Synthetic single-stranded DNA molecules and methods for making and using same

Abstract

This application discloses modified single-stranded DNA molecules, as well as methods for their cell-free synthesis and their use as therapeutic agents. The technology described herein is generally directed to novel single-stranded deoxyribonucleic acid (ssDNA) molecules (e.g., single-stranded DNA) and methods for producing single-stranded DNA molecules, for example, in the absence of cells or cell lines. Thus, the resulting single-stranded DNA molecules have fewer impurities than comparable vectors made using conventional cell-based production methods and exhibit significantly less immunogenicity in mammalian hosts, which may result in better in vivo expression that lasts for a longer period of time after administration.

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 429,461, filed December 1, 2022, U.S. Provisional Patent Application No. 63 / 449,872, filed March 3, 2023, U.S. Provisional Patent Application No. 63 / 529,637, filed July 28, 2023, and U.S. Provisional Patent Application No. 63 / 544,571, filed October 17, 2023. The entire contents of each of the foregoing applications are expressly incorporated herein by reference. [Background technology]

[0002] Adeno-associated viruses AAV (i.e., recombinant AAV (rAAV) or AAV vectors) are attractive for delivering genetic material because (i) they can infect (transduce) a wide variety of dividing and non-dividing cell types, such as muscle cells and neurons; (ii) they lack viral structural genes, thereby attenuating host cell responses to viral infection, e.g., interferon-mediated responses; (iii) wild-type AAV is considered non-pathological in humans; and (iv) in contrast to wild-type AAV, which can integrate into the host cell genome, replication-deficient AAV vectors lack the rep gene and generally persist episomally, thus greatly limiting the risk of insertional mutagenesis or genotoxicity.

[0003] However, there are several major drawbacks and deficiencies in using AAV particles as gene delivery vectors derived from traditional AAV production from host cells (e.g., Sf9 insect cells under large-scale production conditions). One major drawback associated with rAAV is its limited viral packaging capacity of approximately 4.5 kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). As a result, the use of AAV vectors is limited to protein-coding capacities of less than 150 kDa due to this limitation in viral packaging. A second drawback is related to capsid immunogenicity, which prevents re-administration to patients. The patient's immune system can respond to the vector, effectively acting as a booster to stimulate the immune system to generate high titers of anti-AAV antibodies that could prevent future treatment. Several recent reports have raised concerns about immunogenicity under high-dose conditions. Another significant drawback is that production of AAV in host cells (e.g., insect cells) during large-scale production of the viral genome results in a random mixture of plus (+) and minus (-) strand vectors, which dramatically reduces strand specificity of the transgene for desired therapeutic expression of the sense strand.

[0004] In addition, conventional capsid-containing AAV virions are produced by introducing a plasmid containing the AAV genome, rep gene, and cap gene (Grimm et al., 1998). However, it has been found that such encapsidated AAV viral vectors do not efficiently transduce certain cell and tissue types, and the capsids induce severe immune responses in the host. Therefore, the use of adeno-associated virus (AAV) vectors for gene therapy (including gene editing) is limited to a single administration to a patient due to the patient's immune response, the limited range of transgene genetic material suitable for delivery in AAV vectors due to the minimal viral packaging capacity (approximately 4.5 kb), and slow AAV-mediated gene expression. Furthermore, methods for producing such AAV vectors rely heavily on traditional insect cell-dependent production methods. Such methods can be hindered by contaminants from the cells used to produce the vector, which are inconvenient or expensive to remove or purify, and may result in undesirable side effects if included in a therapeutic formulation.

[0005] Thus, there is a strong need in the gene therapy field for technologies that are minimally immunogenic, re-administrable, and allow for the generation of large quantities of recombinant vectors, increasing expression levels, strand specificity, and purity while also increasing transgene size capacity. Summary of the Invention [Means for solving the problem]

[0006] The technology described herein is generally directed to novel single-stranded deoxyribonucleic acid (ssDNA) molecules (e.g., single-stranded DNA), as well as methods for producing single-stranded DNA molecules, e.g., in the absence of cells or cell lines. Thus, the resulting single-stranded DNA molecules may have fewer impurities and exhibit significantly less immunogenicity in mammalian hosts than comparable vectors made using traditional cell-based production methods, resulting in better in vivo expression that lasts for longer periods after administration. According to some aspects, the present disclosure features methods for cell-free synthesis of single-stranded DNA molecules using rolling circle amplification and enzymatic degradation.

[0007] In a first aspect, the present disclosure provides a method for generating a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure comprising at least one stem and at least one loop at its 3'-end, the method comprising the sequential steps of: (a) contacting a double-stranded closed-end DNA (ceDNA) molecule comprising the at least one nucleic acid sequence of interest with an endonuclease; and (b) contacting the double-stranded ceDNA with an exonuclease, thereby generating the linear ssDNA molecule. In some embodiments, the ceDNA molecule further comprises at least one promoter. According to some embodiments, the promoter comprises a transcription start site (TSS).

[0008] According to some aspects and embodiments herein, the ceDNA molecule further comprises at least one enhancer. According to some aspects and embodiments herein, the promoter is double-stranded in the ssDNA molecule. According to some aspects and embodiments herein, the TSS is double-stranded in the ssDNA molecule. According to some aspects and embodiments herein, the enhancer is double-stranded in the ssDNA molecule. According to some aspects and embodiments herein, the ssDNA molecule further comprises at least one stem-loop structure at the 5'-end, the stem-loop structure comprising at least one stem and one loop. According to some aspects and embodiments herein, the at least one stem-loop structure at the 3'-end comprises at least two stem-loop structures, and / or the at least one stem-loop structure at the 5'-end comprises at least two stem-loop structures. According to further embodiments, the ceDNA molecule comprises one or more endonuclease recognition sequences. According to some aspects and embodiments herein, the stem-loop structure at the 3' end comprises one or more endonuclease recognition sequences. According to some aspects and embodiments herein, the stem-loop structure at the 5' end comprises one or more endonuclease recognition sequences.

[0009] According to some embodiments of the aspects and embodiments herein, the one or more endonuclease recognition sequences are selected from the group consisting of 5'-CCAA-3'(Nb.BtsI)(Nb.BsrDI)(Nt.CviPII), 5'-CCAAGC-3'(Nb.BbvCI), 5'-CCAACC-3'(Nb.BbvCI), 5'-CCAAGAGTCNNNN-3'(Nt.BstNBI) -N can be A, G, C, or T, 5'-CCAAG-3'(Nb.BsmI), 5'-CCAAC-3'(Nb.BssSI), 5'-CCAAGGATCNNNN-3'(Nt.AlwI), CCAAGTCTCN-3'(Nt.BsmAI), and CCAAGCTCTTCN-3'(Nt.BspQI). According to some embodiments of the aspects and embodiments herein, the terminal residue of the 3'-terminal stem-loop structure is capable of priming replication and / or transcription in the nucleus of a host cell. According to some embodiments, the 3'-terminal residue comprises a free -OH.

[0010] According to some aspects and embodiments herein, contacting the double-stranded ceDNA molecule with an endonuclease creates one or more nicks in the sense strand of the nucleic acid sequence of interest, thereby creating a nicked ceDNA molecule. According to further embodiments, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest, within the nucleic acid sequence of interest, and / or 3' upstream of the nucleic acid sequence of interest. According to other further embodiments, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest. According to still other further aspects and embodiments herein, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 3' downstream of the nucleic acid sequence of interest. According to some aspects and embodiments herein, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located within the nucleic acid sequence of interest.

[0011] According to some aspects and embodiments herein, the sense strand further comprises at least one phosphorothioate (PS)-modified nucleotide downstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least two PS-modified nucleotides downstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least three PS-modified nucleotides downstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least four PS-modified nucleotides downstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least five PS-modified nucleotides downstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least one phosphorothioate (PS)-modified nucleotide upstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least two PS-modified nucleotides upstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least three PS-modified nucleotides upstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least four PS-modified nucleotides upstream of the expression cassette. According to some aspects and embodiments herein, the sense strand further comprises at least five PS-modified nucleotides upstream of the expression cassette.

[0012] According to some aspects and embodiments herein, contacting the nicked ceDNA molecule with an exonuclease generates a stretch of single-stranded DNA (ssDNA) corresponding to the desired nucleic acid sequence in the double-stranded ceDNA molecule. According to some aspects and embodiments herein, the endonuclease is a type II restriction enzyme. According to some aspects and embodiments herein, the endonuclease is selected from the group consisting of Nb.BtsI, Nb.BsrDI, Nt.CviPII, Nb.BbvC1, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, Nb.BssSI, Nt.AlwI, Nt.BsmA1, Nt.BspQI, and endonuclease V (Endo V). According to further embodiments, the type II restriction enzyme is Nb.BbvCI. According to other further embodiments, the endonuclease is Endo V. According to some aspects and embodiments herein, the double-stranded ceDNA molecule comprises at least one deoxyinosine residue. According to some embodiments, the deoxyinosine residue is present in at least one stem-loop structure at the 3' end, two bases upstream of the desired nick site. According to some aspects and embodiments herein, the double-stranded ceDNA molecule comprises at least one uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue nicked by an endonuclease, wherein the endonuclease has enzymatic activity against the uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue. According to some embodiments, the endonuclease nicks the DNA at a second phosphodiester bond 3' to the uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue.

[0013] According to some aspects and embodiments herein, the exonuclease is T7 exonuclease. According to some aspects and embodiments herein, the exonuclease is exonuclease III (Exo III). According to some aspects and embodiments herein, the method further comprises: (1) performing rolling circle amplification (RCA) using a double-stranded DNA (dsDNA) molecule, thereby generating an intermediate dsDNA molecule; and (2) performing cell-free enzymatic synthesis using the intermediate dsDNA molecule, thereby generating a ceDNA molecule, wherein steps (1) and (2) are performed before steps (a) and (b). According to some embodiments, the method further comprises: (3) purifying the ceDNA molecule after step (2) and before step (a). According to some aspects and embodiments herein, the RCA step (1) comprises: (i) contacting the dsDNA molecule with a primer and a DNA polymerase. According to some aspects and embodiments herein, step (2) comprises (i) contacting the intermediate dsDNA molecule with a restriction endonuclease to generate a cleaved intermediate dsDNA molecule, and (ii) contacting the cleaved intermediate dsDNA molecule with an oligonucleotide comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule and a ligase. According to further embodiments, step (ii) further comprises contacting the cleaved intermediate dsDNA molecule with at least two oligonucleotides, each comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule. According to another further embodiment, the at least two oligonucleotides each comprise the same end. According to another further embodiment, the at least two oligonucleotides each comprise different ends. According to some aspects and embodiments herein, the at least two oligonucleotides are the same. According to some aspects and embodiments herein, the at least two oligonucleotides are different.According to some embodiments of the aspects and embodiments herein, step (2) further comprises (iii) ligating at least one oligonucleotide to the cleaved dsDNA intermediate.

[0014] According to some aspects and embodiments herein, at least one stem at the 3' end comprises a partial DNA duplex of 4 to 500 nucleotides. According to some aspects and embodiments herein, at least one stem at the 3' end comprises a partial DNA duplex of 4 to 5 nucleotides. According to some aspects and embodiments herein, at least one stem at the 5' end comprises a partial DNA duplex of 4 to 500 nucleotides, e.g., 4 to 10, 4 to 20, 4 to 30, 4 to 40, 4 to 50, 4 to 100, 4 to 200, 4 to 300, 4 to 400, 4 to 500, 10 to 500, 20 to 500, 50 to 500, 100 to 500, 200 to 500, 300 to 500, 400 to 500, 10 to 500, According to some aspects and embodiments herein, at least one stem at the 5'-end comprises a partial DNA duplex of 4 to 5 nucleotides. According to some aspects and embodiments herein, at least one loop at the 3'-end comprises 3 to 500 unlinked nucleotides. According to some aspects and embodiments herein, at least one loop at the 3'-end comprises at least three unlinked nucleotides. According to some aspects and embodiments herein, at least one loop at the 5'-end comprises 3 to 500 unlinked nucleotides, for example, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 unlinked nucleotides. According to some aspects and embodiments herein, at least one loop at the 5'-end comprises at least three unlinked nucleotides.

[0015] According to some aspects and embodiments herein, the ssDNA comprises at least two stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least three stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least four or more stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least two stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least three stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least four or more stem-loop structures at the 3'-end. According to some aspects and embodiments herein, the ssDNA comprises at least one bubble structure at the 5'-end. According to some aspects and embodiments herein, the ssDNA comprises at least two stem-loop structures at the 5'-end. According to some aspects and embodiments herein, the ssDNA comprises at least three stem-loop structures at the 5'-end. According to some aspects and embodiments herein, the ssDNA comprises at least four or more stem-loop structures at the 5'-end. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end comprises a hairpin DNA structure. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

[0016] According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end does not include the A or A' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end does not include the A, A', D, or D' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end does not include the A, A', B, B', C, C', D, or D' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end does not include the A or A' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end does not include the A, A', D, or D' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end does not include the A region, the A' region, the B region, the B' region, the C region, the C' region, the D region, or the D' region that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end does not include the rep binding element (RBE) that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end does not include the terminal resolution site (trs) that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end does not include the rep binding element (RBE) that would be present in a wild-type AAV ITR. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end does not include the terminal resolution site (trs) that would be present in a wild-type AAV ITR.According to some embodiments of the aspects and embodiments herein, the ssDNA molecule does not include any viral-derived sequences.

[0017] According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end comprises one or more nucleotides modified to be exonuclease-resistant. According to some embodiments, the nucleotides modified to be exonuclease-resistant are selected from the group consisting of phosphorothioate-modified nucleotides, locked nucleic acid (LNA)-modified nucleotides, 2'-O-methyl (m)-modified nucleotides, 2'-O-methoxyethyl (E)-modified nucleotides, 2'-fluoro (F)-modified nucleotides, and combinations thereof. According to some aspects and embodiments herein, at least one stem-loop structure at the 3'-end and / or at least one stem-loop structure at the 5'-end each independently comprise a functional moiety. According to some aspects and embodiments herein, at least one stem-loop structure at the 5'-end comprises a hairpin DNA structure. According to some embodiments of the aspects and embodiments herein, the at least one stem-loop structure at the 5' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

[0018] According to some aspects and embodiments herein, the stem structure at the 5'-end comprises one or more nucleotides modified to be exonuclease resistant. According to some aspects and embodiments herein, the nucleotides modified to be exonuclease resistant are PS-modified nucleotides. According to some aspects and embodiments herein, at least one loop structure at the 5'-end further comprises one or more nucleic acids to stabilize the end. According to some aspects and embodiments herein, at least one loop structure at the 5'-end further comprises one or more chemically modified nucleic acids. According to some aspects and embodiments herein, the deoxyinosine residue is located at position -1i, -2i, -5i, or -7i relative to SEQ ID NO:7. According to some aspects and embodiments herein, the deoxyinosine residue is located at position -1i or -7i relative to SEQ ID NO:7.

[0019] According to some aspects and embodiments herein, the ssDNA molecule can be transported across the nuclear membrane from the cytosol into the nucleus of a host cell. According to some aspects and embodiments herein, the ssDNA molecule further comprises at least one functional moiety. According to some aspects and embodiments herein, at least one stem-loop structure at the 3' end comprises at least one functional moiety. According to some aspects and embodiments herein, at least one stem-loop structure at the 5' end comprises at least one functional moiety. According to some aspects and embodiments herein, the at least one functional moiety is an aptamer. According to some aspects and embodiments herein, the loop at the 5' end and / or the 3' end further comprises one or more aptamers. According to some aspects and embodiments herein, the aptamer is encoded by a ceDNA molecule, and the aptamer forms a secondary aptamer structure in the ssDNA molecule. According to some aspects and embodiments herein, the aptamer is a CH4-1 aptamer. According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more synthetic ribozymes. According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more antisense oligonucleotides (ASOs). According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more short interfering RNAs (siRNAs). According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more antiviral nucleoside analogs (ANAs). According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more triplex-forming oligonucleotides. According to some aspects and embodiments herein, at least one loop at the 3'-end and / or 5'-end further comprises one or more gRNAs or gDNAs.According to some aspects and embodiments herein, at least one loop at the 3' end and / or 5' end further comprises one or more molecular probes. According to some aspects and embodiments herein, the ssDNA molecule lacks any viral capsid protein coding sequence. According to some aspects and embodiments herein, the ssDNA molecule comprises a first ITR and a second ITR, and the ITRs do not comprise any viral-derived sequences.

[0020] According to some aspects and embodiments herein, the ssDNA molecule does not contain any virus-derived sequences. According to some aspects and embodiments herein, the ssDNA molecule comprises a first ITR and a second ITR, wherein the ITRs are synthetic. According to some aspects and embodiments herein, the ssDNA molecule is synthetically generated in vitro. According to some aspects and embodiments herein, the ssDNA molecule is synthetically generated in vitro in a cell-free environment. According to some aspects and embodiments herein, the ssDNA molecule does not activate or only minimally activates an immune pathway. According to some embodiments, the immune pathway is an innate immune pathway. According to further embodiments, the immune pathway is an innate immune pathway selected from the group consisting of the cGAS / STING pathway, the TLR9 pathway, the inflammasome-mediated pathway, and combinations thereof. According to some aspects and embodiments herein, the nucleic acid sequence of interest is a therapeutic protein or a therapeutic fragment thereof.

[0021] According to some embodiments of the aspects and embodiments herein, the at least one therapeutic protein is selected from the group consisting of an antibody, an enzyme, a clotting factor, a transcription factor, a replication factor, a growth factor, a hormone, and a fusion protein. According to further embodiments, the at least one therapeutic protein is a therapeutic agent for melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell disease, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g., Hurler syndrome (MPS type I), Scheie syndrome (MPS type IS), Hurler-Scheie syndrome (MPS type I HS), Hunter syndrome (MPS type II), Sanfilippo syndrome types A, B, C, and D (MPS type III), A, B, C, and D), Morquio syndrome types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), hyaluronidase deficiency (MPSIX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, The present invention is useful for treating a genetic disorder selected from the group consisting of Alzheimer's disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber's congenital amaurosis, Stargardt's macular dystrophy (ABCA4), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency.

[0022] According to another aspect, the present disclosure provides a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure at its 3' end, produced by the method of any one of the aspects and embodiments herein.

[0023] According to another aspect, the present disclosure provides a lipid nanoparticle comprising an ssDNA molecule of any of the aspects and embodiments herein and a lipid.

[0024] According to another aspect, the present disclosure provides a pharmaceutical composition comprising an ssDNA molecule of any of the aspects or embodiments herein or a lipid nanoparticle composition of any of the aspects and embodiments herein, and a pharmaceutically acceptable excipient.

[0025] According to another aspect, the present disclosure provides a host cell comprising the ssDNA molecule of any of the aspects or embodiments herein, or the lipid nanoparticle of any of the aspects or embodiments herein.

[0026] According to another aspect, the present disclosure provides a method of treating a genetic disorder in a subject, comprising administering to the subject a therapeutically effective amount of an ssDNA molecule of any of the aspects or embodiments herein, a lipid nanoparticle of any of the aspects or embodiments herein, or a pharmaceutical composition of any of the aspects or embodiments herein.

[0027] According to another aspect, the present disclosure provides a method of delivering a therapeutic gene and / or a therapeutic protein to a subject, the method comprising administering to the subject a therapeutically effective amount of an ssDNA molecule of any of the aspects or embodiments herein, a lipid nanoparticle of any of the aspects or embodiments herein, or a pharmaceutical composition of any of the aspects or embodiments herein.

[0028] According to another aspect, the present disclosure provides a method of delivering a therapeutic gene and / or a therapeutic protein to a cell, comprising contacting the cell with an ssDNA molecule of any of the aspects or embodiments herein, a lipid nanoparticle of any of the aspects or embodiments herein, or a pharmaceutical composition of any of the aspects or embodiments herein, thereby delivering the therapeutic gene and / or the therapeutic protein to the cell.

[0029] According to another aspect, the present disclosure provides a method of delivering a therapeutic gene to the nucleus of a cell, comprising contacting a cell with an ssDNA molecule of any of the aspects or embodiments herein, a lipid nanoparticle of any of the aspects or embodiments herein, or a pharmaceutical composition of any of the aspects or embodiments herein, thereby delivering the therapeutic gene and / or therapeutic protein to the nucleus of the cell.

[0030] According to another aspect, the present disclosure provides a method of minimizing an immune response in a subject being treated with a therapeutic gene or therapeutic protein, the method comprising administering to the subject a therapeutically effective amount of a ssDNA molecule of any of the aspects or embodiments herein, a lipid nanoparticle of any of the aspects or embodiments herein, or a pharmaceutical composition of any of the aspects or embodiments herein, wherein the nucleic acid of interest encodes the therapeutic gene or therapeutic protein.

