQ ID NO:41.

[0103] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein comprises a 5' spacer sequence having the polynucleotide sequence of SEQ ID NO:40 and a 3' spacer sequence having the polynucleotide sequence of SEQ ID NO:41.

[0104] In some embodiments, the 5' spacer sequence is the polynucleotide sequence of SEQ ID NO: 40, the 5' ITR is the polynucleotide sequence of SEQ ID NO: 38, and / or the 3' spacer sequence is the polynucleotide sequence of SEQ ID NO: 41, and the 3' ITR is the polynucleotide sequence of SEQ ID NO: 39.

[0105] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein comprises a 5' spacer sequence having the polynucleotide sequence of SEQ ID NO: 40, a 5' ITR having the polynucleotide sequence of SEQ ID NO: 38, a 3' spacer sequence having the polynucleotide sequence of SEQ ID NO: 41, and a 3' ITR having the polynucleotide sequence of SEQ ID NO: 39.

[0106] In some embodiments, the expression vector lacks any spacer sequence between the target sequence for the first recombinase and the first sequence.

[0107] In some embodiments, the expression vector further comprises an expression cassette comprising an AAV replication (Rep) gene and / or an AAV capsid (cap) gene flanked on one end by a target sequence for a first recombinase and on the other end by the first sequence.

[0108] The AAV rep and cap genes of any of the expression vectors or msDNAs disclosed herein can be derived from any AAV, including any of the AAV serotypes disclosed herein. The ITRs, rep genes, and / or cap genes can be derived from the same or different AAVs, including the same or different AAV serotypes. The rep and / or cap genes can also be hybrid sequences containing sequences from different AAVs, such that Rep40, Rep52, Rep68, Rep78, VP1, VP2, VP3, and AAP, or portions thereof, can be encoded by sequences from different AAVs.

[0109] Sequences representing the rep and cap genes for each of the 13 identified serotypes are known in the art or could be readily determined by one of skill in the art, including from the representative accession numbers for the 13 serotypes disclosed herein. For example, the AAV2 rep and cap genes are provided herein as SEQ ID NOs: 21 and 22, respectively, or SEQ ID NOs: 45 and 22, respectively. As used herein, a "serotype" refers to an AAV having a capsid that is serologically distinct from other AAVs, as indicated, for example, by a lack of cross-reactivity between antibodies to one AAV and another AAV due to differences in capsid proteins.

[0110] Serotypes differ in their tissue tropism (i.e., the type of cell that AAV infects) based on their capsid. See, e.g., Likowski et al.; Daya and Berns.

[0111] In some embodiments, the AAV targets tissues or cells that contain a cell surface receptor for the AAV serotype. In some embodiments, the cell surface receptor is a heparan sulfate proteoglycan (e.g., a cell surface receptor for AAV-3), an O-linked sialic acid (e.g., a cell surface receptor for AAV-4), a platelet-derived growth factor receptor (e.g., a cell surface receptor for AAV-5), or a 37-kDa / 67-kDa laminin receptor (e.g., a cell surface receptor for AAV-2, AAV-3, AAV-8, or AAV-9).

[0112] Mixing genomic sequences from one AAV serotype with capsids from another AAV serotype is known as pseudotyping and is designated herein with a slash, e.g., the combination of a recombinant AAV with ITR sequences from AAV2 and a capsid from AAV5 is designated herein as AAV2 / 5.

[0113] In some embodiments, an expression vector, msDNA, expression vector combination (i.e., the ITR and cap sequences are located on separate expression vectors), msDNA combination, or AAV disclosed herein comprises a 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, 1 / 11, 1 / 12, or 1 / 13 ITR / cap pseudotype. In some embodiments, a pseudotyped AAV disclosed herein contains 2 / 1, 2 / 3, 2 / 4, 2 / 5, 2 / 6, 2 / 7, 2 / 8, 2 / 9, 2 / 10, 2 / 11, 2 / 12, or 2 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 3 / 1, 3 / 2, 3 / 4, 3 / 5, 3 / 6, 3 / 7, 3 / 8, 3 / 9, 3 / 10, 3 / 11, 3 / 12, or 3 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 4 / 1, 4 / 2, 4 / 3, 4 / 5, 4 / 6, 4 / 7, 4 / 8, 4 / 9, 4 / 10, 4 / 11, 4 / 12, or 4 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 5 / 1, 5 / 2, 5 / 3, 5 / 4, 5 / 6, 5 / 7, 5 / 8, 5 / 9, 5 / 10, 5 / 11, 5 / 12, or 5 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 6 / 1, 6 / 2, 6 / 3, 6 / 4, 6 / 5, 6 / 7, 6 / 8, 6 / 9, 6 / 10, 6 / 11, 6 / 12, or 6 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 7 / 1, 7 / 2, 7 / 3, 7 / 4, 7 / 5, 7 / 6, 7 / 8, 7 / 9, 7 / 10, 7 / 11, 7 / 12, or 7 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 8 / 1, 8 / 2, 8 / 3, 8 / 4, 8 / 5, 8 / 6, 8 / 7, 8 / 9, 8 / 10, 8 / 11, 8 / 12, or 8 / 13 ITR / cap genes. In some aspects, the pseudotyped AAV disclosed herein contains the 9 / 1, 9 / 2, 9 / 3, 9 / 4, 9 / 5, 9 / 6, 9 / 7, 9 / 8, 9 / 10, 9 / 11, 9 / 12, or 9 / 13 ITR / cap genes.In some embodiments, the pseudotyped AAV disclosed herein contains 10 / 1, 10 / 2, 10 / 3, 10 / 4, 10 / 5, 10 / 6, 10 / 7, 10 / 8, 10 / 9, 10 / 11, 10 / 12, or 10 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAV disclosed herein contains 11 / 1, 11 / 2, 11 / 3, 11 / 4, 11 / 5, 11 / 6, 11 / 7, 11 / 8, 11 / 9, 11 / 10, 11 / 12, or 11 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 12 / 1, 12 / 2, 12 / 3, 12 / 4, 12 / 5, 12 / 6, 12 / 7, 12 / 8, 12 / 9, 12 / 10, 12 / 11, 12 / 12, or 12 / 13 ITR / cap genes. In some embodiments, the pseudotyped AAVs disclosed herein contain 13 / 1, 13 / 2, 13 / 3, 13 / 4, 13 / 5, 13 / 6, 13 / 7, 13 / 8, 13 / 9, 13 / 10, 13 / 11, or 13 / 12 ITR / cap genes.

[0114] The capsids disclosed herein may also be hybrid capsids made using capsid proteins from multiple serotypes. For example, AAV-DJ has hybrid capsids derived from eight serotypes. In some embodiments, the expression vectors or msDNAs disclosed herein encode hybrid capsids, or the AAVs disclosed herein comprise hybrid capsids. In some embodiments, the hybrid capsids comprise capsid proteins derived from any two or more of the AAV1 to AAV13 serotypes.

[0115] Table 2 provides a representative list of tissue tropism for selected AAV serotypes, strains, and recombinant AAVs.

[0116] [Table 2]

[0117] In some embodiments, any of the expression vectors, msDNA, or AAVs disclosed herein comprises an ITR, rep gene, or cap gene from any of the AAVs listed in Table 2, or any combination of AAVs. In some embodiments, any of the AAVs disclosed herein comprises a capsid from any of the AAVs listed in Table 2.

[0118] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein that contain a rep gene and a cap gene contains the rep2 gene in combination with a cap gene from any of the AAV1 to AAV13 serotypes for the production of serotypes.

[0119] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein that contain the rep and cap genes includes the rep2 gene and the cap1 gene for AAV1 production.

[0120] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein that contain the rep and cap genes includes the rep2 gene and the cap2 gene for AAV2 production.

[0121] In some aspects, the msDNA for expression of the rep and cap genes in AAV2 production disclosed herein comprises the polynucleotide sequence of SEQ ID NO:24.

[0122] In some aspects, the msDNA for expression of the rep and cap genes in AAV2 production disclosed herein comprises the polynucleotide sequence of SEQ ID NO:48.

[0123] In some aspects, the msDNA for expression of the rep and cap genes in AAV5 production disclosed herein comprises the polynucleotide sequence of SEQ ID NO:49.

[0124] In some aspects, the msDNA for expression of the rep and cap genes in AAV9 production disclosed herein comprises the polynucleotide sequence of SEQ ID NO:50.

[0125] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein that contain the rep and cap genes includes the rep2 gene and the cap5 gene for AAV5 production.

[0126] In some embodiments, any of the expression vectors, msDNA, or AAV disclosed herein that contain the rep and cap genes includes the rep2 gene and the cap9 gene for AAV9 production.

[0127] In some embodiments, the cap gene comprises a sequence encoding a small peptide or ligand for targeting the AAV disclosed herein to a cell and / or tissue type (i.e., the cap gene is a recombinant sequence). In some embodiments, the sequence encoding the small peptide or ligand is intended to target the AAV to tumor cells or tumor tissue. In some embodiments, the cap gene comprises a sequence for targeting the AAV to tumor tissue. In some embodiments, the cap gene comprises a sequence encoding an NGR peptide motif. In some embodiments, the cap gene comprises a sequence encoding an RGD peptide motif (e.g., a 4C-RGD peptide). In some embodiments, the cap gene comprises a sequence encoding a designed ankyrin repeat protein (DARPin). In some embodiments, the cap gene comprises a mutation that enhances transduction efficiency. In some embodiments, the cap gene is derived from AAV3 and encodes a capsid protein having Y701F, Y705F, Y731F, S663V, T492V, and / or K533R mutations. In some embodiments, the cap gene is from any other serotype and encodes a capsid protein having mutations corresponding to Y701F, Y705F, Y731F, S663V, T492V, and / or K533R, numbered according to the AAV3 capsid protein. In some embodiments, the mutations include a combination of Y705F and Y731F. In some embodiments, the mutations include S663V, T492V, and K533R. In some embodiments, the mutations include S663V and T492V. In some embodiments, the cap gene includes a sequence encoding a protease recognition sequence (e.g., a protease recognition sequence recognized by matrix metalloproteinases (MMPs)). See, e.g., Santiago-Oritz et al., J. Control Release (2016) http: / / dx.doi.org / 10.1016 / j.jconrel.2016.01.001.

[0128] In some embodiments, the expression vector or msDNA disclosed herein comprises an MCS. The MCS comprises a restriction site for inserting a nucleic acid sequence of interest (e.g., a gene of interest) into the expression vector. The MCS can be operably linked to any suitable expression control region known to those skilled in the art.

[0129] Provided herein is an expression vector (i.e., "Expression Vector A") intended for generating a bacterial sequence-free vector with linear covalent ends, comprising: (a) a first sequence comprising an inverted terminal repeat (ITR) and a multiple cloning site (MCS), the ITRs flanking at least one end of the MCS, the ITRs comprising a sequence for adeno-associated virus (AAV) replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase. In some embodiments, the ITRs flank only one end of the MCS. In some embodiments, the ITRs flank each end of the MCS. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides long. In some embodiments, the expression vector further comprises an expression cassette comprising an AAV replication (Rep) gene and an AAV capsid (cap) gene flanked on one end by a target sequence for a first recombinase and on the other end by the first sequence.

[0130] Provided herein is an expression vector (i.e., "Expression Vector B") intended for generating a bacteria-free vector with linear covalent ends, the expression vector comprising: (a) a first sequence comprising an expression cassette comprising ITRs and a nucleic acid sequence of interest, the ITRs flanking at least one end of the expression cassette comprising the nucleic acid sequence of interest, the ITRs comprising sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding regions of the target sequence for the first recombinase.

[0131] In some embodiments, the ITRs flank only one end of the expression cassette containing the nucleic acid sequence of interest in expression vector B (i.e., "expression vector B1"). In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0132] In some embodiments, expression vector B1 further comprises an expression cassette comprising the AAVrep gene and the AAVcap gene flanked on one end by a target sequence for the first recombinase and on the other end by the first sequence (i.e., "expression vector B2").

[0133] In some embodiments, the ITRs flank each end of the expression cassette containing the nucleic acid sequence of interest in expression vector B (i.e., "expression vector B3"). In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0134] In some embodiments, expression vector B3 further comprises an expression cassette comprising the AAVrep gene and the AAVcap gene flanked on one end by a target sequence for the first recombinase and on the other end by the first sequence (i.e., "expression vector B4").

[0135] Provided herein is an expression vector (i.e., "Expression Vector C") intended for generating a bacterial sequence-free vector having linear covalent ends, the expression vector comprising: (a) a first sequence comprising ITRs and palindromic sequences, the ITRs flanking each end of the palindromic sequence, an expression cassette comprising a nucleic acid sequence of interest, and the complement of the expression cassette, the ITRs comprising a sequence for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase. In some embodiments, the complement is separated from the expression cassette comprising the nucleic acid sequence of interest by a non-complementary spacer sequence. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence. In some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0136] In some embodiments, expression vector C further comprises an expression cassette comprising the AArep gene and the AAVcap gene flanked on one end by a target sequence for a first recombinase and on the other end by a first sequence (i.e., "expression vector C1").

