T cell receptors for cancer-associated antigens and uses thereof
Novel TCRs targeting PRAME and CTCFL antigens address the limitations of current ovarian cancer treatments by enhancing immune responses against ovarian cancer cells while minimizing harm to healthy tissues.
Patent Information
- Application Number
- JP2025524363
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-11
- Filing Date
- 2023-11-09
- Publication Date
- 2025-12-09
AI Technical Summary
Current treatments for ovarian cancer, particularly high-grade serous ovarian carcinoma, are limited by the lack of effective tumor-specific targets and the development of treatment resistance, with existing immunotherapies like CAR-T and TCR-T cells facing challenges due to low tumor mutational burden and immune evasion mechanisms.
Identification of novel T cell receptors (TCRs) targeting cancer-associated antigens such as PRAME and CTCFL, which are highly expressed in ovarian cancer and minimally expressed in healthy tissues, allowing for the development of TCR-T cell therapies that enhance immune responses against ovarian cancer cells.
The novel TCRs demonstrate specific and potent anti-tumor reactivity against ovarian cancer cells without harming healthy cells, offering a promising therapeutic approach for ovarian cancer treatment.
Smart Images

Figure 2025539707000016 
Figure 2025539707000017 
Figure 2025539707000018
Abstract
Description
[Technical Field]
[0001] Provided herein are novel nucleic acid compositions, vector systems, engineered cells, and pharmaceutical compositions that encode or express T cell receptor components against cancer-associated antigens (e.g., preferentially expressed melanoma antigen (PRAME) and CCCTC-binding factor (CTCFL)). These novel components may be used to enhance immune responses in subjects diagnosed with a PRAME-associated disease or condition, or a CTCFL-associated disease or condition (e.g., a hematological malignancy or solid tumor). Related methods for treating such subjects are also provided herein. [Background technology]
[0002] Ovarian cancer (OVCA) is the fifth most lethal cancer type in women [1]. Due to the lack of specific symptoms, 58% of OVCA patients are diagnosed at advanced or metastatic stages, and the 5-year survival rate is only 30% compared to approximately 80% for early-stage disease [2]. OVCA is heterogeneous, with five distinct histological types, of which high-grade serous ovarian carcinoma (HGSC) is the most frequent type, accounting for 70% of all ovarian cancers [3]. Late-stage patients initially respond well to standard treatments, including debulking surgery and platinum- and taxane-based chemotherapy, or more recently, ADP-ribose polymerase inhibitors (PARPi), but the majority of patients develop recurrent disease and treatment resistance [4-6]. Immunotherapy, such as infusion of tumor-infiltrating lymphocytes (TILs), anticancer vaccination, and treatment with immune checkpoint inhibitors such as anti-PD1, has been investigated in patients with ovarian cancer. Adoptive T cell-based therapy using chimeric antigen receptors (CARs) or T cell receptors (TCRs) has also been explored [7-9]. Promising clinical results have been achieved using both CAR-T and TCR-T cells, primarily in B cell malignancies and more recently in solid tumors [10-14]. CARs are limited to targeting epitopes on extracellular proteins, limiting their options for ovarian cancer. However, TCRs offer a wider range of potential targets, as peptides derived from both intracellular and extracellular proteins presented by human leukocyte antigens (HLA) are possible targets.
[0003] Ovarian cancers are classified as immunogenic tumors, and tumors rich in CD8+ T cells are associated with prolonged survival [15, 16]. On the other hand, immune evasion mechanisms, such as downregulation of HLA and increased expression of immune inhibitory molecules, correlate with poor survival
[17] . For immune-infiltrated tumors ("hot" tumors), infusion of immune checkpoint inhibitors or TILs is considered a good treatment strategy. However, the majority of ovarian tumors have a low tumor mutational burden (TMB), resulting in limited T cell infiltration, a lack of anti-tumor reactive T cells, and consequently, "cold" tumors [17, 18]. For these "cold" tumors, adoptive T cell-based therapy using TCR-T cells targeting tumor-associated antigens (TAA) is considered a promising solution [8].
[0004] Clinical trials in patients with OVCA have explored TCRs targeting the cancer-testis antigens (CTAs) NY-ESO-1, MAGE-A4, and more recently PRAME.[8] However, notably because escape variants occur with the growth of antigen-negative tumors, and most of the TCRs explored target HLA-A. * Because of the 02:01 restriction, more TCRs specific for additional peptides derived from different TAAs that bind to various HLA class I molecules are essential to treat a wider patient population.
[0005] Thus, there is a need for additional and improved means to treat OVCA. [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Siegel, RL et al., A Cancer Journal for Clinicians, 2022. 72(1):7-33 [Non-patent document 2] Howlader N,NA, Krapcho M, Miller D, Brest A, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ, Cronin KA. SEER Cancer Statistics Review, 1975-2017, National Cancer Institute. Bethesda, MD. [Cited based on the November 2019 SEER data submission posted on the SEER website in April 2020; available at https: / / seer.cancer.gov / csr / 1975_2017 / [Non-patent document 3] Vaughan, S. et al., Nature Reviews Cancer, 2011. 11(10):719-725 [Non-patent document 4] Hennessy, B.T., R.L.Coleman, and M.Markman, The Lancet, 2009. 374(9698):1371-1382 [Non-Patent Document 5] Freimund, AE et al. Hematology / Oncology Clinics of North America, 2018. 32(6):983-996 pages [Non-patent document 6] Konstantinopoulos, P.A., S. Lheureux, and KNMoore, American Society of Clinical Oncology Educational Book, 2020(40): pages e116-e131 [Non-Patent Document 7] Coukos, G., J. Tanyi, and L. E. Kandalaft, Annals of Oncology, 2016. 27:i11-i15 pages [Non-patent document 8] Wu, JWY et al., Front Immunol, 2021. 12:672502 pages [Non-Patent Document 9] Yang, C. et al., Frontiers in Immunology, 2020. 11 [Non-Patent Document 10] Park, JH et al., N Engl J Med, 2018. 378(5):449-459 [Non-Patent Document 11] Rapoport, AP et al., Nat Med, 2015. 21(8):914-921 [Non-Patent Document 12] Munshi, NC et al., N Engl J Med, 2021. 384(8):705-716 [Non-Patent Document 13] Robbins, PF et al., Clinical Cancer Research, 2015. 21(5):1019-1027 [Non-Patent Document 14] Leidner, R. et al., New England Journal of Medicine, 2022. 386(22):2112-2119 [Non-Patent Document 15] Santoiemma, PP et al., Gynecologic Oncology, 2016. 143(1):120-127 [Non-Patent Document 16] Sato, E. et al., Proc Natl Acad Sci USA, 2005. 102(51):18538-43 [Non-Patent Document 17] Rodriguez, GM et al., Cancers, 2018. 10(8):242 [Non-Patent Document 18] Alexandrov, LB et al., Nature, 2013. 500(7463):415-421 Summary of the Invention [Problem to be solved by the invention]
[0007] As described herein, we sought to identify stringent tumor-specific TAAs in ovarian cancer and high-affinity TCRs targeting these targets. An ideal TAA would be highly and uniformly expressed in ovarian tumors and not expressed in healthy tissues. Coexpression in tissues from the reproductive tract is acceptable because expression in the reproductive compartment does not pose a lethal toxicity risk to ovarian cancer patients. Furthermore, options for inducing expression in cases of consistent or variable protein expression are needed. For example, DNA demethylating agents have shown the potential to induce the expression of several CTAs [19, 20]. T cells targeting the TAA can be found in the T cell repertoire of either healthy individuals or patients. If the TAA is also expressed in healthy tissues, self-tolerance occurs in the autologous HLA (autologous HLA) T cell repertoire during negative selection as a mechanism for centrally depleting high-avidity autoreactive T cells (in recognition and killing assays). Self-tolerance can be circumvented by searching for TAA-specific T cells in the allogeneic HLA (alloHLA) T-cell repertoire, as previously demonstrated for several B-cell-restricted antigens and WT1 [21-23]. [Means for solving the problem]
[0008] By combining mRNA-seq datasets from healthy and tumor tissues, we identified PRAME, CTCFL, and CLDN6 as stringent tumor-specific TAA targets with high expression in ovarian cancer and at least 20-fold lower expression in all healthy tissues at risk. We then identified naturally expressed peptides derived from selected targets in the HLA class I ligandome of OVCA patient samples and cell lines. For the identified peptides, we surprisingly isolated high-avidity T cell clones from the allo-HLA T cell repertoires of 25 healthy individuals. Using a large panel of OVCA patient samples, OVCA cell lines, and healthy cell subsets, we advantageously identified two novel PRAME TCRs and one novel CTCFL TCR with potent and specific anti-tumor reactivity against OVCA cells (in recognition and killing assays). These TCRs are promising candidates for the treatment of ovarian cancer patients and are associated with HLA-A binding. * 02:01 This is essentially an extension to the restrictive PRAME TCR.
[0009] The differentially expressed genes, naturally expressed peptides, and TCRs identified herein can be advantageously used to improve the use of T cell-based therapies in patients with OVCA. For example, the TCRs identified herein have been shown by the inventors to be specific and safe, as they do not respond to cells that express minimal or no PRAME TAAs, as discussed in more detail in the Examples section.
[0010] Accordingly, the present invention provides an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, comprising: (i) a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 3 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to PRAME; or (ii) a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to PRAME; or (iii) A nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 31 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 34 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to CTCFL. The present invention provides a nucleic acid composition comprising:
[0011] Preferably, (i) the CDR3 of the Vα domain may comprise or consist of the amino acid sequence of SEQ ID NO: 3, and the CDR3 of the Vβ domain may comprise or consist of the amino acid sequence of SEQ ID NO: 6, or (ii) the CDR3 of the Vα domain may comprise or consist of the amino acid sequence of SEQ ID NO: 17, and the CDR3 of the Vβ domain may comprise or consist of the amino acid sequence of SEQ ID NO: 20; or (iii) The CDR3 of the Vα domain may comprise or consist of the amino acid sequence of SEQ ID NO: 31, and the CDR3 of the Vβ domain may comprise or consist of the amino acid sequence of SEQ ID NO: 34.
[0012] Preferably, (i) the Vα domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 7, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 9; or (ii) the Vα domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 21, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 23; or (iii) The Vα domain may comprise an amino acid sequence having at least 80% sequence identity with, comprising, or consisting of SEQ ID NO: 35, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity with, comprising, or consisting of SEQ ID NO: 37.
[0013] Suitably, the cancer-associated antigen may be a PRAME antigen or a CTCFL antigen, in other words, the antigen may be derived from PRAME or CTCFL.
[0014] Suitably, the cancer associated antigen may comprise an amino acid sequence selected from the group consisting of LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44) and KLHGILVEA (SEQ ID NO: 45).
[0015] Preferably, the encoded binding protein is LYVDSLFFL:HLA-A *24:02 Complex, SPSVSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * It may be capable of specifically binding to a peptide:HLA complex selected from the group consisting of: 02:01 complexes.
[0016] Suitably, the nucleic acid sequence may be codon optimized for expression in a host cell, optionally the host cell is a human cell.
[0017] Suitably, the nucleic acid composition may further comprise a TCR alpha chain constant domain and / or a TCR beta chain constant domain.
[0018] Suitably, the encoded binding protein may comprise a TCR, an antigen-binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager, or an ImmTAC.
[0019] Suitably, the antigen-binding fragment of a TCR may be a single chain TCR (scTCR) or a chimeric TCR dimer in which the antigen-binding fragment of a TCR is linked to alternative transmembrane and intracellular signalling domains.
[0020] The present invention also provides a vector system comprising the nucleic acid composition of the present invention.
[0021] Preferably, the vector may be a plasmid, a viral vector, or a cosmid; optionally, the vector is selected from the group consisting of a retrovirus, a lentivirus, an adeno-associated virus, an adenovirus, a vaccinia virus, a canarypox virus, a herpes virus, a minicircle vector, and a synthetic DNA or RNA.
[0022] The present invention also provides modified cells comprising the nucleic acid compositions of the invention or the vector systems of the invention.
[0023] Suitably, the modified cells may be selected from the group consisting of CD8 T cells, CD4 T cells, NK cells, NK-T cells, gamma-delta T cells, hematopoietic stem cells, induced pluripotent stem cells, progenitor cells, T cell lines and NK-92 cell lines.
[0024] Preferably, the modified cells may be human cells.
[0025] The present invention also provides a pharmaceutical composition comprising a nucleic acid composition according to the invention, a vector system according to the invention, or a modified cell according to the invention, and a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.
[0026] The present invention also provides a pharmaceutical composition according to the invention for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
[0027] The present invention also provides a pharmaceutical composition according to the invention for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
[0028] The present invention also provides a pharmaceutical composition according to the invention for use in providing anti-tumour immunity to a human subject.
[0029] The invention also provides a pharmaceutical composition according to the invention for use in treating a human subject having a disease or condition associated with elevated levels of the HLA-restricted PRAME antigen or elevated levels of the HLA-restricted CTCFL antigen.
[0030] Also provided are pharmaceutical compositions described herein for use in treating or preventing a PRAME-associated disease or condition or a CTCFL-associated disease or condition in a subject.
[0031] Also provided is a method for treating or preventing a PRAME-associated disease or condition or a CTCFL-associated disease or condition in a subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0032] Preferably, the method may induce or enhance a cellular immune response in the subject.
[0033] Also provided is a method of inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0034] Also provided is a method of stimulating a cellular immune response against a target cell population or tissue in a human subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0035] Also provided is a method of providing anti-tumor immunity in a human subject, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0036] Also provided is a method for treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME antigen or elevated levels of HLA-restricted CTCFL antigen, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0037] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for treating or preventing a PRAME-associated disease or condition or a CTCFL-associated disease or condition in a subject.
[0038] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
[0039] There is also provided the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
[0040] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in providing anti-tumor immunity to a human subject.
[0041] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME antigen or elevated levels of HLA-restricted CTCFL antigen.
[0042] Suitably, the human subject may have at least one tumor.
[0043] Suitably, the subject may have been diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
[0044] Suitably, the PRAME-associated disease or condition or CTCFL-associated disease or condition may be a hematological malignancy or a solid tumor.
[0045] Suitably, the hematological malignancy may be selected from the group consisting of multiple myeloma, plasma cell leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), and B-cell lymphoma, and optionally, the B-cell lymphoma is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), and Burkitt's lymphoma.
[0046] Preferably, the solid tumor may be selected from the group consisting of melanoma, uveal melanoma, ovarian cancer, endometrial cancer, testicular tumor, lung cancer, lung squamous cell carcinoma, thymoma, synovial sarcoma, kidney cancer, breast cancer, sarcoma, bladder cancer, mesothelioma, pancreatic cancer, prostate cancer, colorectal cancer, cervical cancer and gastric cancer.
[0047] Suitably, the solid tumor may be selected from the group consisting of ovarian cancer, synovial sarcoma, endometrial cancer, lung cancer, melanoma and uveal melanoma.
[0048] Preferably, the solid tumor may be ovarian cancer.
[0049] The invention also provides a method for producing a binding protein that can specifically bind to a peptide containing a cancer-associated antigen and that does not bind to peptides that do not contain the cancer-associated antigen, the method comprising contacting a nucleic acid composition of the invention with a cell under conditions such that the nucleic acid composition is taken up and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.
[0050] Suitably, the method may be an ex vivo method.
[0051] The present invention also provides an isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:42.
[0052] The present invention also provides an isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:42 for use in therapy.
[0053] Throughout the description and claims of this specification, the terms "comprise" and "contain" and variations thereof mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, ingredients, integers or steps.
[0054] Throughout the description and claims of this specification, the singular includes the plural unless the context requires not to include the plural. In particular, where the indefinite article is used, the specification should be understood as contemplating the plural as well as the singular, unless the context requires that only the singular is contemplated.
[0055] It is to be understood that any feature, integer, property, compound, chemical moiety or group described in connection with a particular aspect, embodiment or example of the invention is also applicable to any other aspect, embodiment or example described herein, unless inconsistent.
[0056] Various aspects of the invention are described in further detail below. [Brief explanation of the drawings]
[0057] In the following, embodiments of the present invention will be further described in detail with reference to the accompanying drawings.
[0058] [Figure 1]Figure 1 shows that differential gene expression analysis reveals genes associated with high-grade serous ovarian cancer. (A) Scheme illustrating the analysis strategy described in Materials and Methods. (B) Plot displaying three DE genes identified for ovarian cancer (FC≥20; adjusted p-value ≤0.05). All other genes on the plot are non-DE genes and genes without protein-coding potential. (C) Box plot showing PRAME, CTCFL, and CLDN6 expression in OVCA (TCGA data, n=30) and the nine healthy tissue types with the highest gene expression (HPA and / or GTEx data, n=5-25). Where possible, overlapping healthy tissue types within HPA and GTEx were combined. Box plots extend from the first to third quartile, with horizontal lines representing median expression. Whiskers represent minimum and maximum expression. The upper and lower red dashed lines represent the median expression value and the 20-fold lower expression value, respectively (adjusted p-value: p-value after adjusting for the false discovery rate; DE: differentially expressed; FDR: fold discovery rate; GTEx: Genotype-tissue expression; HPA: human protein atlas; Log2-CPM: log2-transformed counts per million; minlog2FC: log2-fold change; TCGA: Tissue cancer genome atlas). [Figure 2(1)] Figure 2 shows the identification of PRAME, CTCFL, and CLDN6 peptides and T cell clones. (A) PRAME, CTCFL (TvX), and CLDN6 mRNA gene expression in 14 OVCA patient samples (12 solid tumor tissues and 2 malignant ascites samples (OVCA-L23 and OVCA-L25)) and 9 OVCA cell lines. Expression was measured by RT-qPCR and is shown as a percentage of three HKGs, GUSB, VPS29, and PSMB4, set to 100% (HKGs: housekeeping genes; OVCA: primary ovarian cancer samples). [Figure 2(2)](B) Examples of three OVCA-derived peptides identified in our HLA ligandome analysis. Mass spectra of the eluted peptides are shown, including the gene, peptide sequence, and HLA restriction. All eluted peptides were validated by comparing the tandem mass spectra of the eluted peptides and synthetic peptides, as shown in Figure 9. (C) Representative flow cytometry plot of a pMHC multimer-enriched cell population from one of 25 healthy donors. The gating strategy for the single-cell sorted population (indicated by circles) is shown, gated on CD8 (Alx700), pMHC multimer (PE), and CD4 / CD14 / CD19 (FITC). [Figure 2 (3)] (D) Example of recognition patterns based on IFN-γ production (ng / mL) of selected and excluded T cell clones during the primary T cell screening. T cell clones were co-cultured with Raji cells transduced with various HLA alleles in combination with OVCA peptide loading (1 μM) or OVCA gene transduction (E:T = 1:6). Exclusions 1-4 represent T cell clones lacking potency and / or specificity (OVCA: primary ovarian cancer samples). [Figure 3(1)]Figure 3 shows the recognition patterns of selected T cell clones that recognize PRAME- or CTCFL-positive tumor cells without substantial peptide or HLA cross-reactivity. The recognition patterns are based on IFN-γ production (ng / mL) after overnight coculture assays using (A) PRAME- or CTCFL-positive tumor cell lines, (B) PRAME- or CTCFL-negative tumor cell lines and healthy cell subsets, and (C) 25 EBV-LCLs expressing all frequent HLA alleles present in the Caucasian population (allele frequency >1%). The HLA alleles in (C) are indicated if the HLA allele is recognized by the T cell clone and meets the requirement that all EBV-LCLs carrying this HLA allele are recognized. All cell lines in panels (A) and (B), both wild-type and transduced with HLA alleles (+A2, +A24, +B7), express the HLA alleles that present the targeted peptide. The percentage of relative PRAME or CTCFL expression determined by RT-qPCR is shown. Bars represent averaged duplicate values and are representative of two independent experiments (EBV-1cl: Epstein-Barr virus-transformed lymphoblastoid cell line). [Figure 3(2)] Continued from Figure 3(1). [Figure 4(1)]Figure 4 shows that three PRAME TCR-T cells recognize PRAME-positive OVCA cells and mature DCs. Three PRAME TCRs and the clinically tested HSS3 TCR were constructed, introduced into CD8+ cells from four different donors via retroviral transduction, and purified. (A) Representative flow cytometry plots of purified CMV and PRAME TCR-T cells and their parental PRAME T cell clones stained with mouse TCR (mTCR) and PRAME-specific pMHC multimers. (B) IFN-γ production (ng / mL) of TCR-T cells and their parental T cell clones cocultured overnight with Raji cells (transduced with HLA-A2, A24, or B7) loaded with titrating peptide concentrations (E:T = 1:6). (C) IFN-γ production of TCR-T cells cocultured with OVCA cells (E:T = 1:6). All OVCA cells, both wild-type and transduced with HLA alleles, express the target peptide-presenting HLA allele. The patient-derived malignant ascites sample OVCA-L23 (wild-type HLA-A2) was either at passage 0 (included for TCRs DSK3 and HSS3) or at passage 10 transduced with HLA-A24 or B7 (included for all TCRs). (D) IFN-γ production of TCR-T cells cocultured with several healthy cell subsets (E:T = 1:4 for keratinocytes, fibroblasts, PTECs, and CD14+ cells, 1:6 for CD19+ cells). Cell subsets were isolated from multiple HLA-A2+, A24+, and / or B7+ donors. (C-D) Percentages of relative PRAME expression determined by RT-qPCR are shown. Bars represent the mean and symbols represent the average duplicate values from four different donors included in two independent experiments (E:T: effector:target ratio, imDC and mDC: immature and mature dendritic cells, pMHC multimers: peptide-MHC multimers, PTEC: proximal tubular epithelial cells, OVCA: primary ovarian cancer samples). [Figure 4(2)] Continued from Figure 4(1). [Figure 5(1)]Figure 5 shows that PRAME TCR-T cells kill OVCA cells without harming PRAME-negative or HLA-negative cells. Purified PRAME TCR-T cells were tested for cytotoxicity against (A) primary OVCA patient samples and OVCA cell lines in a 6-hour 51Cr release assay at an E:T ratio of 10:1. All target cells expressed the target HLA allele. COV318 and OVCAR-3 (wild-type HLA-A2+ and B7+) were transduced with HLA-A24. Patient-derived malignant ascites sample OVCA-L23 (wild-type HLA-A2+) was either passage 0 (included for TCRs DSK3 and HSS3) or passage 10 transduced with HLA-A24 or B7 (included for TCRs 16.3C1 and 8.10C4). The percentage of relative PRAME expression determined by RT-qPCR is shown. The cytotoxic potential of PRAME TCR-T cells and CMV TCR-T cells was compared using a paired t-test (two-tailed). Means and SDs of technical triplicates are shown for four donors in two independent experiments (E:T: effector:target ratio; ns: not significant; OVCA: primary ovarian cancer samples). [Figure 5(2)]Figure 5 shows that PRAME TCR-T cells kill OVCA cells without harming PRAME-negative or HLA-negative cells. (B) Purified PRAME TCR-T cells were tested for cytotoxicity against PRAME-negative cells (Raji and imDC) or target HLA-negative cells (COV362.4) in a 6-hour 51Cr release assay at an E:T ratio of 10:1. Except for COV362.4, all target cells expressed the target HLA allele. Raji cells were transduced with HLA-A2, A24, or B7. imDC were isolated from PBMCs of HLA-A2+, A24+, and B7+ donors. The percentage of relative PRAME expression determined by RT-qPCR is shown. The cytotoxic potential of PRAME TCR-T cells and CMV TCR-T cells was compared using a paired t-test (two-tailed). The mean and SD of technical triplicates are shown for four donors in two independent experiments (E:T: effector:target ratio, ns: not significant, imDC: immature dendritic cells). [Figure 6]Figure 6 shows that CTCFL TCR-T cells recognize and kill (DAC-treated) CTCFL-positive OVCA cells. The 39.2E12CTCFL / KLH / A2 TCR was constructed, introduced into CD8+ cells from four different donors via retroviral transduction, and purified. (A) Representative flow cytometry plots of purified CMV and CTCFL TCR-T cells and the parental CTCFL T cell clone stained with mouse TCR (mTCR) and CTCFL-specific pMHC multimers. (B) IFN-γ production (ng / mL) of TCR-T cells and the parental T cell clones cocultured overnight (E:T = 1:6) with Raji cells transduced with HLA-A*02:01 and loaded with titrating peptide concentrations. (C-F) IFN-γ production of TCR-T cells cocultured with (C) primary OVCA-L11 passage 0 single cells (E:T 1:6), (D) healthy cell subsets from multiple donors (E:T = 1:4 for fibroblasts, PTECs, and CD14+ cells, 1:6 for CD19+ cells), (E) tumor cells treated with 1 μM DAC or DMSO for 7 days (E:T = 1:6), and (F) fibroblasts treated with 1 μM DAC or DMSO for 7 days. Bars represent the mean, and symbols represent averaged duplicate values from three or four different donors in two independent experiments. (G) Cytotoxicity of CTCFL TCR-T cells in a 6-hour 51Cr release assay against Raji cells loaded with KLH (SEQ ID NO: 45) peptide, and COV413b and SK-OV-3 cells treated with 1 μM DAC or DMSO for 7 days. Means and SD represent technical triplicates from four different donors in two independent experiments at an E:T ratio of 10:1. (B-G) All target cells, both wild-type and transduced with one of the HLA alleles (Raji, SK-OV-3, A2780), express HLA-A*02:01. The percentage of relative CTCFL (TvX) expression determined by RT-qPCR is shown. (D) IFN-γ production of CTCFL TCR-T cells and CMV TCR-T cells was compared using a paired t-test (two-tailed).