An ultrasensitive assay for the detection of ORF1p in biological fluids

An ultrasensitive immunoassay for detecting ORF1p in biological fluids addresses the limitations of current cancer detection methods by providing accurate and early diagnosis of carcinomas like ovarian cancer through the use of nanobodies and ultrasensitive assays.

JP2025539020APending Publication Date: 2025-12-03THE BRIGHAM & WOMEN S HOSPITAL INC +4
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025526377
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-08
Filing Date
2023-11-08
Publication Date
2025-12-03

AI Technical Summary

Technical Problem

Current cancer detection methods, particularly for ovarian cancer, face challenges due to low levels of circulating tumor DNA and insufficient sensitivity and specificity of protein-based biomarkers, limiting early detection and diagnosis.

Method used

An ultrasensitive immunoassay, such as digital ELISA, is used to detect the ORF1p protein encoded by the LINE-1 retrotransposon in biological fluids, utilizing nanobodies and ultrasensitive protein assays with a detection limit of less than 1 picomole, enabling accurate cancer detection.

Benefits of technology

The method provides highly sensitive and specific detection of ORF1p, allowing for early cancer diagnosis and monitoring treatment effectiveness, with potential applications in various carcinomas, including ovarian cancer, by leveraging the stability and high expression of ORF1p in tumor tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025539020000016
    Figure 2025539020000016
  • Figure 2025539020000017
    Figure 2025539020000017
  • Figure 2025539020000018
    Figure 2025539020000018
Patent Text Reader

Abstract

Described herein are methods and compositions for accurately detecting cancer using an ultrasensitive immunoassay (e.g., digital ELISA) to detect open reading frame 1 protein (ORF1p) encoded by the LINE-1 retrotransposon in biological fluids.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Priority claim This application claims the benefit of U.S. Provisional Patent Application No. 63 / 423,696, filed November 8, 2022, the entire contents of which are incorporated herein by reference.

[0002] Described herein are methods and compositions for accurately detecting cancer using an ultrasensitive immunoassay (e.g., digital ELISA) to detect open reading frame 1 protein (ORF1p) encoded by the LINE-1 retrotransposon in biological fluids. [Background technology]

[0003] Early detection of cancer is important for improving outcomes. For example, ovarian cancer is the fifth leading cause of cancer-related deaths in women in the United States, and is primarily diagnosed at an advanced stage. High-grade serous ovarian cancer (HGSOC) accounts for 70-80% of ovarian cancer deaths. 1 The 5-year survival rate for cases diagnosed at stage I is over 90%. 2 Circulating tumor DNA (ctDNA) has shown considerable promise for cancer detection, but ovarian cancer remains a rare disease because ctDNA levels are often extremely low and often undetectable, often in the early stages of the disease. 3and other cancers, it remains a major obstacle. MicroRNAs (miRNAs) have also shown great potential, but clinical validation of miRNA signatures for early cancer detection requires further research. Proteins are a promising class of biomarkers because they can play a direct functional role in biological processes and are abundant in blood compared to ctDNA. However, protein-based liquid biopsies remain limited by significant gaps in biomarker specificity and protein measurement technology. For example, in the case of ovarian cancer, the FDA has approved the blood-based biomarkers carbohydrate antigen 125 (CA125) and human epididymis protein 4 (HE4), but their sensitivity and specificity for early detection are insufficient. This limits their usefulness in screening. 4 . Summary of the Invention

[0004] Provided herein are methods that include obtaining a sample comprising blood from a subject (e.g., a subject suspected of or at risk for cancer) and determining the level of ORF1p in the sample using an ultrasensitive protein assay (i.e., an assay with a detection limit of less than 1 picomole (0.1 femtomole in 100 ul)). In some embodiments, the method further includes comparing the level of ORF1p in the sample with a disease standard, wherein a level of ORF1p above the standard indicates that the subject is suffering from or at risk of developing cancer.

[0005] In some embodiments, the cancer is a carcinoma (e.g., ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, gastric cancer, head and neck cancer, soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer), and in some embodiments, the cancer is a carcinoma that is not brain cancer. In some embodiments, the cancer is ovarian cancer (e.g., high-grade serous ovarian cancer (HGSOC)). In some embodiments, the cancer is not breast cancer. In some embodiments, the cancer is ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, stomach cancer, head and neck cancer, brain cancer (optionally glioblastoma), soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer, blood or bone marrow cancer (optionally lymphoma, leukemia, or myeloma), or skin cancer (optionally melanoma).

[0006] Provided herein are methods comprising obtaining a sample comprising blood from a subject and determining the level of ORF1p in the sample with an ultrasensitive protein assay. In some embodiments, the method further comprises comparing the level of ORF1p to a disease standard, wherein a level of ORF1p above the standard indicates that the subject has cancer or is at risk of developing cancer. In some embodiments, the sample is a biological fluid that is whole blood, plasma, or serum; alternatively, in some embodiments, the sample is or comprises feces, cervical mucus (e.g., Pap smear), uterine washing, urine, or sputum. The sample may also be a tissue sample, e.g., a tissue lysate, derived from, for example, a biopsy (e.g., a punch, needle, or shave biopsy, or a surgical biopsy).

[0007] In some embodiments, the cancer is a carcinoma. In some embodiments, the carcinoma is ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, gastric cancer, head and neck cancer, brain cancer, soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer. In some embodiments, the cancer is not brain cancer. In some embodiments, the ovarian cancer is high-grade serous ovarian cancer (HGSOC). In some embodiments, the cancer is not breast cancer. In some embodiments, the cancer is of blood, bone marrow, brain, skin, or soft tissue origin, particularly lymphoma, leukemia, myeloma, glioma, or melanoma.

[0008] In some embodiments, the ultrasensitive assay is single molecule array (SIMOA); molecule-on-bead signal amplification for individual counting (MOSAIC); mesoscale discovery (MSD); single molecule counting (SMC); nucleic acid binding immunosandwich assay (NULISA); LUMINEX; SOMAscan assay; mass spectrometry (e.g., MALDI-MS), and / or mass cytometry (e.g., CyTOF).

[0009] In some embodiments, determining the level of ORF1p comprises treating the sample with a capture or detection reagent (a nanobody selected from Nb2, Nb5, Nb9, Nb10, or NB21, or an ORF1p-binding derivative comprising its CDRs (as shown in Table B), or a concatemer thereof, optionally MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, or MT1040, and / or 62H12, 64C6, 3 and optionally, the capture / detection reagent is 34H7 / Ab6, 62H12 / Ab6, 34H7 / Nb5-5LL, 62H12 / Nb5-5LL, 4H1 / Nb5-5, or 4H1 / Nb5-5LL.

[0010] In some embodiments, the Nanobody comprises a sequence at least 80%, 85%, 90%, or 95% identical to a sequence of Table B, or a multimer thereof, and preferably the CDRs of the Nanobody are identical to those from a sequence of Table B, or a multimer thereof. Exemplary Nanobody concatemers include MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, and MT1040 (see Figure 22A).

[0011] In some embodiments, the method further comprises recommending or subjecting the subject to further evaluation (e.g., by imaging and / or biopsy). In some embodiments, the method further comprises administering a cancer treatment to the subject identified as having or at risk of developing cancer. In some embodiments, the treatment comprises chemotherapy, hormone therapy, immunotherapy, radiation therapy, or surgical resection.

[0012] In some embodiments, the method further includes determining the subject's ORF1p level after administration of the treatment and comparing the ORF1p level before treatment with the ORF1p level during and / or after treatment, where a decrease in the ORF1p level indicates that the treatment is effective in treating cancer. Thus, the method can be used to monitor the effectiveness of the treatment. If the treatment is effective, the method can include continuing the treatment. If the treatment is not effective (e.g., the ORF1p level does not decrease or increases), the method can include selecting, and optionally administering, a different treatment.

[0013] Also provided herein are single domain antibodies or antigen-binding fragments thereof that bind to human ORF1p as described herein, which comprise, for example, a sequence at least 90%, 95%, 97%, or 99% identical to a Nanobody sequence set forth in Table B, or its CDR1, CDR2, and CDR3, or comprise the CDR1, CDR2, and CDR3 set forth in Table B, and multimers thereof.

[0014] Further provided herein are fusion constructs comprising at least two (e.g., three, four, or five) of the single domain antibodies or antigen-binding fragments thereof described herein, optionally with a linker between them, as shown in Table C. Exemplary nanobody concatamers include MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, and MT1040 (see Figure 22A).

[0015] Further provided herein is an antibody or antigen-binding portion thereof that specifically binds to human ORF1p described herein, for example, the antibody or antigen-binding portion thereof comprises at least one of a heavy chain variable region (VH) comprising or consisting of a VH sequence that is at least 95% identical to, or CDR1, CDR2, and CDR3 derived therefrom, a sequence shown in Table D or Figures 20A-J, and / or a light chain variable region (VL) comprising or consisting of a VL sequence that is at least 95% identical to, or CDR1, CDR2, and CDR3 derived therefrom, a sequence shown in Table D or Figures 20A-J, and preferably the VH and VL or CDRs are derived from the same antibody.

[0016] In some embodiments, the antibody optionally comprises a constant region as shown in Table A.

[0017] In some embodiments, the single domain antibody or antigen-binding fragment thereof, fusion protein, or antibody or antigen-binding portion thereof is fused to a tag (e.g., an oligonucleotide, peptide, chemiluminescent, fluorescent, radioactive, or colorimetric label). In some embodiments, the radioactive label is 125 I.

[0018] Also provided herein are nucleic acid molecules encoding the single domain antibodies or antigen-binding fragments thereof, fusion constructs, or antibodies or antigen-binding portions thereof described herein, as well as vectors comprising the nucleic acid molecules and optionally a promoter, and host cells comprising the nucleic acid molecules and optionally expressing the single domain antibodies or antigen-binding fragments thereof, fusion constructs, or antibodies or antigen-binding portions thereof described herein.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention. Other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database values, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0020] Other features and advantages of the invention will become apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]

