Method for producing high-yield and high-quality recombinant adeno-associated virus

Abstract

The present specification provides a method for producing a recombinant adeno-associated virus (rAAV) of a desired composition with high yield and high quality. The method for producing a recombinant adeno-associated virus disclosed in the present application is characterized by comprising a pre-culture process and an osmotic shock process. The pre-culture process and the osmotic shock process mutually create a synergistic effect within the production method, resulting in the production of a high-yield, high-quality recombinant adeno-associated virus.

Description

[Technical Field]

[0001] This specification discloses technical details regarding methods for preparing recombinant adeno-associated viruses. [Background technology]

[0002] The method for producing recombinant adeno-associated viruses can be divided into the following processes: a) an upstream process in which recombinant adeno-associated viruses are produced in host cells; and b) a downstream process in which the recombinant adeno-associated viruses produced in host cells are harvested, filtered, separated, and purified. The upstream process directly relates to the process in which host cells express each component of the recombinant adeno-associated virus. The downstream process directly relates to the method for separating and purifying only the recombinant adeno-associated virus of interest from a mixture of various biological substances such as proteins, nucleic acids, and lipids. Summary of the Invention [Problem to be solved by the invention]

[0003] The technical problem faced herein is to provide a method for producing a recombinant adeno-associated virus (rAAV) of a desired composition in high yield and with high quality. [Means for solving the problem]

[0004] To achieve this technical goal, the method for producing recombinant adeno-associated viruses disclosed herein includes a pre-culture process and an osmotic shock process. The pre-culture process allows host cells to produce recombinant adeno-associated viruses more efficiently and in larger quantities, thereby improving yields. The osmotic shock process allows host cells to release most of the produced recombinant adeno-associated viruses into the medium, allowing the adeno-associated viruses to be directly recovered from the medium without cell disruption. The osmotic shock process allows the recombinant adeno-associated viruses to be recovered and purified without significant cell damage. As a result, high-quality recombinant adeno-associated viruses can be produced. Furthermore, the osmotic shock process allows the recombinant adeno-associated virus production method to omit the cell disruption process, thereby simplifying the adeno-associated virus purification and recovery process. Accordingly, the production method disclosed herein can help achieve further improved yields and high quality by minimizing the loss of virus particles during purification and recovery.

[0005] The pre-culture process and the osmotic shock process synergize with each other within the production method to produce high yields and high quality recombinant adeno-associated viruses.

[0006] beneficial effects

[0007] By following the method for producing a recombinant adeno-associated virus disclosed herein, it is possible to produce a recombinant adeno-associated virus in high yield and with high quality. The method for producing a recombinant adeno-associated virus disclosed herein is a more economical method for producing a recombinant adeno-associated virus than conventional production methods. [Brief explanation of the drawings]

[0008] [Figure 1]2 shows a graph illustrating the yield improvement effect of the osmotic shock process according to Experimental Example 2.2 as a function of salt concentration. After the osmotic shock process was performed on each experimental group, the total number of viral genomes (vg) was measured and shown. Here, NT represents a negative control group that was not subjected to the osmotic shock process, and the remaining experimental groups were added with NaCl as an osmotic shock reagent at the corresponding concentration indicated on each label.

[0009] [Figure 2] This graph shows the yield improvement effect of the osmotic shock process according to the type of salt in Experimental Example 2.3. After the osmotic shock process was performed on each experimental group, the total number of viral genomes (vg) was measured and shown. Here, NT represents a negative control group that was not subjected to the osmotic shock process. For the remaining experimental groups, salts of the type and concentration indicated on each label were used as osmotic shock reagents.

[0010] [Figure 3] This graph shows the yield improvement effect of the pre-incubation treatment process according to Experimental Example 3.2. After the pre-incubation treatment process for each experimental group, the total number of viral genomes (vg) was measured and shown. Here, the control represents a negative control in which the pre-incubation treatment process was not performed. For the remaining experimental groups, various substances indicated on the label were used as pre-incubation treatment agents. The detailed composition of each is shown in Table 3 in the section "Experimental Example 3.2. Yield improvement effect when pre-incubation treatment is performed with nocodazole and M344."

[0011] [Figure 4]This graph shows the yield improvement effect of the pre-incubation treatment process according to Experimental Example 3.3. After the pre-incubation treatment process for each experimental group, the total number of viral genomes (vg) was measured and shown. Here, the control represents a negative control in which the pre-incubation treatment process was not performed. For the remaining experimental groups, various substances indicated on the label were used as pre-incubation treatment agents. The detailed composition of each is shown in Table 4 in the section "Experimental Example 3.3. Yield improvement effect when pre-incubation treatment is performed with nocodazole and M344."

[0012] [Figure 5] FIG. 1 shows a schematic diagram outlining the overall production process disclosed herein.

[0013] [Figure 6] This shows a cell photograph taken before the downstream process in Process 2 of Experimental Example 4 (not including pre-culture treatment, including freeze-thaw process), and the cell viability of the process was measured, which was determined to be 15.8%.

[0014] [Figure 7] This shows a cell photograph taken before the downstream process in Process 5 of Experimental Example 4 (including pre-culture treatment and freeze-thaw process), and the cell viability of the process was measured, which was determined to be 18.2%.

[0015] [Figure 8] This shows a cell photograph taken before the downstream process in Process 6 of Experimental Example 4 (including pre-culture treatment and osmotic shock process) was performed, and the cell viability of the process was measured, which was determined to be 35.4%.

[0016] [Figure 9]Figure 1 shows the number of viral genomes (vg) measured in the medium before downstream processing for each process in Experimental Example 4, where no chemical + no treatment represents process 1, no chemical + freeze-thaw represents process 2, no chemical + osmotic shock represents process 3, sucrose, nocodazole, M344 + no treatment represents process 4, sucrose, nocodazole, M344 + freeze-thaw represents process 5, and sucrose, nocodazole, M344 + osmotic shock represents process 6.

[0017] [Figure 10] The final number of viral genomes (vg) obtained after ultracentrifugation for each process in Experimental Example 4 is shown, where no chemicals + no treatment represents process 1, no chemicals + freeze-thaw represents process 2, no chemicals + osmotic shock represents process 3, sucrose, nocodazole, M344 + no treatment represents process 4, sucrose, nocodazole, M344 + freeze-thaw represents process 5, and sucrose, nocodazole, M344 + osmotic shock represents process 6.

[0018] [Figure 11] The results of Coomassie Brilliant Blue staining after each process in Experimental Example 4 are shown, where Harvested Cell Culture Fluid represents the sample at the time of medium harvest before downstream processing, PEG Sup. represents the supernatant sample after filtration and PEG precipitation, and further, 1:(-) chemical represents Process 1, 2:(-) chemical and freeze / thaw represents Process 2, 3:(-) chemical and osmotic shock represents Process 3, 4:(+)3 chemical represents Process 4, 5:(+)3 chemical and freeze / thaw represents Process 5, and 6:(+)3 chemical and osmotic shock represents Process 6.

[0019] [Figure 12]Figure 1 shows the results of Coomassie brilliant blue staining of cell pellet samples after filtration and PEG precipitation for each process in Experimental Example 4, where 1: (-) chemical represents process 1, 2: (-) chemical and freeze / thaw represents process 2, 3: (-) chemical and osmotic shock represents process 3, 4: (+) 3 chemical represents process 4, 5: (+) 3 chemical and freeze / thaw represents process 5, and 6: (+) 3 chemical and osmotic shock represents process 6.

[0020] [Figure 13] Figure 1 shows the results of Coomassie brilliant blue staining of supernatant samples after filtration and benzonase processes for each process in Experimental Example 4, where 1: (-) chemical represents process 1, 2: (-) chemical and freeze / thaw represents process 2, 3: (-) chemical and osmotic shock represents process 3, 4: (+) 3 chemical represents process 4, 5: (+) 3 chemical and freeze / thaw represents process 5, and 6: (+) 3 chemical and osmotic shock represents process 6.