[0031] Embodiments of the present disclosure, briefly summarized above and discussed in more detail below, can be understood by reference to illustrative embodiments of the disclosure that are depicted in the accompanying drawings. However, because the present disclosure may admit of other equally effective embodiments, the accompanying drawings illustrate only typical embodiments of the present disclosure and therefore should not be considered limiting in scope. [Brief explanation of the drawings]

[0032] [Figure 1] 1 shows a schematic comparing symmetric and asymmetric inverted terminal repeat (ITR) oligos. [Figure 2]This figure shows the synthesis of single-stranded DNA (ssDNA, SSD) via rolling circle amplification and enzymatic synthesis. Plasmid templates (lanes 2 and 7) were subjected to rolling circle amplification to generate an intermediate dsDNA molecule "A" (lane 3). This intermediate molecule was subjected to enzymatic synthesis to generate a closed-end DNA (ceDNA) molecule "C" (lanes 4 and 9). The ceDNA was further treated with either Nb.BbvCI (lane 5) or endonuclease V (lane 10) to generate ssDNA "I." oc is the open-circular plasmid, sc is the supercoiled plasmid, A is the amplified product, C is the ceDNA, and I is the ssDNA. [Figure 3A]

[0033] Figure 3A shows the design of an endonuclease V substrate for single-stranded DNA (ssDNA) synthesis. As shown in Figure 3A, inosine positions -1, -2, -5, and -7 are numbered with reference to the 3' end of the left ITR (see SEQ ID NO: 4). Within the RBE region of the left ITR (SEQ ID NO: 4), certain nucleotides (nt) were modified from the AAV2 ITR sequence to minimize CpG sites. This was advantageous in the present invention because CpG sites are known to activate the innate immune response and methylation of CpG motifs can affect promoter function, for example, via promoter silencing. [Figure 3B] An exemplary ssDNA molecule containing a hairpin ITR with potential positions for inosine substitutions and phosphorothioate (PS) linkages is shown. [Figure 4A] A schematic of the predicted secondary structure of the inosine-modified left ITR is shown. The inosine position influences second-strand synthesis of ssDNA. The leftmost structure (i) is the standard (unmodified) structure. Structures designated (ii) through (v) are models of inosine modifications in the left ITR relative to the 3' end. Red, green, and blue indicate high, medium, or low probability of base pairing. [Figure 4B]A schematic diagram of the predicted secondary structure of the inosine-modified left ITR after endonuclease V-mediated ssDNA synthesis is shown. Structures designated (i)-(iv) show the predicted secondary structure of the left ITR with the inosine modification relative to the 3' end. Red, green, and blue indicate high, medium, or low probability of base pairing. The 3' and 5' ends of each ITR are labeled. [Figure 5] The results of Klenow fill-in of inosine-containing single-stranded DNA are shown, demonstrating successful ssDNA conversion. ceDNA (SEQ ID NO: 1) with or without inosine at various positions within the left ITR was generated by RAMP (lanes 2, 5, 8, 11, and 14). The ceDNA was subjected to endonuclease V-mediated ssDNA synthesis (lanes 3, 7, 10, and 15). The resulting products were treated with DNA polymerase I large (Klenow) fragment exo- (lacking 3' to 5' and 5' exonuclease activity) to facilitate second-strand synthesis (lanes 4, 7, 10, 13, and 16). Products of successful ceDNA and ssDNA second-strand synthesis comigrated. [Figure 6] Results are shown demonstrating that the universal endonuclease V-mediated synthesis protocol enables efficient ssDNA conversion across constructs. Multiple ceDNAs with unique internal sequences were generated by RAMP. All ceDNAs contained a left ITR containing an inosine at position -1 and a right ITR containing an extended A stem (SO-238, SEQ ID NO: 14) (lanes 3, 5, 7, 10, and 11). ceDNA lacking inosine served as a control for endonuclease V activity (lane 2). All ceDNAs were subjected to endonuclease V-mediated ssDNA synthesis (lanes 2, 4, 6, 8, 9, and 12). [Figure 7]An exemplary approach for a synthetic process with functional moieties to enable a minimalist, universal synthesis approach is described. Previous approaches are GOI-directed and therefore GOI-specific, requiring enzyme / sequence optimization for the GOI. The new process described herein is left ITR-directed, a universal approach, and uses a modification-specific enzyme, such as endonuclease V, a DNA damage repair protein that recognizes and nicks inosine-containing DNA. [Figure 8] Described herein is the process of removing various ITR regions to arrive at the minimally required ssDNA. [Figure 9] ssDNA variants are described to improve metabolic stability and promote higher gene expression. [Figure 10] Exemplary modifications at the ITR locations that inhibit nucleases and / or increase duplex stability are described. [Figure 11] 1 shows an exemplary LNP encapsulating ssDNA as described herein. [Figure 12] This figure illustrates the synthesis of ssDNA in the absence of phosphorothioate (PS) bonds for terminating T7 exonuclease using a ceDNA precursor with AAV-derived ITRs. The left and middle diagrams show the conversion of ceDNA precursors to ssDNA with and without PS bonds, respectively. The right side shows a gel demonstrating the efficient conversion of ceDNA to ssDNA after treatment of ceDNA with nicking enzyme and T7 exonuclease with and without PS bonds in the ceDNA precursor. [Figure 13]This paper illustrates the synthesis of ssDNA in the absence of phosphorothioate (PS) bonds for terminating T7 exonuclease using a ceDNA precursor with a simple hairpin end. The left and middle diagrams show a schematic of a ceDNA precursor with a simple hairpin end showing its conversion to ssDNA with and without PS bonds, respectively. The right diagram shows a gel showing the efficient conversion of ceDNA to ssDNA after treatment of the ceDNA with nicking enzyme and T7 exonuclease with and without PS bonds in the ceDNA precursor. [Figure 14A] Figure 14 shows schematic diagrams of ssDNA generated by processing ceDNA precursors with and without PS attachments, either AAV-derived or with simple hairpin ends. Triangles indicate the positions of nick sites. Arrows indicate the positions of priming sites for Sanger run-off sequencing. Stars indicate the positions of PS attachments. Figure 14A: AAV-derived ITR ends (right side) with PS attachments. Figure 14B: AAV-derived ITR ends (right side) without PS attachments. Figure 14C: Simple hairpin ends (right side) with PS attachments. Figure 14D: Simple hairpin ends (right side) without PS attachments. The dotted lines on the right side of Figures 14B and 14D indicate heterogeneity of the endpoint sequences. [Figure 14B] Same as above [Figure 14C] Same as above [Figure 14D] Same as above [Figure 15] Examples of terminal structure oligonucleotides and the strategy used to test the sequence and structural requirements for T7 exonuclease termination are described. Above are examples of oligonucleotide sequences and predicted dsDNA structures, including the CH4-1 aptamer on the right. Below are schematic diagrams of predicted fragments generated by RsaI and EcoRI digestion depending on whether T7 exonuclease is terminated by a structured region. [Figure 16A] On the right are shown the sequence (bottom) and a schematic diagram (top) of the full hilt oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16B]On the right are shown the sequence (bottom) and a schematic diagram (top) of the half hilt oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16C] On the right are shown the sequence (bottom) and a schematic diagram (top) of the extended half-stalk oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16D] On the right is shown the sequence (bottom) and schematic (top) of the bubble_v1 oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16E] On the right is the sequence (bottom) and schematic (top) of the bubble_v19 oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16F] On the right are shown the sequence (bottom) and a schematic diagram (top) of the loop oligonucleotide, which also contains the CH4-1 aptamer. [Figure 16G] On the right are shown the sequences (bottom) and schematics (top) of oligonucleotides with PS bonds, including the CH4-1 aptamer ("1-5" indicates that the oligonucleotide contains 1, 2, 3, 4, or 5 PS bonds). [Figure 16H] On the right are shown the sequence (bottom) and a schematic diagram (top) of a control (no TS) oligonucleotide that also contains the CH4-1 aptamer. [Figure 17] 1 shows a gel analysis of restriction enzyme digestion profiles of bubble_v1 oligonucleotide, bubble_v19 oligonucleotide, full stalk oligonucleotide, half stalk oligonucleotide, and extended half stalk oligonucleotide. [Figure 18] 1 shows a gel analysis of restriction enzyme digestion profiles of an oligonucleotide having five PS bonds, an oligonucleotide having four PS bonds, an oligonucleotide having three bonds, an oligonucleotide having two PS bonds, an oligonucleotide having one PS bond, or a loop oligonucleotide. [Figure 19]This figure illustrates a schematic strategy for generating ssDNA using a stalk-structured motif to terminate T7 exonuclease. Both sides illustrate the use of the stalk structure. In addition, the right side illustrates the inclusion of an aptamer encoded as double-stranded DNA that folds into a functional aptamer structure only after the ssDNA is generated. [Figure 20] This figure illustrates a schematic strategy for generating ssDNA using different structural motifs to terminate T7 exonuclease. Both sides illustrate the use of a hemistalk structure. Additionally, the right side illustrates the inclusion of an aptamer encoded as double-stranded DNA that folds into a functional aptamer structure only after the ssDNA is generated. [Figure 21] We describe a schematic strategy for generating ssDNA using exonuclease III (ExoIII) to degrade nicked strands in the 3'→5' direction. ExoIII termination is controlled by the specific location of PS bonds (represented by circles connected by fold lines). [Figure 22] Figure 1 shows a gel analysis of ssDNA generated using Exo III compared to T7 exonuclease. The left side shows the results of the two-step method. The right side shows the results of the "one-pot" method. DETAILED DESCRIPTION OF THE INVENTION

[0033] I. Definition Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meaning commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein, as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition (published by Merck Sharp & Dohme Corp.), 2011 (ISBN 978-0-911910-19-3), Robert S. Porter et al. (eds.), Fields Virology, 6th Edition (published by Lippincott Williams & Wilkins, Philadelphia, PA, USA) (2013), Knipe, DM and Howley, PM (ed.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine (published by Blackwell Science Ltd.), 1999-2012 (ISBN 9783527600908), and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference (VCH Publishers, Inc.), 1995 (ISBN1-56081-569-8), Immunology by Werner Luttmann (published by Elsevier), 2006, Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN0815345305, 9780815345305), Lewin's Genes Harbor, NY, USA (2012) (ISBN1936113414), Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN044460149X), Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN0124199542), Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005, and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBNs 0471142735, 9780471142737), the contents of all of which are incorporated herein by reference in their entireties.

[0034] As used herein, the term "AAV" or "adeno-associated virus" refers to a single-stranded DNA parvovirus that replicates exclusively in cells. Certain functions of AAV are provided only by co-infection with a helper virus. Thirteen serotypes of AAV have been identified. General information and reviews on AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York).

[0035] As used herein, phrases such as "anti-therapeutic nucleic acid immune response," "immune response to a therapeutic nucleic acid," "immune response to a transfer vector," and the like refer to any immune response to a therapeutic nucleic acid, whether of viral or non-viral origin. For example, in some embodiments, the immune response is specific to a transfer vector, which may be single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. In other embodiments, the immune response is specific to single-stranded DNA, e.g., single-stranded synthetic DNA.

[0036] As used herein, the term "aptamer" refers to a nucleic acid molecule that can bind to a specific molecule of interest with high affinity and specificity (Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). For example, aptamers can be composed of DNA or RNA, or can contain non-natural nucleotides and nucleotide analogs (e.g., locked DNA or peptide nucleic acid [PNA]) that have high affinity for proteins localized in the nucleus or its membrane.

[0037] As used herein, the terms "cell-free," "cell-free synthesis," "cell-free production," "synthetic closed-end DNA vector production," and "synthetic production," and all other related counterparts, are used interchangeably and refer to the production of one or more molecules in a manner that does not involve replication or other propagation of the molecule by or within a cell or using a cell extract. Synthetic production avoids contamination of the produced molecule with cellular contaminants (e.g., cellular proteins or cellular nucleic acids) and also avoids undesired cell-specific modifications of the molecule during the production process (e.g., methylation or glycosylation, or other post-translational modifications).

[0038] As used herein, the terms "single-stranded DNA molecule," "ssDNA molecule," or "SSD molecule" refer to a deoxyribonucleic acid (DNA) molecule comprising at least one single-stranded nucleic acid sequence adjacent to at least one stem-loop structure at the 3'-end. In some embodiments, the single-stranded DNA molecule further comprises at least one stem-loop structure at the 5'-end. As used herein, a single-stranded DNA molecule may comprise a region of double-stranded DNA (or partial duplex), e.g., a stem-loop structure, e.g., an inverted terminal repeat sequence or a portion thereof, at an end, e.g., the 3'-end and / or the 5'-end. In some embodiments, the ssDNA molecule is a synthetic ssDNA molecule. In some embodiments, the ssDNA molecule comprises at least one stem-loop structure at the 5'-end and at least one stem-loop structure at the 3'-end.

[0039] As used herein, the terms "single-stranded (ss) synthetic DNA molecule," "single-stranded (ss) synthetic vector," "synthetic production of ssDNA molecule," and "synthetic production of ss vector" refer to single-stranded (ss) synthetic DNA molecules (ssDNA), single-stranded vectors, and methods for their synthetic production in a completely cell-free environment. This production can involve one or more molecules in a manner that does not require replication or other propagation of the molecule by a cell or the interior of a cell or by the use of a cell extract. Synthetic production avoids contamination of the produced molecule with cellular contaminants, such as cellular proteins or nucleic acids, viral proteins or DNA, or insect proteins or DNA, and further minimizes undesired cell-specific modifications of the molecule during the production process, such as methylation or glycosylation, or other post-translational modifications.

[0040] As used herein, the term "gap" refers to an interrupted portion of the synthetic DNA vectors of the present disclosure that creates a stretch of single-stranded DNA in an otherwise double-stranded DNA. Gaps can be from 1 nucleotide to 100 nucleotides in length. Exemplary gaps designed and created by the methods described herein, and synthetic vectors generated thereby, can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides (nt) in length. Exemplary gaps in the present disclosure can be 1 nt to 10 nt in length, 1 to 20 nt in length, 1 to 30 nt in length, or any length. According to some embodiments, the gap can be 5' upstream of the expression cassette. According to some embodiments, the gap can be 3' downstream of the expression cassette. According to some embodiments, the gap can be both 5' upstream and 3' downstream of the expression cassette.

[0041] As used herein, the term "nick" refers to a discontinuity in a double-stranded DNA molecule in which a phosphodiester bond is absent between adjacent nucleotides on one strand, typically due to damage or enzymatic action. It should be understood that one or more nicks allow for the release of a twist in the DNA strand during replication, and that the nicks serve to facilitate the binding of the transcription machinery. According to some embodiments, single-strand breaks ("nicks") in DNA can be formed by hydrolysis and subsequent removal of phosphate groups in the helical backbone.

[0042] As used herein, the term "ceDNA" refers to capsid-free, closed-ended, linear, double-stranded (ds) duplex DNA, whether synthetic or otherwise, for non-viral gene transfer. A detailed description of ceDNA is provided in International Patent Application PCT / US2017 / 020828, filed March 3, 2017 (published as International Patent Publication No. 2017152149A1), the entire contents of which are expressly incorporated herein by reference. Certain methods for the generation of ceDNA containing various inverted terminal repeat (ITR) sequences and configurations using cell-based methods are described in Example 1 of International Patent Application No. PCT / US18 / 49996, filed September 7, 2018 (published as International Patent Publication No. 2019 / 051255A1), and International Patent Application No. PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. 2019 / 113310A1), each of which is incorporated herein by reference in its entirety. Certain methods for the generation of synthetic ceDNA vectors containing various ITR sequences and configurations are described, for example, in International Patent Application No. PCT / US2019 / 14122, filed January 18, 2019 (published as International Patent Publication No. 2019 / 143885A1), the entire contents of which are incorporated herein by reference. As used herein, the terms "ceDNA vector" and "ceDNA" are used interchangeably. According to some embodiments, the ceDNA is a closed-end linear double-stranded (CELiD) CELiD DNA. According to some embodiments, the ceDNA is a DNA-based minicircle. According to some embodiments, the ceDNA is a minimal immunologically defined gene expression (MIDGE) vector. According to some embodiments, the ceDNA is ministring DNA. According to some embodiments, the ceDNA is doggybone™ DNA. According to some embodiments, the ceDNA comprises one or more phosphorothioate-modified nucleotides. According to some embodiments, the ceDNA does not comprise phosphorothioate-modified nucleotides.

[0043] As used herein, the term "neDNA" or "nicked ceDNA" refers to closed-end DNA that has a nick or gap of 1 to 100 base pairs in the stem or spacer region upstream of the open reading frame (e.g., the expressed promoter and transgene).

[0044] As used herein, the term "inverted terminal repeat" or "ITR" refers to a nucleic acid sequence located at the 5' and / or 3' end of an ssDNA molecule disclosed herein that comprises at least one stem-loop structure that is partially duplexed and includes at least one loop.

[0045] As used herein, the term "stem-loop structure" refers to a nucleic acid structure comprising at least one double-stranded region (referred to herein as a "stem") and at least one single-stranded region (referred to herein as a "loop"). In some embodiments, the stem-loop structure is a hairpin structure. In some embodiments, the stem-loop structure comprises two or more stems and two or more loops. In some embodiments, a loop is located at the end of a stem (such that a single loop connects two strands of a double-stranded stem, e.g., similar to a hairpin structure). In some embodiments, a loop may be located between two stems (which may be referred to herein as a "bulge" or "bubble"), such that a loop connects two strands of different stems. In some embodiments, as described in more detail herein, the stem-loop structure may comprise a more complex secondary structure comprising multiple stems and multiple loops.

[0046] According to some embodiments, the 5' and / or 3' ends of the ssDNA molecules disclosed herein contain an inverted terminal repeat (ITR) of approximately 145 nucleotides at each end, or a fragment thereof. The terminal 125 nucleotides in each ITR form a palindromic double-stranded T-shaped hairpin structure, in which the A-A' palindrome forms the stem, and two smaller palindromes, B-B' and C-C', form the cross arms of the T. The other 20 nucleotides in the ITR remain single-stranded and are referred to as the D sequence. The D(-) sequence (also referred to herein as the "ssD(-) sequence") is at the 3' end, and the complementary D(-) sequence (also referred to herein as the "ssD(-) sequence") is at the 5' end. Upon second-strand DNA synthesis, both the ssD(-) sequence and the ssD(+) sequence become double-stranded (ds)D(±) sequences, each of which contains a D region and a D' region. Ling et al. J Virol. 2015 Jan 15;89(2):952-61, WO2016081927A2 (incorporated herein by reference in its entirety) describe ssD(+) sequence-substituted ssAAV genomes. ssD(-) and ssD(+) have been reported to contain one or more transcription factor binding sites and are required for packaging and replication (Ling et al. J Virol. 2015 Jan 15;89(2):952-61, WO2016081927A2 (incorporated herein by reference in its entirety)).

[0047] According to some embodiments, the ITRs can be viral ITRs (e.g., AAV or other dexoviruses), sequences derived from or modified from viral ITRs (e.g., truncations, deletions, substitutions, insertions, and / or additions), or completely artificial sequences (e.g., the ITRs do not contain sequences derived from a virus). The ITRs can further comprise a stem-loop structure (e.g., a "hairpin") or two or more stem-loop structures. For example, the ITRs can comprise two stem-loop structures (e.g., a "hammerhead," "dogbone," or "dumbbell"), three stem-loop structures (e.g., a "cruciform"), or a more complex structure (e.g., a quadruplex stem-loop structure). The ITRs can comprise an aptamer sequence or one or more chemical modifications. The ITRs can be made entirely of an aptamer sequence having at least one stem region and at least one loop region.

[0048] According to some embodiments, "ITRs" can be artificially synthesized using a set of oligonucleotides containing one or more desired functional sequences (e.g., palindromic sequences). The ITR sequences can be artificial AAV ITRs, artificial non-AAV ITRs, or ITRs physically derived from viral AAV ITRs (e.g., ITR fragments removed from the viral genome). For example, ITRs can be derived from the Parvoviridae family, which includes parvoviruses and dependoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, and human parvovirus B-19), or the SV40 hairpin that functions as the origin of SV40 replication can be used as an ITR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. The Parvoviridae family of viruses consists of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Dependoparvoviruses include the adeno-associated virus (AAV) family of viruses that can replicate in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and bovine species. Typically, ITR sequences can be derived from AAV, as well as parvoviruses, lentiviruses, goose viruses, and B19, in wild-type, "dogbone," and "dumbbell" configurations, symmetric, or even asymmetric ITR orientations. While ITRs are typically present at both the 5' and 3' ends of AAV vectors in single-stranded DNA (ssDNA) molecules, ITRs can be present at only one end of a linear vector. For example, ITRs can be present only at the 5' end. In some other cases, ITRs can be present only at the 3' end in single-stranded DNA (ssDNA) molecules. For convenience herein, an ITR located 5' to ("upstream of") an expression cassette of a single-stranded DNA (ssDNA) molecule vector is referred to as the "5' ITR," and an ITR located 3' to ("downstream of") an expression cassette of a single-stranded DNA (ssDNA) molecule is referred to as the "3' ITR."

[0049] As used herein, "wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in an AAV or other dependovirus that retains, for example, Rep binding activity and Rep nicking ability. The nucleic acid sequence of a WT-ITR from any AAV serotype may differ slightly from the naturally occurring reference sequence due to degeneracy or drift in the genetic code; therefore, WT-ITR sequences encompassed for use herein include WT-ITR sequences that result from naturally occurring variations (e.g., replication errors).

[0050] As used herein, the terms "substantially symmetric WT-ITR" or "substantially symmetric WT-ITR pair" refer to a pair of WT-ITRs in a single-stranded DNA (ssDNA) molecule, both of which are wild-type ITRs with reverse-complementary sequences throughout their entire length. For example, an ITR can be considered a wild-type sequence even if it has one or more nucleotides that deviate from a naturally occurring reference sequence, as long as the changes do not affect the physical and functional properties and overall three-dimensional structure (secondary and tertiary) of the sequence. In some embodiments, the deviating nucleotides represent conservative sequence changes. As one non-limiting example, a sequence that has at least 95%, 96%, 97%, 98%, or 99% sequence identity with a reference sequence (e.g., as determined using BLAST with default settings) and also has a symmetric three-dimensional spatial configuration relative to the other WT-ITR, such that their three-dimensional structures are the same shape in geometric space. A substantially symmetric WT ITR has the same ssD(-) / ssD(+), A-A', C-C', and B-B' loops in three-dimensional space. A substantially symmetric WT ITR can be functionally confirmed as WT by determining that it has an operable Rep binding site (RBE or RBE') and terminal resolution site (TRS) that pairs with the appropriate Rep protein. One skilled in the art can optionally test other functions, including transgene expression under permissive conditions.

[0051] As used herein, the phrases "modified ITR" or "mod-ITR" or "mutated ITR" are used interchangeably herein and refer to an ITR that has a mutation in at least one or more nucleotides compared to a wild-type ITR from the same serotype. The mutation can result in a change in one or more of the ssD(-) or ssD(+), A region, A' region, C region, C' region, B region, or B' region in the ITR, and can result in a change in the three-dimensional spatial configuration (i.e., its three-dimensional structure in geometric space) compared to the three-dimensional spatial configuration of a wild-type ITR from the same serotype.

[0052] As used herein, the term "asymmetric ITR," also referred to as an "asymmetric ITR pair," refers to a pair of ITRs in a single-stranded ssDNA vector that are not reverse complements along their entire length. As one non-limiting example, an asymmetric ITR pair does not have a symmetric three-dimensional spatial configuration relative to its cognate ITR, such that their three-dimensional structures are different shapes in geometric space. In other words, an asymmetric ITR pair has a different overall geometric structure, i.e., they have a different configuration of their ssD(-) / ssD(+) regions, A region, A' region, C region, C' region, B region, and B' region in three-dimensional space (e.g., compared to the cognate ITR, one ITR may not have ssD(-) and may have a short C-C' arm and / or a short B-B' arm, while the other ITR may not have ssD(+) but may have a normal AAV C-C' arm and a truncated B-B' arm). The sequence difference between the two ITRs can be due to one or more nucleotide additions, deletions, truncations, or point mutations. In one embodiment, one ITR of the asymmetric ITR pair can be a wild-type AAV ITR sequence, and the other ITR can be a modified ITR as defined herein (e.g., a non-wild-type or synthetic ITR sequence). In another embodiment, neither ITR of the asymmetric ITR pair is a wild-type AAV sequence, and the two ITRs are modified ITRs that have different shapes in geometric space (i.e., different overall geometric structures). In some embodiments, one mod-ITR of the asymmetric ITR pair can have a short C-C' arm, and the other ITR can have a different modification (e.g., a single arm or a short B-B' arm) such that they have a different three-dimensional spatial configuration compared to their cognate asymmetric mod-ITR.

[0053] As used herein, the term "symmetric ITRs" refers to a pair of ITRs in an ssDNA vector that are mutated or modified compared to the wild-type Depend virus ITR sequences and are reverse-complementary across their entire length. Neither ITR is the wild-type ITR AAV2 sequence (i.e., they are modified ITRs, also referred to as mutant ITRs), and may have a sequence that differs from the wild-type ITR due to nucleotide additions, deletions, substitutions, truncations, or point mutations. For convenience herein, the ITR located 5' to (upstream of) the expression cassette of a single-stranded DNA (ssDNA) molecule vector is referred to as the "5' ITR," and the ITR located 3' to (downstream of) the expression cassette of a single-stranded DNA (ssDNA) molecule is referred to as the "3' ITR."