[0137] Provided herein is an expression vector (i.e., "Expression Vector D") intended for generating a bacteria-free sequence vector with linear covalent ends, comprising: (a) a portion of an expression cassette containing a nucleic acid sequence of interest flanked at one end by splicing sequences, with ITRs flanking each end of the first sequence, the ITRs including sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each ITR; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase. In some embodiments, the portion of the expression cassette comprises a 5' portion that, when combined with the remainder of the expression cassette, provides the complete sequence of the expression cassette, and the splicing sequence is adjacent to the 3' end of the 5' portion. In some embodiments, the portion of the expression cassette comprises a 3' portion that, when combined with the remainder of the expression cassette, provides the complete sequence of the expression cassette, and the splicing sequence is adjacent to the 5' end of the 3' portion. In some embodiments, the expression vector further comprises a spacer sequence between the target sequence for the first recombinase and the first sequence, hi some embodiments, the spacer sequence is 10 to 500 nucleotides.

[0138] The expression cassette of any of the expression vectors disclosed herein can include any suitable expression control region known to those of skill in the art.

[0139] In some embodiments, the expression control region is a cis-regulatory module (CRM), promoter, enhancer, operator, repressor, ribosome binding site, translation leader sequence, intron, post-transcriptional element, polyadenylation recognition sequence, RNA processing site, effector binding site, stem-loop structure, transcription termination signal, miRNA binding site, or a combination thereof. See, e.g., Domenger and Grimm, Hum. Mol. Genet. 28(R1):R3-R14 (2019).

[0140] In some embodiments, the promoter is a mammalian, viral, wild-type, or synthetic promoter, including, for example, a tissue- and / or cell-specific promoter.

[0141] In some aspects, the post-transcriptional element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0142] In some embodiments, the 3' end of the expression cassette contains an miRNA binding site for control of vector expression, eg, tissue- and / or cell-specific expression.

[0143] The nucleic acid sequence of interest in any of the expression vectors disclosed herein can be any desired sequence and is not limited by any particular requirements other than the packaging constraints imposed by the AAV capsid. Specifically, single-stranded DNA sequences up to about 5 kilobases in length, including any ITR sequences, can be packaged into a single AAV capsid, and double-stranded DNA sequences up to about half that size can be packaged.

[0144] In some embodiments, the nucleic acid sequence of interest comprises a sequence encoding a polypeptide, RNA (messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), ribozyme, or antisense RNA), or non-coding DNA (e.g., antisense oligonucleotide). In some embodiments, the nucleic acid sequence of interest comprises a sequence encoding an anti-cancer agent, a tumor suppressor, an apoptotic agent, an anti-angiogenic agent, an enzyme, a cytotoxic drug, a suicide gene, a cytokine, an interferon, an interleukin, an immunomodulatory agent, an immunostimulatory agent, an immunosuppressant, a chemokine, an agent for stimulating antigen-presenting cells, an antibody (e.g., a monoclonal, chimeric, humanized, or human antibody, or an antigen-binding fragment thereof), or an immunogenic agent (e.g., as a vaccine).

[0145] Exemplary nucleic acid sequences of interest and exemplary associated therapeutics include surfactant protein B (SP-B, for the treatment of surfactant dysfunction disorders), surfactant protein C (SP-C, for the treatment of surfactant dysfunction disorders), ATP-binding cassette subfamily A member 3 (ABCA3, for the treatment of surfactant dysfunction disorders), solute transporter family 34 member 2 (SLC34A2, for the treatment of pulmonary alveolar microlithiasis and / or testicular microlithiasis), cystic fibrosis transmembrane conductance regulator (CFTR, for the treatment of cystic fibrosis), glutamic acid decarboxylase inhibitor (GlcNAc, for the treatment of cystic fibrosis), and the like. GAD65 or GAD67, for the treatment of Parkinson's disease), aspartoacylase gene [ASPA, also known as aminoacylase (AAC), for the treatment of Canavan disease], aromatic L-amino acid decarboxylase (AADC, for the treatment of Parkinson's disease and / or for the treatment of AADC deficiency), neurturin (NRTN, for the treatment of Parkinson's disease), glial cell line-derived neurotrophic factor (GDNF, for the treatment of Parkinson's disease), nerve growth factor (NGF, for the treatment of Alzheimer's disease), tripeptidyl peptidase I (TPP1, for the treatment of neurotransmitters), Also known as ceroid lipofuscinosis-2 (CLN2), for the treatment of Batten disease), arylsulfatase A (ARSA, for the treatment of metachromatic leukodystrophy), N-sulfoglucosamine sulfohydrolase (SGSH, for the treatment of Sanfilippo syndrome type A), sulfatase modifying factor 1 (SUMF1, for the treatment of Sanfilippo syndrome type A), N-acetyl-alpha-glucosaminidase (NAGLU, for the treatment of Sanfilippo syndrome type B), survival of motor neuron 1 (SMN1, for the treatment of spinal muscular atrophy 1), retinal pigment epithelium-specific 65 kDa Protein (RPE65, also known as retinoid isomerohydrolase, for the treatment of Leber's congenital amaurosis), Love Escort Protein 1 (REP1, for the treatment of total choroidal atrophy), Retinoschisin 1 (RS1, for the treatment of X-linked juvenile retinoschisis), Alpha-1 Antitrypsin (AAT, for the treatment of hereditary emphysema or AAT deficiency), Minidystrophin (for the treatment of Duchenne muscular dystrophy), Alpha-Sarcoglycan (αSG, for the treatment of Duchenne muscular dystrophy or Limb-Girdle Muscular Dystrophy Type 2),β-Sarcoglycan (βSG), γ-Sarcoglycan (γSG, for the treatment of limb-girdle muscular dystrophy type 2), δ-Sarcoglycan (γSG), lipoprotein lipase (LPL, for the treatment of familial LPL deficiency), acid alpha-glucosidase (GAA, for the treatment of Pompe disease), tumor necrosis factor receptor:Fc (TNFR:Fc, for the treatment of arthritis, e.g., inflammatory arthritis), sarcoplasmic / endoplasmic reticulum Ca(2+)ATPase 2a (SERCA2a, for the treatment of congestive heart failure), factor VIII, factor IX (FIX, for the treatment of hemophilia B), porphobilinogen deaminase acid gene (PBGD, for the treatment of acute intermittent porphyria), soluble fms-like tyrosine kinase-1 (sFLT1, for the treatment of age-related macular degeneration or cancer, e.g., ovarian cancer), soluble chimeric vascular endothelial growth factor (VEGF) receptor comprising domains of VEGFR-1 and VEGF-R2 (for the treatment of cancer, e.g., melanoma or colon cancer), soluble VEGFR3 (for the treatment of cancer, e.g., endometrial cancer), soluble VEGF-C decoy receptor (sVEGFR3-Fc, for the treatment of cancer, e.g., melanoma, renal cell carcinoma, or prostate cancer), pigment epithelium-derived growth factor ( PEDF, for the treatment of cancer, e.g., Lewis lung carcinoma), neutralizing monoclonal antibodies against VEGFR2 (e.g., DC101, for the treatment of cancer, e.g., melanoma or glioblastoma), endostatin (for the treatment of cancer, e.g., bladder or pancreatic cancer), angiostatin (for the treatment of cancer, e.g., liver cancer), both endostatin and angiostatin (i.e., as a bicistronic sequence, for the treatment of cancer, e.g., ovarian or prostate cancer), endostatin mutants (i.e., P1254A-endostatin, for the treatment of cancer, e.g., ovarian cancer), angiogenesis inhibitory domain of TSP-1 (3TSR, for treating cancer, e.g., pancreatic cancer), tissue factor pathway inhibitor-2 (TFPI-2, for treating cancer, e.g., glioblastoma), fragments of plasminogen (e.g., kringle 5, for treating cancer, e.g., ovarian cancer), plasminogen kringle 1-5 (for treating cancer, e.g., melanoma or lung cancer), siRNA against unfolded protein response proteins (UPR; e.g., IRE1α, XBP-1, or ATF6, for treating cancer, e.g., breast cancer), vasostatin (for treating cancer, e.g., lung cancer),Herpes simplex virus type 1 thymidine kinase (HSV-TK, for treating cancer, e.g., breast cancer), sc39TK (for treating cancer, e.g., cervical cancer), diphtheria toxin A (DTA, for treating cancer, e.g., cervical cancer or myeloma), p53 up-regulated modulator of apoptosis (PUMA, for treating cancer, e.g., cervical cancer or myeloma), tumor necrosis factor (TNF)-related apoptosis-inducing ligand [TRAIL, for treating cancer, e.g., lymphoma, hepatocellular carcinoma, squamous cell carcinoma of the head and neck (i.e., head and neck cancer) or glioblastoma], soluble TRAI L (for treating cancer, e.g., liver cancer or lung adenocarcinoma), IFN-β (for treating cancer, e.g., colorectal cancer, lung cancer, neuroblastoma, or glioblastoma multiforme), IFN-α (for treating cancer, e.g., metastatic melanoma), CD-40 ligand (CD40L) or CD40L mutant (for treating cancer, e.g., lung cancer), melanoma differentiation-associated gene-7 and interleukin 24 (mda-7 and IL24, for treating cancer, e.g., Ehrlich ascites carcinoma), apoptotin and IL24 (for treating cancer, e.g., liver cancer), IL 24 [for the treatment of cancer, e.g., mixed lineage leukemia (MLL) / AF4-positive acute lymphoblastic leukemia (ALL)], IL15 (for the treatment of cancer, e.g., metastatic hepatocellular carcinoma), secondary lymphoid tissue chemokine (SLC, for the treatment of cancer, e.g., liver cancer), Nk4 [the N-terminal hairpin and four subsequent kringle domains of hepatocyte growth factor (HGF), for the treatment of cancer, e.g., metastatic Lewis lung carcinoma], tumor necrosis factor superfamily member 14 (TNFSF14, also known as LIGHT, for the treatment of cancer, e.g., cervical cancer), granulocyte-macrophage colony stimulating factors (GM-CSF, for the treatment of cancer), TNF-α (for the treatment of cancer, e.g., glioma), dominant negative mutants of survivin (e.g., C84A or T34A, for the treatment of cancer, e.g., colon cancer or gastric cancer), C-terminal fragment of human telomerase reverse transcriptase (hTERTC27, for the treatment of cancer, e.g., glioblastoma multiforme), maspin (for the treatment of cancer, e.g., prostate cancer), nm23H1 (for the treatment of cancer, e.g., metastatic ovarian cancer), kringle 1 domain of human hepatocyte growth factor (HGFK1, for the treatment of cancer, e.g., colorectal cancer),anti-calcitonin ribozyme (for treating cancer, e.g., prostate cancer), eukaryotic translation initiation factor 4E-binding protein 1 (4EBP1, for treating cancer, e.g., lung cancer), C-X-C motif chemokine receptor 2 (CXCR2) C-tail sequence (for treating cancer, e.g., pancreatic cancer), alpha-tocopherol-associated protein (alpha-tocopherol-associated protein) (TAP, for the treatment of cancer, e.g., prostate cancer), trichosanthin (for the treatment of cancer, e.g., hepatocellular carcinoma), decorin (for the treatment of cancer, e.g., glioblastoma multiforme), cathelicidin (for the treatment of cancer, e.g., colon cancer), Niemann-Pick disease type C2 (NPC2, for the treatment of cancer, e.g., hepatocellular carcinoma), Mullerian inhibitory factor (MIS, for the treatment of cancer, e.g., ovarian cancer), p53 (for the treatment of cancer, e.g., bronchoalveolar carcinoma), shRNA against highly expressed in cancer 1 (Hec1, for the treatment of cancer, e.g., glioma), shRNA against Epstein-Barr virus latent membrane protein 1 (EBV LMP-1, for the treatment of cancer, e.g., nasopharyngeal carcinoma), antisense RNA against human papillomavirus 16 E7 oncogene (HPV16-E7, for the treatment of cancer, e.g., cervical cancer), shRNA against androgen receptor (AR, for the treatment of cancer, e.g., prostate cancer), siRNA against Snail (also known as SNA1, for the treatment of cancer, e.g., pancreatic cancer), siRNA against Slug (i.e., the protein product of SNAI2, for the treatment of cancer, e.g., cholangiocarcinoma (liver cancer)), shRNA against Four and a half LIM-only protein 2 (FHL2, for the treatment of cancer, e.g., colon cancer), miR-26a (for the treatment of cancer, e.g., hepatocellular carcinoma), HPV 16 structural protein L1 (HPV16-L1, for the treatment of cancer, e.g., cervical cancer), HPV16 E5, E6, and E7 oncogenes (HPV16 E5 / E6 / E7, for the treatment of cancer, e.g., cervical cancer), B-cell leukemia / lymphoma 1 (BLC1) idiotype (for the treatment of cancer, e.g., B-cell leukemia / lymphoma 1), EBV LMP1 and LMP2 fused to heat shock proteins (EBV LMP2 / 1-hsp, for the treatment of cancer, e.g., cervical cancer),for the treatment of nasopharyngeal carcinoma), carcinoembryonic antigen (CEA, for the treatment of cancer, e.g., colon cancer), soluble forms of B and T lymphocyte attenuator in combination with heat shock proteins (BTLA and HSP70, for the treatment of cancer, e.g., melanoma lung metastasis), HPV16-L1 / E7 (for the treatment of cancer, e.g., cervical cancer), HPV16-L1 (for the treatment of cancer, e.g., cervical cancer), anti-EGFR antibodies (e.g., 14D1, for the treatment of cancer, e.g., vulvar cancer), anti-death antibodies These include receptor 5 (DR5) antibodies (e.g., adximab, for treating cancer, e.g., liver or colon cancer), anti-elanose 1 (ENOI1) antibodies (for treating cancer, e.g., pancreatic ductal adenocarcinoma), anti-VEGFA antibodies (e.g., bevacizumab, for treating cancer, e.g., metastatic lung cancer or ovarian cancer), mucin 1 (MUC1) antigen (for treating cancer, e.g., gastric cancer), or aquaporins (e.g., hAQP1, for treating radiation-induced parotid salivary hypofunction, i.e., xerostomia). See, e.g., Lisowski et al., Santiago-Oritz et al.