[0021] [Figure 1] LINE-1 retrotransposon movement involves: (i) transcription of LINE-1 RNA by RNA pol II; (ii) translation of open reading frame 1 protein (ORF1p) and ORF2p, and assembly of ribonucleoproteins; and (iii) insertion of LINE-1 cDNA into the genome via ORF2p-mediated target-primed reverse transcription (TPRT) of LINE-1 RNA. [Figure 2] Signal-to-background evaluation of the indicated capture antibody (x-axis) and detection antibody (y-axis) pairs evaluated with recombinant protein-spiked samples (top) or breast cancer cell lysates (bottom). Darker colors indicate higher signal-to-background. [Figure 3] Representative calibration curves for several affinity reagent pairs (capture / detection). [Figure 4] Antibody pair screening in breast cancer serum samples (8-fold dilution). [Figure 5] Screening of antibody pairs in BioIVT serum samples (4-fold dilution). [Figure 6] Simoa assay measurements of plasma ORF1p levels in high-grade serous ovarian cancer (HGSOC) patients compared with healthy controls. Two different combinations of capture and detection antibodies (Ab54 / Ab6 and C5 / Ab6) are shown above. [Figure 7A] A, Plasma ORF1p levels measured by SIMOA in a preliminary pan-cancer pilot study; triplicate measurements of 25 μL aliquots were performed using Nb5 (clone 5) nanobody (capture) / Ab6 (detector). Detectability is shown in the pie chart above. Four of 400 "healthy" patients assayed were positive; one was found to have prostate cancer, while limited information was available for the other patients, achieving a specificity of over 99%. B, Pilot study in patients with high-grade serous ovarian cancer (HGSOC) and healthy patients (Pennsylvania cohort). [Figure 7B] A, Plasma ORF1p levels measured by SIMOA in a preliminary pan-cancer pilot study; triplicate measurements of 25 μL aliquots were performed using Nb5 (clone 5) nanobody (capture) / Ab6 (detector). Detectability is shown in the pie chart above. Four of 400 "healthy" patients assayed were positive; one was found to have prostate cancer, while limited information was available for the other patients, achieving a specificity of over 99%. B, Pilot study in patients with high-grade serous ovarian cancer (HGSOC) and healthy patients (Pennsylvania cohort). [Figure 8] Schematic diagram of an example of an ultrasensitive Simoa assay for detecting ORF1p in biological fluids. [Figure 9A]Digital ELISA based on an array of femtoliter-sized wells. (11) (a, b) Using standard ELISA reagents, single protein molecules are captured and labeled on beads (a), and the beads are loaded into a femtoliter-volume well array (b). [Figure 9B] Digital ELISA based on an array of femtoliter-sized wells. (11) (a, b) Using standard ELISA reagents, single protein molecules are captured and labeled on beads (a), and the beads are loaded into a femtoliter-volume well array (b). [Figure 9C] Digital ELISA based on an array of femtoliter-sized wells. (11) (c) SEM of a portion of the femtoliter-volume well array after bead loading. [Figure 9D] Digital ELISA based on an array of femtoliter-sized wells (11). (d) Fluorescence image of a portion of the femtoliter-volume well array after signal generation from a single enzyme. Only a portion of the beads have enzymatic activity, indicating a single bound protein molecule. [Figure 10A] Improved detection of ORF1p by second-generation assay. (A) Schematic of the affinity reagents used. 34H7 and 62H2 are custom mAbs, and Nb5-5LL is an engineered homodimeric nanobody. [Figure 10B] Improved detection of ORF1p by second-generation assays. (B) 25 μL of plasma from ovarian cancer patients (University of Pennsylvania cohort) was measured in triplicate with our first- and second-generation assays, where the affinity reagent used was labeled [capture::detect]. The second-generation assays contain novel capture reagents (mAbs 34H7 or 62H12) and detection reagents (engineered artificial dimeric nanobody Nb5-5LL). ORF1p was detected in 4 out of 5 stage I patients in the cohort, with assay #3 appearing to increase sensitivity and potentially decreasing specificity. [Figure 10C]Improved detection of ORF1p with the second-generation assay. (C) The second-generation assay was performed in triplicate using 25 μL of plasma from the MGH advanced-stage gastroesophageal and ovarian cancer cohort. The ovarian cohort included 102 HGSOC and 30 other ovarian malignancies (mucinous, clear cell, and low-grade serous). 80-90% of ovarian cancers were detectable. Sensitivity improved for both cancer types. [Figure 10D] Improved detection of ORF1p with second-generation assays. (D) Second-generation assay measurements of 34H7::Nb5-5LL across multiple cancer cohorts. (E) ROC curve using the single marker ORF1p across all healthy and ovarian cancer patients (top, n = 128-132 (cancer), 447-455 (healthy)), and multivariate model for ovarian cancer (bottom, n = 51-53 (cancer), 50 (healthy)). [Figure 10E] Improved detection of ORF1p with the second-generation assay. (E) ROC curve using the single marker ORF1p across all healthy and ovarian cancer patients (top, n = 128–132 (cancer), 447–455 (healthy)), and multivariate model for ovarian cancer (bottom, n = 51–53 (cancer), 50 (healthy)). [Figure 11A] ORF1p is an early predictor of response and prognosis for GE and colorectal cancer (CRC) in 19 patients undergoing chemotherapy / chemoradiotherapy. Responders and non-responders were retrospectively characterized by a medical oncologist blinded to preoperative imaging assay results. (A) Plasma ORF1p measured by all three second-generation Simoa assays before and during / after treatment; left panel: non-responders had higher ORF1p levels before treatment than responders (p=0.02, t-test); right panel: responders and non-responders were classified by ORF1p before and during / after treatment; p<0.0001, Fisher's exact test. [Figure 11B]ORF1p is an early predictor of response and prognosis in 19 gastroesophageal (GE) and colorectal cancer (CRC) patients undergoing chemotherapy / chemoradiotherapy. Responders and non-responders were retrospectively characterized by a medical oncologist blinded to preoperative imaging assay results. (B) Representative CT and PET-CT images of patients within the cohort. The representative non-responder had the second highest pretreatment plasma ORF1p (25.8 pg / ml), which increased to 43.0 pg / ml by day 28 of FOLFOX therapy (47 days after diagnosis), coincident with an increase in the size and number of liver metastases on CT at day 61. The representative responder showed the fourth highest plasma ORF1p level (0.83 pg / ml) among the responder cohort, which decreased to below the limit of detection by day 26 of CROSS therapy (48 days after diagnosis); the PET-CT shown is from day 59 after the start of therapy, 31 days after the second ORF1p measurement. [Figure 11C] ORF1p is an early predictor of response and prognosis for 19 gastroesophageal (GE) patients undergoing chemotherapy / chemoradiotherapy and is prognostic for GE and colorectal cancer (CRC). After treatment, responders and non-responders were retrospectively characterized by a medical oncologist blinded to preoperative imaging assay results. (C) Kaplan-Meier survival analysis of patients categorized as ORF1p-high or ORF1p-low based on median plasma ORF1p assay values ​​shows significantly longer survival in ORF1p-low patients for GE (stages III-IV, p=0.0017, log-rank test) and CRC (all stages IV, p=0.011, log-rank test). Shaded regions represent 95% confidence intervals. [Figure 12] A large-volume, second-generation assay was tested using the flow cytometry-based digital ELISA platform MOSAIC. A pilot cohort of 10 healthy individuals and 10 gastroesophageal (GE) cancer patients with undetectable ORF1p levels was assayed in a 25 μL assay volume (left panel) using 20x plasma and flow cytometry readout. This resulted in 9 out of 10 isolations from healthy subjects (right panel). [Figure 13]The signal-to-noise (SNR) of the new rabbit monoclonal α-ORF1p antibody from Simoa shows up to a 5-fold improvement compared to our current best antibody, Abcam Ab6 (left). Two different capture beads with different epitopes were used: nanobody C5 (Nb-5) and 4H1. [Figure 14-1] Screening of nanobody / antibody pairs in plasma samples from healthy and cancer (colon and gastroesophageal) patients. Capture / detector pairs are indicated for each panel. For comparison, measurements from the first generation assay (Nb5 / Ab6) are shown. All assays were performed as three-stage Simoa assays. [Figure 14-2] Screening of nanobody / antibody pairs in plasma samples from healthy and cancer (colon and gastroesophageal) patients. Capture / detector pairs are indicated for each panel. For comparison, measurements from the first generation assay (Nb5 / Ab6) are shown. All assays were performed as three-stage Simoa assays. [Figure 15] Screening of newly developed and commercially available monoclonal antibodies with dimeric nanobodies for ORF1p detection by Simoa. Comparison of signal-to-background of affinity reagents as capture / detection pairs in Simoa using recombinant ORF1p protein. All labeled affinity reagents are monoclonal antibodies except for Nb5-5(LL), which represents a homodimer of nanobody Nb5. [Figure 16-1] Plasma screening round #3: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 16-2] Plasma screening round #3: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 16-3]Plasma screening round #3: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 17-1] Plasma screening round #4: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 17-2] Plasma screening round #4: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 17-3] Plasma screening round #4: Screening of the newly developed monoclonal antibody and dimeric nanobody reagent pair in the plasma of eight healthy patients and eight cancer patients (colorectal or gastroesophageal cancer). [Figure 18-1] Plasma screening round #5: Screening of newly developed monoclonal antibody and dimeric nanobody reagent pairs in patient plasma. Selected affinity reagent pairs from the previous screening (Figures 16-17) were screened in plasma samples from 25 healthy patients and 25 patients with cancer (colorectal, gastroesophageal, and breast cancer). Each assay is represented by a capture / detection reagent pair. For comparison, first-generation assay (Nb5 / Ab6) measurements are shown. [Figure 18-2] Plasma screening round #5: Screening of newly developed monoclonal antibody and dimeric nanobody reagent pairs in patient plasma. Selected affinity reagent pairs from the previous screening (Figures 16-17) were screened in plasma samples from 25 healthy patients and 25 patients with cancer (colorectal, gastroesophageal, and breast cancer). Each assay is represented by a capture / detection reagent pair. For comparison, first-generation assay (Nb5 / Ab6) measurements are shown. [Figure 18-3]Plasma screening round #5: Screening of newly developed monoclonal antibody and dimeric nanobody reagent pairs in patient plasma. Selected affinity reagent pairs from the previous screening (Figures 16-17) were screened in plasma samples from 25 healthy patients and 25 patients with cancer (colorectal, gastroesophageal, and breast cancer). Each assay is represented by a capture / detection reagent pair. For comparison, first-generation assay (Nb5 / Ab6) measurements are shown. [Figure 19A] A: Second generation assay 1, 34H7 / Nb5-5LL; B: Second generation assay 2, 62H12 / Nb5-5LL; C: Second generation assay 3, 62H12 / Ab6. [Figure 19B] A: Second generation assay 1, 34H7 / Nb5-5LL; B: Second generation assay 2, 62H12 / Nb5-5LL; C: Second generation assay 3, 62H12 / Ab6. [Figure 19C] A: Second generation assay 1, 34H7 / Nb5-5LL; B: Second generation assay 2, 62H12 / Nb5-5LL; C: Second generation assay 3, 62H12 / Ab6. [Figure 20A] Monoclonal antibody sequences shown in Table D. [Figure 20B] Monoclonal antibody sequences shown in Table D. [Figure 20C] Monoclonal antibody sequences shown in Table D. [Figure 20D] Monoclonal antibody sequences shown in Table D. [Figure 20E] Monoclonal antibody sequences shown in Table D. [Figure 20F] Monoclonal antibody sequences shown in Table D. [Figure 20G] Monoclonal antibody sequences shown in Table D. [Figure 20H] Monoclonal antibody sequences shown in Table D. [Figure 20I] Monoclonal antibody sequences shown in Table D. [Figure 20J] Monoclonal antibody sequences shown in Table D. [Figure 21A]Improved detection of ORF1p by the third-generation Simoa assay and the MOSAIC assay. (A) Comparison of second- and third-generation Simoa assays (25 μL) in 25 patients with barely detectable gastroesophageal cancer (GE) and healthy controls. [Figure 21B] Improved detection of ORF1p by the third-generation Simoa and MOSAIC assays. (B) Schematic of the MOSAIC assay. A captured single-molecule "immunosandwich" is formed similarly to the Simoa assay. DNA-conjugated streptavidin enables rolling circle amplification, generating a strong localized fluorescent signal on the bead surface. "On" and "off" beads are then quantified by flow cytometry, allowing efficient sampling of a larger number of captured beads. This improves sensitivity and multiplexing capabilities. [Figure 21C] Improved detection of ORF1p by third-generation Simoa and MOSAIC assays. (C) 37H7::Nb5-5LL MOSAIC and Simoa assays in 10 previously undetectable GE cancer patients and healthy controls. The dashed line in the left panel and the lower dashed line in the right panel indicate the analytical limit of detection (LoD) of recombinant ORF1p in buffer. The upper dashed line in the right panel indicates the plasma-specific background in the large-volume MOSAIC assay used to determine positivity in the pie chart. [Figure 21D] Improved detection of ORF1p by the third-generation Simoa and MOSAIC assays. (D) Similar results were observed in the breast cancer cohort. [Figure 22A] Engineered nanobody constructs. (A) Schematic of engineered dimeric and trimeric nanobody constructs with flexible linkers (GGGGS x 4) and rigid helical linkers (EAAAK x 3 or DAAAR x 3). The 5xCys tag sequence is CGSGRCGSGRCGSGRCGSGRC. [Figure 22B] Engineered nanobody constructs. (B) Representative preparation of engineered nanobody constructs, Coomassie stained. [Figure 23]Calibration curve for the "third generation" Simoa assay, gray boxes comparing two "second generation" assays. The dashed line indicates the detection limit of the assay. [Figure 24] Second-round screening of a newly developed "third-generation" assay using a dimeric nanobody detector. Affinity reagent pairs selected from the first round of screening of plasma samples were screened with 25 healthy plasma samples and 25 GE cancer patient plasma samples. Each assay is represented by a capture / detection reagent pair. Second-generation assays were performed for comparison (top and bottom left graphs). The dashed line indicates the assay detection limit, taking into account a 4-fold dilution. The middle row of the graphs shows the three final selected third-generation assays. MT1032 and MT1035 are Nb5-5 homodimers with different linkers. MT1036 is a Nb2-Nb9 heterodimer, MT1037 is a Nb5-Nb9 heterodimer, and MT1038 is a Nb9-Nb9 homodimer. [Figure 25] Calibration curve for the large volume (500 μL) MOSAIC assay used in Figure 5. The dashed line indicates the detection limit of the assay. DETAILED DESCRIPTION OF THE INVENTION

[0022] Liquid biopsies are highly desirable because they are minimally invasive and can facilitate widespread screening. Many current liquid biopsies detect circulating tumor DNA (ctDNA), circulating tumor cells (CTCs), or microRNAs (miRNAs). However, significant challenges remain: (1) in the early stages of disease, when ctDNA and CTC levels are extremely low and often undetectable, requiring large amounts of blood; 3、12、13 (2) DNA mutations not associated with malignant tumors may reduce the specificity of ctDNA testing. 14、15 (3) miRNAs have shown promise for the detection of cancers such as ovarian cancer, but further clinical validation of miRNA signatures for early detection is needed. 4 .

[0023] Overexpression of LINE-1 retrotransposons is a hallmark of many human cancers.

[0024] Transposable elements, which make up nearly half of the human genome, are attracting increasing attention due to their aberrant activity in human cancers. 7 In particular, expression of the retrotransposon long interspersed nucleobase type 1 (LINE-1) has emerged as a hallmark of various human malignancies and is associated with specific mutational signatures in the cancer genome. 17~20 LINE-1 is the only protein-coding transposable element still active in humans; its 6-kb sequence encodes two proteins essential for retrotransposition, open reading frame 1 protein (ORF1p) and ORF2p (Figure 1). LINE-1 expression in somatic cells is normally silenced by promoter methylation and histone modifications, but hypomethylation of the LINE-1 promoter is observed in many human malignancies. 7、17、21 Consistent with this observation, ORF1p is expressed in many tumors, especially ovarian cancer. 8、10、22 and esophageal cancer 18、43、44 Importantly, ORF1p is a stable homotrimer and is highly expressed when derepressed. For example, ORF1p expression has been observed in over 90% of cases of high-grade serous ovarian cancer (HGSOC), the most aggressive and lethal subtype of ovarian cancer. 8 ORF1p is a particularly promising "binary" biomarker for ovarian cancer: ORF1p is not expressed in normal fallopian tube epithelium, but activated expression occurs in early precursor lesions of ovarian cancer (serous tubal intraepithelial carcinoma (STIC) lesions). 9、10 This suggests its potential usefulness for the early detection of ovarian cancer (Figure 2A). However, the presence of ORF1p in blood remains largely unexplored in liquid biopsies. Importantly, the absence of ORF1p expression in non-malignant cells suggests its potential as a "binary" blood-based biomarker with much higher specificity compared to existing protein cancer biomarkers, which often have different individual baseline levels and are expressed in normal tissues. 23~25.

[0025] Although ORF1p expression is elevated in tumor tissues, ORF1p released from tumors is diluted to very low levels in the bloodstream, far below the detection limit of conventional methods (e.g., mass spectrometry), necessitating ultrasensitive detection. Ultrasensitive single-molecule detection techniques, such as single molecule arrays (SIMOA, Figure 2D), and the recently reported detection of ORF1p in blood, 26、48 .

[0026] Diagnostic methods Included herein are methods for diagnosing cancer. The methods rely on the detection of ORF1p in a biological fluid (e.g., whole blood, plasma, or serum, feces, cervical mucus (e.g., Pap smear), uterine washings, urine, or sputum) or a tissue sample (e.g., from a biopsy (e.g., punch, needle, or shave biopsy, or surgical biopsy of tissue suspected of cancer), e.g., a tissue lysate), as described herein. In some embodiments, the method provides a blood test for the detection and diagnosis of cancer using circulating ORF1p. In some embodiments, the cancer is a carcinoma (e.g., ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, gastric cancer, head and neck cancer, brain cancer, soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer). 8、22 In some embodiments, the cancer is of blood, bone marrow, brain, skin, or soft tissue origin, particularly lymphoma, leukemia, myeloma, glioma, or melanoma. In some embodiments, the biological fluid is whole blood, plasma, or serum.

[0027] As used herein, the terms "cancer," "hyperproliferative," and "neoplastic" refer to an abnormal state or condition characterized by the growth of cells capable of autonomous growth, i.e., rapidly proliferating cells. Hyperproliferative and neoplastic disease states can be classified as pathological (i.e., characterizing or constituting a disease state) or non-pathological (i.e., deviating from normal but not associated with a disease state). The terms include all types of cancerous growths or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. "Pathological hyperproliferative" cells occur in disease states characterized by malignant tumor growth. Examples of non-pathological hyperproliferative cells include the proliferation of cells associated with wound repair.

[0028] The term "cancer" or "tumor" includes malignant tumors of various organ systems (e.g., lung, breast, thyroid, lymphatic, brain, soft tissue, gastrointestinal, and genitourinary origin), as well as adenocarcinomas, including malignant tumors (e.g., most colon and colorectal cancers, kidney or renal cell carcinoma, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, prostate cancer and / or testicular cancer, non-small cell carcinoma of the lung, small intestine cancer, and esophageal cancer).

[0029] The term "carcinoma" is art-recognized and refers to a malignant tumor of epithelial or endocrine tissue (e.g., respiratory system cancer, digestive system cancer, genitourinary system cancer, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma). In some embodiments, the disease is kidney cancer or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, kidney, gallbladder, bile duct (cholangiocarcinoma), bladder, uterus, colon / colorectum, and ovary. The term also includes carcinosarcomas, which include, for example, malignant tumors composed of carcinomatous and sarcomatous tissue. "Adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.

[0030] In some embodiments, the cancer is a non-brain cancer.

[0031] The term "sarcoma" is art-recognized and refers to malignant tumors of mesenchymal derivation. In some embodiments, the cancer is not a sarcoma.

[0032] In some embodiments, the cancer is ovarian cancer (e.g., high-grade serous ovarian cancer). In some embodiments, the cancer is not breast cancer.

[0033] In some embodiments, the cancer is of blood, bone marrow, brain, skin, or soft tissue origin, particularly lymphoma, leukemia, myeloma, glioma, or melanoma.

[0034] An exemplary sequence of human ORF1p is: MGKKQNRKTGNSKTQSASPPPKERSSSPATEQSWMENDFDELREEGFRRSNYSELREDIQTKGKEVENFEKNLEECITRITNTEKCLKELMELKTKARELREECRSLRSRCDQLEERVSAMEDEMNEMKREGKFREKRIKRNEQSLQEIWDYVKRPNLRLIGVPESDVENGTKLENTLQDIIQENFPNLARQANVQIQEIQRTPQRYSSRRATPRHIIVRFTKVEMKEKMLRAAREKGRVTLKGKPIRLTADLSAETLQARREWGPIFNILKEKNFQPRISYPAKLSFISEGEIKYFIDKQMLRDFVTTRPALKELLKEALNMERNNRYQPLQNHAKM* (complete sequence derived from a Homo sapiens retrotransposon L1 insertion at the X-linked retinitis pigmentosa gene locus, GenBank: AF148856.1).