[0054] As used herein, the term "substantially symmetric modified ITR" or "substantially symmetric mod-ITR pair" refers to a pair of modified ITRs in a single-stranded DNA (ssDNA) molecule (e.g., a synthetic vector, e.g., a single-stranded (ss) synthetic vector) that have reverse-complementary sequences along their entire length. For example, modified ITRs can be considered substantially symmetric even if they have several nucleotide sequences that deviate from their reverse-complementary sequences, as long as the changes do not affect their properties and overall shape. As one non-limiting example, a sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with a reference sequence (as measured using BLAST with default settings) and also has a symmetrical three-dimensional spatial organization relative to its cognate modified ITR, such that their three-dimensional structures have the same shape in geometric space. In other words, a substantially symmetric modified ITR pair has the same stem-loop structure organized in three-dimensional space. In some embodiments, the ITRs from a mod-ITR pair can have different reverse-complementary nucleotide sequences but still have the same symmetrical three-dimensional spatial organization, i.e., both ITRs have mutations that result in the same overall three-dimensional shape. For example, in a virus-derived ITR, one ITR (e.g., the 5' ITR) of a mod-ITR pair can be from one serotype, and the other ITR (e.g., the 3' ITR) can be from a different serotype, but both can have the same corresponding mutations so that the modified ITR pair has the same symmetrical three-dimensional spatial organization (e.g., if the 5' ITR has a deletion in the C region, the cognate modified 3' ITR from the different serotype has a deletion at a corresponding position in the C' region). In such embodiments, each ITR of a modified ITR pair can be from a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), e.g., a combination of AAV2 and AAV6, with modifications in one ITR mirrored at the corresponding position in the cognate ITR from the different serotype. In one embodiment, a substantially symmetric modified ITR pair refers to a pair of modified ITRs (mod-ITRs), so long as the nucleotide sequence differences between the ITRs do not affect the properties or overall shape and they have substantially the same shape in three-dimensional space.Non-limiting examples include mod-ITRs that share at least 95%, 96%, 97%, 98%, or 99% sequence identity with a reference mod-ITR, as determined by standard means known in the art, such as BLAST (Basic Local Alignment Search Tool) or BLASTN with default settings, and also have symmetrical three-dimensional spatial configurations such that their three-dimensional structures are the same shape in geometric space. A substantially symmetric mod-ITR pair will have the same ssD(-) / ssD(+) region, A region, A' region, C region, C' region, B region, and B' region in three-dimensional space; for example, if the modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, the cognate mod-ITR will have a corresponding deletion of the C-C' loop and also have a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in the geometric space of the cognate mod-ITR.

[0055] As used herein, the term "flanking" refers to the relative position of one nucleic acid sequence with respect to another. Generally, in the sequence ABC, B is flanked by A and C. Similarly for the arrangement AxBxC. Thus, a flanking sequence precedes or follows the flanking sequence, but need not be contiguous with or immediately adjacent to the sequence it flanks. In one embodiment, the term flanking refers to terminal repeat sequences at each end of a linear single-stranded DNA (ssDNA) molecule.

[0056] As defined herein, "reporter(s)" refers to protein(s) that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with light of a particular wavelength, luciferase causes cells to catalyze a light-producing reaction, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.

[0057] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, e.g., as a reporter polypeptide, or more appropriately, as a cell-killing polypeptide, e.g., a toxin or agent that renders the cell susceptible to killing by a selected agent or its deletion. Effector proteins include any protein or peptide that directly targets or damages the DNA and / or RNA of a host cell. For example, effector proteins can include, but are not limited to, restriction endonucleases that target host cell DNA sequences (whether on genomic or extrachromosomal elements), proteases that degrade polypeptide targets required for cell survival, DNA gyrase inhibitors, and ribonuclease-type toxins. According to some embodiments, the expression of effector proteins controlled by the synthetic biological circuits described herein can participate as factors in another synthetic biological circuit, thereby expanding the range and complexity of the responsiveness of the biological circuit system.

[0058] Transcriptional regulators refer to transcriptional activators and repressors that either activate or repress the transcription of a gene of interest. A promoter is a region of nucleic acid that initiates transcription of a specific gene. Transcriptional activators typically bind near the transcriptional promoter and recruit RNA polymerase to directly initiate transcription. Repressors bind to the transcriptional promoter and sterically hinder transcription initiation by RNA polymerase. Other transcriptional regulators can function as either activators or repressors depending on where they bind and on cellular and environmental conditions. Non-limiting examples of transcriptional regulator classes include, but are not limited to, homeodomain proteins, zinc finger proteins, winged helix (forkhead) proteins, and leucine zipper proteins.

[0059] As used herein, the term "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce toxic, allergic, or similar untoward reactions when administered to a host.

[0060] As used herein, the term "in vivo" refers to an assay or process performed on or within an organism, such as a multicellular animal. In some of the aspects described herein, a method or use can be said to be performed "in vivo" when a unicellular organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses performed using living cells with intact membranes outside a multicellular animal or plant, for example, explants, cultured cells including primary cells and cell lines, transformed cell lines, and extracted tissues or cells including blood cells, among others. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and can refer to the introduction of a programmable synthetic biological circuit in a non-cellular system, such as a cell- or cell-line-free medium, such as a cell extract.

[0061] As used herein, the term "promoter" refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of that nucleic acid sequence, which may be a heterologous target gene encoding a protein or RNA. Promoters can be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter is a control region of a nucleic acid sequence that controls the initiation and rate of transcription of the remainder of the nucleic acid sequence. Promoters can also contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. Within the promoter sequence, transcription initiation sites and protein binding domains involved in the binding of RNA polymerase are found. Eukaryotic promoters often, but not necessarily, contain "TATA" and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive the expression of transgenes in the single-stranded (ssDNA) molecules disclosed herein. The promoter sequence can be bounded at its 3' end by a transcription initiation site and can extend upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background.

[0062] As used herein, the terms "expression cassette" and "expression unit" are used interchangeably and refer to a heterologous DNA sequence operably linked to a promoter or other DNA regulatory sequence sufficient to direct transcription of a transgene in a DNA vector, e.g., a single-stranded (ssDNA) molecule. Suitable promoters include, for example, tissue-specific promoters. The promoter can also be of AAV origin.

[0063] As used herein, the term "renaturation," when referring to a "renatured double-stranded expression cassette" or "renatured double-stranded transgene," refers to a double-stranded expression cassette or double-stranded transgene that is formed after an ssDNA molecule is transported into the nucleus of a host cell and that is responsive to DNA polymerase activity that creates double-stranded DNA from the ssDNA by filling in the single-stranded portion of the ssDNA molecule.

[0064] As used herein, "operably linked" refers to a juxtaposition in which the components so described are in a relationship permitting them to function in their intended manner. By way of example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. A promoter can be said to drive expression or drive the transcription of a nucleic acid sequence that it regulates. The phrases "operably linked," "operably positioned," "operably linked," "under control," and "under transcriptional control" refer to a promoter in the correct functional location and / or orientation with respect to the nucleic acid sequence it regulates so as to control transcription initiation and / or expression of the nucleic acid sequence. As used herein, an "inverted promoter" refers to a promoter in which a nucleic acid sequence is in an inverted orientation, such that what was the coding strand is now the non-coding strand (or vice versa). Inverted promoter sequences can be used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, a promoter can be used in conjunction with an enhancer.

[0065] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, proteolysis signals, etc., that provide and / or regulate the transcription of a non-coding sequence (e.g., a DNA-targeting RNA) or a coding sequence (e.g., a site-directed modifying polypeptide or a Cas9 / Csn1 polypeptide) and / or regulate the translation of an encoded polypeptide.

[0066] As used herein, the term "enhancer" refers to a cis-acting regulatory sequence (e.g., 50 to 1,500 base pairs) that binds to one or more proteins (e.g., activator proteins or transcription factors) to increase transcriptional activation of a nucleic acid sequence. Naturally, enhancers can be located up to 1,000,000 base pairs upstream of the start site of the gene they regulate or downstream of the start site of the gene. Enhancers can be located within intronic or exon regions of unrelated genes. Typically, cis-acting enhancer sequences of 20 to 200 base pairs can be used to increase expression of a transgene.

[0067] A promoter can be a promoter naturally associated with a gene or sequence, as can be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exons of a given gene or sequence. Such a promoter can be referred to as "endogenous." Similarly, according to some embodiments, an enhancer can be an enhancer naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. In some embodiments, a coding nucleic acid segment is positioned under the control of a "recombinant promoter" or a "heterologous promoter," both of which refer to a promoter that is not normally associated with the coding nucleic acid sequence to which it is operably linked in its natural environment. Similarly, a "recombinant or heterologous enhancer" refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers can include promoters or enhancers of other genes, promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, as well as synthetic promoters or enhancers that are not "naturally occurring," i.e., contain different elements of different transcriptional regulatory regions and / or mutations that alter expression using genetic engineering methods known in the art. In addition to synthetically producing promoter and enhancer nucleic acid sequences, promoter sequences can be generated using recombinant cloning and / or nucleic acid amplification techniques, including PCR, in conjunction with the synthetic biological circuits and modules disclosed herein (see, e.g., U.S. Pat. Nos. 4,683,202 and 5,928,906, each of which is incorporated herein by reference). Furthermore, it is contemplated that control sequences that direct transcription and / or expression of sequences within non-nuclear organelles, such as mitochondria and chloroplasts, can also be used.

[0068] As described herein, an "inducible promoter" is characterized by initiating or enhancing transcriptional activity when affected by or contacted with an inducer or inducing agent. As defined herein, an "inducer" or "inducing agent" can be an endogenous or, usually, exogenous compound or protein that is administered in such a way that it is active in inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducing agent, i.e., a chemical, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., an inducer can be an inducer protein expressed by another component or module), which can itself be under the control of an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as a repressor. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionine, ecdysone, mammalian viruses (e.g., adenovirus late promoter and mouse mammary tumor virus long terminal repeat (MMTV-LTR)), as well as other steroid-responsive promoters, rapamycin-responsive promoters, and the like.

[0069] As used herein, the term "subject" refers to a human or animal to which treatment, including prophylactic treatment, with a single-stranded (ssDNA) molecule according to the present disclosure is provided. Typically, the animal is a vertebrate, such as, but not limited to, a primate, a rodent, a domestic animal, or a game animal. Primates include, but are not limited to, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include, but are not limited to, cattle, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cats, canine species, e.g., dogs, foxes, wolves, avian species, e.g., chickens, emus, ostriches, and fish, e.g., trout, catfish, and salmon. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate or a human. The subject can be male or female. Additionally, the subject can be an infant or child. In some embodiments, the subject can be a newborn or unborn subject, e.g., the subject is present in utero. Preferably, the subject is a mammal. The mammal can be, but is not limited to, a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow. Non-human mammals can be advantageously used as subjects that represent animal models of diseases and disorders. Additionally, the methods and compositions described herein can be used with domestic animals and / or pets. Human subjects can be of any age, sex, race, or ethnic group, e.g., Caucasian (white), Asian, African, Black, African-American, African-European, Hispanic, Middle Eastern, etc. In some embodiments, the subject can be a patient or other subject in a clinical setting. In some embodiments, the subject has already received treatment. In some embodiments, the subject is an embryo, fetus, newborn, infant, child, adolescent, or adult. In some embodiments, the subject is a human fetus, a human newborn, a human infant, a human child, a human adolescent, or a human adult, hi some embodiments, the subject is an animal embryo, or a non-human embryo, or a non-human primate embryo.In some embodiments, the subject is a human embryo.

[0070] As used herein, the term "host cell" includes any cell type that is amenable to transformation, transfection, transduction, etc. with the single-stranded (ssDNA) molecules described in this disclosure. By way of non-limiting example, host cells include isolated primary cells, pluripotent stem cells, CD34 + The host cells can be cells, induced pluripotent stem cells, or any of several immortalized cell lines (e.g., HepG2 cells). Alternatively, the host cells can be in situ or in vivo cells in a tissue, organ, or organism. Furthermore, the host cells can be target cells, for example, in a mammalian subject (e.g., a human patient in need of gene therapy).

[0071] As used herein, the term "exogenous" refers to a substance present in a cell other than its natural source. As used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that has been introduced by a process requiring human intervention into a biological system, such as a cell or organism, where it is not normally found and it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that has been introduced by a process requiring human intervention into a biological system, such as a cell or organism, where it is found in relatively low amounts and it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., to result in ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is native to a biological system or cell.

[0072] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms include single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. An "oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides, either single- or double-stranded. However, for purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides, also known as "oligomers" or "oligos," can be isolated from genes or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded polynucleotides (e.g., sense or antisense) and double-stranded polynucleotides, as applicable to the described embodiments. According to some embodiments, the nucleic acid is a single-stranded DNA (ssDNA) molecule as described herein. The DNA may be in the form of, for example, an antisense molecule, a plasmid DNA, a DNA-DNA duplex, a pre-condensed DNA, a PCR product, a vector (P1, PAC, BAC, YAC, artificial chromosome), an expression cassette, a chimeric sequence, a chromosomal DNA, or derivatives and combinations thereof. The DNA may be in the form of a minicircle, a plasmid, a bacmid, a minigene, a ministring DNA (a covalently closed linear DNA vector), a closed-end linear double-stranded DNA (CELiD or ceDNA), a doggybone (dbDNA™) DNA, a dumbbell-shaped DNA, a minimal immunologically defined gene expression (MIDGE) vector, a viral vector, or a non-viral vector. The RNA may be in the form of a small interfering RNA (siRNA), a Dicer substrate dsRNA, a short hairpin RNA (shRNA), an asymmetric interfering RNA (aiRNA), a microRNA (miRNA), an mRNA, a rRNA, a tRNA, a viral RNA (vRNA), or a combination thereof.Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, both synthetic, naturally occurring, and non-naturally occurring, that have similar binding properties to the reference nucleic acid. Examples of such analogs and / or modified residues include, but are not limited to, phosphorothioates, phosphorodiamidate morpholino oligomers (morpholinos), phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, locked nucleic acids (LNA™), and peptide nucleic acids (PNAs). Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid. Unless otherwise indicated, a particular nucleic acid sequence implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the explicitly indicated sequence.

[0073] As used herein, "inhibitory polynucleotide" refers to a DNA or RNA molecule that reduces or prevents the expression (transcription or translation) of a second (target) polynucleotide. Inhibitory polynucleotides include antisense polynucleotides, ribozymes, and external guide sequences. The term "inhibitory polynucleotide" further includes DNA molecules and RNA molecules, e.g., RNAi, that encode the actual inhibitory species, such as a DNA molecule encoding a ribozyme.

[0074] A "nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate group.

[0075] "Base" includes purines and pyrimidines, which further include the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and naturally occurring analogues, as well as synthetic derivatives of purines and pyrimidines, including, but not limited to, modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0076] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) contains a sequence of nucleotides that allows it to non-covalently bind, i.e., form Watson-Crick base pairs and / or G / U base pairs, or "anneal" or "hybridize" (i.e., a nucleic acid specifically binds to a complementary nucleic acid) to another nucleic acid in a sequence-specific antiparallel manner under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. As is known in the art, standard Watson-Crick base pairings include adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). In addition, it is known in the art that guanine (G) base pairs with uracil (U) for hybridization between two RNA molecules (e.g., dsRNA). For example, G / U base pairing, in conjunction with tRNA anticodon base pairing with codons in mRNA, is partially responsible for the degeneracy (i.e., redundancy) of the genetic code. In the context of the present disclosure, guanine (G) of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule is considered complementary to uracil (U), and vice versa. Thus, if a G / U base pair can be created at a given nucleotide position of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule, that position is not considered non-complementary, but instead is considered complementary.

[0077] The term "nucleic acid construct," as used herein, refers to a nucleic acid molecule, either single-stranded or double-stranded, that is isolated from a naturally occurring gene or that has been modified to contain a segment of nucleic acid in a manner that would not otherwise occur in nature, or that is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette," when the nucleic acid construct contains the control sequences necessary for expression of a coding sequence of the present disclosure. An "expression cassette" comprises a DNA coding sequence operably linked to a promoter. The terms "peptide," "polypeptide," and "protein" are used interchangeably herein and refer to polymeric forms of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0078] As used herein, the term "sequence identity" refers to the relationship between two nucleotide sequences. For purposes of this disclosure, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) implemented in version 3.0.0 or later. Optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (the EMBOSS version in NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity, calculated as follows: (identical deoxyribonucleotides × 100) / (length of alignment - total number of gaps in the alignment). The length of the alignment is preferably at least 10 nucleotides, preferably at least 25 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.

[0079] As used herein, the term "homology" or "homology" is defined as the percentage of nucleotide residues in the homologous arm that are identical to the nucleotide residues in the corresponding sequence on the target chromosome after aligning the sequences and introducing gaps as necessary to achieve the maximum sequence identity percentage. Alignment for determining the percentage of nucleotide sequence homology can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ClustalW2, or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences being compared. In some embodiments, for example, a nucleic acid sequence (e.g., a DNA sequence) of a homologous arm of a repair template is considered to be "homologous" if the sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the corresponding native or unedited nucleic acid sequence (e.g., genomic sequence) of the host cell.

[0080] As used herein, a "vector" or "expression vector" is a replicon, which can be a nucleic acid construct designed to be delivered to a host cell or moved between different host cells. As used herein, a vector can be of viral or non-viral origin in its final form. For the purposes of this disclosure, "vector" generally refers to a capsid-free synthetic AAV, such as a single-stranded (ss) synthetic vector or a nicked ceDNA vector. Thus, the term "vector" encompasses any genetic element that, when associated with the appropriate control elements, can replicate or express and transfer gene sequences into a cell. In some embodiments, a vector can be a recombinant vector or an expression vector. It should be understood that, as used herein, the term "single-stranded (ss) synthetic vector" is intended to include a single-stranded AAV-like vector that does not have any viral sequences.

[0081] As used herein, the phrase "recombinant vector" refers to a vector containing a heterologous nucleic acid sequence or "transgene" that can be expressed in vivo. It is understood that the vectors described herein can, in some embodiments, be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining a nucleotide of interest in a subject in high copy number extrachromosomal DNA, thereby eliminating the potential effects of chromosomal integration.

[0082] As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or polypeptides from sequences linked to transcriptional regulatory sequences on the vector. The expressed sequences are often, but not necessarily, heterologous to the host cell. An expression vector can be a recombinant vector.

[0083] As used herein, the term "expression" refers to the cellular processes involved in the production of RNA and proteins, and optionally secreted proteins, including, for example, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing, as applicable.

[0084] As used herein, the phrase "expression product" includes RNA transcribed from a gene (e.g., a transgene) and polypeptides obtained by translation of mRNA transcribed from a gene.

[0085] As used herein, the term "gene" means a nucleic acid sequence that is transcribed (from DNA) into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, such as 5' untranslated (5'UTR) or "leader" sequences and 3'UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0086] As used herein, the term "site-specific nuclease" or "sequence-specific nuclease" refers to an enzyme that can specifically recognize and cleave a DNA sequence. Site-specific nucleases can be engineered. Examples of engineered site-specific nucleases include zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), and CRISPR / Cas-based systems that use various natural and non-natural Cas enzymes.

[0087] As used herein, the phrase "genetic disease" refers to a disease caused, directly or indirectly, in part or in whole by one or more abnormalities in the genome, particularly a condition that is present from birth and that can be treated by the single-stranded (ssDNA) molecules described herein. The abnormality can be a mutation, insertion, or deletion. The abnormality can affect the coding sequence of a gene or its regulatory sequence. Genetic disorders include phenylketonuria (PKU), melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, and mucopolysaccharidosis (e.g., Hurler syndrome (MPS type I), Scheie syndrome (MPS type IS), Hurler-Scheie syndrome (MPS type I HS), Hunter syndrome (MPS type II), Sanfilippo types A, B, C, and D (MPS type III). A, B, C, and D), Morquio syndrome types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), hyaluronidase deficiency (MPS IX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, and galactosialidosis.Genetic disorders also include amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber's congenital amaurosis (LCA, e.g., LCA10 [CEP290]), Stargardt macular dystrophy (ABCA4), or cathepsin A deficiency.

[0088] As used herein, the terms "increase," "enhance," and "elevate" (and similar terms) generally refer to the act of increasing, either directly or indirectly, a concentration, level, function, activity, or behavior compared to native, expected, or average conditions, or compared to a control condition.

[0089] As used herein, the terms "suppress," "reduce," "interfere," "inhibit," and / or "decrease" (and similar terms) generally refer to the act of decreasing, either directly or indirectly, a concentration, level, function, activity, or behavior compared to native, expected, or average conditions, or compared to a control condition.

[0090] As used herein, the terms "synthetic vector," "single-stranded (ss) synthetic vector," and "synthetic production of vector" refer to a vector and a method for its synthetic production in a cell-free environment.

[0091] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, processes, and their respective components that are essential to the process, method, or composition, but which embrace the inclusion of unspecified elements, whether essential or not. The use of "comprising" indicates inclusion rather than limitation.

[0092] The term "consisting of" refers to compositions, methods, processes, and their respective components described herein, excluding any element not recited in the description of the embodiment.

[0093] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic novel or functional characteristics of that embodiment of the present disclosure.

[0094] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to a "method" includes one or more methods and / or steps of the type described herein and / or that will become apparent to those skilled in the art upon reading this disclosure. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0095] The abbreviation "eg" is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example."

[0096] Except in the examples or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein are understood to be modified in all instances by the term "about." When used in connection with percentages, the term "about" can mean ±1%. The present disclosure is further illustrated by the following examples, but the scope of the present disclosure should not be limited thereto.

[0097] Grouping of alternative elements or embodiments of the present disclosure disclosed herein should not be construed as limiting. Each group member may be referenced and claimed individually or in any combination with other members of the group or other elements found herein. For reasons of convenience and / or patentability, one or more members of a group may be included in, or deleted from, a group. When any such inclusion or deletion occurs, the specification herein is deemed to include the group as modified and, therefore, to satisfy the specification of all Markush groups used in the appended claims.

[0098] In some embodiments of any of its aspects, the disclosure described herein does not relate to processes for cloning humans, processes for modifying the germline genetic identity of humans, the use of human embryos for industrial or commercial purposes, or processes for modifying the genetic identity of animals that are likely to cause suffering to humans or animals without providing any substantial medical benefit to them, and similarly processes for modifying the genetic identity of animals resulting from such processes.

[0099] Other terms are defined herein within the description of various aspects of the disclosure.

[0100] All patents and other publications, including literature references, issued patents, published patent applications, and copending patent applications, cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodology described in such publications, which might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicant and do not constitute an admission as to the correctness of the dates or contents of these documents.

[0101] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While certain specific embodiments and examples of the present disclosure are described herein for illustrative purposes, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions are presented in a given order, alternative embodiments may perform the functions in a different order, or may perform the functions substantially simultaneously. The teachings of the present disclosure provided herein can be applied to other procedures or methods, where appropriate. The various embodiments described herein can be combined to provide further embodiments. Where necessary, aspects of the present disclosure can be modified to employ compositions, functions, and concepts from the above references and applications to provide still further embodiments of the present disclosure. Furthermore, due to considerations of biological functional equivalence, some changes can be made to protein structure without affecting biological or chemical activity in terms of type or amount. These and other modifications can be made to the present disclosure in light of the Detailed Description. All such modifications are intended to be within the scope of the appended claims.

[0102] Specific elements of any of the foregoing embodiments can be combined with or substituted for elements of other embodiments. Furthermore, although advantages associated with certain embodiments of the present disclosure are described in connection with those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages to fall within the scope of the present disclosure.

[0103] The technology described herein is further illustrated by the following examples, which should not be construed as further limiting in any way. It is understood that the disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein, as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the disclosure, which is defined solely by the claims.

[0104] II. Single-stranded (ss) DNA molecule In some aspects, the present disclosure relates to single-stranded (ssDNA) molecules, e.g., synthetic ssDNA molecules, and their production, e.g., their production from closed-ended DNA (ceDNA) and / or plasmid templates using methods described herein.