[0021] [Figure 14] For Example 4, Process 2, negative stained TEM images were taken according to Example 4.6. The images showed a dirty background, unclear morphology of virus particles, and a ratio of full to empty capsids of 40%.

[0022] [Figure 15] For Example 4, Process 5, negative stained TEM images were taken according to Example 4.6. The images showed a dirty background, unclear morphology of virus particles, and a ratio of full to empty capsids of 67%.

[0023] [Figure 16]For Example 4, Process 3, negative stained TEM images taken according to Example 4.6 are shown, which show a clear background, clear morphology of virus particles, and a ratio of full to empty capsids of 82%.

[0024] [Figure 17] For Example 4, Process 6, negative stained TEM images taken according to Example 4.6 are shown, which show a clear background, clear morphology of virus particles, and a ratio of full to empty capsids of 87%.

[0025] [Figure 18] Figure 1 shows the silver staining results of the final samples obtained after performing all steps of each process in Experimental Example 4, where W / O Chemical F / T represents Process 2, W / O Chemiosmotic Shock represents Process 3, W / Chemical F / T represents Process 5, and W / Chemiosmotic Shock represents Process 6. DETAILED DESCRIPTION OF THE INVENTION

[0026] Hereinafter, the contents of the present disclosure will be described in more detail through specific implementation embodiments and examples with reference to the accompanying drawings. It should be noted that the accompanying drawings include some, but not all, of the embodiments of the present disclosure. The subject matter of the present disclosure disclosed herein can be implemented in various ways and is not limited to the specific implementation examples described herein. These implementations should be considered to be provided to satisfy the legal requirements applicable to this specification. Those skilled in the art will be able to conceive many modifications and other implementations of the disclosure disclosed herein. Accordingly, it should be understood that the contents of the present disclosure disclosed herein are not limited to the specific embodiments described herein, and that modifications and other embodiments are also encompassed within the scope of the claims.

[0027] Disclosed herein is a method for producing a recombinant adeno-associated virus (rAAV) comprising the steps of:

[0028] (a) preparing a host cell;

[0029] wherein the host cell comprises a vector encoding the components of the rAAV,

[0030] The host cell can then express rAAV;

[0031] (b) adding sugar, nocodazole and M344 to the medium containing the host cells;

[0032] (c) culturing the host cells;

[0033] Here, culture allows for expression of rAAV within the host cells;

[0034] (d) applying an osmotic shock by adding salt to the medium containing the host cells;

[0035] wherein osmotic shock promotes the release of rAAV from the host cells into the medium; and

[0036] (e) Obtaining the rAAV from the culture medium without lysing the host cells.

[0037] In one embodiment, the serotype of the rAAV is selected from one or more of the following:

[0038] wild-type serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10;

[0039] Synthetic (variant) serotypes, including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2; and

[0040] Other AAV variant serotypes.

[0041] In one embodiment, step (e) comprises:

[0042] (e-1) separating the medium in the product of step (d) from the host cells;

[0043] (e-2) filtering the medium;

[0044] (e-3) performing PET precipitation on the product of step (e-2);

[0045] (e-4) adding benzonase to the product of step (e-3) in the presence of salt;

[0046] (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and

[0047] (e-6) A step of subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation.

[0048] Disclosure Form

[0049] Definition of Terms

[0050] About

[0051] As used herein, the term "about" means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 0% based on the reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0052] Nucleic acid sequence notation

[0053] The symbols "A, T, C, G, and U" used herein are to be interpreted as understood by those skilled in the art. Depending on the context and approach, the symbols may be interpreted as bases, nucleosides, or nucleotides on DNA or RNA, as appropriate. For example, when a symbol refers to a base, it may be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U) itself, respectively. When a symbol refers to a nucleoside, it may be interpreted as adenosine (A), thymidine (T), cytidine (C), guanosine (G), or uridine (U), respectively. When a symbol refers to a nucleotide within a sequence, it should be interpreted to mean the nucleotide containing each nucleoside.

[0054] Limitations of conventional technology

[0055] Methods for producing recombinant adeno-associated viruses can be divided into the following processes: a) an upstream process in which recombinant adeno-associated viruses are produced in host cells; and b) a downstream process in which the recombinant adeno-associated viruses produced in host cells are harvested, filtered, separated, and purified. The upstream process directly relates to the process in which host cells express each component of the recombinant adeno-associated virus. The downstream process directly relates to the method for separating and purifying only the recombinant adeno-associated virus of interest from a mixture of various biological substances such as proteins, nucleic acids, and lipids.

[0056] Conventional research on recombinant adeno-associated virus production methods has limitations in that the methods only focus on improving the upstream or downstream processes, and little focus is placed on process improvements, particularly in the process itself. Currently, there is little research on how to design an entire method for producing recombinant adeno-associated virus, including upstream and downstream processes, to obtain high-quality recombinant adeno-associated virus particles with high efficiency.

[0057] Methods for producing recombinant adeno-associated virus (rAAV)

[0058] Overview of methods for producing rAAV

[0059] The method for producing recombinant adeno-associated virus (rAAV) disclosed herein comprises the steps of preparing host cells, treating the host cells with a preculture, culturing the host cells, applying an osmotic shock, and recovering the recombinant adeno-associated virus produced from the host cells and / or the medium containing the host cells. The method for producing recombinant adeno-associated virus can be divided into the following processes: a) an upstream process for producing adeno-associated virus via host cells, and b) a downstream process for separating and purifying the adeno-associated virus produced by the host cells. In the upstream process, the method for producing recombinant adeno-associated virus enables the host cells to produce recombinant adeno-associated virus more efficiently and with a higher production capacity through a preculture treatment. Furthermore, this production method allows the majority of the recombinant adeno-associated virus produced by the host cells to be released into the medium through the osmotic shock process, thereby eliminating the need for cell disruption in the downstream process. This allows for higher-quality recovery of recombinant adeno-associated virus. The method for producing recombinant adeno-associated virus includes a pre-culture treatment process in the upstream process and employs an osmotic shock process immediately prior to the downstream process, thereby enabling the processes to synergize and thereby maximizing yield and quality.

[0060] Methods for producing recombinant adeno-associated viruses are described in more detail below.

[0061] Host Cell Preparation Process

[0062] The method for producing a recombinant adeno-associated virus disclosed herein includes a host cell preparation process, which refers to a process for preparing a host cell capable of producing the recombinant adeno-associated virus to be produced.

[0063] The host cell preparation process is not particularly limited as long as it prepares host cells capable of producing the recombinant adeno-associated virus to be produced. The host cell preparation process can be carried out by appropriately selecting a method known to those skilled in the art and modifying it to suit the method disclosed herein. For example, the host cell preparation process can use a method known in (paper).

[0064] An example of a host cell preparation process is exemplified in "Host Cell Preparation Process" in "Possible Embodiments of the Invention."

[0065] Pre-culture treatment process

[0066] The method for producing a recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process, which refers to a process that enables the host cells to more efficiently produce the recombinant adeno-associated virus before culturing the host cells to produce the recombinant adeno-associated virus.

[0067] The pre-incubation treatment process involves the addition of a pre-incubation agent. The pre-incubation agent contains sugar, nocodazole, and / or M344.

[0068] The pre-culture treatment process disclosed herein serves to increase the yield of recombinant adeno-associated virus rather than arresting the cell cycle and preventing cell growth. As a result of the pre-culture treatment, host cells are able to produce more recombinant adeno-associated virus during culture. More specific details about the pre-culture treatment are provided in the "Pre-culture Process" section.

[0069] Host Cell Culture Process

[0070] The method for producing a recombinant adeno-associated virus disclosed herein includes a host cell culture process. The host cell culture process refers to a process of appropriately treating host cells and / or a medium containing host cells so that the host cells, after the pre-culture treatment, can produce a recombinant adeno-associated virus. The term "appropriately treating" includes adding a specific substance to the host cells (e.g., adding a nutrient medium), placing the host cells in a predetermined environment for a predetermined period of time (e.g., culturing the host cells in an incubator at room temperature for a predetermined period of time), changing the environment of the host cells to a new environment (e.g., changing the medium for subculture), or using a predetermined device to cause a predetermined shock (e.g., using a shaker to vibrate the host cells and medium). This term encompasses all technical concepts that a person skilled in the art would recognize.