[0035] The method includes obtaining a sample from a subject and assessing the presence and / or level of ORF1p in the sample. In some embodiments, the subject is a mammal (e.g., a human, or a non-human veterinary subject, e.g., a cat, dog, cow, horse, goat, or non-human primate). In some embodiments, the subject is suspected of having or is at risk for cancer, e.g., suffers from one or more clinical symptoms associated with cancer, or has a family or personal history of cancer, genetic or environmental risk factors for cancer, or is at increased risk for developing cancer compared to a reference cohort of subjects.

[0036] As used herein, the term "sample," when referring to a material tested for the presence of ORF1p using the methods described herein, includes, among other things, biological fluids (e.g., whole blood, plasma, or serum). In some embodiments, the sample is or includes feces, cervical mucus (e.g., Pap smear), uterine washings, urine, or sputum. The sample can also be, for example, a tissue sample derived from a biopsy (e.g., punch, needle, or shave biopsy, or surgical biopsy); for example, a tissue lysate can be used. Various methods are known in the art for identifying and / or isolating and / or purifying ORF1p protein from a sample, as needed. An "isolated" or "purified" biological marker (e.g., ORF1p) is substantially free of cellular material or other contaminants from the cell or tissue source from which the biological marker is derived, i.e., partially or completely altered or removed from its natural state by human intervention. For example, proteins contained in a sample can be separated according to standard methods (e.g., using lytic enzymes, chemical solutions) or separated by protein-binding resins according to the manufacturer's instructions.

[0037] The method can include incubating a sample (e.g., a 7.5 μl, 25 μl, 50 μl, 100 μl, 250 μl, 500 μl, 750 μl, 1 ml, 2 ml, 2.5 ml, or 10 ml sample) with a capture reagent (e.g., an antibody, nanobody, or antigen-binding fragment thereof described herein). In some embodiments, the sample is diluted, for example, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:8, 1:10, or 1:20, and any range therebetween (e.g., 1:1 to 1:20, or 1:1 or 1:10). In some embodiments, the sample is diluted with a buffer; exemplary sample dilution buffers are described herein and may include, for example, a detergent (e.g., Triton-X100, Tween 20, NP-40, Brij 35, Brij 58, or C12E8) present at about 0.05% to 2% of the sample. As used herein, "about" means plus or minus 10%.

[0038] In some embodiments, the sample is contacted with the capture reagent for a time sufficient to allow any ORF1p present in the sample to bind to the capture reagent (e.g., at least 5, 10, 15, 20, 30, or 45 minutes, or at least 1, 2, 3, 4, 5, or 6 hours, and up to 1, 2, 3, 4, 5, 6, 8, 10, 12, 18, or 24 hours). In preferred embodiments, the capture reagent is on beads (e.g., paramagnetic beads). The capture reagent bound to ORF1p is then incubated in the presence of a detection antibody (e.g., an antibody, nanobody, or antigen-binding fragment thereof described herein), and the presence and / or amount of bound antibody is determined.

[0039] The presence and / or levels of ORF1p protein can be assessed using methods known in the art. In preferred embodiments, the methods are sensitive or ultrasensitive, preferably using multiplexed detection methods (e.g., mesoscale discovery (MSD); single molecule array (SIMOA); droplet digital ELISA (ddELISA)). 26 Molecular on-bead signal amplification for individual counting (MOSAIC)30 These include single molecule counting (SMC), nucleic acid binding immunosandwich assays (NULISA), SpearBio's NAB-SURE (a cell-free assay that quantifies neutralizing antibodies (NAbs) using a real-time PCR system), LUMINEX (an immunoassay that accurately measures multiple analytes in a single sample), and SOMAscan assays; preferably using multiplexed detection methods, such as mass spectrometry (e.g., MALDI-MS), and mass cytometry (e.g., CyTOF) (see Cohen and Walt, Chem. Rev. 2019, 119, 293-321).

[0040] In some embodiments, ORF1p protein in blood for cancer detection is measured using the SIMOA or MOSAIC assay (11, 30, 39). The SIMOA assay has several advantages over traditional ELISA (the current gold standard for protein detection in blood). First, SIMOA is 1000 times more sensitive than ELISA, allowing for the quantification of analytes present at low concentrations (11). SIMOA is 10 -12 at least 10 compared to the ability of conventional ELISA to detect only M -19 Protein concentrations of M can be detected. Second, due to the high sensitivity of SIMOA, serum samples can be more diluted, reducing nonspecific binding resulting from matrix effects (40, 41). Third, SIMOA has a wide dynamic range spanning four orders of magnitude in concentration, allowing a single assay to be used to detect both low- and high-abundance markers (42). In some embodiments, the SIMOA approach achieves this high sensitivity by labeling each immune complex, physically separating them into femtoliter-sized wells, and digitally counting the number of molecules in the sample (Figures 8 and 9A-D). These advantages provide a robust assay for the detection and quantification of blood biomarkers (e.g., ORF1p).

[0041] In preferred embodiments, an ELISA method (e.g., SIMOA, MOSAIC, or other ultrasensitive method) is used, and in preferred embodiments, the capture antibody is Ab54 (ab246320, AbCam) or Nb5, which are further described herein. In some embodiments, the detection antibody is Ab6 (ab246317, AbCam). In some embodiments, the capture / detection pair is a pair described herein (e.g., Table 2), or 34H7 / Ab6, 62H12 / Ab6, 34H7 / Nb5-5LL, 62H12 / Nb5-5LL, 4H1 / Nb5-5, or 4H1 / Nb5-5LL.

[0042] In some embodiments, mass spectrometry, particularly matrix-assisted laser desorption / ionization mass spectrometry (MALDI-MS) and surface-enhanced laser desorption / ionization mass spectrometry (SELDI-MS), is used to detect biomarkers (see U.S. Patent Nos. 5,118,937; 5,045,694; 5,719,060; 6,225,047).

[0043] In some embodiments, other methods can be used, such as standard electrophoresis and quantitative immunoassays for ORF1p protein (including, but not limited to, Western blot; enzyme-linked immunosorbent assay (ELISA); enzyme-linked immunospot (ELISPOT); biotin / avidin-type assays; protein array detection methods (e.g., protein microarrays); radioimmunoassays; immunohistochemistry (IHC); immunoprecipitation assays; flow cytometry / FACS (fluorescence-activated cell sorting); proximity ligation assays (PLA); lateral flow assays; surface plasmon resonance (SPR); optical imaging; Spear Bio's NAB-SURE (a cell-free assay that quantifies neutralizing antibodies (NAbs) using a real-time PCR system); and mass spectrometry) (Kim (2010) Am J Clin Pathol 134:157-162; Yasun (2012) Anal Chem 84(14):6008-6015; Brody (2010) Expert Rev Mol Diagn 10(8):1013-1022; Philips (2014) PLOS One 9(3):e90226; Pfaffe (2011) Clin Chem 57(5):675-687; Cohen and Walt, Chem. Rev. 2019, 119, 293-321). The methods typically involve revealing a label (e.g., fluorescent, chemiluminescent, radioactive, enzymatic, or dye molecule) that directly or indirectly provides a signal; or an oligo-label that can be used, for example, in MOSAIC or other digital ELISA platforms, immuno-PCR, etc. As used herein, the term "label" refers to the coupling (i.e., physical binding) of a detectable substance (e.g., a radioactive substance or a fluorophore (e.g., phycoerythrin (PE) or indocyanine (Cy5)) to an antibody or probe, as well as the indirect labeling of a probe or antibody (e.g., horseradish peroxidase, HRP) by reaction with a detectable substance.

[0044] The method may also include comparing the presence and / or level to one or more standards (e.g., a control standard representing a normal level of ORF1p (e.g., the level in an unaffected subject) and / or a disease standard representing a level of the protein associated with cancer (e.g., the level in a subject afflicted with cancer). Suitable standards may include an undetectable level of ORF1p, or a level of less than, for example, 0.01, 0.005, or 0.001 pg / mL in a subject without cancer.

[0045] In some embodiments, if the presence and / or level of ORF1p is comparable to the presence and / or level of ORF1p in the disease reference and the subject has one or more symptoms associated with cancer, the subject is afflicted with cancer. In some embodiments, if the subject does not exhibit overt signs or symptoms of cancer, but the presence and / or level of one or more of the assessed proteins is comparable to the presence and / or level of the protein(s) in the disease reference, the subject is afflicted with cancer or is at high risk for developing cancer. In some embodiments, once a person has been determined to have cancer or is at high risk for developing cancer, for example, as known in the art or described herein, the subject can be selected or identified for further evaluation (e.g., other blood-based diagnostics (e.g., biomarker panels), imaging, or biopsy to identify a tumor or cancer, and / or treatment), and can be selected and / or administered.

[0046] Suitable reference values ​​can be determined using methods known in the art (e.g., using standard clinical testing methods and statistical analysis). The reference value can have any relevant format. In some cases, the reference value comprises a predetermined value of a meaningful level of ORF1p (e.g., a control reference level representing a normal level of ORF1p (e.g., a level in an unaffected subject or a subject not at risk of developing a disease described herein) and / or a disease reference level representing a level of ORF1p associated with cancer (e.g., a level in a subject afflicted with cancer)).

[0047] The predetermined level can be a single cutoff (threshold) value (e.g., median or mean), or a level defining the boundaries of an upper or lower quartile, tertile, or other segment of a clinical trial population that is determined to be statistically different from other segments. It can also be a range of cutoff values ​​(or thresholds) (e.g., a confidence interval). It can be established based on comparison groups, for example, where the association between the risk of developing or the presence of disease in one defined group is 1-fold (e.g., about 2-fold, 4-fold, 8-fold, 16-fold, or more) higher or lower than the association between the risk of developing or the presence of disease in another defined group. It can be, for example, a range in which a population of subjects (e.g., control subjects) is divided evenly (or unequally) into groups (e.g., low-risk, medium-risk, and high-risk groups), or into quartiles (the lowest quartile being the lowest-risk subjects and the highest quartile being the highest-risk subjects), or into n-quantiles (i.e., n regular intervals, the lowest n-quantile being the lowest risk and the highest n-quantile being the highest risk).

[0048] In some embodiments, the predetermined level is a level or occurrence in the same subject, eg, at a different time point, eg, an earlier time point.

[0049] A subject associated with a predetermined value is typically referred to as a reference subject. For example, in some embodiments, a control reference subject has cancer, is not at risk of developing cancer, or will not subsequently develop cancer.

[0050] Disease criteria subjects are those who have cancer (or are at increased risk of developing cancer), where increased risk is defined as a risk above that of subjects in the general population.

[0051] In some embodiments, a level of ORF1p in a subject that is equal to or greater than the reference level of ORF1p indicates the presence or risk of developing cancer, and a level of ORF1p in a subject that is equal to or less than the reference level of ORF1p indicates the absence of disease or a normal risk of disease.

[0052] Therefore, in some embodiments, to assess whether a subject is suffering from clinical cancer, the method may include firstly logarithmically transforming the ORF1p value, and then assigning a predicted probability, for example, using a logistic regression model, to generate a probability score. If the predicted probability score of the subject exceeds a selected threshold (for example, at least 50%), the subject will be predicted to suffer from cancer (for example, be assigned to the cancer category). If the predicted probability score is below a selected threshold (for example, 50%), the subject will be predicted to be healthy (for example, be assigned to the healthy category).

[0053] In some embodiments, the level of ORF1p is used, for example, together with one or more additional variables (e.g., age), to calculate a score. For example, an algorithm (e.g., sum or weighted sum of the (normalized) levels of the variables) can be used to calculate the score. A specific algorithm can be identified using known statistical methods (e.g., PCA, linear regression, SVM (support vector machine), decision tree, KNN (K nearest neighbors), K-means, gradient boosting, or random forest).

[0054] For example, in some embodiments, an exemplary model uses logistic regression analysis, where each variable (X) is given a weight (B). In the exemplary formula below, a weight (B) is calculated for each marker, and each biomarker may have a unique B value.

[0055]

number

[0056] In clinical practice, the measured ORF1p value (X value) can be used to obtain a probability score that a patient has or will have cancer by plugging the measured biomarker value (X) into a formula and then calculating a probability value (P). In some embodiments, the clinical procedure for obtaining the probability that an individual has cancer would be as follows: First, blood will be drawn from the test subject. Next, the blood ORF1p protein concentration of the test subjects in the panel will be measured, for example, using Simoa. Third, the test subject's predicted probability of cancer will be calculated based on a logistic regression equation including the dependent variable of the natural logarithm of [(probability of having cancer) / (probability of not having cancer)] and the independent variables of age and ORF1p. The predicted probability can then be used to discuss the best course of action between the test subject and the physician (e.g., determining whether further follow-up is not required or whether to proceed with confirmatory radiological imaging).

[0057] In some embodiments, the amount by which the subject's level (or score) is lower than the reference level (or score) is sufficient to distinguish the subject from a control subject, and optionally is statistically significantly lower than the level (or score) of the control subject. When the subject's level (or score) of a biomarker(s) is equal to the reference level (or score) of the biomarker(s), "equal" refers to near equality (e.g., no statistical difference).

[0058] The predetermined value will depend on the particular population of subjects (e.g., human subjects) selected. For example, an apparently healthy population will have a different "normal" range of biomarker(s) levels than a population of subjects who are afflicted with, likely to be afflicted with, or at high risk for a disorder described herein. Thus, the predetermined value selected may take into account the category (e.g., sex, age, health status, risk, presence of other diseases) to which the subject (e.g., human subject) belongs. Those skilled in the art can select appropriate ranges and categories with no more than routine experimentation.

[0059] In characterizing likelihood or risk, a number of predefined values ​​can be established.

[0060] In some embodiments, multiple assays are performed using different combinations of the antibodies described herein, eg, to improve sensitivity and / or specificity.

[0061] Nanobodies Nanobodies (also called VHH antibodies) and their antigen-binding domains are described herein. The antibodies provided herein, in one aspect, comprise an antigen-binding site within a single polypeptide. Therefore, the antibodies are referred to herein as "single-domain antibodies." Single-domain antibodies are also known as nanobodies. However, the single antibodies disclosed herein may, in certain embodiments, be bispecific or multispecific single-domain antibodies in which two single-domain antibodies are coupled, as described elsewhere herein.

[0062] Single domain antibodies are antibody fragments consisting of a single monomeric variable antibody domain. Like intact antibodies, they can selectively bind to specific antigens. Single domain antibodies typically have molecular weights in the 12-15 kDa range, much smaller than typical antibodies (typically 150-160 kDa). Single domain antibodies are also smaller than the Fab fragments (approximately 50 kDa) of heterotetrameric antibodies, which contain one light chain and half a heavy chain.

[0063] In some embodiments, the antibody used in the method is preferably a single domain antibody derived from a camelid antibody, preferably a llama antibody, including functional homologs, fragments thereof, and fusion polymers containing a VHH domain covalently linked to a chemical group that is not a glycan, nucleic acid, protein, or polymer.

[0064] The single domain VHH antibodies described herein preferably comprise one or more CDRs set out in Table B (e.g., SEQ ID NO: 1). In particular, the CDRs may specify the specificity of the antibody, and accordingly, it is preferred that an antigen-binding site comprises one or more CDRs, preferably at least one, more preferably at least two, and even more preferably three or more CDRs. In one embodiment, the single domain antibody comprises one CDR. In one embodiment, the single domain antibody comprises two CDRs. In a preferred embodiment, the single domain antibody comprises three CDRs and four framework regions. Methods for CDR swapping in VHH antibodies are known. See, for example: Zupancic et al., Cell Chem Biol.2021 Sep 16;28(9):1379-1388.e7; Saerens et al., J Mol Biol.2005 Sep 23;352(3):597-607; Muyldermans et al., FEBS J.2021 Apr;288(7):2084-2102.