[0105] In some embodiments, the ssDNA molecules described herein are linear single-stranded DNA molecules that are completely single-stranded along their entire length (i.e., contain no double-stranded regions).

[0106] A. 3'-terminal stem-loop structure In some aspects, the present disclosure provides ssDNA molecules comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure at the 3' end. In some embodiments, the ssDNA molecule may further comprise at least one stem-loop structure at the 5' end. As described herein, the stem-loop structure at the 3' end may comprise a partial DNA duplex (e.g., with a free 3'-OH group) for priming replication or transcription. The partial DNA duplex functions, in part, to hold the stem-loop structure together.

[0107] According to some embodiments, the partial DNA duplex is 4 to 500 nucleotides, e.g., 4 to 10 nucleotides, 4 to 25 nucleotides, 4 to 50 nucleotides, 4 to 100 nucleotides, 4 to 200 nucleotides, 4 to 300 nucleotides, 4 to 400 nucleotides, 20 to 25 nucleotides, 20 to 50 nucleotides, 20 to 100 nucleotides, 20 to 200 nucleotides, 20 to 300 nucleotides, 20 to 400 nucleotides, 20 to 500 nucleotides, 50 to 100 nucleotides, 50 to 200 nucleotides, 50 to 300 nucleotides, 50 to 400 nucleotides. and 50 to 500 nucleotides, 150 to 200 nucleotides, 150 to 300 nucleotides, 150 to 400 nucleotides, 150 to 500 nucleotides, 200 to 300 nucleotides, 200 to 400 nucleotides, 200 to 500 nucleotides, 250 to 300 nucleotides, 250 to 400 nucleotides, 250 to 500 nucleotides, 300 to 400 nucleotides, 300 to 500 nucleotides, 350 to 400 nucleotides, 350 to 500 nucleotides, 400 to 500 nucleotides, or 450 to 500 nucleotides, and comprising at least one loop at the 3' end. According to some embodiments, the DNA duplex comprises at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides and comprises at least one loop at the 3' end.

[0108] According to some embodiments, the loop structure at the 3' end is at least 3 to 500 unlinked nucleotides, for example, 3 to 450 nucleotides, 3 to 400 nucleotides, 3 to 350 nucleotides, 3 to 300 nucleotides, 3 to 250 nucleotides, 3 to 200 nucleotides, 3 to 150 nucleotides, 3 to 100 nucleotides, 3 to 90 nucleotides, 3 to 80 nucleotides, 3 to 70 nucleotides, 3 to 60 nucleotides, 3 to 50 nucleotides, 3 to 40 nucleotides, 3 to 30 nucleotides, Nucleotide, 3-20 nucleotides, 3-10 nucleotides, 3-5 nucleotides, 10-450 nucleotides, 10-400 nucleotides, 10-350 nucleotides, 10-300 nucleotides, 10-250 nucleotides, 10-200 nucleotides, 10-150 nucleotides, 10-100 nucleotides, 10-90 nucleotides, 10-80 nucleotides, 10-70 nucleotides, 10-60 nucleotides, 10-50 nucleotides, 10-40 nucleotides , 10-30 nucleotides, 10-20 nucleotides, 50-450 nucleotides, 50-400 nucleotides, 50-350 nucleotides, 50-300 nucleotides, 50-250 nucleotides, 50-200 nucleotides, 50-150 nucleotides, 50-100 nucleotides, 50-90 nucleotides, 50-80 nucleotides, 50-70 nucleotides, 50-60 nucleotides, 100-450 nucleotides, 100-400 nucleotides, 100-350 Nucleotides, 100-300 nucleotides, 100-250 nucleotides, 100-200 nucleotides, 150-450 nucleotides, 150-400 nucleotides, 150-350 nucleotides, 150-300 nucleotides, 150-250 nucleotides, 150-200 nucleotides, 200-450 nucleotides, 200-400 nucleotides, 200-350 nucleotides, 200-300 nucleotides, 200-250 nucleotides, 250-450 nucleotides,It contains 250 to 400 nucleotides, 250 to 350 nucleotides, 250 to 300 nucleotides, 300 to 450 nucleotides, 300 to 400 nucleotides, 300 to 350 nucleotides, 350 to 450 nucleotides, 350 to 400 nucleotides, or 400 to 450 nucleotides.

[0109] In some embodiments, the stem portion of the stem-loop is 4 to 500 nucleotides in length, and the loop portion of the stem-loop is 3 to 500 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 50 nucleotides in length, and the loop portion of the stem-loop is 3 to 50 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 20 nucleotides in length, and the loop portion of the stem-loop is 3 to 20 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 10 nucleotides in length, and the loop portion of the stem-loop is 3 to 10 nucleotides in length.

[0110] In some embodiments, the loop further comprises one or more nucleic acids or is used to stabilize the termini. In other embodiments, the loop further comprises one or more nucleic acids that may be used in therapeutic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used in diagnostic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used for research purposes.

[0111] According to some embodiments, the minimum nucleic acid structure required at the 3' end of the ssDNA is any structure that loops back on itself, i.e., a hairpin structure. However, it should be understood that various structures are contemplated at the 3' end, so long as there is at least one stem and one loop. For example, in some embodiments, the ssDNA described herein may contain at least one stem-loop structure at its 3' end. In some embodiments, the ssDNA may contain at least two stem-loop structures at its 3' end. In some embodiments, the ssDNA may contain at least three stem-loop structures at its 3' end. In some embodiments, the ssDNA may contain at least four stem-loop structures at its 3' end. In some embodiments, the ssDNA may contain at least five stem-loop structures at its 3' end.

[0112] In some embodiments, the 3'-terminal nucleotides form a cruciform DNA structure. A DNA cruciform structure can be formed when both strands form a stem-loop structure at the same position within the molecule and contain a four-way junction and two closed hairpin-shaped points.

[0113] In some embodiments, the 3'-terminal nucleotides form a hairpin DNA structure, where the hairpin loop structure in the nucleic acid consists of a base-paired stem structure and a loop sequence having unpaired or non-Watson-Crick paired nucleotides.

[0114] According to some embodiments, the 3' terminal nucleotides form a hammerhead DNA structure composed of three base-paired helices separated by short linkers of conserved sequence.

[0115] According to some embodiments, the 3'-terminal nucleotides form a quadruplex DNA structure. A G-quadruplex is a four-stranded DNA secondary structure (G4) formed from certain guanine-rich sequences.

[0116] According to some embodiments, the 3' terminal nucleotides form a bulge DNA structure.

[0117] According to some embodiments, the 3' terminal nucleotides form a multi-branched loop.

[0118] According to some embodiments, the 3' terminal nucleotides do not form two stem-loop structures.

[0119] According to some embodiments, the stem structure at the 3' end comprises one or more nucleotides modified to be exonuclease resistant. According to some embodiments, the stem structure at the 3' end comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or twenty or more nucleotides modified to be exonuclease resistant.

[0120] According to some embodiments, the stem structure at the 3'-end comprises one or more phosphorothioate-modified nucleotides. According to some embodiments, the stem structure at the 3'-end comprises about 2 to about 12 phosphorothioate-modified nucleotides. According to some embodiments, the stem structure at the 3'-end comprises about 4 to about 10, e.g., about 4 to about 5, about 4 to about 6, about 4 to about 7, about 4 to about 8, about 4 to about 9, about 4 to about 10, about 5 to about 6, about 5 to about 7, about 5 to about 8, about 5 to about 9, about 5 to about 10, about 6 to about 7, about 6 to about 8, about 6 to about 9, about 6 to about 10, about 7 to about 8, about 7 to about 9, about 7 to about 10, about 8 to about 9, about 8 to about 10, or about 9 to about 10 phosphorothioate-modified nucleotides. According to some embodiments, the stem structure comprises more than 10 phosphorothioate modified nucleotides.

[0121] According to some embodiments, the phosphorothioate modified nucleotides are located adjacent to one another.

[0122] According to some embodiments, one or more phosphorothioate-modified nucleotides at the 3'-end are resistant to exonuclease degradation. Boranophosphate-modified DNA is also resistant to nuclease degradation and can be considered an alternative to phosphorothioate modification.

[0123] According to a further embodiment, the stem structure may comprise at least one functional moiety. In one embodiment, the at least one functional moiety is an aptamer sequence. In a further embodiment, the aptamer sequence has high binding affinity to a nuclear-localized protein.

[0124] According to some embodiments, the nucleotides in the loop are chemically modified with functional groups to alter their properties.

[0125] According to some embodiments, the loop further comprises one or more aptamers, according to some embodiments, the aptamers are identified from the publicly available Apta-index database of aptamers (aptagen.com / apta-index).

[0126] According to some embodiments, the loop further comprises one or more synthetic ribozymes.

[0127] According to some embodiments, the loop further comprises one or more antisense oligonucleotides (ASOs).

[0128] According to some embodiments, the loop further comprises one or more short interfering RNAs (siRNAs).

[0129] In some embodiments, the loop further comprises one or more antiviral nucleoside analogs (ANAs).

[0130] According to some embodiments, the loop further comprises one or more triplex-forming oligonucleotides.

[0131] According to some embodiments, the loop further comprises one or more gRNAs or gDNAs.

[0132] According to some embodiments, the loop further comprises one or more molecular probes, for example, nucleic acid-based fluorescent probes.

[0133] According to some embodiments, "click" azide-alkyne cycloaddition (Kolb et al., Angew. Chem. Int. Ed. Engl. 2001, 40, 2004-2021) is used to modify the nucleotides in the loop. Click chemistry was developed to link organic molecules together under mild conditions in the presence of various functional groups. Most click-mediated modifications are performed on nitrogenous bases by introducing novel base analogs, attaching fluorophores or isotopic elements for molecular imaging, forming interstrand linkages between oligonucleotides, and for molecular bioconjugation. The best examples of click chemistry are the CuAAC reaction (CuAAC reaction) independently discovered by Sharpless and Meldal (Angew. Chem., Int. Ed. 2002, 41, 2596-2599) and the Cu-based [3+2] azide-alkyne cycloaddition reaction (Angew. Chem., Int. Ed. 1963, 2, 633-645) by Huisgen. I This is the catalytic version.

[0134] According to some embodiments, introduction of a reactive amino or thiol group into a synthetic oligonucleotide provides, for example, an acceptor for subsequent chemiluminescent labeling.

[0135] In some embodiments, the stem-loop structure may comprise alternative or modified nucleotides, including, but not limited to, ribonucleic acid (RNA), peptide-nucleic acid (PNA), locked nucleic acid (LNA), etc. According to some embodiments, the loop portion of the stem-loop structure may comprise a chemical structure that does not include nucleic acid.

[0136] In some embodiments, the ssDNA molecule does not include any viral-derived sequences.

[0137] Differences from known ITR structures As known in the art, a typical AAV ITR structure comprises a palindromic double-stranded T-shaped hairpin structure, in which the double-stranded A-A' region forms the stem and the double-stranded B-B' and C-C' regions form the cross-arms of the T-shaped structure (see, e.g., Ling et al., J. Virology, 89(2):952-961, 2015). The other nucleotides of a typical AAV ITR remain single-stranded and are referred to as the single-stranded D(-) sequence (3' end of the ITR) and the single-stranded D(-) sequence (5' end of the ITR). Once inside the cell, the single-stranded regions of the D(+) and D(-) regions undergo second-strand DNA synthesis to become double-stranded D and D' regions. Thus, as generally used herein, the term "D region" refers to either the single-stranded D(-) and / or D(+) regions or the double-stranded D and / or D' regions, as appropriate in the context of this disclosure.

[0138] Prior to the present invention, it had been demonstrated that removal of both the ssD(+) region and the ssD(-) region from the AAV ITRs impaired the rescue, replication, and encapsidation of AAV DNA (e.g., Wang et al., J. Mol. Biol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997). Those skilled in the art believed that at least one of the D(+) single-stranded region or the D(-) single-stranded region was essential for AAV replication and encapsidation, and that deletion of the ssD(+) or ssD(-) region could adversely affect AAV DNA expression because it was believed that the ssD(+) or ssD(-) region contained one or more transcription factor binding sites (e.g., Ling et al., J. Virol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997). al., J. Virology, 89(2):952-961, 2015; see WO2016081927A2).

[0139] However, the inventors of the present invention have surprisingly discovered that deletion of both the D(+) and D(-) regions from the stem-loop structure of the disclosed single-stranded DNA molecule results in a functional single-stranded DNA (ssDNA).

[0140] Thus, in some embodiments, the ssDNA does not contain the D(-) or D(+) regions that would be present in a wild-type AAV ITR. In some embodiments, at least one stem-loop structure at the 3' end of the ssDNA does not contain a single-stranded D(-) region. In other embodiments, at least one stem-loop structure at the 3' end of the ssDNA molecule does not contain any of the A, A', B, B', C, C', and / or D(-) regions that would be present in a wild-type AAV ITR.

[0141] According to some embodiments, at least one stem-loop structure at the 3' end does not include a rep-binding element (RBE) that would be present in a wild-type ITR. According to some embodiments, at least one stem-loop structure at the 3' end does not include a terminal resolution site (trs) that would be present in a wild-type ITR.

[0142] According to some embodiments, at least one stem-loop structure at the 3' end is devoid of any viral capsid protein coding sequence.

[0143] In some embodiments, the nucleotides at the 3' end of the ssDNA do not form an AAV ITR structure.

[0144] B. 5'-terminal stem-loop structure In some embodiments, the ssDNA molecule comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure at its 3' end further comprises a 5' end comprising at least one stem-loop structure. As described herein, the stem-loop structure at the 5' end can comprise a partial DNA duplex.

[0145] According to some embodiments, the partial DNA duplex is 4 to 500 nucleotides, e.g., 4 to 10 nucleotides, 4 to 25 nucleotides, 4 to 50 nucleotides, 4 to 100 nucleotides, 4 to 200 nucleotides, 4 to 300 nucleotides, 4 to 400 nucleotides, 20 to 25 nucleotides, 20 to 50 nucleotides, 20 to 100 nucleotides, 20 to 200 nucleotides, 20 to 300 nucleotides, 20 to 400 nucleotides, 20 to 500 nucleotides, 50 to 100 nucleotides, 50 to 200 nucleotides, 50 to 300 nucleotides, 50 to 400 nucleotides. and 50 to 500 nucleotides, 150 to 200 nucleotides, 150 to 300 nucleotides, 150 to 400 nucleotides, 150 to 500 nucleotides, 200 to 300 nucleotides, 200 to 400 nucleotides, 200 to 500 nucleotides, 250 to 300 nucleotides, 250 to 400 nucleotides, 250 to 500 nucleotides, 300 to 400 nucleotides, 300 to 500 nucleotides, 350 to 400 nucleotides, 350 to 500 nucleotides, 400 to 500 nucleotides, or 450 to 500 nucleotides, and comprising at least one loop at the 3' end. According to some embodiments, the DNA duplex comprises at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides and comprises at least one loop at the 5' end.

[0146] According to some embodiments, the loop structure at the 5' end is at least 3 to 500 unlinked nucleotides, for example, 3 to 450 nucleotides, 3 to 400 nucleotides, 3 to 350 nucleotides, 3 to 300 nucleotides, 3 to 250 nucleotides, 3 to 200 nucleotides, 3 to 150 nucleotides, 3 to 100 nucleotides, 3 to 90 nucleotides, 3 to 80 nucleotides, 3 to 70 nucleotides, 3 to 60 nucleotides, 3 to 50 nucleotides, 3 to 40 nucleotides, 3 to 30 nucleotides, Nucleotide, 3-20 nucleotides, 3-10 nucleotides, 3-5 nucleotides, 10-450 nucleotides, 10-400 nucleotides, 10-350 nucleotides, 10-300 nucleotides, 10-250 nucleotides, 10-200 nucleotides, 10-150 nucleotides, 10-100 nucleotides, 10-90 nucleotides, 10-80 nucleotides, 10-70 nucleotides, 10-60 nucleotides, 10-50 nucleotides, 10-40 nucleotides , 10-30 nucleotides, 10-20 nucleotides, 50-450 nucleotides, 50-400 nucleotides, 50-350 nucleotides, 50-300 nucleotides, 50-250 nucleotides, 50-200 nucleotides, 50-150 nucleotides, 50-100 nucleotides, 50-90 nucleotides, 50-80 nucleotides, 50-70 nucleotides, 50-60 nucleotides, 100-450 nucleotides, 100-400 nucleotides, 100-350 Nucleotides, 100-300 nucleotides, 100-250 nucleotides, 100-200 nucleotides, 150-450 nucleotides, 150-400 nucleotides, 150-350 nucleotides, 150-300 nucleotides, 150-250 nucleotides, 150-200 nucleotides, 200-450 nucleotides, 200-400 nucleotides, 200-350 nucleotides, 200-300 nucleotides, 200-250 nucleotides, 250-450 nucleotides,It contains 250 to 400 nucleotides, 250 to 350 nucleotides, 250 to 300 nucleotides, 300 to 450 nucleotides, 300 to 400 nucleotides, 300 to 350 nucleotides, 350 to 450 nucleotides, 350 to 400 nucleotides, or 400 to 450 nucleotides.

[0147] In some embodiments, the stem portion of the stem-loop is 4 to 500 nucleotides in length, and the loop portion of the stem-loop is 3 to 500 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 50 nucleotides in length, and the loop portion of the stem-loop is 3 to 50 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 20 nucleotides in length, and the loop portion of the stem-loop is 3 to 20 nucleotides in length. In some embodiments, the stem portion of the stem-loop is 4 to 10 nucleotides in length, and the loop portion of the stem-loop is 3 to 10 nucleotides in length.

[0148] In some embodiments, the loop further comprises one or more nucleic acids or is used to stabilize the termini. In other embodiments, the loop further comprises one or more nucleic acids that may be used in therapeutic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used in diagnostic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used for research purposes.

[0149] According to some embodiments, the minimum nucleic acid structure required at the 5' end of the ssDNA is any structure that loops back on itself, i.e., a hairpin structure. However, it should be understood that various structures are contemplated at the 5' end, so long as there is at least one stem and one loop. For example, in some embodiments, the ssDNA described herein may contain at least one stem-loop structure at the 5' end. In some embodiments, the ssDNA may contain at least two stem-loop structures at the 5' end. In some embodiments, the ssDNA may contain at least three stem-loop structures at the 5' end. In some embodiments, the ssDNA may contain at least four stem-loop structures at the 5' end. In some embodiments, the ssDNA may contain at least five stem-loop structures at the 5' end.

[0150] In some embodiments, the 5'-terminal nucleotides form a cruciform DNA structure. A DNA cruciform structure can be formed when both strands form a stem-loop structure at the same position within the molecule and contain a four-way junction and two closed hairpin-shaped points.

[0151] According to some embodiments, the DNA structure at the 5' end is the same as the DNA structure at the 3' end. According to some embodiments, the DNA structure at the 5' end is different from the DNA structure at the 3' end.

[0152] For example, in some embodiments, the ssDNA described herein may comprise at least one stem-loop structure at its 5' end. According to some embodiments, the ssDNA may comprise at least two stem-loop structures at its 5' end. According to some embodiments, the ssDNA may comprise at least three stem-loop structures at its 5' end. According to some embodiments, the ssDNA may comprise at least four stem-loop structures at its 5' end. According to some embodiments, the ssDNA may comprise at least five stem-loop structures at its 5' end.

[0153] According to some embodiments, the 5' terminal nucleotides form a cruciform DNA structure.

[0154] According to some embodiments, the 5' terminal nucleotides form a hairpin structure.

[0155] According to some embodiments, the 5' terminal nucleotide forms a hammerhead structure.

[0156] According to some embodiments, the 5' terminal nucleotides form a quadruplex structure.

[0157] According to some embodiments, the 5' terminal nucleotide forms a bulge structure.

[0158] According to some embodiments, the 5' terminal nucleotides form a multi-branched loop.

[0159] According to some embodiments, the 5' terminal nucleotides do not form two stem-loop structures.

[0160] According to some embodiments, the stem structure at the 5' end comprises one or more nucleotides modified to be exonuclease resistant. According to some embodiments, the stem structure at the 5' end comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or twenty or more nucleotides modified to be exonuclease resistant.

[0161] According to some embodiments, the stem structure comprises one or more phosphorothioate-modified nucleotides. According to some embodiments, the stem structure comprises about 2 to about 12 phosphorothioate-modified nucleotides. According to some embodiments, the stem structure comprises about 4 to about 10, e.g., about 4 to about 5, about 4 to about 6, about 4 to about 7, about 4 to about 8, about 4 to about 9, about 4 to about 10, about 5 to about 6, about 5 to about 7, about 5 to about 8, about 5 to about 9, about 5 to about 10, about 6 to about 7, about 6 to about 8, about 6 to about 9, about 6 to about 10, about 7 to about 8, about 7 to about 9, about 7 to about 10, about 8 to about 9, about 8 to about 10, or about 9 to about 10 phosphorothioate-modified nucleotides. According to some embodiments, the stem structure comprises more than 10 phosphorothioate modified nucleotides.

[0162] According to some embodiments, the phosphorothioate modified nucleotides are located adjacent to one another. According to some embodiments, the one or more phosphorothioate modified nucleotides are resistant to exonuclease degradation.

[0163] In some embodiments, the loop further comprises one or more nucleic acids or is used to stabilize the termini. In other embodiments, the loop further comprises one or more nucleic acids that may be used in therapeutic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used in diagnostic methods. In other embodiments, the loop further comprises one or more nucleic acids that may be used for research purposes.

[0164] According to some embodiments, the nucleotides in the loop are chemically modified with functional groups to alter their properties.

[0165] According to some embodiments, the loop further comprises one or more aptamers, according to some embodiments, the aptamers are identified from the publicly available Apta-index database of aptamers (aptagen.com / apta-index).

[0166] According to some embodiments, the loop further comprises one or more synthetic ribozymes.

[0167] According to some embodiments, the loop further comprises one or more antisense oligonucleotides (ASOs).

[0168] According to some embodiments, the loop further comprises one or more short interfering RNAs (siRNAs).

[0169] In some embodiments, the loop further comprises one or more antiviral nucleoside analogs (ANAs).

[0170] According to some embodiments, the loop further comprises one or more triplex-forming oligonucleotides.

[0171] According to some embodiments, the loop further comprises one or more gRNAs or gDNAs.

[0172] According to some embodiments, the loop further comprises one or more molecular probes, for example, nucleic acid-based fluorescent probes.

[0173] According to some embodiments, "click" azide-alkyne cycloaddition (Kolb et al., Angew. Chem. Int. Ed. Engl. 2001, 40, 2004-2021) is used to modify the nucleotides in the loop. Click chemistry was developed to link organic molecules together under mild conditions in the presence of various functional groups. Most click-mediated modifications are performed on nitrogenous bases by introducing novel base analogs, attaching fluorophores or isotopic elements for molecular imaging, forming interstrand linkages between oligonucleotides, and for molecular bioconjugation. The best examples of click chemistry are the CuAAC reaction (CuAAC reaction) independently discovered by Sharpless and Meldal (Angew. Chem., Int. Ed. 2002, 41, 2596-2599) and the Cu-based [3+2] azide-alkyne cycloaddition reaction (Angew. Chem., Int. Ed. 1963, 2, 633-645) by Huisgen. I This is the catalytic version.

[0174] According to some embodiments, introduction of a reactive amino or thiol group into a synthetic oligonucleotide provides, for example, an acceptor for subsequent chemiluminescent labeling.