[0146] In some embodiments, the sequences for AAV replication in any of the above expression vectors include an AAV ITR replication (Rep) protein binding element (RBE) and a terminal resolution site (TRS).

[0147] In some aspects, the AAV packaging signal in any of the above expression vectors comprises an AAV ITR D-sequence.

[0148] Provided herein is an expression vector (i.e., msDNA) for generating a bacterial sequence-free vector with linear covalent ends, the expression vector comprising a sequence encoding the AAVrep, AAVcap, and / or helper virus genes required for AAV production. In some embodiments, the expression vector comprises AAVrep. In some embodiments, the expression vector comprises AAVcap. In some embodiments, the expression vector comprises AAVrep and AAVcap. In some embodiments, the expression vector comprises a helper virus gene. In some embodiments, the expression vector comprises AAVrep and a helper virus gene. In some embodiments, the expression vector comprises AAVcap and a helper virus gene. In some embodiments, the expression vector comprises AAVrep, AAVcap, and a helper virus gene. The expression vector comprising the AAVrep, AAVcap, and / or helper virus gene lacks (i.e., does not comprise) the ITRs flanking the ends of the AAVrep, AAVcap, and / or helper virus gene, respectively, to avoid packaging of the AAVrep, AAVcap, and / or helper virus gene into the AAV capsid. In some aspects, the coding sequence(s) of the expression vectors disclosed herein consist essentially of AAVrep, AAVcap, and / or helper virus genes.

[0149] The helper virus genes disclosed herein include one or more genes derived from viruses that provide functions necessary for AAV replication. In some embodiments, the helper virus genes include one or more genes derived from adenovirus, herpesvirus (e.g., herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), or pseudorabies virus (PRV)), retrovirus, poxvirus (e.g., vaccinia virus), and / or lentivirus. In some embodiments, the helper virus genes include one or more of the adenovirus Early 4 (E4) gene, the adenovirus Early 2A (E2A) gene, or the adenovirus virus-associated (VA) gene. In some embodiments, the helper virus genes include the adenovirus E4, E2A, and VA genes.

[0150] In some aspects, the msDNA for expression of the helper genes disclosed herein comprises the polynucleotide sequence of SEQ ID NO:25.

[0151] In some aspects, the msDNA for expression of the helper genes disclosed herein comprises the polynucleotide sequence of SEQ ID NO:51.

[0152] Provided herein is an expression vector (i.e., "Expression Vector E") intended for generating a bacterial sequence-free vector having linear covalent ends, comprising: (a) an expression cassette containing AAVrep and AAVcap genes; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-junction regions of the target sequence for the first recombinase.

[0153] Provided herein is an expression vector (i.e., "expression vector F") intended to generate a bacterial sequence-free vector with linear covalent ends, comprising: (a) an expression cassette containing one or more helper virus genes for AAV production; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated into the non-binding region of the target sequence for the first recombinase. In some embodiments, the one or more helper virus genes are derived from adenovirus, herpesvirus, retrovirus, poxvirus, and / or lentivirus. In some embodiments, the one or more helper virus genes include the adenovirus E4 gene, the adenovirus E2A gene, and the adenovirus VA gene.

[0154] In some embodiments, the target sequence for the first recombinase and the one or more additional target sequences for the one or more additional recombinases in any of the expression vectors disclosed herein are selected from the group consisting of a PY54 pal site, an N15 telRL site, and a φK02 telRL site. In some embodiments, any of the expression vectors disclosed herein contain each of the target sequences. In some embodiments, any of the expression vectors disclosed herein contain a Tel recombinase pal site and a telRL recombinase target binding sequence integrated within the pal site.

[0155] In some embodiments, the target sequence for the first recombinase in any of the expression vectors disclosed herein is the phage PY54 Tel 142 base pair target site.

[0156] Provided herein is a vector production system comprising a recombinant cell engineered to encode at least a first recombinase under the control of an inducible promoter, the cell comprising any of the expression vectors disclosed herein. In some embodiments, the cell comprises any of expression vectors B-F disclosed herein. In some embodiments, the recombinant cell is an Escherichia coli cell, a yeast cell such as Saccharomyces cerevisiae, or a mammalian cell as disclosed in U.S. Patent No. 9,862,954. In some embodiments, the inducible promoter is thermally regulated, chemically regulated, IPTG regulated, glucose regulated, arabinose induced, T7 polymerase regulated, cold shock induced, pH induced, or a combination thereof. In some embodiments, the first recombinase is selected from TelN and Tel, and the expression vector incorporates a target sequence for at least the first recombinase. In some embodiments, the recombinant cell is further designed to encode a nuclease genome editing system, and the expression vector further comprises a backbone sequence containing a cleavage site for the nuclease genome editing system. In some embodiments, the nuclease genome editing system is a CRISPR nuclease system comprising a Cas nuclease and a gRNA, and the expression vector comprises a target sequence for the gRNA within the backbone sequence.

[0157] Provided herein are methods for producing a bacterial sequence-free vector (i.e., msDNA or msDNA vector) having linear covalent ends, the method comprising incubating any of the vector production systems disclosed herein under conditions suitable for expression of a first recombinase.

[0158] Provided herein are methods for producing a bacteria-free sequence vector having linear covalent ends, comprising incubating any of the vector production systems disclosed herein under conditions suitable for expression of a first recombinase and a nuclease genome editing system. In some embodiments, the method further comprises recovering the bacteria-free sequence vector.

[0159] Provided herein are methods for producing a bacteria-free sequence vector having linear covalent ends, the methods comprising in vitro incubating any of the expression vectors disclosed herein with the bacteriophage PY54-derived Tel / Pal recombination system. In some embodiments, the methods further comprise recovering the bacteria-free sequence vector.

[0160] Provided herein are bacteria-free sequence vectors produced by any of the methods for producing bacteria-free sequence vectors with linear covalent ends disclosed herein. In some embodiments, the bacteria-free sequence vector is produced from expression vector B1. In some embodiments, the bacteria-free sequence vector is produced from expression vector B2. In some embodiments, the bacteria-free sequence vector is produced from expression vector B3. In some embodiments, the bacteria-free sequence vector is produced from expression vector B4. In some embodiments, the bacteria-free sequence vector is produced from expression vector C. In some embodiments, the bacteria-free sequence vector is produced from expression vector C1. In some embodiments, the bacteria-free sequence vector is produced from expression vector D. In some embodiments, the bacteria-free sequence vector is produced from expression vector E. In some embodiments, the bacteria-free sequence vector is produced from expression vector F.

[0161] B. Methods for Producing AAV from msDNA Wild-type AAV is packaged as a single-stranded genome (i.e., single-stranded AAV, "ssAAV"). The msDNA disclosed herein, which contains an expression cassette flanked by ITRs on each end, can produce ssAAV in the presence of rep, cap, and helper virus genes.

[0162] The packaging capacity of an AAV capsid is approximately 5 kb. Nucleic acid sequences of interest greater than approximately 5 kb and up to approximately 10 kb can be delivered by co-infection of cells with two separate ssAAVs, each carrying a portion of the nucleic acid sequence of interest. The portions can be joined together in the co-infected cells through trans-splicing or homologous recombination to regenerate the complete nucleic acid sequence of interest.

[0163] Trans-splicing exploits the ability of the AAV genome to form head-to-tail concatemers through recombination at the ITRs after infection of a cell. See, for example, Daya and Berns; Yan et al., PNAS 97(12):6716-6721 (2000). Transcription from the recombinant AAV and subsequent splicing of the mRNA transcript allows the joining of separate 5' and 3' portions. Specifically, the 5' portion of the nucleic acid sequence of interest is flanked on each side by ITRs from a first AAV along with splicing sequences (e.g., a 3' splice donor), and the remaining 3' portion of the nucleic acid of interest is flanked on each side by ITRs from a second AAV along with splicing sequences (e.g., a 5' splice acceptor). Upon infection, the 5' and 3' portions from each AAV are spliced ​​together to form the complete nucleic acid sequence of interest.

[0164] Alternatively, the nucleic acid sequence of interest can be split into two parts with substantial sequence overlap between two separate ssAAVs, and co-expression in infected cells induces homologous recombination and formation of the complete nucleic acid sequence of interest.

[0165] The msDNA disclosed herein can be used to produce ssAAVs containing portions of a nucleic acid sequence of interest for delivery of up to about 10 kb of sequence to target cells and tissues through co-infection and trans-splicing or homologous recombination.

[0166] Because AAV relies on the cellular DNA replication machinery to synthesize the complementary strand of the ssAAV genome, expression of a nucleic acid sequence of interest (e.g., a transgene) from ssAAV can be delayed following infection of a cell or tissue. To overcome delayed expression of a nucleic acid sequence of interest, self-complementary AAV (scAAV) can be produced, which contains complementary sequences that can spontaneously anneal to form transcriptionally competent double-stranded DNA upon infection. See, for example, Daya and Berns. The msDNA disclosed herein, which contains a palindromic sequence (e.g., an expression cassette containing the complement of a nucleic acid sequence of interest and the expression cassette) flanked by ITRs on each end, is packaged as ssAAV in the presence of rep, cap, and helper virus genes.

[0167] scAAVs can also be formed using the msDNA disclosed herein, which contains only a single ITR flanking one end of the expression cassette. Without both ITRs, the msDNA will not replicate as an ssAAV intermediate. Instead, the sequence is directly packaged as double-stranded DNA due to the packaging signal in the ITR in the presence of rep, cap, and helper virus genes. The nucleic acid sequence of interest is then available as transcriptionally competent double-stranded DNA upon infection.

[0168] The AAVrep and cap sequences can be provided in standard plasmids for producing AAV or can be provided in one or more msDNAs disclosed herein.

[0169] The helper virus genes can be provided in a standard plasmid as the helper virus or in one or more msDNAs disclosed herein.

[0170] In some aspects, the production of AAV2 disclosed herein includes msDNA encoding a GOI disclosed herein, msDNA comprising the rep2 and cap2 genes comprising the polynucleotide sequence of SEQ ID NO: 24, and / or msDNA comprising a helper virus gene comprising the polynucleotide sequence of SEQ ID NO: 25.

[0171] In some aspects, the production of AAV2 disclosed herein includes msDNA encoding a GOI disclosed herein, msDNA comprising the rep2 and cap2 genes comprising the polynucleotide sequence of SEQ ID NO: 48, and / or msDNA comprising a helper virus gene comprising the polynucleotide sequence of SEQ ID NO: 51.

[0172] In some aspects, the production of AAV5 disclosed herein includes msDNA encoding a GOI disclosed herein, msDNA comprising the rep2 and cap5 genes comprising the polynucleotide sequence of SEQ ID NO: 49, and / or msDNA comprising a helper virus gene comprising the polynucleotide sequence of SEQ ID NO: 51.

[0173] In some aspects, the production of AAV9 disclosed herein includes msDNA encoding a GOI disclosed herein, msDNA comprising the rep2 and cap9 genes comprising the polynucleotide sequence of SEQ ID NO: 50, and / or msDNA comprising a helper virus gene comprising the polynucleotide sequence of SEQ ID NO: 51.