[0065] In some embodiments, the nanobody comprises a VHH sequence: [ka] The sequences in bold represent CDR1 (GGTSSNYG, SEQ ID NO: 2), CDR2 (ISWSGSRT, SEQ ID NO: 3), and CDR3 (TAVREYRDYPQRDNFDY, SEQ ID NO: 4) (identified based on IMGT numbering).

[0066] In preferred embodiments, the Nanobody comprises a sequence at least 90%, 95%, 97%, 99%, or 100% identical to SEQ ID NO: 1. In some embodiments, any mutations or substitutions are in the framework regions (not the CDRs) and do not significantly affect binding to the target antigen (ORF1p).

[0067] In some embodiments, concatemers of Nanobody sequences are used, e.g., 2, 3, 4, 5, or more C5 Nanobodies fused together, optionally with linkers between them. Exemplary Nanobody concatemers include MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, and MT1040 (see Figure 22A). A variety of suitable linkers are known to those of skill in the art and are not limited by the specific sequences disclosed herein. In some embodiments, the polypeptide linker is composed of naturally occurring or non-naturally occurring amino acids. In some embodiments, the linker comprises amino acids that allow flexibility. In some embodiments, the linker comprises amino acids that allow solubility. In some embodiments, the linker comprises glycine amino acids. In some embodiments, the linker comprises glycine and serine amino acids. In certain embodiments, the linker comprises one or more sets of glycine / serine repeats. In some embodiments, the polypeptide linker is selected from the group consisting of: (GGGGS)n, where n=1-4 (SEQ ID NO:5), GGGGS (SEQ ID NO:6), GGGGSGGGGS (SEQ ID NO:7), GGGGSGGGGSGGGGGS (SEQ ID NO:8), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:9), and (GGGGA)n, where , n=1-4 (SEQ ID NO:20), or rigid helical linkers, such as (EAAAK)n or (DAAAR)n, where n=1-4, preferably n=3, SEQ ID NO:11 and SEQ ID NO:12, respectively. In some embodiments, the linker comprises GGGGSGGGGSGGGGGS (SEQ ID NO:8). In some embodiments, the linker is preferably 5-100, 5-80, or 10-80 amino acids in length and comprises GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:9) or GGGGSGGGGSGGGGSGGGGSEAAAKEAAAKEAAAKSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO:13).

[0068] Anti-ORF1p monoclonal antibody Monoclonal antibodies 62H12, 64C6, 33A8, 61A11, 36D12, 34H7, 50E9, 34C5, 55A6, and 42D10, and derivatives and antigen-binding fragments thereof, are described herein. The term "antibody" refers to an immunoglobulin molecule or an immunologically active portion thereof (i.e., an antigen-binding portion (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequence). In preferred embodiments, the antibody comprises a sequence that is at least 90, 95, 97, 99, or 100% identical to a sequence described herein. In some embodiments, the mutations or substitutions are in the framework regions (not within the CDRs) and do not significantly affect binding to the target antigen (ORF1p).

[0069] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., the individual antibodies comprising the population are identical except for minor naturally occurring mutations that may be present. The antibody may be monoclonal. The antibody may be human or humanized. The term "monoclonal antibody" encompasses intact and full-length monoclonal antibodies, as well as antibody fragments (e.g., Fab, Fab', F(ab')2, Fv), single-chain antibodies (e.g., scFv), fusion proteins comprising antibody fragments, and any other modified immunoglobulin molecule comprising at least one antigen-binding site. Furthermore, "monoclonal antibody" refers to antibodies produced by several techniques, including, but not limited to, hybridoma production, phage library display, recombinant expression, and transgenic animals.

[0070] The term "chimeric antibody" refers to an antibody in which a portion of its heavy and / or light chain is derived from a first source or species, while the remainder of the heavy and / or light chain is derived from a different source or species.

[0071] The term "humanized antibody," as used herein, refers to an antibody comprising human heavy and light chain variable regions in which native CDR residues are replaced by residues from corresponding CDRs of a non-human antibody (e.g., a mouse, rat, rabbit, or non-human primate antibody), such that the non-human antibody has the desired specificity, affinity, and / or activity. In some embodiments, one or more framework region residues of the human heavy or light chain variable region are replaced by the corresponding residue from the non-human antibody. Furthermore, humanized antibodies may comprise residues that are not found in human or non-human antibodies. In some embodiments, these modifications are made to further refine and / or optimize antibody performance. In some embodiments, the humanized antibody comprises at least a portion of an immunoglobulin constant region (e.g., CH1, CH2, CH3, Fc), typically that of a human immunoglobulin.

[0072] The term "human antibody," as used herein, refers to an antibody having an amino acid sequence corresponding to an antibody produced by a human and / or an antibody that has been made using any of the techniques known to those of skill in the art for making human antibodies, including, but not limited to, phage display libraries, yeast display libraries, transgenic animals, recombinant protein production, and B-cell hybridoma technology.

[0073] An "antibody fragment" can comprise a portion of an intact antibody, preferably the antigen-binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab'), and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. "Single-chain Fv" or "scFv" antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the scFv to form the desired structure for antigen binding.

[0074] The terms "epitope" and "antigenic determinant" are used interchangeably herein and refer to the portion of an antigen or target that can be recognized and bound by a specific antibody. When the antigen or target is a polypeptide, epitopes can be formed from both contiguous amino acids juxtaposed by tertiary folding of the protein and non-contiguous amino acids. Epitopes formed from contiguous amino acids (also called linear epitopes) typically persist upon denaturation of the protein, whereas epitopes formed by folding into a tertiary structure (also called conformational epitopes) typically are lost upon denaturation of the protein. Epitopes typically contain at least three, and more commonly at least five, six, seven, or eight to ten, amino acids in a unique spatial conformation. Epitopes can be predicted using any one of numerous software bioinformatics tools available online. X-ray crystallography can be used to characterize epitopes on target proteins by analyzing the interactions of amino acid residues in antigen / antibody complexes.

[0075] "Fv" comprises the minimum antibody fragment containing a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, noncovalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three antigen-specific CDRs) has the ability to recognize and bind antigen, albeit with lower affinity than the entire binding site. Fab fragments also contain the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy-chain CH1 domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine ​​residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0076] Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins (IgA, IgD, IgE, IgG, and IgM), and some of these can be further divided into subclasses (isotypes) (e.g., IgB1, IgG2, IgG3, IgG4, IgA, and IgA2). "Single-chain Fv" or "scFv" antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.

[0077] In various embodiments, the antibody or antigen-binding fragment thereof comprises a human antibody or a humanized antibody. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies comprise human immunoglobulins (recipient antibodies) in which residues from a complementarity-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) (e.g., mouse, rat, or rabbit) having the desired specificity, affinity, and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. Methods for humanizing non-human antibodies are well known in the art.

[0078] The ORF1p antibodies described herein can be affinity matured, for example, using selection and / or mutagenesis methods known in the art. Generally, an "affinity matured" antibody is one that contains one or more modifications in one or more of its hypervariable regions that result in improved affinity for an antigen compared to a parent antibody lacking the modification(s). In one embodiment, the affinity matured antibody has nanomolar or picomolar affinity for the target antigen. Preferred affinity matured antibodies have 5-fold, more preferably 10-fold, and even more preferably 20-fold or 30-fold greater affinity than the starting antibody (generally murine, humanized, or human) from which the matured antibody is prepared.

[0079] An antibody that "binds," "specifically binds," or is "specific" for a particular polypeptide or epitope on a particular polypeptide is an antibody that binds to a particular polypeptide or epitope on a particular polypeptide without substantially binding to other polypeptides or polypeptide epitopes. As used herein, the term "specifically binds" refers to an ORF1p agent (e.g., an anti-ORF1p antibody) that interacts with a particular antigen, epitope, protein, or target molecule more frequently, more rapidly, for longer, with higher affinity, or a combination thereof, than other substances. In some cases, an ORF1p antibody may or may not cross-react with ORF1p-related proteins (e.g., it may have the highest affinity for one (e.g., human ORF1p) and the lowest affinity for another (e.g., ORF2p)).

[0080] In some embodiments, the VH and VL domains of the antibodies described herein are fused to a constant region, for example, as shown in Table A. [Table 1-1] [Table 1-2]

[0081] identity The term "identical" or percent "identity" in the context of two or more nucleic acids or polypeptides refers to two or more sequences or subsequences that have the same or a specified percentage of the same nucleotide or amino acid residues when compared and aligned (introducing gaps, if necessary) to obtain maximum correspondence, without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity may be measured using sequence comparison software or algorithms, or by visual inspection. Various algorithms and software that can be used to align amino acid or nucleotide sequences are well known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof. In some embodiments, two nucleic acids or polypeptides of the present disclosure are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments, at least 95%, 96%, 97%, 98%, or 99% nucleotide or amino acid identity when compared and aligned for maximum correspondence, as determined using a sequence comparison algorithm or by visual inspection. In some embodiments, the identity exists over a region of the sequence that is at least about 10, at least about 20, at least about 20-40, at least about 40-60, or at least about 60-80 nucleotides or amino acids in length, or any integer value therebetween. In some embodiments, the identity exists over a region longer than 60-80 nucleotides or amino acids (e.g., at least about 80-100 nucleotides or amino acids), and in some embodiments, the sequences are substantially identical over the entire length of the sequences being compared, e.g., (i) the coding region of the nucleotide sequence, or (ii) the amino acid sequence.

[0082] As used herein, the phrase "conservative amino acid substitution" refers to a substitution in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues with similar side chains are generally defined in the art, and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, etc.), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, the substitution of alanine for valine is considered a conservative substitution. Methods for identifying conservative substitutions of nucleotides and amino acids that do not eliminate binding are well known in the art.

[0083] In some embodiments, the nanobody or antibody can be conjugated to another protein or peptide, e.g., to form a multifunctional protein / peptide. An exemplary conjugate can include an Fc fragment. See, e.g., Bao et al., EJNMMI Res. 2021;11:6; Hoey et al., Exp Biol Med (Maywood). 2019 Dec;244(17):1568-1576; Bever et al., Anal Bioanal Chem. 2016 Sep;408(22):5985-6002.

[0084] In some embodiments, the nanobody or antibody may be conjugated to or comprise a tag, e.g., a label (detectable moiety) or purification moiety (e.g., FLAG, hexahistidine (6-HIS), or hemagglutinin (HA)). Examples of detectable substances used as labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; examples of suitable radioactive materials include 125 I, 131 I, 35 S, or 3 H is one example.

[0085] Also provided herein are kits and compositions comprising the Nanobodies and / or antibodies described herein, as well as nucleic acids encoding the Nanobodies and / or antibodies, vectors (e.g. viral vectors or plasmids, preferably comprising regulatory sequences (e.g. a promoter that drives expression of the Nanobody and / or antibody)) comprising the nucleic acids, and host cells (e.g. bacterial cells, yeast cells, insect cells, or mammalian cells) that contain the nucleic acids and, optionally, express the Nanobodies and / or antibodies.

[0086] Treatment methods, screening, and monitoring of treatment effectiveness As shown herein, plasma ORF1p levels measured at the time of diagnosis are predictive of overall survival in cancers (e.g., colon cancer and gastroesophageal cancer) and can be used to monitor treatment response over time. This application allows patients to be stratified into high-risk and low-risk groups and receive further treatment (e.g., chemotherapy, more aggressive chemotherapy, or further surgery), particularly in colon, breast, and prostate cancers where multiple treatments are available. Accordingly, the methods described herein include methods for treating cancer. Generally, the methods involve selecting and optionally administering a therapeutically effective amount of a cancer treatment to a subject determined to be in need of such treatment by the methods described herein. Cancer treatment may be determined by the type of cancer and may include radiation therapy, surgical resection, chemotherapy, hormonal / endocrine therapy, and / or immunotherapy. In some embodiments, the cancer is a carcinoma (e.g., ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, gastric cancer, head and neck cancer, brain cancer, soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer. In some embodiments, the cancer is of blood, bone marrow, brain, skin, or soft tissue origin, particularly lymphoma, leukemia, myeloma, glioma, or melanoma.

[0087] In some embodiments, if a subject is identified as likely to have ovarian cancer, the subject is treated with surgical resection, and optionally chemotherapy and / or immunotherapy. Chemotherapy can include, for example, paclitaxel and carboplatin, docetaxel and carboplatin, or carboplatin and pegylated liposomal doxorubicin, gemcitabine, toptecan, etoposide, and / or bevacizumab; PARP inhibitors (e.g., olaparib); or hormone therapy (e.g., tamoxifen or letrozole).

[0088] The method may also include subjecting the subject to further screening (e.g., referring the subject for further workup (e.g., transvaginal ultrasound, uterine lavage, or salpingoscopy)) based on the updated posterior probability of having ovarian cancer, optionally combining the ORF1p results with other clinical features and potentially other biomarkers (e.g., CA125 and / or HE4 in the case of ovarian cancer).

[0089] The method can be used to monitor response to treatment (e.g., radiation therapy, surgical resection, chemotherapy, hormone / endocrine therapy, and / or immunotherapy). The method can include using the methods described herein to determine a baseline level of ORF1p in a subject; administering treatment (e.g., one or more doses of treatment); and determining the subject's subsequent ORF1p levels (e.g., during treatment (when obtained while treatment is in progress)) and / or after treatment (when obtained after treatment is completed). A decrease in the subject's ORF1p level from baseline to a subsequent level indicates that the subject is responding or is responding to the treatment. The method can also be used to monitor a subject in remission, to determine whether the subject remains in remission (e.g., has an ORF1p level below a threshold (e.g., the level of detection in the sample, or the level in subjects not afflicted with cancer)). If the treatment is effective, the method can include continuing the treatment. If the treatment is not effective (eg, the level of ORF1p does not decrease or increases), the method can include selecting, and optionally administering, a different treatment.

[0090] Kits and Assay Reagents Also provided herein are kits and assay reagents comprising the nanobodies and antibodies (e.g., antigen-binding fragments thereof) described herein. In some embodiments, the kits or reagents comprise a solid surface to which the nanobodies or antibodies are coupled. In some embodiments, the surface is a bead (e.g., a paramagnetic bead or a polymeric bead). [Example]

[0091] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0092] Materials and Methods In the examples below, the following materials and methods were used:

[0093] Materials. All affinity reagents used in this study are listed in Table E. Conjugation reagents, paramagnetic beads, and assay buffer were obtained from Quanterix Corporation. DNA oligos used in the MOSAIC assay were obtained from Integrated DNA Technologies. The antibodies used in the final Simoa and MOSAIC assays (monoclonal Ab6, Ab54, 62H12, 34H7) were further validated by Western blotting. [Table 2]

[0094] Preparation of capture and detection reagents. All capture antibodies and nanobodies were obtained or dialyzed in phosphate-buffered saline (PBS). For the first-generation Simoa assay, 7 × 10 8Carboxylated paramagnetic 2.7 μm beads (Homebrew Singleplex Beads, Quanterix Corp.) were first washed three times with 400 μL of Bead Wash Buffer (Quanterix Corp.), washed twice with 400 μL of cold Bead Conjugation Buffer (Quanterix Corp.), and then resuspended in 390 μL of cold Bead Conjugation Buffer. Next, a 1 mg vial of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Thermo Fisher Scientific) was dissolved to 10 mg / mL in cold Bead Conjugation Buffer, and 10 μL was added to the beads. The beads were shaken at 4°C for 30 minutes to activate the carboxyl groups on the beads, then washed once with 400 μL of cold Bead Conjugation Buffer, resuspended in the capture nanobody solution (10 g total nanobody), and diluted to a final volume of 400 μL with Bead Conjugation Buffer. The beads were shaken for 2 hours at 4°C, washed twice with 400 μL of Bead Wash Buffer, resuspended in 400 μL of Bead Blocking Buffer (Quanterix Corp.), and then shaken at room temperature for 30 minutes to block the beads. After washing once each with 400 μL of Bead Wash Buffer and Bead Diluent (Quanterix Corp.), the beads were resuspended in Bead Diluent and stored at 4°C. Before use in the assay, the beads were counted in a Beckman Counter Z-series particle counter. For the second-generation Simoa assay, the following bead coupling conditions were used: starting beads (4.2 × 10 8 ), wash volume (300 μL), EDC (6 μL), antibody (40 g).