[0175] In some embodiments, the stem-loop structure may comprise alternative or modified nucleotides, including, but not limited to, ribonucleic acid (RNA), peptide-nucleic acid (PNA), locked nucleic acid (LNA), etc. According to some embodiments, the loop portion of the stem-loop structure may comprise a chemical structure that does not include nucleic acid.

[0176] Differences from known ITR structures As known in the art, a typical AAV ITR structure comprises a palindromic double-stranded T-shaped hairpin structure, in which the double-stranded A-A' region forms the stem, and the double-stranded B-B' and C-C' regions form the cross-arms of the T-shaped structure (see, for example, Ling et al., J. Virology, 89(2):952-961, 2015; WO2016081927A2). The other nucleotides in a typical AAV ITR remain single-stranded and are referred to as the single-stranded D(-) sequence (3' end of the ITR) and the single-stranded D(-) sequence (5' end of the ITR). Once inside the cell, the single-stranded regions of the D(+) and D(-) regions undergo second-strand DNA synthesis to become the double-stranded D and D' regions.

[0177] Prior to the present invention, it had been demonstrated that removal of both the D(+) and D(-) regions from the AAV ITRs impaired the rescue, replication, and encapsidation of AAV DNA (e.g., Wang et al., J. Mol. Biol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997). Those skilled in the art believed that at least one of the D(+) single-stranded region or the D(-) single-stranded region was essential for AAV replication and encapsidation, and that deletion of the ssD(+) or ssD(-) region could adversely affect AAV DNA expression because it was believed that the ssD(+) or ssD(-) region contained one or more transcription factor binding sites (e.g., Ling et al., J. Virol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997). al., J. Virology, 89(2):952-961, 2015, WO2016081927A2).

[0178] However, the present inventors have surprisingly discovered that deletion of both the ssD(+) and ssD(-) regions from the stem-loop structure of the disclosed single-stranded DNA molecule results in a functional single-stranded DNA (ssDNA).

[0179] Thus, in some embodiments, at least one stem-loop structure of the ssDNA does not include the ssD(-) region or the ssD(+) region that would be present in a wild-type AAV ITR. In some embodiments, at least one stem-loop structure at the 5' end of the ssDNA does not include a single-stranded D(+) region. In other embodiments, at least one stem-loop structure at the 5' end of the ssDNA molecule does not include any of the A region, A' region, B region, B' region, C region, C' region, and / or D(+) region that would be present in a wild-type AAV ITR.

[0180] According to some embodiments, at least one stem-loop structure at the 5' end does not include a rep-binding element (RBE) that would be present in a wild-type ITR. According to some embodiments, at least one stem-loop structure at the 5' end does not include a terminal resolution site (trs) that would be present in a wild-type ITR.

[0181] According to some embodiments, at least one stem-loop structure at the 5' end is devoid of any viral capsid protein coding sequence.

[0182] In some embodiments, the 5' terminal nucleotides of the ssDNA do not form an AAV ITR structure.

[0183] C. Transgene The single-stranded DNA (ssDNA) molecules described herein do not have the packaging constraints imposed by the limited space within a viral capsid, allowing for the insertion of one or more genetic elements, such as single-stranded enhancers, single-stranded introns, single-stranded posttranscriptional regulatory elements, single-stranded polyadenylation signals, and single-stranded regulatory switches, large transgenes, multiple transgenes, etc.

[0184] According to some embodiments, the transgene, e.g., nucleic acid sequence of interest, further comprises at least one single-stranded promoter linked to the at least one nucleic acid sequence of interest.

[0185] In other aspects of the present disclosure, single-stranded transgene cassettes are used in gene editing applications, as described in more detail herein.

[0186] According to some embodiments, the nucleic acid sequence of interest (also referred to herein as a transgene) encodes a gene that encodes a protein that is absent, inactive, or insufficiently active in a recipient subject, or a protein that has a desired biological or therapeutic effect. The transgene can encode a gene product that can function to correct the expression of a defective gene or transcript. In principle, the expression cassette can include any gene that encodes a protein, polypeptide, or RNA that is reduced or absent due to a mutation, or that provides a therapeutic effect, where overexpression is considered within the scope of the present disclosure.

[0187] The nucleic acid sequence of interest can include any sequence useful for treating a disease or disorder in a subject. ssDNA molecules can be used to deliver and express any gene of interest to a subject, including, but not limited to, exogenous genes and nucleotide sequences, including nucleic acids encoding polypeptides or non-coding nucleic acids (e.g., RNAi, miR, etc.), and viral sequences in the subject's genome, such as HIV viral sequences. In some embodiments, the ssDNA molecules disclosed herein are used for therapeutic purposes (e.g., for medical, diagnostic, or veterinary use). In certain embodiments, the ssDNA molecules are useful for expressing any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAis, antisense oligonucleotides, antisense polynucleotides, or RNAs (coding or non-coding, e.g., siRNAs, shRNAs, microRNAs, mRNAs, or gRNAs, and their antisense counterparts (e.g., antagomirs)), antibodies, antigen-binding fragments, or any combination thereof.

[0188] The sequence can be codon-optimized for the target host cell. As used herein, the term "optimized codons" or "codon optimization" refers to the process of modifying a nucleic acid sequence for enhanced expression in cells of a target vertebrate, such as a mouse or human, by replacing at least one, two or more, or a substantial number of codons in the native sequence (e.g., a prokaryotic sequence) with codons frequently or most frequently used by the genes of that vertebrate. Different species exhibit specific biases toward certain codons for specific amino acids. Typically, codon optimization does not alter the amino acid sequence of the original translated protein. Optimized codons can be determined, for example, using Aptagen's GENEFORGE® codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Rd. Suite 300, Herndon, Va. 20171) or another publicly available database.

[0189] In some embodiments, the transgene expressed by the ssDNA molecule is a therapeutic gene, hi some embodiments, the therapeutic gene is an antibody, or antibody fragment, or antigen-binding fragment thereof, such as a neutralizing antibody or antibody fragment.

[0190] Specifically, a therapeutic gene is one or more therapeutic agents, including, but not limited to, proteins, polypeptides, peptides, enzymes, antibodies, antigen-binding fragments, and variants and / or active fragments thereof, for use in treating, preventing, and / or ameliorating one or more symptoms of a disease, dysfunction, injury, and / or disorder. Exemplary therapeutic genes are described herein in the section entitled "Methods of Treatment."

[0191] According to any of the above aspects and embodiments, the ssDNA molecule is synthetically produced.

[0192] According to any of the above aspects and embodiments, the ssDNA molecule is devoid of any viral capsid protein coding sequence.

[0193] According to any of the above embodiments, the DNA is a peptide nucleic acid (PNA), which is a synthetic mimic of DNA.

[0194] D. Promoter In some embodiments, the ssDNA molecules produced by the methods described herein comprise a promoter (described in more detail below), which comprises a transcription start site (TSS). In some embodiments, the ssDNA molecules produced by the methods described herein comprise an enhancer.

[0195] In some embodiments, the promoter, TSS, and / or enhancer are single-stranded in the ssDNA molecules produced by the methods described herein. In some embodiments, the promoter, TSS, and / or enhancer are double-stranded in the ssDNA molecules produced by the methods described herein.

[0196] Thus, in some embodiments, the double-stranded region comprising a promoter, enhancer, and / or TSS is at least 10 base pairs in length, at least 20 base pairs in length, at least 30 base pairs in length, at least 40 base pairs in length, at least 50 base pairs in length, at least 60 base pairs in length, at least 70 base pairs in length, at least 80 base pairs in length, at least 90 base pairs in length, at least 100 base pairs in length, at least 110 base pairs in length, at least 120 base pairs in length, at least 130 base pairs in length, at least 140 base pairs in length, at least 150 base pairs in length, at least 160 base pairs in length, at least 170 base pairs in length, at least 180 base pairs in length, at least 190 base pairs in length, at least 200 base pairs in length, at least 220 base pairs in length, at least 240 base pairs in length, at least 260 base pairs in length, at least 280 base pairs in length, at least 300 base pairs in length, at least 320 base pairs in length, at least 340 base pairs in length, at least 360 base pairs in length, at least 380 base pairs in length, at least 390 base pairs in length, at least 400 base pairs in length, at least 410 base pairs in length, at least 420 base pairs in length, at least 430 base pairs in length, at least 440 base pairs in length, at least 450 base pairs in length, at least 460 base pairs in length, at least 470 base pairs in length, at least 480 base pairs in length, at least 490 base pairs in length, at least 500 base pairs in length, at least 510 base pairs in length, at least 520 base pairs in length, at least 530 base pairs in length, at least 540 base pairs in length at least 300 base pairs long, at least 320 base pairs long, at least 340 base pairs long, at least 360 base pairs long, at least 380 base pairs long, at least 400 base pairs long, at least 420 base pairs long, at least 440 base pairs long, at least 460 base pairs long, at least 480 base pairs long, at least 500 base pairs long, at least 550 base pairs long, at least 600 base pairs long, at least 650 base pairs long, at least 700 base pairs long, at least 750 base pairs long, at least 800 base pairs long, at least 850 base pairs long, at least 900 base pairs long, at least 950 base pairs long, at least 1000 base pairs long, at least 1100 base pairs long, at least 1200 base pairs long, at least 1300 base pairs long, at least 1400 base pairs long, or at least 1500 base pairs long.

[0197] In some embodiments, the double-stranded region comprising a promoter, enhancer, and / or TSS is less than 1500 base pairs in length, less than 1400 base pairs in length, less than 1300 base pairs in length, less than 1200 base pairs in length, less than 1100 base pairs in length, less than 1000 base pairs in length, less than 950 base pairs in length, less than 900 base pairs in length, less than 850 base pairs in length, less than 800 base pairs in length, less than 750 base pairs in length, less than 700 base pairs in length, less than 650 base pairs in length, less than 600 base pairs in length, less than 550 base pairs in length, less than 500 base pairs in length, less than 480 base pairs in length, less than 460 base pairs in length, less than 440 base pairs in length, less than 420 base pairs in length, less than 400 base pairs in length, less than 380 base pairs in length, less than 400 base pairs in length, less than 500 base pairs in length, less than 550 base pairs in length, less than 500 base pairs in length, less than 480 base pairs in length, less than 460 base pairs in length, less than 440 base pairs in length, less than 420 base pairs in length, less than 400 base pairs in length, less than 380 base pairs in length, less than 40 ... less than 360 base pairs in length, less than 340 base pairs in length, less than 320 base pairs in length, less than 300 base pairs in length, less than 280 base pairs in length, less than 260 base pairs in length, less than 240 base pairs in length, less than 220 base pairs in length, less than 200 base pairs in length, less than 190 base pairs in length, less than 180 base pairs in length, less than 170 base pairs in length, less than 160 base pairs in length, less than 150 base pairs in length, less than 140 base pairs in length, less than 130 base pairs in length, less than 120 base pairs in length, less than 110 base pairs in length, less than 100 base pairs in length, less than 90 base pairs in length, less than 80 base pairs in length, less than 70 base pairs in length, less than 60 base pairs in length, less than 50 base pairs in length, less than 40 base pairs in length, or less than 30 base pairs in length.

[0198] In some embodiments, the double-stranded region comprising the promoter, enhancer, and / or TSS is about 30 to 1500 base pairs in length, about 40 to 1400 base pairs in length, about 50 to 1300 base pairs in length, about 60 to 1200 base pairs in length, about 70 to 1100 base pairs in length, about 80 to 1000 base pairs in length, about 90 to 900 base pairs in length, about 90 to 900 base pairs in length, about 100 to 800 base pairs in length, about 110 to 700 base pairs in length, about 120 to 600 base pairs in length, about 130 to 500 base pairs in length, about 140 to 400 base pairs in length, about 150 to 300 base pairs in length, about 160 to 200 base pairs in length, about 1381 base pairs in length, or about 499 base pairs in length.

[0199] E. Apatomer In some embodiments, the ssDNA molecules generated by the methods described herein include an aptamer, as described in more detail throughout this disclosure. In some embodiments, the aptamer may be located within a 3' and / or 5' stem-loop structure of the ssDNA molecule generated by the methods described herein. In some embodiments, the aptamer may be located within or adjacent to a nucleic acid sequence of interest. In some embodiments, the aptamer may be encoded by a double-stranded ceDNA molecule, and the aptamer may fold into a secondary structure only after one strand of the double-stranded ceDNA molecule is removed to generate the ssDNA molecule (see, e.g., Figure 19, right side and Figure 20, right side). In some embodiments, the aptamer is a CH4-1 aptamer.

[0200] III. Closed-Ended DNA (ceDNA) Intermediate Molecules As described herein, a cell-free enzymatic method is used to generate synthetic double-stranded closed-end DNA (ceDNA) intermediate molecules. In one embodiment, the present disclosure provides an isolated closed-end DNA (ceDNA) construct comprising a double-stranded transgene cassette comprising at least one double-stranded transgene, and a first inverted terminal repeat (ITR) and an optional second ITR each flanking the at least one double-stranded transgene, wherein at least one of the first ITR and the optional second ITR comprises one or more phosphorothioate-modified nucleotides.

[0201] According to embodiments of the present disclosure, the double-stranded transgene cassette further comprises at least one double-stranded promoter operably linked to the at least one double-stranded transgene for controlling expression of the at least one double-stranded transgene. In further embodiments, the double-stranded transgene cassette further comprises one or more genetic elements selected from the group consisting of a double-stranded enhancer, a double-stranded intron, a double-stranded post-transcriptional regulatory element, a double-stranded polyadenylation signal, and a double-stranded regulatory switch. According to other further embodiments, the at least one double-stranded transgene is a promoterless double-stranded transgene. As described herein, the at least one double-stranded transgene is a double-stranded donor sequence, and the double-stranded transgene cassette further comprises a double-stranded 5' homologous arm and a double-stranded 3' homologous arm adjacent to the double-stranded donor sequence. According to some embodiments, the double-stranded 5' homologous arm and the double-stranded 3' homologous arm are each about 10 to 2000 nt in length, for example, about 100 to 2000 nt in length, or about 1000 to 2000 nt in length, or about 10 to 1000 nt in length, for example, about 100 to 1000 nt in length, or about 10 to 500 nt in length, about 50 to 500 nt in length, or about 100 to 500 nt in length, about 10 to 50 nt in length, about 50 to 500 nt in length, or about 500 to 1000 nt in length, about 500 to 1500 nt in length, about 1500 to 2000 nt in length, about 2 to 1000 nt in length, about 2 to 500 nt in length, about 2 to 100 nt in length, or about 2 to 50 nt in length.

[0202] According to some embodiments, at least one double-stranded transgene is a double-stranded donor sequence, and the double-stranded transgene cassette lacks a single-stranded 5' homology arm and a single-stranded 3' homology arm. Further, in some embodiments, the double-stranded transgene cassette is cleavable and comprises at least a first double-stranded guide RNA (gRNA) target sequence (TS), at least a first double-stranded protospacer adjacent motif (PAM), It further comprises at least a second double-stranded gRNA TS, and at least a second double-stranded PAM.

[0203] Due to the fact that single-stranded DNA (ssDNA) according to embodiments of the present disclosure is derived from a double-stranded DNA (dsDNA) intermediate, the physical properties of ds ceDNA vectors, including the presence of at least one functional moiety, such as, for example, an aptamer sequence, with high binding affinity for a nuclear localization protein or fluorophore chemically conjugated to an ITR oligonucleotide, are also present in the single-stranded DNA (ssDNA) molecule.

[0204] Single-stranded DNA (ssDNA) molecules and ds DNA constructs (e.g., ds ceDNA) produced using the synthetic processes described herein do not have the packaging constraints imposed by the limited space within the viral capsid, allowing for the insertion of control elements, such as the regulatory switches disclosed herein, large transgenes, multiple transgenes, etc.

[0205] A. Endonuclease recognition nucleotide sequence According to some embodiments, the ceDNA construct comprises a nickase recognition sequence ("nick site") for an endonuclease, e.g., a nicking endonuclease. In one embodiment, the dsDNA construct comprises a terminal resolution site (trs) sequence of an AAV ITR that contains the nick site for the endonuclease. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for one or more nicking endonucleases, each independently selected from Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BssSI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BsmI, Nt.BspQI, Nt.BstNBI, Nt.CviPII, and an isoschizomer of any of the foregoing. According to further embodiments, the one or more recognition nucleotide sequences comprise any one or more of the following sequences shown in Table 1 below: [Table 1]

[0206] According to some embodiments, each of the one or more recognition nucleotide sequences is an engineered sequence. According to further embodiments, each of the one or more recognition nucleotide sequences comprises one or more nick sites for one or more nicking endonucleases.

[0207] In some embodiments where the ITRs contain a terminal resolution site (trs), one or more nick sites are located about 0 to about 20 nucleotides downstream of the (trs), e.g., about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides downstream of the terminal resolution site (trs), or, e.g., about 0 to about 15, about 0-10, about 0-5, about 5-15, about 10-20, about 15-20, about 10-20, or about 5-20 nucleotides downstream of the terminal resolution site (trs). In some embodiments, only one nick site functions as an exonuclease entry site. In some embodiments where the ITRs do not contain a trs, the nick site may be within the stem region upstream of the expression cassette. In some embodiments, the nick site is at least about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, 25, 30, 35, or 40 nucleotides upstream of the expression cassette.

[0208] According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for Nb.BbvCI or an isoschizomer thereof. According to some embodiments, the dsDNA construct comprises a single recognition nucleotide sequence for Nb.BbvCI or an isoschizomer thereof. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for Nb.BtsI or an isoschizomer thereof. According to some embodiments, the dsDNA construct comprises a single recognition nucleotide sequence for Nb.BtsI or an isoschizomer thereof. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for endonuclease V or an isoschizomer thereof.

[0209] According to some embodiments, the double-stranded ceDNA molecule comprises at least one deoxyinosine residue, which is present in a stem-loop structure at the 3' end, two bases upstream of the desired nick site.

[0210] According to some embodiments, the deoxyinosine modification is present at position -1i, -2i, -3i, -4i, -5i, -6i, -7i, -8i, -9i, or -10i relative to the 3' end of the 3' ITR.

[0211] According to some embodiments, the deoxyinosine modification is at position -1i, -2i, -5i, or -7i relative to the 3' end of the 3'ITR.

[0212] According to some embodiments, the deoxyinosine residue is present at position -1i, -2i, -5i, or -7i relative to SEQ ID NO: 7 shown below.

[0213] CTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAG (SEQ ID NO: 7) According to some embodiments, the position of the inosine modification affects the stability of the secondary structure of the ITR, particularly the 3'ITR.

[0214] According to some embodiments, the double-stranded ceDNA molecule comprises at least one uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue. According to further embodiments, the endonuclease has enzymatic activity towards uridine-, inosine-, xanthosine-, and / or oxanosine-containing residues.

[0215] In some embodiments, an endonuclease having enzymatic activity against uridine-, inosine-, xanthosine-, and / or oxanosine-containing residues can nick the modified DNA at the second phosphodiester bond 3' to the lesion.

[0216] According to some embodiments, the 3'-end portion of the double-stranded DNA molecule (starting material) comprises a nickase recognition sequence. In one embodiment, the 3'-end portion of the dsDNA molecule comprises the sequence 5'-CCAA-3'. In some embodiments, the 3'-end portion of the dsDNA molecule comprises any one or more of the sequences shown in Table 2 below. Furthermore, because these are unique sequences after double-stranded ceDNA with the special engineered nick sites shown in Table 2 is nicked by a nicking endonuclease, the resulting ssDNA molecule also comprises any one or more of the sequences shown in Table 2 below in its 3'-end fragment. [Table 2]

[0217] B. Phosphorothioate (PS) modification After the step of contacting with an endonuclease, the double-stranded ceDNA described herein is treated with an exonuclease to produce the ssDNA described herein.

[0218] According to some embodiments, the exonuclease can remove the nicked strand of the dsDNA construct beginning at one or more nick sites and ending with one or more phosphorothioate-modified nucleotides. The exonuclease can be selected from, but not limited to, T7 exonuclease, lambda exonuclease, T5 exonuclease, and exonuclease V. According to some embodiments, the exonuclease is T7 exonuclease.

[0219] According to some embodiments, the double-stranded closed-end DNA intermediate comprises a phosphorothioate (PS) bond. The PS bond replaces a sulfur atom with a non-bridging oxygen in the phosphate backbone of the oligonucleotide. Advantageously, this modification renders the internucleotide bond resistant to nuclease degradation and provides precision for exonuclease targeting. More specifically, this modification is advantageously located in the ITR region within the exonuclease-active space and functions as a 5'- and / or 3'-end lock, rendering the internucleotide bond resistant to nuclease degradation and ensuring precision of exonuclease activity.

[0220] According to some embodiments, in methods for producing single-stranded DNA (ss DNA) molecules, PS linkages substitute sulfur atoms for non-bridging oxygen atoms in the phosphate backbone of oligonucleotides. Advantageously, this modification stabilizes the nucleic acid and makes the internucleotide linkage resistant to nuclease degradation.

[0221] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A, A', B, B', C, C', D(+), and D(-) of at least one of the first and optional second ITRs. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A, A', B, B', C, C', D, and D' of at least one of the first and optional second ITRs.

[0222] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A, A', and D of at least one of the first and optional second ITRs. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A, A', and D of at least one of the first and optional second ITRs.

[0223] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A and A' of at least one of the first and optional second ITRs. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A and A' of at least one of the first and optional second ITRs.

[0224] According to some embodiments, all of the one or more phosphorothioate modified nucleotides of the ssDNA molecule in the first ITR are located in the A' and / or D regions of the first ITR. According to some embodiments, all of the one or more phosphorothioate modified nucleotides of the dsDNA construct in the first ITR are located in the A' and / or D regions of the first ITR.

[0225] According to some embodiments, all of the one or more phosphorothioate-modified nucleotides in the first ITR of the ssDNA molecule are located in the A region of the first ITR. According to some embodiments, all of the one or more phosphorothioate-modified nucleotides in the first ITR of the dsDNA construct are located in the A region of the first ITR.

[0226] According to some embodiments, all of the one or more phosphorothioate modified nucleotides in the second ITR of the ssDNA molecule, if present, are located in the A' and / or D regions of the second ITR. According to some embodiments, all of the one or more phosphorothioate modified nucleotides in the second ITR of the dsDNA construct, if present, are located in the A' and / or D regions of the second ITR.

[0227] According to some embodiments, all of the one or more phosphorothioate-modified nucleotides in the second ITR of the ssDNA molecule, if present, are located in the A region of the second ITR. According to some embodiments, all of the one or more phosphorothioate-modified nucleotide dsDNA constructs in the second ITR, if present, are located in the A region of the second ITR.

[0228] According to some embodiments, one or more phosphorothioate-modified nucleotides of the ssDNA molecule are adjacent to one another. According to some embodiments, one or more phosphorothioate-modified nucleotides of the dsDNA construct are adjacent to one another.

[0229] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule, if present, are about 1-15 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotide dsDNA construct, if present, are about 1-15 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR.

[0230] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule, if present, are about 1-10 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotide dsDNA construct, if present, are about 1-10 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR.

[0231] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule, if present, are about 1-5 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotide dsDNA construct, if present, are about 1-5 nucleotides from the B-B' and C-C' arms of the first ITR or optional second ITR.

[0232] According to some embodiments, one or more phosphorothioate-modified nucleotides of the ssDNA molecule are resistant to exonuclease degradation. According to some embodiments, one or more phosphorothioate-modified nucleotides comprising the dsDNA construct are resistant to exonuclease degradation at the PS-binding sequence.