[0071] The host cell culture process is not particularly limited as long as the host cell can produce a recombinant adeno-associated virus. The host cell culture process can be performed by appropriately selecting a method known to those skilled in the art and modifying it to suit the method disclosed herein.

[0072] Osmotic Shock Process

[0073] The method for producing a recombinant adeno-associated virus disclosed herein includes an osmotic shock process, which refers to a process in which an osmotic shock is applied to a host cell that produces and contains a recombinant adeno-associated virus within the cell, causing the host cell to release the recombinant adeno-associated virus into the culture medium.

[0074] By allowing the recombinant adeno-associated virus to be released into the medium, the method for producing recombinant adeno-associated virus allows the recombinant adeno-associated virus to be purified and / or obtained without disrupting cells. Obtaining recombinant adeno-associated virus without disrupting cells simplifies the harvesting process, minimizes the loss of recombinant adeno-associated virus particles during the harvesting process, and allows intact recombinant adeno-associated virus particles to be recovered. As a result, the osmotic shock process contributes to increasing the quality of the recombinant adenovirus produced by the method for producing recombinant adeno-associated virus. More specific details about the osmotic shock process are described in the "Osmotic Shock Process" section.

[0075] Process for obtaining recombinant adeno-associated viruses

[0076] The method for producing a recombinant adeno-associated virus disclosed herein includes a process for obtaining a recombinant adeno-associated virus. The process for obtaining a recombinant adeno-associated virus refers to a process for obtaining a recombinant adeno-associated virus produced from host cells and / or a medium containing host cells. The process for obtaining a recombinant adeno-associated virus is carried out without disrupting cells due to an osmotic shock process.

[0077] The process for obtaining a recombinant adeno-associated virus is not particularly limited as long as it can obtain a recombinant adeno-associated virus. The process for obtaining a recombinant adeno-associated virus can be carried out by appropriately selecting a method known to those skilled in the art and modifying it to suit the method disclosed herein.

[0078] In one embodiment, the process for obtaining the recombinant adeno-associated virus may involve obtaining the recombinant adeno-associated virus from host cells and / or a culture medium containing the host cells by a chromatography method. Specifically, the chromatography method may be the method disclosed in Rieser R, Koch J, Faccioli G, Richter K, Menzen T, Biel M, Winter G, Michalakis S. Comparison of Different Liquid Chromatography-Based Purification Strategies for Adeno-Associated Virus Vectors. Pharmaceuticals. 2021;13(5):748. https: / / doi.org / 10.3390 / pharmaceutics13050748, or a suitable modification thereof.

[0079] In another embodiment, the process for obtaining the recombinant adeno-associated virus may involve obtaining the recombinant adeno-associated virus from host cells and / or a culture medium containing the host cells by ultracentrifugation. Specifically, the ultracentrifugation may be the method disclosed in Sena-Esteves M, Gao G. Purification of Recombinant Adeno-Associated Viruses (rAAVs) by Iodixanol Gradient Centrifugation. Cold Spring Harb Protoc. 2020 Feb 3; 2020(2):095612. doi:10.1101 / pdb.prot095612. PMID:32015002, or an appropriate modification thereof.

[0080] Characteristics of the method for producing recombinant adeno-associated viruses

[0081] Overview of the characteristics of methods for producing recombinant adeno-associated viruses

[0082] The method for producing a recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process and an osmotic shock process, which allows the method to produce a recombinant adeno-associated virus with high quality and high yield.

[0083] In order to compare the characteristics of various recombinant adeno-associated virus production methods and select a superior production method, a standard for comparing the yield and quality of the produced recombinant adeno-associated virus is required. However, it is inappropriate to compare the yield and quality using only one standard; it is essential to compare the yield and quality using various standards.

[0084] The present specification intends to disclose various criteria for evaluating recombinant adeno-associated viruses produced by various production methods, and based on this, the inventors hope to demonstrate that the production methods disclosed herein are significantly superior in many respects to previously disclosed production methods.

[0085] Evaluation of Production Method 1—Quantity and Yield of rAAV Produced

[0086] The production amount or yield is disclosed herein as a criterion for evaluating the quality of the recombinant adeno-associated virus produced and obtained. This is an indicator of how much recombinant adeno-associated virus is produced when the same amount of host cells, i.e., cells that produce recombinant adeno-associated virus, are used. To produce large amounts of recombinant adeno-associated virus, it is basically efficient to select a production method that produces a large amount of virus particles (or vectors) per host cell. Therefore, the production amount or yield of recombinant adeno-associated virus is a basic quantitative indicator for comparing the superiority or inferiority of production methods.

[0087] In one embodiment, the amount of recombinant adeno-associated virus produced can be determined by measuring the number of total viral genomes (vg) in the measurement subject. In another embodiment, the yield of recombinant adeno-associated virus produced by each production method can be compared by measuring and comparing the number of viral genomes produced in the same amount of host cells.

[0088] Evaluation method for production method 2 - full capsid to empty capsid ratio

[0089] The complete capsid-empty capsid ratio is disclosed herein as a criterion for evaluating the quality of recombinant adeno-associated viruses produced and obtained. Here, complete capsids refer to recombinant adeno-associated virus particles in which genetic material is properly packaged within the capsid. In contrast, empty capsids refer to particles in which genetic material is not properly packaged within the capsid. Empty capsids may be toxic when administered to a living organism. Therefore, removing empty capsids during the production process and increasing the ratio of complete capsids is a very important task when using recombinant adeno-associated viruses as therapeutic agents. The higher the ratio of complete capsids to empty capsids, the higher the quality of the recombinant adeno-associated viruses produced.

[0090] In one embodiment, the ratio of full to empty capsids can be obtained by negatively staining the produced recombinant adeno-associated virus sample, followed by taking and analyzing TEM photographs.

[0091] Evaluation method for production method 3 - Genome integrity

[0092] The genome integrity ratio is disclosed herein as a standard for evaluating the quality of recombinant adeno-associated viruses produced and obtained. Here, genome integrity refers to measuring the proportion of particles in which the "intended genetic material" in the capsid is properly packaged by performing digital PCR on the produced recombinant adeno-associated viruses. This measures the percentage of recombinant adeno-associated viruses produced as designed. This is used as a standard for measuring the quality of the produced recombinant adeno-associated viruses. Compared with the ratio of complete capsids to empty capsids, this method can be used as a complementary quality standard because it is a method for measuring the quality of the obtained virus particles from a different perspective.

[0093] In one embodiment, the genome integrity of the recombinant adeno-associated virus produced is measured by PCR, and the recombinant adeno-associated virus in each sample is determined to contain ITR and bGHpA target gene in its transgene.Therefore, genome integrity can be measured as the ratio of the number of viruses that contain both ITR and bGHpA target gene to the total number of recombinant adeno-associated viruses produced.

[0094] Evaluation method for production method 4 - Purity

[0095] The purity of the final product obtained is disclosed herein as a criterion for evaluating the quality of the recombinant adeno-associated virus produced and obtained. Here, purity refers to the degree to which the final product obtained contains only recombinant adeno-associated virus. For example, if the final product obtained contains a large amount of cellular by-products (proteins and nucleic acids) other than the recombinant adeno-associated virus, the purity is low. If the final product obtained contains only recombinant adeno-associated virus, the purity is significantly high. In one embodiment, purity can be measured by examining the extent to which background bands appear using silver staining and Coomassie brilliant blue staining. Generally, the substance used as a therapeutic agent is the recombinant adeno-associated virus itself. In situations where it is unclear whether the presence of impurities may cause side effects or toxicity, high purity of the final product is also an important criterion.