[0095] For biotinylation of detection antibodies or nanobodies, a 1 mg vial of Sulfo-NHS-LC-LC-Biotin was freshly dissolved in 150 μL of water and added at an 80-fold molar excess to a 1 mg / mL solution of antibody or nanobody. The reaction mixture was incubated at room temperature for 30 minutes and then purified through an Amicon Ultra-0.5 mL centrifugal filter (50K and 10K cutoffs for antibodies and dimeric nanobodies, respectively). Five centrifugations were performed at 14,000 × g for 5 minutes with 450 μL of PBS per cycle. The purified biotinylated detection reagent was recovered by inverting the filter into a new tube and centrifuging at 1,000 × g for 2 minutes. Concentrations were quantified using a NanoDrop spectrophotometer.

[0096] Production of recombinant ORF1p protein. ORF1p was prepared as described (25). Briefly, codon-optimized human ORF1p corresponding to L1RP (an L1 insertion in the X-linked retinitis pigmentosa locus, GenBank AF148856.1) bearing an N-terminal His6-TEV was expressed in E. coli, purified by Ni-NTA affinity cleavage, eluted, and the tag was cleaved in the presence of RNase A. The protein was then polished by size exclusion in a buffer containing 50 mM HEPESp(p7.8), 500 mM NaCl, 10 mM MgCl2, and 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) to obtain monodisperse trimeric ORF1p bearing an N-terminal glycine scar.

[0097] Nanobody generation and screening. To identify antigen-specific nanobody candidates, nanobodies were generated essentially as described (49, 52) using mass spectrometry / lymphocyte cDNA sequencing. Briefly, llamas were immunized with monodisperse ORF1p, and serum and bone marrow were isolated. The heavy chain-only IgG fraction (VHH) was isolated from the serum and bound to a column of immobilized ORF1p. Bound proteins were eluted with SDS and sequenced by mass spectrometry using a library derived from PCR-amplified VHH fragments from bone marrow-derived plasma cells. Candidate sequences were cloned into an E. coli expression vector with a C-terminal His6 tag and expressed overnight at 12°C in a 50 ml culture of E. coli Arctic Express RP (Agilent) under 0.2 mM IPTG induction. Periplasmic extracts were generated as follows: the pellet was resuspended in 10 ml / L of culture medium TES buffer (200 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, and 500 mM sucrose), and 20 ml / L of hypotonic lysis buffer (TES buffer diluted 1:4 with ddH2O) was added, supplemented with 1 mM PMSF and 3 μg / ml pepstatin A, incubated at 4°C for 45 min, and centrifuged at 25,000 × g for 30 min. The supernatant (periplasmic extract) was bound to ORF1p-conjugated Sepharose, washed three times, and eluted with SDS at 70°C for 10 min. The periplasmic extract and eluate were analyzed by SDS-PAGE to assay expression and yield. ORF1p-binding candidates were purified as follows and analyzed by ELISA.

[0098] Purification of Nanobodies and Multimeric Nanobodies. C-terminal His6-tagged nanobody constructs were expressed and purified essentially as described (49). Briefly, proteins were expressed overnight at 12°C in E. coli Arctic Express RP (Agilent) with 0.2 mM IPTG induction. Periplasmic extracts generated as described above were supplemented with 5 mM MgCl2, 500 mM NaCl, and 20 mM imidazole, purified by Ni-NTA chromatography, dialyzed against 150 mM NaCl, 10 mM HEPES (pH 7.4), and concentrated to 1–3 mg / ml by ultrafiltration. The "5xCys tail" construct was purified by adding 5 mM TCEP-HCl to the resuspension, wash, elution, and dialysis buffers.

[0099] Surface plasmon resonance (SPR) assay. Binding kinetics (k a , k d , and K D ) was acquired on a Biacore 8K instrument (Cytiva). Recombinant ORF1p was immobilized at 1.5 μg / ml on a Series S CM5 sensor chip using EDC / NHS coupling chemistry according to the manufacturer's guidelines. Nanobodies and antibodies were prepared as analytes in a buffer containing 20 mM HEPES (pH 7.4), 150 mM NaCl, and 0.05% Tween-20. Depending on the observed off-rate, analytes were injected at 30 μl / min at concentrations of 0.1, 0.3, 1, 3.3, and 10 nM in single-cycle kinetic experiments (association time 120-180 s, dissociation time 1200-7200 s). Residual bound protein was removed between experiments using 10 mM glycine-HCl (pH 3.0). Data were analyzed using Biacore software, and a Langmuir 1:1 binding model was fitted to the sensorgrams to calculate kinetic parameters.

[0100] For epitope binning, a pair of antibodies was sequentially flowed over immobilized ORF1p using Biacore tandem dual injection according to the manufacturer's guidelines. Antibodies were injected at a concentration of 200 nM at a flow rate of 10 μl / min. The contact time of the first antibody was 120 seconds, followed by a contact time of the second antibody of 150 seconds, followed by a dissociation time of 30 seconds. The response signal of the second antibody was measured in a 10-second window at the start of dissociation. The chip was regenerated between experiments with glycine (pH 3.0) as described above. Data were analyzed using the epitope binning module in the Biacore software.

[0101] ORF1p Simoa Assay. Simoa assays were performed on an HD-X Analyzer (Quanterix Corp.) with all assay reagents and consumables loaded into the instrument according to the manufacturer's instructions. Each Simoa assay used 250,000 capture beads and 250,000 helper (unconjugated) beads. A three-step assay configuration was used for both first- and second-generation assays, consisting of a 15-minute target capture step (incubation of capture beads with 100 μL of sample), a 5-minute incubation with detection reagent (0.3 μg / mL for both first- and second-generation assays), and a 5-minute incubation with streptavidin-galactosidase (150 pM for first-generation assays; 300 pM for second-generation assays). After each assay step, beads were washed with System Wash Buffer 1 (Quanterix Corp.). During the final wash cycle, the beads were loaded into a 216,000-microwell array with the fluorescent enzyme substrate resorufin-D-galactopyranoside and then sealed with oil. Automated imaging and counting of "on" and "off" wells, as well as calculation of the average enzyme per bead (AEB), were performed by the instrument. 2 The calibration curve was fitted using 4PL fit with a weighting factor of and the limit of detection (LOD) was determined as three standard deviations above the blank.

[0102] All plasma and serum samples were diluted 4-fold in Homebrew Sample Diluent (Quanterix Corp.) containing 1x Halt Protease Inhibitor Cocktail (ThermoFisher), and in second-generation assays, an additional 1% Triton-X100 was added. All recombinant ORF1p calibrators were run in triplicate, blank calibrators in quadruplicate, and all plasma and serum samples were run in duplicate. The average LOD across all sample runs was determined for each assay and is shown in each figure.

[0103] Plasma and serum samples from healthy individuals were obtained from the Massachusetts General Hospital Brigham Biobank, and additional samples were obtained from the Pennsylvania Ovarian Cancer Research Center and Thomas Musterin (University of Washington).

[0104] ORF1p Large-Capacity MOSAIC Assay. The MOSAIC assay was performed as described above, using 2 ml microcentrifuge tubes for the initial capture step. For each sample, 500 μL of plasma was diluted 4-fold with Homebrew Sample Diluent containing protease inhibitors and 1% Triton-X100 to a total volume of 2 ml. Briefly, 100,000 capture beads were incubated with the sample and mixed at room temperature for 2 hours. They were then magnetically separated, resuspended in 250 μL of System Wash Buffer 1, and transferred to a 96-well plate. After washing with System Wash Buffer 1 using a Biotek 405TS Microplate Washer, 100 μL of nanobody detection reagent (0.3 g / mL, diluted in Homebrew Sample Diluent) was added, and the plate was shaken at room temperature for 10 minutes. After washing with a microplate washer, the beads were incubated with 100 μL of streptavidin DNA (100 pM, diluted in Homebrew sample diluent containing 5 mM EDTA and 0.02 mg / mL heparin) for 10 minutes at room temperature with shaking, followed by an additional wash step. The beads were transferred to a new 96-well plate, manually washed with 180 μL of System Wash Buffer 1, and resuspended in a 50 μL reaction mixture for rolling circle amplification (RCA). The RCA reaction mixture consisted of 0.33 U / μL phi29 polymerase, 1 nM ATTO647N-labeled DNA probe, 0.5 mM deoxyribonucleotide mix, 0.2 mg / mL bovine serum albumin, and 0.1% Tween-20 in 50 mM Tris-HCl (pH 7.5), 10 mM (NH4)2SO4, and 10 mM MgCl2. The beads were shaken at 37°C for 1 hour, followed by the addition of 160 μL of PBS containing 5 mM EDTA and 0.1% Tween-20. The beads were washed once with 200 μL of the same buffer and then resuspended in 140 μL of buffer containing 0.2% BSA. All samples were analyzed using a three-laser NovoCyte flow cytometer (Agilent).Analysis of average molecules per bead (AMB) values ​​was performed using FlowJo software (BD Biosciences) and Python, as described above. All code used for MOSAIC data analysis can be downloaded as part of the waltlabtools.mosaic Python module (available at github.com / tylerdougan / waltlabtools).

[0105] Targeted proteomic analysis of immunoprecipitated ORF1p. For accurate quantification, isotope-labeled standard peptides ( 13 C 15Protein levels of LINE-1 ORF1p (UniProt ID: Q9UN81) were determined by targeted proteomics using AQUA QuantProHeavy peptides containing N-labeled C-terminal lysine or arginine (ThermoFisher). Assays were developed for two quantitative peptides of ORF1p: LSFISEGEIK and cysteine-alkylated NLEECITR (the approach is similar to assay development previously described for other proteins (53)). Briefly, 3–6 mL of patient plasma was diluted with an equal volume of 2× dilution buffer (PBS containing 2% TritonX-100, 10 mM EDTA, and one Pierce protease inhibitor tablet (2× concentration, ThermoFisher) per 25 mL for a final concentration of 1% TritonX-100, 5 mM EDTA, and 1× protease inhibitor) and allowed to bind to 7 million 62H12-conjugated magnetic beads at room temperature for 1 hour. The beads were washed three times with 5x PBS containing 0.1% Tween 20 and 1x protease inhibitor, then once with the same buffer without Tween 20, and eluted with 50 μl of buffer containing 2% SDS and Tris (50 mM, pH 8.5) by heating at 95°C for 5 min with stirring. After reduction with 10 mmol / L dithiothreitol and alkylation with 55 mmol / L iodoacetamide, the separated eluate was subjected to in-gel digestion with trypsin (150 ng of sequencing-grade modified trypsin V5111, Promega) before LC-MS analysis of the target peptides (53).

[0106] Classification models. Classification models were trained on: (1) all healthy and ovarian cancer patients measured with the second-generation assay, and (2) a subset of 51 ovarian cancer patients and 50 age-matched healthy female patients obtained from Ronnie Drapkin (University of Pennsylvania). Each dataset contained no missing values, and measurements within the dataset were log-transformed and normalized prior to classification analysis of healthy and ovarian cancer subjects. Logistic regression was used as a univariate classifier, as well as k-nearest neighbor (KNN) and lightweight gradient boosting machines (LightGBM). This showed the best performance among the multivariate classifiers and was implemented in Python 3.7.15 using the scikit-learn version 1.0.2 package. Each classifier underwent optimization of class weights to address data imbalance between healthy and cancer subjects, as well as hyperparameter tuning using grid search.

[0107] The performance of each biomarker in distinguishing ovarian cancer subjects from healthy subjects was evaluated using 5-fold cross-validation by calculating accuracy, precision, recall, F1 score, sensitivity, specificity, and the area under the receiver operating characteristic (ROC) curve (AUC). The stratified 5-fold cross-validation strategy randomly divides the positive and negative samples into five equally sized subsets. Each time, one positive and one negative subset were selected as the test dataset, and the other samples were used to train the classification model.

[0108] In the multivariate analysis, the variance inflation factors (VIFs) of the biomarkers were calculated, and any biomarkers with very high correlations, with a VIF greater than 10, were excluded a priori from the classification model.

[0109] Barrett's esophagus cases. A cohort of 75 esophageal biopsies with BE and varying degrees of dysplasia was collected. Negative cases without a history of previous dysplasia were screened. The mean age of the cohort was 67 years, with a male predominance (M:F ratio = 3.7:1). All samples were reanalyzed for histologic features of dysplasia by three experienced gastrointestinal pathologists (LRZ, VD, OHY) who were blinded to the original diagnosis. Consensus was reached for 72 cases, and the consensus diagnosis was used as the gold standard. There was moderate agreement between the pathologists (kappa 0.43-0.51).

[0110] Colon cancer tissue microarray. 178 colon cancers consecutively resected by a single surgeon between 2011 and 2013 were assembled onto 3-mm core tissue microarrays. All cases were independently scored by two pathologists. The mean age of the cohort was 65 years, and 49.8% were male. The mean follow-up was 25 months. At the time of resection, 23% were stage I, 33% were stage II, 44% were stage III, and 1% were stage IV.

[0111] Ovarian Cancer Samples. Plasma samples from age-matched ovarian cancer (n=53) and healthy control (n=50) patients were from the University of Pennsylvania Ovarian Cancer Research Center, OCRC Tumor BioTrust Collection, Research Resource Identifier (RRID): SCR_02287.

[0112] Gastroesophageal cancer treatment cohort. Nineteen patients received systemic therapy, three of whom also underwent surgical resection. Patients were treated with concurrent chemotherapy (carboplatin / Taxol) and radiation therapy (N=3), fluorouracil / leucovorin / oxaliplatin / docetaxel (FLOT, N=2), fluorouracil / leucovorin / irinotecan / oxaliplatin (FOLFIRINOX, N=2), fluorouracil / leucovorin / oxaliplatin (FOLFOX, N=9), FOLFOX plus trastuzumab (N=1), pembrolizumab (N=1), or FOLFOX followed by chemoradiotherapy (1). The mean age of the cohort was 76 years. All patients were male (100%). At the time of initial diagnosis, 58% had locally advanced disease (stage II-III) and 42% had progressive disease (stage IV). Review of restaging imaging (CT and / or PET-CT) by investigators blinded to assay results identified 68% (N=13) as responders to treatment and 32% (N=6) as non-responders to standard of care. It should be noted that intra- / post-treatment blood draws measured by Simoa often preceded these imaging studies.

[0113] Patient consent. All plasma samples were obtained with informed consent under IRB-approved protocols at Massachusetts General Hospital at the Brigham (MGB), the University of Pennsylvania, and the University of Washington. All experiments using patient samples were conducted under IRB approval and in accordance with the ethical guidelines of the Belmont Report. Tissue samples were obtained with consent or, optionally, a waiver of consent under MGB-approved protocols.