[0174] Alternatively, AAV producer cell lines containing integrated rep, cap, and / or helper virus genes in the producer cell genome can be used in the production of AAV according to the methods disclosed herein, which result in consistent and stable expression of AAV replication and packaging proteins. AAV producer cell lines can be generated that contain integrated rep, cap, and / or helper virus genes by homologous recombination with the corresponding msDNA disclosed herein that contains homologous arms for recombination.

[0175] An AAV producer cell can be any cell capable of producing AAV. In some embodiments, the producer cell is a mammalian cell (e.g., HEK293, COS, HeLa, or KB). In some embodiments, the producer cell is HEK293. In some embodiments, the producer cell is an insect cell (e.g., expressSF+®, Drosophila Schneider 2 (S2), Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-I, 5 Tn368, HzAml, Ha2302, or Hz2E5). In some embodiments, when the producer cell is an insect cell, the expression vector for producing the msDNA disclosed herein is a baculovirus vector.

[0176] Provided herein are methods for producing single-stranded AAV, the methods comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector B3, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising an AAVrep gene and an AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0177] Provided herein are methods for producing single-stranded AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector generated from expression vector B4, (ii) a bacteria-free sequence vector generated from expression vector F, or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0178] Provided herein is a method for producing single-stranded AAV, comprising: (a) transfecting a bacteria-sequence-free vector generated from expression vector B3 into a cell capable of producing AAV, wherein the AAVrep gene, the AAVcap gene, and one or more helper virus genes for the production of AAV are each encoded by the cell or the vector; and (b) incubating the cells under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes and the production of AAV.

[0179] Provided herein are methods for producing self-complementary AAV, the method comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector B1, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising an AAVrep gene and an AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0180] Provided herein are methods for producing self-complementary AAV, comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector generated from expression vector B2, (ii) a bacteria-free sequence vector generated from expression vector F, or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0181] Provided herein are methods for producing self-complementary AAV, the method comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector made from expression vector C, (ii) a bacteria-free sequence vector made from expression vector E or an expression vector comprising an expression cassette comprising an AAVrep gene and an AAVcap gene, and (iii) a bacteria-free sequence vector made from expression vector F or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0182] Provided herein are methods for producing self-complementary AAV, the methods comprising: (a) transfecting a cell capable of producing AAV with (i) a bacteria-free sequence vector generated from expression vector C1, (ii) a bacteria-free sequence vector generated from expression vector F, or an expression vector comprising an expression cassette comprising one or more helper virus genes for the production of AAV; and (b) incubating the cells under conditions suitable for the production of AAV.

[0183] Provided herein is a method for producing self-complementary AAV, comprising: (a) transfecting a bacteria-sequence-free vector generated from expression vector B1 or C into a cell capable of producing AAV, wherein the AAVrep gene, the AAVcap gene, and one or more helper virus genes for the production of AAV are each encoded by the cell or the vector; and (b) incubating the cell under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes and the production of AAV.

[0184] In some embodiments, the cells in any of the methods for producing single-stranded or self-complementary AAV disclosed herein are HEK293T cells.

[0185] In some embodiments, any of the methods for producing single-stranded or self-complementary AAV disclosed herein further include recovering the AAV.

[0186] In one aspect, the present disclosure is directed to AAV produced by any of the methods for producing single-stranded or self-complementary AAV disclosed herein.

[0187] In some embodiments, AAV produced according to the methods disclosed herein has a reduced number of contaminating bacterial sequences compared to AAV produced using another method (e.g., a system in which three plasmids each contain a nucleic acid sequence of interest, rep / cap, and helper virus genes (i.e., a three-plasmid system)). In some embodiments, the reduction in the number of contaminating bacterial sequences is below the limit of detection (i.e., the contaminating bacterial sequences are undetectable in the AAV). In some embodiments, the reduction in the number of contaminating bacterial sequences is determined by real-time quantitative PCR against the bacterial backbone and / or other plasmid-associated impurities, such as, for example, the ampicillin resistance (ampR) gene, origin of replication (ori, e.g., F1 ori), kanamycin resistance (kanR) gene, or chromatography, affinity, and sequences for recombination (SCAR).

[0188] In some embodiments, AAV produced according to the methods disclosed herein provides a greater number of AAVs containing a nucleic acid sequence of interest when compared to AAV produced using alternative methods.

[0189] In some embodiments, AAV produced according to the methods disclosed herein contains a reduced number of empty capsids when compared to AAV produced using alternative methods.

[0190] The number of empty capsids, including the ratio of full to empty AAV particles, can be assessed by any method known in the art, including, for example, analytical ultracentrifugation, transmission electron microscopy, anion-exchange high-performance liquid chromatography assays, and / or capillary isoelectric focusing. See, e.g., Burnham et al., Hum. Gene Ther. Methods 26(6):228-242 (2015); Chen, Microsc. Microanal. 13(5), 384-389 (2007); Fu et al., Hum. Gene Ther. Methods 30(4):144-152 (2019); Li et al., Curr. Mol. Med. doi: 10.2174 / 1566524020666200915105456 (2020).

[0191] In some aspects, AAV produced according to the methods disclosed herein provides higher transfection efficiency when compared to AAV produced using alternative methods.

[0192] In some aspects, AAV produced according to the methods disclosed herein provides a higher copy number per unit of transfection when compared to AAV produced using alternative methods.

[0193] In some aspects, AAV produced according to the methods disclosed herein provides greater nuclear localization of AAV when compared to AAV produced using alternative methods.

[0194] In some embodiments, AAV produced according to the methods disclosed herein results in a reduced immune response, fewer neutralizing antibodies, less risk of genomic integration, less silencing of a nucleic acid of interest, and / or less risk of antibiotic resistance following administration to a subject or measured in vitro, when compared to AAV produced using another method.

[0195] III. Pharmaceutical Compositions and Therapeutic Uses Provided herein are pharmaceutical compositions comprising the AAV disclosed herein.

[0196] In certain embodiments, the composition further comprises a physiologically acceptable carrier, excipient, or stabilizer. See, e.g., Remington: The Science and Practice of Pharmacy, 22 nd See, e.g., ed. (2013). Acceptable carriers, excipients, or stabilizers can include carriers, excipients, or stabilizers that are non-toxic to subjects. In certain embodiments, the composition or one or more components of the composition are sterile. Sterile components can be prepared, for example, by filtration (e.g., through a sterile filtration membrane) or by irradiation (e.g., by gamma irradiation).

[0197] The excipients of the present invention, when added to a pharmaceutical composition, can be described as "pharmaceutically acceptable," meaning that the excipient is a compound, material, composition, salt, and / or dosage form that, within the scope of sound medical judgment, is suitable for contact with human and animal tissues without undue toxicity, irritation, allergic response, or other problematic complication for the desired period of contact commensurate with a reasonable benefit / risk ratio. In some embodiments, the term "pharmaceutically acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopoeia or other generally recognized international pharmacopoeias for use in animals, more particularly in humans. A variety of excipients can be used. In some embodiments, the excipient can be, but is not limited to, an alkalinity agent, a stabilizer, an antioxidant, an adhesive, a separating agent, a coating agent, an external phase component, a sustained-release component, a solvent, a surfactant, a wetting agent, a buffer, a filler, a softener, or a combination thereof. In addition to the excipients discussed herein, excipients can be any of the excipients described in Remington: The Science and Practice of Pharmacy, 22 nded. (2013). The inclusion of an excipient in a particular category (e.g., "solvent") herein is intended to illustrate, rather than limit, the role of the excipient. A particular excipient may fit into multiple categories.

[0198] The pharmaceutical compositions of the present disclosure are formulated to be compatible with their intended administration route. Examples of administration routes include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes, such as by injection or infusion, for the compositions disclosed herein. The term "parenteral administration" as used herein refers to methods of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intraarticular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection and infusion, and in vivo electroporation. In some embodiments, the compositions are administered via a parenteral route, and in some embodiments, orally. Other parenteral routes include topical, epithelial, or mucosal administration routes, such as intranasal, sublingual, or topical. Administration can be, for example, one time, multiple times, and / or one or more times over an extended period of time. In some embodiments, the pharmaceutical composition comprising the AAV disclosed herein further comprises a delivery agent. In some embodiments, the delivery agent comprises a nanoparticle. In some embodiments, the delivery agent is selected from the group consisting of a liposome, a non-lipid polymer molecule, an endosome, and any combination thereof. In some embodiments, the delivery agent (e.g., nanoparticle) comprises a targeting ligand.

[0199] Provided herein are methods for treating a disease or disorder in a subject in need thereof, comprising administering to the subject an AAV or pharmaceutical composition disclosed herein.

[0200] Treatment is continued as long as clinical benefit is observed or until unacceptable toxicity or disease progression occurs. The dosage and frequency of administration can vary depending on whether the treatment is preventive or therapeutic. In preventive applications, relatively low dosages are typically administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. In therapeutic applications, relatively high dosages at relatively short intervals may be required until the progression of the disease is reduced or terminated, preferably until the patient shows partial or complete relief of disease symptoms. Thereafter, the patient can be administered a preventive administration regimen.

[0201] The actual dosage level can be varied to obtain an amount of the nucleic acid sequence of interest disclosed herein that is effective for achieving the desired therapeutic response for a particular patient, composition, and administration method without being excessively toxic to the patient.The selected dosage level depends on various pharmacokinetic factors, including the activity of the particular composition of the present disclosure used, the route of administration, the time of administration, the excretion rate of the particular compound used, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular composition used, the age, sex, weight, condition, overall health and medical history of the patient being treated, and similar factors well known in the medical field.The composition of the present disclosure can be administered via one or more routes of administration using one or more of a variety of methods well known in the art.As will be recognized by those skilled in the art, the route and / or method of administration will vary depending on the desired results.

[0202] All of the references cited above, and all references cited herein, are incorporated herein by reference in their entirety.

[0203] The following examples are offered by way of illustration and not by way of limitation. [Example]

[0204] [Example 1] Preparation of expression vectors and ministring DNA Ministring DNA (msDNA) containing a gene of interest, Rep / Cap sequences for AAV replication / packaging, or adenovirus helper sequences is generated according to the methods disclosed herein and in U.S. Pat. No. 9,290,778, U.S. Pat. No. 9,862,954, and International Publication No. WO2022 / 264095, which are incorporated by reference in their entireties.

[0205] A. Construction of an expression vector containing GFP Expression vectors are prepared containing green fluorescent protein (GFP) as a representative gene of interest, flanked by the 5' and 3' ITRs ("ITR-GFP-ITR", see, e.g., Figure 1) or by just the 3' ITR ("GFP-ITR").

[0206] The ITR-GFP-ITR and GFP-ITR sequences are obtained by restriction digestion or polymerase chain reaction (PCR) amplification from the AAV-GFP vector, or the GFP sequence is cloned into a plasmid carrying the appropriate ITR(s).

[0207] ITR-GFP-ITR and GFP-ITR are each inserted into a multiple cloning site between two specialized supersequence ("SS" or "SSeq" used interchangeably herein) sites in separate expression vectors (pMinistring, Mediphage Bioceuticals, Inc., Toronto, CA; U.S. Patent No. 9,290,778, U.S. Patent No. 9,862,954, and International Publication No. WO2022 / 264095).

[0208] A map representing a representative expression vector encoding the ITR-GFP-ITR msDNA is shown in Figure 1 as "ITR-CAG-GFP-ITR Plasmid," and the nucleic acid sequence representing the vector is provided as SEQ ID NO:18.

[0209] The map and sequence representing a representative expression vector encoding GFP-ITR are identical to those of the ITR-CAG-GFP-ITR plasmid, except that the expression cassette in the expression vector encoding GFP-ITR is only flanked by the 3' ITR and not the 5' ITR.

[0210] Additional expression vectors containing ITR-GFP-ITR and GFP-ITR have been prepared containing spacer sequences of different lengths, between the 5' SS and 5' ITR and between the 3' ITR and 3' SS for ITR-GFP-ITR, or between the 3' ITR and 3' SS for GFP-ITR. Typical spacer sequence lengths are 0-10, 10-15, 50-100, 100-250, and 250-500 nucleotides.

[0211] Expression vectors are also prepared in which the ITRs in ITR-GFP-ITR and GFP-ITR are minimal ITRs lacking the B-B' and C-C' palindromic sequences (i.e., the ITRs contain only the A-A' palindromic sequence and the D sequence).

[0212] B. Construction of expression vectors containing rep and cap sequences The sequence containing rep and cap is obtained by restriction digestion and PCR amplification from a plasmid containing the gene and inserted between two SS sites in an expression vector.