[0233] According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises about 1 to about 60, e.g., about 1 to about 3, about 1 to about 5, about 1 to about 7, about 1 to about 10, about 1 to about 20, about 1 to about 30, about 1 to about 40, about 1 to about 50, about 10 to about 20, about 10 to about 30, about 10 to about 40, about 10 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 30 to about 50, about 40 to about 50, about 25 to about 50, about 5 to about 10, about 5 to about 15, about 5 to about 20, or about 5 to about 25, phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each comprises about 1 to about 60 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR of the ssDNA molecule each comprises about 1 to about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR of the ssDNA molecule each comprises about 1 to about 10 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR of the ssDNA molecule each comprises about 1 to about 15 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each comprises about 1 to about 20 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR of the ssDNA molecule each comprises from about 1 to about 25 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises from about 1 to about 30 phosphorothioate-modified nucleotides.

[0234] According to some embodiments, one or more phosphorothioate-modified nucleotides are located at the 5'-end of the ssDNA molecule. According to some embodiments, one or more phosphorothioate-modified nucleotides are located at the 3'-end of the ssDNA molecule. According to some embodiments, one or more phosphorothioate-modified nucleotides are located at the 3'-end of the ssDNA molecule, the 5'-end of the ssDNA molecule, or both.

[0235] According to some embodiments, one or more phosphorothioate modified nucleotides are located upstream of each of the one or more nicking endonuclease recognition sequences.

[0236] According to some embodiments, the one or more phosphorothioate modified nucleotides are located at the 5' end of the first ITR and / or the optional second ITR.

[0237] According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more phosphorothioate-modified nucleotides. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, or more phosphorothioate-modified nucleotides at the 3' end of the ssDNA molecule, the 5' end of the ssDNA molecule, or both. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, or more phosphorothioate-modified nucleotides upstream of each of one or more nicking endonuclease recognition sequences. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, or more phosphorothioate-modified nucleotides at the 5' end of the first ITR and / or at least 1, 2, 3, 4, 5, or more phosphorothioate-modified nucleotides at the 5' end of the optional second ITR.

[0238] According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 6 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 5 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 4 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 3 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 2 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and the optional second ITR of the ssDNA molecule each comprises about 1 or fewer phosphorothioate-modified nucleotide. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each contains about 6 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each contains about 5 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each contains about 4 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each contains about 3 or fewer phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each contains about 2 or fewer phosphorothioate-modified nucleotides.According to some embodiments, at least one of the first ITR and optional second ITR dsDNA constructs each comprises no more than about one phosphorothioate modified nucleotide.

[0239] According to some embodiments, at least one of the first and optional second ITR of the ssDNA molecule each comprises about 3, about 4, or about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises about 3, about 4, or about 5 phosphorothioate-modified nucleotides.

[0240] C. Transgene The ceDNA may contain a transgene (a nucleic acid sequence of interest) and one or more regulatory sequences, e.g., an expression cassette, that allow and / or control the expression of the transgene. In one embodiment, the expression cassette may contain, in this order, one or more of an enhancer / promoter, an ORF reporter (transgene), a post-transcriptional regulatory element (e.g., a WPRE), and a polyadenylation and termination signal (e.g., a BGH polyA). The expression cassette may also contain an internal ribosome entry site (IRES) and / or a 2A element. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, mir-regulatable elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers. In some embodiments, an ITR may act as a promoter for the transgene. In some embodiments, the ssDNA molecules described herein include additional components for regulating expression of a transgene or nucleic acid sequence of interest, such as a regulatory switch for controlling and regulating expression of the transgene described herein in the section entitled "Regulatory Switches," and, if desired, a kill switch to allow for controlled cell death of cells containing the ssDNA molecule.

[0241] The expression cassette or nucleic acid sequence of interest in the ssDNA construct can comprise more than 4000 nucleotides, more than 5000 nucleotides, more than 10,000 nucleotides, or more than 20,000 nucleotides, or more than 30,000 nucleotides, or more than 40,000 nucleotides, or more than 50,000 nucleotides, or any range of about 4000 to 10,000 nucleotides, or 10,000 to 50,000 nucleotides, or more than 50,000 nucleotides. According to some embodiments, the expression cassette can comprise a transgene in the length range of 500 to 50,000 nucleotides. According to some embodiments, the expression cassette can comprise a transgene in the length range of 500 to 75,000 nucleotides. According to some embodiments, the expression cassette can comprise a transgene in the length range of 500 to 10,000 nucleotides. According to some embodiments, the expression cassette can comprise a transgene in the length range of 1000 to 10,000 nucleotides. According to some embodiments, the expression cassette can contain a transgene ranging in length from 500 to 5,000 nucleotides. The ssDNA molecules described herein are free of the size limitations of encapsidated AAV vectors, allowing for the efficient delivery of large expression cassettes to hosts. In some embodiments, the ssDNA molecules described herein are modified to minimize prokaryote-specific methylation.

[0242] An expression cassette can include, for example, an expressible exogenous sequence (e.g., an open reading frame) or transgene or nucleic acid sequence of interest that encodes a protein that is either absent, inactive, or insufficiently active in a recipient subject, or a gene that encodes a protein with a desired biological or therapeutic effect. The transgene or nucleic acid sequence of interest can encode a gene product that can function to correct expression of a defective gene or transcript. In principle, an expression cassette can include any gene that encodes a protein, polypeptide, or RNA that is reduced or absent due to a mutation, or that provides a therapeutic effect, where overexpression is considered within the scope of the present disclosure.

[0243] The expression cassette can include any transgene or nucleic acid sequence of interest useful for treating a disease or disorder in a subject. The ssDNA molecules described herein, produced using the synthetic processes described herein, can be used to deliver and express any gene of interest in a subject, including, but not limited to, exogenous genes and nucleotide sequences, including polypeptide-encoding or non-coding nucleic acids (e.g., RNAi, miR, etc.), and viral sequences in the subject's genome, such as HIV viral sequences. In some embodiments, the ssDNA molecules described herein are used for therapeutic purposes (e.g., for medical, diagnostic, or veterinary use). In certain embodiments, the ssDNA molecules described herein are useful for expressing any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAis, antisense oligonucleotides, antisense polynucleotides, or RNAs (coding or non-coding, e.g., siRNAs, shRNAs, microRNAs, mRNAs, or gRNAs, and their antisense counterparts (e.g., antagomirs)), antibodies, antigen-binding fragments, or any combination thereof.

[0244] The expression cassette can also encode a polypeptide, a sense or antisense oligonucleotide, or RNA (e.g., coding or non-coding, e.g., siRNA, shRNA, microRNA, and their antisense counterparts (e.g., antagomirs)). The expression cassette can include exogenous sequences encoding reporter proteins used for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.

[0245] The sequences provided in the expression cassettes, which are expression constructs for the ssDNA molecules described herein, can be codon-optimized for the target host cell. As used herein, the terms "optimized codons" or "codon optimization" refer to the process of modifying a nucleic acid sequence for enhanced expression in cells of a target vertebrate, such as a mouse or human, by replacing at least one, two or more, or a substantial number of codons in the native sequence (e.g., a prokaryotic sequence) with codons frequently or most frequently used by the genes of that vertebrate. Different species exhibit specific biases toward certain codons for specific amino acids. Typically, codon optimization does not alter the amino acid sequence of the original translated protein. Optimized codons can be determined, for example, using Aptagen's GENEFORGE® codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Rd. Suite 300, Herndon, Va. 20171) or another publicly available database.

[0246] In some embodiments, the transgene or nucleic acid sequence of interest expressed by the ssDNA molecule is a therapeutic gene, hi some embodiments, the therapeutic gene is an antibody, or antibody fragment, or antigen-binding fragment thereof, such as a neutralizing antibody or antibody fragment.

[0247] Specifically, a therapeutic gene is one or more therapeutic agents, including, but not limited to, proteins, polypeptides, peptides, enzymes, antibodies, antigen-binding fragments, and variants and / or active fragments thereof, for use in treating, preventing, and / or ameliorating one or more symptoms of a disease, dysfunction, injury, and / or disorder. Exemplary therapeutic genes are described herein in the section entitled "Methods of Treatment."

[0248] The ssDNA molecules described herein have many structural features that distinguish them from plasmid-based expression vectors. The ssDNA molecules generated by the synthetic methods herein may have one or more of the following characteristics: lack of original (i.e., uninserted) bacterial DNA; lack of a prokaryotic origin of replication; self-sufficiency, i.e., they do not require any sequence other than the two ITRs containing the Rep binding site and terminal resolution site (RBS and TRS) and any exogenous sequence between the ITRs; the presence of ITR sequences that form hairpins; the absence of bacterial-type DNA methylation or indeed any other methylation associated with production in a given cell type and considered abnormal by a mammalian host; and the absence of bacterial-type DNA methylation or indeed any other methylation. While it is generally preferred that the vectors do not contain any prokaryotic DNA, it is contemplated that some prokaryotic DNA may be inserted as exogenous sequence, as a non-limiting example, within promoter or enhancer regions.

[0249] There are several advantages to using the ssDNA molecules described herein over plasmid-based expression vectors, including, but not limited to, the following: 1) while plasmids contain bacterial DNA sequences and are subject to prokaryote-specific methylation, such as 6-methyladenosine and 5-methylcytosine methylation, capsid-free AAV vector sequences are of eukaryotic origin and are not subject to prokaryote-specific methylation, resulting in capsid-free AAV vectors being less likely to induce inflammatory and immune responses compared to plasmids; 2) while plasmids require the presence of resistance genes during the production process, the ssDNA molecules of the present disclosure do not require their presence; and 3) while circular plasmids are not delivered to the nucleus upon introduction into cells and require overloading to bypass degradation by cellular nucleases, ssDNA molecules contain viral cis-elements, i.e., ITRs, that confer resistance to nucleases and can be designed to be targeted and delivered to the nucleus. It is hypothesized that the minimal defining elements essential for ITR function are a Rep binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3' in AAV2) and a terminal resolution site (TRS; 5'-AGTTGG-3' in AAV2) plus a variable palindromic sequence that allows hairpin formation, and 4) the ssDNA molecule does not have an overrepresentation of CpG dinucleotides often found in prokaryotic-derived plasmids, which have been reported to bind members of the Toll-like family of receptors and elicit T cell-mediated immune responses.

[0250] D. Inverted Terminal Repeats (ITRs) As described herein, according to some aspects, the present disclosure provides ceDNA molecules comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure comprising a partial DNA duplex and at least one loop at the 3'-end. In some embodiments, the ceDNA molecule comprises at least one stem-loop structure comprising a partial DNA duplex and at least one loop at the 5'-end.

[0251] According to some embodiments, a ceDNA molecule comprises a transgene or heterologous nucleic acid sequence positioned between two inverted terminal repeat (ITR) sequences, which can be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as these terms are defined herein. The ceDNA molecules and dsDNA constructs disclosed herein can comprise ITR sequences selected from any of: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (ITR) (e.g., an asymmetrically modified ITR), (ii) two modified ITRs in which the mod-ITR pair have different three-dimensional spatial configurations relative to each other (e.g., an asymmetrically modified ITR), (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration, wherein the methods of the present disclosure may further comprise a delivery system, such as, but not limited to, a liposomal nanoparticle delivery system.

[0252] In some embodiments, the ITR sequences can be derived from viruses of the Parvoviridae family, which includes two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect insects. The Parvovirinae subfamily (called parvoviruses) includes the Dependovirus genus, whose members, under most conditions, require co-infection with a helper virus, such as an adenovirus or herpesvirus, for productive infection. The Dependovirus genus includes adeno-associated viruses (AAVs), which typically infect humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), as well as related viruses that infect other warm-blooded animals (e.g., bovine, canine, equine, and ovine adeno-associated viruses). Parvoviruses and other members of the family Parvoviridae are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996).

[0253] The ITRs exemplified herein and in the Examples herein are AAV2 WT-ITRs; however, as discussed above, one of skill in the art will recognize that ITRs from any known parvovirus, e.g., dependovirus, e.g., AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes, e.g., NCBI:NC002077, NC001401, NC001729, NC001829, NC006152, NC006260, NC006261), chimeric ITRs, or ITRs from any synthetic AAV can be used. In some embodiments, the AAV can infect warm-blooded animals, such as avian (AAAV), bovine (BAAV), canine, equine, and ovine adeno-associated viruses. In some embodiments, the ITRs are derived from B19 parvovirus (GenBank Accession No. NC000883), minute virus of mice (MVM) (GenBank Accession No. NC001510), goose parvovirus (GenBank Accession No. NC001701), or snake parvovirus 1 (GenBank Accession No. NC006148). In some embodiments, the 5'WT-ITR can be from one serotype and the 3'WT-ITR can be from a different serotype, as discussed herein.

[0254] Those skilled in the art recognize that ITR sequences share a common structure of a double-stranded Holliday junction, typically a T- or Y-shaped hairpin structure, formed by two palindromic arms or loops (B-B' and C-C') embedded in a larger palindromic arm (A-A') and a single-stranded D sequence (the order of these palindromic sequences defines the flip or flop configuration of the ITR). See, e.g., Grimm et al., J. Virology, 2006;80(1);426-439; Yan et al., J. Virology, 2005;364-379; Duan et al., Virology 1999;261;8-14, for structural analysis and sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6). Those skilled in the art can readily determine the WT-ITR sequence from any AAV serotype for use in ssDNA molecules and dsDNA constructs based on the exemplary AAV2 ITR sequences provided herein. See, for example, the sequence comparison of ITRs from different AAV serotypes (AAV1 through AAV6, as well as avian AAV (AAAV) and bovine AAV (BAAV)) described in Grimm et al., J. Virology, 2006;80(1);426-439, which shows the percent identity of the AAV2 3' ITR to the 3' ITRs from other serotypes: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%), AAV-6 (3' ITR) (100%), and AAV-6 (3' ITR) (82%).

[0255] According to some other embodiments, at least one of the first ITR oligonucleotide and the optional second ITR oligonucleotide comprising one or more phosphorothioate-modified nucleotides of the present invention can further comprise one or more functional moieties. In one embodiment, at least one functional moiety is an aptamer sequence, and optionally, the aptamer sequence has high binding affinity for a nuclear-localized protein. In another embodiment, at least one functional moiety is a nuclear-localization peptide conjugated to at least one of the ITR oligonucleotides. In another embodiment, at least one functional moiety is a fluorophore chemically conjugated to the ITR oligonucleotide.

[0256] E. Regulatory Elements The single-stranded DNA (ssDNA) molecules described herein can further comprise specific combinations of cis-regulatory elements. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, miR-regulatory elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers. In some embodiments, the single-stranded DNA (ssDNA) molecules described herein comprise additional components for regulating the expression of a transgene or nucleic acid of interest described herein, such as a regulatory switch, additional components for regulating the expression of a transgene or nucleic acid of interest, or a kill switch capable of killing cells containing the single-stranded DNA (ssDNA) molecules described herein. Regulatory elements, including regulatory switches, that can be used in the present disclosure are more fully discussed in International Patent Application PCT / US18 / 49996 (published as International Patent Publication No. 2019 / 051255A1), which is incorporated herein by reference in its entirety.

[0257] According to some embodiments, the second nucleic acid sequence comprises a regulatory sequence and a nucleic acid sequence encoding a nuclease. In certain embodiments, a gene regulatory sequence is operably linked to the nucleic acid sequence encoding the nuclease. In certain embodiments, the regulatory sequence is suitable for controlling expression of the nuclease in the host cell. In certain embodiments, the regulatory sequence comprises a suitable promoter sequence capable of directing transcription of a gene operably linked to the promoter sequence, such as a nucleic acid sequence encoding a nuclease of the present disclosure. In certain embodiments, the second nucleic acid sequence comprises an intron sequence linked to the 5' end of the nucleic acid sequence encoding the nuclease. In certain embodiments, an enhancer sequence is provided upstream of the promoter to increase the effectiveness of the promoter. In certain embodiments, the regulatory sequence comprises an enhancer and a promoter, and the second nucleic acid sequence comprises an intron sequence upstream of the nucleic acid sequence encoding the nuclease, the intron comprising one or more nuclease cleavage sites, and the promoter is operably linked to the nucleic acid sequence encoding the nuclease.

[0258] The single-stranded DNA (ssDNA) molecules described herein, and the dsDNA molecules produced using the synthetic processes described herein, can further comprise certain combinations of cis-regulatory elements, such as a WHP post-transcriptional regulatory element (WPRE) and a BGH polyA. Expression cassettes suitable for use in expression constructs are not limited by packaging constraints imposed by viral capsids.

[0259] (i) Promoter Those skilled in the art will understand that promoters used in the synthetically produced single-stranded DNA (ssDNA) molecules and dsDNA molecules of the present disclosure described herein should be adjusted as necessary for the specific sequences they are promoting. For example, a guide RNA may not require a promoter at all, as its function is to form a duplex with a specific target sequence on natural DNA to trigger a recombination event. In contrast, a nuclease encoded by a ssDNA molecule or dsDNA construct vector will benefit from a promoter so that it can be expressed efficiently from the vector, and optionally in a regulatable manner.

[0260] The expression cassettes of the present disclosure contain promoters that can influence overall expression levels and cell specificity. In the case of transgene expression, they can include highly active viral immediate-early promoters. The expression cassette can also contain tissue-specific eukaryotic promoters to restrict transgene expression to specific cell types and reduce toxic effects and immune responses resulting from unregulated ectopic expression. In a preferred embodiment, the expression cassette can contain synthetic regulatory elements such as the CAG promoter. The CAG promoter contains (i) a cytomegalovirus (CMV) early enhancer element, (ii) the promoter, first exon, and first intron of the chicken beta-actin gene, and (iii) the splice acceptor of the rabbit beta-globin gene. Alternatively, the expression cassette can contain the alpha-1-antitrypsin (AAT) promoter, the liver-specific (LP1) promoter, the human elongation factor-1 alpha (EF1a) promoter, or the human transthyretin (TTR) promoter. In some embodiments, the expression cassette comprises one or more constitutive promoters, such as the retroviral Rous Sarcoma Virus (RSV) LTR promoter (optionally with an RSV enhancer), or the cytomegalovirus (CMV) immediate early promoter (optionally with a CMV enhancer). Alternatively, an inducible promoter, the native promoter for the transgene, a tissue-specific promoter, or a variety of promoters known in the art can be used.

[0261] Suitable promoters, including those described above, can be derived from viruses and therefore can be referred to as viral promoters, or they can be derived from any organism, including prokaryotes or eukaryotes. Suitable promoters can be used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter, such as the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, the human U6 micronucleus promoter (U6) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), the enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep. 1; 31 (17)), the human H1 promoter (H1), the CAG promoter, the human alpha 1-antitypsin (HAAT) promoter, and the like. In certain embodiments, these promoters are modified at their downstream intron-containing ends to include one or more nuclease cleavage sites. In certain embodiments, the DNA containing the nuclease cleavage site is exogenous to the promoter DNA.

[0262] In one embodiment, the promoter used is the native promoter of the gene encoding the therapeutic protein. The promoter and other regulatory sequences of each gene encoding the therapeutic protein are known and characterized. The promoter region used may further comprise one or more additional regulatory sequences (e.g., native enhancers). Preferably, the gap is located 5' upstream of the promoter.

[0263] (ii) polyadenylation sequence Sequences encoding polyadenylation sequences can be included in synthetically produced vectors to stabilize mRNA expressed from single-stranded DNA (ssDNA) molecules (e.g., synthetic vectors, e.g., single-stranded (ss) synthetic vectors) and to aid in nuclear transport and translation. In one embodiment, a synthetically produced vector does not contain a polyadenylation sequence. In other embodiments, the vector contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, or more adenine dinucleotides. In some embodiments, the polyadenylation sequence contains about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range therebetween.

[0264] Expression cassettes can include polyadenylation sequences known in the art or variations thereof, such as naturally occurring sequences isolated from bovine BGHpA or viral SV40pA, or synthetic sequences. Some expression cassettes can also include an SV40 late polyA signal upstream enhancer (USE) sequence. In some embodiments, a USE sequence can be used in combination with SV40pA or a heterologous polyA signal.

[0265] The expression cassette can also include post-transcriptional elements to increase transgene expression. In some embodiments, the woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) is used to increase transgene expression. Other post-transcriptional processing elements can be used, such as the post-transcriptional elements derived from the thymidine kinase gene of herpes simplex virus or hepatitis B virus (HBV). A secretory sequence can be linked to the transgene, e.g., the VH-02 and VK-A26 sequences.

[0266] (iii) Nuclear localization sequence In some embodiments, the vector encoding the RNA-guided endonuclease contains one or more nuclear localization sequences (NLSs), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs. In some embodiments, the one or more NLSs are located at or near the amino terminus, at or near the carboxy terminus, or a combination thereof (e.g., one or more NLSs at the amino terminus and / or one or more NLSs at the carboxy terminus). When two or more NLSs are present, each can be selected independently of the others, such that a single NLS is present in two or more copies and / or in combination with one or more other NLSs present in one or more copies. Non-limiting examples of NLSs are shown in Table 3 below. [Table 3]

[0267] F. Additional Components The single-stranded DNA (ssDNA) molecules described herein, and the dsDNA molecules produced using the synthetic processes described herein, may contain nucleotides encoding other components for gene expression. For example, to select for specific gene targeting events, a protective shRNA may be embedded in a microRNA and inserted into a recombinant single-stranded DNA (ssDNA) molecule described herein designed for site-specific integration into a highly active locus, such as the albumin locus. Such an embodiment may provide a system for in vivo selection and expansion of genetically modified hepatocytes in any genetic background, such as that described in Nygaard et al., "A universal system to select gene-modified hepatocytes in vivo," Gene Therapy, June 8, 2016. The single-stranded DNA (ssDNA) molecules described herein of the present disclosure may contain one or more selectable markers that allow for the selection of transformed, transfected, transduced, or similar cells. A selectable marker is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, NeoR, etc. In certain embodiments, a positive selection marker is incorporated into the donor sequence, such as NeoR. A negative selection marker may be incorporated downstream of the donor sequence, for example, a nucleic acid sequence encoding the negative selection marker, HSV-tk, may be incorporated into the nucleic acid construct downstream of the donor sequence.

[0268] In embodiments, the single-stranded DNA (ssDNA) molecules described herein and dsDNA molecules produced using the synthesis processes described herein can be used for gene editing, as disclosed, for example, in International Patent Application PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. 2019 / 113310A1), which is incorporated herein by reference in its entirety, and may include one or more of a 5' homology arm, a 3' homology arm, and a polyadenylation site upstream of and adjacent to the homology arm. Exemplary homology arms are 5' and 3' albumin homology arms, or CCR5 5' homology arm and 3' homology arm.

[0269] G. Switch A molecular regulatory switch is one that generates a measurable change in state in response to a signal. Such regulatory switches can be usefully combined with the single-stranded DNA (ssDNA) molecules described herein and dsDNA molecules generated using the synthetic processes described herein to control the output of transgene expression from the single-stranded DNA (ssDNA) molecules described herein. In some embodiments, the single-stranded DNA (ssDNA) molecules described herein comprise a regulatory switch that functions to fine-tune transgene expression. For example, this can function as a biological containment function for the single-stranded DNA (ssDNA) molecules described herein. In some embodiments, the switch is an "on / off" switch designed to start or stop (i.e., shut off) expression of a gene of interest in the synthetic AAV in a controllable and tunable manner. In some embodiments, the switch can comprise a "kill switch" that, when activated, can instruct a cell containing a single-stranded DNA (ssDNA) molecule described herein to undergo programmed cellular death. Exemplary regulatory switches encompassed for use in the single-stranded DNA (ssDNA) molecules described herein can be used to regulate expression of a transgene and are more fully discussed in International Patent Application No. PCT / US18 / 49996 (published as International Patent Publication No. WO 2019 / 051255A1), which is incorporated herein by reference in its entirety.