[0096] Characteristics of the method for producing recombinant adeno-associated viruses

[0097] The method for producing recombinant adeno-associated viruses disclosed herein comprises 1) a pre-culture treatment process and 2) an osmotic shock process, allowing downstream processes to proceed without disrupting the cells. These features allow the production method disclosed herein to: 1) produce recombinant adeno-associated viruses at a higher yield; 2) exhibit a higher ratio of intact capsids to empty capsids; 3) exhibit a higher proportion of genome integrity; and 4) have a higher purity final product, compared to conventional production methods that do not incorporate these features. Furthermore, the production method disclosed herein increases the yield and quality of recombinant adeno-associated virus particles, reduces the time and cost required for the purification process, and enables more economical production of recombinant adeno-associated viruses. In conclusion, the recombinant adeno-associated virus production method disclosed herein allows for the production of recombinant adeno-associated viruses with the intended composition at significantly higher yields and with significantly higher quality than conventional production methods.

[0098] Host Cell Preparation Process

[0099] The method for producing a recombinant adeno-associated virus disclosed herein includes a host cell preparation process. The host cell is capable of producing a recombinant adeno-associated virus. To enable the production of a recombinant adeno-associated virus, the host cell contains 1) a nucleic acid encoding the recombinant adeno-associated virus envelope (capsid); and 2) a nucleic acid encoding the desired genetic material contained in the envelope. Furthermore, the host cell may contain 3) additional nucleic acids encoding various substances and information to ensure that the envelope and genetic material can be expressed in the host cell and that the genetic material is properly packaged within the expressed envelope. The host cell may contain the nucleic acids 1) to 3) in the form of a well-known vector (e.g., a plasmid). To prepare the host cell, a process of transfecting the nucleic acids 1) to 3) into a predetermined cell line may be required. As described above, the process for preparing the host cell can be carried out by appropriately selecting a method known to those skilled in the art and modifying it to suit the method disclosed herein. Host cells are capable of producing recombinant adeno-associated viruses when provided with the appropriate environment. In the processes described below, cells referred to as "host cells" refer to cells capable of producing recombinant adeno-associated viruses.

[0100] Pre-culture treatment process

[0101] Overview of the pre-culture treatment process

[0102] The method for producing recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process. The pre-culture treatment process allows host cells to produce recombinant adeno-associated virus more efficiently by treating them with a pre-culture agent containing one or more selected from the group consisting of sugars, nocodazole, and M344. Specifically, 1) sugars increase the amount of recombinant protein (here, recombinant adeno-associated virus) produced by the host cells. 2) nocodazole increases recombinant adeno-associated virus production by locking the host cells into a specific cell cycle. 3) M344 increases virus production by inhibiting the degradation mechanism of recombinant adeno-associated virus envelope proteins. This allows host cells to produce recombinant adeno-associated virus more efficiently and in larger quantities.

[0103] sugar

[0104] The pre-culture treatment process may include adding sugar to the host cells. Adding sugar may mean treating the host cells with a pre-culture agent containing sugar. The sugar is not limited as long as the sugar can be used as a nutrient source within the cells. For example, the sugar may be, but is not limited to, sucrose or sorbitol. Treating the host cells with sugar may increase the amount of recombinant protein (here, recombinant adeno-associated virus) produced by the host cells. The sugar does not affect downstream processes in the recombinant adenovirus production process, but only affects the process by which the host cells produce recombinant adeno-associated virus.

[0105] Nocodazole

[0106] The pre-culture treatment process may include adding nocodazole to the host cells. Addition of nocodazole may refer to treating the host cells with a pre-culture agent containing nocodazole. Nocodazole is an antimitotic agent. Nocodazole is known to act on cells, inhibiting chromosome segregation and thereby preventing cell division and proliferation. Treating host cells with nocodazole causes the host cells to be locked in the G2 / M cell cycle. This increases the average cell volume of the host cells and causes them to express, on average, more recombinant protein (i.e., recombinant adeno-associated virus particles) than cells not treated with nocodazole.

[0107] M344

[0108] The pre-culture treatment process may include adding M344 to the host cells. Adding M344 may mean treating the host cells with a pre-culture agent containing M344. M344 is a histone deacetylase inhibitor. M344 can inhibit the deacetylation of intracellular histones and the degradation of ubiquitinated proteins, including viral capsid proteins. When M344 is added to the host cells, the degradation of recombinant adeno-associated virus proteins in the host cells is inhibited, resulting in the expression of more viral particles.

[0109] Osmotic Shock Process

[0110] Overview of the osmotic shock process

[0111] The method for producing a recombinant adeno-associated virus disclosed herein includes an osmotic shock process. The osmotic shock process refers to a process in which the osmotic pressure outside the host cell is maintained higher than the osmotic pressure inside the host cell for a predetermined period of time. The "method for increasing osmotic pressure" is not particularly limited as long as the objective is achieved. For example, the osmotic shock process may include adding a salt-containing osmotic shock reagent to the host cell. Furthermore, an additional substance may be added to stabilize the recombinant adeno-associated virus released during the osmotic shock process. For example, the additional substance may be, but is not limited to, a nonionic surfactant.

[0112] salt

[0113] The osmotic shock process involves adding an osmotic shock reagent containing a salt to host cells. Here, the salt is used to maintain high osmotic pressure outside the host cells (i.e., in the medium), and is not particularly limited as long as the salt is not toxic to the host cells. For example, the salt may be a salt containing a monovalent ion, such as sodium chloride (NaCl) or potassium chloride (KCl). As another example, the salt may be a salt containing a divalent ion, such as magnesium chloride (MgCl).

[0114] Nonionic surfactants

[0115] The osmotic shock reagent used in the osmotic shock process may further contain a non-ionic surfactant, which stabilizes the recombinant adeno-associated virus particles released into the culture medium by the host cells, thereby allowing more recombinant adeno-associated virus particles to be recovered from the culture medium. For example, the non-ionic surfactant may be, but is not limited to, pluronic acid (PF68).

[0116] Possible embodiments of the present invention

[0117] Host Cell Preparation Process

[0118] Example 1. Host Cell Preparation Process

[0119] The process of preparing, introducing, and / or providing a host cell.

[0120] Example 2, Insertion of Media

[0121] In Example 1, the process of preparing, introducing, and / or providing host cells refers to the process of preparing, introducing, and / or providing host cells and media containing the host cells.

[0122] Example 3. Potential for rAAV expression

[0123] In any one of Examples 1-2, the host cell is capable of expressing a recombinant adeno-associated virus (rAAV).

[0124] Example 4, Insertion of rAAV Vector

[0125] In Example 3, the host cell contains an rAAV expression vector.

[0126] Example 5. Serotype restriction of rAAV

[0127] In any one of Examples 3-4, the rAAV is a serotype selected from one or more of the following:

[0128] Wild-type serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10.

[0129] synthetic (variant) serotypes including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2;

[0130] Other AAV variant serotypes.

[0131] Example 6. Restriction of host cells

[0132] In any one of Examples 1-5, the host cell is one or more selected from the following:

[0133] HEK293T, and Expi293F.

[0134] Pre-culture process

[0135] Example 7, Pre-culture process

[0136] The process of adding, mixing, treating, and / or introducing a pre-culture agent into host cells.

[0137] Example 8. Addition of pre-culture agent to the medium

[0138] In Example 7, the process of adding, mixing, treating and / or introducing a pre-culture agent to a host cell refers to the process of adding, mixing, treating and / or introducing a pre-culture agent to a medium containing the host cells.

[0139] Example 9: Pre-culture agent specifications

[0140] In Example 7, the pre-incubation agent comprises one or more selected from the following:

[0141] sugar; nocodazole; and M344.

[0142] Example 10, Pre-incubation Process Time Specifications

[0143] In any one of Examples 7-9, the pre-incubation agent is applied at a predetermined time after the preceding process (eg, a host cell preparation process).