[0213] A map representing a representative expression vector encoding the Rep-Cap msDNA is shown in Figure 4 as "PGL2-SS-CMV-Rep-Cap-SS," and the nucleic acid sequence representing the vector is provided as SEQ ID NO:23.

[0214] Additional expression vectors are prepared in which the rep and cap sequences are combined into a single expression vector with the GOI, e.g., rep and cap flanked by SS at one end and ITR-GFP-ITR or GFP-ITR at the other end (e.g., SS-Rep-Cap-ITR-GFP-ITR-SS and SS-Rep-Cap-GFP-ITR-SS).

[0215] C. Construction of Expression Vectors Containing Adenovirus Helper Sequences Adenovirus helper sequences for AAV replication are obtained from AAV helper plasmids by restriction digestion or PCR amplification and inserted into the multiple cloning site between the two SS sites in the ministring vector.

[0216] D. Preparation of msDNA from Expression Vectors DNA ministrings (msDNA) are produced in inducible E. coli cells according to the methods described herein, as well as U.S. Pat. No. 9,290,778, U.S. Pat. No. 9,862,954, and International Publication No. WO2022 / 264095, which are incorporated by reference in their entireties.

[0217] Figure 2 shows a map representing a representative ITR-GFP-ITR msDNA, "ITR-CAG-GFP-ITR msDNA," generated from the expression vector shown in Figure 1. The nucleic acid sequence representing the ITR-CAG-GFP-ITR msDNA is provided as SEQ ID NO:19.

[0218] 3 shows a map representing a representative GFP-ITR msDNA, "CAG-GFP-ITR msDNA." The nucleic acid sequence representing the CAG-GFP-ITR msDNA is provided as SEQ ID NO:20.

[0219] Figure 5 shows a map representing a representative Rep-Cap msNA, "PGL2-SS-CMV-Rep-Cap-SS msDNA," generated from the expression vector shown in Figure 4. The nucleic acid sequence representing PGL2-SS-CMV-Rep-Cap-SS msDNA is provided as SEQ ID NO:24.

[0220] 6 shows a map representing a representative "helper sequence msDNA." The nucleic acid sequence representing the helper sequence msDNA is provided as SEQ ID NO:25.

[0221] [Example 2] Production and characterization of AAVs generated using msDNA The purpose of this study was to evaluate AAV produced using msDNA as described in Example 1 compared to AAV produced using conventional plasmids.

[0222] A. AAV Production AAV is produced using conventional plasmids and the msDNA of Example 1. The conventional plasmids are a plasmid containing GFP flanked by ITRs (i.e., pITR-GFP-ITR), a plasmid containing the AAV rep and cap genes (e.g., pRep-Cap, such as pRep2-Cap1 for AAV1 production, pRep2-Cap2 for AAV2 production, pRep2-Cap5 for AAV5 production, and pRep2-Cap9 for AAV9 production), and a plasmid containing adenovirus helper genes (i.e., pHelper).

[0223] Three conventional plasmid combinations for AAV production (i.e., pITR-GFP-ITR, pRep-Cap, and pHelper, shown below as Combination 1 in Table 3) serve as baselines for comparison with AAV produced using msDNA as a carrier of the GOI, in combination with conventional plasmids as carriers of Rep / Cap and helper sequences or msDNA providing Rep / Cap and helper sequences.

[0224] [Table 3]

[0225] Combinations also include ITR-GFP-ITR msDNA and GFP-ITR msDNA with varying lengths of spacer sequences between the SS and ITR and the minimal ITRs described in Example 1.

[0226] Following standard procedures, the combinations in Table 3 are separately transfected into mammalian producer cells (e.g., HEK293T, ATCC® CRL-3216™), the cells are incubated for production of AAV, and the AAV is purified.

[0227] B. Generation of stable AAV-producing cell lines harboring msDNA Stable mammalian AAV producer cell lines (e.g., HEK-293) are generated through nuclease-mediated homologous recombination of Rep-Cap msDNA and / or helper msDNA as described in Example 1 to integrate the Rep / Cap and / or helper genes, respectively, into the cell line genome. This results in consistent and stable expression of AAV replication and packaging proteins by the producer cell line such that AAV can be produced by transfection of a single vector carrying the GOI.

[0228] According to standard procedures, AAV producer cells with stably integrated Rep / Cap and / or helper genes are transfected with ITR-GFP-ITR msDNA or GFP-ITR msDNA from Example 1, the cells are incubated for production of AAV, and the AAV is purified.

[0229] C. AAV Characterization The AAV produced by each combination in Table 3 is characterized similarly to the AAV produced from producer cells with stably integrated Rep / Cap and helper genes.

[0230] Capsid composition is analyzed by Western blotting using a capsid protein-specific primary mouse antibody and a secondary peroxidase-conjugated donkey anti-mouse IgG.

[0231] Transduction titers are determined by transduction of HeLa cells with serially diluted vectors.

[0232] Transduction efficiency is assessed by applying the same viral titer to cells and evaluating transgene expression by flow cytometry 72 hours post-transduction. Packaging efficiency determines the number of fully filled AAV particles compared to empty capsids. Transfection efficiency determines the level and persistence of GFP expression.

[0233] Viral vector genome particles (genome titer) were assessed by real-time quantitative PCR (qPCR). Total DNA was isolated from AAV preparations, followed by real-time qPCR using transgene-specific primers.

[0234] Bacterial backbone and other plasmid-associated impurities are quantified by real-time qPCR using the primers listed in Table 4.

[0235] [Table 4]

[0236] Multiple t-test or ANOVA was used for statistical analysis followed by Tukey's test, with P values ​​below 0.05 considered statistically significant.

[0237] [Example 3] Preparation of ITR-GOI-ITR msDNA An expression vector for generating msDNA encoding enhanced green fluorescent protein (eGFP) as a gene of interest (GOI) flanked by artificial AAV2 ITRs was constructed as described in Example 1, U.S. Pat. No. 9,290,778, U.S. Pat. No. 9,862,954, and International Publication No. WO 2022 / 264095. Figure 7 shows a map of the expression vector [pITR2Cis (precursor plasmid)], which contains specialized supersequence sites ("SSeq") with recombinase target sequences (telL, FRT(minimal), and loxP) flanking the artificial AAV2 ITR sequences [5' "AAV ITR2" (SEQ ID NO: 38) and 3' "AAV ITR2" (SEQ ID NO: 39)]. * " (SEQ ID NO: 36)), which is flanked by an expression cassette containing a cytomegalovirus (CMV) enhancer, a promoter derived from chicken β-actin, and a synthetic promoter comprising a chimeric intron, a sequence encoding enhanced green fluorescent protein (eGFP), and a bovine growth hormone polyadenylation signal (bGHpA). SSeq is separated from each of the 5' and 3' ITRs (SEQ ID NOs: 40 and 41, respectively) by an artificial spacer sequence. The nucleic acid sequence representing pITR2Cis (precursor plasmid) is provided as SEQ ID NO: 42.

[0238] The msDNA was prepared from the precursor plasmid shown in Figure 7 as described in Example 1, U.S. Patent No. 9,290,778, U.S. Patent No. 9,862,954, and International Publication No. WO2022 / 264095. Figure 8 shows a map of the msDNA (ITR2Cis msDNA), which contains a portion of SSeq after Tel recombination (SEQ ID NO: 37) at the 5' and 3' ends. The nucleic acid sequence representing the ITR2Cis msDNA is provided as SEQ ID NO: 43.

[0239] Preparation of ITR-GOI-ITR msDNA The transfection efficiency of msDNA (ITR2Cis msDNA) was compared with that of its parental plasmid (pITR2Cis).

[0240] Briefly, equimolar concentrations of ITR2Cis msDNA and pITR2C were formulated with LIPOFECTAMINE 3000 and transfected separately into adherent HEK293 cells. Transfection efficiency (TE, percentage of GFP-positive cells) and median fluorescence intensity (MFI) were assessed by flow cytometry on days 2 and 6 posttransfection. Figures 9A and 9B show the results on day 2 for TE and MFI, respectively, and Figures 9C and 9D show the results on day 6 for TE and MFI, respectively.

[0241] The results show that lower doses of msDNA showed greater TE and GFP expression levels, with a 0.125 pMol dose of msDNA (0.38 μg) showing the highest TE and MFI. Maximum transfection efficiency and transgene expression were observed 2 days posttransfection. The results also show that the AAV ITR-GOI-ITR msDNA was significantly superior to an equimolar amount of ITR-GOI-ITR precursor plasmid DNA.

[0242] Cell viability was not affected by the ITR-GOI-ITR msDNA (Fig. 9D).

[0243] Furthermore, live imaging was performed 3 days after transfection of HEK293 cells with 0.25 pMol msDNA (0.58 μg) or 0.25 pMol precursor plasmid DNA (1.05 μg) at a 1:4 ratio with LIPOFECTAMINE 3000. Figure 10 shows micrographs of GFP expression in transfected cells. Nuclei were stained with diamidino-2-phenylindole (DAPI). msDNA showed much stronger TE than the parental plasmid.

[0244] [Example 4] Sucrose toxicity assay We used a sucrose toxicity (SuTox) fidelity assay to assess the accuracy of in vivo versus in vitro msDNA synthesis based on a loss-of-function (LOF) mutation in the conditionally toxic sacB gene. Specifically, the SacB protein is toxic to bacteria in the presence of sucrose, allowing for positive selection of mutants. Faithful replication of the sacB gene results in bacterial cell death, while LOF mutations in sacB that occur during DNA synthesis result in colony growth on sucrose.

[0245] A multigene expression vector for msDNA was created containing an expression cassette with the sacB gene and chloramphenicol resistance gene (encoding chloramphenicol acetyltransferase) flanked by 5' and 3' AAV ITR2 sequences. See Examples 1 and 3, U.S. Patent Nos. 9,290,778, 9,862,954, and International Publication No. WO 2022 / 264095. Figure 11 shows the ITR-sacB-CmR-ITR cassette contained in the expression vector.

[0246] The msDNA was expressed in vivo from an expression vector in Escherichia coli cells (MBI2 and MBI3 strains, Mediphage Bioceuticals, Inc., Toronto, CA) using the methods described in Example 1, U.S. Pat. Nos. 9,290,778 and 9,862,954, and International Publication No. WO 2022 / 264095.

[0247] For in vitro replication, primers containing SacI or SalI restriction enzyme sites were designed to ligate just outside the ITR-sacB-cmR-ITR region in the expression vector. Using these primers, the cassette was amplified by PCR using Taq (FroggaBio T-500) or Q5 (New England Biolabs M0491) polymerase, applying the buffer and thermocycling conditions recommended by the respective manufacturers. The same primers were used to guide rolling circle amplification (RCA) using Phi29 polymerase (New England Biolabs M0269). Following PCR or RCA, the enzyme and buffer reagents were removed using a commercially available PCR purification kit (Thermo Fisher K0702), yielding in vitro synthesized DNA. Because Phi29 produces multimers that are difficult to purify, the completed Phi29 reaction was digested with SacI and SalI restriction enzymes prior to the PCR purification protocol. DNA input was calculated as the amount of starter plasmid added to the reaction as template multiplied by the length of the amplified region as a fraction of the total plasmid size. DNA output was calculated as the concentration of the PCR purification (obtained using a Nanodrop spectrophotometer) multiplied by the elution volume.

[0248] The in vivo and in vitro synthesized DNAs, as well as the pUC19 vector carrying ampicillin resistance, were digested with SacI and SalI restriction enzymes (New England Biolabs R3156, R3138). The sacB-CmR fragments were isolated using a commercially available gel extraction kit (Thermo Fisher K0691), and each insert-vector combination was ligated overnight with T4 ligase (New England Biolabs M0202). A no-insert reaction was also included as a negative control. Ligations were highly efficient (1–3 × 10 9The transformants were transformed into competent cells (New England Biolabs C3040) at 100 μg / ml (CFU / μg pUC19 DNA). Transformants were serially diluted and plated on LB medium containing ampicillin (100 μg / ml), chloramphenicol (25 μg / ml), and 1% NaCl (standard Miller LB) or 6% sucrose. Plates were grown at 37°C for 16–24 hours. Colony-forming units (CFU) were counted for each sample, with and without sucrose. Any CFU counted from the negative control transformation was subtracted as background for all samples. Samples with no CFU on sucrose after background subtraction were treated as below the detection limit (BDL) and calculated as if 0.5 CFU were present on the sucrose plate. CFU from the sucrose plate were counted as sacB mutants. Figure 12A shows representative images of sucrose plates bearing transformations of ITR-sacB-CmR-ITR LCC DNA generated by PCR (Taq and Q5), RCA (Phi29), or in vivo in E. coli (MBI2). For Taq, one-quarter the dose was plated compared to the other images.