(E–G) IFN-γ production and cytotoxicity of CTCFL TCR-T cells cocultured with DMSO- and DAC-treated cells, or peptide-loaded and non-loaded Raji cells, compared using a paired t-test (two-tailed) (ns: not significant; DAC: 5-aza-2′-deoxycytidine; imDC and mDC: immature and mature dendritic cells; pMHC multimers: peptide-MHC multimers; PTEC: proximal tubule epithelial cells; OVCA: primary ovarian cancer samples). [Figure 7(1)] Figure 7 shows PRAME, CTCFL, and CLDN6 expression in OVCA and healthy tissues. (A) Box plots showing PRAME expression in ovarian cancer (TCGA data, n = 30) and 51 (GTEx data, n = 6-20) and 32 (HPA data, n = 3-5) healthy tissue types. Gray box plots represent healthy reproductive tissues. Dark gray box plots represent ovarian tumors, and white box plots represent all remaining healthy tissues. Box plots extend from the first to third quartiles, and horizontal lines represent median expression values. Whiskers represent minimum and maximum expression values (1.5 IQR from the first and third quartiles). Outliers are defined as >1.5 × IQR above the third quartile or >1.5 × IQR below the first quartile, respectively. Upper and lower dashed lines represent median and 20-fold lower expression values, respectively. [FemRPS: female reproductive system, GTEx: Genotype-tissue expression, HPA: Human Protein Atlas, HSOvCa: high-grade serous ovarian cancer, IQR: interquartile range, log2-CPM: log2-transformed counts per million, MaRPS: male reproductive system, PRAME: preferentially expressed antigen of melanoma, TCGA: Tissue cancer genome atlas]. [Figure 7(2)]Figure 7 shows PRAME, CTCFL, and CLDN6 expression in OVCA and healthy tissues. (A) Box plots showing CTCFL expression in ovarian cancer (TCGA data, n = 30) and 51 (GTEx data, n = 6-20) and 32 (HPA data, n = 3-5) healthy tissue types. Gray box plots represent healthy reproductive tissues. Dark gray box plots represent ovarian tumors, and white box plots represent all remaining healthy tissues. Box plots extend from the first to third quartiles, and horizontal lines represent median expression values. Whiskers represent minimum and maximum expression values (1.5 IQR from the first and third quartiles). Outliers are defined as >1.5 × IQR above the third quartile or >1.5 × IQR below the first quartile, respectively. Upper and lower dashed lines represent median and 20-fold lower expression values, respectively. [CTCFL: CCCTC binding factor, FemRPS: female reproductive system, GTEx: Genotype-tissue expression, HPA: Human Protein Atlas, HSOvCa: high-grade serous ovarian cancer, IQR: interquartile range, log2-CPM: log2-transformed counts per million, MaRPS: male reproductive system, TCGA: Tissue cancer genome atlas]. [Figure 7(3)]Figure 7 shows PRAME, CTCFL, and CLDN6 expression in OVCA and healthy tissues. Box plots showing (C)CLDN6 expression in ovarian cancer (TCGA data, n = 30) and 51 (GTEx data, n = 6-20) and 32 (HPA data, n = 3-5) healthy tissue types. Gray box plots represent healthy reproductive tissues. Dark gray box plots represent ovarian tumors, and white box plots represent all remaining healthy tissues. Box plots extend from the first to third quartiles, and horizontal lines represent median expression values. Whiskers represent minimum and maximum expression values (1.5 IQR from the first and third quartiles). Outliers are defined as >1.5 × IQR above the third quartile or >1.5 × IQR below the first quartile, respectively. Upper and lower dashed lines represent median and 20-fold lower expression values, respectively. [CLDN6]: claudin-6, FemRPS: female reproductive system, GTEx: Genotype-tissue expression, HPA: Human Protein Atlas, HSOvCa: high-grade serous ovarian cancer, IQR: interquartile range, log2-CPM: log2-transformed counts per million, MaRPS: male reproductive system, TCGA: Tissue cancer genome atlas]. [Figure 8(1)]Figure 8 shows PRAME, CTCFL, and CLDN6 expression in tumor samples. Box plots showing (A) PRAME and (B) CTCFL expression across 33 different tumor types (TCGA data, n=30). Dark and gray box plots represent ovarian tumors and all other tumor types, respectively. Box plots extend from the first to third quartiles, and horizontal lines represent median expression. Whiskers represent minimum and maximum expression values (1.5 IQR from the first and third quartiles). Outliers are defined as >1.5xIQR above the third quartile or >1.5xIQR below the first quartile, respectively. [AML]: acute myeloid leukemia, CTCFL: CCCTC binding factor, DLBCL: diffuse large B-cell lymphoma, IQR: interquartile range, log2-CPM: log2-transformed counts per million, PRAME: melanoma preferentially expressed antigen, TCGA: tissue cancer genome atlas]. [Figure 8(2)] Figure 8 shows PRAME, CTCFL, and CLDN6 expression in tumor samples. (C) Box plots showing CLDN6 expression across 33 different tumor types (TCGA data, n = 30). Dark and gray box plots represent ovarian tumors and all other tumor types, respectively. Box plots extend from the first to third quartiles, and horizontal lines represent median expression. Whiskers represent minimum and maximum expression values (1.5 IQR from the first and third quartiles). Outliers are defined as >1.5 × IQR above the third quartile or >1.5 × IQR below the first quartile, respectively. [AML]: acute myeloid leukemia; CLDN6: claudin-6; DLBCL: diffuse large B-cell lymphoma; IQR: interquartile range; log2-CPM: log2-transformed counts per million; TCGA: Tissue cancer genome atlas]. [Figure 9(1)] Figure 9 shows an example of a mass spectral comparison of eluted peptides (top) and synthetic peptides (bottom). (A) Mass spectral comparison of peptide SPSVSQLSVL (SEQ ID NO: 44) derived from PRAME presented in HLA-B*07:02. [Figure 9(2)] Figure 9 shows an example of a mass spectral comparison of an eluted peptide (top) and a synthetic peptide (bottom). (B) Mass spectral comparison of peptide KLHGILVEA (SEQ ID NO: 45) derived from CTCFL presented in HLA-A*02:01. *The mass spectrum of the eluted peptide with a BMI of 43, also eluted from K562+A2, is not available for publication. (C) Mass spectral comparison of peptide VLTSGIVFV (SEQ ID NO: 73) derived from CLDN6 presented in HLA-A*02:01 (BMI: best Mascot ion score). [Figure 10] Figure 10 shows the positions of peptides and primers used in aligned CTCFL variants. (A) Protein sequence alignment of 15 protein variants derived from CTCFL gene isoforms resulting from alternative splicing according to the UniProt database
[30] . The canonical sequence was selected as the reference sequence, and differences from the reference sequence are highlighted in white. The identified CTCFL peptides, primers specific to the canonical sequence (CTCFL TvX), and primers specific to variant 13 (CTCFL Tv13) are shown. (B) Zoom-in of the selection marked in (A). (C) CTCFL expression was measured by RT-qPCR using primers TvX and Tv13. The percentage of expression relative to three HKGs, GUSB, VPS29, and PSMB4, which were set to 100%, is shown. HKGs: housekeeping genes. [Figure 11(1)]Figure 11 shows the peptide specificity and target gene recognition summarized for 56 isolated T cell clones. A summary graph of IFN-γ production (ng / mL) for 56 isolated T cell clones that recognized both peptide-loaded (1 μM) and target gene-transduced target cells is shown. Each graph (A) shows the five most potent T cell clones per specificity for six PRAME peptides. The number of T cell clones shown and the total number isolated are indicated in parentheses. For all target cells, the HLA alleles presenting the targeted peptides were introduced by transduction (+A2, +A24, +B7). Bars indicate averaged overlap values, and the four T cell clones ultimately selected for TCR transduction are colored. [Figure 11(2)] Figure 11 shows the peptide specificity and target gene recognition summarized for 56 isolated T cell clones. A summary graph of IFN-γ production (ng / mL) for 56 isolated T cell clones that recognized both peptide-loaded (1 μM) and target gene-transduced target cells is shown. Each graph (B) shows the five most potent T cell clones per specificity for three CTCFL peptides. The number of T cell clones shown and the total number isolated are indicated in parentheses. *T cell clones that recognized transduced CLDN6 were not identified; the five best T cell clones that recognized peptide-loaded cells are shown in (C). In all target cells, the HLA alleles presenting the targeted peptide were introduced by transduction (+A2, +A24, +B7). Bars indicate averaged overlap values; the four T cell clones ultimately selected for TCR transduction are colored. [Figure 12]Figure 12 shows PRAME, CTCFL, and CLDN6 expression (RT-qPCR) in primary OVCA patient samples and healthy cell subsets. PRAME, CTCFL (TvX), and CLDN6 mRNA gene expression in primary OVCA patient samples and various healthy cell subsets. Expression was measured by RT-qPCR and is shown as a percentage of three KKGs, GUSB, VPS29, and PSMB4, which were set at 100% (OVCA: primary ovarian cancer patient samples; imDC and mDC: immature and mature dendritic cells; HKG: housekeeping genes; PBEC: primary bronchial epithelial cells; PTEC: proximal tubule epithelial cells). [Figure 13] Figure 13 shows the recognition and killing of peptide-loaded tumor cell lines by PRAME TCR-T cells. Recognition and killing of unloaded and peptide-loaded OVCA cell lines by PRAME TCR-T cells and CMV TCR-T cells. All experiments were performed simultaneously, and data are shown for one donor, but are representative of two donors. (A) IFN-γ production (ng / mL) of TCR-T cells cocultured overnight with three OVCA cell lines (E:T = 1:6). Mean and SD of technical duplicates are shown. Percentage of dead cells measured in a 6-hour 51Cr release assay (E:T = 10:1 and 1:1). Mean and SD of technical triplicates are shown. All OVCA cell lines were wild-type A2+ and B7+, and A24 was transduced. (B) IFN-γ production and killing of OVCA cell lines loaded with QLL / A2 peptide (200 nM), LYV / A24 peptide (200 nM), SLL / A2 peptide (200 nM), and SPS / B7 peptide (1000 nM). [Figure 14]Figure 14 shows the recognition and killing of peptide-loaded tumor cell lines by CTCFL TCR-T cells. Recognition and killing of unloaded and peptide-loaded target cells by CTCFL TCR-T cells and CMV TCR-T cells. All experiments were performed simultaneously, and data are shown for one donor, but are representative of two donors. (A) IFN-γ production (ng / mL) of TCR-T cells cocultured overnight with 1 μM DAC- or DMSO-treated target cells (E:T = 1:6). Mean and SD of technical duplicates are shown. Additionally, the percentage of killed cells measured in a 6-hour 51Cr-release assay (E:T = 10:1 and 1:1) are shown. Mean and SD of technical triplicates are shown. COV413b is wild-type A2+, while Raji and SK-OV-3 are transduced with A2. (B) IFN-γ production and killing of the same target cells loaded with KLH / A2 peptide (200 nM) (DAC: 5-aza-2′-deoxycytidine, E:T: effector:target ratio). [Figure 15] Figure 15 shows the increased recognition and killing of DAC-treated OVCA cells by PRAME TCR-T cells. Recognition and killing of DAC-treated target cells by HSS3PRAME / SLL / A2 TCR-T cells is shown for four different donors. (A) IFN-γ production (ng / mL) of PRAME TCR-T cells cocultured overnight with fibroblasts and tumor cells treated with 1 μM DAC or DMSO for 7 days (E:T = 1:6). Bars represent the mean, and symbols represent average duplicate values from four different donors in two independent experiments. (B) Percentage of killed cells measured in a 6-hour 51Cr-release assay (E:T = 10:1 and 1:1). Allo-HLA-A*02:01-reactive T cells are also shown. Means and SD represent technical triplicates from four different donors in two independent experiments at an E:T ratio of 10:1. (A-B) Recognition and killing of DMSO- and DAC-treated cells, or peptide-loaded and non-loaded Raji cells, are compared using paired t-tests (two-tailed) (ns: not significant, DAC: 5-aza-2'-deoxycytidine, E:T: effector:target ratio). [Figure 16]Figure 16. NSG mice implanted with 2 x 106 Luc2 luciferase-transduced U266 MM cells. 14 days after tumor injection, mice were treated intravenously with 5 x 106 PRAME or CMV TCR-T cells. A) DSK3 PRAME / QLL / A2 TCR-T cells were injected into U266-implanted mice. B) 16.3C1 PRAME / LYV / A24 TCR-T cells were injected into U266+A24-implanted mice. C) 8.10C4 PRAME / SPS / B7 TCR-T cells were injected into U266-implanted mice. D) HSS3 PRAME / SLL / A2 TCR-T cells were injected into U266-implanted mice. The mean and SD of tumor growth (mean radiance measured by bioluminescence imaging) over time on the ventral side are shown. For PRAME TCR-T cells, n = 6; for CMV TCR-T cells, n = 4. Tumor growth in mice treated with PRAME or CMV-TCR T cells was compared for each time point using two-way ANOVA on log-transformed data followed by Bonferroni post-hoc analysis. Only significant results are shown (ANOVA = analysis of variance).
[0059] The patents, scientific and technical literature referred to in this specification establishes the knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of issued patents, published and pending patent applications, and other publications cited in this specification are incorporated herein by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of any conflict, the present disclosure will control.
[0060] Various aspects of the invention are described in further detail below. DETAILED DESCRIPTION OF THE INVENTION
[0061] Nucleic acid compositions encoding binding protein components Provided herein is an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, the composition comprising: (a) a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence; (b) a nucleic acid sequence encoding a TCR Vβ domain containing a CDR3 amino acid sequence; and the CDR3 sequences together specifically bind to a cancer-associated antigen (e.g., PRAME or CTCFL).
[0062] As will be apparent to those skilled in the art, the CDR3 amino acid sequences described herein specifically bind to their targets (i.e., the appropriate cancer-associated peptides) when those targets (in this case, cancer-associated peptides, e.g., PRAME or CTCFL peptides) are presented in the context of HLA. Thus, the binding proteins (and the CDR3 sequences specifically described herein) are capable of specifically binding to the appropriate cancer-associated peptide:HLA complexes. These complexes are described in more detail elsewhere herein.
[0063] The present invention provides isolated nucleic acid compositions encoding binding proteins comprising a T cell receptor (TCR) component that specifically bind to a cancer-associated antigen (e.g., a PRAME or CTCFL antigen). Thus, the encoded binding protein can specifically bind to a peptide containing the cancer-associated antigen (e.g., a PRAME antigen comprising an amino acid sequence selected from the group consisting of SEQ ID NO:43 and SEQ ID NO:44, or a CTCFL antigen comprising the amino acid sequence of SEQ ID NO:45), but does not bind to peptides that do not contain the cancer-associated antigen (e.g., the encoded binding protein does not bind to peptides that do not contain the cancer-associated antigen comprising an amino acid sequence selected from the group consisting of SEQ ID NO:43 to SEQ ID NO:45).
[0064] The nucleic acid composition comprises (a) a nucleic acid sequence encoding a TCR Vα domain having the particular characteristics described herein, and (b) a nucleic acid sequence encoding a TCR Vβ domain having the particular characteristics described herein, wherein the encoded TCR components form a cancer-associated antigen-specific binding protein.
[0065] The nucleic acid sequences (a) and (b) above may be separate nucleic acid sequences within the nucleic acid composition. Thus, the TCR components of the binding protein may be encoded by two (or more) nucleic acid sequences (having separate nucleotide sequences) that together encode all of the TCR components of the binding protein. In other words, some of the TCR components may be encoded by one nucleic acid sequence within the nucleic acid composition, and others may be encoded by another (separate) nucleic acid sequence within the nucleic acid composition.
[0066] Alternatively, the nucleic acid sequences of (a) and (b) may be part of a single nucleic acid sequence, and thus, all of the TCR components of the binding protein may be encoded by a single nucleic acid sequence (e.g., having a single open reading frame or having multiple (e.g., two or more, three or more, etc.) open reading frames).
[0067] The nucleic acid sequences described herein may form part of a larger nucleic acid sequence encoding a larger component portion of a functional binding protein. For example, a nucleic acid sequence encoding a TCR Vα domain having the particular characteristics described herein may be part of a larger nucleic acid sequence encoding a functional TCR α chain (including a constant domain). As another example, a nucleic acid sequence encoding a TCR Vβ domain having the particular characteristics described herein may be part of a larger nucleic acid sequence encoding a functional TCR β chain (including a constant domain). As a further example, both nucleic acid sequences (a) and (b) above may be part of a larger nucleic acid sequence encoding a combination of a functional TCR α chain (including a constant domain) and a functional TCR β chain (including a constant domain), optionally with the sequence encoding the functional TCR α chain separated from the sequence encoding the functional TCR β chain by a linker sequence that allows for coordinated expression of the two proteins or polypeptides in the same nucleic acid sequence. Further details on this are provided below.
[0068] Alternatively, the nucleic acid sequences described herein may encode only a small component of a T cell receptor, e.g., the TCR Vα domain or the TCR Vβ domain. This nucleic acid sequence may be considered a "building block" that provides the essential components for peptide binding specificity. The nucleic acid sequences described herein may be incorporated into separate nucleic acid sequences (e.g., vectors) encoding other elements of a functional binding protein, such as a TCR; thus, when the nucleic acid sequences described herein are incorporated, new nucleic acid sequences are generated that encode, for example, a TCR α chain and / or a TCR β chain that specifically binds to a cancer-associated antigen (e.g., the cancer-associated antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43 to 45). Thus, the nucleic acid sequences described herein have utility as essential components that confer binding specificity for a cancer-associated antigen and, therefore, can be used to generate larger nucleic acid sequences encoding binding proteins with the required antigen-binding activity and specificity.
[0069] The nucleic acid sequences described herein may be codon-optimized for expression in a host cell; for example, they may be codon-optimized for expression in human cells, such as cells of the immune system, induced pluripotent stem cells (iPSCs), hematopoietic stem cells, T cells, primary T cells, T cell lines, NK cells, or natural killer T cells (Scholten et al., Clin. Immunol. 119:135, 2006). The T cells may be CD4+ or CD8+ T cells. Codon optimization is a method well known in the art for maximizing expression of a nucleic acid sequence in a particular host cell. For example, one or more cysteine residues may be introduced into the encoded TCR alpha and beta chain components (e.g., to reduce the risk of mispairing with endogenous TCR chains).
[0070] In one example, the nucleic acid sequences described herein are codon-optimized for expression in a suitable host cell and / or modified to introduce codons encoding one or more cysteine amino acids (e.g., into the constant domains of the encoded TCR alpha chain and / or the encoded TCR beta chain) to reduce the risk of mispairing with endogenous TCR chains. In one example, the nucleic acid sequences described herein are codon-optimized for expression in a suitable host cell, optionally the host cell is a human cell.
[0071] In some instances, the TCR constant domain is modified to enhance desired TCR chain pairing. For example, enhanced pairing between a heterologous TCR α chain and a heterologous TCR β chain due to modification may result in preferential assembly of a TCR comprising two heterologous chains over undesired mispairing between the heterologous TCR chain and an endogenous TCR chain (see, e.g., Govers et al., Trends Mol. Med. 16(2):11(2010)). Exemplary modifications to enhance heterologous TCR chain pairing include the introduction of complementary cysteine residues in each of the heterologous TCR α chain and β chain.
[0072] The binding proteins encoded by the nucleic acid compositions described herein are specific for a cancer-associated antigen (e.g., PRAME or CTCFL) and comprise a cancer-associated antigen-specific TCR component. However, the encoded binding protein is not limited to being a TCR. Other suitable binding proteins comprising a TCR component specific for a particular cancer-associated antigen (e.g., PRAME or CTCFL) are also encompassed. For example, the encoded binding protein may comprise a TCR, an antigen-binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager, or an immTAC. TCRs, antigen-binding fragments thereof, CARs, T-engagers, and ImmTACs are well defined in the art.
[0073] Those skilled in the art will understand that in the context of the present invention, the antigen-binding fragment of a TCR may be linked to a further amino acid sequence, for example, to an antibody or nanobody or other protein or part of a DNA structure (DNA origami).
[0074] Non-limiting examples of antigen-binding fragments of TCRs are single-chain TCRs (scTCRs) or chimeric dimers composed of antigen-binding fragments of the TCR α and TCR β chains linked to the transmembrane and intracellular domains of a dimeric complex, such that the complex is a chimeric dimeric TCR (cdTCR). T-engagers and ImmTACs comprise a TCR linked to an anti-CD3 antibody. Thus, T-engagers and ImmTACs are bispecific, combining a cancer-associated antigen-recognizing TCR component with an immune activating complex.
[0075] In some examples, the antigen-binding fragment of a TCR comprises a single-chain TCR (scTCR), which comprises both the TCR Vα and TCR Vβ domains but only a single TCR constant domain. In other examples, the antigen-binding fragment of a TCR comprises a chimeric TCR dimer in which the antigen-binding fragment of a TCR is linked to alternative transmembrane and intracellular signaling domains, which alternative transmembrane and intracellular signaling domains are not naturally found in the TCR. In further examples, the antigen-binding fragment of a TCR or chimeric antigen receptor is chimeric (e.g., contains amino acid residues or motifs from multiple donors or species), humanized (e.g., contains residues from a non-human organism that have been altered or substituted to reduce the risk of immunogenicity in humans), or human.
[0076] "Chimeric antigen receptor" (CAR) refers to a fusion protein that is not naturally occurring or that has been engineered to contain two or more naturally occurring amino acid sequences linked to each other in a manner that does not naturally occur in a host cell, and which fusion protein is capable of functioning as a receptor when present on the surface of a cell. The CARs described herein comprise an extracellular portion comprising an antigen-binding domain (i.e., an antigen-binding domain obtained or derived from an immunoglobulin or immunoglobulin-like molecule, e.g., an scFv or TCR derived from an antibody specific for an antigen (e.g., a cancer antigen), or an antigen-binding domain derived or derived from a killer immune receptor from an NK cell), linked to a transmembrane domain and one or more intracellular signaling domains (optionally including a costimulatory domain) (see, e.g., Sadelain et al., Cancer Discov., 3(4):388 (2013); see also Harris and Kranz, Trends Pharmacol. Sci., 37(3):220 (2016); and Stone et al., Cancer Immunol Immunother., 63(11):1163 (2014)).
[0077] Methods for producing engineered TCRs are described, for example, in Bowerman et al., Mol. Immunol, 5(15):3000 (2009). Methods for producing CARs are well known in the art and are described, for example, in U.S. Pat. No. 6,410,319; U.S. Pat. No. 7,446,191; U.S. Patent Application Publication No. 2010 / 065818; U.S. Pat. No. 8,822,647; WO 2014 / 031687; U.S. Pat. No. 7,514,537; and Brentjens et al., 2007, Clin. Cancer Res. 73:5426.
[0078] The binding proteins described herein may be expressed as part of a transgene construct encoding additional accessory proteins, such as a safety switch protein, a tag, a selectable marker, the CD8 co-receptor beta chain, alpha chain or both, or any combination thereof.
[0079] T cell receptors (TCRs) are molecules found on the surface of T cells (T lymphocytes) that are responsible for recognizing peptides bound to (presented by) major histocompatibility complex (MHC) molecules on target cells. The present invention provides methods for identifying specific peptides in association with the appropriate serotype of MHC, i.e., HLA-A. * 24:02, HLA-B * 07:02 or HLA-A * The present invention relates to nucleic acid compositions encoding binding proteins comprising a TCR component that interacts with a cancer-associated antigen (e.g., PRAME or CTCFL) in the context of 02:01 (i.e., the encoded binding protein is capable of specifically binding to a cancer-associated antigen (e.g., PRAME or CTCFL):specific HLA complex). In one example, the present invention relates to nucleic acid compositions encoding specific peptides in the context of an appropriate serotype of MHC, i.e., HLA-A. * LYVDSLFFL (SEQ ID NO: 43) in association with 24:02, HLA-B * SPSVSQLSVL (SEQ ID NO: 44) in association with 07:02, or HLA-A *The present invention is directed to nucleic acid compositions encoding binding proteins comprising a TCR component that interacts with KLHGILVEA (SEQ ID NO: 45) in the context of 02:01.
[0080] HLA-A * 02:01 is a globally common human leukocyte antigen serotype within the HLA-A serogroup. * The peptides presented to the TCR by 02:01 are identified as HLA-A * 02:01 It is described as "restrictive."
[0081] HLA-A * 24:02 and HLA-B * 07:02 is also a common human leukocyte antigen serotype within the HLA-A and HLA-B serogroups. * The peptide presented to the TCR by 24:02 is "HLA-A * 24:02-restricted. * The peptide presented to the TCR by 07:02 is "HLA-B * 07:02 It is described as "restrictive."
[0082] HLA-A * 02:01 is referred to herein as HLA-A2 and HLA-B * 07:02 is also referred to herein as HLA-B7 and is a * 24:02 is also referred to herein as HLA-A24.
[0083] As described herein, the inventors have identified HLA-A * 24:02, HLA-B * 07:02 or HLA-A * We have identified several cancer-associated antigen (e.g., PRAME and CTCFL)-derived peptides that are presented on malignant cells at 02:01. Specifically, we have identified PRAME-derived peptides SEQ ID NO: 43 to SEQ ID NO: 44 and CTCFL-derived peptide SEQ ID NO: 45.
[0084] Thus, a cancer-associated antigen that is specifically bound by a binding protein described herein may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45. The antigen may be an antigenic fragment (i.e., portion) of an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 35, the antigen may consist of an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45, or the antigen may include (i.e., be contained within a longer sequence) an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45. The present inventors have demonstrated that the PRAME-derived peptide LYVDSLFFL (SEQ ID NO: 43) binds to HLA-A * 24:02, and that the PRAME-derived peptide SPSVSQLSVL (SEQ ID NO: 44) can be presented by HLA-B * 07:02, and that the CTCFL-derived peptide KLHGILVEA (SEQ ID NO: 45) can be presented by HLA-A * It was determined that it could be presented by 02:01.
[0085] Thus, in one example, the encoded binding protein is LYVDSLFFL:HLA-A * 24:02 Complex, SPSVSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * The peptide is capable of specifically binding to a peptide:HLA complex selected from the group consisting of 02:01 complexes.
[0086] In one example, the cancer-derived peptide (e.g., a PRAME-derived peptide or a CTCFL-derived peptide) of the peptide:HLA complex comprises an antigenic fragment of an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45. In a further example, the cancer-derived peptide (e.g., a PRAME-derived peptide or a CTCFL-derived peptide) of the peptide:HLA complex comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45.
[0087] TCRs are composed of two distinct polypeptide chains. In humans, 95% of TCRs consist of an alpha (α) chain and a beta (β) chain (encoded by TRA and TRB, respectively). TCRs are associated with HLA (e.g., HLA-A, as appropriate). * 24:02, HLA-B * 07:02 or HLA-A * When T cells engage with the peptide (in the context of 02:01), they are activated by signal transduction.
[0088] The alpha and beta chains of the TCR are highly variable in sequence. Each chain consists of two extracellular domains, a variable domain (V) and a constant domain (C). The constant domain is proximal to the T cell membrane and is followed by a transmembrane region and a short cytoplasmic tail, while the variable domain binds to the peptide / HLA complex.
[0089] Provided herein are isolated nucleic acid compositions encoding cancer-associated antigen-specific binding proteins having a TCR alpha chain variable (Valpha) domain and a TCR beta chain variable (Vbeta) domain. In one example, the nucleic acid compositions described herein may include a TCR alpha chain constant domain and / or a TCR beta chain constant domain.
[0090] The variable domain of each chain has three hypervariable regions (also called complementarity determining regions, CDRs). Thus, a TCR alpha variable domain (herein referred to as a TCR Vα domain, TCR V alpha domain, Vα domain or V alpha domain, alpha variable domain, etc.) comprises CDR1, CDR2, and CDR3 regions. Similarly, a TCR beta variable domain (herein referred to as a TCR Vβ domain, TCR V beta domain, Vβ domain or V beta domain, beta variable domain, etc.) also comprises (different) CDR1, CDR2, and CDR3 regions. In each of the alpha and beta variable domains, it is CDR3 that is primarily responsible for recognizing peptides presented by HLA molecules.
[0091] As will be apparent to those skilled in the art, the phrase "TCR alpha chain variable domain" refers to the variable (V) domain (extracellular domain) of the TCR alpha chain, and therefore includes the three hypervariable regions (CDR1, CDR2 and particular CDR3) and intervening sequences, but does not include the constant (C) domain of the alpha chain which does not form part of the variable domain.