[0144] wherein the predetermined time point is selected from the following:

[0145] A real number between 0 and 1440, selected as a time point, representing the time point after any number of minutes, e.g., 30 minutes;

[0146] a selected real number between 0 and 1440 representing a time point after any number of minutes has elapsed, e.g., 60 minutes (thereafter);

[0147] A real number between 0 and 1440 representing a selected time point before any time point in minutes has elapsed, e.g., 90 minutes later (or before);

[0148] a time point selected as a real number between 0 and 1440, representing a time point within any two numeric ranges, e.g., 180 minutes after and 300 minutes before (after A and before B); or

[0149] 30 minutes before, approximately 30 minutes before, approximately 1 hour before, approximately 1 hour and a half before, approximately 2 hours before, approximately 2 hours and a half before, approximately 3 hours before, approximately 3 hours and a half before, approximately 4 hours before, approximately 4 hours and a half before, or approximately 5 hours later.

[0150] Example 11. Conceptualization of a Yield Improvement Process

[0151] A process for increasing the production of recombinant adeno-associated virus, comprising any one of Examples 7-10.

[0152] Osmotic Shock Process

[0153] Example 12, Osmotic Shock Process

[0154] The process of adding, mixing, treating, and / or introducing an osmotic shock reagent into host cells.

[0155] Example 13. Addition of osmotic shock reagent to culture medium

[0156] In Example 12, the process of adding, mixing, treating and / or introducing an osmotic shock reagent to host cells refers to the process of adding, mixing, treating and / or introducing an osmotic shock reagent to a medium containing host cells.

[0157] Example 14. Osmotic Shock Reagent Specifications

[0158] In any one of Examples 12-13, the osmotic shock reagent comprises one or more selected from the following:

[0159] salt; and

[0160] Nonionic surfactants

[0161] Example 15: Restrictions on the type of salt

[0162] In Example 14, the salt comprises one or more selected from the following:

[0163] Sodium chloride (NaCl); potassium chloride (KCl); and magnesium chloride (MgCl2).

[0164] Example 16: Limiting salt concentration

[0165] In any one of Examples 14-15, the salt concentration is one or more selected from the following:

[0166] a concentration selected from about 0.1M, about 0.2M, about 0.3M, about 0.4M, about 0.5M, about 0.6M, about 0.7M, about 0.8M, about 0.9M, about 1.0M, about 1.1M, about 1.2M, about 1.3M, about 1.4M, about 1.5M, about 1.6M, about 1.7M, about 1.8M, about 1.9M, or about 2.0M;

[0167] a concentration within a range consisting of two values ​​selected from the group consisting of about 0.1M, about 0.2M, about 0.3M, about 0.4M, about 0.5M, about 0.6M, about 0.7M, about 0.8M, about 0.9M, about 1.0M, about 1.1M, about 1.2M, about 1.3M, about 1.4M, about 1.5M, about 1.6M, about 1.7M, about 1.8M, about 1.9M, and about 2.0M, for example, about 0.1M to about 1.5M;

[0168] a concentration selected from about 0.1 M or less, about 0.2 M or less, about 0.3 M or less, about 0.4 M or less, about 0.5 M or less, about 0.6 M or less, about 0.7 M or less, about 0.8 M or less, about 0.9 M or less, about 1.0 M or less, about 1.1 M or less, about 1.2 M or less, about 1.3 M or less, about 1.4 M or less, about 1.5 M or less, about 1.6 M or less, about 1.7 M or less, about 1.8 M or less, about 1.9 M or less, or about 2.0 M or less; and

[0169] A concentration selected from about 0.1 M or higher, about 0.2 M or higher, about 0.3 M or higher, about 0.4 M or higher, about 0.5 M or higher, about 0.6 M or higher, about 0.7 M or higher, about 0.8 M or higher, about 0.9 M or higher, about 1.0 M or higher, about 1.1 M or higher, about 1.2 M or higher, about 1.3 M or higher, about 1.4 M or higher, about 1.5 M or higher, about 1.6 M or higher, about 1.7 M or higher, about 1.8 M or higher, about 1.9 M or higher, or about 2.0 M or higher.

[0170] Example 17: Limitations of nonionic surfactants

[0171] In any one of Examples 14-16, the nonionic surfactant is PF68.

[0172] Example 18, Osmotic Shock Time Specification

[0173] In any one of Examples 12-17, the process is carried out for a predetermined time;

[0174] wherein the predetermined time is selected from the following:

[0175] A time selected as a real number between 0 and 1440, representing the time at which any point in minutes has elapsed, e.g., 30 minutes;

[0176] A time selected as a real number between 0 and 1440, representing a time point after any number of minutes has elapsed, for example 60 minutes or more;

[0177] a selected real number between 0 and 1440 representing a point in time before any minute has elapsed, e.g., 90 minutes or less; or

[0178] A duration of about 30 minutes or less, about 30 minutes, about 1 hour, about 1 hour 30 minutes, about 2 hours, about 2 hours 30 minutes, about 3 hours, about 3 hours 30 minutes, about 4 hours, about 4 hours 30 minutes, or about 5 hours.

[0179] Example 19: Limiting medium osmolarity

[0180] In any one of Examples 12-18, the process maintains the osmolality outside the host cell at a concentration selected from the following:

[0181] Example 20: Conceptualizing a quality improvement process

[0182] A process for improving the quality of a recombinant adeno-associated virus, comprising any one of Examples 12 to 19.

[0183] Example 21, Impact on Quality Improvement

[0184] In Example 20, improving the quality of a recombinant adeno-associated virus means any one selected from the following:

[0185] Increase in the ratio of full-capsid to empty capsid of the obtained recombinant adeno-associated virus;

[0186] Increased purity of the recombinant adeno-associated virus obtained or a reduction in the cellular debris contained with the recombinant adeno-associated virus obtained; and

[0187] Increased genomic integrity of the obtained recombinant adeno-associated viruses.

[0188] rAAV acquisition process

[0189] Example 22, rAAV acquisition process

[0190] A process for obtaining, extracting, and / or purifying recombinant adeno-associated virus (rAAV) without disrupting, lysing, and / or destroying host cells.

[0191] Example 23, Chromatography Process

[0192] In Example 22, the rAAV acquisition process further comprises the following steps:

[0193] (e-1) separating the culture medium from the host cells in the product resulting from the preceding process;

[0194] (e-2) filtering the medium;

[0195] (e-3) performing affinity chromatography on the product resulting from step (e-2); and

[0196] (e-4) subjecting the resulting product of step (e-3) to anion exchange chromatography.

[0197] Example 24, Ultracentrifugation Process

[0198] In Example 22, the rAAV acquisition process further comprises the following steps:

[0199] (e-1) separating the medium in the product of step (d) from the host cells;

[0200] (e-2) filtering the medium;

[0201] (e-3) performing PET precipitation on the product of step (e-2);

[0202] (e-4) adding benzonase to the product of step (e-3) in the presence of salt;

[0203] (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and

[0204] (e-6) A step of subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation.

[0205] rAAV production method

[0206] Example 25. rAAV Production Method

[0207] 1. A method for producing a recombinant adeno-associated virus (rAAV), comprising the steps of:

[0208] (a) performing a host cell preparation process according to any one of Examples 1 to 6;

[0209] (b) subjecting the host cells prepared in step (a) to a pre-culture process according to any one of Examples 7 to 11;

[0210] (c) carrying out a process of culturing, incubating, growing, and / or growing the host cells that have completed step (b);

[0211] (d) subjecting the host cells that have completed step (c) to an osmotic shock process according to any one of Examples 12 to 21; and

[0212] (e) subjecting the host cells that have completed step (d) to a process for obtaining a recombinant adeno-associated virus according to any one of Examples 22 to 24;

[0213] [Experimental Example]

[0214] Hereinafter, the present disclosure provided herein will be further explained in detail through experimental examples and examples. These examples are intended only to illustrate the contents disclosed herein. It is clear to those skilled in the art that the scope of the contents disclosed herein should not be interpreted as being limited by these examples.