[0114] Histochemistry: Immunohistochemistry for ORF1p was performed essentially as described (8) using anti-ORF1 4H1 (Millipore) diluted 1:3000 and reoptimized on a Leica Bond system (17). Cases were scored by three experienced gastrointestinal pathologists (MST, VD, OHY) at two institutions. LINE-1 in situ hybridization was performed on a Leica Bond system using RNAscope catalog 565098 (Advanced Cell Diagnostics) as described (17). The probe is complementary to the 5' end of L1RP (L1 insertion in the X-linked retinitis pigmentosa locus). Cases were evaluated by three experienced gastrointestinal pathologists (MST, VD, OHY).

[0115] Survival analysis: Kaplan-Meier (KM) curves (54) were calculated to study the relationship between overall survival and plasma ORF1p concentrations in ovarian, colorectal, and esophageal cancer. To investigate the association with survival, we classified ORF1p concentrations in two different ways. First, we classified each of the three assays as positive if the signal exceeded the limit of detection (LoD) in at least two of the three assays (majority vote). Next, we evaluated whether ORF1p concentrations measured only by the most sensitive assay (62H12::Ab6) were associated with survival and classified patients as ORF1p-high or ORF1p-low based on cohort-specific median values. The time variable was defined as the number of days after diagnosis (GE and CRC) or treatment initiation (ovarian). Surviving patients were censored at the date of last assessment. Because age at diagnosis was significantly associated with poor prognosis for CRC and male gender was significantly associated with poor prognosis for GE cancer, we applied a Cox proportional hazards regression model (55); ORF1p was found to be independently predictive. Survival objectives and KM curves were calculated using the Survival, ggpubr, and survminer packages in R. All tests were performed using R version 4.3.1 (The R Project for Statistical Computing, R-project.org / ). The proportional hazards assumption was tested by plotting Schoenfeld residuals and applying the Grambsch-Therneau test using the ggcoxdiagnostics function in R. The effect of influential observations was assessed by plotting deviance residuals using the ggcoxdiagnostics function in R. The original survival data are provided in the file "Supplementary Original Survival Data."

[0116] Example 1. Ultrasensitive detection of circulating ORF1p. Despite elevated expression of ORF1p in tumor tissue from ovarian and other cancers, levels of ORF1p and many other biomarkers released by tumors are diluted into the bloodstream, resulting in very low levels. These circulating concentrations can be far below the detection limits of conventional enzyme-linked immunosorbent assays (ELISAs) and mass spectrometry, thus necessitating ultrasensitive detection methods. A digital ELISA technology, single molecule array (Simoa), can provide a 1000-fold increase in analytical sensitivity compared to conventional ELISA (Figure 2B). 11 Using Simoa technology, we reported an ultrasensitive digital assay to detect ORF1p in blood. 26 .

[0117] The assay was optimized and expanded to detect circulating ORF1p concentrations down to sub-pg / mL (low femtomole) in ovarian cancer and other cancer patients, with extremely high specificity for cancer detection (Figure 2C). Briefly, affinity reagents were screened in combination as capture and detector pairs on the Simoa platform. The capture affinity reagent was conjugated to 2.7 μm paramagnetic beads using EDC chemistry, while the detector affinity reagent was biotinylated using SulfoNHS-LC-LC-biotin reagent. For each pair, several concentrations of recombinant human ORF1p protein and a buffer blank were measured to determine signal versus background. Selected pairs were used to measure ORF1p levels in breast cancer cell lysates and subsequently in serum samples from breast cancer and healthy patients.

[0118] The reagents tested included 4H1 (a mouse monoclonal antibody targeting amino acids 35-44 of human ORF1p, MABC1152, Sigma-Aldrich), JH73 (a rabbit monoclonal antibody raised against the C-terminus of human ORF1p, Taylor et al., Cell. 2013 Nov 21;155(5):1034-48), and JH74 (a rabbit monoclonal antibody raised against the C-terminus of human ORF1p, Doucet-O'Hare et al., Proc Natl Acad Sci US A. 2015 Sep 1;112(35):E4894-900). See, e.g., Mita et al., eLife. 2018;7:e30058; commercially available antibodies Ab6 (ab246317, AbCam), Ab54 (ab246320, AbCam), D3W9O (#88701, Cell Signaling Technology), and 168006 (NovoPro Labs), Nanobody 5 (Nb5) (a nanobody described herein), and monoclonal antibodies 62H12, 64C6, 33A8, 61A11, 36D12, 34H7, 50E9, 34C5, 55A6, and 42D10 described herein.

[0119] The signal-to-background ratios of various pairs on the Simoa platform are shown in Figure 2. These values ​​were determined using recombinant human ORF1p protein and diluted breast cancer cell lysates, and the affinity reagent pair with the highest signal-to-background ratio was selected for further screening in an investigational cohort of serum samples from healthy and breast cancer patients. Representative calibration curves for selected affinity reagent pairs are shown in Figure 3, where the measured signal is the average enzyme per bead (AEB). ORF1p levels measured in serum samples from healthy and breast cancer patients on the Simoa platform using select affinity reagent pairs are shown in Figures 4-5. ORF1p levels measured using the Nb5 nanobody / Ab6 and Ab54 / Ab6 capture / detector pairs in plasma samples from high-grade serous ovarian cancer and healthy patients are shown in Figure 6.

[0120] The final nanobody / antibody pair Nb5 nanobody / Ab6 was selected due to its high specificity in healthy patients (undetectable baseline levels) and good sensitivity in cancer patients.

[0121] As shown in Figures 6 and 7A-B, the results demonstrate elevated ORF1p levels across multiple cancer types, with detectable levels in approximately 63% (36 / 57) of HGSOC patients across two independent pilot cohorts. Importantly, the data indicate that circulating ORF1p was highly specific: ORF1p levels were undetectable (4× LOD (taking into account the dilution factor) was 0.28 pg / mL in nearly all of the more than 400 healthy individuals across the independent cohorts) (Figure 7); four were positive; one of them was found to have prostate cancer, and limited information (>99% specificity) was available for the other patients.

[0122] Therefore, undetectable ORF1p baseline levels (<0.28 pg / mL (accounting for a 4-fold dilution factor), using 25 uL of plasma or serum per replicate, diluted 4-fold to a total volume of 100 uL) in the majority of healthy subjects facilitates the establishment of a robust threshold for distinguishing healthy individuals from cancer patients, in contrast to many existing ovarian cancer protein biomarkers, which may have different baseline levels across individuals. These results therefore established strong support for the feasibility and transformative potential of ORF1p as a blood-based biomarker in many types of cancer (e.g., ovarian, pancreatic, liver, colorectal, lung, and head and neck cancers).

[0123] Example 2. Improved Assay - Second Generation We developed improved "second-generation assays" using custom reagents that increased analytical sensitivity by approximately 2-5 times, and now detect ORF1p with approximately 50 attomole sensitivity. This corresponds to approximately 1000 ORF1 homotrimers out of approximately 10 molecules in 25 μL of plasma. These assays use optimized buffers and rabbit mAbs for capture, and either mAbs or an engineered bivalent nanobody "Nb5-5LL" consisting of two linked Nb5 molecules. We applied these assays, along with our "first-generation assay," to a pilot cohort of plasma samples from 53 ovarian cancer patients and 50 healthy controls. These results (Figure 10A) showed detection of approximately 50% of patients (e.g., 3 of 5 stage I patients assayed) with the first-generation assay; the "second-generation assay" using the three best-performing capture / detection pairs (rabbit monoclonal antibodies 34H7 and 62H12 as capture reagents, and either Ab6 or Nb5 homodimer (Nb5-5LL) as detector) improved detection to 70-80% and 4 of 5 stage I patients, while maintaining high specificity (Figure 10A-D). Adding detergent further improved performance, likely by limiting bead aggregation and improving bead loading into the microwells. These second-generation assays achieved detection limits of 0.016–0.029 pg / mL (130–240 aM trimeric ORF1p), and the four different reagents had largely non-overlapping epitopes in binning experiments (34H7 and 62H12 partially overlapped).

[0124] Somewhat unexpectedly, the analytical sensitivity of the assay (detection of recombinant ORF1p in buffer) did not perfectly match its clinical sensitivity (detection of ORF1p in the plasma of cancer patients). Although the second-generation assay improved analytical sensitivity by less than an order of magnitude compared to the first-generation assay, it significantly improved the ability to detect circulating ORF1p in buffer over background in samples re-measured in a large cohort of healthy and cancer patients. This difference may be due to differences in the accessibility of the circulating ORF1p epitope or to different nonspecific binding patterns in plasma.

[0125] We next applied these assays to a larger cohort of patients with stage III and stage IV MGH ovarian and gastroesophageal cancer (Figure 10B). For ovarian cancer, we observed similar or even better detection rates across large cohorts using the improved assay, including detection of mucinous ovarian cancer subtypes, which tend not to have elevated CA-125 levels. For esophageal cancer, we demonstrated improved detection rates. Overall, these results demonstrate utility for early detection of ovarian cancer, including 80% of ovarian patients with stage I disease at clinical diagnosis, and for detecting esophageal cancer.

[0126] Undetectable or extremely low ORF1p levels in healthy individuals could be easily distinguished from ORF1p levels measured in ovarian cancer patients, demonstrating strong discriminatory power with the single-marker model (area under the receiver operating characteristic curve, AUC, 0.93–0.948, sensitivity 41–81%, specificity 98%, Figure 10D). This large cohort included pretreatment plasma samples from a subcohort of ovarian cancer patients (mostly high-grade serous ovarian cancer, the "Pennsylvania cohort") and age-matched controls (n = 51–53 women, Figure 10C). Furthermore, the second-generation assay demonstrated higher sensitivity while maintaining high specificity, achieving detection of 5 of 6 stage I / II patients with >98% specificity. Furthermore, a multivariate model combining ORF1p (34H7::Nb5-5LL assay) with the ovarian cancer biomarkers CA125 and HE4 demonstrated improved diagnostic performance compared with these existing markers (CA125 and HE4 alone, AUC = 0.94, 59% sensitivity with 98% specificity; ORF1p, CA125, and HE4, AUC = 0.98, 91% sensitivity with 98% specificity; Figure 10D). While it is unclear whether the low ORF1p levels detected in several healthy individuals were due to nonspecific binding, actual background levels of ORF1p, or unrecognized precancerous conditions, some positive healthy controls were positive in only one of the three second-generation assays (n = 4 positive in 62H12::Nb5-5LL alone, n = 75 positive in 62H12::Ab6 alone). This suggests nonspecific binding in at least some of these cases and the possibility of improving specificity by combining data from multiple assays. Our results show that by developing an improved affinity reagent, we achieved improved clinical sensitivity in detecting circulating ORF1p in cancer patients (>98% specificity and 83% sensitivity for early detection of ovarian cancer).

[0127] Receptor subtypes were available for a breast cancer cohort containing 30 patients each with metastatic and localized disease. While there was a trend toward higher triple-negative test positivity in all assays, the most sensitive second-generation assay (62H12::Ab6) had a sensitivity of 93% for both localized and metastatic disease, detecting 96% of triple-negative cases and 91% of the remaining cases. Overall, metastatic disease was more commonly detected than localized disease (43% vs. 6.7% for the first-generation assay, and 67–93% vs. 23–93% for the second-generation assay, depending on the assay). All three second-generation assays demonstrated higher sensitivity than the first-generation assays.

[0128] To test whether ORF1p is useful for monitoring treatment response, we identified 19 patients with gastroesophageal cancer who had both detectable plasma ORF1p at diagnosis and available subsequent samples collected during or after treatment (mean 80 days after initiation of treatment, range 26–179 days). All primary tumors were adenocarcinomas located in the esophagus (n = 7), gastroesophageal junction (n = 7), and stomach (n = 5). All patients received systemic therapy, chemotherapy, or chemoradiation: CROSS (n = 3), FLOT (n = 3), FOLFIRINOX (n = 2), FOLFOX (n = 9), FOLFOX plus trastuzumab (n = 1), or FOLFOX followed by CROSS (n = 1). A small number of patients also received radiation therapy and / or surgery. Clinical response ("responders" and "non-responders") was determined by review of restaging CT and PET-CT imaging by clinicians blinded to assay results. Over a mean period of 465 days (range 98–1098), 12 patients died, 6 were alive at the last follow-up (all "responders"), and 1 was lost to follow-up. Non-responders had elevated pretreatment plasma ORF1p (Figure 11A, left panel, p=0.02). All 6 patients with detectable ORF1p at follow-up sampling, defined as positive above background in 2 of 3 assays, were also non-responders by imaging (Figure 11A, right panel, p<0.0001, Fisher's exact test), and had reduced survival (p=0.001 by log-rank test for overall survival). In contrast, circulating ORF1p declined to undetectable levels at follow-up sampling in all 13 responders. Plasma ORF1p was measured in 4 responders and 2 non-responders at early time points, 26–33 days. The timing of sampling did not differ between groups (mean 93 days for non-responders and 74 days for responders, p=0.5). Pretreatment blood was collected on average 20 days after diagnosis (range -8 to 48; mean 22 for non-responders and 19 for responders, p=0.6). Representative PET and PET-CT images are shown (Figure 11B); both images were taken approximately 2 months after the start of treatment and 1 month after the plasma ORF1p results.Thus, a decrease in circulating ORF1p paralleled response to treatment and survival, while persistent circulating ORF1p corresponded to patients with refractory disease, demonstrating the predictive potential of this marker.

[0129] Because these results indicate that pretreatment plasma ORF1p levels can be predictive, we evaluated the prognostic value of the second-generation ORF1p Simoa assay in our cohort of GE, CRC, and ovarian cancer patients. We stratified patients based on either median ORF1p levels or ORF1p detectability (Methods) and found that higher pretreatment plasma ORF1p levels were significantly associated with poorer survival in GE and CRC (Figure 11C, p = 0.0017 and 0.011, respectively, log-rank test), but not in ovarian cancer. ORF1p remained significantly predictive in multivariate analyses for GE and CRC.

[0130] Example 3. Improving analytical sensitivity It was hypothesized that the assay described in Example 1 would be limited by the number of ORF1p molecules in a 25 μL sample. Using larger volumes of patient plasma could increase the number of target molecules present. For example, one teaspoon (5 ml) is 200 times the amount used in a 25 μL assay sample. Furthermore, a recently developed flow-based detection platform, Molecules on Bead Signal Amplification for Individual Counting (MOSAIC), could improve sensitivity. 30 A cohort using 20x the volume was evaluated. 0.5 ml of plasma (500 μl) was further diluted 1:4 with dilution binding buffer containing 1% Triton X-100 detergent, bound to 34H7-conjugated beads for 90 minutes, washed, detected by binding biotinylated Nb5-5LL (also known as MT997), read on a flow cytometer, and assayed for on-bead signal generation using MOSAIC. As shown in Figure 12, 9 of 10 previously undetectable patients exhibited signals above those of healthy controls.

[0131] To provide a "ground truth" of ORF1p expression, we collected larger volumes of blood (3-10 ml) from 20 HGSOC patients, 20 benign control subjects, 20 EAC patients, and 20 Barrett's esophagus patients with matched histology, as well as larger volumes of healthy plasma and gastroesophageal plasma. The MOSAIC assay was performed using the reagents described herein. Variables such as reagent selection, buffer additives (e.g., bead number and loading volume), salts, and detergents, binding time, and wash conditions were varied to optimize sensitivity, specificity, and reproducibility.

[0132] Example 3. Nanobody development Fridy et al., 2014 49 We generated nanobodies that bind to ORF1p using the method described in

[2014] . Briefly, similar to Carter et al., 2020, we generated highly purified ORF1p from E. coli. 35 llamas were immunized, bone marrow extracted, candidate DNA regions amplified and sequenced to generate libraries, serum fractionated, and then bound to immobilized purified ORF1p. Bound heavy chain antibodies were eluted, and VHH fragments were extracted and sequenced by mass spectrometry using a library derived from the bone marrow library described above. Candidate sequences were then assembled, synthesized, cloned, and screened for the ability to bind to ORF1p. The identified sequences are shown in Table B. [Table 3]

[0133] NB5 (also referred to herein as clone 5) was selected for further development.