[0092] As will be apparent to those skilled in the art, the phrase "TCR beta chain variable domain" refers to the variable (V) domain (extracellular domain) of the TCR beta chain, and therefore includes the three hypervariable regions (CDR1, CDR2 and specifically CDR3) and intervening sequences, but does not include the constant (C) domain of the beta chain which does not form part of the variable domain.
[0093] TCR component The isolated nucleic acid compositions described herein encode cancer-associated antigen-specific binding proteins (e.g., PRAME antigen-specific binding proteins or CTCFL antigen-specific binding proteins). As discussed herein, the inventors have identified several TCRs that specifically bind to cancer-associated antigens selected from LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44), and KLHGILVEA (SEQ ID NO: 45).
[0094] (i) TCR components that interact with LYVDSLFFL (SEQ ID NO: 43) from PRAME As provided elsewhere herein, the inventors have identified HLA-A * We identified TCR clone 16.3C1 (PRAME p365 A24 TCR) that interacts with LYVDSLFFL (SEQ ID NO: 43) in the context of 24:02. The sequences provided herein corresponding to TCR clone 16.3C1 are SEQ ID NO: 1 to SEQ ID NO: 14.
[0095] In one embodiment, an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein (i.e., a PRAME antigen-specific binding protein) having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, comprising: The nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 3 or a functional fragment thereof, and the nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 6 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to PRAME. Nucleic acid compositions are provided.
[0096] An example of a suitable TCR Vα domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular the PRAME antigen (e.g., LYVDSLFFL (SEQ ID NO: 43)), is set forth in SEQ ID NO: 3. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 3 may also be functional (i.e., when the CDR3 is part of a TCR Vα domain, may retain the ability to confer specific binding to a PRAME antigen (e.g., the peptide LYVDSLFFL (SEQ ID NO: 43))). Accordingly, such functional variants are encompassed by the present invention.
[0097] For example, a suitable (functional) Vα domain CDR3 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 3, i.e., the sequence may have at least 80%, at least 83%, at least 91%, or 100% sequence identity with SEQ ID NO: 3. Suitably, the percent identity is calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 3). In other words, a suitable (functional) Vα domain CDR3 amino acid sequence may differ from the sequence shown in SEQ ID NO: 3 by one or a few (e.g., two) amino acids.
[0098] As noted above, functional variants of SEQ ID NO: 3 retain the ability to confer specific binding to the PRAME antigen (e.g., the peptide shown in SEQ ID NO: 43) when the CDR3 is part of the TCR Vα domain.
[0099] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 3. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO: 3, or substitutions, deletions or insertions of non-critical amino acids in non-critical regions of CDR3.
[0100] Non-functional variants are amino acid sequence variants of SEQ ID NO: 3 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 3, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0101] In one example, the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 3. In examples where the TCR Vα domain CDR3 has the amino acid sequence of SEQ ID NO: 3, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0102] The encoded TCR Vα domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO: 1 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43)). Such functional variants may be naturally occurring functional variants of SEQ ID NO: 1, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 1, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0103] Non-functional variants are amino acid sequence variants of SEQ ID NO: 1 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 1, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0104] For example, a suitable functional Vα domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 1, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 1. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 1). In other words, a suitable functional Vα domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 1 by one or a few amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 1. As mentioned above, functional variants of SEQ ID NO: 1 retain the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43) when CDR1 is part of a TCR Vα domain.
[0105] In one example, the CDR1 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 1. In examples where the TCR Vα domain CDR1 has the amino acid sequence of SEQ ID NO: 1, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0106] The encoded TCR Vα domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 comprising the amino acid sequence of SEQ ID NO: 2 or a functional variant thereof (i.e., this variant is HLA-A * 24:02)。 Such functional variants may be naturally occurring functional variants, synthetic functional variants, or synthetically improved functional variants of SEQ ID NO: 2. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 2, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0107] Non-functional variants include HLA-A * 24:02. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 2, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0108] For example, a suitable functional Vα domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO:2, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO:2. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO:2). In other words, a suitable (functional) Vα domain CDR2 amino acid sequence may differ from the sequence shown in SEQ ID NO:2 by one or a few amino acids. As mentioned above, variants may contain amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence shown in SEQ ID NO:2. As mentioned above, functional variants of SEQ ID NO:2 may be used to identify HLA-A * It retains the ability to specifically bind to 24:02.
[0109] In one example, the CDR2 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 2. In examples where the TCR Vα domain CDR2 has the amino acid sequence of SEQ ID NO: 2, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0110] The encoded TCR Vα domain may therefore comprise the CDRs detailed above (specifically by SEQ ID NO:3, SEQ ID NO:1 and SEQ ID NO:2, or functional variants thereof), together with appropriate intervening sequences between the CDRs.
[0111] The encoded TCR Vα domain may comprise the amino acid sequence of SEQ ID NO:7 or a functional variant thereof (i.e., this variant TCR Vα domain, when part of a binding protein described herein, retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:43)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:7. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:7, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0112] Non-functional variants are amino acid sequence variants of SEQ ID NO: 7 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 7, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0113] In one example, the encoded TCR Vα domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:7, while retaining the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:43). In other words, functional TCR Vα domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO:7 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. Any sequence variability compared to SEQ ID NO:7 may be in regions of the TCR Vα domain that do not form CDRs (i.e., a variant may have the CDRs of SEQ ID NO:3, SEQ ID NO:1, and / or SEQ ID NO:2 and still have 25% (or less) sequence variability compared to SEQ ID NO:7). In other words, the sequence of the CDRs of SEQ ID NO: 7 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 7).
[0114] As an example, the encoded TCR Vα domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 7, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 3. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO: 1, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO: 2.
[0115] As another example, the encoded TCR Vα domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO:7 with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO:3. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO:1, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO:2.
[0116] In an example where the TCR Vα domain has the amino acid sequence of SEQ ID NO: 7, the TCR Vα domain may be encoded by the nucleic acid sequence of SEQ ID NO: 8 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0117] The phrase "a genetically degenerate sequence thereof" is used interchangeably herein with "a derivative thereof."
[0118] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Vα domain may also encode a TCR α chain constant domain. An example of a suitable constant domain (for either the TCR α chain or the TCR β chain) is encoded in the MP71-TCR-flex retroviral vector. However, the present invention is not limited to this particular constant domain and encompasses any suitable TCR α chain constant domain. The constant domain may be of murine or human origin, or may be humanized. Methods for identifying or generating suitable constant domains are well known to, and within the routine capabilities of, those skilled in the art.
[0119] By way of example only, the constant domain may be encoded by or derived from a vector, such as a lentiviral, retroviral, or plasmid vector, or even an adenoviral, adeno-associated, vaccinia, canarypox, or herpesvirus vector into which a mouse or human constant domain has been pre-cloned. Recently, minicircles have also been described for TCR gene transfer (non-viral Sleeping Beauty transposition from a minicircle vector, published by R Monjezi et al., 2017). Furthermore, naked (synthetic) DNA / RNA can also be used to introduce TCRs. For example, the pMSGV retroviral vector with pre-cloned TCR-Ca and Cb genes, described by LV Coren et al., BioTechniques 2015, may be used to provide the appropriate constant domain. Alternatively, single- or double-stranded DNA or RNA can be inserted into the TCR locus by homology-directed repair (see Roth et al., 2018 Nature 559:405). As a further option, non-homologous end joining is possible.
[0120] An example of a specific TCR α chain amino acid sequence comprising the TCR Vα domain described herein together with an appropriate constant domain is set forth in SEQ ID NO: 11. Suitable functional variants of SEQ ID NO: 11 are also encompassed (e.g., variants having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 11, which variant TCR α chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43)). In other words, functional TCR α chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 11 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All sequence variability compared to SEQ ID NO: 11 may be in regions of the TCR alpha chain that do not form the CDRs (i.e. a variant may have the CDRs of SEQ ID NO: 3, SEQ ID NO: 1 and / or SEQ ID NO: 2 and still have 25% (or less) sequence variability compared to SEQ ID NO: 11). In other words, the sequence of the CDRs of SEQ ID NO: 11 may be retained while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g. SEQ ID NO: 11).
[0121] By way of example, the encoded TCR alpha chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 11, and the TCR alpha chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 3. In this example, the TCR alpha chain CDR1 may have the amino acid sequence of SEQ ID NO: 1, and the TCR alpha chain CDR2 may have the amino acid sequence of SEQ ID NO: 2.
[0122] In the example where the TCR alpha chain has the amino acid sequence of SEQ ID NO: 11, the TCR alpha chain may be encoded by the nucleic acid sequence of SEQ ID NO: 12 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 12 is the nucleic acid sequence of the TCR alpha chain of clone 16.3C1 (PRAME p365 A24 TCR).
[0123] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof.
[0124] In another example, the CDR3 of the Vα domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:3.
[0125] In another example, the Vα domain of the nucleic acid compositions provided herein comprises an amino acid sequence that has at least 80% sequence identity with, includes, or consists of SEQ ID NO:7.
[0126] As mentioned above, the present inventors have * We identified TCR clone 16.3C1 (PRAME p365 A24 TCR) that interacts with LYVDSLFFL (SEQ ID NO: 43) in the context of 24:02. The sequences provided herein corresponding to TCR clone 16.3C1 are SEQ ID NO: 1 to SEQ ID NO: 14.
[0127] Thus, an example of a suitable TCR Vβ domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular the PRAME antigen (e.g., LYVDSLFFL (SEQ ID NO: 43)), is set forth in SEQ ID NO: 6. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 6 may also be functional (i.e., when the CDR3 is part of a TCR Vβ domain, retain the ability to confer specific binding to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43)). Accordingly, such functional variants are encompassed by the present invention.
[0128] For example, suitable (functional) Vβ domain CDR3 amino acid sequences may have at least 80% sequence identity with SEQ ID NO: 6, i.e., they may have at least 80%, at least 84%, at least 92%, or 100% sequence identity with SEQ ID NO: 6. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 6). In other words, suitable (functional) Vβ domain CDR3 amino acid sequences may differ from the sequence set forth in SEQ ID NO: 6 by one or a few (e.g., two) amino acids. As mentioned above, functional variants of SEQ ID NO: 6 retain the ability to confer specific binding to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43) when the CDR3 is part of a TCR Vβ domain.
[0129] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 6. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 6, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of CDR3.
[0130] Non-functional variants are amino acid sequence variants of SEQ ID NO: 6 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 6, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0131] In one example, the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 6. In examples where the TCR Vβ domain CDR3 has the amino acid sequence of SEQ ID NO: 6, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0132] The encoded TCR Vβ domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO: 4 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43)). Such functional variants may be naturally occurring functional variants of SEQ ID NO: 4, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 4, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0133] Non-functional variants are amino acid sequence variants of SEQ ID NO: 4 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 4, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0134] For example, a suitable functional Vβ domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 4, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 4. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 4). In other words, a suitable (functional) Vβ domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 4 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 4. As mentioned above, functional variants of SEQ ID NO: 4 retain the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43) when CDR1 is part of a TCR Vβ domain.
[0135] In one example, the CDR1 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 4. In examples where the TCR Vα domain CDR1 has the amino acid sequence of SEQ ID NO: 4, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0136] The encoded TCR Vβ domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 having the amino acid sequence of SEQ ID NO: 5 or a functional variant thereof (i.e., this variant is associated with HLA-A * 24:02)。 Such functional variants may be naturally occurring functional variants, synthetic functional variants, or synthetically improved functional variants of SEQ ID NO: 5. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 5, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0137] Non-functional variants include HLA-A *24:02. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 5, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0138] For example, a suitable functional Vβ domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 5, i.e., the sequence may have at least 80%, at least 83%, or 100% sequence identity with SEQ ID NO: 5. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 5). In other words, a suitable (functional) Vβ domain CDR2 amino acid sequence may differ from the sequence shown in SEQ ID NO: 5 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence shown in SEQ ID NO: 5. As mentioned above, functional variants of SEQ ID NO: 5 may be used to identify HLA-A * It retains the ability to specifically bind to 24:02.
[0139] In one example, the CDR2 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 5. In examples where the TCR Vβ domain CDR2 has the amino acid sequence of SEQ ID NO: 5, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0140] The encoded TCR Vβ domain may therefore comprise the CDRs referred to in detail above (specifically by SEQ ID NO: 6, SEQ ID NO: 4 and SEQ ID NO: 5, or functional variants thereof), together with appropriate intervening sequences between the CDRs.
[0141] The encoded TCR Vβ domain may have the amino acid sequence of SEQ ID NO:9 or a functional variant thereof (i.e., this variant TCR Vβ domain, when part of a binding protein described herein, retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:43)). Such functional variants may be naturally occurring functional variants of SEQ ID NO:9, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:9, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0142] Non-functional variants are amino acid sequence variants of SEQ ID NO: 9 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 9, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0143] In one example, the encoded TCR Vβ domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:9, while retaining the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:43). In other words, functional TCR Vβ domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO:9 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO:9 may be in regions of the TCR Vβ domain that do not form CDRs (i.e., a variant may have the CDRs of SEQ ID NO:6, SEQ ID NO:4, and / or SEQ ID NO:5 and still have 25% (or less) sequence variability compared to SEQ ID NO:9). In other words, the sequence of the CDRs of SEQ ID NO: 9 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 9).
[0144] By way of example, the encoded TCR Vβ domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 9, and the TCR Vβ domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 6. In this example, the TCR Vβ domain CDR1 may have the amino acid sequence of SEQ ID NO: 4, and the TCR Vβ domain CDR2 may have the amino acid sequence of SEQ ID NO: 5.
[0145] In the example where the TCR Vβ domain has the amino acid sequence of SEQ ID NO: 9, the TCR Vβ domain may be encoded by the nucleic acid sequence of SEQ ID NO: 10 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0146] For the avoidance of doubt, a nucleic acid sequence encoding a TCR Vβ domain may also encode a TCR β chain constant domain. Examples of suitable constant domains are generally discussed above.
[0147] An example of a specific TCR β chain amino acid sequence comprising the TCR Vβ domain and a suitable constant domain described herein is set forth in SEQ ID NO: 13. Suitable functional variants of SEQ ID NO: 13 (e.g., a variant having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 13, which variant TCR β chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 43)) are also encompassed. In other words, functional TCR β chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 13 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO: 13 may be in regions of the TCR β chain that do not form the CDRs (i.e., a variant may have the CDRs of SEQ ID NO: 6, SEQ ID NO: 4 and / or SEQ ID NO: 5 and still have 25% (or less) sequence variability compared to SEQ ID NO: 13). In other words, the sequence of the CDRs of SEQ ID NO: 13 may be retained, while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g., SEQ ID NO: 13).
[0148] By way of example, the encoded TCR β chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 13, and the TCR β chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 6. In this example, the TCR β chain CDR1 may have the amino acid sequence of SEQ ID NO: 4, and the TCR β chain CDR2 may have the amino acid sequence of SEQ ID NO: 5.
[0149] In the example where the TCR β chain has the amino acid sequence of SEQ ID NO: 13, the TCR β chain may be encoded by the nucleic acid sequence of SEQ ID NO: 14 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 14 is the nucleic acid sequence of the TCR β chain of clone 16.3C1 (PRAME p365 A24 TCR).
[0150] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:6, or a functional fragment thereof.
[0151] In another example, the CDR3 of the Vβ domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:6.
[0152] In a further example, the Vβ domain of the nucleic acid compositions provided herein comprises an amino acid sequence that has at least 80% sequence identity with, includes, or consists of SEQ ID NO:9.
[0153] The TCR Vβ domain sequences derived from TCR clone 16.3C1 discussed above are particularly compatible with the TCR Vα domain sequences derived from TCR clone 16.3C1 discussed elsewhere herein.
[0154] Thus, in one example, the nucleic acid composition described herein encodes a PRAME antigen-specific binding protein having a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:6, or a functional fragment thereof.
[0155] In particular examples, the nucleic acid compositions described herein encode a PRAME antigen-specific binding protein having a TCR Vα domain with a CDR3 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 3 and a TCR Vβ domain with a CDR3 that comprises or consists of the amino acid sequence of SEQ ID NO: 6. Furthermore, the PRAME antigen may comprise or consist of the sequence set forth in SEQ ID NO: 43. Furthermore, the TCR Vα domain may be part of a TCR α chain having a constant domain, and the TCR Vβ domain may be part of a TCR β chain having a constant domain.
[0156] In this particular example, the Vα domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO:7, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO:9. In one example, the Vα domain comprises the amino acid sequence of SEQ ID NO:7 and the Vβ domain comprises the amino acid sequence of SEQ ID NO:9. In such a case, the Vα domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO:8, and the Vβ domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO:10.
[0157] In this particular example, the TCR Vα domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 1 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 2. Additionally, the TCR Vβ domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 4 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 5. For the avoidance of doubt, this particular example encompasses the components of TCR clone 16.3C1 exemplified herein. The different components of TCR clone 16.3C1 and their respective SEQ ID NOs are summarised in Table 4 below.
[0158] As described in more detail elsewhere herein, the nucleic acid compositions described herein encode both a TCR Vα domain and a TCR Vβ domain that form a binding protein capable of specifically binding to a cancer-associated antigen. In instances where the TCR Vα domain and the TCR Vβ domain are encoded by the same nucleic acid sequence, the TCR Vα domain and the TCR Vβ domain may be linked to each other via a linker, e.g., a linker that allows expression of the two proteins or polypeptides from the same vector. By way of example, a linker comprising the porcine teschovirus-1 2A (P2A) sequence, such as that published by ALSzymczak et al., Nature Biotechnology 22, 589-594 (2004), a 2A sequence from, e.g., foot-and-mouth disease virus (F2A), equine rhinitis A virus (E2A), or Thosea asigna virus (T2A), or a 2A-like sequence, may be used. The 2A and 2A-like sequences are linkers that are cleavable once the nucleic acid molecule is transcribed and translated. Another example of a linker is an internal ribosomal entry site (IRES), which allows translation of two proteins or polypeptides from the same transcript. Any other suitable linker may also be used. As a further example, a nucleic acid sequence encoding a TCR Vα domain and a nucleic acid sequence encoding a TCR Vβ domain may be cloned into a vector with dual internal promoters (see, for example, S Jones et al., Human Gene Ther 2009). Identifying suitable linkers and vectors that allow expression of both the TCR Vα domain and the TCR Vβ domain is within the routine capabilities of one skilled in the art.
[0159] Additional suitable polypeptide domains may also be encoded by the nucleic acid sequence encoding the TCR Vα domain and / or the TCR Vβ domain. By way of example only, the nucleic acid sequence may include a membrane targeting sequence that provides for transport of the encoded polypeptide to the cell surface membrane of the modified cell. Other suitable additional domains are known and are described, for example, in WO 2016 / 071758.
[0160] In one example, the nucleic acid composition described herein may encode a soluble TCR. For example, the nucleic acid composition may encode the variable domains of the TCR alpha and beta chains, respectively, along with an immune modulator molecule such as a CD3 agonist (e.g., an anti-CD3 scFv). The CD3 antigen is present on a subset of mature human T cells, thymocytes, and natural killer cells. It associates with the TCR and is involved in TCR signaling. Antibodies specific for the human CD3 antigen are well known. One such antibody is the murine monoclonal antibody OKT3, which was the first monoclonal antibody approved by the FDA. Other antibodies specific for CD3 have also been reported (see, e.g., WO 2004 / 106380, U.S. 2004 / 0202657, and U.S. Pat. No. 6,750,325). Immune mobilizing mTCR Against Cancer (ImmTAC; Immunocore Limited, Milton Park, Abington, Oxfordshire, UK) is a bifunctional protein that combines affinity monoclonal T cell receptor (mTCR) targeting with a therapeutic mechanism of action (i.e., anti-CD3 scFv). In another example, the soluble TCR of the present invention may be combined with a radioisotope or a toxic drug. Suitable radioisotopes and / or toxic drugs are well known in the art and readily identifiable by those skilled in the art.
[0161] In one example, the nucleic acid composition may encode a chimeric single-chain TCR in which a TCR alpha chain variable domain is linked to a TCR beta chain variable domain and a constant domain fused to, for example, a CD3ζ signaling domain. In this example, the linker is not cleavable. In an alternative embodiment, the nucleic acid composition may encode a chimeric two-chain TCR in which a TCR alpha chain variable domain and a TCR beta chain variable domain are each linked to a CD3ζ signaling domain or other transmembrane and intracellular domain. Methods for preparing such single-chain and two-chain TCRs are well known in the art; see, for example, RA Willemsen et al., Gene Therapy 2000.
[0162] (ii) TCR components that interact with SPSVSQLSVL (SEQ ID NO: 44) from PRAME As provided elsewhere herein, the inventors have identified HLA-B * We also identified TCR clone 8.10C4 (PRAME p359 B7 TCR), which interacts with SPSVSQLSVL (SEQ ID NO: 44) in the context of 07:02. The sequences provided herein corresponding to TCR clone 8.10C4 are SEQ ID NO: 15 to SEQ ID NO: 28.
[0163] In one embodiment, an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein (i.e., a PRAME antigen-specific binding protein) having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, comprising: The nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 17 or a functional fragment thereof, and the nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 20 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to PRAME. Nucleic acid compositions are provided.
[0164] Thus, another example of a suitable TCR Vα domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular a PRAME antigen (e.g., SPSVSQLSVL (SEQ ID NO: 44)), is set forth in SEQ ID NO: 17. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 17 may also be functional (i.e., when the CDR3 is part of a TCR Vα domain, may retain the ability to confer specific binding to a PRAME antigen (e.g., the peptide SPSVSQLSVL (SEQ ID NO: 44))). Accordingly, such functional variants are encompassed by the present invention.
[0165] For example, suitable (functional) Vα domain CDR3 amino acid sequences may have at least 80% sequence identity with SEQ ID NO: 17, i.e., they may have at least 80%, at least 81%, at least 90%, or 100% sequence identity with SEQ ID NO: 17. Suitably, the percent identity is calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 17). In other words, suitable (functional) Vα domain CDR3 amino acid sequences may differ from the sequence shown in SEQ ID NO: 17 by one or several (e.g., two, etc.) amino acids.
[0166] As noted above, functional variants of SEQ ID NO: 17 retain the ability to confer specific binding to the PRAME antigen (e.g., the peptide shown in SEQ ID NO: 44) when the CDR3 is part of the TCR Vα domain.
[0167] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 17. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO: 17, or substitutions, deletions or insertions of non-critical amino acids in non-critical regions of CDR3.
[0168] Non-functional variants are amino acid sequence variants of SEQ ID NO: 17 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 17, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art. In one example, the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 17. In examples where the TCR Vα domain CDR3 has the amino acid sequence of SEQ ID NO: 17, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0169] The encoded TCR Vα domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO: 15 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 15. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 15, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0170] Non-functional variants are amino acid sequence variants of SEQ ID NO: 15 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 15, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0171] For example, a suitable functional Vα domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 15, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 15. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 15). In other words, a suitable functional Vα domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 15 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 15. As mentioned above, functional variants of SEQ ID NO: 15 retain the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44) when CDR1 is part of a TCR Vα domain.
[0172] In one example, the CDR1 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 15. In examples where the TCR Vα domain CDR1 has the amino acid sequence of SEQ ID NO: 15, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0173] The encoded TCR Vα domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 comprising the amino acid sequence of SEQ ID NO: 16 or a functional variant thereof (i.e., this variant is HLA-B * 07:02)。 Such functional variants may be naturally occurring functional variants, synthetic functional variants, or synthetically improved functional variants of SEQ ID NO: 16. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 16, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0174] Non-functional variants include HLA-B *07:02. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 16, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0175] For example, a suitable functional Vα domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 16, i.e., the sequence may have at least 80%, at least 85%, or 100% sequence identity with SEQ ID NO: 16. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 16). In other words, a suitable (functional) Vα domain CDR2 amino acid sequence may differ from the sequence shown in SEQ ID NO: 16 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence shown in SEQ ID NO: 16. As mentioned above, functional variants of SEQ ID NO: 16 may be used to identify HLA-B * Retains the ability to specifically bind to 07:02.
[0176] In one example, the CDR2 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 16. In examples where the TCR Vα domain CDR2 has the amino acid sequence of SEQ ID NO: 16, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0177] The encoded TCR Vα domain may therefore comprise the CDRs referred to in detail above (specifically by SEQ ID NO: 17, SEQ ID NO: 15 and SEQ ID NO: 16, or functional variants thereof), together with appropriate intervening sequences between the CDRs.
[0178] The encoded TCR Vα domain may comprise the amino acid sequence of SEQ ID NO:21 or a functional variant thereof (i.e., this variant TCR Vα domain, when part of a binding protein described herein, retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:44)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:21. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:21, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0179] Non-functional variants are amino acid sequence variants of SEQ ID NO: 21 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 21, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art. In one example, the encoded TCR Vα domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:21, while retaining the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:44). In other words, functional TCR Vα domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO:21 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO:21 may be in regions of the TCR Vα domain that do not form the CDRs (i.e., a variant may have the CDRs of SEQ ID NO:17, SEQ ID NO:15, and / or SEQ ID NO:16 and still have 25% (or less) sequence variability compared to SEQ ID NO:21). In other words, the sequence of the CDRs of SEQ ID NO: 21 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 21).
[0180] By way of example, the encoded TCR Vα domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 21, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 17. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO: 15, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO: 16.
[0181] As another example, the encoded TCR Vα domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO: 21 with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 17. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO: 15, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO: 16.
[0182] In the example where the TCR Vα domain has the amino acid sequence of SEQ ID NO: 21, the TCR Vα domain may be encoded by the nucleic acid sequence of SEQ ID NO: 22 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0183] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Vα domain may also encode a TCR α chain constant domain. Examples of suitable constant domains are generally discussed above.
[0184] An example of a specific TCR α chain amino acid sequence comprising the TCR Vα domain described herein together with an appropriate constant domain is set forth in SEQ ID NO: 25. Suitable functional variants of SEQ ID NO: 25 are also encompassed (e.g., variants having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 25, which variant TCR α chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44)). In other words, functional TCR α chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 25 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All sequence variability compared to SEQ ID NO:25 may be in regions of the TCR alpha chain that do not form the CDRs (i.e. a variant may have the CDRs of SEQ ID NO:17, SEQ ID NO:15 and / or SEQ ID NO:16 and still have 25% (or less) sequence variability compared to SEQ ID NO:25). In other words, the sequences of the CDRs of SEQ ID NO:25 may be retained while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g. SEQ ID NO:25).
[0185] As an example, the encoded TCR alpha chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 25, and the TCR alpha chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 17. In this example, the TCR alpha chain CDR1 may have the amino acid sequence of SEQ ID NO: 15, and the TCR alpha chain CDR2 may have the amino acid sequence of SEQ ID NO: 16.
[0186] In the example where the TCR alpha chain has the amino acid sequence of SEQ ID NO: 25, the TCR alpha chain may be encoded by the nucleic acid sequence of SEQ ID NO: 26 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 26 is the nucleic acid sequence of the TCR alpha chain of clone 8.10C4.
[0187] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof. In another example, the CDR3 of the Vα domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:17.