[0215] Experimental Example 1 Experimental methods and materials

[0216] Experimental Example 1.1. Preparation of recombinant adeno-associated virus expression plasmid

[0217] Of the three recombinant adeno-associated virus plasmids—Addgene #202364 (pAAVCMV.PI.eGFP.WPRE.bGH), Addgene #327732 pRepCap9, and Addgene #244764 pHelper—pAAV was transformed into the NEB Stable competent cell line (catalog no. C3040H), while the other two plasmids were transformed into the Dyne Bio DH5a strain (DYO1350). The culture method involved subculturing in 3L batches and subsequently freezing and storing the E. coli cells transformed with each plasmid to create frozen cell stocks. These frozen cells were then subcultured in large quantities (culture medium: LB broth (BD DIFCO catalog no. 244620)). Plasmids were prepared using a plasmid extraction kit (Nucleobond PC 10000 EF, Giga Kit for Endotoxin-Free Plasmid DNA (Macherey-Nagel, Cat. No. 740548)).

[0218] Experimental Example 1.2. Host cell preparation

[0219] Expi293F cells (catalog number A14527, Thermo) were grown in Expi293 expression medium (catalog number A14351-02, Thermo) supplemented with 1% penicillin-streptomycin (catalog number 15140122, Thermo). The cells were then maintained under serum-free suspension culture conditions as follows: 120 rpm agitation speed in a shaker incubator (catalog number NB-206CL, N-biotek, Korea); 37°C; 8% CO2; and 85% relative humidity.

[0220] For large-scale production of recombinant adeno-associated viral vectors, cells were grown in 250 mL of medium in 1 L Erlenmeyer flasks (catalog no. 784011, Nest) with agitation at 120 rpm.

[0221] Experimental Example 1.3. Transfection of recombinant adeno-associated virus expression plasmid into host cells

[0222] Expi293F cells were added at 2.5 × 10 per mL. 6 The cells were seeded at a density of 1 / 3 of a million cells in Expi293F expression medium and cultured for 3 hours. Then, 25 kDa linear PEI (catalog no. 23966-1, Polyscience, USA) was used together with three plasmids (pHelper [catalog no. 112867, Addgene], pRC9n [catalog no. 112865, Addgene], and pAAV [catalog no. 105530, Addgene]) to transfect the cells. Specifically, the plasmids were mixed with DMEM (catalog no. 10569010, Thermo Scientific) at a volume of 1 / 10 the volume of the cells to be transfected. Next, PEI was added to the DNA diluted in DMEM. After further culture for 20 minutes, the DNA-PEI complex was added to the cells.

[0223] Experimental Example 1.4. Collection of recombinant adeno-associated virus before purification 1 - Osmotic shock

[0224] Ninety-six hours after transfection according to Example 1.3, osmotic shock reagent (using 0.5 M NaCl in water) was added to the host cells and maintained in this state for 3 hours. The host cell culture was then collected in a 1000 mL polypropylene conical tube by pouring it into a shaker flask. The cell culture was then centrifuged at 3300 x g for 30 minutes at 4 °C using a high-speed centrifuge (catalog number SU-R22, Hanil) and an angle rotor (catalog number A1000-4, Hanil). The cells were discarded, and the supernatant was used for purification using a 0.45 PES filter system.

[0225] Experimental Example 1.5. Collection of recombinant adeno-associated virus before purification 2 - Freezing and thawing

[0226] Ninety-six hours after transfection, cells were subjected to six or more freeze-thaw cycles according to Example 1.3. Here, cells were frozen using liquid nitrogen at -197°C and thawed in a 37°C water bath. The recombinant adeno-associated virus particles in each medium were then precipitated with 1 / 4 cell culture volume of 40% PEG8000 (Cat. No. V3011, Promega), 2.5M NaCl, and pH 7.4. Each precipitate was then cultured overnight at 4°C, and the recombinant adeno-associated virus in each medium was precipitated by centrifugation at 3,300 x g for 20 minutes. The precipitate was resuspended in resuspension buffer (1x PBS, 250 mM NaCl, 0.001% PF-68, pH 7.5). After benzonase treatment (50 U / mL, 1 hour at 37°C), cell debris was centrifuged at 4,000 rpm for 30 minutes.

[0227] Experimental Example 1.6. Recombinant adeno-associated virus purification - Ultracentrifugation

[0228] The recombinant adeno-associated viruses collected through Experimental Example 1.4 or Experimental Example 1.5 were subjected to an ultracentrifugation process using the following method to purify the recombinant adeno-associated viruses.

[0229] 1) The recombinant adeno-associated virus was pipetted into a Beckman Quick Seal tube using a pipetting needle attached to a 10 mL syringe.

[0230] 2) From the bottom of the Beckman Quick Seal tube into which the recombinant adeno-associated virus had been pipetted, 6 mL of 15% iodixanol (catalog number PB-1893, Progen), 6 mL of 25% iodixanol, 6 mL of 40% iodixanol, and 5 mL of 60% iodixanol were layered in that order.

[0231] 3) 1x PBS was then added to completely fill the Beckman Quick Seal tube.

[0232] 4) The Beckman Quick Seal tubes from step 3) were centrifuged at 350,000 xg for 1.5 hours at 10°C using a 70Ti rotor.

[0233] 5) Next, to collect the recombinant adeno-associated virus particles, the Beckman Quick Seal tube was secured to a clamp stand set at eye level, and an 18G needle was inserted into the top of the tube to allow air in.

[0234] 6) Then, another 18G needle was inserted into the tube just below the interface between the 40% and 60% iodixanol layers with the needle tilted upward.

[0235] 7) Using an 18G needle, approximately 4 mL of the recombinant adeno-associated virus sample contained in the 40% iodixanol layer was extracted.

[0236] 8) The extracted sample was centrifuged again at 350,000xg for 1.5 hours at 10°C using a 70Ti rotor.

[0237] 9) Then, the process of steps 5) to 7) was repeated again to obtain purified recombinant adeno-associated virus.

[0238] Example 1.7. Concentration and buffer exchange

[0239] First, VivaSpin 20 concentrates were coated with 0.1%, 0.01%, and 0.001% PF-68, respectively. Next, recombinant adeno-associated virus samples extracted according to Example 1.6 were added to 10 mL of formulation buffer (1x PBS, 220 mM NaCl, 5% D-sorbitol, and pH 7.5) pre-dispensed on top of Vivaspin 20 100,000 MWCO (Cat. No. VS2020, Sartorius) concentrators, and each was centrifuged at 3000 x g for 10 minutes. After the majority of the solution had passed through the filter, 10 mL of PBS was added, and the washing and centrifugation process was repeated five times. After the final wash, the formulation buffer was repeatedly spun until 200 μL remained. The virus from each sample was then aliquoted and stored at -80°C for future use.

[0240] Experimental Example 1.8. Silver staining

[0241] For use in SDS-PAGE gels, recombinant adeno-associated virus samples were prepared by adding an appropriate amount of NuPAGE lithium dodecyl sulfate (LDS) sample buffer (catalog no. NP0007, Thermo). The samples were then placed at 70°C for 10 minutes. Next, equal amounts of recombinant adeno-associated virus from each sample were loaded onto a Bolt 4-12% Bis-Tris gel (catalog no. NW04122BOX, Thermo) and then subjected to electrophoresis in Bolt 2-(N-morpholino)ethanesulfonic acid (MES) SDS running buffer (catalog no. B0002, Thermo). After electrophoresis, the gel was stained using the SilverXpress Silver Staining Kit (catalog no. LC6100, Thermo) according to the manufacturer's instructions.

[0242] Experimental Example 1.9. Coomassie Brilliant Blue Staining

[0243] Before Coomassie Brilliant Blue staining, the recombinant adeno-associated virus samples were incubated at 95°C for 10 minutes. The gel was then run at 200V for 40 minutes until the loading dye reached the bottom of the gel. The gel was then immersed in distilled water and incubated twice for 5 minutes each. The gel was then placed in Coomassie Brilliant Blue R-250 staining solution (catalog no. EBC001-1000, Enzynomics) and incubated for 1 hour with gentle agitation. The gel was then destained with a destaining solution (80% distilled water, 10% methanol, and 10% acetic acid). The destaining solution was then removed and destained with fresh destaining solution.