[0134] An exemplary nucleic acid encoding Nb5 is as follows: CAGGTACAGCTTGTGGAATCAGGGGGTGACCTTGTGCAGGCAGGAGGGTCACTGCGCTTATCTTGTGCGGTCAGTGGGGGCACGTCATCAAACTACGGGATGGGTTGGTTTCGTCAAGCCCCTGGAAAGGAGCGCGAGTTTGTCTCATCGATCTCCTGGTCAGGCAGTCGTACTTTATATAGCGACTC AGTGAAAGGCCGCTTCACGATTAGTCGTGATAATGCGAAAAACACCGTTGACTTGCAGATGAACTCTTTGAAGCCTGAAGACACGGCAGTCTATTATTGCACCGCAGTACGCGAGTATCGCGACTACCCGCAGCGCGATAACTTTGACTATTGGGGACAAGGGACGCAGGTTACGGTAAGT (SEQ ID NO: 41) Because ORF1p is a homotrimer, numerous high-affinity combinations of binding reagents are possible. After two rounds of affinity mass spectrometry and cloning, further screening yielded 21 high-affinity clones. 49 The best of these had picomolar affinity (Table 1), identifying clones with non-overlapping epitopes. As shown in Table 1, the engineered nanobody reagents exhibited low-picomolar affinity comparable to or superior to existing antibody reagents (Ab6, 4H1, and Ab54). First-round engineering of dimeric and trimeric reagents by optimizing linker length (a 56-residue "long linker" containing both flexible (GGGGS) (SEQ ID NO: 6) and rigid (EAAAK) (SEQ ID NO: 11) segments was most advantageous, with a linker of 20 flexible (GGGGS) (SEQ ID NO: 6) residues also being favored) improved affinity, with two reagents surpassing the best mAb to date, Ab6. Table C presents the sequences of some of the concatemeric constructs developed. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]

[0135] Reagents with non-overlapping epitopes were identified through SPR binning experiments. 49 Combinations were empirically tested using calibration curves with recombinant ORF1p, and the best performers were then tested on a pilot cohort of plasma from cancer and healthy patients. These affinity reagent combinations were tested using Simoa in spiked healthy plasma and showed up to a 7-fold improvement in the limit of detection (Table 2). Interestingly, as shown in Figure 14, which shows ORF1p measurements of select reagent pairs in a small set of plasma from healthy and cancer patients, the highest affinity reagents did not necessarily perform best in plasma, necessitating a combination of rational and empirical screening. [Table 5] [Table 6]

[0136] Optimization of Simoa using new and existing reagents resulted in a candidate assay with a limit of detection (LOD) of 7 fg / ml (approximately 50 aM) for ORF1p, up to 7-fold lower. Because the target is a trimer, some combinations can yield very high affinity.

[0137] Example 4. Development of monoclonal antibodies GenScript's MonoRab™ immunization and B cell cloning platform was used with purified recombinant human ORF1p trimer. The 50 best-performing clones, as determined by ELISA screening of conditioned cell media at multiple dilutions, were selected and used in a modified Simoa assay using two different detection beads (Nb-5, the C5 nanobody clone described above, or 4H1 (Sigma-Aldrich)). The 10 best-performing clones (62H12, 64C6, 33A8, 61A11, 36D12, 34H7, 50E9, 34C5, 55A6, and 42D10) all exhibited up to 5-fold higher signal-to-noise than our existing best reagent, Ab6 (Figure 13A). The variable region heavy and light chain sequences of each of the 10 antibodies are presented in Table D and Figures 20A-J.

[0138] These antibodies were first screened using SIMOA against recombinant ORF1p protein in buffer (Quanterix Corp. sample diluent supplemented with Triton-X100) to identify pairs that provided improved sensitivity and specificity. Table 3 shows the representative limits of detection (LOD) of selected antibody pairs in diluent buffer. The LOD of the original Nb5 / Ab6 pair averaged approximately 0.05 pg / ml. [Table 7]

[0139] The signal / background of a number of pairs was also determined by Simoa using recombinant ORF1p protein in dilution buffer. The results are shown in Figure 15. When rabbit monoclonal antibodies were used as capture and detector, the background was high. The best combinations were rabbit monoclonal antibody as capture / Ab6 detector, Nb5-5 capture / rabbit monoclonal antibody detector, and 4H1 capture / rabbit monoclonal antibody detector pairs.

[0140] A select number of pairs (including the original Nb5 / Ab6 for comparison) were used to test ORF1p levels in plasma samples diluted 4-fold with sample diluent (Quanterix Corp.) containing Triton-X100. The results are shown in Figures 16 and 17. For these assays, the original Nb5 / Ab6 samples were diluted with sample diluent buffer, while the new assays used samples diluted with sample diluent + 1% Triton-X. Sample diluent was made using BSA (20 μg, Millipore #820451), 10X PBS (100 mL, Sigma #P5493-1L), 10% Tween-20 (10 mL, Sigma #P9416-50ML), Proclin 300 (500 μL, Sigma #48912-U), and 0.5 M EDTA (10 mL, Sigma #E7889-100ML), and brought to 1 L with MilliQ Water.

[0141] Unless otherwise noted, all assays were performed as a three-step assay (separate capture, detector labeling, and streptavidin beta-galactosidase labeling steps) or as a two-step assay (combined capture and detector labeling steps). Results demonstrated variability in sensitivity depending on the capture / detector selection. Figure 18 shows the results of assays performed on a cohort of 25 healthy subjects and 25 patients with breast, colon, or esophageal cancer.

[0142] Selected pairs were then evaluated in a panel of cancers, and the results are shown in Figures 19A-C. [Table 8-1] [Table 8-2]

[0143] Example 5. Development of a third generation assay Building on our nanobody-engineered improvements in our second-generation assay, we developed an expanded set of nanobody concatamers (e.g., homodimeric, heterodimeric, and heterotrimeric anti-ORF1p nanobodies) and screened them in combination with the 34H7 and 62H12 capture antibodies to obtain a "third-generation" assay (Figures 22A-B, 23, and 24). We noted that reagents containing Nb2 performed very well in SPR but poorly in Simoa detection. We hypothesized that this was because Nb2 contains a lysine in its CDR, which becomes biotinylated during the procedure, reducing affinity. Therefore, we engineered new reagents that biotinylated the C-terminal cysteine ​​residue and varied the linker sequence. Five of these assays, utilizing constructs containing Nb2 and Nb9, performed better than our second-generation assay in a cohort of 25 GE cancer patients with previously nearly undetectable ORF1p measurements, while maintaining high specificity for healthy individuals (Figure 21A, Figure 24).

[0144] To leverage a more sensitive assay for ORF1p detection, we next tested ORF1p affinity reagents from one of the second-generation Simoa assays on our recently developed molecule-on-bead signal amplification platform for individual counting (MOSAIC, Figure 21B). MOSAIC generates a localized, on-bead signal from a single capture molecule, as opposed to Simoa's microwell array format, increasing the number of beads counted, thereby improving analytical sensitivity by an order of magnitude over Simoa (26). Furthermore, because the developed Simoa assay used only 25 μL of plasma, we hypothesized that using a larger plasma volume would enhance ORF1p detectability by increasing the number of analyte molecules present. By using a 20-fold larger sample volume (500 μL plasma) and the MOSAIC platform, we achieved 10-fold increased analytical sensitivity (detection limit of 0.002 pg / mL ORF1p) (17 aM trimer, Figure 25). Indeed, in a pilot cohort of gastroesophageal cancer and healthy individuals, previously undetectable ORF1p levels in 9 of 10 cancer patients were readily distinguishable from healthy individuals (Figure 21C). Similar results were observed in a breast cancer cohort (Figure 21D). Thus, the use of larger sample volumes and higher analytical sensitivity techniques, in addition to improved affinity reagents, may further enhance both the sensitivity and discrimination of circulating ORF1p levels between healthy controls and cancer patients. The relative contributions of increased capacity and improved assay platforms to improved sensitivity remain under investigation; assay background seen in patient plasma but not in buffer may also be further optimized.