[0188] In another example, the Vα domain of the nucleic acid compositions provided herein comprises an amino acid sequence that has at least 80% sequence identity with, includes, or consists of SEQ ID NO:21.
[0189] As provided elsewhere herein, the inventors have identified HLA-B * TCR clone 8.10C4 was identified that interacts with SPSVSQLSVL (SEQ ID NO: 44) in the context of 07:02. The sequences provided herein corresponding to TCR clone 8.10C4 are SEQ ID NO: 15 to SEQ ID NO: 28.
[0190] An example of a suitable TCR Vβ domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular the PRAME antigen (e.g., SPSVSQLSVL (SEQ ID NO: 44)), is set forth in SEQ ID NO: 20. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 20 may also be functional (i.e., when the CDR3 is part of a TCR Vβ domain, retain the ability to confer specific binding to the PRAME antigen (i.e., the peptide set forth in SEQ ID NO: 44)). Accordingly, such functional variants are encompassed by the present invention.
[0191] For example, suitable (functional) Vβ domain CDR3 amino acid sequences may have at least 80% sequence identity with SEQ ID NO: 20, i.e., they may have at least 80%, at least 85%, at least 92%, or 100% sequence identity with SEQ ID NO: 20. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 20). In other words, suitable (functional) Vβ domain CDR3 amino acid sequences may differ from the sequence set forth in SEQ ID NO: 20 by one or a few (e.g., two) amino acids. As mentioned above, functional variants of SEQ ID NO: 20 retain the ability to confer specific binding to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44) when the CDR3 is part of a TCR Vβ domain.
[0192] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 20. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 20, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of CDR3.
[0193] Non-functional variants are amino acid sequence variants of SEQ ID NO: 20 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 20, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0194] In one example, the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 20. In examples where the TCR Vβ domain CDR3 has the amino acid sequence of SEQ ID NO: 20, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0195] The encoded TCR Vβ domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO: 18 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44)). Such functional variants may be naturally occurring functional variants of SEQ ID NO: 18, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 18, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0196] Non-functional variants are amino acid sequence variants of SEQ ID NO: 18 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 18, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0197] For example, a suitable functional Vβ domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 18, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 18. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 18). In other words, a suitable (functional) Vβ domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 18 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 18. As mentioned above, functional variants of SEQ ID NO: 18 retain the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44) when CDR1 is part of a TCR Vβ domain.
[0198] In one example, the CDR1 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 18. In examples where the TCR Vα domain CDR1 has the amino acid sequence of SEQ ID NO: 18, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0199] The encoded TCR Vβ domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 having the amino acid sequence of SEQ ID NO: 19 or a functional variant thereof (i.e., this variant is associated with HLA-B * 07:02). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 19. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 19, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0200] Non-functional variants include HLA-B * 07:02. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 19, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0201] For example, a suitable functional Vβ domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 19, i.e., the sequence may have at least 80%, at least 83%, or 100% sequence identity with SEQ ID NO: 19. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 19). In other words, a suitable (functional) Vβ domain CDR2 amino acid sequence may differ from the sequence shown in SEQ ID NO: 19 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence shown in SEQ ID NO: 19. As mentioned above, functional variants of SEQ ID NO: 19 may be used to identify HLA-B * Retains the ability to specifically bind to 07:02.
[0202] In one example, the CDR2 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 19. In examples where the TCR Vβ domain CDR2 has the amino acid sequence of SEQ ID NO: 19, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0203] The encoded TCR Vβ domain may therefore comprise the CDRs referred to in detail above (specifically by SEQ ID NO:20, SEQ ID NO:18 and SEQ ID NO:19, or functional variants thereof), together with appropriate intervening sequences between the CDRs. The encoded TCR Vβ domain may have the amino acid sequence of SEQ ID NO:23 or a functional variant thereof (i.e., this variant TCR Vβ domain, when part of a binding protein described herein, retains the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:44)). Such functional variants may be naturally occurring functional variants of SEQ ID NO:23, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:23, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0204] Non-functional variants are amino acid sequence variants of SEQ ID NO: 23 that do not specifically bind to the PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 23, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0205] In one example, the encoded TCR Vβ domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:23, while retaining the ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO:44). In other words, functional TCR Vβ domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO:23 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO:23 may be in regions of the TCR Vβ domain that do not form CDRs (i.e., a variant may have the CDRs of SEQ ID NO:20, SEQ ID NO:18, and / or SEQ ID NO:19 and still have 25% (or less) sequence variability compared to SEQ ID NO:23). In other words, the sequence of the CDRs of SEQ ID NO: 23 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 23).
[0206] By way of example, the encoded TCR Vβ domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 23, and the TCR Vβ domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 20. In this example, the TCR Vβ domain CDR1 may have the amino acid sequence of SEQ ID NO: 18, and the TCR Vβ domain CDR2 may have the amino acid sequence of SEQ ID NO: 19.
[0207] In the example where the TCR Vβ domain has the amino acid sequence of SEQ ID NO: 23, the TCR Vβ domain may be encoded by the nucleic acid sequence of SEQ ID NO: 24 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0208] For the avoidance of doubt, a nucleic acid sequence encoding a TCR Vβ domain may also encode a TCR β chain constant domain. Examples of suitable constant domains are generally discussed above.
[0209] An example of a specific TCR β chain amino acid sequence comprising the TCR Vβ domain and a suitable constant domain described herein is set forth in SEQ ID NO: 27. Suitable functional variants of SEQ ID NO: 27 (e.g., a variant having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 27, which variant TCR β chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a PRAME antigen (e.g., the peptide set forth in SEQ ID NO: 44)) are also encompassed. In other words, functional TCR β chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 27 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO:27 may be in regions of the TCR beta chain that do not form the CDRs (i.e., a variant may have the CDRs of SEQ ID NO:20, SEQ ID NO:18 and / or SEQ ID NO:19 and still have 25% (or less) sequence variability compared to SEQ ID NO:27). In other words, the sequences of the CDRs of SEQ ID NO:27 may be retained, while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g., SEQ ID NO:27).
[0210] By way of example, the encoded TCR β chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 27, and the TCR β chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 20. In this example, the TCR β chain CDR1 may have the amino acid sequence of SEQ ID NO: 18, and the TCR β chain CDR2 may have the amino acid sequence of SEQ ID NO: 19.
[0211] In the example where the TCR β chain has the amino acid sequence of SEQ ID NO: 27, the TCR β chain may be encoded by the nucleic acid sequence of SEQ ID NO: 28 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 28 is the nucleic acid sequence of the TCR β chain of clone 8.10C4.
[0212] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20, or a functional fragment thereof.
[0213] In another example, the CDR3 of the Vβ domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:20.
[0214] In a further example, the Vβ domain of the nucleic acid compositions provided herein comprises an amino acid sequence having at least 80% sequence identity to, including, or consisting of SEQ ID NO:23.
[0215] The TCR Vβ domain sequences derived from TCR clone 8.10C4 discussed above are particularly compatible with the TCR Vα domain sequences derived from TCR clone 8.10C4 discussed elsewhere herein.
[0216] Thus, in one example, the nucleic acid composition described herein encodes a PRAME antigen-specific binding protein having a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20, or a functional fragment thereof.
[0217] In particular examples, the nucleic acid compositions described herein encode a PRAME antigen-specific binding protein having a TCR Vα domain with a CDR3 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 17 and a TCR Vβ domain with a CDR3 that comprises or consists of the amino acid sequence of SEQ ID NO: 20. Furthermore, the PRAME antigen may comprise or consist of the sequence set forth in SEQ ID NO: 44. Furthermore, the TCR Vα domain may be part of a TCR α chain having a constant domain, and the TCR Vβ domain may be part of a TCR β chain having a constant domain.
[0218] In this particular example, the Vα domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 21, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 23. In one example, the Vα domain comprises the amino acid sequence of SEQ ID NO: 21 and the Vβ domain comprises the amino acid sequence of SEQ ID NO: 23. In such a case, the Vα domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 22, and the Vβ domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 24.
[0219] In this particular example, the TCR Vα domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 15 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 16. Additionally, the TCR Vβ domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 18 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 19.
[0220] For the avoidance of doubt, this particular example encompasses the components of TCR clone 8.10C4 exemplified herein. The different components of TCR clone 8.10C4 and their respective SEQ ID NOs are summarised in Table 5 below.
[0221] As described in more detail elsewhere herein, the nucleic acid compositions described herein encode both a TCR Vα domain and a TCR Vβ domain that form a binding protein capable of specifically binding to a cancer-associated antigen. In instances where the TCR Vα domain and the TCR Vβ domain are encoded by the same nucleic acid sequence, the TCR Vα domain and the TCR Vβ domain may be linked to each other via a linker. Suitable linkers are generally discussed elsewhere herein. Additional suitable polypeptide domains that may also be encoded by the nucleic acid sequences encoding the TCR Vα domain and / or the TCR Vβ domain are also generally discussed elsewhere herein.
[0222] In one example, the nucleic acid compositions described herein may encode a soluble TCR, or a chimeric single chain TCR in which a TCR alpha chain variable domain is linked to a TCR beta chain variable domain and a constant domain fused to, for example, a CD3 zeta signaling domain, as generally discussed in more detail elsewhere herein.
[0223] (iii) TCR components that interact with KLHGILVEA (SEQ ID NO: 45) from CTCFL As provided elsewhere herein, the inventors have identified HLA-A * We also identified TCR clone 39.2E12 (CTCFL p752A2 TCR), which interacts with KLHGILVEA (SEQ ID NO: 45) in the context of 02:01. The sequences provided herein corresponding to TCR clone 39.2E12 are SEQ ID NO: 29 through SEQ ID NO: 42. In one embodiment, an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein (i.e., a CTCFL antigen-specific binding protein) having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, comprising: The nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 31 or a functional fragment thereof, and the nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 34 or a functional fragment thereof, wherein both CDR3 sequences specifically bind to CTCFL. Nucleic acid compositions are provided.
[0224] An example of a suitable TCR Vα domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular the CTCFL antigen (e.g., KLHGILVEA (SEQ ID NO: 45)), is set forth in SEQ ID NO: 31. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 31 may also be functional (i.e., when the CDR3 is part of a TCR Vα domain, retain the ability to confer specific binding to the CTCFL antigen (e.g., the peptide KLHGILVEA (SEQ ID NO: 45))). Accordingly, such functional variants are encompassed by the present invention.
[0225] For example, suitable (functional) Vα domain CDR3 amino acid sequences may have at least 80% sequence identity with SEQ ID NO: 31, i.e. they may have at least 80%, at least 85%, at least 92%, or 100% sequence identity with SEQ ID NO: 31. Suitably, the percent identity is calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 31). In other words, suitable (functional) Vα domain CDR3 amino acid sequences may differ from the sequence shown in SEQ ID NO: 31 by one or a few (e.g., two, etc.) amino acids.
[0226] As noted above, functional variants of SEQ ID NO: 31 retain the ability to confer specific binding to the CTCFL antigen (i.e., the peptide shown in SEQ ID NO: 45) when the CDR3 is part of the TCR Vα domain.
[0227] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 31. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO: 31, or substitutions, deletions or insertions of non-critical amino acids in non-critical regions of CDR3.
[0228] Non-functional variants are amino acid sequence variants of SEQ ID NO: 31 that do not specifically bind to the CTCFL antigen (i.e., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 31, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0229] In one example, the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 31. In examples where the TCR Vα domain CDR3 has the amino acid sequence of SEQ ID NO: 31, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0230] The encoded TCR Vα domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO:29 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO:45)). Such functional variants may be naturally occurring functional variants of SEQ ID NO:29, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:29, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0231] Non-functional variants are amino acid sequence variants of SEQ ID NO: 29 that do not specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 29, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0232] For example, a suitable functional Vα domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO:29, i.e., the sequence may have at least 80%, at least 85%, or 100% sequence identity with SEQ ID NO:29. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO:29). In other words, a suitable functional Vα domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO:29 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO:29. As mentioned above, functional variants of SEQ ID NO:29 retain the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO:45) when CDR1 is part of a TCR Vα domain.
[0233] In one example, the CDR1 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 29. In examples where the TCR Vα domain CDR1 has the amino acid sequence of SEQ ID NO: 29, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0234] The encoded TCR Vα domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 comprising the amino acid sequence of SEQ ID NO: 30 or a functional variant thereof (i.e., this variant is HLA-A * 02:01). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 30. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 30, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0235] Non-functional variants include HLA-A * 02:01. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 30, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0236] For example, a suitable functional Vα domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 30, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 30. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 30). In other words, a suitable (functional) Vα domain CDR2 amino acid sequence may differ from the sequence shown in SEQ ID NO: 30 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence shown in SEQ ID NO: 30. As mentioned above, functional variants of SEQ ID NO: 30 may be used to identify HLA-A * Retains the ability to specifically bind to 02:01.
[0237] In one example, the CDR2 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 30. In examples where the TCR Vα domain CDR2 has the amino acid sequence of SEQ ID NO: 30, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0238] The encoded TCR Vα domain may therefore comprise the CDRs referred to in detail above (specifically by SEQ ID NO: 31, SEQ ID NO: 29 and SEQ ID NO: 30, or functional variants thereof), together with appropriate intervening sequences between the CDRs. The encoded TCR Vα domain may comprise the amino acid sequence of SEQ ID NO: 35 or a functional variant thereof (i.e., this variant TCR Vα domain, when part of a binding protein described herein, retains the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 35. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 35, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0239] Non-functional variants are amino acid sequence variants of SEQ ID NO: 35 that do not specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 35, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0240] In one example, the encoded TCR Vα domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:35, while retaining the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO:45). In other words, functional TCR Vα domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO:35 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO:35 may be in regions of the TCR Vα domain that do not form the CDRs (i.e., a variant may have the CDRs of SEQ ID NO:31, SEQ ID NO:29, and / or SEQ ID NO:30 and still have 25% (or less) sequence variability compared to SEQ ID NO:35). In other words, the sequence of the CDRs of SEQ ID NO: 35 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 35).
[0241] By way of example, the encoded TCR Vα domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 35, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 31. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO: 29, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO: 30.
[0242] As another example, the encoded TCR Vα domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO: 35 with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions, and the TCR Vα domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 31. In this example, the TCR Vα domain CDR1 may have the amino acid sequence of SEQ ID NO: 29, and the TCR Vα domain CDR2 may have the amino acid sequence of SEQ ID NO: 30.
[0243] In an example where the TCR Vα domain has the amino acid sequence of SEQ ID NO: 35, the TCR Vα domain may be encoded by the nucleic acid sequence of SEQ ID NO: 36 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0244] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Vα domain may also encode a TCR α chain constant domain. Examples of suitable constant domains are generally discussed above.
[0245] An example of a specific TCR α chain amino acid sequence comprising the TCR Vα domain described herein together with an appropriate constant domain is set forth in SEQ ID NO: 39. Suitable functional variants of SEQ ID NO: 39 are also encompassed (e.g., variants having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 39, which variant TCR α chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45)). In other words, functional TCR α chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 39 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All sequence variability compared to SEQ ID NO: 39 may be in regions of the TCR alpha chain that do not form the CDRs (i.e. a variant may have the CDRs of SEQ ID NO: 31, SEQ ID NO: 29 and / or SEQ ID NO: 30 and still have 25% (or less) sequence variability compared to SEQ ID NO: 39). In other words, the sequence of the CDRs of SEQ ID NO: 39 may be retained while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g. SEQ ID NO: 39).
[0246] By way of example, the encoded TCR alpha chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 39, and the TCR alpha chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 31. In this example, the TCR alpha chain CDR1 may have the amino acid sequence of SEQ ID NO: 29, and the TCR alpha chain CDR2 may have the amino acid sequence of SEQ ID NO: 30.
[0247] In the example where the TCR alpha chain has the amino acid sequence of SEQ ID NO: 39, the TCR alpha chain may be encoded by the nucleic acid sequence of SEQ ID NO: 40 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 40 is the nucleic acid sequence of the TCR alpha chain of clone 39.2E12.
[0248] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 31, or a functional fragment thereof.
[0249] In another example, the CDR3 of the Vα domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:31.
[0250] In another example, the Vα domain of the nucleic acid compositions provided herein comprises an amino acid sequence that has at least 80% sequence identity with, includes, or consists of SEQ ID NO:35.
[0251] As mentioned above, the present inventors have * TCR clone 39.2E12 was identified which interacts with KLHGILVEA (SEQ ID NO: 45) in the context of 02:01. The sequences provided herein corresponding to TCR clone 39.2E12 are SEQ ID NO: 29 to SEQ ID NO: 42.
[0252] An example of a suitable TCR Vβ domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular the CTCFL antigen (e.g., KLHGILVEA (SEQ ID NO: 45)), is set forth in SEQ ID NO: 34. As will be apparent to one of skill in the art, variants of the amino acid sequence set forth in SEQ ID NO: 34 may also be functional (i.e., retain the ability to confer specific binding to the CTCFL antigen (i.e., the peptide set forth in SEQ ID NO: 45) when the CDR3 is part of a TCR Vβ domain). Accordingly, such functional variants are encompassed by the present invention.
[0253] For example, a suitable (functional) Vβ domain CDR3 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 34, i.e., the sequence may have at least 80%, at least 86%, at least 93%, or 100% sequence identity with SEQ ID NO: 34. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 34). In other words, a suitable (functional) Vβ domain CDR3 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 34 by one or a few (e.g., two) amino acids. As mentioned above, functional variants of SEQ ID NO: 34 retain the ability to confer specific binding to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45) when the CDR3 is part of a TCR Vβ domain.
[0254] The functional variant may be a naturally occurring functional variant, a synthetic functional variant, or a synthetically improved functional variant of SEQ ID NO: 34. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 34, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of CDR3.
[0255] Non-functional variants are amino acid sequence variants of SEQ ID NO: 34 that do not specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 34, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0256] In one example, the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 34. In examples where the TCR Vβ domain CDR3 has the amino acid sequence of SEQ ID NO: 34, the CDR3 may be encoded by any suitable nucleic acid sequence.
[0257] The encoded TCR Vβ domain may comprise, in addition to a particular CDR3, a CDR1 comprising the amino acid sequence of SEQ ID NO: 32 or a functional variant thereof (i.e., the variant retains the ability to specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45)). Such functional variants may be naturally occurring functional variants of SEQ ID NO: 32, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 32, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0258] Non-functional variants are amino acid sequence variants of SEQ ID NO: 32 that do not specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 32, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0259] For example, a suitable functional Vβ domain CDR1 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 32, i.e., the sequence may have at least 80% or 100% sequence identity with SEQ ID NO: 32. Suitably, the percent identity is calculated as the percent identity relative to the entire length of a reference sequence (e.g., SEQ ID NO: 32). In other words, a suitable (functional) Vβ domain CDR1 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 32 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 32. As mentioned above, functional variants of SEQ ID NO: 32 retain the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45) when CDR1 is part of a TCR Vβ domain.
[0260] In one example, the CDR1 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 32. In examples where the TCR Vβ domain CDR1 has the amino acid sequence of SEQ ID NO: 32, the CDR1 may be encoded by any suitable nucleic acid sequence.
[0261] The encoded TCR Vβ domain comprises, in addition to a specific CDR3 (and optionally a specific CDR1 as described above), a CDR2 having the amino acid sequence of SEQ ID NO: 33 or a functional variant thereof (i.e., this variant is associated with HLA-A * 02:01). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 33. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 33, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0262] Non-functional variants include HLA-A * and amino acid sequence variants of SEQ ID NO: 33 that do not specifically bind to 02:01. Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 33, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those skilled in the art.
[0263] For example, a suitable functional Vβ domain CDR2 amino acid sequence may have at least 80% sequence identity with SEQ ID NO: 33, i.e., the sequence may have at least 80%, at least 83%, or 100% sequence identity with SEQ ID NO: 33. Suitably, the percent identity is calculated as the percent identity relative to the full length of a reference sequence (e.g., SEQ ID NO: 33). In other words, a suitable (functional) Vβ domain CDR2 amino acid sequence may differ from the sequence set forth in SEQ ID NO: 33 by one or several amino acids. As mentioned above, variants may include amino acid substitutions, such as conservative amino acid substitutions, compared to the sequence set forth in SEQ ID NO: 33. As mentioned above, functional variants of SEQ ID NO: 33 may be used to identify HLA-A * Retains the ability to specifically bind to 02:01.
[0264] In one example, the CDR2 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 33. In examples where the TCR Vβ domain CDR2 has the amino acid sequence of SEQ ID NO: 33, the CDR2 may be encoded by any suitable nucleic acid sequence.
[0265] The encoded TCR Vβ domain may therefore comprise the CDRs referred to in detail above (specifically by SEQ ID NO: 34, SEQ ID NO: 32 and SEQ ID NO: 33, or functional variants thereof), with appropriate intervening sequences between the CDRs.
[0266] The encoded TCR Vβ domain may have the amino acid sequence of SEQ ID NO: 37 or a functional variant thereof (i.e., this variant TCR Vβ domain, when part of a binding protein described herein, retains the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45)). Such functional variants may be naturally occurring functional variants of SEQ ID NO: 37, synthetic functional variants, or synthetically improved functional variants. The term "variant" also encompasses homologues and fragments. Functional variants typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 37, or substitutions, deletions, or insertions of non-critical amino acids in non-critical regions of the protein.
[0267] Non-functional variants are amino acid sequence variants of SEQ ID NO: 37 that do not specifically bind to the CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). Non-functional variants typically contain non-conservative substitutions, deletions, or insertions or premature truncations of the amino acid sequence of SEQ ID NO: 37, or substitutions, insertions, or deletions in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to those of skill in the art.
[0268] In one example, the encoded TCR Vβ domain may have an amino acid sequence having at least 75%, at least 80%, at least 85%, or at least 90% (or at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 37, while retaining the ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45). In other words, functional TCR Vβ domains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 37 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All of the sequence variability compared to SEQ ID NO: 37 may be in regions of the TCR Vβ domain that do not form CDRs (i.e., a variant may have the CDRs of SEQ ID NO: 34, SEQ ID NO: 32, and / or SEQ ID NO: 33 and still have 25% (or less) sequence variability compared to SEQ ID NO: 37). In other words, the sequence of the CDRs of SEQ ID NO: 37 may be retained while the remainder of the sequence is varied appropriately within the above-specified "at least 75% identity" parameter. Suitably, the percent identity may be calculated as the percent identity relative to the full length of the reference sequence (e.g., SEQ ID NO: 37).
[0269] By way of example, the encoded TCR Vβ domain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 37, and the TCR Vβ domain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 34. In this example, the TCR Vβ domain CDR1 may have the amino acid sequence of SEQ ID NO: 32, and the TCR Vβ domain CDR2 may have the amino acid sequence of SEQ ID NO: 33.
[0270] In the example where the TCR Vβ domain has the amino acid sequence of SEQ ID NO: 37, the TCR Vβ domain may be encoded by the nucleic acid sequence of SEQ ID NO: 38 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).
[0271] For the avoidance of doubt, a nucleic acid sequence encoding a TCR Vβ domain may also encode a TCR β chain constant domain. Examples of suitable constant domains are generally discussed above.
[0272] An example of a specific TCR β chain amino acid sequence comprising the TCR Vβ domain and a suitable constant domain described herein is set forth in SEQ ID NO: 41. Suitable functional variants of SEQ ID NO: 41 are also encompassed (e.g., variants having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 41, which variant TCR β chain amino acid sequence, when part of a binding protein described herein, retains its ability to specifically bind to a CTCFL antigen (e.g., the peptide set forth in SEQ ID NO: 45)). In other words, functional TCR β chains having one or several amino acid substitutions compared to the sequence of SEQ ID NO: 41 are also encompassed. As noted above, the amino acid substitutions may be conservative amino acid substitutions. All sequence variability compared to SEQ ID NO:41 may be in regions of the TCR β chain that do not form the CDRs (i.e., a variant may have the CDRs of SEQ ID NO:34, SEQ ID NO:32 and / or SEQ ID NO:33 and still have 25% (or less) sequence variability compared to SEQ ID NO:41). In other words, the sequence of the CDRs of SEQ ID NO:41 may be retained, while the remainder of the sequence is varied appropriately within the "at least 75% identity" parameter specified above. Suitably, the percent identity may be calculated as the percent identity relative to the entire length of the reference sequence (e.g., SEQ ID NO:41).
[0273] By way of example, the encoded TCR β chain may comprise an amino acid sequence having at least 75% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, etc.) sequence identity to the amino acid sequence of SEQ ID NO: 41, and the TCR β chain comprises a CDR3 having the amino acid sequence of SEQ ID NO: 34. In this example, the TCR β chain CDR1 may have the amino acid sequence of SEQ ID NO: 32, and the TCR β chain CDR2 may have the amino acid sequence of SEQ ID NO: 33.
[0274] In the example where the TCR β chain has the amino acid sequence of SEQ ID NO: 41, the TCR β chain may be encoded by the nucleic acid sequence of SEQ ID NO: 42 or a genetically degenerate sequence thereof (i.e., other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code), where SEQ ID NO: 42 is the nucleic acid sequence of the TCR β chain of clone 39.2E12.
[0275] In one example, the nucleic acid compositions provided herein comprise a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 34, or a functional fragment thereof.
[0276] In another example, the CDR3 of the Vβ domain of the nucleic acid compositions provided herein comprises or consists of the amino acid sequence of SEQ ID NO:34.
[0277] In a further example, the Vβ domain of the nucleic acid compositions provided herein comprises an amino acid sequence having at least 80% sequence identity to, including, or consisting of SEQ ID NO:37.
[0278] The TCR Vβ domain sequences derived from TCR clone 39.2E12 discussed above are particularly compatible with the TCR Vα domain sequences derived from TCR clone 39.2E12 discussed elsewhere herein.
[0279] Thus, in one example, a nucleic acid composition described herein encodes a CTCFL antigen-specific binding protein having a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 31, or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 34, or a functional fragment thereof.
[0280] In particular examples, the nucleic acid compositions described herein encode a CTCFL antigen-specific binding protein having a TCR Vα domain with a CDR3 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 31 and a TCR Vβ domain with a CDR3 that comprises or consists of the amino acid sequence of SEQ ID NO: 34. Furthermore, the CTCFL antigen may comprise or consist of the sequence set forth in SEQ ID NO: 45. Furthermore, the TCR Vα domain may be part of a TCR α chain having a constant domain, and the TCR Vβ domain may be part of a TCR β chain having a constant domain.
[0281] In this particular example, the Vα domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 35, and the Vβ domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 37. In one example, the Vα domain comprises the amino acid sequence of SEQ ID NO: 35 and the Vβ domain comprises the amino acid sequence of SEQ ID NO: 37. In such a case, the Vα domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 36, and the Vβ domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 38.
[0282] In this particular example, the TCR Vα domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 29 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 30. Additionally, the TCR Vβ domain may comprise a CDR1 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 32 and a CDR2 amino acid sequence that comprises or consists of the amino acid sequence of SEQ ID NO: 33.
[0283] For the avoidance of doubt, this particular example encompasses the components of TCR clone 39.2E12 exemplified herein. The different components of TCR clone 39.2E12 and their respective SEQ ID NOs are summarised in Table 6 below.