[0249] CFUs on standard LB plates were counted as total transformants. The number of DNA doublings was calculated as log2 (DNA output / input). Finally, the mutation rate was calculated as sacB mutants / total transformants / DNA doublings, as shown in Figure 12B. In other words, this calculates the proportion of DNA molecules containing LOF sacB mutations, normalized to how many times the initial template was replicated. The mutation rate calculated from the SuTox method describes LOF mutations in the sacB gene.

[0250] To obtain an estimate of the number of mutations per bp duplicated, the mutation rate was divided by the length of the sacB ORF and promoter (1533 bp), then multiplied by 1000 bp to obtain the mutations duplicated / kb, which was then multiplied by 100% to express the value as a percentage. The mutation rates are shown in Table 5 below.

[0251] [Table 5]

[0252] The data in Figure 12B and Table 5 show that in vitro replication using Taq, Phi29, or Q5 resulted in approximately 3000, 750, and 85 times more errors, respectively, than in vivo replication of msDNA. Thus, the data demonstrate that DNA generated in vivo in E. coli cells significantly exceeded the accuracy of PCR or RCA methods. Using E. coli-based in vivo-generated DNA, such as msDNA, can effectively reduce mutations, thereby mitigating risk and enhancing the overall quality of the final product.

[0253] [Example 5] Production of AVV using msDNA AAV has been produced by replacing one, two, or all three components of the traditional plasmid AAV production system with msDNA.

[0254] Test 1 - 1 msDNA, 2 conventional plasmids Figure 13 shows a diagram of AAV production in which the conventional GOI-containing plasmid is replaced with msDNA.

[0255] AAV1 and AAV2 serotypes were produced using the ITR-GOI-ITR msDNA (i.e., ITR2Cis msDNA) described in Example 3 or a plasmid encoding GFP and not containing SSeq (i.e., the ITR2Cis-no-SSeq plasmid control shown in Figure 14) in combination with a conventional Rep / Cap plasmid (i.e., pDNA-Rep2 / Cap1 for AAV1 production or pDNA-Rep2 / Cap2 for AAV2 production) and a conventional helper plasmid (i.e., pDNA-Helper) at constant masses in different molar ratios. The nucleic acid sequence representing the ITR2Cis-no-SSeq plasmid control is provided as SEQ ID NO:44.

[0256] pDNA-Helper, pDNA-Rep / Cap, and ITR2Cis msDNA or ITR2Cis No-SSeq plasmid control were mixed at a molar ratio of 1:2:1, 2:1.5:1, or 1.4:1.5:1. Each mixture was then complexed 1:1 with FECTOVIR-AAV transfection reagent in 5% high-glucose DMEM medium for 15 minutes. Following complexation, 2 μg / mL of each mixture was transfected with 1 μg DNA / 1 x 10 cells. 6 2 x 10 for the total cell concentration 6 The DNA was transfected separately into 35 mL or 150 mL cultures of GIBCO VCP2.0 cells (Thermo Fisher Scientific), a clonal cell line derived from the HEK293F parent cell line, at a density of 1000 cells / mL. DNA was selected for AAV2 production in the 35 mL cultures, and DNA was selected for both AAV1 and AAV2 serotypes in the 150 mL cultures.

[0257] Figure 15 shows GFP expression from samples of 35 mL cultures for all three ratios.

[0258] Figure 16 shows GFP expression from samples of 150 mL cultures for AAV1 and AAV2 serotypes produced from a 1.4 to 1.5 to 1 molar ratio of pDNA-helper to pDNA-Rep / Cap to ITR2Cis msDNA ("msDNA") or a 2 to 1.5 to 1 molar ratio of pDNA-helper to pDNA-Rep / Cap to ITR2Cis no SSeq plasmid control ("pDNA"). The cell viability associated with these transfections is shown in Figures 17A (% viable cells) and 17B [viable cell density (VCD), x 10 6 cells / mL].

[0259] After 72 hours, cells in 35 mL and 150 mL cultures were lysed in lysis buffer containing 1% Tween, 500 mM NaCl, 2 mM MgCl2 buffer, and 20 U / mL DENARASE at 37°C for 2 hours on a shaker.

[0260] Droplet digital PCR (ddPCR) was performed to determine the titer of AAV2 vector genomes / mL (VG / mL) based on the presence of GOI in 35 mL cultures for different ratios using ITR2Cis msDNA ("msDNA") or ITR2Cis no-SSeq plasmid control ("pDNA"). The results are shown in Figure 18 and Table 6 below.

[0261] [Table 6]

[0262] AAV1 and AAV2 were purified from 150 mL shake flask cultures using affinity chromatography. Figures 19A-19B and 20A-20B show chromatograms from affinity chromatography of cultures produced using ITR2Cis msDNA [msDNA (1.4 vs. 1.5 vs. 1), Figures 19A (AAV1) and 19B (AAV2)] or an ITR2Cis-free SSeq plasmid control [pDNA (2 vs. 1.5 vs. 1), Figures 20A (AAV1) and 20B (AAV2)]. The top line in each figure is the absorbance at 280 nm, indicating AAV1 or AAV2 empty capsids (i.e., capsids without encapsulated DNA), and the bottom line is the absorbance at 260 nm, indicating AAV1 or AAV2 capsids containing encapsulated DNA. The "VP / mL" quantity indicates the concentration of vector particles per milliliter of eluate, and the percentage indicates the proportion of particles that package DNA [i.e., A260 / A280, as determined directly from the AKTA chromatography trace (see, e.g., Werle et al., Mol. Ther. Methods Clin. Dev. 23: 254-262 (Dec. 2021)) or % full, as calculated by molecular weight spectrophotometry (REFEYN)]. The percentage of full particles may include particles that package the GOI and aberrantly packaged DNA, such as conventional plasmid backbones. Figure 21A shows a micrograph of an electrophoresis gel showing the capsid proteins VP1, VP2, and VP3 as three distinct bands from top to bottom in each lane, detected by ddPCR following affinity chromatography of msDNA (1.4 vs. 1.5 vs. 1) and pDNA (2 vs. 1.5 vs. 1) samples from AAV2 harvests. Figure 21B shows vector genome titers of AAV1 and AAV2 recovery from msDNA (1.4 vs. 1.5 vs. 1) and pDNA (2 vs. 1.5 vs. 1) samples as determined by ddPCR of the GOI.

[0263] AAV1 purified by affinity chromatography from 150 mL shake flask cultures was further purified using MUSTANG Q anion exchange (AEX) chromatography. Figures 22 and 23 show the relevant chromatograms from cultures produced using ITR2Cis msDNA [msDNA (1.4 vs. 1.5 vs. 1), Figure 22] or the ITR2Cis-free SSeq plasmid control [pDNA (2 vs. 1.5 vs. 1), Figure 23]. Overlines, underlines, VP / mL, and percentages are as described for Figures 19-20. Peak #1 in each figure contains primarily DNA-packaged particles, while Peak #2 contains empty particles and particles with packaged DNA. Figure 24A shows a micrograph of an electrophoresis gel showing capsid proteins VP1, VP2, and VP3 as three distinct bands from top to bottom in each lane, detected by ddPCR from MUSTANG Q AEX peaks #1 and #2. Figures 24B and 24C show the titers for peaks #1 and #2, respectively, associated with packaged DNA containing a gene of interest (GOI) or conventional plasmid DNA such as an origin of replication (Ori), KanR gene, or AmpR gene. These data show that msDNA produced a 1.9-fold higher yield and a 3.5% higher full-to-empty ratio.

[0264] Figure 25 compares titers for AAV2 produced from 35 mL cultures containing encapsulated conventional plasmid DNA ("Ori(Backbone)") or an expression cassette containing a GOI ("CMV(GOI)") from the different msDNA and pDNA ratios described above. The figure shows much lower packaging of the plasmid backbone sequence, even when a single msDNA was used.

[0265] Figure 26 shows next-generation sequencing (NGS) coverage maps of AAV1 and AAV2 packaged genomes produced using ITR2Cis msDNA [msDNA as described above (1.4 vs. 1.5 vs. 1)] or the ITR2Cis no-SSeq plasmid control [pDNA as described above (2 vs. 1.5 vs. 1)], relative to the plasmid map position. Based on the absence of backbone sequences in the msDNA vector, Figure 26 demonstrates that aberrant packaging of sequences outside the ITR-GOI-ITR region is largely negligible when using a single msDNA. Therefore, aberrant backbone plasmid sequences can be eliminated when using msDNA as a carrier of the GOI versus conventional plasmids in AAV production.

[0266] Test 2 - 2 msDNA, 1 conventional plasmid AAV2 was produced using the ITR-GOI-ITR msDNA (i.e., ITR2Cis msDNA) described in Example 3 or a conventional plasmid encoding GFP and not containing SSeq (i.e., ITR2Cis no SSeq plasmid control) described in Study 1, in combination with the Rep2 / Cap2 msDNA or conventional Rep2 / Cap2 plasmid shown in Figure 27, and a conventional helper plasmid (i.e., pDNA helper from Applied Viromics). The nucleic acid sequence representing the Rep2 / Cap2 msDNA is provided as SEQ ID NO:48.

[0267] pDNA-Helper, Rep2 / Cap2 msDNA, and ITR2Cis msDNA were mixed at a molar ratio of 1.4:1.5:1 ("msDNA"). pDNA-Helper, pDNA-Rep2 / Cap2, and ITR2Cis msDNA were mixed at a molar ratio of 1.4:1.5:1 ("Mixed-msDNA"). pDNA-Helper, pDNA-Rep / Cap, and ITR2Cis SSeq-free plasmid control were mixed at a molar ratio of 1:2:1 ("pDNA"). Each mixture was then individually complexed with FECTOVIR-AAV transfection reagent at a 1:1 ratio in 5% high-glucose DMEM medium for 15 minutes. Following complexation, each mixture was separately transfected into 150 mL cultures of GIBCO VCP2.0 cells (passage 37). 2% Glutamax was added to VPC medium before use, and all medium components were warmed before incubation. Cells were grown at 37°C with 7% CO2 with shaking at 130 rpm and harvested 72 hours post-transfection. Cells were then lysed by adding 1% Tween, 500 mM NaCl, and 25 U / mL DENARASE with mixing for 2 hours. The lysate was then clarified by spinning at 4000 rpm for 40 minutes before purification. Table 7 below shows the viability of the samples after 72 hours of culture.

[0268] [Table 7]

[0269] AAV2 was purified from the culture using affinity chromatography. Figures 28A and 28B show chromatograms for AAV produced from msDNA and pDNA samples, respectively. Overlines, underlines, VP / mL, and percentages are as described for Figures 19-20. VG / mL indicates the number of DNA-packaged particles per mL of eluate. Consistent production was observed from individual repeats, and chromatograms for AAV produced from the msDNA, mixed-msDNA, and pDNA samples derived from those repeats are shown in Figures 29A-29C, respectively. Figure 29D shows a micrograph of an electrophoresis gel showing the capsid proteins VP1, VP2, and VP3 as three distinct bands from top to bottom in each lane, detected by ddPCR following affinity chromatography of the msDNA sample (lane (a)), the mixed-msDNA sample (lane (b)), and the pDNA sample (lane (c)).

[0270] Approximately 87.5% of the capture from affinity chromatography of the repeats shown in Figures 29A-29C was used for further AEX purification, resulting in the chromatograms shown in Figures 30-32, respectively. As discussed above, the peaks labeled VG / mL and % full in each figure indicate the number of vector particles containing encapsulated DNA and the percentage of vector particles containing encapsulated DNA, respectively. Those peaks represent the eluates with the highest percentage of particles containing encapsulated DNA.

[0271] Figure 33A shows titers of AAV2 vector genomes / mL (VG / mL) based on the presence of the GOI as determined by ddPCR for samples from the initial harvest of AAV2 after cell culture lysis ("Harvest"), affinity chromatography ("Capture"), and AEX chromatography ("AEX"). The two harvest and two capture values ​​for the msDNA and pDNA samples are from separate repeats on different days as described in Figures 28 and 29, respectively.

[0272] Figure 33B shows the AAV2 titer (VG, mass balance) determined for each sample by multiplying the corresponding VG / mL titer in Figure 33A by the total volume of the sample.

[0273] FIG. 34A shows full particle estimation by A260 / A280 ratio for the samples described in FIG. 33A, and FIG. 34B shows full particle estimation by molecular weight spectroscopy for samples in the individual repeats above.

[0274] The data demonstrate a greater number of full particles and a major improvement in avoiding aberrant packaging of the backbone plasmid DNA using two msDNA vectors instead of two of the three conventional plasmids typically used in AAV manufacturing.

[0275] Test 2 - 3 msDNA Figure 35 shows a diagram of AAV production in which all three conventional plasmids are replaced with msDNA.