[0244] Experimental Example 1.10.qRT-PCR

[0245] To perform qRT-PCR, Dnase I was added to the samples and the samples were incubated at 37°C for 30 minutes. Proteinase K was then added and the samples were incubated at 55°C for 30 minutes. The samples were then inactivated at 95°C for 15 minutes.

[0246] Here, pTR UF-11 plasmid (ATCC MBA-331) was used as the standard plasmid, and the reference standard stock AAV8 (ATCC VR-1816) was used as a positive control.

[0247] The primers used in qRT-PCR were as follows:

[0248] 1) ITR (forward: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 1), reverse: CGGCCTCAGTGAGCGA (SEQ ID NO: 2), Prv: CACTCCCTCTCTGCGCGCTCG (SEQ ID NO: 3))

[0249] 2) bGH (forward: GCCAGCCATCTGTTGT (SEQ ID NO: 4), reverse: GGAGTGGCACCTTCCA (SEQ ID NO: 5), Prv: TCCCCCGTGCCTTCCTTGACC (SEQ ID NO: 6))

[0250] The running protocol used was 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds and 60°C for 1 minute. After the process was completed, samples were analyzed on a QuantStudio3 (Applied Biosystems).

[0251] Experimental Example 1.11. Digital PCR

[0252] To perform digital PCR, Dnase I was added to the sample and the sample was incubated at 37°C for 30 minutes. Proteinase K was then added and the sample was incubated at 55°C for 30 minutes. The sample was then inactivated by placing it at 95°C for 15 minutes. The sample was then inactivated by placing it at 10°C for 10 minutes. 5 From 10 7 Serial dilutions were made.

[0253] The primers used in the digital PCR were as follows:

[0254] 1) ITR (forward: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 1), reverse: CGGCCTCAGTGAGCGA (SEQ ID NO: 2), Prv: CACTCCCTCTCTGCGCGCTCG (SEQ ID NO: 3))

[0255] 2) bGH (forward: GCCAGCCATCTGTTGT (SEQ ID NO: 4), reverse: GGAGTGGCACCTTCCA (SEQ ID NO: 5), Prv: TCCCCCGTGCCTTCCTTGACC (SEQ ID NO: 6))

[0256] The following process was used as the running protocol: 95°C for 10 minutes, 40 cycles of 94°C for 30 seconds and 60°C for 1 minute, and 98°C for 10 minutes. After the process was completed, analysis was performed using a QIACuity dPCR system (Qiagen).

[0257] Experimental Example 1.12. TEM Analysis

[0258] To visualize the recombinant adeno-associated virus particles, analysis was performed using TEM. Negative staining analysis was performed to analyze the ratio of intact to empty capsids. Specifically, 1) 10 μL of sample was placed on a Formvar / carbon-coated Ni grid for 5 minutes, 2) the sample was stained with 5% uranyl acetate for 2 minutes, 3) after washing off the dye, the sample was allowed to dry in air for 30 minutes, and 4) the sample was analyzed using a Match Finder (Tecnai G2 Spirit Twin (FEI, The Netherlands, accelerating voltage 120 kV).

[0259] Experimental Example 2: Experiment on the yield improvement effect of the recombinant adeno-associated virus production process including the osmotic shock process

[0260] Experimental Example 2.1. Experimental conditions and methods

[0261] To investigate the yield-improving effect of osmotic shock conditions in a recombinant adeno-associated virus production process that includes an osmotic shock process, the following experiment was carried out.

[0262] Host cells capable of producing recombinant adeno-associated viruses of the AAV9 serotype were prepared according to Experimental Examples 1.1 to 1.3.

[0263] 2.5 × 10 per mL for each experimental group 6 The cells were seeded into 30 mL culture vessels, and experiments were performed using a total of 16 culture vessels for each experimental group.

[0264] Four days after transfection of the recombinant adeno-associated virus expression plasmid into the host cells, an osmotic shock reagent was added and maintained for 3 hours. Samples of the medium and / or cells were then collected and the number of viral genomes (vg) was measured.

[0265] Experimental Example 2.2. Yield improvement effect of salt addition and concentration

[0266] According to Experimental Example 2.1, the yield improvement effect of the osmotic shock process was measured for each salt concentration.

[0267] The composition of the osmotic shock reagent for each experimental group is shown in the table below.

[0268] [Table 1] [Table 1]

[0269] The experimental results showed that increasing the salt concentration that causes osmotic shock also increased the number of viral genomes recovered from the medium (Figure 1), indicating that when the salt concentration was increased to 1.0 M, host cells actively released recombinant adeno-associated viral particles into the medium.

[0270] Experimental Example 2.3. Salt addition and yield improvement effect depending on the type of salt

[0271] The yield-improving effect of the osmotic shock process was measured for each salt type according to Experimental Example 2.1.

[0272] The composition of the osmotic shock reagent for each experimental group is shown in the table below.

[0273] [Table 2] [Table 2]

[0274] The experimental results showed that NaCl, KCl, and MgCl2 all significantly increased the number of viral genomes recovered from the medium compared to the negative control (NT) without osmotic shock (Figure 2). This suggests that host cells release recombinant adeno-associated viral particles into the medium, regardless of the salt type.

[0275] Experimental Example 3: Experiment on the yield improvement effect of the recombinant adeno-associated virus production process including the pre-culture treatment process

[0276] Experimental Example 3.1. Experimental conditions and methods

[0277] In order to investigate the yield improvement effect depending on the pre-culture treatment conditions in the recombinant adeno-associated virus production process including the pre-culture treatment process, the following experiment was carried out.

[0278] Host cells capable of producing recombinant adeno-associated viruses of the AAV9 serotype were prepared according to Experimental Examples 1.1 to 1.3.

[0279] For each experimental group, 2.5 × 10 per mL 6 The cells were seeded into 30 mL culture vessels, and experiments were performed using a total of eight culture vessels for each experimental group.

[0280] The pre-incubation treatment process was carried out 4 hours after transfection of the recombinant adeno-associated virus expression plasmid into the host cells, and after 4 days, an osmotic shock reagent was added. This condition was maintained for 3 hours, and then sample medium and / or cells were collected to measure the number of viral genomes (vg). Here, the pre-incubation treatment process was carried out by adding a pre-incubation reagent to the host cells.

[0281] Experimental Example 3.2. Yield improvement effect of pre-culture treatment with nocodazole and M344

[0282] According to Experimental Example 3.1, the yield-improving effect of pre-culture treatment with nocodazole and / or M344 was measured.

[0283] The composition of the pre-incubation treatment for each experimental group is shown in the table below:

[0284] [Table 3] [Table 3]

[0285] The experimental results showed that adding nocodazole and M344 during the pre-culture treatment process increased the yield of recombinant adeno-associated virus in host cells (Figure 3). Notably, adding nocodazole and M344 simultaneously resulted in a much higher yield than adding nocodazole and M344 individually during the pre-culture treatment process. In conclusion, adding both nocodazole and M344 to the pre-culture treatment process produced a synergistic effect, significantly improving yield.

[0286] Experimental Example 3.3. Yield improvement effect of pre-culture treatment using sugar, nocodazole, and M344

[0287] According to Experimental Example 3.1, the yield-improving effect of pre-culture treatment using nocodazole, M344, and / or sugar was measured.

[0288] The composition of the pre-incubation treatment for each experimental group is shown in the table below:

[0289] [Table 4] [Table 4]

[0290] The experimental results showed that the yield improvement was higher when nocodazole and M344 were added together than when sugar (sucrose) alone was added during the pre-culture treatment process (Figure 4).