[0270] (i) Binary Adjustment Switch In some embodiments, the single-stranded DNA (ssDNA) molecules described herein produced using the synthetic processes described herein contain a regulatory switch that can function to controllably regulate expression of a transgene. For example, an expression cassette located between the ITRs of a single-stranded DNA (ssDNA) molecule described herein may additionally include a regulatory region, such as a promoter, cis-element, repressor, enhancer, etc., operably linked to a gene of interest, where the regulatory region is regulated by one or more cofactors or exogenous factors. By way of example only, the regulatory region can be regulated by a small molecule switch or an inducible or repressible promoter. Non-limiting examples of inducible promoters are hormone-inducible promoters or metal-inducible promoters. Other exemplary inducible promoter / enhancer elements include, but are not limited to, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.

[0271] (ii) small molecule regulatory switches A variety of art-known small molecule-based regulatory switches are known in the art and can be combined with the synthetically generated single-stranded DNA (ssDNA) molecules disclosed herein to form regulatory switch-controlled single-stranded DNA (ssDNA) molecules described herein. In some embodiments, the regulatory switch comprises an artificial promoter controlling expression of an operably linked transgene, such as those disclosed in Taylor, et al. BMC Biotechnology 10 (2010): 15, plus an orthogonal ligand / nuclear receptor pair, e.g., retinoid receptor variants / LG335 and GRQCIMFI; engineered steroid receptors, e.g., a modified progesterone receptor with a C-terminal truncation that cannot bind progesterone but can bind RU486 (mifepristone) (U.S. Patent No. 5,364,791); the ecdysone receptor from Drosophila and its ecdysteroid ligands (Saez, et al., PNAS, 97(26) (2000), 14512-14517); or Sando R 3 rd or a switch controlled by the antibiotic trimethoprim (TMP) disclosed in Nat Methods. 2013, 10(11):1085-8. In some embodiments, the regulatory switch for controlling a transgene or a regulatory switch expressed by a single-stranded DNA (ssDNA) molecule (e.g., a synthetic vector, e.g., a single-stranded (ss) synthetic vector) is a prodrug activation switch, such as those disclosed in U.S. Patent Nos. 8,771,679 and 6,339,070.

[0272] (iii) "Passcode" adjustment switch In some embodiments, the regulatory switch can be a "passcode switch" or "passcode circuit." A passcode switch allows for fine-tuning of control of transgene expression from a synthetically generated single-stranded DNA (ssDNA) molecule described herein when specific conditions occur, i.e., a combination of conditions must be present for transgene expression and / or repression to occur. For example, at least condition A and condition B must occur for transgene expression to occur. A passcode regulatory switch can have any number of conditions present for transgene expression to occur, e.g., at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or more. In some embodiments, at least two conditions must occur (e.g., condition A, condition B), and in some embodiments, at least three conditions must occur (e.g., A, B, and C, or A, B, and D). By way of example only, conditions A, B, and C must be present for gene expression to occur from a synthetic AAV having a passcode "ABC" regulatory switch. Conditions A, B, and C can be as follows: Condition A is the presence of a condition or disease, Condition B is a hormonal response, and Condition C is a response to transgene expression. For example, if the transgene edits a defective EPO gene, Condition A is the presence of chronic kidney disease (CKD), Condition B occurs when the subject has hypoxia in the kidney, and Condition C occurs when erythropoietin-producing cell (EPC) recruitment in the kidney is impaired or HIF-2 activation is impaired. When oxygen levels increase or a desired level of EPO is reached, the transgene will be turned off and back on again until one of the three conditions occurs.

[0273] In some embodiments, passcode regulatory switches or "passcode circuits" included for use in the synthetically generated single-stranded DNA (ssDNA) molecules described herein include hybrid transcription factors (TFs) to expand the range and complexity of environmental signals used to define biocontainment conditions. In contrast to dead-man switches, which induce cell death in the presence of predetermined conditions, "passcode circuits" allow cell survival or transgene expression in the presence of specific "passcodes" and can be easily reprogrammed to allow transgene expression and / or cell survival only when the predetermined environmental conditions or passcodes are present.

[0274] Any and all combinations of the regulatory switches disclosed herein, e.g., small molecule switches, nucleic acid-based switches, small molecule-nucleic acid hybrid switches, post-transcriptional transgene regulatory switches, post-translational regulatory switches, radiation-controlled switches, hypoxia-mediated switches, and other regulatory switches disclosed herein and known to those of skill in the art, can be used in the passcode regulatory switches disclosed herein. Regulatory switches encompassed for use are also discussed in the review Kis et al., JR Soc Interface. 12:20141000 (2015) and summarized in Table 1 of Kis et al. In some embodiments, regulatory switches for use in the passcode system can be selected from any or combination of the switches in Table 4 below.

[0275] (iv) a nucleic acid-based regulatory switch for controlling transgene expression In some embodiments, the regulatory switches controlling transgenes expressed by synthetically generated single-stranded DNA (ssDNA) molecules described herein are based on nucleic acid-based regulatory mechanisms. Exemplary nucleic acid regulatory mechanisms are known in the art and are contemplated for use. For example, such mechanisms include riboswitches, such as those disclosed in US2009 / 0305253, US2008 / 0269258, US2017 / 0204477, WO2018026762A1, U.S. Patent No. 9,222,093, and European Patent Application No. 288071, and also in the review by Villa JK et al., Microbiol Spectr. 2018 May;6(3). Metabolite-responsive transcriptional biosensors, such as those disclosed in WO2018 / 075486 and WO2017 / 147585, are also included. Other mechanisms known in the art that are envisioned for use include silencing transgenes using siRNA or RNAi molecules (e.g., miR, shRNA). For example, the single-stranded DNA (ssDNA) molecules described herein can contain a regulatory switch that encodes an RNAi molecule complementary to the transgene expressed by the single-stranded DNA (ssDNA) molecules described herein. If such RNAi is expressed even when the transgene is expressed by the single-stranded DNA (ssDNA) molecules described herein, it will be silenced by the complementary RNAi molecule; if the RNAi is not expressed when the transgene is expressed by the single-stranded DNA (ssDNA) molecules described herein, the transgene will not be silenced by RNAi.

[0276] In some embodiments, the regulatory switch is a tissue-specific self-inactivating regulatory switch, e.g., as disclosed in US2002 / 0022018, whereby the regulatory switch purposefully switches off transgene expression at sites where transgene expression would otherwise be detrimental. In some embodiments, the regulatory switch is a recombinase reversible gene expression system, e.g., as disclosed in US2014 / 0127162 and U.S. Patent No. 8,324,436.

[0277] (v) Post-transcriptional and post-translational regulatory switches. In some embodiments, the regulatory switch for controlling the transgene or gene of interest expressed by the synthetically generated single-stranded DNA (ssDNA) molecules described herein is a post-transcriptional modification system. For example, such a regulatory switch can be a tetracycline- or theophylline-sensitive aptazyme riboswitch, as disclosed in US2018 / 0119156, GB201107768, WO2001 / 064956A3, EP2707487, and Beilstein et al., ACS Synth. Biol., 2015, 4(5), pp526-534; Zhong et al., Elife. 2016 Nov 2;5. Pii:e18858. In some embodiments, one skilled in the art can encode both the transgene and an inhibitory siRNA containing a ligand-sensitive (off-switch) aptamer, with the end result being a ligand-sensitive on-switch.

[0278] (vi) Other exemplary adjustment switches Any known regulatory switch can be used in synthetically generated ssDNA molecules to control gene expression of the transgene expressed by the single-stranded DNA (ssDNA) molecules described herein, including those triggered by environmental changes. Additional examples include, but are not limited to, the BOC method of Suzuki et al., Scientific Reports 8;10051 (2018); genetic code expansion and non-physiological amino acids; radiation- or ultrasound-controlled on / off switches (see, e.g., Scott S et al., Gene Ther. 2000 Jul;7(13):1121-5; U.S. Patent Nos. 5,612,318, 5,571,797, 5,770,581, 5,817,636, and WO1999 / 025385A1). In some embodiments, the regulatory switch is controlled by an implantable system, such as those disclosed in U.S. Pat. No. 7,840,263, US2007 / 0190028A1, in which gene expression is controlled by one or more forms of energy, including electromagnetic energy, that activate a promoter operably linked to a transgene in a single-stranded DNA (ssDNA) molecule as described herein.

[0279] In some embodiments, regulatory switches contemplated for use in the synthetically generated single-stranded DNA (ssDNA) molecules described herein are hypoxia-mediated or stress-activated switches, e.g., S368, as well as FROG, TOAD, and NRSE elements, such as those disclosed in WO1999060142A2, U.S. Pat. Nos. 5,834,306, 6,218,179, 6,709,858, US2015 / 0322410, Greco et al., (2004) Targeted Cancer Therapies 9, and conditionally inducible silence elements, including hypoxia response elements (HRE), inflammation response elements (IRE), and shear stress activated elements (SSAE), e.g., as disclosed in U.S. Pat. No. 9,394,526). Such embodiments are useful for turning on transgene expression from single-stranded DNA (ssDNA) molecules described herein following ischemia or in ischemic tissues and / or tumors.

[0280] (vii) Kill Switch Other embodiments of the present disclosure relate to synthetically produced single-stranded DNA (ssDNA) molecules described herein and dsDNA molecules comprising a kill switch. The kill switches disclosed herein allow cells containing the single-stranded DNA (ssDNA) molecules described herein to die or undergo programmed cell death as a means to permanently remove the introduced single-stranded DNA (ssDNA) molecules described herein from a subject's system. It will be understood by those skilled in the art that the use of kill switches in the synthetically produced single-stranded DNA (ssDNA) molecules described herein of this disclosure will typically be coupled with targeting the single-stranded DNA (ssDNA) molecules described herein to a limited number of cells that a subject can acceptably lose, or to a cell type (e.g., cancer cells) for which apoptosis is desired. In all aspects, the "kill switches" disclosed herein are designed to provide rapid and robust cell killing of cells containing the single-stranded DNA (ssDNA) molecules described herein in the absence of an input survival signal or other specific conditions. In other words, a kill switch encoded by a single-stranded DNA (ssDNA) molecule described herein can restrict cell survival of a cell containing the single-stranded DNA (ssDNA) molecule described herein to an environment defined by a particular input signal. Such a kill switch functions as a biological containment function when it is desirable to remove a synthetically produced single-stranded DNA (ssDNA) molecule described herein from a subject or when it is desirable to ensure that the encoded transgene is not expressed.

[0281] Thus, a kill switch is a synthetic biological circuit within an ssDNA molecule or dsDNA construct that couples an environmental signal to the conditional survival of a cell containing the ssDNA molecule or dsDNA construct. In some embodiments, different ssDNA molecules can be designed to have different kill switches.

[0282] In some embodiments, the single-stranded DNA (ssDNA) molecules described herein can include a kill switch, a modular biological containment circuit. In some embodiments, a kill switch incorporated for use in an ssDNA molecule or dsDNA construct is disclosed in WO 2017 / 059245, which describes a switch called a "deadman kill switch" that includes a mutually inhibitory arrangement of at least two repressible sequences such that an environmental signal suppresses the activity of a second molecule in the construct (e.g., using a small molecule-binding transcription factor to suppress toxin production, resulting in a "survival" state). In cells containing the single-stranded DNA (ssDNA) molecules described herein that include a deadman kill switch, upon loss of the environmental signal, the circuit permanently switches to a "dead" state, where the toxin is suppressed, resulting in toxin production that kills the cell. In another embodiment, a synthetic biological circuit called a "passcode circuit" or "passcode kill switch" is provided that uses hybrid transcription factors (TFs) to construct complex environmental requirements for cell survival. The deadman and passcode kill switches described in WO2017 / 059245 are particularly useful for use with single-stranded DNA (ssDNA) molecules described herein because they are modular and customizable, both in terms of the environmental conditions that control circuit activation and the output modules that control cell fate. By appropriate selection of toxins, including but not limited to endonucleases such as EcoRI, the passcode circuit present in the ssDNA molecule or dsDNA construct can be used not only to kill a host cell containing the ssDNA molecule or dsDNA construct, but also to degrade its genome and associated plasmid.

[0283] Other kill switches known to those of skill in the art, such as those disclosed in US2010 / 0175141, US2013 / 0009799, US2011 / 0172826, US2013 / 0109568, as well as those disclosed in Jusiak et al., Reviews in Cell Biology and molecular Medicine; 2014; 1-56, Kobayashi et al., PNAS, 2004; 101; 8419-9, Marchisio et al., Int. Journal of Biochem and Cell Biol., 2011; 43; 310-319, and Reinshagen et al., Science Translational Medicine, 2018, 11, are encompassed for use in the single-stranded DNA (ssDNA) molecules described herein.

[0284] Thus, in some embodiments, a single-stranded DNA (ssDNA) molecule described herein can comprise a kill-switch nucleic acid construct comprising a nucleic acid encoding an effector toxin or a reporter protein, wherein expression of the effector toxin (e.g., death protein) or reporter protein is controlled by a predetermined condition. For example, the predetermined condition can be the presence of an environmental factor, e.g., an exogenous factor, without which the cell will not express the effector toxin (e.g., death protein) and will die. In an alternative embodiment, the predetermined condition is the presence of two or more environmental factors, e.g., a cell will only survive when two or more necessary exogenous factors are provided, without which the cell containing the single-stranded DNA (ssDNA) molecule described herein will die.

[0285] In some embodiments, the single-stranded DNA (ssDNA) molecules described herein are modified to incorporate a kill switch for destroying cells containing the single-stranded DNA (ssDNA) molecules described herein, effectively terminating in vivo expression of a transgene expressed by the ssDNA molecule or dsDNA construct (e.g., a therapeutic gene, protein, or peptide). Specifically, the single-stranded DNA (ssDNA) molecules described herein are further engineered to express a switch protein that does not function in mammalian cells under normal physiological conditions. Only upon administration of a drug or environmental condition that specifically targets this switch protein are cells expressing the switch protein destroyed, thereby terminating expression of the therapeutic protein or peptide. For example, it has been reported that cells expressing HSV thymidine kinase can be killed upon administration of drugs such as ganciclovir and cytosine deaminase. See, e.g., Dey and Evans, "Suicide Gene Therapy by Herpes Simplex Virus-1 Thymidine Kinase (HSV-TK)," in "Targets in Gene Therapy," edited by You (2011), and Beltinger et al., "Proc. Natl. Acad. Sci. USA 96(15):8699-8704 (1999)." In some embodiments, the ssDNA molecule or dsDNA construct can contain an siRNA kill switch called DISE (Death Induced by Survival Gene Elimination) (Murmann et al., Oncotarget. 2017;8:84643-84658. Induction of DISE in ovarian cancer cells in vivo).

[0286] In some embodiments, a deadman kill switch is a biological circuit or system that sensitizes a cellular response to a predetermined condition, such as a factor in the cell's growth environment, e.g., the absence of an exogenous factor. Such a circuit or system can include a nucleic acid construct comprising an expression module that forms a deadman regulatory circuit sensitive to the predetermined condition, the construct comprising an expression module that forms a regulatory circuit, the construct comprising: a first repressor protein expression module, wherein the first repressor protein binds to the first repressor protein nucleic acid binding element and represses transcription from a coding sequence comprising the first repressor protein binding element, the repression activity of the first repressor protein being sensitive to inhibition by a first exogenous factor, the presence or absence of the first exogenous factor establishing the predetermined condition; ii) a second repressor protein expression module, wherein the second repressor protein binds to a second repressor protein nucleic acid binding element and represses transcription from a coding sequence comprising the second repressor protein binding element, and the second repressor protein is different from the first repressor protein; and iii) an effector expression module comprising a nucleic acid sequence encoding an effector protein and operably linked to a genetic element comprising a binding element for a second repressor protein, such that expression of the second repressor protein causes repression of effector expression from the effector expression module, the second expression module comprising a first repressor protein nucleic acid binding element that enables repression of transcription of the second repressor protein when the element is bound by the first repressor protein, each module forming a regulatory circuit whereby, in the absence of a first exogenous factor, the first repressor protein binds to the first repressor protein expression module. an effector expression module that is generated from a first exogenous factor and represses transcription from a second repressor protein expression module, thereby relieving repression of effector expression by the second repressor protein and resulting in expression of the effector protein; however, in the presence of a first exogenous factor, activity of the first repressor protein is inhibited, allowing expression of a second repressor protein that maintains expression of the effector protein expression in an "off" state, such that the first exogenous factor becomes required by the circuit to maintain effector protein expression in an "off" state; and

[0287] In some embodiments, the effector is a toxin or protein that induces a cell death program. Any protein toxic to host cells can be used. In some embodiments, the toxin kills only the cell in which it is expressed. In other embodiments, the toxin kills other cells in the same host organism. Any of a number of products that lead to cell death can be used in the dead-man kill switch. Agents that inhibit DNA replication, protein translation, or other processes, or agents that degrade host cell nucleic acids, for example, are particularly useful. To identify an efficient mechanism for killing host cells upon circuit activation, several toxin genes that directly damage host cell DNA or RNA were tested. The endonuclease ecoRI, the DNA zyrase inhibitor ccdB, and the ribonuclease-type toxin mazF were tested because they are well characterized, native to E. coli, and offer a broad killing mechanism. To increase circuit robustness and provide an independent method of circuit-dependent cell death, the system can be further adapted to express, for example, targeted proteases or nucleases that further interfere with repressors that maintain death genes in the "off" state. Upon loss or withdrawal of the survival signal, death gene repression is removed even more efficiently, for example, by active degradation of the repressor protein or its message. As a non-limiting example, mf-Lon protease was used to not only degrade LacI but also target proteins essential for degradation. The mf-Lon degradation tag pdt#1 can be attached to the 3' ends of five essential genes whose protein products are particularly sensitive to mf-Lon degradation, and cell viability was measured after removal of aTc. Of the essential gene targets tested, the peptidoglycan biosynthesis gene murC provided the strongest and fastest cell death phenotype (1 x 10 viability within 6 hours). -4 less than).

[0288] As used herein, the term "predetermined input" refers to a factor or condition that affects the activity of a transcription factor polypeptide in a known manner. Generally, such a factor can bind to and / or change the conformation of a transcription factor polypeptide, thereby modifying the activity of the transcription factor polypeptide. Examples of predetermined inputs include, but are not limited to, environmental input factors that are not required for the survival of a given host organism (i.e., in the absence of a synthetic biological circuit described herein). Conditions that can provide predetermined inputs include, for example, temperature, e.g., a temperature at which the activity of one or more factors is temperature-sensitive, the presence or absence of light, including light of a given wavelength spectrum, and concentrations of gases, salts, metals, or minerals. Environmental input factors include, for example, concentrations of small molecules, biological agents, e.g., pheromones, hormones, growth factors, metabolites, nutrients, etc., and their analogs, chemicals, environmental by-products, metal ions, and other such molecules or agents, light levels, temperature, mechanical stress or pressure, or electrical signals, e.g., current and voltage.

[0289] In some embodiments, reporters are used to quantify the strength or activity of signals received by modules or programmable synthetic biological circuits of the present disclosure. In some embodiments, reporters can be fused in-frame to other protein-coding sequences to identify where the proteins are located in a cell or organism. Luciferase can be used as an effector protein in various embodiments described herein, for example, to measure low levels of gene expression, because in the absence of luciferase, cells tend to have little or no background luminescence. In other embodiments, enzymes that produce colored substrates can be quantified using a spectrophotometer or other instrument capable of measuring absorbance, including a plate reader. Similar to luciferase, enzymes such as β-galactosidase tend to amplify low signals and can therefore be used to measure low levels of gene expression. In some embodiments, the effector protein can be an enzyme that can degrade or otherwise destroy a given toxin. In some embodiments, the effector protein can be an odorant enzyme that converts a substrate into an odorant product. In some embodiments, the effector protein can be an enzyme that phosphorylates or dephosphorylates either small molecules or other proteins, or that methylates or demethylates other proteins or DNA.

[0290] In some embodiments, the effector protein can be a receptor, ligand, or solubility protein. Receptors tend to have three domains: an extracellular domain for binding ligands such as proteins, peptides, or small molecules; a transmembrane domain; and an intracellular or cytoplasmic domain that may frequently be involved in some signaling event, such as phosphorylation. In some embodiments, transporter, channel, or pump gene sequences are used as effector proteins. Non-limiting examples and sequences of effector proteins for use in the kill switches described herein can be found on the World Wide Web at the Registry of Standard Biological Parts at parts.igem.org.

[0291] As used herein, a "modulator protein" is a protein that regulates expression from a target nucleic acid sequence. Modulator proteins include, for example, transcription factors, including transcription activators and repressors, as well as proteins that bind to or modify transcription factors to affect their activity. In some embodiments, modulator proteins include, for example, proteases that degrade protein factors involved in regulating expression from a target nucleic acid sequence. Preferred modulator proteins include, for example, modular proteins in which the DNA-binding and input factor binding or response elements or domains are separable and transportable, such that, for example, fusing the DNA-binding domain of a first modulator protein to the input factor response domain of a second modulator protein results in a new protein that binds to a DNA sequence recognized by the first protein but is sensitive to the input factor to which the second protein normally responds. Thus, as used herein, the terms "modulator polypeptide" and the more specific term "repressor polypeptide" include specific polypeptides, e.g., "Lacl (repressor) polypeptides," as well as variants or derivatives of polypeptides that respond to different or variant input factors. Thus, in the case of LacI polypeptides, LacI mutants or variants that bind agents other than lactose or IPTG are included. A wide range of such agents are known in the art.

[0292] Table 4: Exemplary regulatory switches. b "On" switchability by effector, other than removal of the effector imparting the off state. c "Off" switchability by effectors, other than removal of the effector that confers the on state. d A ligand or other physical stimulus (eg, temperature, electromagnetic radiation, electricity) that stabilizes the switch in either the "on" or "off" state. eRefers to the reference numbers cited in Kis et al., JR Soc Interface. 12:20141000 (2015) (both the literature and references cited therein are incorporated by reference in their entirety). [Table 4-1] [Table 4-2] [Table 4-3]

[0293] IV. Cell-Free Methods for Producing Single-Stranded DNA Molecules Traditional methods for producing viruses and virus-derived DNA typically use eukaryotic cells, such as mammalian or insect cells. One commonly used insect cell line is Sf9. However, not only do these cells contain both enzymes and other proteins that can adversely affect the replicated DNA, but the process of purifying the desired DNA from cell lysates can introduce cellular nucleic acids, the presence of which can make purification of the desired DNA product more difficult. Furthermore, such impurities or contaminants can have a variety of harmful and / or undesirable effects on the subject to whom the desired DNA is administered. In addition, such traditional cell-based production methods can have issues regarding the amount of DNA vector product produced, and it is not uncommon for significant manipulation of the cell line itself or the production technology to produce the desired yield.