[0284] As described in more detail elsewhere herein, the nucleic acid compositions described herein encode both a TCR Vα domain and a TCR Vβ domain that form a binding protein capable of specifically binding to a cancer-associated antigen. In instances where the TCR Vα domain and the TCR Vβ domain are encoded by the same nucleic acid sequence, the TCR Vα domain and the TCR Vβ domain may be linked to each other via a linker. Suitable linkers are generally discussed elsewhere herein. Additional suitable polypeptide domains that may also be encoded by the nucleic acid sequences encoding the TCR Vα domain and / or the TCR Vβ domain are also generally discussed elsewhere herein.
[0285] In one example, the nucleic acid compositions described herein may encode a soluble TCR, or a chimeric single chain TCR in which a TCR alpha chain variable domain is linked to a TCR beta chain variable domain and a constant domain fused to, for example, a CD3 zeta signaling domain, as generally discussed in more detail elsewhere herein.
[0286] Vector Also provided are vector systems comprising the nucleic acid compositions described herein. The vector system may have one or more vectors. As discussed above, the binding protein components encoded by the nucleic acid composition may be encoded by one or more nucleic acid sequences in the nucleic acid composition. In examples where all of the binding protein components are encoded by a single nucleic acid sequence, that nucleic acid sequence may be present in a single vector (thus, the vector system described herein may include only one vector). In examples where the binding protein components are encoded by two or more nucleic acid sequences (multiple nucleic acid sequences together encode all of the components of the binding protein), these two or more nucleic acid sequences may be present in one vector (e.g., in different open reading frames of the vector) or may be distributed across two or more vectors. In this example, the vector system includes multiple separate vectors (i.e., vectors with different nucleotide sequences).
[0287] Thus, in one example, a vector system is provided that includes the nucleic acid compositions described herein.
[0288] Any suitable vector can be used. By way of example only, the vector may be a plasmid, a cosmid, or a viral vector such as a retroviral or lentiviral vector. Adenovirus, adeno-associated virus, vaccinia virus, canarypox virus, herpes virus, minicircle vectors, and naked (synthetic) DNA / RNA may also be used (for details about minicircle vectors, see, for example, the non-viral Sleeping Beauty transposition from minicircle vectors published by R Monjezi et al., Leukemia 2017). Alternatively, single- or double-stranded DNA or RNA can be used to transfect lymphocytes with the TCR of interest (see Roth et al., 2018 Nature 559:405).
[0289] In one example, the vector is a plasmid, a viral vector, or a cosmid, and optionally the vector is selected from the group consisting of a retrovirus, a lentivirus, an adeno-associated virus, an adenovirus, a vaccinia virus, a canarypox virus, a herpes virus, a minicircle vector, and a synthetic DNA or RNA.
[0290] As used herein, the term "vector" refers to a nucleic acid sequence capable of transporting another nucleic acid sequence to which it is operably linked. A vector may be capable of autonomous replication or may be capable of integrating into host DNA. A vector may contain a restriction enzyme site for insertion of recombinant DNA and may contain one or more selectable markers or suicide genes. A vector may be a nucleic acid sequence in the form of a plasmid, bacteriophage, or cosmid. Preferably, the vector is suitable for expression in a cell (i.e., the vector is an "expression vector"). Preferably, the vector is a vector that encodes a CD8 + T cells or CD4 + The vector is suitable for expression in human T cells, such as T cells, or stem cells, iPS cells, or NK cells. In certain embodiments, the vector is a viral vector, such as a retroviral vector, a lentiviral vector, or an adeno-associated vector. Optionally, the vector is selected from the group consisting of adenovirus, vaccinia virus, canarypox virus, herpes virus, minicircle vector, and synthetic DNA or RNA.
[0291] Preferably, the (expression) vector is capable of propagating in the host cell and being stably transmitted to future generations.
[0292] A vector may contain a regulatory sequence. As used herein, "regulatory sequence" refers to a DNA or RNA element that can control gene expression. Examples of expression control sequences include promoters, enhancers, silencers, TATA boxes, internal ribosome entry sites (IRES), transcription factor attachment sites, transcription terminators, polyadenylation sites, etc. Optionally, a vector contains one or more regulatory sequences operably linked to the nucleic acid sequence to be expressed. Regulatory sequences include those that direct constitutive expression as well as tissue-specific regulatory sequences and / or inducible sequences.
[0293] Optionally, the vector comprises a nucleic acid sequence of interest operably linked to a promoter. As used herein, a "promoter" refers to a nucleotide sequence in DNA to which RNA polymerase binds and initiates transcription. A promoter may be inducible or constitutively expressed. Alternatively, a promoter may be under the control of a repressor or stimulatory protein. A promoter may be a promoter not naturally found in the host cell (e.g., it may be an exogenous promoter). Those skilled in the art are familiar with suitable promoters for use in expressing target proteins, and the promoter selected will depend on the host cell.
[0294] "Operably linked" refers to the fact that the control elements described below, singly or in combination, are in a functional relationship with each other, e.g., linked in such a way as to direct the expression of the coding sequence, along with the coding sequence.
[0295] The vector may contain a transcription terminator. As used herein, "transcription terminator" refers to a DNA element that terminates the function of RNA polymerase, which is responsible for transcribing DNA into RNA. A preferred transcription terminator is characterized by a stretch of T residues preceded by a GC-rich dyad symmetrical region.
[0296] The vector may also contain a translational control element. "Translational control element," as used herein, refers to a DNA or RNA element that controls the translation of mRNA. A preferred translational control element is a ribosome binding site. Preferably, the translational control element is derived from the same (homologous) system as the promoter, e.g., a promoter and its associated ribozyme binding site. Preferred ribosome binding sites are known and depend on the selected host cell.
[0297] A vector may contain a restriction enzyme recognition site. As used herein, a "restriction enzyme recognition site" refers to a motif on DNA that is recognized by a restriction enzyme.
[0298] The vector may contain a selectable marker. As used herein, a "selectable marker" refers to a protein that, when expressed in a host cell, confers a phenotype on the cell that allows for the selection of cells expressing the selectable marker gene. Generally, this may be a protein that confers a new beneficial property to the host cell (e.g., antibiotic resistance) or a protein that is expressed on the cell surface and therefore available for antibody binding. Suitable selectable markers are well known in the art.
[0299] Optionally, the vector may also contain a suicide gene. As used herein, a "suicide gene" encodes a protein that induces the death of modified cells when treated with a specific drug. For example, suicide in cells modified with the herpes simplex virus thymidine kinase gene can be induced by treatment with certain nucleoside analogs, including ganciclovir; suicide in cells modified with human CD20 can be induced by treatment with an anti-CD20 monoclonal antibody; and suicide in cells modified with inducible caspase 9 (iCasp9) can be induced by treatment with AP1903 (reviewed by BS Jones, LS Lamb, F Goldman, A Di Stasi; Improving the safety of cell therapy products by suicide gene transfer, Front Pharmacol. (2014) 5:254). Suitable suicide genes are well known in the art.
[0300] Preferably, the vector contains the genetic elements necessary for the expression of the binding proteins described herein by a host cell. Elements necessary for transcription and translation in a host cell include a promoter, a coding region for the protein of interest, and a transcription terminator.
[0301] Those skilled in the art are familiar with the molecular techniques available for the preparation of (expression) vectors and how they may be transduced or transfected into suitable host cells (thereby generating modified cells, as further described below). The (expression) vector systems described herein can be introduced into cells by conventional techniques such as transformation, transfection, or transduction. "Transformation," "transfection," and "transduction" generally refer to techniques for introducing foreign (exogenous) nucleic acid sequences into host cells and thus encompass methods such as electroporation, microinjection, biolistic delivery, transduction with retroviral, lentiviral, or adeno-associated vectors, lipofection, superfection, etc. The specific method used typically depends on both the type of vector and the cells. Suitable methods for introducing nucleic acid sequences and vectors into host cells, such as human cells, are well known in the art; see, for example, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Ausubel et al. (1987) Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY; Cohen et al. (1972) Proc. Natl. Acad. Sci. USA 69, 2110; Luchansky et al. (1988) Mol. Microbiol. 2, 637-646. Further conventional methods suitable for preparing expression vectors and introducing them into suitable host cells are described in detail, for example, in WO 2016 / 071758.
[0302] It is understood that in some instances, the host cell is contacted with the vector system (e.g., a viral vector) in vitro, ex vivo, and in some instances, the host cell is contacted with the vector system (e.g., a viral vector) in vivo.
[0303] The term "host cell" includes any cell into which a nucleic acid composition or vector system described herein may be introduced. Once a nucleic acid molecule or vector system has been introduced into a cell, the cell may be referred to herein as an "modified cell." Once a nucleic acid molecule or vector has been introduced into a host cell, the resulting modified cell should be able to express the encoded binding protein (and, e.g., correctly localize the encoded binding protein for its intended function, e.g., transport the encoded binding protein to the cell surface).
[0304] The nucleic acid composition or vector system may be introduced into cells using any conventional method known in the art. For example, the nucleic acid composition or vector system may be introduced using CRISPR technology. Thus, insertion of a nucleic acid sequence at the endogenous TCR locus by engineering with CRISPR / Cas9 and homologous directed repair (HDR) or non-homologous end joining (NHEJ) is encompassed. Other conventional methods, such as transfection, transduction, or transformation of cells, may also be used.
[0305] The term "modified cell" refers to a genetically altered (e.g., recombinant) cell. Modified cells contain at least one exogenous nucleic acid sequence (i.e., a nucleic acid sequence not naturally found in the host cell). In the context of the present invention, the exogenous sequence may include at least one of the T cell receptor component portions described herein for any of clones 16.3C1, 8.10C4, or 39.2E12 (e.g., a sequence encoding a CDR3 sequence specific for a cancer-associated antigen (e.g., PRAME or CTCFL, e.g., peptides of SEQ ID NOs: 43-45)). The term "modified cell" refers to the particular subject cell and also to the progeny or potential progeny of such a cell. Because certain modifications may occur in subsequent generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell but are still within the scope of the term as used herein.
[0306] In one example, the modified cell comprises a nucleic acid composition or vector system provided herein.
[0307] The host cell (and thus the modified cell) is typically a eukaryotic cell, particularly a human cell (e.g., a CD8 + T cells or CD4 + The host cells (and thus the modified cells) can be autologous or allogeneic cells (e.g., CD8 T cells, T cells, or mixtures thereof, or hematopoietic stem cells, iPSCs, or gamma-delta T cells, or pluripotent stem cells, or NK-T cells or NK cells). + T cells or CD4 + The host cells (and thus the modified cells) may be isolated cells from a distinct individual relative to the subject to be treated. "Autologous cells" refer to cells from an individual to which the host cells are subsequently administered. In other words, the host cells (and thus the modified cells) may be isolated cells from a distinct individual relative to the subject to be treated. "Autologous cells" refer to cells from an individual to which the host cells are subsequently administered. In other words, the host cells (and thus the modified cells) may be isolated cells from the subject to be treated.
[0308] Thus, in one example, the modified cell is a human cell.
[0309] The host cell (and thus the modified cell) may be any cell capable of conferring anti-tumor immunity after TCR gene transfer. Non-limiting examples of suitable cells include autologous or allogeneic CD8 T cells, CD4 T cells, natural killer (NK) cells, NKT cells, gamma-delta T cells, induced pluripotent stem cells (iPSCs), hematopoietic stem cells, or other progenitor cells, and any other autologous or allogeneic cell or cell line (e.g., NK-92 or T cell line) capable of conferring anti-tumor immunity after TCR gene transfer. Thus, in one example, the modified cells are selected from the group consisting of CD8 T cells, CD4 T cells, NK cells, NK-T cells, gamma-delta T cells, hematopoietic stem cells, induced pluripotent stem cells, progenitor cells, T cell lines, and NK-92 cell lines.
[0310] In the context of the therapeutic methods described herein, the host cells (and thus the modified cells) typically contain HLA-A * 24:02, HLA-B * 07:02 or HLA-A * It is intended for administration to 02:01 positive human subjects, although other suitable subjects are described elsewhere herein. With this in mind, the host cells (and thus the modified cells) are typically HLA-A positive. * 24:02, HLA-B * 07:02 or HLA-A * The cells must be 02:01 positive but cancer-associated antigen (e.g., PRAME or CTCFL) negative (i.e., the modified cells must be HLA-A * 24:02, HLA-B * 07:02 or HLA-A * 02:01 may be either positive or negative).
[0311] In the context of the therapeutic methods described herein, the host cells (and thus the modified cells) administered to a subject can be either autologous or allogeneic.
[0312] Advantageously, the modified cells are capable of expressing the binding proteins (i.e., TCR component portions) encoded by the nucleic acid compositions or vector systems described herein, thereby providing immunotherapy that specifically targets cells expressing cancer-associated antigens (e.g., PRAME or CTCFL) and, therefore, the corresponding HLA-A. * 24:02, HLA-B * 07:02 or HLA-A * It can be used to treat or prevent a disease or condition associated with PRAME or CTCFL in a 02:01-positive human subject. Further details regarding this use are provided below.
[0313] Pharmaceutical Composition The nucleic acid compositions, vector systems, modified cells, or isolated nucleic acid sequences described herein may be provided as part of a pharmaceutical composition. Advantageously, such compositions may be administered to a human subject in need thereof (as described elsewhere herein). Particularly suitable compositions may be selected based on the HLA serotype of the human subject, as described in detail elsewhere herein.
[0314] Pharmaceutical compositions may include the nucleic acid compositions, vector systems, modified cells, or isolated nucleic acid sequences described herein together with a pharmaceutically acceptable excipient, adjuvant, diluent, and / or carrier.
[0315] The compositions may routinely contain pharmaceutically acceptable concentrations of salts, buffering agents, preservatives, compatible carriers, supplemental immune enhancing agents such as adjuvants and cytokines, and optionally other therapeutic agents or compounds.
[0316] As used herein, "pharmaceutically acceptable" refers to a substance that is not biologically or otherwise undesirable, i.e., the substance may be administered to an individual together with a selected nucleic acid composition, vector system, modified cell or isolated nucleic acid sequence without causing any undesired biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which the selected nucleic acid composition, vector system, modified cell or isolated nucleic acid sequence is included.
[0317] Excipients are natural or synthetic substances that are formulated with an active ingredient (e.g., a nucleic acid sequence, nucleic acid composition, vector or vector system, modified cell, or isolated nucleic acid provided herein) and included to bulk the formulation or to impart a therapeutic enhancement to the active ingredient in the final dosage form, such as promoting drug absorption or solubility. In addition to aiding in vitro stability, such as preventing degradation over the expected shelf life, excipients can also be useful in the manufacturing process to aid in handling of the associated active agent, such as by promoting powder flowability or non-stick properties. Pharmaceutically acceptable excipients are well known in the art. Accordingly, suitable excipients can be readily identified by those skilled in the art. By way of example, suitable pharmaceutically acceptable excipients include water, saline, aqueous dextrose, glycerol, ethanol, and the like.
[0318] Adjuvants are pharmacological and / or immunological agents that modify the effects of other agents in the formulation. Pharmaceutically acceptable adjuvants are well known in the art. Therefore, suitable adjuvants can be easily identified by those skilled in the art.
[0319] A diluent is a diluting agent. Pharmaceutically acceptable diluents are well known in the art. Thus, a suitable diluent can be readily identified by a person skilled in the art.
[0320] The carrier is non-toxic to the recipient at the dosage and concentration used and is compatible with the other ingredients of the formulation. The term "carrier" refers to a natural or synthetic organic or inorganic component with which the active ingredient is combined to facilitate application. Pharmaceutically acceptable carriers are well known in the art. Therefore, suitable carriers can be easily identified by those skilled in the art.
[0321] Targeted treatment The pharmaceutical compositions described herein advantageously comprise an HLA-A * 24:02, HLA-B * 07:02 or HLA-A * It may be administered to 02:01-positive human subjects (as described in more detail elsewhere herein, certain compositions may be more suitable for certain human subjects based on the HLA status of the human subject).
[0322] Typically, the subject in need of treatment has a disease or condition associated with elevated levels of an HLA-restricted cancer-associated antigen (i.e., a cancer-associated antigen that is presented on the cell surface in the context of HLA). For example, PRAME and / or CTCFL antigens are presented on the cell surface in the context of HLA. Thus, in some examples, the subject in need of treatment has a disease or condition associated with elevated levels of HLA-restricted PRAME antigen or elevated levels of HLA-restricted CTCFL antigen. Thus, in some examples, the subject in need of treatment has a disease or condition associated with elevated levels of HLA-restricted PRAME antigen. Thus, in some examples, the subject in need of treatment has a disease or condition associated with elevated levels of HLA-restricted CTCFL antigen.
[0323] The disease or condition is typically a PRAME-associated disease or condition or a CTCFL-associated disease or condition, although other examples of diseases or conditions are described elsewhere herein. In a particular example, the disease or condition is a PRAME-associated disease or condition. In another example, the disease or condition is a CTCFL-associated disease or condition. In one example, the PRAME-associated disease or condition or CTCFL-associated disease or condition can be a hyperproliferative disease or condition. A PRAME-associated disease or condition or a CTCFL-associated disease or condition (e.g., a hyperproliferative disease or condition) is typically one in which an HLA-restricted cancer-associated antigen described herein is presented on the cell surface in the context of an HLA, e.g., one in which a PRAME or CTCFL antigen is presented on the cell surface in the context of an HLA.
[0324] In one example, the PRAME-associated disease or condition or the CTCFL-associated disease or condition may be a hematological malignancy. In other words, the disease or condition may be a hematological malignancy associated with elevated levels of an HLA-restricted cancer-associated antigen (i.e., a cancer-associated antigen presented on the cell surface in the context of an HLA, e.g., a PRAME and / or CTCFL antigen presented on the cell surface in the context of an HLA). For example, the disease or condition may be a hematological malignancy associated with elevated levels of an HLA-restricted PRAME antigen, or the disease or condition may be a hematological malignancy associated with elevated levels of an HLA-restricted CTCFL antigen. Examples of suitable hematological malignancies are well known in the art and include, for example, multiple myeloma, plasma cell leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), and B-cell lymphoma. Examples of B-cell lymphomas include diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), and Burkitt lymphoma.
[0325] In an alternative example, the PRAME-associated disease or condition or the CTCFL-associated disease or condition may be a solid tumor. In other words, the disease or condition may be a solid tumor associated with elevated levels of an HLA-restricted cancer-associated antigen (i.e., a cancer-associated antigen presented on the cell surface in the context of HLA, e.g., a PRAME and / or CTCFL antigen presented on the cell surface in the context of HLA). For example, the disease or condition may be a solid tumor associated with elevated levels of an HLA-restricted PRAME antigen, or the disease or condition may be a solid tumor associated with elevated levels of an HLA-restricted CTCFL antigen. Examples of suitable solid tumors are well known in the art and include, for example, melanoma, uveal melanoma, ovarian cancer, endometrial cancer, testicular tumor, lung cancer, lung squamous cell carcinoma, thymoma, synovial sarcoma, kidney cancer, breast cancer, sarcoma, bladder cancer, mesothelioma, pancreatic cancer, prostate cancer, colorectal cancer, cervical cancer, and gastric cancer.
[0326] The PRAME-associated disease or condition or the CTCFL-associated disease or condition may be a hyperproliferative disease or condition. For example, the PRAME-associated disease or condition or the CTCFL-associated disease or condition may be a tumor or cancer that expresses an HLA-restricted PRAME antigen or an HLA-restricted CTCFL antigen. For example, the PRAME-associated disease or condition may be a tumor or cancer that expresses an HLA-restricted PRAME antigen. For example, the CTCFL-associated disease or condition may be a tumor or cancer that expresses an HLA-restricted CTCFL antigen. In other words, the PRAME-associated disease or condition may be a PRAME-positive tumor or cancer. In other words, the CTCFL-associated disease or condition may be a CTCFL-positive tumor or cancer.
[0327] In one example, the pharmaceutical compositions provided herein are for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
[0328] As will be apparent to one of skill in the art, an appropriate treatment (e.g., an appropriate pharmaceutical composition described herein) for a subject in need may be selected based on the subject's HLA serotype.
[0329] In one example, a subject in need may have HLA-A * If the patient is 24:02 positive, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) may include a component of the TCR clone 16.3C1 exemplified herein. Thus, a TCR including a component of the TCR clone 16.3C1 exemplified herein may bind to HLA-A * It is particularly suitable for administration to, or for treating, stimulating, providing adequate immunity (eg, anti-tumor immunity, etc.) in 24:02-positive human subjects.
[0330] In one example, a subject in need may have HLA-B * If the test is 07:02 positive, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) may include components of the TCR clone 8.10C4 exemplified herein. Thus, a TCR including components of the TCR clone 8.10C4 exemplified herein may be used to treat HLA-B * 07:02 is particularly suitable for administration to positive human subjects, or for treating, stimulating, or providing appropriate immunity (e.g., anti-tumor immunity, etc.).
[0331] In one example, a subject in need may have HLA-A * If the patient is 02:01 positive, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) may include components of the TCR clone 39.2E12 exemplified herein. Thus, a TCR including components of the TCR clone 39.2E12 exemplified herein may bind to HLA-A * 02:01 is particularly suitable for administration to, or for treating, stimulating, providing appropriate immunity (e.g., anti-tumor immunity, etc.) in positive human subjects.
[0332] The phrase "induced or enhanced immune response" refers to an increase in a subject's immune response (e.g., a cellular immune response, such as a T cell-mediated immune response) during or after treatment compared to the immune response before treatment. Thus, an "induced or enhanced" immune response encompasses any measurable increase in an immune response that is directly or indirectly targeted to the disease or condition being treated (or prevented).
[0333] In another example, the pharmaceutical composition may be for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
[0334] In another example, the pharmaceutical composition may be for use in stimulating a cellular immune response against a target cell population or tissue in a human subject. In such an example, the target cell population or tissue may be a target cell population or tissue that expresses an HLA-restricted cancer-associated antigen (e.g., a target cell population or tissue that expresses a PRAME and / or CTCFL antigen). Typically, the target cell population or tissue is a target cell population or tissue that expresses an HLA-restricted cancer-associated antigen (e.g., a target cell population or tissue that expresses an HLA-restricted PRAME and / or an HLA-restricted CTCFL antigen). For example, the target cell population or tissue may be a target cell population or tissue containing a tumor or cancer that expresses an HLA-restricted cancer-associated antigen. For example, the target cell population or tissue may be a target cell population or tissue containing a tumor or cancer that expresses an HLA-restricted PRAME antigen and / or an HLA-restricted CTCFL antigen.
[0335] The pharmaceutical composition may be for use in providing anti-tumor immunity to a human subject. Typically, the pharmaceutical composition is for use in providing anti-tumor immunity against tumors in which an HLA-restricted cancer-associated antigen described herein is presented on the cell surface in the context of HLA, such as tumors in which PRAME and / or CTCFL antigens are presented on the cell surface in the context of HLA. For example, the pharmaceutical composition may be for use in providing anti-tumor immunity against tumors in which an HLA-restricted PRAME antigen or CTCFL antigen described herein is presented on the cell surface in the context of HLA.
[0336] In another example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of an HLA-restricted cancer-associated antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of the HLA-restricted PRAME antigen or elevated levels of the HLA-restricted CTCFL antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME and / or CTCFL.
[0337] Those skilled in the art will be well aware of PRAME-associated diseases or conditions and CTCFL-associated diseases or conditions that may be treated in accordance with the present invention. Suitable examples of such diseases or conditions are discussed elsewhere herein.
[0338] As will be apparent to one skilled in the art, a PRAME-associated disease or condition and / or a CTCFL-associated disease or condition may involve at least one tumor (particularly at least one HLA-restricted PRAME antigen-expressing tumor or at least one HLA-restricted CTCL antigen-expressing tumor), for example an HLA-restricted PRAME antigen- and / or an HLA-restricted CTCFL antigen-expressing tumor.
[0339] It will also be apparent to those skilled in the art that certain compositions are more suitable for treating certain diseases or conditions. For example, a composition comprising a PRAME-binding protein or a nucleic acid component encoding it is particularly suitable for treating a PRAME-related disease or condition. Similarly, a composition comprising a CTCFL-binding protein or a nucleic acid component encoding it is particularly suitable for treating a CTCFL-related disease or condition. Specific examples of PRAME-binding proteins and CTCFL-binding proteins are provided herein.
[0340] As used herein, the terms "treat," "treating," and "treatment" are intended to include interventions intended to prevent the onset of or alter the pathology of a condition, disorder, or symptom (e.g., a PRAME-associated disease or condition and / or a CTCFL-associated disease or condition). Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow (alleviate) the targeted condition, disorder, or symptom. Thus, "treatment" encompasses a reduction, slowing, or inhibition of the amount or concentration of target cells, e.g., as measured in a sample obtained from a subject, by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the amount or concentration of target cells before treatment. Methods for measuring the amount or concentration of target cells include, for example, qRT-PCR and quantification of disease-specific biomarkers in a sample obtained from a subject.
[0341] As used herein, the term "subject" refers to an individual, e.g., a human, who has or is at risk of having a specified condition, disorder, or condition. A subject may be a patient, i.e., a subject in need of treatment according to the present invention. A subject may have previously been treated for a condition, disorder, or condition. Alternatively, a subject may have not been treated prior to treatment according to the present invention.
[0342] The compositions described herein can be administered to a subject by any conventional route, including injection, or by gradual infusion over time. Administration may be, for example, by injection, or by intramuscular, intravascular, intracavitary, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, or transdermal administration.
[0343] The compositions described herein may be in any form suitable for the above-mentioned modes of administration. For example, compositions containing modified cells may be in any form suitable for injection. As a further example, forms suitable for parenteral injection (including subcutaneous, intramuscular, intravascular, or infusion) include sterile solutions, suspensions, or emulsions. Alternatively, the route of administration may be by direct injection into the target area, or by regional or local delivery. Identifying the appropriate dosage of the compositions of the present invention is well within the routine capabilities of one skilled in the art.
[0344] Advantageously, the compositions described herein may be formulated for use in T cell receptor (TCR) gene transfer, an approach that is rapid, reliable, and capable of generating large numbers of T cells with specificity for a cancer-associated antigenic peptide (e.g., a peptide set forth in any one of SEQ ID NOs: 43-45), regardless of the patient's preexisting immune repertoire. Using TCR gene transfer, modified cells suitable for infusion may be generated within a few days.
[0345] The compositions described herein are intended to be administered in an effective amount. An "effective amount" is an amount that, alone or together with further doses, produces the desired (therapeutic or non-therapeutic) response. The effective amount used will depend, for example, on the therapeutic (or non-therapeutic) purpose, the route of administration, and the condition of the patient / subject. For example, the appropriate dosage of the compositions of the present invention for a given patient / subject will be determined by the attending physician (or the person administering the composition) taking into account various factors known to modify the action of the compositions of the present invention, such as the severity and type of hematological malignancy, body weight, sex, diet, time and route of administration, other medications, and other relevant clinical factors. Dosage amounts and schedules may vary according to the specific condition, disorder, or symptom and the overall condition of the patient / subject. An effective dosage may be determined by either in vitro or in vivo methods.