[0291] Experimental Example 4: Experiment on the yield and quality improvement effect of the recombinant adeno-associated virus production method including pre-culture treatment and osmotic shock process

[0292] Experimental Example 4.1. Production methods to be compared

[0293] In this example, a method for producing recombinant adeno-associated viruses, including a pre-culture and osmotic shock process, was compared with a commonly used conventional production method. The production method used in the experiment is depicted schematically in Figure 5.

[0294] The specific experimental method was as follows:

[0295] Upstream Process

[0296] 1) A recombinant adeno-associated virus expression plasmid was prepared according to Experimental Example 1.1.

[0297] 2) Host cells were prepared according to Experimental Example 1.2.

[0298] 3) The recombinant adeno-associated virus expression plasmid prepared in step 1) was transformed into the host cells prepared in step 2) according to Experimental Example 1.3.

[0299] 4) After the process of step 3), the compound was added 4 hours later.

[0300] 5) One day after transformation, the host cells were pre-cultured. In some cases, the pre-culture was omitted.

[0301] 6) Four days after transformation, the cells were processed for downstream processing. Depending on the example, the cells were processed by i) freeze-thawing or by osmotic shock (see Example 1.4 or Example 1.5).

[0302] 7) After the treatment in step 6), downstream processing was carried out.

[0303] Downstream Process

[0304] 1) The product resulting from the upstream process was filtered using a 0.45 μm PES filter, followed by precipitation with 40% PEG8000 with stirring at 4°C for 1 hour, and filtered at 4°C overnight.

[0305] 2) The resulting filtered product was centrifuged at 3000 g for 20 minutes at 4°C.

[0306] 3) The supernatant obtained after centrifugation at 37°C for 45 minutes at 50 units / mL in the presence of 2 mM MgCl2 was subjected to benzonase treatment.

[0307] 4) The resulting product after benzonase treatment was centrifuged at 2500 g, 4° C. for 30 minutes.

[0308] 5) The product obtained after centrifugation was subjected to ultracentrifugation according to Experimental Example 1.6.

[0309] 6) The resulting products from step 5) were subjected to silver staining according to Example 1.8, Coomassie Brilliant Blue staining according to Example 1.9, and qRT-PCR according to Example 1.10. The characteristics of the products resulting from each process were analyzed.

[0310] 7) The product resulting from step 5) was finally blended using a 100K PES concentrator and finally analyzed according to Examples 1.7 to 1.12.

[0311] The method for producing recombinant adeno-associated viruses is shown in the table below:

[0312] [Table 5] [Table 5]

[0313] Experimental Example 4.2. Comparison of cell viability by each method

[0314] The cell viability measured by TEM analysis immediately after the upstream process in Experimental Example 4.1 was compared for each example, and the results are shown in FIGS.

[0315] The experimental results showed that Process 2 (15.8%) and Process 5 (18.2%), which included the freeze-thaw process, had significantly lower cell viability than Process 6 (35.4%), which included the osmotic shock process. This indicates that cells are more damaged during the freeze-thaw process, and that the inclusion of the osmotic shock process significantly reduces cell damage compared to the typical freeze-thaw process.

[0316] Experimental Example 4.3. Comparison of yields by each method

[0317] The yield of recombinant adeno-associated virus obtained by performing the entire process of Experimental Example 4.1 for each example is shown in Figures 9 and 10 and in the table below.

[0318] [Table 6] [Table 6]

[0319] The experimental results showed that when a pre-incubation treatment process was included during cell culture, the host cells produced large amounts of recombinant adeno-associated virus, regardless of the method used to recover the recombinant adeno-associated virus.

[0320] Experimental Example 4.4. Comparison of the purity of recombinant adeno-associated viruses obtained by each method

[0321] For each example, the results of Coomassie brilliant blue staining to compare purity are shown in Figures 11 to 13.

[0322] 11 to 13, it was confirmed that recombinant adeno-associated viruses obtained through the freeze-thaw process (Process 2 and Process 5) had significantly lower purity than recombinant adeno-associated viruses obtained through the osmotic shock process (Process 3 and Process 6). Specifically, when Process 2 and Process 3 were compared, it was confirmed that the column obtained in Process 2 exhibited a significantly higher background band than the column obtained in Process 3. This was thought to be because the inclusion of the freeze-thaw process disrupted the cells, generating a large amount of cell debris.

[0323] Experimental Example 4.5. Comparison of the genome integrity of recombinant adeno-associated viruses obtained by each method

[0324] For each example, the results of genome integrity performed according to Example 1.10 are shown in the table below:

[0325] [Table 7] [Table 7]

[0326] The experimental results showed that recombinant adeno-associated viruses prepared according to the examples using osmotic shock had higher genome integrity than those prepared by disrupting cells using the freeze-thaw method. The same trend was observed even without the pre-culture treatment process. This suggests that the osmotic shock process is an important process for producing the intended recombinant adeno-associated viruses with high quality.

[0327] Experimental Example 4.6. Comparison of the ratio of full capsids to empty capsids of recombinant adeno-associated viruses obtained by each method

[0328] For each example, the results of TEM analysis performed according to Experimental Example 1.11 are shown in FIGS.

[0329] The analysis showed that in Processes 2 and 5, in which cells were disrupted by freeze-thawing, the full / empty ratio was only 40% and 67%, respectively. In contrast, Processes 3 and 6, which included the osmotic shock process, showed high full / empty ratios of 82% and 87%, respectively. This indicates that the osmotic shock process had a very significant impact on the increase in the full / empty ratio (compare Processes 2 and 3, and Processes 5 and 6). This also indicates that the pre-culture treatment process also contributed to some extent to the increase in the full / empty ratio (compare Processes 2 and 5, and Processes 3 and 6).

[0330] Experimental Example 4.7. Comparison of the yield and purity of recombinant adeno-associated viruses obtained by each method

[0331] The yield results for the entire process of Example 4.1 are shown in the table below:

[0332] [Table 8] [Table 8]

[0333] Furthermore, to compare the purity of the obtained recombinant adeno-associated viruses, the results of silver staining performed according to Experimental Example 1.8 are shown in Figure 18.

[0334] The experimental results confirmed that 1) a significantly higher yield was achieved when a pre-culture treatment was used compared to a process without a pre-culture treatment, and 2) a process using an osmotic shock process enabled the production of recombinant adeno-associated virus particles with significantly higher purity compared to a process including a conventional freeze-thaw process. In conclusion, the recombinant adeno-associated virus production method disclosed herein included a pre-culture treatment process and an osmotic shock process. By including these processes, this method can produce recombinant adeno-associated virus of higher quality and higher yield compared to conventional production methods. [Industrial Applicability]

[0335] The method for producing a recombinant adeno-associated virus disclosed herein can be used to produce recombinant adeno-associated viruses with high quality and high yield, and is a more economical and superior method for producing recombinant adeno-associated viruses than conventional production methods.

Claims

1. 1. A method for producing a recombinant adeno-associated virus (rAAV), comprising: (a) preparing a host cell; wherein the host cell contains a vector encoding components of the rAAV, such that the host cell is capable of expressing the rAAV; (b) adding sugar, nocodazole and M344 to the medium containing the host cells; (c) culturing the host cells; wherein said culturing allows for expression of said rAAV in said host cells; (d) applying an osmotic shock to the medium containing the host cells by adding salt; wherein the osmotic shock promotes release of the rAAV from the host cells into the medium; and (e) obtaining the rAAV from the culture medium without lysing the host cells. A method comprising:

2. The rAAV serotype is one of the following: Wild-type serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10; Synthetic (variant) serotypes including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2; and Other AAV variant serotypes The method of claim 1 , wherein the ion exchange rate is selected from one or more of:

3. Step (e) (e-1) separating the culture medium from the host cells in the product of step (d); (e-2) filtering the medium; (e-3) performing PET precipitation on the product of step (e-2); (e-4) adding benzonase to the product of step (e-3) in the presence of salt; (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and (e-6) subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation 3. The method of claim 1 or 2, comprising:

Images