[0276] AAV2 was produced using all of the msDNAs, namely, the ITR-GOI-ITR msDNA (i.e., ITR2Cis msDNA) described in Example 3, the Rep2 / Cap2 msDNA described in Study 2, and the helper msDNA shown in Figure 36, the nucleic acid sequence of which is provided as SEQ ID NO: 51. For example, AAV produced using all of the pDNAs from the individual repeats in Study 2 shown in Figure 29C was used as a comparison.

[0277] ITR2Cis msDNA, Rep2 / Cap2 msDNA, and helper msDNA were mixed at a molar ratio of 1:2:1 or 1:1:1. The 1:2:1 mixtures were complexed with FECTOVIR-AAV transfection reagent to DNA at a 1:1 or 2:1 ratio, and the 1:1:1 mixture was complexed with FECTOVIR-AAV transfection reagent to DNA at a 2:1 ratio. Complexation was performed for 15 minutes in 5% high-glucose DMEM medium. Following complexation, each mixture was separately transfected into 150 mL cultures of GIBCO VCP2.0 cells. 2% Glutamax was added to VPC medium before use, and all medium components were warmed before incubation. Cells were grown at 37°C with 7% CO2, shaking at 130 rpm, and harvested 72 hours posttransfection. Cells were then lysed by adding 1% Tween, 500 mM NaCl, and 25 U / mL DENARASE with mixing for 2 hours, after which the lysate was clarified by spinning at 4000 rpm for 40 minutes before purification.

[0278] AAV2 was purified from the culture using affinity chromatography. Figures 37A-37D show chromatograms for AAV produced from a 1:2:1 molar ratio msDNA (1:1 FECTOVIR to DNA sample) (A), a 1:2:1 molar ratio msDNA (2:1 FECTOVIR to DNA sample) (B), and a 1:1:1 molar ratio msDNA (2:1 FECTOVIR to DNA sample) (C). Figure 37D shows chromatograms for all pDNA samples from Figure 29C (1:2:1 molar ratios of pDNA-Helper, pDNA-Rep / Cap, and ITR2Cis-less SSeq plasmid control, as well as a 1:1 FECTOVIR to DNA sample). Overline, underline, VP / mL, and % full values ​​are as above. VG / L is the concentration of vector genomes in the culture. Figure 38 includes a summary of the sample characteristics from Figures 37A-37D, including a photomicrograph of an electrophoresis gel showing capsid proteins VP1, VP2, and VP3 as three respective bands from top to bottom in each lane detected by ddPCR following affinity chromatography of the samples.

[0279] Approximately 87.5% of the capture from the affinity chromatography shown in Figures 37A-37D was used for further AEX purification, yielding the chromatograms shown in Figures 39-42, respectively. As discussed above, the peaks labeled VG / mL and % full in each figure indicate the number of vector particles containing encapsulated DNA and the percentage of vector particles containing encapsulated DNA, respectively. Those peaks represent the eluates with the highest percentage of particles containing encapsulated DNA.

[0280] Figure 43A shows the full particle estimation by A260 / A280 ratio for samples from affinity chromatography ("Capture") and AEX chromatography ("AEX Peak #1" and "AEX Peak #2"). Figure 43B shows the full particle estimation by molecular weight spectrophotometry for the samples.

[0281] Figure 44A shows the titers of AAV2 vector genomes / mL (VG / mL) based on the presence of the GOI determined by ddPCR for samples from the initial harvest of AAV2 after cell culture lysis ("Harvest"), affinity chromatography ("Capture"), and peak #1 of AEX chromatography ("AEX"). Figure 44B shows the AAV2 titers (VG, mass balance) determined for each sample by multiplying the corresponding VG / mL titers in Figure 44A by the total volume of the sample. Figure 44C shows the AAV2 titers (VG, mass balance) determined for each sample, including both peaks #1 and #2 of AEX chromatography.

[0282] The data show that the full-to-empty capsid ratio improved dramatically from 5.4% full (triple pDNA conventional plasmid transfection) to >20% full under suboptimal conditions using msDNA in place of all three conventional plasmids. Culture and other process-specific parameters were not optimized for msDNA; for the plasmids, they were simply plug-and-play based on existing SOPs.

[0283] Figure 45 shows NGS coverage maps of AAV2 packaged genomes produced using one, two, or three msDNAs instead of three conventional plasmids.

[0284] Figure 45 also shows that replacing the conventional plasmid encoding the GOI with msDNA resulted in a 100-fold improvement in aberrant packaging over the use of all three plasmids. Replacing the conventional plasmids encoding the GOI and Rep2 / Cap2 with msDNA resulted in a 1000-fold improvement. Furthermore, replacing all conventional plasmids with msDNA resulted in a 10,000-fold improvement.

[0285] [Example 6] Production of AAV9 using msDNA Test 1 AAV9 was produced using the ITR-GOI-ITR msDNA (i.e., ITR2Cis msDNA) described in Example 3 or a plasmid encoding GFP and containing no SSeq (i.e., ITR2Cis no SSeq plasmid control) described in Example 5, in combination with bacterial sequence-minimized / reduced plasmids for Rep2 / Cap9 and helper sequences, respectively.

[0286] ITR2Cis msDNA or ITR2Cis no-SSeq plasmid control was mixed with Rep2 / Cap9 and helper plasmid at a 1:1:1 molar ratio, and the individual mixtures were complexed with polyethyleneimine (PEI) at PEI-to-DNA ratios of 1.5:1, 2:1, and 2.5:1.

[0287] In combination with msDNA, total DNA concentrations of 1.0 μg / mL (0.156 μg / mL msDNA, 0.379 μg / mL Rep2 / Cap9 plasmid, and 0.465 μg / mL helper plasmid), 1.75 μg / mL (0.273 μg / mL msDNA, 0.663 μg / mL Rep2 / Cap9 plasmid, and 0.813 μg / mL helper plasmid), and 2.5 μg / mL (0.39 μg / mL msDNA, 0.948 μg / mL Rep2 / Cap9 plasmid, and 1.162 μg / mL helper plasmid) were transfected into separate 150 mL cultures of HEK-293 cells. Nine different msDNA transfectants were transfected: (msDNA1) 1.0 μg / mL DNA and 1.5:1 PEI to DNA; (msDNA2) 1.0 μg / mL DNA and 2:1 PEI to DNA. PEI to DNA, (msDNA3) 1.0 μg / mL DNA and 2.5 to 1 PEI to DNA, (msDNA4) 1.75 μg / mL DNA and 1.5 to 1 PEI to DNA, (msDNA5) 1.75 μg / mL DNA and 2 to 1 PEI to DNA, (msDNA6) 1.75 μg / mL DNA and 2.5 to 1 PEI to DNA, (msDNA7) 2.5 μg / mL DNA and 1.5 to 1 PEI to DNA, (msDNA8) 2.5 μg / mL DNA and 2 to 1 PEI to DNA, and (msDNA9) 2.5 μg / mL DNA and 2.5 to 1 PEI to DNA.

[0288] The ITR2Cis no-SSeq plasmid control and the Rep2 / Cap9 and helper bacterial sequence-minimized / reduced plasmids were complexed with PEI at a PEI-to-DNA ratio of 2:1 and a total DNA concentration of 2 μg / mL (0.36 μg / mL ITR2Cis plasmid control, 0.74 μg / mL Rep2 / Cap9 plasmid, and 0.9 μg / mL helper plasmid).

[0289] A summary of DNA concentrations and PEI to DNA ratios for the transfectants is provided in Table 8 below.

[0290] [Table 8]

[0291] Figure 46 shows the transfection efficiency of three plasmid ("AAV PP") and nine separate msDNA transfectants at 48 and 72 hours post-transfection, as assessed using flow cytometry for the GFP GOI.

[0292] Figure 47 shows the viable cell density (VCD, viable cells / mL) and viability (% viable cells) for samples analyzed using the Vi-CELL XR HEK293 profile at 48 and 72 hours post-transfection.

[0293] Figure 48 shows capsid titers for samples determined by AAV9-specific ELISA 72 hours post-transfection. Capsid ELISA does not distinguish between empty and full capsids. The figure shows that replacing the conventional plasmid carrying the GOI with msDNA resulted in 2.5-3 times more AAV / mL.

[0294] Figure 49 shows AAV titers determined for samples by ddPCR using primers specific for the ITR region at 72 hours post-transfection. Compared to standard plasmid conditions (2 μg / mL total DNA and a 2:1 ratio of PEI to DNA), half the starting mass yielded similar VG / mL when using msDNA instead of the GOI-containing plasmid, and a similar starting mass yielded twice as much VG / mL.

[0295] Test 2 msDNA5 (1.75 μg / mL total DNA and a 2:1 ratio of PEI to DNA) and standard plasmid conditions (2 μg / mL total DNA and a 2:1 ratio of PEI to DNA) were scaled to fit a 10 L AAV culture.

[0296] Figure 50 shows that similar masses of transfected DNA containing msDNA instead of the conventional plasmid containing the GOI resulted in higher AAV titers in 10 L cultures as determined by AEX chromatography followed by ddPCR.

[0297] Full capsids were also determined by molecular spectrophotometry using msDNA5, which resulted in 46.1% full capsids compared to 40.2% in standard plasmid conditions. [Sequence List Free Text]

[0298] SEQ ID NO: 1 AAV-2 wild-type 5'ITR (+ strand) ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct SEQ ID NO: 2 AAV-2 wild-type 3'ITR (+ strand) aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa SEQ ID NO: 3 AAV-2 wild-type ITR A-sequence (+ strand) ttggccactccctctctgcgcgctcgctcgctcactgaggc SEQ ID NO: 4 AAV-2 wild-type ITR A'-sequence (+ strand) gcctcagtgagcgagcgagcgcgcagagagggagtggccaa SEQ ID NO: 5 AAV-2 wild-type ITR B-sequence (+ strand) cgggcgacca SEQ ID NO: 6 AAV-2 wild-type ITR B'-sequence (+ strand) aaggtcgcccg SEQ ID NO: 7 AAV-2 wild-type ITR C-sequence (+ strand) cgcccgggct SEQ ID NO: 8 AAV-2 wild-type ITR C'-sequence (+ strand) ttgcccgggcg SEQ ID NO: 9 AAV-2 wild-type 5'ITR D-sequence (+ strand) ctccatcactaggggttcct SEQ ID NO: 10 AAV-2 wild-type 3'ITR D-sequence (+ strand) aggaacccctagtgatggag SEQ ID NO: 11 AAV-2 wild-type ITR A-RBS (+ strand) gcgcgctcgctcgctc SEQ ID NO: 12 AAV-2 wild-type ITR A'-RBS (+ strand) gagcgagcgagcgcgc SEQ ID NO: 13 AAV-2 wild-type ITR RBE' (positive strand) caaag SEQ ID NO: 14 AAV-2 wild-type 5'ITR TRS (+ strand) ccaact SEQ ID NO: 15 AAV-2 wild-type 3'ITR TRS (+ strand) agttgg SEQ ID NO: 16 AAV artificial 5'ITR (+ strand) ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct SEQ ID NO: 17 AAV artificial 3'ITR (+ strand) aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag SEQ ID NO: 18 ITR-CAG-GFP-ITR plasmid SEQ ID NO: 19 ITR-CAG-GFP-ITR msDNA SEQ ID NO: 20 CAG-GFP-ITR msDNA SEQ ID NO: 21 AAV-2 rep SEQ ID NO: 22 AAV-2 cap SEQ ID NO: 23 PGL2-SS-CMV-Rep-Cap-SS plasmid SEQ ID NO: 24 PGL2-SS-CMV-Rep-Cap-SS msDNA SEQ ID NO: 25 Helper sequence msDNA SEQ ID NO: 26 ampR forward primer atcccgtattgacgcc SEQ ID NO: 27 ampR reverse primer cgctcgtcgtttggta SEQ ID NO: 28 F1 ori forward primer gcgtgatggacagact SEQ ID NO: 29 F1 ori reverse primer gtcgaggtgccgtaaag SEQ ID NO: 30 ori forward primer taccgggttggactca SEQ ID NO: 31 ori reverse primer cccgacaggactataaag SEQ ID NO: 32 SCAR forward primer aacccataattgtgagcg SEQ ID NO: 33 SCAR reverse primer cattaaggtcgggaaaatgc SEQ ID NO: 34 kanR forward primer gccctgaatgaactgc SEQ ID NO: 35 kanR reverse primer ccatccgagtacgtgc SEQ ID NO: 36 SSeq taaagtaacccaatcagcacacaattgccattatacgcgcgtataatggactattgtgtgctgataaacctatttcagcatactacgcgcgtagtatgctgaaataggtgactagaagttcctatactttctagagaataggaacttcataacttcgtataatgtatgctatacgaagttatgggttactttaatttggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccacacctggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccacacc SEQ ID NO: 37 SSeq after Tel recombination cgcgtagtatgctgaaataggtgactagaagttcctatactttctagagaataggaacttcataacttcgtataatgtatgctatacgaagttatgggttactttaatttggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccacacctggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccacacc SEQ ID NO: 38 AAV artificial 5’ ITR (+ strand) ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct SEQ ID NO: 39 AAV artificial 3’ ITR (+ strand) aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa SEQ ID NO: 40 5' spacer between SSeq and ITR cctgattctgtggataaccgtatta SEQ ID NO: 41 3' spacer between SSeq and ITR acgcaattcggctt SEQ ID NO: 42 pITR2Cis msDNA precursor plasmid SEQ ID NO: 43 ITR2Cis msDNA SEQ ID NO: 44 pITR2Cis no SSeq Plasmid Control SEQ ID NO: 45 AAV-2 rep SEQ ID NO: 46 AAV-5 cap SEQ ID NO: 47 AAV-9 cap SEQ ID NO: 48 Rep2 / Cap2 msDNA SEQ ID NO: 49 Rep2 / Cap5 msDNA SEQ ID NO: 50 Rep2 / Cap9 msDNA SEQ ID NO: 51 Helper msDNA

Claims

1. To generate a bacterial sequence-free vector with linear covalent ends, (a) a first sequence comprising an inverted terminal repeat (ITR) and a multiple cloning site (MCS), the ITRs flanking at least one end of the MCS, and the ITRs comprising sequences for adeno-associated virus (AAV) replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase An expression vector comprising:

2. The expression vector of claim 1 , wherein the ITR flanks only one end of the MCS.

3. The expression vector of claim 1 , wherein an ITR flanks each end of the MCS.

4. 4. The expression vector according to claim 1, further comprising a spacer sequence between the target sequence for the first recombinase and the first sequence.