[0346] The pharmaceutical compositions described herein are advantageously presented in unit dosage form.
[0347] Methods for Producing Binding Proteins (e.g., TCRs) Also provided is a method for producing a binding protein that can specifically bind to a peptide that comprises a cancer-associated antigen, and that does not bind to a peptide that does not comprise the cancer-associated antigen, comprising contacting a nucleic acid composition (or vector system) described herein with a cell under conditions such that the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.
[0348] In the context of the binding proteins described herein, the cancer associated antigen may comprise or consist of an amino acid sequence selected from the group consisting of SEQ ID NO: 43 to SEQ ID NO: 45, or a sequence comprising a functional fragment or variant thereof.
[0349] The method may be performed on (host) cells ex vivo or in vitro. Alternatively, the method may be performed in vivo, where the nucleic acid composition (or vector system) is administered to a subject and contacted with cells in vivo under conditions where the nucleic acid sequence is incorporated and expressed by the cells to produce the binding protein. In one example, the method is not a method of treatment of the human or animal body. Suitable in vivo, in vitro and ex vivo methods for contacting a nucleic acid sequence (or vector system) with a cell under conditions whereby the nucleic acid sequence (or vector system) is incorporated and expressed by the cell are well known, as described elsewhere herein.
[0350] As described elsewhere herein, the binding protein includes a TCR, an antigen-binding fragment of a TCR, a T-engager, an ImmTAC, or a chimeric antigen receptor (CAR). Further details are provided elsewhere herein.
[0351] The binding proteins described herein may be used therapeutically, as described elsewhere herein, and may also be used in a diagnostic setting, for example, to detect the presence of cancer-associated antigens (e.g., PRAME and / or CTCFL) presented in the context of the appropriate HLA on the cell surface of diseased / malignant tissue.
[0352] General definition As used herein, "nucleic acid sequence," "polynucleotide," "nucleic acid," and "nucleic acid molecule" are used interchangeably to refer to an oligonucleotide sequence or a polynucleotide sequence. The term nucleotide sequence may be substituted herein with nucleic acid molecule. A nucleotide sequence may be of genomic, synthetic, or recombinant origin and may be double-stranded or single-stranded (representing the sense or antisense strand). The term "nucleotide sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA (e.g., mRNA), as well as analogs of DNA or RNA produced, for example, by the use of nucleotide analogs. In one example, the nucleotide sequence lacks introns. In other words, the nucleotide sequence is an intron-less nucleic acid sequence. For example, the nucleotide sequence may be a DNA sequence that does not contain intron sequences.
[0353] As used herein, an "isolated nucleic acid sequence" or "isolated nucleic acid composition" refers to a nucleic acid sequence that is not in its natural environment, and when in its natural environment, the nucleic acid sequence is linked to its naturally associated sequences, also in their natural environment. In other words, an isolated nucleic acid sequence / composition is not a naturally occurring nucleotide sequence / composition; "native nucleotide sequence / composition" herein refers to the entire nucleotide sequence in its natural environment, and, if it is operably linked to the entire promoter with which it is naturally associated, the promoter is also in its natural environment. Such nucleic acids may be part of a vector, and / or such nucleic acids or polypeptides may be part of a composition (e.g., a cell lysate) and still be isolated in that such a vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term "gene" refers to the segment of DNA involved in producing a polypeptide chain, including regions preceding and following the coding region ("leader and trailer"), as well as intervening sequences (introns) between individual coding segments (exons).
[0354] The nucleic acid sequences of the present invention may be non-naturally occurring nucleic acid sequences (e.g., the entire sequence may not be entirely naturally occurring). For example, the nucleic acid sequences of the present invention may be operably linked to a promoter that is not naturally associated with the equivalent human nucleic acid sequence in nature (e.g., a human TCR sequence or a fragment thereof), i.e., the entire promoter is not naturally associated with the nucleic acid in its natural environment. In this context, such a promoter may be considered an exogenous promoter. Examples of suitable promoters are described elsewhere. As used herein, "specifically binds" or "specific for" refers to a binding protein (e.g., a TCR receptor) or binding domain (or a fusion protein thereof) and a target molecule that binds to the target molecule within 10 5 M -1 or higher affinity or K a (i.e., the equilibrium association constant for a particular binding interaction, which has units of 1 / M) (which is the on-rate [k on ] versus off-rate [k off ]) but does not significantly associate or bind to any other molecules or components in the sample. A binding protein or binding domain (or fusion protein thereof) may be classified as a "high affinity" binding protein or binding domain (or fusion protein thereof) or as a "low affinity" binding protein or binding domain (or fusion protein thereof). A "high affinity" binding protein or binding domain has a binding affinity of at least 10 7 M -1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M -1 , or at least 10 13 M -1 K a A "low affinity" binding protein or binding domain refers to a binding protein or binding domain having a7 M -1 Up to 10 6 M -1 Up to 10 5 M -1 K up to a Alternatively, affinity may be expressed in units of M (e.g., 10 -5 M~10 -13 M) the equilibrium dissociation constant (K d ) can be defined as
[0355] In certain embodiments, a receptor or binding domain may have "enhanced affinity," which refers to a selected or engineered receptor or binding domain that has stronger binding to a target antigen than the wild-type (or parent) binding domain. For example, enhanced affinity may refer to a receptor or binding domain that has a higher K for a target antigen than the wild-type binding domain. a (equilibrium association constant), which may be due to a lower K d This may be due to a lower off-rate (k off ), or a combination thereof. In certain embodiments, the enhanced affinity TCR can be codon-optimized to enhance expression in certain host cells, such as cells of the immune system, induced pluripotent stem cells (iPSCs), hematopoietic stem cells, T cells, primary T cells, T cell lines, NK cells, or natural killer T cells (Scholten et al., Clin. Immunol. 119:135, 2006). The T cells may be CD4+ or CD8+ T cells, or gamma-delta T cells.
[0356] The PRAME gene (ENSG00000185686; Uniprot:P78395) is located on the opposite strand of chromosome 22, is approximately 12 kilobases long, and contains a leucine-rich repeat domain. Overexpression of PRAME (also known as MAPE, OIP4, CT130, and OIP-4) blocks retinoic acid (RA)-mediated cell differentiation, cell growth arrest, and apoptotic death, suggesting that PRAME likely acts as an inhibitor of retinoic acid receptor (RAR) signaling. Upregulation of PRAME contributes to tumorigenesis through inhibition of the RA / RAR signaling pathway. Consistent with this, elevated PRAME expression is observed in 88% of primary melanoma tissues and 95% of metastatic melanoma tissues. In addition to melanoma, PRAME is frequently expressed in numerous solid tumors, including head and neck cancer, breast cancer, renal cell carcinoma, and non-small cell lung cancer (NSCLC). CTCFL (ENSG00000124092; Uniprot:Q8N151), also known as brother of the regulator of imprinted sites (BORIS), or CT27, CTCF-T, HMGB1L1, and dJ579F20.2, is a DNA-binding protein that plays a central role in gene regulation by acting as a transcription factor for testis-specific genes, including CTA. By interfering with cellular processes, CTCFL exhibits several oncogenic properties, including apoptosis, proliferation, and immortalization. In ovarian cancer, CTCFL expression indeed correlates with increasing stage and decreased survival. CTCFL expression has also been detected in other tumor types, but data have been conflicting. TCGA data suggest that CTCFL is primarily expressed in ovarian cancer. Because CTCFL expression is epigenetically regulated, treatment with the demethylating agent DAC showed upregulation of CTCFL in OVCA cell lines.
[0357] CLDN6 (ENSG00000184697; Uniprot:P56747) is one of the 27 members of the CLDN family. CLDN6 (claudin 6) binds to signaling proteins and cytoskeletal proteins and can be involved in cellular responses to external and intracellular signaling. CLDN6 is expressed in various embryonic epithelia, induces epithelial cell junction formation and polarity, and is involved in stem cell differentiation into epithelial cells. CLDN6 is an important component of the CLDN family and plays a substantial role in maintaining the function of tight junctions. In certain tumors, such as liver cancer, ovarian cancer, endometrial cancer, and esophageal cancer, as well as atypical teratomas / rhabdoid tumors, studies have consistently shown that CLDN6 is expressed in tumor tissues but not or at low levels in surrounding tissues. In these tumors, CLDN6 has potential as an oncofetal antigen and therapeutic target.
[0358] In some instances, a protein and the gene encoding the protein may be referred to using the same term. In instances where a protein and the gene encoding the protein are referred to using the same term, one skilled in the art will be able to readily determine whether the protein or the gene is being referred to, depending on the context in which the term is mentioned. Typically, the gene name is written in italics.
[0359] As discussed elsewhere herein, the cancer-associated antigen may be a PRAME antigen or a CTCFL antigen, in other words, the (cancer-associated) antigen may be derived from PRAME and / or CTCFL.
[0360] As used herein, the term "cancer-associated antigen" or "cancer-associated peptide antigen" refers to a naturally occurring or synthetically produced peptide portion of a cancer-associated protein (e.g., antigen) ranging in length from about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, up to about 20 amino acids, which can form a complex with an MHC (e.g., HLA) molecule, and a binding protein of the present disclosure specific for a cancer-associated peptide:MHC (e.g., HLA) complex can specifically bind to such a complex. In other words, the cancer-associated antigen may be derived from a cancer-associated protein (e.g., antigen). The cancer-associated peptide antigen may be a PRAME or CTCFL peptide antigen. In other words, the cancer-associated antigen may be derived from a PRAME protein or a CTCFL protein (see, e.g., SEQ ID NOs: 43-45). Typically, for purposes of the present disclosure, a cancer-associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 43-45, although other cancer-associated peptide antigens are described elsewhere herein. Furthermore, for purposes of this disclosure, a cancer-associated peptide antigen:HLA complex is typically represented by the following structure: LYVDSLFFL:HLA-A * 24:02 Complex, SPSVSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * 02:01 complex, although other cancer-associated peptide antigen:HLA complexes are described elsewhere herein.
[0361] The term "cancer-associated antigen-specific binding protein," as used herein, refers to a protein that binds to a cancer-associated peptide antigen (e.g., PRAME and / or CTCFL peptide antigen) (or to a cancer-associated peptide antigen:HLA complex, e.g., PRAME:HLA-A, on a cell surface). * 24:02 complex, PRAME:HLA-B * 07:02 complex, and / or CTCFL:HLA-A *"Cancerous associated peptide antigen" refers to a protein or polypeptide, such as a TCR or CAR, that specifically binds to a peptide sequence (e.g., PRAME or CTCFL) that does not contain a cancer-associated peptide antigen. Typically, for purposes of this disclosure, a cancer-associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NO:43 to SEQ ID NO:45, and a cancer-associated peptide antigen:HLA complex is, as appropriate, LYVDSLFFL:HLA-A. * 24:02 Complex, SPSVSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * 02:01 complex, although other cancer-associated peptide antigens and cancer-associated peptide antigen:HLA complexes are described elsewhere herein.
[0362] In certain embodiments, the cancer-associated antigen-specific binding protein is about 10 -8 Less than M, about 10 -9 Less than M, about 10 -10 Less than M, about 10 -11 Less than M, about 10 -12 Less than M or about 10 -13 The cancer-associated antigen-specific binding protein specifically binds to a cancer-associated peptide antigen (e.g., a PRAME and / or CTCFL peptide antigen) (or a cancer-associated peptide antigen:HLA complex, e.g., a PRAME:HLA complex and / or a CTCFL:HLA complex) with a Kd of less than M or with an affinity about the same as, at least about the same as, or about the same as or greater than the affinity exhibited by exemplary cancer-associated antigen-specific binding proteins provided herein, such as any of the cancer-associated antigen-specific TCRs provided herein, when measured by the same assay. In certain embodiments, the cancer-associated antigen-specific binding protein comprises a cancer-associated antigen-specific immunoglobulin superfamily binding protein or binding portion thereof. Typically, for purposes of the present disclosure, the cancer-associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs:43 to 45, and the cancer-associated peptide antigen:HLA complex is, as appropriate, LYVDSLFFL:HLA-A. *24:02 Complex, SPSVSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * 02:01 complex, although other cancer-associated peptide antigens and cancer-associated peptide antigen:HLA complexes are described elsewhere herein.
[0363] Selective binding is HLA-A * 24:02, HLA-B * 07:02 or HLA-A * 02:01. In other words, in certain embodiments, a binding protein that "specifically binds to a cancer-associated antigen" may do so only when that antigen is presented by (i.e., bound by) a particular HLA, or when the antigen is in a structural formation equivalent to when presented by a particular HLA. As discussed elsewhere herein, the inventors have demonstrated that the PRAME-derived peptide LYVDSLFFL (SEQ ID NO: 43) binds to HLA-A * 24:02, and that the PRAME-derived peptide SPSVSQLSVL (SEQ ID NO: 44) can be presented by HLA-B * 07:02, and that the CTCFL-derived peptide KLHGILVEA (SEQ ID NO: 45) can be presented by HLA-A * It was identified that it may be presented by 02:01.
[0364] Thus, in certain instances, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 43," may be one that specifically binds to an HLA-A * 24:02 (i.e., it is HLA-A * 24:02) or when it is HLA-A *In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 44," may do so only when it is in a conformation equivalent to that presented by HLA-B 24:02. * 07:02 (i.e., it is HLA-B * 07:02) or when it is HLA-B * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 45," may do so only when it is in a conformation equivalent to that presented by HLA-A 07:02. * 02:01 (i.e., it is HLA-A * 02:01) or when it is HLA-A * They may be so combined only if they are in a structural formation equivalent to that presented by 02:01.
[0365] "Specifically binds to," when it refers to a T cell receptor, or to a recombinant T cell receptor, nucleic acid fragment, variant, or analog, or engineered cell, such as the PRAME or CTCFL T cell receptors herein, and engineered cells expressing PRAME or CTCFL, means that the T cell receptor or fragment thereof recognizes or selectively binds to a particular antigen, such as the PRAME antigen or CTCFL antigen, as appropriate (e.g., the PRAME antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43-44, and the CTCFL antigen comprises the amino acid sequence of SEQ ID NO: 45). Further suitable antigens are described elsewhere herein. Under certain conditions, for example, in an immunoassay, such as the immunoassays discussed herein, the T cell receptor binds to the PRAME antigen or CTCFL antigen (e.g., the PRAME antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43-44, and the CTCFL antigen comprises the amino acid sequence of SEQ ID NO: 45) and does not bind to any significant amount to other polypeptides. Thus, the T cell receptor may bind to the PRAME antigen or CTCFL antigen (e.g., the PRAME antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 43-44, and the CTCFL antigen comprises the amino acid sequence of SEQ ID NO: 45) with at least 10-fold, 100-fold, or 1000-fold greater affinity than a control antigenic polypeptide. This binding may be determined indirectly in the context of engineered T cells expressing a PRAME or CTCFL TCR. For example, in an assay such as those discussed herein, the engineered T cells are specifically reactive to a melanoma cell line (e.g., the SK2.3 cell line) expressing PRAME or CTCFL, as appropriate, or a multiple myeloma cell line (e.g., the U266 cell line) expressing PRAME or CTCFL, as appropriate.Thus, T cells expressing the modified PRAME-TCR or CTCFL-TCR may bind to a melanoma cell line expressing PRAME or CTCFL or a multiple myeloma cell line expressing PAME or CTCFL (e.g., the SK2.3 cell line or the U266 cell line, respectively) with at least 10-fold, 100-fold, or 1000-fold greater reactivity than their reactivity to a control cell line that is not a melanoma cell line expressing PRAME or CTCFL or a multiple myeloma cell line expressing PAME or CTCFL (e.g., the SK2.3 cell line or the U266 cell line, respectively).
[0366] "Nonessential" (or "unimportant") amino acid residues are those that can be altered from a wild-type sequence (e.g., a sequence identified by a SEQ ID NO: herein) without eliminating, or more preferably substantially altering, biological activity, whereas "essential" (or "critical") amino acid residues are subject to such alteration. For example, conserved amino acid residues are predicted to be particularly unamenable to alteration, with the exception that amino acid residues within the hydrophobic core of a domain generally can be substituted by other residues of roughly equivalent hydrophobicity without significantly altering activity.
[0367] A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, non-essential (or non-critical) amino acid residues in a protein are preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly and the resulting mutants screened for activity to identify mutants that retain activity.
[0368] Calculations of sequence homology or identity between sequences (the terms are used interchangeably herein) are performed as follows.
[0369] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second amino acid or nucleic acid sequences for optimal alignment, and non-homologous sequences can be ignored for comparison purposes). In a preferred embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position (as used herein, amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences.
[0370] Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, percent identity between two amino acid sequences is determined using the Needleman et al. (1970) J. Mol. Biol. 48:444-453 algorithm incorporated into the GAP program in the GCG software package (available at http: / / www.gcg.com), using either a BLOSUM 62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http: / / www.gcg.com), using a NWSgapdna.CMP matrix, and gap weights of 40, 50, 60, 70, or 80 and length weights of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the parameters to be used if the practitioner is uncertain as to which parameters to apply to determine whether a molecule is within the sequence identity or homology limits of the invention) is the BLOSUM62 scoring matrix, with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0371] Alternatively, percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers et al. (1989) CABIOS 4:11-17, as incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.
[0372] The nucleic acid and protein sequences described herein can be used, for example, as a "query sequence" to search public databases to identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed using the NBLAST program, score = 100, word length = 12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches can be performed using the XBLAST program, score = 50, word length = 3, to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, gapped BLAST can be utilized as described in Altschul et al. (1997, Nucl. Acids Res. 25:3389-3402). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used.<http: / / www.ncbi.nlm.nih.gov> See.
[0373] The polypeptides and nucleic acid molecules described herein can have amino acid or nucleic acid sequences that are fully or substantially identical to a sequence identified by a SEQ ID NO. The terms "sufficiently identical" or "substantially identical" are used herein to refer to a first amino acid or nucleotide sequence containing a sufficient or minimum number of identical or equivalent amino acid residues or nucleotides (e.g., having similar side chains) relative to a second amino acid or nucleotide sequence, such that the first and second amino acid or nucleotide sequences share a common structural domain or common functional activity. In other words, an amino acid or nucleic acid sequence having one or several (e.g., two, three, four, etc.) amino acid or nucleic acid substitutions compared to the corresponding sequence identified by a SEQ ID NO may be fully or substantially identical to the sequence identified by a SEQ ID NO (provided that they retain the required functionality). In such instances, the one or several (e.g., two, three, four, etc.) amino acid or nucleic acid substitutions may be conservative substitutions. For example, amino acid or nucleotide sequences that contain a common structural domain having at least about 60% or 65% identity, perhaps 75% identity, perhaps 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity are defined herein as sufficiently or substantially identical.
[0374] TCR sequences are defined according to IMGT. For further details, see the references of LeFranc herein: [1] LeFranc M.-P., "Unique database numbering system for immunogenetic analysis," Immunology Today, 18:509 (1997); [2] Lefranc M.-P., "The IMGT unique numbering for immunoglobulins, T cell receptors and Ig-like domains," The immunologist, 7, 132-136 (1999); [3] Lefranc M.-P. et al., “IMGT unique numbering for immunoglobulin and Tcell receptor variable domains and Ig superfamily V-like domains” Dev.Comp.Immunol., 27, 55-77 (2003), [4] Lefranc M.-P. et al., “IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains” Dev.Comp.Immunol., 2005, 29, 185-203 PMID:15572068 See.
[0375] As used herein, the term "ex vivo" refers to "outside" the body. The term "in vitro" can be used to encompass "ex vivo" components, compositions and methods.
[0376] Further binding proteins, vector systems, modified cells, isolated peptides and uses thereof As described elsewhere herein, the inventors have identified several novel peptides encoded by OVCA-associated genes (e.g., presented by HLA class I molecules). The peptides SPSVSQLSVL (SEQ ID NO:44) and KLHGILVEA (SEQ ID NO:45) are discussed in detail above, but these peptides are also discussed herein in the context of additional binding proteins, vector systems, modified cells, isolated peptides and their uses.
[0377] The present inventors have identified the following novel peptides encoded by OVCA-associated genes that are presented by HLA class I: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72), and DSKARLVL (SEQ ID NO: 74). These peptides are derived from either PRAME, CTCFL, or CLDN6, which the present inventors have identified as ovarian cancer-associated antigens.
[0378] Advantageously, peptides derived from the cancer-associated antigens PRAME, CTCFL, and CLDN6 can be used as therapeutics (e.g., vaccines) to treat or prevent a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition (e.g., to induce or enhance an immune response in a human subject diagnosed with a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition, as appropriate). Thus, the peptides themselves have utility, for example, in isolated form or when formulated as pharmaceutical compositions. Alternatively, they can be used as target antigens for treatment of patients with engineered cells described herein (e.g., peripheral blood lymphocytes or tumor-infiltrating lymphocytes (TILs)) that have a T cell receptor that specifically recognizes one of the above-specified peptides.
[0379] Accordingly, an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, comprising: A nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a peptide selected from the group consisting of SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72), and DSKARLVL (SEQ ID NO: 74). Also provided is a nucleic acid composition comprising:
[0380] Also provided is an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain (i.e., a PRAME antigen-specific binding protein), the nucleic acid composition comprising a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence, both of which specifically bind to SPSVSQLSVL (SEQ ID NO: 44).
[0381] Also provided is an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain (i.e., a CTCFL antigen-specific binding protein), the nucleic acid composition comprising a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a peptide selected from the group consisting of CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), and AETTGLIKL (SEQ ID NO: 71).
[0382] Also provided is an isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein (i.e., a CLDN6 antigen-specific binding protein) having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, the nucleic acid composition comprising a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence, both of which specifically bind to a peptide selected from the group consisting of GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).
[0383] Nucleic acid compositions encoding binding protein components (e.g., nucleic acid compositions encoding cancer-associated antigen-specific binding proteins) are described elsewhere herein. The information, definitions, and examples provided elsewhere herein regarding nucleic acid compositions encoding binding protein components (e.g., nucleic acid compositions encoding cancer-associated antigen-specific binding proteins) apply equally here, i.e., cancer-associated antigens include PRAME, CTCFL, or CLDN6, or antigens or peptides thereof (e.g., cancer-associated antigens include peptides selected from the group consisting of SPSVSQLSVL (SEQ ID NO:44), CSAVFHERY (SEQ ID NO:68), RSDEIVLTV (SEQ ID NO:69), KLHGILVEA (SEQ ID NO:45), HAYSAAELK (SEQ ID NO:75), SVLSEQFTK (SEQ ID NO:76), KYASVEASKL (SEQ ID NO:77), DSKLAVSL (SEQ ID NO:70), AETTGLIKL (SEQ ID NO:71), GPSEYPTKNYV (SEQ ID NO:72), and DSKARLVL (SEQ ID NO:74)).
[0384] The present inventors have demonstrated that peptide SPSVSQLSVL (SEQ ID NO: 44) binds to HLA-B * 07:02, and CSAVFHERY (SEQ ID NO: 68) is HLA-A * 01:01 and RSDEIVLTV (SEQ ID NO: 69) is presented by HLA-A * 01:01 and KLHGILVEA (SEQ ID NO: 45) is presented by HLA-A * 02:01 and HAYSAAELK (SEQ ID NO: 75) is presented by HLA-A * 03:01 and SVLSEQFTK (SEQ ID NO: 76) is presented by HLA-A * 03:01 and KYASVEASKL (SEQ ID NO: 77) is presented by HLA-A * 24:02 and DSKLAVSL (SEQ ID NO: 70) is presented by HLA-B * 08:01, and AETTGLIKL (SEQ ID NO: 71) is presented by HLA-B * 40:01 and GPSEYPTKNYV (SEQ ID NO: 72) is presented by HLA-A *01:01 and DSKARLVL (SEQ ID NO: 74) is presented by HLA-B * 08:01. Accordingly, specific binding to any one of these peptides may occur in the context of the appropriate HLA (i.e., specific binding to a peptide may occur only if the peptide is presented by the appropriate HLA).
[0385] As described elsewhere herein, the present invention provides specific peptides in association with the appropriate serotype of MHC, i.e., HLA-B. * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * The present invention is directed to nucleic acid compositions encoding binding proteins comprising a TCR component that interacts with a cancer-associated antigen (e.g., PRAME, CTCFL, or CLDN6) in association with 40:01 (in other words, the encoded binding protein is capable of specifically binding to a cancer-associated antigen (e.g., PRAME, CTCFL, or CLDN6):specific HLA complex). In one example, the present invention provides nucleic acid compositions encoding specific peptides in association with appropriate serotypes of MHC, i.e., HLA-B. * SPSVSQLSVL (SEQ ID NO: 44) in association with 07:02, HLA-A * CSAVFHERY (SEQ ID NO: 68) in association with 01:01, HLA-A * RSDEIVLTV (SEQ ID NO: 69) in association with 01:01, HLA-A * KLHGILVEA (SEQ ID NO: 45) in association with 02:01, HLA-A * HAYSAAELK (SEQ ID NO: 75) in association with 03:01, HLA-A * SVLSEQFTK (SEQ ID NO: 76) in association with 03:01, HLA-A * KYASVEASKL (SEQ ID NO: 77) in association with 24:02, HLA-B * DSKLAVSL (SEQ ID NO: 70) in association with 08:01, HLA-B* AETTGLIKL (SEQ ID NO: 71) in association with 40:01, HLA-A * GPSEYPTKNYV (SEQ ID NO: 72) or HLA-B in association with 01:01 * The present invention relates to nucleic acid compositions encoding binding proteins comprising TCR components that interact with DSKARLVL (SEQ ID NO: 74) in the context of 08:01.
[0386] HLA-A * 02:01, HLA-A * 24:02, and HLA-B * 07:02 is described elsewhere herein.
[0387] HLA-A * 01:01, HLA-A * 03:01, HLA-B * 08:01 and HLA-B * 40:01 is also a common human leukocyte antigen serotype within the HLA-A and HLA-B serogroups.
[0388] HLA-A * 01:01, HLA-A * 03:01, HLA-B * 08:01 or HLA-B * The peptides presented to TCR by 40:01 are each expressed as "HLA-A * 01:01Restrictiveness”, “HLA-A * 03:01Restrictiveness”, “HLA-B * 08:01 Restricted" or "HLA-B * 40:01 Restrictive" is described.
[0389] HLA-A * 01:01 is also referred to herein as HLA-A1, HLA-A * 03:01 is also referred to herein as HLA-A3 and HLA-B * 08:01 is also referred to herein as HLA-B8, * 40:01 is also referred to herein as HLA-B40.
[0390] As described herein, the inventors have identified HLA-B * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * The present inventors have identified several cancer-associated antigen (e.g., PRAME, CTCFL, and CLDN6)-derived peptides that are presented on malignant cells at 40:01. The present inventors have identified the PRAME-derived peptide of SEQ ID NO: 44, the CTCFL-derived peptides of SEQ ID NOs: 68 to 71, SEQ ID NOs: 45, and SEQ ID NOs: 75 to 77, and the CLDN6-derived peptides of SEQ ID NOs: 72 and 74.