[0145] References 1.Bowtell DD,Bohm S,Ahmed AA,Aspuria P-J,Bast RC,Beral V,Berek JS,Birrer MJ,Blagden S,Bookman MA,Brenton JD,Chiappinelli KB,Martins FC,Coukos G,Drapkin R,Edmondson R,Fotopoulou C,Gabra H,Galon J,Gourley C,Heong V,Huntsman DG,Iwanicki M,Karlan BY,Kaye A,Lengyel E,Levine DA,Lu KH,McNeish IA,Menon U,Narod SA,Nelson BH,Nephew KP,Pharoah P,Powell DJ,Ramos P,Romero IL,Scott CL,Sood AK,Stronach EA,Balkwill FR.Rethinking ovarian cancer II:reducing mortality from high-grade serous ovarian cancer.Nature Reviews Cancer.2015;15(11):668-79.doi:10.1038 / nrc4019. 2.Torre LA,Trabert B,DeSantis CE,Miller KD,Samimi G,Runowicz CD,Gaudet MM,Jemal A,Siegel RL.Ovarian cancer statistics,2018.CA:A Cancer Journal for Clinicians.2018;68(4):284-96.doi.org / 10.3322 / caac.21456. 3.Cescon DW,Bratman SV,Chan SM,Siu LL.Circulating tumor DNA and liquid biopsy in oncology.Nature Cancer.2020;1(3):276-90.doi:10.1038 / s43018-020-0043-5. 4.Elias KM,Fendler W,Stawiski K,Fiascone SJ,Vitonis AF,Berkowitz RS,Frendl G,Konstantinopoulos P,Crum CP,Kedzierska M,Cramer DW,Chowdhury D.Diagnostic potential for a serum miRNA neural network for detection of ovarian cancer.eLife.2017;6:e28932.doi:10.7554 / eLife.28932. 5.Dochez V,Caillon H,Vaucel E,Dimet J,Winer N,Ducarme G.Biomarkers and algorithms for diagnosis of ovarian cancer:CA125,HE4,RMI and ROMA,a review.Journal of Ovarian Research.2019;12(1):28.doi:10.1186 / s13048-019-0503-7. 6.Drapkin R,von Horsten HH,Lin Y,Mok SC,Crum CP,Welch WR,Hecht JL.Human Epididymis Protein 4(HE4)Is a Secreted Glycoprotein that Is Overexpressed by Serous and Endometrioid Ovarian Carcinomas.Cancer Research.2005;65(6):2162.doi:10.1158 / 0008-5472.CAN-04-3924. 7.Burns KH.Transposable elements in cancer.Nature Reviews Cancer.2017;17(7):415-24.doi:10.1038 / nrc.2017.35. 8.Rodic N,Sharma R,Sharma R,Zampella J,Dai L,Taylor MS,Hruban RH,Iacobuzio-Donahue CA,Maitra A,Torbenson MS,Goggins M,Shih I-M,Duffield AS,Montgomery EA,Gabrielson E,Netto GJ,Lotan TL,De Marzo AM,Westra W,Binder ZA,Orr BA,Gallia GL,Eberhart CG,Boeke JD,Harris CR,Burns KH.Long Interspersed Element-1 Protein Expression Is a Hallmark of Many Human Cancers.The American Journal of Pathology.2014;184(5):1280-6.doi:10.1016 / j.ajpath.2014.01.007. 9.Pisanic TR,Asaka S,Lin S-F,Yen T-T,Sun H,Bahadirli-Talbott A,Wang T-H,Burns KH,Wang T-L,Shih I-M.Long Interspersed Nuclear Element 1 Retrotransposons Become Deregulated during the Development of Ovarian Cancer Precursor Lesions.The American Journal of Pathology.2019;189(3):513-20.doi.org / 10.1016 / j.ajpath.2018.11.005. 10.Xia Z,Cochrane DR,Tessier-Cloutier B,Leung S,Karnezis AN,Cheng AS,Farnell DA,Magrill J,Schmidt D,Kommoss S,Kommoss FKF,Kommoss F,McAlpine JN,Gilks CB,Koebel M,Rabban JT,Huntsman DG.Expression of L1 retrotransposon open reading frame protein 1 in gynecologic cancers.Human Pathology.2019;92:39-47.doi.org / 10.1016 / j.humpath.2019.06.001. 11.Rissin DM,Kan CW,Campbell TG,Howes SC,Fournier DR,Song L,Piech T,Patel PP,Chang L,Rivnak AJ,Ferrell EP,Randall JD,Provuncher GK,Walt DR,Duffy DC.Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations.Nature Biotechnology.2010;28(6):595-9.doi:10.1038 / nbt.1641. 12.Ignatiadis M,Sledge GW,Jeffrey SS.Liquid biopsy enters the clinic-implementation issues and future challenges.Nature Reviews Clinical Oncology.2021;18(5):297-312.doi:10.1038 / s41571-020-00457-x. 13.Bettegowda C,Sausen M,Leary RJ,Kinde I,Wang Y,Agrawal N,Bartlett BR,Wang H,Luber B,Alani RM,Antonarakis ES,Azad NS,Bardelli A,Brem H,Cameron JL,Lee CC,Fecher LA,Gallia GL,Gibbs P,Le D,Giuntoli RL,Goggins M,Hogarty MD,Holdhoff M,Hong SM,Jiao Y,Juhl HH,Kim JJ,Siravegna G,Laheru DA,Lauricella C,Lim M,Lipson EJ,Marie SKN,Netto GJ,Oliner KS,Olivi A,Olsson L,Riggins GJ,Sartore-Bianchi A,Schmidt K,Shih lM,Oba-Shinjo SM,Siena S,Theodorescu D,Tie J,Harkins TT,Veronese S,Wang TL,Weingart JD,Wolfgang CL,Wood LD,Xing D,Hruban RH,Wu J,Allen PJ,Schmidt CM,Choti MA,Velculescu VE,Kinzler KW,Vogelstein B,Papadopoulos N,Diaz LA.Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Annals of Oncology.2019;30(3):358-9.doi:10.1093 / annonc / mdy552.14.Abbosh C,Swanton C,Birkbak NJ. 15.Serrano MJ,Garrido-Navas MC,Diaz Mochon JJ,Cristofanilli M,Gil-Spleen I,Pauwels P,Malapelle U,Russo A,Lorente JA,Ruiz-Rodriguez AJ,Paz-Ares LG,Vilar E,Raez LE,Cardona AF,Rolfo C.Precision Prevention and Cancer Cancer Discovery.2020;10(11):1635.doi:10.1158 / 2159-8290.CD-20-0466. [ PMC free article ] [ PubMed ] 16.Welsh JB,Sapinoso LM,Kern SG,Brown DA,Liu T,Bauskin AR,Ward RL,Hawkins NJ,Quinn DI,Russell PJ,Sutherland RL,Breit SN,Moskaluk CA,Frierson HF,Hampton GM serum.Proceedings of the National Academy of Sciences.2003;100(6):3410.doi:10.1073 / pnas.0530278100. doi.org / 10.1111 / febs.15722 17.Grundy EE,Diab N,Chiappinelli KB.Transposable element regulation and expression in cancer. 18.Rodriguez-Martin et al.,Pan-cancer analysis of whole genomes identifies driver rearrangements promoted by LINE-1 retrotransposition.Nature Genetics.2020;52(3):306-19.doi:10.1038 / s41588-019-0562-0. 19.Scott EC,Gardner EJ,Masood A,Chuang NT,Vertino PM,Devine SE.A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer.Genome Research.2016;26(6):745-55. 20.Rodic N,Steranka JP,Makohon-Moore A,Moyer A,Shen P,Sharma R,Kohutek ZA,Huang CR,Ahn D,Mita P,Taylor MS,Barker NJ,Hruban RH,Iacobuzio-Donahue CA,Boeke JD,Burns KH.Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma.Nature Medicine.2015;21(9):1060-4.doi:10.1038 / nm.3919. 21.Goodier JL.Restricting retrotransposons:a review.Mobile DNA.2016;7(1):16.doi:10.1186 / s13100-016-0070-z. 22.Ardeljan D,Taylor MS,Ting DT,Burns KH.The Human Long Interspersed Element-1 Retrotransposon:An Emerging Biomarker of Neoplasia.Clinical Chemistry.2017;63(4):816-22.doi:10.1373 / clinchem.2016.257444. 23.Pavlou MP,Diamandis EP,Blasutig IM.The Long Journey of Cancer Biomarkers from the Bench to the Clinic.Clinical Chemistry.2013;59(1):147-57.doi:10.1373 / clinchem.2012.184614. 24.Enroth S,Johansson Å,Enroth SB,Gyllensten U.Strong effects of genetic and lifestyle factors on biomarker variation and use of personalized cutoffs.Nature Communications.2014;5(1):4684.doi:10.1038 / ncomms5684. 25.Wu D,Dinh TL,Bausk BP,Walt DR.Long-Term Measurements of Human Inflammatory Cytokines Reveal Complex Baseline Variations between Individuals.The American Journal of Pathology.2017;187(12):2620-6.doi:10.1016 / j.ajpath.2017.08.007. 26.Cohen L,Cui N,Cai Y,Garden PM,Li X,Weitz DA,Walt DR.Single Molecule Protein Detection with Attomolar Sensitivity Using Droplet Digital Enzyme-Linked Immunosorbent Assay.ACS Nano.2020;14(8):9491-501.doi:10.1021 / acsnano.0c02378. 27.Ardeljan D,Wang X,Oghbaie M,Taylor MS,Husband D,Deshpande V,Steranka JP,Gorbounov M,Yang WR,Sie B,Larman HB,Jiang H,Molloy KR,Altukhov I,Li Z,McKerrow W,Fenyo D,Burns KH,LaCava J.LINE-1 ORF2p expression is nearly imperceptible in human cancers.Mobile DNA.2019;11(1):1.doi:10.1186 / s13100-019-0191-2. 28.Wellner A,McMahon C,Gilman MSA,Clements JR,Clark S,Nguyen KM,Ho MH,Hu VJ,Shin J-E,Feldman J,Hauser BM,Caradonna TM,Wingler LM,Schmidt AG,Marks DS,Abraham J,Kruse AC,Liu CC.Rapid generation of potent antibodies by autonomous hypermutation in yeast.Nature Chemical Biology.2021;17(10):1057-64.doi:10.1038 / s41589-021-00832-4. 29.Zupancic JM,Desai AA,Schardt JS,Pornnoppadol G,Makowski EK,Smith MD,Kennedy AA,Garcia de Mattos Barbosa M,Cascalho M,Lanigan TM,Tai AW,Tessier PM.Directed evolution of potent neutralizing nanobodies against SARS-CoV-2 using CDR-swapping mutagenesis.Cell Chemical Biology.2021;28(9):1379-88.e7.doi:doi.org / 10.1016 / j.chembiol.2021.05.019. 30.Wu C,Dougan TJ,Walt DR.MOSAIC:High-Throughput,High-Multiplex Digital Protein Detection with Attomolar Sensitivity.Wu,C.,Dougan,T.J.& Walt,D.R.High-Throughput,High-Multiplex Digital Protein Detection with Attomolar Sensitivity.ACS Nano,doi:10.1021 / acsnano.1c08675(2022). 31.Sudmant PH,et al.,An integrated map of structural variation in 2,504 human genomes.Nature.2015;526(7571):75-81.doi:10.1038 / nature15394. 32.Mahmood W,Erichsen L,Ott P,Schulz WA,Fischer JC,Arauzo-Bravo MJ,Bendhack ML,Hassan M,Santourlidis S.Aging-associated distinctive DNA methylation changes of LINE-1 retrotransposons in pure cell-free DNA from human blood.Scientific Reports.2020;10(1):22127.doi:10.1038 / s41598-020-79126-z. 33.Crow MK.Long interspersed nuclear elements(LINE-1):Potential triggers of systemic autoimmune disease.Autoimmunity.2010;43(1):7-16.doi:10.3109 / 08916930903374865. 34.Mavragani CP,Sagalovskiy I,Guo Q,Nezos A,Kapsogeorgou EK,Lu P,Liang Zhou J,Kirou KA,Seshan SV,Moutsopoulos HM,Crow MK.Expression of Long Interspersed Nuclear Element 1 Retroelements and Induction of Type I Interferon in Patients With Systemic Autoimmune Disease.Arthritis & Rheumatology.2016;68(11):2686-96.doi.org / 10.1002 / art.39795. 35.Carter V,LaCava J,Taylor MS,Liang SY,Mustelin C,Ukadike KC,Bengtsson A,Lood C,Mustelin T.High Prevalence and Disease Correlation of Autoantibodies Against p40 Encoded by Long Interspersed Nuclear Elements in Systemic Lupus Erythematosus.Arthritis & Rheumatology.2020;72(1):89-99.doi.org / 10.1002 / art.41054. 36.Ukadike KC,Ni K,Wang X,Taylor MS,LaCava J,Pachman LM,Eckert M,Stevens A,Lood C,Mustelin T.IgG and IgA autoantibodies against L1 ORF1p expressed in granulocytes correlate with granulocyte consumption and disease activity in pediatric systemic lupus erythematosus.Arthritis Research & Therapy.2021;23(1):153.doi:10.1186 / s13075-021-02538-3. 37.Crow MK.Reactivity of IgG With the p40 Protein Encoded by the Long Interspersed Nuclear Element 1 Retroelement:Comment on the Article by Carter et al.Arthritis Rheumatol.2020;72(2):374-6.Epub 2019 / 12 / 27.doi:10.1002 / art.41102. 38.Sharma R,Rodic N,Burns KH,Taylor MS.Immunodetection of Human LINE-1 Expression in Cultured Cells and Human Tissues.Methods Mol Biol.2016;1400:261-80.doi:10.1007 / 978-1-4939-3372-3_17. 39.Cohen L and Walt DR.Highly Sensitive and Multiplexed Protein Measurements.Chem.Rev.2019,119,293-321. 40.D.Wild,The Immunoassay Handbook:Theory and applications of ligand binding,ELISA and related techniques(Elsevier,Amsterdam,The Netherlands,ed.4th,2013;linkinghub.elsevier.com / retrieve / pii / B9781455778966000583). 41.Cohen,L.et al.,Single Molecule Arrays for ultra-sensitive detection of rat cytokines in serum,J.Immunol.Methods 452,20-25(2018). 42.Rissin DM,et al.,Simultaneous detection of single molecules and singulated ensembles of molecules enables immunoassays with broad dynamic range,Anal.Chem.83,2279-2285(2011). 43.Katz-Summercorn,A.C.et al.Multi-omic cross-sectional cohort study of pre-malignant Barrett’s esophagus reveals early structural variation and retrotransposon activity.Nat Commun 13,1407,doi:10.1038 / s41467-022-28237-4(2022). 44.Taylor,M.S.et al.Affinity proteomics reveals human host factors implicated in discrete stages of LINE-1 retrotransposition.Cell 155,1034-1048,doi:10.1016 / j.cell.2013.10.021(2013). 45.Taylor,M.S.et al.Dissection of affinity captured LINE-1 macromolecular complexes.Elife 7,doi:10.7554 / eLife.30094(2018). 46.De Cecco,M.et al.L1 drives IFN in senescent cells and promotes age-associated inflammation.Nature 566,73-78,doi:10.1038 / s41586-018-0784-9(2019). 47 Simon,M.et al.LINE1 Derepression in Aged Wild-Type and SIRT6-Deficient Mice Drives Inflammation.Cell Metab 29,871-885 e875,doi:10.1016 / j.cmet.2019.02.014(2019). 48.Rajurkar,M.et al.Reverse Transcriptase Inhibition Disrupts Repeat Element Life Cycle in Colorectal Cancer.Cancer Discov 12,1462-1481,doi:10.1158 / 2159-8290.CD-21-1117(2022). 49.Fridy,P.C.et al.A robust pipeline for rapid production of versatile nanobody repertoires.Nat Methods 11,1253-1260,doi:10.1038 / nmeth.3170(2014). 50.Skates,S.J.et al.Early Detection of Ovarian Cancer using the Risk of Ovarian Cancer Algorithm with Frequent CA125 Testing in Women at Increased Familial Risk-Combined Results from Two Screening Trials.Clin Cancer Res 23,3628-3637,doi:10.1158 / 1078-0432.CCR-15-2750(2017). 51.Skates,SJ et al.,Screening based on the risk of cancer calculation from Bayesian hierarchical change-point and mixture models of longitudinal markers.J Am Stat Assoc 96(454),429-439(2001). 52.Mast,FD et al.Highly synergistic combinations of nanobodies that target SARS-CoV-2 and are resistant to escape.Elife 2021;10 doi 10.7554 / eLife.73027. 53. Wolters, JC et al. Translational Targeted Proteomics Profiling of Mitochondrial Energy Metabolic Pathways in Mouse and Human Samples. J Proteome Res 2016;15(9):3204-13 doi 10.1021 / acs.jproteome.6b00419. 54. Kaplan, EL and Meier, P. Nonparametric estimation from incomplete observations. Journal of the American statistical association 1958;53(282):457-81. 55.Cox, DR.Regression models and life‐tables.Journal of the Royal Statistical Society:Series B(Methodological)1972;34(2):187–202.

[0146] Other embodiments While the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A method comprising: The method comprises providing a sample, preferably a sample comprising a biological fluid or tissue, preferably wherein the biological fluid is blood, serum, or plasma, or the tissue is a tissue lysate from a subject, and further comprising determining the level of ORF1p in the sample with an ultrasensitive protein assay.

2. The method of claim 1, further comprising comparing the level of ORF1p with a disease standard, wherein a level of ORF1p exceeding the standard indicates that the subject is suffering from or at risk of developing cancer.

3. The method of claim 1 or 2, wherein the cancer is a carcinoma.

4. 4. The method of claim 3, wherein the carcinoma is ovarian cancer, breast cancer, liver cancer, colon / colorectal cancer, lung cancer, esophageal cancer, prostate cancer, stomach cancer, head and neck cancer, brain cancer (optionally glioblastoma), soft tissue cancer, kidney cancer, gallbladder cancer, bile duct cancer (cholangiocarcinoma), bladder cancer, uterine cancer, or pancreatic cancer, blood or bone marrow cancer (optionally lymphoma, leukemia, or myeloma), or skin cancer (optionally melanoma).

5. 5. The method of claim 4, wherein the ovarian cancer is high-grade serous ovarian cancer (HGSOC).

6. 6. The method of claims 1 to 5, wherein the ultrasensitive assay is single molecule array (SIMOA); molecule-on-bead signal amplification for individual counting (MOSAIC); mesoscale discovery (MSD); single molecule counting (SMC); nucleic acid binding immunosandwich assay (NULISA); LUMINEX; SOMAscan assay; NAB-SURE; mass spectrometry (optionally MALDI-MS), and / or mass cytometry (optionally CyTOF).

7. determining the level of ORF1p may involve using a Nanobody selected from Nb2, Nb5, Nb9, Nb10, or NB21, or an ORF1p-binding derivative comprising its CDRs, or a concatemer thereof, optionally MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, or MT1040, and / or 62H12, 64C6, 33A8, 61A11, 36D12, 34H7, 50E9, 34C5, 55A6, 42D1 7. The method of claims 1-6, comprising contacting the sample with a capture or detection reagent comprising a monoclonal antibody selected from 62H12 / MT1036, 62H12 / MT1037, 62H12 / MT1038, 62H12 / Ab6, 34H7 / Nb5-5LL, 34H7 / Ab6, 62H12 / Nb5-5LL, 4H1 / Nb5-5, or 4H1 / Nb5-5LL.

8. 8. The method of claim 7, wherein the Nanobody comprises a sequence at least 80%, 85%, 90%, or 95% identical to a sequence of Table B, and preferably the CDRs of the Nanobody are identical to the CDRs of a sequence of Table B.

9. The method of claims 1 to 8, further comprising recommending or subjecting said subject to further evaluation (optionally by imaging and / or biopsy).

10. 10. The method of claims 1-9, further comprising administering a cancer treatment to a subject identified as having or at risk of developing cancer.

11. 9. The method of claim 8, wherein the treatment comprises chemotherapy, hormone therapy, immunotherapy, radiation therapy, or surgical resection.

12. The method of claim 1, further comprising determining the level of ORF1p in the subject after administration of the treatment and comparing the level of ORF1p before treatment with the level of ORF1p during and / or after treatment, wherein a decrease in the level of ORF1p indicates that the treatment is effective in treating the cancer.

13. A single domain antibody or antigen-binding fragment thereof that binds to human ORF1p, comprising a sequence at least 90% identical to a Nanobody sequence shown in Table B or to its CDR1, CDR2, and CDR3.

14. A single domain antibody or antigen-binding fragment thereof comprising the CDR1, CDR2, and CDR3 shown in Table B.

15. 15. A fusion construct comprising at least two, optionally three, four, or five, of the single domain antibodies or antigen-binding fragments thereof of claim 13 or 14, and optionally MT1032, MT1033, MT1034, MT1035, MT1036, MT1037, MT1038, MT1039, and MT1040, optionally with a linker between them, as shown in Table C.

16. An antibody or antigen-binding portion thereof that specifically binds to human ORF1p, said antibody or antigen-binding portion thereof comprising: a heavy chain variable region (VH) comprising or consisting of a VH sequence that is at least 95% identical to a CDR1, CDR2, and CDR3 sequence shown in Table D or Figures 20A-J, or derived therefrom; and / or the antibody or antigen-binding portion thereof, comprising at least one light chain variable region (VL) comprising or consisting of a VL sequence that is at least 95% identical to a sequence shown in Table D or Figures 20A-J, or CDR1, CDR2, and CDR3 derived therefrom, and preferably the VH and VL or CDRs are from the same antibody.

17. 17. The antibody or antigen-binding portion thereof of claim 16, wherein the antibody optionally comprises a constant region as shown in Table A.

18. A single domain antibody or antigen-binding fragment thereof according to claims 13 to 14, a fusion construct according to claim 15, or an antibody or antigen-binding portion thereof according to claim 16 or 17, fused to a tag.

19. 19. The single domain antibody or antigen-binding fragment thereof, fusion construct, or antibody or antigen-binding portion thereof of claim 18, wherein the tag is an oligonucleotide, peptide, chemiluminescent, fluorescent, radioactive, or colorimetric label.

20. The radiolabel is 125 20. The single domain antibody or antigen-binding fragment thereof, fusion construct, or antibody or antigen-binding portion thereof of claim 19, wherein said antibody or antigen-binding portion is I.

21. A nucleic acid molecule encoding a single domain antibody or antigen-binding fragment thereof, a fusion construct, or an antibody or antigen-binding portion thereof according to claims 13 to 20.

22. 22. A vector comprising the nucleic acid molecule of claim 21 and, optionally, a promoter.

23. 22. A host cell comprising the nucleic acid molecule of claim 21 and optionally expressing a single domain antibody or antigen-binding fragment thereof, a fusion construct, or an antibody or antigen-binding portion thereof according to claims 13 to 19.