5. 5. The expression vector of claim 4, wherein the spacer sequence is 10 to 500 nucleotides.

6. 4. The expression vector of claim 1, further comprising an expression cassette comprising an AAV replication (rep) gene and an AAV capsid (cap) gene flanked on one end by a target sequence for a first recombinase and on the other end by the first sequence.

7. To generate a bacterial sequence-free vector with linear covalent ends, (a) a first sequence comprising an expression cassette comprising ITRs and a nucleic acid sequence of interest, said ITRs flanking at least one end of the expression cassette comprising the nucleic acid sequence of interest, and said ITRs comprising sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase; An expression vector comprising:

8. 8. The expression vector of claim 7, wherein the ITRs flank only one end of the expression cassette containing the nucleic acid sequence of interest.

9. 9. The expression vector of claim 8, further comprising a spacer sequence between the target sequence for the first recombinase and the first sequence.

10. 10. The expression vector of claim 9, wherein the spacer sequence is 10 to 500 nucleotides.

11. 11. The expression vector of any one of claims 8 to 10, further comprising an expression cassette comprising AAVrep and AAVcap genes flanked on one end by target sequences for a first recombinase and on the other end by the first sequence.

12. 8. The expression vector of claim 7, wherein an ITR flanks each end of the expression cassette containing the nucleic acid sequence of interest.

13. 13. The expression vector of claim 12, further comprising a spacer sequence between the target sequence for the first recombinase and the first sequence.

14. The expression vector of claim 13, wherein the spacer sequence is 10 to 500 nucleotides.

15. 15. The expression vector of any one of claims 12 to 14, further comprising an expression cassette comprising AAVrep and AAVcap genes flanked on one end by target sequences for a first recombinase and on the other end by the first sequence.

16. To generate a bacterial sequence-free vector with linear covalent ends, (a) a first sequence comprising an ITR and a palindromic sequence, the ITRs flanking each end of the palindromic sequence, the palindromic sequence comprising an expression cassette comprising a nucleic acid sequence of interest and the complement of the expression cassette, and the ITRs comprising sequences for AAV replication and an AAV packaging signal; (b) target sequences for a first recombinase flanking each end of the first sequence; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase An expression vector comprising:

17. 17. The expression vector of claim 16, wherein the complement is separated from the expression cassette containing the nucleic acid sequence of interest by a non-complementary spacer sequence.

18. 18. The expression vector of claim 16 or 17, further comprising a spacer sequence between the target sequence for the first recombinase and the first sequence.

19. 19. The expression vector of claim 18, wherein the spacer sequence is 10 to 500 nucleotides.

20. 20. The expression vector of any one of claims 16 to 19, further comprising an expression cassette comprising AAVrep and AAVcap genes flanked on one end by target sequences for a first recombinase and on the other end by the first sequence.

21. To generate a bacterial sequence-free vector with linear covalent ends, (a) a first sequence comprising a portion of an expression cassette containing a nucleic acid sequence of interest flanked at one end by splicing sequences; (b) ITRs flanking each end of the first sequence and containing sequences for AAV replication and an AAV packaging signal; (c) target sequences for the first recombinase flanking each ITR; and (d) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase An expression vector comprising:

22. 22. The expression vector of claim 21, wherein a portion of the expression cassette comprises a 5' portion that combines with the remainder of the expression cassette to provide the complete sequence of the expression cassette, and a splicing sequence is adjacent to the 3' end of the 5' portion.

23. 22. The expression vector of claim 21, wherein a portion of the expression cassette comprises a 3' portion that combines with the remainder of the expression cassette to provide the complete sequence of the expression cassette, and a splicing sequence is adjacent to the 5' end of the 3' portion.

24. 24. The expression vector of any one of claims 21 to 23, further comprising a spacer sequence between the target sequence for the first recombinase and the first sequence.

25. 25. The expression vector of claim 24, wherein the spacer sequence is 10 to 500 nucleotides.

26. 26. The expression vector of any one of claims 1 to 25, wherein the sequences for AAV replication comprise an AAV ITR replication (Rep) protein binding element (RBE) and a terminal resolution site (TRS).

27. 27. The expression vector of any one of claims 1 to 26, wherein the AAV packaging signal comprises an AAV ITR D-sequence.

28. To generate a bacterial sequence-free vector with linear covalent ends, (a) an expression cassette comprising an AAV rep gene and an AAV cap gene; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase An expression vector comprising:

29. To generate a bacterial sequence-free vector with linear covalent ends, (a) an expression cassette containing one or more helper virus genes for the production of AAV; (b) target sequences for a first recombinase flanking each end of the expression cassette; and (c) one or more additional target sequences for one or more additional recombinases integrated within the non-binding region of the target sequence for the first recombinase An expression vector comprising:

30. 30. The expression vector of claim 29, wherein the one or more helper virus genes are derived from adenovirus, herpesvirus, retrovirus, poxvirus, and / or lentivirus.

31. 31. The expression vector of claim 30, wherein the one or more helper virus genes comprise the adenovirus Early 4 (E4) gene, the adenovirus Early 2A (E2A) gene, and the adenovirus Viral Associated (VA) gene.

32. 32. The expression vector of any one of claims 1 to 31, wherein the target sequence for the first recombinase and the one or more additional target sequences for the one or more additional recombinases are selected from the group consisting of a PY54 pal site, an N15 telRL site, and a φK02 telRL site.

33. 33. The expression vector of claim 32, wherein the expression vector comprises each of the target sequences.

34. 33. The expression vector of claim 32, wherein the expression vector comprises a Tel recombinase pal site and a telRL recombinase target binding sequence integrated within the pal site.

35. 32. The expression vector of any one of claims 1 to 31, wherein the target sequence for the first recombinase is the phage PY54 Tel 142 base pair target site.

36. A vector production system comprising a recombinant cell engineered to encode at least a first recombinase under the control of an inducible promoter, said cell comprising the expression vector of any one of claims 7 to 35.

37. 37. The vector production system of claim 36, wherein the inducible promoter is thermally regulated, chemically regulated, IPTG regulated, glucose regulated, arabinose inducible, T7 polymerase regulated, cold shock inducible, pH inducible, or a combination thereof.

38. 38. The vector production system of claim 36 or 37, wherein the first recombinase is selected from TelN and Tel, and the expression vector incorporates a target sequence for at least the first recombinase.

39. The vector production system of any one of claims 36 to 38, wherein the recombinant cell is further designed to encode a nuclease genome editing system, and the expression vector further comprises a backbone sequence containing a cleavage site for the nuclease genome editing system.

40. The vector production system of claim 39, wherein the nuclease genome editing system is a CRISPR nuclease system comprising a Cas nuclease and a gRNA, and the expression vector comprises a target sequence for the gRNA within the backbone sequence.

41. 39. A method for producing a bacteria-sequence-free vector with linear covalent ends, the method comprising incubating the vector production system of any one of claims 36 to 38 under conditions suitable for expression of a first recombinase.

42. A method for producing a bacterial sequence-free vector having linear covalent ends, comprising incubating the vector production system described in claim 39 or 40 under conditions suitable for expression of a first recombinase and a nuclease genome editing system.

43. 43. The method of claim 41 or 42, further comprising recovering the bacteria-free sequence vector.

44. A bacteria-free sequence vector produced by the method of any one of claims 41 to 43.

45. A bacteria-free sequence vector according to claim 44, which is produced from the expression vector according to any one of claims 8 to 10.

46. 45. The bacteria-free sequence vector of claim 44, produced from the expression vector of claim 11.

47. A bacteria-free sequence vector according to claim 44, produced from the expression vector according to any one of claims 12 to 14.

48. 45. The bacteria-free sequence vector of claim 44, produced from the expression vector of claim 15.

49. A bacteria-free sequence vector according to claim 44, produced from the expression vector according to any one of claims 16 to 19.

50. 45. The bacteria-free sequence vector of claim 44, produced from the expression vector of claim 20.

51. A bacteria-free sequence vector according to claim 44, produced from an expression vector according to any one of claims 21 to 25.

52. 45. The bacteria-free sequence vector of claim 44, produced from the expression vector of claim 28.

53. A bacteria-free sequence vector according to claim 44, produced from the expression vector according to any one of claims 29 to 31.

54. 1. A method for producing a single-stranded AAV comprising: (a) injecting into cells capable of producing AAV, i. the bacteria-free sequence vector of claim 47; ii. An expression vector comprising the bacteria-free sequence vector of claim 52 or an expression cassette comprising an AAV rep gene and an AAV cap gene; and iii. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

55. 1. A method for producing a single-stranded AAV comprising: (a) injecting into cells capable of producing AAV, i. the bacteria-free sequence vector of claim 48; ii. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

56. 1. A method for producing a single-stranded AAV comprising: (a) transfecting a cell capable of producing AAV with the bacteria-sequence-free vector of claim 47, wherein each of an AAV rep gene, an AAV cap gene, and one or more helper virus genes for the production of AAV is encoded by the cell or the vector; (b) incubating the cells under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes for the production of AAV; A method comprising:

57. 1. A method for producing a self-complementary AAV, comprising: (a) injecting into cells capable of producing AAV, i. the bacteria-free sequence vector of claim 45; ii. An expression vector comprising the bacteria-free sequence vector of claim 52 or an expression cassette comprising an AAV rep gene and an AAV cap gene; and iii. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

58. 1. A method for producing a self-complementary AAV, comprising: (a) injecting into cells capable of producing AAV, iv. The bacteria-free sequence vector of claim 46. v. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

59. 1. A method for producing a self-complementary AAV, comprising: (a) injecting into cells capable of producing AAV, i. the bacteria-free sequence vector of claim 49; ii. An expression vector comprising the bacteria-free sequence vector of claim 52 or an expression cassette comprising an AAV rep gene and an AAV cap gene; and iii. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

60. 1. A method for producing a self-complementary AAV, comprising: (a) injecting into cells capable of producing AAV, i. the bacteria-free sequence vector of claim 50; ii. The bacteria-free sequence vector of claim 53 or an expression vector comprising an expression cassette containing one or more helper virus genes for the production of AAV. transfecting the (b) incubating the cells under conditions suitable for AAV production; A method comprising:

61. 1. A method for producing a self-complementary AAV, comprising: (a) transfecting a cell capable of producing AAV with the bacteria-sequence-free vector of claim 45 or 49, wherein each of an AAV rep gene, an AAV cap gene, and one or more helper virus genes for the production of AAV is encoded by the cell or vector; and (b) incubating the cells under conditions suitable for expression of the rep gene, the cap gene, and one or more helper virus genes for the production of AAV; A method comprising:

62. 62. The method of any one of claims 54 to 61, wherein the cell is a HEK293T cell.

63. 63. The method of any one of claims 54 to 62, further comprising recovering the AAV.

64. An AAV produced by the method of any one of claims 54 to 63.

65. A pharmaceutical composition comprising the AAV of claim 64.

66. 66. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject the AAV of claim 64 or the pharmaceutical composition of claim 65.

Images