[0391] Thus, a cancer-associated antigen that is specifically bound by a binding protein described herein may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74. The antigen may be an antigenic fragment (i.e., portion) of an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74, or the antigen may comprise (i.e., be contained within a longer sequence) an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74. The present inventors have demonstrated that the PRAME-derived peptide SPSVSQLSVL (SEQ ID NO: 44) binds to HLA-B * 07:02, and that the CTCFL-derived peptide CSAVFHERY (SEQ ID NO: 68) is capable of being presented by HLA-A *01:01, and that the CTCFL-derived peptide RSDEIVLTV (SEQ ID NO: 69) can be presented by HLA-A * 01:01, and that the CTCFL-derived peptide KLHGILVEA (SEQ ID NO: 45) can be presented by HLA-A * 02:01, and that the CTCFL-derived peptide HAYSAAELK (SEQ ID NO: 75) can be presented by HLA-A * 03:01, and that the CTCFL-derived peptide SVLSEQFTK (SEQ ID NO: 76) can be presented by HLA-A * 03:01, and that the CTCFL-derived peptide KYASVEASKL (SEQ ID NO: 77) can be presented by HLA-A * 24:02, and that the CTCFL-derived peptide DSKLAVSL (SEQ ID NO: 70) can be presented by HLA-B * 08:01, and that the CTCFL-derived peptide AETTGLIKL (SEQ ID NO: 71) can be presented by HLA-B * 40:01, and that the CLDN6-derived peptide GPSEYPTKNYV (SEQ ID NO: 72) can be presented by HLA-A * 01:01, and that the CDLN6-derived peptide DSKARLVL (SEQ ID NO: 74) can be presented by HLA-B * It was determined that it could be presented by 08:01.
[0392] Thus, in one example, the encoded binding protein is SPSVSQLSVL:HLA-B * 07:02 complex, CSAVFHERY:HLA-A * 01:01 complex, RSDEIVLTV:HLA-A * 01:01 complex, KLHGILVEA:HLA-A * 02:01 complex, HAYSAAELK:HLA-A * 03:01 complex, SVLSEQFTK:HLA-A * 03:01 complex, KYASVEASKL:HLA-A *24:02 complex, DSKLAVSL:HLA-B * 08:01 complex, AETTGLIKL:HLA-B * 40:01 complex, GPSEYPTKNYV:HLA-A * 01:01 complex and DSKARLVL:HLA-B * The peptide is capable of specifically binding to a peptide:HLA complex selected from the group consisting of the 08:01 complex.
[0393] In one example, the cancer-derived peptide of the peptide:HLA complex (e.g., a PRAME-derived peptide, a CTCFL-derived peptide, or a CLDN6-derived peptide) comprises an antigenic fragment of an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74. In a further example, the cancer-derived peptide of the peptide:HLA complex (e.g., a PRAME-derived peptide, a CTCFL-derived peptide, or a CLDN6 peptide) comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74.
[0394] As described elsewhere herein, the nucleic acid compositions may further comprise a TCR alpha chain constant domain and / or a TCR beta chain constant domain. Examples of suitable constant domains are described elsewhere herein and may be used in the context of a nucleic acid composition that specifically binds to a cancer-associated antigen comprising a peptide selected from the group consisting of SPSVSQLSVL (SEQ ID NO:44), CSAVFHERY (SEQ ID NO:68), RSDEIVLTV (SEQ ID NO:69), KLHGILVEA (SEQ ID NO:45), HAYSAAELK (SEQ ID NO:75), SVLSEQFTK (SEQ ID NO:76), KYASVEASKL (SEQ ID NO:77), DSKLAVSL (SEQ ID NO:70), AETTGLIKL (SEQ ID NO:71), GPSEYPTKNYV (SEQ ID NO:72), and DSKARLVL (SEQ ID NO:74), as will be apparent to one of skill in the art.
[0395] As described in more detail elsewhere herein, the nucleic acid compositions described herein encode both a TCR Vα domain and a TCR Vβ domain that form a binding protein capable of specifically binding to a cancer-associated antigen. In instances where the TCR Vα domain and the TCR Vβ domain are encoded by the same nucleic acid sequence, the TCR Vα domain and the TCR Vβ domain may be linked to each other via a linker. Suitable linkers are generally discussed elsewhere herein. Additional suitable polypeptide domains that may also be encoded by the nucleic acid sequences encoding the TCR Vα domain and / or the TCR Vβ domain are also generally discussed elsewhere herein.
[0396] In one example, the nucleic acid compositions described herein may encode a soluble TCR, or a chimeric single chain TCR in which a TCR alpha chain variable domain is linked to a TCR beta chain variable domain and a constant domain fused to, for example, a CD3 zeta signaling domain, as generally discussed in more detail elsewhere herein.
[0397] Also provided are vector systems comprising the nucleic acid compositions described herein.
[0398] Modified cells comprising the nucleic acid compositions described herein or the vector systems described herein are also provided.
[0399] Vector systems and modified cells are described elsewhere herein, and the information, definitions, and examples provided elsewhere herein regarding vector systems and modified cells apply equally here (e.g., cancer-associated antigens include, e.g., PRAME, CTCFL, or CLDN6, or antigens or peptides thereof, associated with an ovarian cancer-associated antigen-specific binding protein that specifically binds to a peptide selected from the group consisting of SPSVSQLSVL (SEQ ID NO:44), CSAVFHERY (SEQ ID NO:68), RSDEIVLTV (SEQ ID NO:69), KLHGILVEA (SEQ ID NO:45), HAYSAAELK (SEQ ID NO:75), SVLSEQFTK (SEQ ID NO:76), KYASVEASKL (SEQ ID NO:77), DSKLAVSL (SEQ ID NO:70), AETTGLIKL (SEQ ID NO:71), GPSEYPTKNYV (SEQ ID NO:72), and DSKARLVL (SEQ ID NO:74)).
[0400] In some examples, the at least one exogenous nucleic acid sequence comprised in the modified cell may be at least one component portion of an ovarian cancer-associated antigen-specific binding protein (e.g., a sequence encoding a CDR3 sequence specific for a cancer-associated antigen (e.g., PRAME, CTCFL, or CLDN6, e.g., a peptide of SEQ ID NO: 44, SEQ ID NO: 68-71, SEQ ID NO: 45, SEQ ID NO: 75-77, SEQ ID NO: 72, or SEQ ID NO: 74)).
[0401] In the context of the therapeutic methods described herein, the host cells (and thus the modified cells) are HLA-B * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * 40:01 positive human subjects. With this in mind, the host cells (and thus the modified cells) may be HLA-B positive or HLA-B positive. * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A *03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * The modified cells may be 40:01 positive but must be cancer-associated antigen (e.g., PRAME, CTCFL, or CLDN6) negative (i.e., the modified cells are HLA-B * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * 40:01 may be either positive or negative).
[0402] Advantageously, the modified cells are capable of expressing the binding proteins (i.e., TCR component portions) encoded by the nucleic acid compositions or vector systems described herein, such that the modified cells provide immunotherapy that specifically targets cells that express a cancer-associated antigen (e.g., PRAME, CTCFL, or CLDN6), and thus bind to the corresponding HLA-B. * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * It can be used to treat or prevent a PRAME-, CTCFL- or CLDN6-related disease or condition in a 40:01-positive human subject. Further details regarding this use are provided below.
[0403] As discussed elsewhere herein, the inventors have identified peptides encoded by OVCA-associated genes that are presented by HLA class I, namely SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).
[0404] Accordingly, the present invention also provides an isolated peptide comprising an amino acid sequence selected from the group consisting of: (i) SPSVSQLSVL (SEQ ID NO:44), (ii) CSAVFHERY (SEQ ID NO:68), (iii) RSDEIVLTV (SEQ ID NO:69), (iv) KLHGILVEA (SEQ ID NO:45), (v) HAYSAAELK (SEQ ID NO:75), (vi) SVLSEQFTK (SEQ ID NO:76), (vii) KYASVEASKL (SEQ ID NO:77), (viii) DSKLAVSL (SEQ ID NO:70), (ix) AETTGLIKL (SEQ ID NO:71), (x) GPSEYPTKNYV (SEQ ID NO:72), and (xi) DSKARLVL (SEQ ID NO:74).
[0405] Also provided is an isolated (PRAME-derived) peptide comprising the amino acid sequence of SPSVSQLSVL (SEQ ID NO: 44).
[0406] Also provided is an isolated (CTCFL-derived) peptide comprising an amino acid sequence selected from the group consisting of CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70) and AETTGLIKL (SEQ ID NO: 71).
[0407] Also provided is an isolated (CLDN6-derived) peptide comprising an amino acid sequence selected from the group consisting of GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).
[0408] As used herein, an "isolated peptide" refers to a peptide that is not in its natural environment. Thus, the peptide may be of synthetic origin (or of natural origin but isolated from its natural environment).
[0409] Isolated peptides may be relatively short (i.e., 20 or fewer amino acids, e.g., 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, or 10 or fewer amino acids). The peptide may consist solely of the amino acid sequence of (i) SPSVSQLSVL (SEQ ID NO:44), (ii) CSAVFHERY (SEQ ID NO:68), (iii) RSDEIVLTV (SEQ ID NO:69), (iv) KLHGILVEA (SEQ ID NO:45), (v) HAYSAAELK (SEQ ID NO:75), (vi) SVLSEQFTK (SEQ ID NO:76), (vii) KYASVEASKL (SEQ ID NO:77), (viii) DSKLAVSL (SEQ ID NO:70), (ix) AETTGLIKL (SEQ ID NO:71), (x) GPSEYPTKNYV (SEQ ID NO:72), or (xi) DSKARLVL (SEQ ID NO:74).
[0410] The isolated peptide may be administered to a human subject to treat or prevent a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition. For example, the isolated peptide may be administered to a subject to induce or enhance an immune response in the subject. Thus, the peptide may be administered to a subject to induce T cell activation (e.g., in vivo T cell activation) in the subject, where the activated T cells are specific for the peptide (and thus specifically target a cancer-associated antigen).
[0411] The isolated peptide may be administered as a peptide vaccine to treat or prevent a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition. The isolated peptide may be administered to induce or enhance activation of T cells specific for PRAME-, CTCFL-, or CLDN6-positive malignant cells.
[0412] The inventors have shown that the peptides described herein are ovarian cancer-associated peptides (e.g., PRAME-, CTCFL-, or CLDN6-derived peptides that bind to T cells). In some instances, these peptides are presented in vivo to the T cell repertoire of PRAME-, CTCFL-, or CLDN6-positive subjects. It has been demonstrated herein that some of these peptides bind to T cells. Thus, these peptides represent authentic, immunogenic OVCA-specific antigens that may be further utilized in the development of personalized vaccines, which may be particularly useful as adjuvants to other therapies (e.g., ACTs described herein). These immunogenic peptides can therefore be used as immunotherapies in the form of peptide-, RNA-, DNA-, dendritic cell-, and adoptive TCR-transgenic T cell-based therapies (for a suitable review, see Reference 23).
[0413] Thus, an isolated peptide comprising an amino acid sequence selected from the group consisting of (i) SPSVSQLSVL (SEQ ID NO:44), (ii) CSAVFHERY (SEQ ID NO:68), (iii) RSDEIVLTV (SEQ ID NO:69), (iv) KLHGILVEA (SEQ ID NO:45), (v) HAYSAAELK (SEQ ID NO:75), (vi) SVLSEQFTK (SEQ ID NO:76), (vii) KYASVEASKL (SEQ ID NO:77), (viii) DSKLAVSL (SEQ ID NO:70), (ix) AETTGLIKL (SEQ ID NO:71), (x) GPSEYPTKNYV (SEQ ID NO:72), and (xi) DSKARLVL (SEQ ID NO:74) may be useful as an immunotherapy. For example, such an isolated peptide may be used as an immunotherapy for a subject having, at risk of developing, or suspected of having a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition. Nucleic acid sequences and vectors encoding these peptides may also be useful for this purpose.
[0414] The particular peptide for administration may be selected based on the subject's HLA-A status. As described elsewhere herein, peptides comprising the sequence SPSVSQLSVL (SEQ ID NO: 44) inhibit HLA-B * The peptide comprising the sequence CSAVFHERY (SEQ ID NO: 68) may be particularly suitable for administration to subjects who are 07:02 positive, and is associated with HLA-A * It may be particularly suitable for administration to subjects who are 01:01 positive, and peptides comprising the sequence RSDEIVLTV (SEQ ID NO: 69) are known to bind to HLA-A * It may be particularly suitable for administration to subjects who are 01:01 positive, and peptides comprising the sequence KLHGILVEA (SEQ ID NO: 45) are known to bind to HLA-A * The peptide comprising the sequence HAYSAAELK (SEQ ID NO: 75) may be particularly suitable for administration to subjects who are 02:01 positive, and is associated with HLA-A * The peptide comprising the sequence SVLSEQFTK (SEQ ID NO: 76) may be particularly suitable for administration to subjects who are 03:01 positive, and is associated with HLA-A *The peptide may be particularly suitable for administration to subjects who are 03:01 positive, and includes the sequence KYASVEASKL (SEQ ID NO: 77), which binds to HLA-A * It may be particularly suitable for administration to subjects who are 24:02 positive, and peptides comprising the sequence DSKLAVSL (SEQ ID NO: 70) are known to bind to HLA-B * It may be particularly suitable for administration to subjects who are 08:01 positive, and peptides comprising the sequence AETTGLIKL (SEQ ID NO: 71) are known to bind to HLA-B * The peptide comprising the sequence GPSEYPTKNYV (SEQ ID NO: 72) may be particularly suitable for administration to subjects who are 40:01 positive, and is associated with HLA-A * It may be particularly suitable for administration to subjects who are 01:01 positive, and peptides comprising the sequence DSKARLVL (SEQ ID NO: 74) are known to bind to HLA-B * It may be particularly suitable for administration to subjects who are 08:01 positive.
[0415] The isolated peptides of the present invention may also be provided in a composition comprising a plurality of the peptides discussed above. Thus, any combination of one or more peptides selected from (i) to (xi) may be provided in the composition.
[0416] Isolated nucleic acid sequences encoding the peptides described herein are provided.
[0417] Also provided are vector systems comprising the nucleic acid sequences described herein (e.g., isolated nucleic acid sequences encoding the peptides described herein). Vector systems are described elsewhere herein, and the information, definitions, and examples provided elsewhere herein regarding vector systems apply equally here (e.g., cancer-associated antigens include, for example, PRAME, CTCFL, or CLDN6, or antigens or peptides thereof, in conjunction with vector systems comprising isolated nucleic acid sequences encoding the peptides described herein).
[0418] The nucleic acid compositions, vector systems, modified cells, isolated peptides, or isolated nucleic acid sequences described herein may be provided as part of a pharmaceutical composition. Advantageously, such compositions may be administered to a human subject in need thereof (as described elsewhere herein). Particularly suitable compositions may be selected based on the HLA serotype of the human subject, as described in detail elsewhere herein.
[0419] Thus, pharmaceutical compositions may include the nucleic acid compositions, vector systems, modified cells, isolated peptides or isolated nucleic acid sequences described herein together with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.
[0420] Pharmaceutical compositions are described elsewhere herein, and the information, definitions, and examples provided elsewhere herein regarding pharmaceutical compositions apply equally here (e.g., cancer-associated antigens include PRAME, CTCFL, or CLDN6, or antigens or peptides thereof, in the context of a pharmaceutical composition comprising, e.g., a nucleic acid composition, vector system, modified cell, isolated peptide, or isolated nucleic acid sequence described herein, together with a pharmaceutically acceptable excipient, adjuvant, diluent, and / or carrier).
[0421] In some examples, the pharmaceutical composition is formulated as a vaccine (e.g., the pharmaceutical composition comprises an isolated peptide described herein, a nucleic acid sequence encoding an isolated peptide described herein, or a vector system comprising the isolated nucleic acid sequence).
[0422] The pharmaceutical compositions described herein advantageously contain the required HLA-B * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B *It may be administered to 40:01-positive human subjects (certain compositions may be more suitable for particular human subjects based on the HLA status of the human subject, as described in more detail elsewhere herein).
[0423] Treatment of a subject is described elsewhere herein, and the information, definitions, and examples provided elsewhere herein regarding treatment of a subject apply equally here (e.g., cancer-associated antigens include PRAME, CTCFL, or CLDN6, or antigens or peptides thereof, e.g., in the context of pharmaceutical compositions comprising the nucleic acid compositions, vector systems, modified cells, isolated peptides, or isolated nucleic acid sequences described herein, together with a pharmaceutically acceptable excipient, adjuvant, diluent, and / or carrier).
[0424] Thus, as described elsewhere herein, typically, the subject in need of treatment has a disease or condition associated with elevated levels of an HLA-restricted cancer-associated antigen (i.e., a cancer-associated antigen that is presented on the cell surface in the context of an HLA), such as a PRAME, CTCFL, and / or CLDN6 antigen that is presented on the cell surface in the context of an HLA. Thus, in some examples, the subject in need of treatment has a disease or condition associated with elevated levels of the HLA-restricted PRAME antigen, elevated levels of the HLA-restricted CTCFL antigen, or elevated levels of the HLA-restricted CLDN6 antigen.
[0425] The disease or condition is typically a PRAME-associated disease or condition, a CTCFL-associated disease or condition, and / or a CLDN6-associated disease or condition. In one example, the disease or condition is a CLDN6-associated disease or condition.
[0426] Thus, in one example, the pharmaceutical compositions described herein are for use in the treatment or prevention of a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition in a subject.
[0427] Also provided is a method for treating or preventing a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition in a subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein. Preferably, the method may induce or enhance a cellular immune response in the subject.
[0428] Also provided is a method of inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0429] Also provided is a method of stimulating a cellular immune response against a target cell population or tissue in a human subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0430] Also provided is a method of providing anti-tumor immunity in a human subject, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0431] Also provided are methods for treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME antigen, elevated levels of HLA-restricted CTCFL antigen, or elevated levels of HLA-restricted CLDN6 antigen, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.
[0432] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for treating or preventing a PRAME-associated disease or condition, or a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition in a subject.
[0433] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition.
[0434] There is also provided the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
[0435] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in providing anti-tumor immunity to a human subject.
[0436] Also provided is the use of a pharmaceutical composition described herein in the manufacture of a medicament for use in treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME antigen, elevated levels of HLA-restricted CTCFL antigen or elevated levels of HLA-restricted CLDN6 antigen.
[0437] In one example, the PRAME-associated disease or condition, CTCFL-associated disease or condition, or CLDN6-associated disease or condition may be a hyperproliferative disease or condition. A PRAME-associated disease or condition, CTCFL-associated disease or condition, or CLDN6-associated disease or condition (e.g., a hyperproliferative disease or condition) is typically one in which an HLA-restricted cancer-associated antigen described herein is presented on the cell surface in the context of an HLA, e.g., one in which a PRAME, CTCFL, or CLDN6 antigen is presented on the cell surface in the context of an HLA.
[0438] Suitable examples of suitable PRAME-associated diseases or conditions or CTCFL-associated diseases or conditions are described elsewhere herein and apply equally here.
[0439] In one example, the PRAME-associated disease or condition, CTCFL-associated disease or condition, and / or CLDN6-associated disease or condition can be a hematological malignancy, e.g., a hematological malignancy with elevated levels of the HLA-restricted CLDN6 antigen.
[0440] In an alternative example, the PRAME-associated disease or condition, CTCFL-associated disease or condition, and / or CLDN6-associated disease or condition may be a solid tumor, for example, it may be a solid tumor with elevated levels of the HLA-restricted CLDN6 antigen.
[0441] The PRAME-associated disease or condition, CTCFL-associated disease or condition, or CLDN6-associated disease or condition may be a hyperproliferative disease or condition. For example, the CLDN6-associated disease or condition may be a tumor or cancer that expresses the HLA-restricted CLDN6 antigen. In other words, the CLDN6-associated disease or condition may be a CLDN6-positive tumor or cancer.
[0442] In one example, the pharmaceutical compositions provided herein are for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition.
[0443] As will be apparent to one of skill in the art, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) for a subject in need may be selected based on the subject's HLA serotype.
[0444] In one example, a subject in need may have HLA-B * If the test is 07:02 positive, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) may include components of the TCR clone 8.10C4 exemplified herein. Thus, a TCR including components of the TCR clone 8.10C4 exemplified herein may be used to treat HLA-B *07:02 is particularly suitable for administration to positive human subjects, or for treating, stimulating, or providing appropriate immunity (e.g., anti-tumor immunity, etc.).
[0445] In one example, a subject in need may have HLA-A * If the patient is 02:01 positive, an appropriate therapy (e.g., an appropriate pharmaceutical composition described herein) may include components of the TCR clone 39.2E12 exemplified herein. Thus, a TCR including components of the TCR clone 39.2E12 exemplified herein may bind to HLA-A * 02:01 is particularly suitable for administration to, or for treating, stimulating, providing appropriate immunity (e.g., anti-tumor immunity, etc.) in positive human subjects.
[0446] It will be apparent to those skilled in the art that certain compositions are more suitable for treating certain diseases or conditions. For example, a composition comprising a PRAME-binding protein, a nucleic acid component encoding it, or a PRAME-derived peptide is particularly suitable for treating a PRAME-related disease or condition. Similarly, a composition comprising a CTCFL-binding protein, a nucleic acid component encoding it, or a CTCFL-derived peptide is particularly suitable for treating a CTCFL-related disease or condition. Similarly, a composition comprising a CLDN6-binding protein, a nucleic acid component encoding it, or a CLDN6-derived peptide is particularly suitable for treating a CLDN6-related disease or condition. Specific examples of PRAME-binding proteins, CTCFL-binding proteins, and CLDN6-binding proteins, PRAME peptides, CTCFL peptides, and CLDN6 peptides are provided herein.
[0447] In another example, the pharmaceutical composition may be for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
[0448] In one example, the target cell population or tissue may be a target cell population or tissue containing a tumor or cancer that expresses an HLA-restricted PRAME antigen, an HLA-restricted CTCFL antigen, or an HLA-restricted CLDN6 antigen.
[0449] The pharmaceutical composition may be for use in providing anti-tumor immunity to a human subject. For example, the pharmaceutical composition may be for use in providing anti-tumor immunity against a tumor in which the HLA-restricted PRAME antigen, HLA-restricted CTCFL antigen, or HLA-restricted CLDN6 antigen described herein is presented on the cell surface in the context of HLA.
[0450] In another example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of an HLA-restricted cancer-associated antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of an HLA-restricted PRAME antigen, elevated levels of an HLA-restricted CTCFL antigen, or elevated levels of an HLA-restricted CLDN6 antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with elevated levels of HLA-restricted PRAME, CTCFL, and / or CLDN6 (e.g., HLA-restricted PRAME antigen, HLA-restricted CTCFL antigen, or HLA-restricted CLDN6 antigen).
[0451] Those skilled in the art will be well aware of PRAME-related diseases or conditions, CTCFL-related diseases or conditions, and CLDN6-related diseases or conditions that may be treated in accordance with the present invention. Suitable examples of such diseases or conditions are discussed elsewhere herein.
[0452] As will be apparent to one skilled in the art, a PRAME-associated disease or condition, a CTCFL-associated disease or condition, or a CLDN6-associated disease or condition may involve at least one tumor (particularly at least one HLA-restricted PRAME antigen-expressing tumor, at least one HLA-restricted CTCL antigen-expressing tumor, or at least one CLDN6 antigen-expressing tumor), for example, an HLA-restricted PRAME antigen, an HLA-restricted CTCFL antigen-expressing tumor, and / or an HLA-restricted CTCFL antigen.
[0453] Advantageously, the compositions described herein may be formulated for use in T cell receptor (TCR) gene transfer, an approach that is rapid, reliable, and capable of generating large numbers of T cells with specificity for a cancer-associated antigenic peptide (e.g., a peptide set forth in any one of SEQ ID NO:44, SEQ ID NO:68-SEQ ID NO:71, SEQ ID NO:45, SEQ ID NO:75-SEQ ID NO:77, SEQ ID NO:72, and SEQ ID NO:74), regardless of the patient's preexisting immune repertoire. Using TCR gene transfer, modified cells suitable for infusion may be generated within a few days.
[0454] Advantageously, the compositions of the present invention may be formulated for use as a vaccine (e.g., a composition comprising one or more peptides selected from the group consisting of (i) SPSVSQLSVL (SEQ ID NO: 44), (ii) CSAVFHERY (SEQ ID NO: 68), (iii) RSDEIVLTV (SEQ ID NO: 69), (iv) KLHGILVEA (SEQ ID NO: 45), (v) HAYSAAELK (SEQ ID NO: 75), (vi) SVLSEQFTK (SEQ ID NO: 76), (vii) KYASVEASKL (SEQ ID NO: 77), (viii) DSKLAVSL (SEQ ID NO: 70), (ix) AETTGLIKL (SEQ ID NO: 71), (x) GPSEYPTKNYV (SEQ ID NO: 72), and (xi) DSKARLVL (SEQ ID NO: 74) may be formulated as a pharmaceutical composition suitable for use as a peptide vaccine). Suitable peptide vaccine formulations are well known in the art.
[0455] Also provided is a method of producing a binding protein that can specifically bind to a peptide that comprises a cancer associated antigen, and that does not bind to a peptide that does not comprise the cancer associated antigen, comprising the step of contacting a nucleic acid composition (or vector system) described herein with a cell under conditions such that the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer associated antigen is a peptide selected from the group consisting of SPSVSQLSVL (SEQ ID NO:44), CSAVFHERY (SEQ ID NO:68), RSDEIVLTV (SEQ ID NO:69), KLHGILVEA (SEQ ID NO:45), HAYSAAELK (SEQ ID NO:75), SVLSEQFTK (SEQ ID NO:76), KYASVEASKL (SEQ ID NO:77), DSKLAVSL (SEQ ID NO:70), AETTGLIKL (SEQ ID NO:71), GPSEYPTKNYV (SEQ ID NO:72), and DSKARLVL (SEQ ID NO:74).
[0456] Methods for producing binding proteins are described elsewhere herein, and information, definitions, and examples provided elsewhere herein regarding methods for producing binding proteins apply equally here (e.g., a cancer associated antigen can, for example, specifically bind to a peptide containing the cancer associated antigen, and not to a peptide that does not contain the cancer associated antigen, the method comprising contacting a nucleic acid composition (or vector system) described herein with a cell under conditions such that the nucleic acid composition is incorporated and expressed by the cell, the cancer associated antigen being a peptide having the structure SPSVSQLSVL (SEQ ID NO: 1). No. 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74), including PRAME, CTCFL or CLDN6, or an antigen or peptide thereof.
[0457] In the context of the binding proteins described herein, the cancer associated antigen may comprise or consist of an amino acid sequence selected from the group consisting of SEQ ID NO:44, SEQ ID NO:68 to SEQ ID NO:71, SEQ ID NO:45, SEQ ID NO:75 to SEQ ID NO:77, SEQ ID NO:72 and SEQ ID NO:74, or a sequence comprising a functional fragment or variant thereof.
[0458] General definitions are provided elsewhere herein. The information, definitions, and examples provided in the General Definitions section above apply equally here (e.g., cancer-associated antigen includes PRAME, CTCFL, or CLDN6, or antigens or peptides thereof).
[0459] Thus, the cancer-associated antigen may be a PRAME antigen, a CTCFL antigen or a CLDN6 antigen. In other words, the (cancer-associated) antigen may be derived from PRAME, CTCFL and / or CLDN6.
[0460] The cancer-associated peptide antigen may be a PRAME, CTCFL, or CLDN6 peptide antigen. In other words, the cancer-associated antigen may be derived from the PRAME protein, the CTCFL protein, and / or the CLDN6 protein (see, e.g., SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74). The cancer-associated peptide antigen may comprise or consist of an amino acid sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 68 to SEQ ID NO: 71, SEQ ID NO: 45, SEQ ID NO: 75 to SEQ ID NO: 77, SEQ ID NO: 72, and SEQ ID NO: 74. Furthermore, for purposes of the present disclosure, the cancer-associated peptide antigen:HLA complex is defined as SPSVSQLSVL:HLA-B * 07:02 complex, CSAVFHERY:HLA-A * 01:01 complex, RSDEIVLTV:HLA-A * 01:01 complex, KLHGILVEA:HLA-A * 02:01 complex, HAYSAAELK:HLA-A * 03:01 complex, SVLSEQFTK:HLA-A *03:01 complex, KYASVEASKL:HLA-A * 24:02 complex, DSKLAVSL:HLA-B * 08:01 complex, AETTGLIKL:HLA-B * 40:01 complex, GPSEYPTKNYV:HLA-A * 01:01 complex and DSKARLVL:HLA-B * The peptide:HLA complex may comprise a peptide:HLA complex selected from the group consisting of the 08:01 complex.
[0461] The term "cancer-associated specific binding protein" is defined elsewhere herein and refers to the CLDN6 antigen (or CLDN6:HLA-A * 01:01 complex or CLDN6:HLA-B * The cancer-associated peptide antigen may comprise or consist of an amino acid sequence selected from the group consisting of SEQ ID NO:44, SEQ ID NO:68 to SEQ ID NO:71, SEQ ID NO:45, SEQ ID NO:75 to SEQ ID NO:77, SEQ ID NO:72, and SEQ ID NO:74, and the cancer-associated peptide antigen:HLA complex is SPSVSQLSVL:HLA-B. * 07:02 complex, CSAVFHERY:HLA-A * 01:01 complex, RSDEIVLTV:HLA-A * 01:01 complex, KLHGILVEA:HLA-A * 02:01 complex, HAYSAAELK:HLA-A * 03:01 complex, SVLSEQFTK:HLA-A * 03:01 complex, KYASVEASKL:HLA-A * 24:02 complex, DSKLAVSL:HLA-B * 08:01 complex, AETTGLIKL:HLA-B * 40:01 complex, GPSEYPTKNYV:HLA-A * 01:01 complex and DSKARLVL:HLA-B *The peptide:HLA complex may comprise a peptide:HLA complex selected from the group consisting of the 08:01 complex.
[0462] Selective binding is HLA-B * 07:02, HLA-A * 01:01, HLA-A * 02:01, HLA-A * 03:01, HLA-A * 24:02, HLA-B * 08:01 or HLA-B * It may be relevant to cancer-associated antigen presentation by 40:01. Peptides capable of being presented by specific HLAs are described elsewhere herein.
[0463] Thus, in certain instances, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 44," may be one that specifically binds to an HLA-B * 07:02 (i.e., it is HLA-B * 07:02) or when it is HLA-B * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 68," may do so only when it is in a conformation equivalent to that presented by HLA-A 07:02. * 01:01 (i.e., it is HLA-A * 01:01) or when it is HLA-A * 01:01. In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 69," may do so only when it is in a conformation equivalent to that presented by HLA-A. * 01:01 (i.e., it is HLA-A * 01:01) or when it is HLA-A *01:01. In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 45," may do so only when it is in a conformational formation equivalent to that presented by HLA-A. * 02:01 (i.e., it is HLA-A * 02:01) or when it is HLA-A * 02:01. In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 75," may do so only when it is in a conformation equivalent to that presented by HLA-A. * 03:01 (i.e., it is HLA-A * 03:01) or when it is HLA-A * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 76," may do so only when it is in a conformation equivalent to that presented by HLA-A 03:01. * 03:01 (i.e., it is HLA-A * 03:01) or when it is HLA-A * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 77," may do so only when it is in a conformation equivalent to that presented by HLA-A 03:01. * 24:02 (i.e., it is HLA-A * 24:02) or when it is HLA-A * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 70," may do so only when it is in a conformation equivalent to that presented by HLA-B 24:02. * 08:01 (i.e., it is HLA-B *08:01) or when it is HLA-B * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 71," may do so only when it is in a conformation equivalent to that presented by HLA-B. * 40:01 (i.e., it is HLA-B * 40:01) or when it is HLA-B * In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 72," may do so only when it is in a conformation equivalent to that presented by HLA-A 40:01. * 01:01 (i.e., it is HLA-A * 01:01) or when it is HLA-A * 01:01. In another example, a binding protein that "specifically binds to a cancer-associated antigen, particularly the peptide of SEQ ID NO: 74," may do so only when it is in a conformation equivalent to that presented by HLA-B. * 08:01 (i.e., it is HLA-B * 08:01) or when it is HLA-B * 08:01. Specific binding to any one of these peptides may occur in the context of the appropriate HLA (i.e., specific binding to a peptide may occur only if the peptide is presented by the appropriate HLA).
[0464] "Specifically binds to..." when it relates to a T cell receptor, or when it refers to a recombinant T cell receptor, nucleic acid fragment, variant, or analog, or engineered cell, such as the PRAME, CTCFL, and CLDN6 T cell receptors herein, and engineered cells expressing PRAME, CTCFL, or CLDN6, means that the T cell receptor or fragment thereof recognizes or selectively binds to a particular antigen (e.g., the PRAME antigen, CTCFL antigen, or CLDN6 antigen), as appropriate (e.g., the PRAME antigen comprises SEQ ID NO:44, the CTCFL antigen comprises a sequence selected from the group consisting of SEQ ID NOs:68 to 71, SEQ ID NO:45, and SEQ ID NOs:75 to 77, or the CLDN6 antigen comprises the sequence of SEQ ID NO:72 or SEQ ID NO:74).
[0465] Under certain conditions, for example, in an immunoassay, such as the immunoassays discussed herein, a T cell receptor binds to a PRAME antigen, a CTCFL antigen, or a CLDN6 antigen (e.g., where appropriate, the PRAME antigen comprises SEQ ID NO:44, the CTCFL antigen comprises a sequence selected from the group consisting of SEQ ID NOs:68-71, 45, and 75-77, or the CLDN6 antigen comprises the sequence of SEQ ID NO:72 or SEQ ID NO:74), and does not bind in any significant amount to other polypeptides. Thus, a T cell receptor may bind to a PRAME antigen, a CTCFL antigen, or a CLDN6 antigen (e.g., where appropriate, the PRAME antigen comprises SEQ ID NO:44, the CTCFL antigen comprises a sequence selected from the group consisting of SEQ ID NOs:68-71, 45, and 75-77, or the CLDN6 antigen comprises the sequence of SEQ ID NO:72 or SEQ ID NO:74) with at least 10-fold, 100-fold, or 1000-fold greater affinity than a control antigenic polypeptide. This binding may be determined indirectly in the context of engineered T cells expressing a PRAME, CTCFL, or CLDN6 TCR, for example, in assays such as those discussed herein, where the engineered T cells are specifically reactive to a melanoma cell line (e.g., the SK2.3 cell line) expressing PRAME, CTCFL, or CLDN6, as appropriate, or a multiple myeloma cell line (e.g., the U266 cell line) expressing PRAME, CTCFL, or CLDN6, as appropriate. Thus, T cells expressing modified PRAME-TCR, CTCFL-TCR or CLDN6-TCR may bind to a PRAME-, CTCFL- or CLDN6-expressing melanoma or a PRAME-, CTCFL- or CLDN6-expressing multiple myeloma cell line (e.g., the SK2.3 or U266 cell line, respectively) with at least 10-fold, 100-fold, or 1000-fold greater reactivity when compared to their reactivity to a control cell line that is not a PRAME-, CTCFL- or CLDN6-expressing melanoma or a PRAME-, CTCFL- or CLDN6-expressing multiple myeloma cell line (e.g., the SK2.3 or U266 cell line, respectively), as appropriate.
[0466] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd ed., John Wiley and Sons, New York (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, New York (1991) provide those of ordinary skill in the art with a general dictionary of many of the terms used in this invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the specification in its entirety. Also, as used herein, the singular terms "a," "an," and "the" include plural references unless clearly contradicted by context. Unless otherwise specified, nucleic acids are written left to right in 5' to 3' orientation, and amino acid sequences are written left to right in amino to carboxy orientation, respectively. It will be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary depending on the context in which they are used by those of skill in the art.
[0467] Aspects of the present invention are demonstrated by the following non-limiting examples. [Example]
[0468] Example 1 - PRAME and CTCFL reactive TCRs for the treatment of ovarian cancer patients As discussed elsewhere herein, ovarian cancer (OVCA) is the fifth most lethal cancer type among women. Recurrent disease and treatment resistance occur in the majority of patients with ovarian cancer (OVCA). Immunotherapy has been explored, and adoptive T cell-based therapy using T cell receptors (TCRs) targeting tumor-associated antigens (TAA) is considered a promising solution for non-immunogenic tumors. However, to treat a broader patient population, more TCRs specific for additional peptides derived from different TAAs that bind to various HLA class I molecules are essential.
[0469] As described herein, we sought to identify stringent tumor-specific TAAs in ovarian cancer and high-affinity TCRs targeting these targets. By performing differential expression analysis using mRNA-seq datasets, we identified PRAME, CTCFL, and CLDN6 as stringent tumor-specific TAAs with high expression in OVCA and at least 20-fold lower expression in all healthy tissues at risk. In OVCA patient samples and cell lines, we confirmed expression by RT-qPCR and identified peptides naturally expressed in the HLA class I ligandome. We then surprisingly isolated high-avidity T cell clones that recognized these peptides from the allo-HLA T cell repertoires of 25 healthy individuals. Using a large panel of OVCA patient samples, OVCA cell lines, and healthy cell subsets, we successfully identified two novel PRAME TCRs and one novel CTCFL TCR with potent and specific anti-tumor reactivity in recognition and killing assays.
[0470] In CTCFL-negative tumor cells, we demonstrated that the demethylating agent DAC can induce CTCFL expression and result in reactivity by CTCFL TCR-T cells.
[0471] Advantageously, as described herein, the inventors have demonstrated that the identified TCRs are promising candidates for the treatment of patients with OVCA and are compatible with currently used HLA-A * These results demonstrate that the differentially expressed genes, naturally expressed peptides, and TCRs identified herein are substantial extensions to the 02:01-restricted PRAME TCR. We anticipate that the differentially expressed genes, naturally expressed peptides, and TCRs identified herein will improve the use of T cell-based therapies in patients with OVCA.
[0472] Materials and Methods Differential gene expression analysis Publicly available datasets (TCGA (https: / / www.cancer.gov / tcga); GTEx
[47] ; HPA
[48] ) were accessed through the online resource Recount2 (https: / / jhubiostatistics.shinyapps.io / recount / )
[49] . Read alignment to the hg38 reference genome and mRNA quantification were part of the Recount2 preprocessing pipeline, resulting in raw count tables that were then combined into one comprehensive dataset. For each distinct primary cancer tissue from TCGA, 30 samples were randomly selected. Random sampling was also applied to the GTEx dataset, with a maximum of 20 samples when available. For the HPA dataset, all samples were included (3–5 samples per tissue). The collected dataset consisted of a total of 2202 samples and was normalized using the EdgeR package and its Relative Log Expression (RLE) method [50, 51] in R (v3.4.3). Finally, the dataset was filtered to retain only genes showing evidence of expression in ovarian cancer, as defined by a minimum mean of 100 read counts (16,855 genes total). A quasi-likelihood negative binomial generalized log-linear model was fitted to the count data, followed by differential gene expression analysis using the EdgeR package. Genes were defined as DE in ovarian cancer if they exhibited an absolute minimum fold change (FC) of ≥ 20 and an FDR-adjusted p-value of ≤ 0.05. Mean expression in ovarian cancer was compared to most of the healthy tissues present in the dataset, excluding only tissues from reproductive organs and tumors.
[0473] Sample collection for peptide elution Seven solid OVCA patient samples (2–20 grams) were collected and dissociated using the gentleMACS (Miltenyi Biotec) procedure (see Supplementary Methods below). Also, one ascites OVCA patient sample (6 × 10 9cells) and three primary AML samples (65–500 × 10 9 In addition, various cell lines were cultured at a concentration of at least 2 × 10 9 Cell lines transduced with HLA alleles, CLDN6 and / or CTCFL, were first enriched for marker gene expression via magnetic-activated cell sorting (MACS) or fluorescence-activated cell sorting (FACS). HLA typing of all samples / cell lines was performed, and gene expression was quantified by real-time quantitative polymerase chain reaction (RT-qPCR) (see Supplementary Methods below).
[0474] HLA class I peptide elution procedure, fractionation and mass spectrometry Cell pellets were lysed and loaded onto an immunoaffinity column to collect bound peptide-HLA complexes. Peptides were subsequently separated, fractionated, and analyzed by data-dependent MS / MS (see Supplementary Methods below). Proteome Discoverer V.2.1 (Thermo Fisher Scientific) was used for peptide and protein identification, using the mascot search node (mascot V.2.2.04) and the UniProt Homo Sapiens database (UP000005640; January 2015; 67,911 entries). Peptides were synthesized in-house using standard Fmoc chemistry, and PE-conjugated pMHC multimers were generated with minor modifications (see Supplementary Methods below).
[0475] cell culture T cells were cultured in T cell medium (TCM) and (restimulated) with autologous feeders every 10–14 days (see Supplementary Methods below). The OVCA cell lines COV-318 / COV-362.4 / COV-413b / COV-434 / COV-504 / COV-641 were established at the Department of Medical Oncology (LUMC, The Netherlands)
[52] . The OVCA cell lines OVCAR-3 and SK-OV-3 were obtained from ATCC, and A2780 was obtained from ECACC. Primary OVCA-L11 cells (isolated from bulk tumor tissue using gentleMACS) and OVCA-L23 cells (malignant cells present in ascites) were thawed and used as target cells in screening experiments 3 days later. OVCA cell lines, other tumor cell lines, and primary OVCA cells were cultured in various media (see Supplementary Methods below). CD14-derived mDCs and imDCs, as well as activated CD19 cells, were isolated from PBMCs of different healthy donors and generated as previously described
[23] . Purity of the generated cells was assessed using flow cytometry (see Supplementary Methods below). Fibroblasts and keratinocytes, both cultured from skin biopsies, were cultured as previously described
[23] . PTECs derived from renal tubules were isolated and cultured as previously described
[53] .
[0476] DAC Processing DAC (5-aza-2'-deoxycytidine) (A3656, Sigma-Aldrich) was dissolved in dimethyl sulfoxide (DMSO). Target cells were 50% confluent at the start of treatment and treated with 1 μM DAC on days 1 and 4. DMSO-treated cells served as a negative control. On day 7, cells were harvested for T cell reactivity assays and RNA isolation to determine gene expression by RT-qPCR.
[0477] Isolation of OVCA-specific T cells by pMHC multimer enrichment Buffy coats from healthy donors were collected after informed consent (Sanquin). PBMCs were isolated using Ficoll density gradient separation and incubated with pMHC multimer selection at 4°C for 1 hour or at 37°C for 15 minutes. pMHC multimers were included only if the healthy donor was negative for the restrictive HLA allele. pMHC multimer-bound cells were enriched by MACS using anti-PE MicroBeads (Miltenyi Biotec / 130-048-801). The positive fraction was stained with CD8 (AF700) and CD4, CD14, and CD19 (FITC). pMHC multimer- and CD8-positive cells were collected at 5 x 10 in 100 μL of TCM containing 0.8 μg / mL PHA. 4 irradiated PBMCs (35 Gy) and 5 × 10 3 EBV-JY cells (55 Gy) were treated in 96-well round-bottom plates with single-cell sorting using an Aria III cell sorter (BD Biosciences). T cell recognition was assessed 10–14 days after stimulation, and selected T cell clones were then restimulated or stored.
[0478] T cell reactivity assay T cell recognition was measured by IFN-γ ELISA (Sanquin or Diaclone). Five thousand T cells were cocultured overnight with target cells at various effector-to-target (E:T) ratios in 60 μL of TCM in 384-well flat-bottom plates (Greiner Bio-One). To upregulate HLA expression, all adherent target cells were treated with 100 IU / mL IFN-γ (Boehringer Ingelheim) for 48 hours before coculture. All T cells and target cells were thoroughly washed before coculture to remove proliferation-associated cytokines. Supernatants were transferred to the ELISA procedure using a Hamilton Microlab STAR Liquid Handling System (Hamilton Company) and diluted 1:5, 1:25, and / or 1:125 to quantify IFN-γ production levels within the range of the standard curve. T cell-mediated cytotoxicity was measured using a 6-hour 51 Measured in a chromium release assay (see Supplementary Methods below).
[0479] TCR identification and TCR gene transduction into CD8+ T cells The TCR α and β chains of selected T cell clones were identified by sequencing with minor modifications (see Supplementary Methods below). The TCR chains were codon-optimized, synthesized, and cloned into the MP71-TCR-flex retroviral vector by Baseclear. The MP71-TCR-flex vector contains a codon-optimized, cysteine-modified murine TCR αβ constant domain and a P2A sequence for linking the TCR chains, resulting in optimized TCR expression and increased preferential pairing
[54] . Apart from the OVCA-specific TCR, a murine CMV-specific TCR (HLA-A) was also identified. *The NLVPMVATV (SEQ ID NO: 46) peptide presented at 02:01 was included as a negative control. CD8+ T cells were isolated from PBMCs of different donors by MACS, and TCR was introduced via retroviral transduction two days after stimulation with autologous feeders. Seven days after stimulation, CD8+ T cells were enriched for mouse TCR by MACS. Ten days after stimulation, CD8+ T cells were functionally tested, and purity was checked by flow cytometry (further details are in the Supplementary Methods below).
[0480] statistical analysis Statistical analyses were performed using GraphPad Prism software (version 9.0.1). The statistical tests used are indicated in the figure legends, and P<0.05 was considered significant. The significance level was p<0.05. * , p<0.01 ** , p<0.001 *** , and p<0.001 **** Shown as:
[0481] research approval AML patient samples were used from the Biobank for Hematological Diseases at Leiden University Medical Center. This study was approved by the Institutional Review Board of Leiden University Medical Center (approval number 3.4205 / 010 / FB / jr) and the METC-LDD (approval number HEM 008 / SH / SH). Materials from patients and healthy individuals were collected after written informed consent in accordance with the Declaration of Helsinki. OVCA samples were residual material and collected anonymously.
[0482] Supplementary Materials and Methods Dissociated OVCA patient samples Solid OVCA tumors were sliced into small pieces and removed of dead, clotted, or non-tumor material. Small tumor pieces were added to C-tubes (Miltenyi Biotec) containing ice-cold buffer without detergent and cOmplete protease inhibitors (Sigma-Aldrich) to prevent proteolysis. Using the gentleMACS (Miltenyi Biotec) procedure, small tumor pieces were dissociated to a nearly homogenous cell solution. Benzonase (Merck) was added at a concentration of 125 IU / mL to remove DNA / RNA complexes during lysis.
[0483] Gene expression by real-time quantitative polymerase chain reaction Gene expression was quantified by real-time quantitative polymerase chain reaction (RT-qPCR) (see Supplementary Methods below). Total RNA was isolated using the RNAqueous-Micro Kit (Ambion) or the ReliaPrep RNA Cell Miniprep System (Promega). First-strand cDNA synthesis was performed using Moloney murine leukemia virus reverse transcriptase and oligo(dT) primers (Invitrogen, Thermo Fisher Scientific). RT-qPCR was performed using Fast Start Taq DNA Polymerase (Roche) and EvaGreen (Biotium), and gene expression was measured using a Lightcycler 480 (Roche). All samples and genes were run in triplicate with 10 ng of cDNA per reaction. Expression was calculated as a percentage of the mean of the housekeeping genes GUSB, VPS29 and PSMB4, which was set to 100%.The following primers were used: PRAME (forward: GTTGCTCAGGCACGTGAT (SEQ ID NO: 47), reverse: CCCACTTAGACTCAGGACACTTA (SEQ ID NO: 48)), CTCFL (TvX) (forward: GTCCGACAC...
Claims
1. 1. An isolated nucleic acid composition encoding a cancer-associated antigen-specific binding protein having a TCR alpha chain variable (Vα) domain and a TCR beta chain variable (Vβ) domain, (i) a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 3 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6 or a functional fragment thereof, wherein both of the CDR3 sequences specifically bind to PRAME; or (ii) a nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20 or a functional fragment thereof, wherein both of the CDR3 sequences specifically bind to PRAME; or (iii) A nucleic acid sequence encoding a TCR Vα domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 31 or a functional fragment thereof, and a nucleic acid sequence encoding a TCR Vβ domain comprising a CDR3 amino acid sequence having at least 80% sequence identity with SEQ ID NO: 34 or a functional fragment thereof, wherein both of the CDR3 sequences specifically bind to CTCFL. A nucleic acid composition comprising:
2. (i) the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 3, and the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 6; or (ii) the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 17, and the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO: 20; or (iii) the CDR3 of the Vα domain comprises or consists of the amino acid sequence of SEQ ID NO: 31, and the CDR3 of the Vβ domain comprises or consists of the amino acid sequence of SEQ ID NO:
34. The nucleic acid composition of claim 1.
3. (i) the Vα domain comprises an amino acid sequence that has at least 80% sequence identity to, comprises, or consists of SEQ ID NO:7, and the Vβ domain comprises an amino acid sequence that has at least 80% sequence identity to, comprises, or consists of SEQ ID NO:9; or (ii) the Vα domain comprises an amino acid sequence that has at least 80% sequence identity to, comprises, or consists of SEQ ID NO: 21, and the Vβ domain comprises an amino acid sequence that has at least 80% sequence identity to, comprises, or consists of SEQ ID NO: 23; or (iii) the Vα domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO: 35, and the Vβ domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of SEQ ID NO:
37. The nucleic acid composition of claim 1 or claim 2.
4. 4. The nucleic acid composition of claim 1, wherein the cancer-associated antigen comprises an amino acid sequence selected from the group consisting of LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44), and KLHGILVEA (SEQ ID NO: 45).
5. The encoded binding protein is LYVDSLFFL:HLA-A * 24:02 complex, SPSVSSQLSVL:HLA-B * 07:02 complex, and KLHGILVEA:HLA-A * 5. The nucleic acid composition of claim 4, which is capable of specifically binding to a peptide:HLA complex selected from the group consisting of the 02:01 complex.
6. 6. The nucleic acid composition of claim 1, wherein the nucleic acid sequence is codon-optimized for expression in a host cell, which may be a human cell.
7. The nucleic acid composition of claim 1 , further comprising a TCR α chain constant domain and / or a TCR β chain constant domain.
8. 8. The nucleic acid composition of any one of claims 1 to 7, wherein the encoded binding protein comprises a TCR, an antigen-binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager, or an ImmTAC.
9. 9. The nucleic acid composition of claim 8, wherein the antigen-binding fragment of the TCR is a single-chain TCR (scTCR) or a chimeric TCR dimer in which the antigen-binding fragment of the TCR is linked to separate transmembrane and intracellular signaling domains.
10. A vector system comprising the nucleic acid composition of any one of claims 1 to 9.
11. 11. The vector system of claim 10, wherein the vector is a plasmid, a viral vector, or a cosmid, and the vector may be selected from the group consisting of a retrovirus, a lentivirus, an adeno-associated virus, an adenovirus, a vaccinia virus, a canarypox virus, a herpes virus, a minicircle vector, and a synthetic DNA or RNA.
12. 12. A modified cell comprising a nucleic acid composition according to any one of claims 1 to 9, or a vector system according to claim 10 or claim 11.
13. 13. The modified cell of claim 12, wherein the modified cell is selected from the group consisting of CD8 T cells, CD4 T cells, NK cells, NK-T cells, gamma-delta T cells, hematopoietic stem cells, induced pluripotent stem cells, progenitor cells, T cell lines, and NK-92 cell lines.
14. The modified cell of claim 12 or claim 13, wherein the modified cell is a human cell.
15. A pharmaceutical composition comprising a nucleic acid composition described in any one of claims 1 to 9, a vector system described in claim 10 or claim 11, or a modified cell described in any one of claims 12 to 14, together with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.
16. 16. The pharmaceutical composition of claim 15 for use in inducing or enhancing an immune response in a human subject diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
17. 16. The pharmaceutical composition of claim 15 for use in stimulating a cellular immune response against a target cell population or tissue in a human subject.
18. 16. The pharmaceutical composition of claim 15 for use in providing anti-tumor immunity to a human subject.
19. 16. The pharmaceutical composition of claim 15 for use in treating a human subject having a disease or condition associated with elevated levels of an HLA-restricted PRAME antigen or elevated levels of an HLA-restricted CTCFL antigen.
20. 20. The pharmaceutical composition for use according to any one of claims 16 to 19, wherein the human subject has at least one tumor.
21. 21. The pharmaceutical composition for use according to any one of claims 17 to 20, wherein the subject has been diagnosed with a PRAME-associated disease or condition or a CTCFL-associated disease or condition.
22. 22. The pharmaceutical composition for use according to claim 16 or claim 21, wherein the PRAME-associated disease or condition or CTCFL-associated disease or condition is a hematological malignancy or a solid tumor.
23. 23. The pharmaceutical composition for use according to claim 22, wherein the hematological malignancy is selected from the group consisting of multiple myeloma, plasma cell leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), and B-cell lymphoma, and the B-cell lymphoma may be selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), and Burkitt's lymphoma.
24. 23. The pharmaceutical composition for use according to claim 22, wherein the solid tumor is selected from the group consisting of melanoma, uveal melanoma, ovarian cancer, endometrial cancer, testicular tumor, lung cancer, lung squamous cell carcinoma, thymoma, synovial sarcoma, kidney cancer, breast cancer, sarcoma, bladder cancer, mesothelioma, pancreatic cancer, prostate cancer, colorectal cancer, cervical cancer and gastric cancer.
25. 23. The pharmaceutical composition for use according to claim 22, wherein the solid tumor is selected from the group consisting of ovarian cancer, synovial sarcoma, endometrial cancer, lung cancer, melanoma and uveal melanoma, and the solid tumor may be ovarian cancer.
26. 10. A method for producing a binding protein capable of specifically binding to a peptide comprising a cancer-associated antigen and not binding to a peptide not comprising the cancer-associated antigen, the method comprising contacting a nucleic acid composition described in any one of claims 1 to 9 with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.
27. 27. The method of claim 26, wherein the method is an ex vivo method.
28. An isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:
42.
29. An isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40 or SEQ ID NO:42 for use in therapy.
Citation Information
Patent Citations
US20051025118538-43