[0294] The present disclosure relates to cell-free methods for producing single-stranded DNA molecules ("ssDNA," "SSD," all used interchangeably herein). The inventors of the present disclosure have surprisingly found that the cell-free methods disclosed herein can be applied to produce ssDNA molecules of a desired yield and quality. This specifically refers to the situation in which the cell-free methods of the present invention are compared to methods that rely on the use of cells to generate closed-end DNA molecules and methods that generate ssDNA molecules without a double-stranded ceDNA intermediate step. Certain methods for the generation of double-stranded ceDNA vectors containing various ITR configurations using cell-based methods are described in Example 1 of International Patent Application Publication Nos. 2019 / 051255 and 2019 / 113310, the contents of which are incorporated herein by reference in their entireties. Another significant advantage over cell-based production methods provided by the cell-free synthesis methods provided herein is that, in addition to higher yields, the methods described herein are easily scalable to small scale reactions (approximately 1 mL) and at least moderate sizes (greater than 40 mL), without compromising purity.

[0295] In some aspects, the present disclosure provides a method for generating a linear single-stranded DNA (ssDNA) molecule, the method comprising contacting a double-stranded, closed-end DNA (ceDNA) molecule with an endonuclease and subsequently contacting it with an exonuclease, thereby generating a linear ssDNA molecule (described herein in Section II). In some embodiments, the method further comprises, prior to the endonuclease contacting step, the following steps: a) performing rolling circle amplification (RCA) using the double-stranded DNA (dsDNA) molecule to generate an intermediate dsDNA product (described herein in Section III); and b) performing cell-free enzymatic synthesis using the intermediate dsDNA product to generate a ceDNA molecule. According to some embodiments, a further step of purifying the ceDNA molecule is performed prior to the endonuclease contacting step. In some embodiments, a further step of purifying the ssDNA molecule is performed after the ssDNA molecule is generated from the ceDNA (described herein). Each of the above steps is described in more detail in the following subsections.

[0296] According to some embodiments, the methods and / or production steps of the present disclosure are performed entirely in a cell-free environment. According to some embodiments, the methods and / or production steps of the present disclosure are performed partially in a cell-free environment. According to some embodiments, the ssDNA molecules are synthetically produced in vitro. According to some embodiments, the ssDNA molecules are synthetically produced in vitro in a cell-free environment.

[0297] A. Generation of single-stranded DNA from closed-end DNA (ceDNA) In some aspects, the present disclosure provides a method for generating a linear single-stranded DNA (ssDNA) molecule, comprising contacting a double-stranded closed-end DNA (ceDNA) molecule with an endonuclease and subsequently with an exonuclease, thereby generating the linear ssDNA molecule.

[0298] (i) Endonuclease step In some embodiments, the ceDNA molecule is contacted with an endonuclease.

[0299] According to some embodiments, the endonuclease is endonuclease V. Endonuclease V, often referred to as deoxyinosine 3' endonuclease, recognizes DNA containing deoxyinosine (paired or unpaired) on double-stranded DNA, single-stranded DNA with deoxyinosine, and to a lesser extent DNA containing abasic sites (ap) or ureas, base mismatches, insertion / deletion mismatches, hairpin or unpaired loops, flaps, and pseudo-Y structures. Endonuclease V cleaves the second phosphodiester bond 3' to the deoxyinosine mismatch (Yao, M. and Kow, YW (1995). J. Biol. Chem. 270, 28609-28616), leaving a nick at the 3'-hydroxyl and 5'-phosphate (He, B., Qing, H. and Kow, YW (2000). Mutat. Res. 459, 109-114).

[0300] In other embodiments, the endonuclease is Nb.BbvCI. In one embodiment, the endonuclease is Nb.BsmI. In one embodiment, the endonuclease is Nb.BsrDI. In one embodiment, the endonuclease is Nb.BssSI. In one embodiment, the endonuclease is Nb.BtsI. In one embodiment, the endonuclease is Nt.AlwI. In one embodiment, the endonuclease is Nt.BbvCI. In one embodiment, the endonuclease is Nt.BsmI. In one embodiment, the endonuclease is Nt.BspQI. In one embodiment, the endonuclease is Nt.BstNBI. In one embodiment, the endonuclease is Nt.CviPII. In one embodiment, the endonuclease is endonuclease V (Endo V).

[0301] According to further embodiments, the endonuclease has enzymatic activity towards uridine-containing residues, inosine-containing residues. In one embodiment, the endonuclease has enzymatic activity towards xanthosine-containing residues. In one embodiment, the endonuclease has enzymatic activity towards oxanosine-containing residues. In some embodiments, endonucleases having enzymatic activity towards uridine-containing residues, inosine-containing residues, xanthosine-containing residues, and / or oxanosine-containing residues can nick the modified DNA at the second phosphodiester bond 3' to the lesion.

[0302] According to some embodiments, the ceDNA comprises a nickase recognition sequence ("nick site") for an endonuclease. In one embodiment, the ceDNA comprises a terminal resolution site (trs) sequence of an AAV ITR that contains the nick site for the endonuclease. According to some embodiments, the ceDNA comprises one or more recognition nucleotide sequences for one or more nicking endonucleases, each independently selected from Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BssSI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BsmI, Nt.BspQI, Nt.BstNBI, Nt.CviPII, and an isoschizomer of any of the foregoing. According to further embodiments, the one or more recognition nucleotide sequences comprise any one or more of the following sequences shown in Table 5 below: [Table 5]

[0303] According to some embodiments, the one or more recognition nucleotide sequences are each engineered sequences. According to further embodiments, the one or more recognition nucleotide sequences each comprise one or more nick sites for one or more nicking endonucleases. According to some embodiments, the 3'-terminal portion of the double-stranded ceDNA molecule comprises a nickase recognition sequence. In one embodiment, the 3'-terminal portion of the ceDNA molecule comprises the sequence 5'-CCAA-3'. In some embodiments, the 3'-terminal portion of the ceDNA molecule comprises any one or more of the sequences shown in Table 6 below. Furthermore, because these are unique sequences after a double-stranded ceDNA having a specific engineered nick site shown in Table 6 is nicked by a nicking endonuclease, the resulting ssDNA molecule also comprises any one or more of the sequences shown in Table 6 below in its 3'-terminal fragment. [Table 6]

[0304] According to some embodiments, the one or more nick sites are about 0 to about 20 nucleotides downstream of the terminal resolution site (trs), e.g., about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides downstream of the terminal resolution site (trs), or, e.g., about 0 to about 15, about 0-10, about 0-5, about 5-15, about 10-20, about 15-20, about 10-20, or about 5-20 nucleotides downstream of the terminal resolution site (trs). According to some embodiments, only one nick site functions as an exonuclease entry site.

[0305] In some embodiments, a double-stranded ceDNA molecule can contain two or more nick sites. For example, a nick site can be located on the 5' sense strand of a nucleic acid sequence of interest. In another embodiment, a nick site can be located within the nucleic acid sequence of interest. In other embodiments, a double-stranded ceDNA molecule can contain multiple nick sites on the 3' and / or 5' side of a nucleic acid sequence of interest and / or within the nucleic acid sequence of interest. In some embodiments, a nick site is located adjacent to and / or upstream of a promoter and / or TSS.

[0306] According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for Nb.BbvCI or an isoschizomer thereof. According to some embodiments, the ceDNA construct comprises a single recognition nucleotide sequence for Nb.BbvCI or an isoschizomer thereof. According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for Nb.BtsI or an isoschizomer thereof. According to some embodiments, the ceDNA construct comprises a single recognition nucleotide sequence for Nb.BtsI or an isoschizomer thereof. According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for endonuclease V or an isoschizomer thereof.

[0307] In some embodiments, a further step of purifying the ceDNA molecule is performed before the step of contacting with the endonuclease. For example, if the ceDNA is produced using rolling circle amplification (described in Section IV(B) herein) and enzymatic synthesis (described in Section IV(C) herein), the ceDNA may be purified before the step of contacting with the endonuclease.

[0308] (ii) Exonuclease step In some embodiments, the ceDNA molecule is contacted with an exonuclease after contacting with the endonuclease. The exonuclease can remove nicked strands of the ceDNA construct beginning at one or more nick sites and ending at one or more phosphorothioate-modified nucleotides or another one or more nick sites. The exonuclease can be selected from, but not limited to, T7 exonuclease, lambda exonuclease, T5 exonuclease, exonuclease V, and exonuclease III.

[0309] In one embodiment, the exonuclease is T7 exonuclease. In one embodiment, the exonuclease is lambda exonuclease. In one embodiment, the exonuclease is T5 exonuclease. In one embodiment, the exonuclease is exonuclease V. In one embodiment, the exonuclease is exonuclease III.

[0310] As discussed more extensively in Section III(B) herein, double-stranded closed-end DNA may contain phosphorothioate (PS) linkages. PS linkages replace a sulfur atom with a non-bridging oxygen in the phosphate backbone of the oligonucleotide. Advantageously, this modification renders the internucleotide linkage resistant to nuclease degradation and provides precision for exonuclease targeting. More specifically, this modification is advantageously located in the ITR region within the exonuclease-active space and functions as a 5'- and / or 3'-end lock, rendering the internucleotide linkage resistant to nuclease degradation and ensuring precision of exonuclease activity.

[0311] According to some embodiments, in methods for producing single-stranded DNA (ss DNA) molecules, PS linkages substitute sulfur atoms for non-bridging oxygen atoms in the phosphate backbone of oligonucleotides. Advantageously, this modification stabilizes the nucleic acid and makes the internucleotide linkage resistant to nuclease degradation.

[0312] According to some embodiments, exonuclease progression can be terminated by including a structured region located on at least one strand of the double-stranded ceDNA molecule. In some embodiments, the structured region is a stem-loop structure. In some embodiments, the structured region is a bubble. In some embodiments, the structured region is a loop.

[0313] In some embodiments, the structured region is located near or adjacent to a stem-loop structure that becomes a 5' stem-loop structure in the ssDNA molecules generated by the methods disclosed herein.

[0314] In some embodiments, the structured region is a "whole-stalk" structure comprising two stem-loop structures on opposite strands of a double-stranded ceDNA molecule (see, e.g., Figure 16A). In some embodiments, the length of each stem in the whole-stalk structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 base pairs, or more. In some embodiments, the length of each loop in the whole-stalk structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 unpaired nucleotides, or more.

[0315] In some embodiments, the structured region is a half-stalk structure comprising one stem-loop structure on one strand of the double-stranded ceDNA molecule (see, e.g., Figure 16B). In some embodiments, the length of each stem within the half-stalk structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 base pairs, or more. In some embodiments, the length of each loop within the full-stalk structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 unpaired nucleotides, or more. In some embodiments, where the stem is at least 8 base pairs in length, the half-stalk structure may also be referred to herein as an "extended half-stalk" (see, e.g., Figure 16C).

[0316] In some embodiments, the structured region may be referred to as a "bubble" structure that includes two unpaired regions on opposing strands of a double-stranded ceDNA molecule flanking either side of the double-stranded DNA (see, e.g., Figures 16D and 16E). In some embodiments, the length of the unpaired nucleotides within the bubble structure is at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 base pairs, or more.

[0317] In some embodiments, the structured region may be referred to as a "loop" structure that includes a single unpaired region looping from one strand of the double-stranded ceDNA molecule adjacent to either side of the double-stranded DNA (see, e.g., Figure 16F). In some embodiments, the length of the unpaired nucleotides in the loop structure is at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 base pairs, or more.

[0318] According to some embodiments, the structured region used to terminate exonuclease progression remains in the ssDNA molecule after the exonuclease reaction is complete, hi some embodiments, the structured region can be removed by other enzymatic means.

[0319] B. Generation of dsDNA intermediates using rolling circle amplification (RCA) According to some embodiments, the method described in section IV(A) further includes, prior to the contacting with the endonuclease, a) performing rolling circle amplification (RCA) using a double-stranded DNA (dsDNA) molecule, e.g., a plasmid, to thereby generate a first intermediate molecule, e.g., an intermediate dsDNA molecule, e.g., a dsDNA molecule that is not a closed-ended DNA molecule, and subsequently b) performing cell-free enzymatic synthesis using the first intermediate dsDNA molecule, to thereby generate a second intermediate molecule, e.g., an intermediate ceDNA molecule.

[0320] In one embodiment, the first dsDNA intermediate is generated using rolling circle amplification (RCA) of a template, e.g., a plasmid template, to generate a first intermediate, e.g., a dsDNA intermediate. In one embodiment, the dsDNA intermediate is not closed-ended DNA. According to some embodiments, the RCA step comprises contacting a dsDNA molecule with a primer and a DNA polymerase.

[0321] The term "plasmid DNA" refers to a circular nucleic acid molecule, preferably an artificial nucleic acid molecule. Such a plasmid DNA construct can be a storage vector, an expression vector, a cloning vector, a transfer vector, etc. Preferably, a plasmid DNA within the meaning of the present invention comprises, in addition to the elements described herein, optionally a selection marker, such as an antibiotic resistance factor, and sequences suitable for propagation of the vector, such as an origin of replication. Typical plasmid backbones are, for example, pUC19 and pBR322.

[0322] RCA uses circular DNA (e.g., a plasmid) as a template and random hexamer primers that anneal to the circular template DNA at multiple sites. Therefore, sequence-specific primers are not required. The reaction requires two components: (a) a free 3' end and (b) a rolling circle polymerase. Typically, Phi29 DNA polymerase is used to extend each primer. Because the reaction is performed at 30°C, thermocycling (i.e., the use of different temperatures for different steps) is not required. When the DNA polymerase reaches the downstream extension primer, strand displacement synthesis occurs, rendering the displaced strand single-stranded and available for priming by more hexamer primers. This process continues, resulting in exponential isothermal amplification.

[0323] Several references disclose primers, primer design, and amplification techniques, including U.S. Patent Nos. 5,871,921, 5,648,245, 5,866,377, and 5,854,033, all of which are incorporated herein by reference. RCA is described, for example, in Dean et al. Genome Res. 2001 June; 11(6):1095-9) and Kumar and Chernaya (Biotechniques. 2009 July; 47(1):637-9), the contents of which are incorporated herein by reference in their entireties.

[0324] C. Formation of closed-end DNA from a double-stranded DNA intermediate As described herein, for example, a first intermediate dsDNA molecule generated using rolling circle amplification (described in Section IV(B)) is subjected to a further step of cell-free enzymatic synthesis to generate a second intermediate, for example, a double-stranded closed-end DNA (ceDNA) molecule.

[0325] A cell-free process for the production of double-stranded ceDNA is described in International Patent Application No. PCT / US2022 / 053868 (published as International Patent Publication No. 2023122303A3), the contents of which are incorporated herein by reference in their entirety.

[0326] An exemplary embodiment of a cell-free synthesis method for preparing a ceDNA vector is outlined in Figure 4 of International Patent Application PCT / US2022 / 053868 (published as International Patent Publication No. 2023122303A3). Briefly, a transgene expression cassette (hatched) is excised from a double-stranded DNA construct using at least one restriction endonuclease, and the insert is then ligated with inverted terminal repeat (ITR) oligonucleotides to form the ceDNA. ITR oligonucleotides are single-stranded oligonucleotides that self-anneal to form an ITR-like three-dimensional configuration. Restriction endonucleases used in the methods described herein, such as, but not necessarily limited to, Type IIS restriction endonucleases, cleave DNA at distinct sites rather than within the recognition site. These restriction endonucleases used in the cell-free synthesis methods disclosed herein recognize non-palindromic nucleotide sequences such that the recognition sequence (which is also the binding site) for the enzyme is encoded on only one strand (see, e.g., Figure 5 of International Patent Application PCT / US2022 / 053868, published as International Patent Publication No. 2023122303A3). Thus, cleavage by this class of restriction endonucleases is directional and occurs either upstream or downstream of the recognition site, but not within the recognition site itself, unlike other restriction endonucleases most frequently used in molecular biology, such as EcoRI (see Figure 5 of International Patent Application PCT / US2022 / 053868, published as International Patent Publication No. 2023122303A3). The strand encoding the recognition sequence determines which side of the sequence (i.e., downstream or upstream) is cleaved. In summary, the inherent activity of the restriction endonucleases used in the methods described herein allows any sequence within a predetermined distance from a specific recognition site to be cleaved by the restriction endonuclease, thereby generating any overhang sequence. Digestion with a particular restriction endonuclease creates sticky overhangs at both the 5' and 3' ends of the excised insert that match the overhangs of the ITR oligonucleotides.In other words, this design of the ITR oligonucleotides and insert overhangs increases the specificity of the ligation process, as the ITR oligonucleotide overhangs and the insert overhangs are compatible with each other. Once ligated, the desired ceDNA product is not susceptible to digestion by restriction endonucleases because the recognition site is not regenerated. However, in the situation where the excised insert and plasmid fragment are religated to the original construct, the recognition site is regenerated, thus allowing the construct to be cleaved.

[0327] In some embodiments, intermediate dsDNA molecules produced by digestion with a restriction endonuclease may be referred to herein as "cleaved dsDNA molecules" or "cleaved intermediate dsDNA molecules."

[0328] In some embodiments, a double-stranded closed-end DNA vector is generated by removing a transgene expression cassette from a double-stranded (ds) DNA (dsDNA) construct, followed by ligating the ends of the insert to a first oligonucleotide comprising one or more hairpin structures and a second oligonucleotide comprising one or more hairpin structures to form a ds ceDNA. In some embodiments, the oligonucleotides each independently comprise one, two, three, four, or more stem-loop regions. In some embodiments, the oligonucleotides each independently comprise two or three stem-loop regions. In some embodiments, the first oligonucleotide comprising one or more hairpin structures and the second oligonucleotide comprising one or more hairpin structures are each single-stranded oligonucleotides that self-anneal to form a three-dimensional configuration. In further embodiments, the three-dimensional configuration is a T-shaped or Y-shaped stem-loop structure.

[0329] In another aspect, dsDNA (e.g., ceDNA) is generated by removing a transgene expression cassette from a double-stranded DNA construct, followed by ligating the ends of the insert to ITR oligonucleotides to form ds ceDNA. Ligation can be accomplished by a ligase (e.g., T4 ligase) or AAV Rep proteins. In one embodiment, the reaction mixture is not purified prior to ligation. In such an embodiment, removal of the transgene expression cassette (e.g., by one or more restriction endonucleases) and ligation are performed simultaneously in a single reaction vessel. In an alternative embodiment, the reaction mixture is purified prior to ligation.

[0330] In one embodiment, the restriction endonuclease used in the synthetic methods provided herein is a Type IIS restriction endonuclease. Non-limiting examples of Type IIS restriction endonucleases include AcuI, AlwI, Alw26I, BasI, BbsI, BbvI, BceAI, BcgI, BCiVI, BcoDI, BruAI, BmrI, BpiI, BpuEI, BsaI, BsaXI, BseGI, BseRI, BsgI, BsmAI, BsmBI, BsmFI, BsmI, BspCNI, BspMI, BspQI, Bsr Examples of type IIS endonucleases include BsrI, BtgZI, BtsCI, BtsI, MutI, CspCI, EarI, EciI, Eco31I, Esp3I, FauI, FokI, HgaI, HphI, HpyAV, LguI, MboII, MlyI, MmeI, MnlI, Mva1269I, NmeAIII, PaqCI, PleI, SapI, SfaNI, and isoschizomers of any of the foregoing. Isoschizomers are pairs of restriction endonucleases specific for the same recognition sequence. For example, BcoDI and BsmAI are isoschizomers of each other, and both are specific for the recognition sequence 5'-GTCTC-3'. In one embodiment, the type IIS endonuclease is selected from BbsI, BsaI, Esp3I, and SapI, and isoschizomers thereof. In one embodiment, the Type IIS endonuclease is BbsI or an isoschizomer thereof. In one embodiment, the Type IIS endonuclease is BsaI or an isoschizomer thereof. In one embodiment, the Type IIS endonuclease is BbsI or an isoschizomer thereof. In one embodiment, the Type IIS endonuclease is Esp3I or an isoschizomer thereof. In one embodiment, the Type IIS endonuclease is SapI or an isoschizomer thereof.

[0331] D. Isolation and Purification The single-stranded DNA (ssDNA) molecules described herein have an advantage over other vectors in that they can be used to more safely express transgenes in cells, tissues, or subjects compared to DNA vectors produced in a cell culture environment (e.g., insect cell lines such as Sf9 cell lines, yeast cells, or mammalian cell lines such as HEK293). That is, producing linear vectors by such cell-free methods can minimize potentially undesirable side effects because the resulting vectors are free of bacterial or insect cell contaminants. This synthetic production method may also result in a higher purity of the desired vector. This synthetic production method may also be more efficient and / or cost-effective than traditional cell-based production methods for such vectors. Vectors synthesized as described herein can express any desired transgene, e.g., a transgene for treating or curing a given disease. Those skilled in the art will readily recognize that any transgene used in conventional gene therapy using conventional recombinant vectors can be adapted for expression by single-stranded DNA (ssDNA) molecules produced, for example, by the methods described herein, without particular limitations on the size capacity of the transgene insert.

[0332] It is understood that the production process of the present disclosure can potentially be carried out in a completely cell-free environment if desired. However, depending on the starting material, some DNA components can be obtained from nucleotide fragments originally prepared in cells (e.g., plasmid-ceDNA, AAV vectors produced from insect cells).

[0333] It will be understood by those skilled in the art that one or more enzymes or one or more oligonucleotide components for the present synthetic production methods can be produced from cells and used in the disclosed methods in purified form. Thus, in some embodiments, the present synthetic production methods are cell-free methods, but the restriction enzymes and / or ligase enzymes can be produced from cells.

[0334] In one embodiment, the restriction endonuclease and / or ligatable protein may be expressed or provided from an expression vector in a cell, e.g., a bacterial cell. In one embodiment, a cell, such as a bacterial cell, may be present that includes an expression vector expressing one or more of the restriction endonuclease or ligase enzymes. Thus, while the methods disclosed herein are primarily directed to cell-free synthetic methods for producing the ssDNA molecules disclosed herein, in some embodiments, synthetic production methods are also encompassed in which cells, e.g., bacterial cells, but not insect cells, are present and can be used to express one or more of the enzymes required for the method. In such embodiments, the cell expressing the restriction endonuclease and / or ligatable protein is not an insect cell. In all embodiments in which a cell is present and expresses one or more restriction endonuclease or ligatable proteins, the cell does not replicate single-stranded DNA (ssDNA) molecules. In other words, the intracellular machinery of the cell does not replicate or participate in the replication of single-stranded DNA (ssDNA) molecules.

[0335] Methods for producing and isolating single-stranded DNA (ssDNA) molecules are described herein. For example, the single-stranded DNA (ssDNA) molecules described herein, produced by the synthesis methods described herein, can be harvested or collected at the appropriate time and optimized to achieve high-yield production of vectors. The ssDNA molecules can be purified by any means known to those skilled in the art for purifying DNA. In one embodiment, the ssDNA molecules are purified as DNA molecules. Generally, any art-known nucleic acid purification method can be employed, as well as commercially available DNA extraction kits.

[0336] Purification can be carried out by subjecting the reaction mixture to chromatographic separation. As a non-limiting example, this process can be carried out by loading the reaction mixture onto an ion exchange column (e.g., SARTOBIND Q®) that retains nucleic acids, followed by elution (e.g., with a 1.2 M NaCl solution), and further chromatographic purification on a gel filtration column (e.g., 6 Fast Flow GE). The DNA vector is then recovered, for example, by precipitation.

[0337] The presence of ssDNA molecules can be confirmed by digesting the vector DNA with a restriction enzyme that has a single recognition site on the DNA vector, and analyzing both the digested and undigested DNA material using gel electrophoresis to confirm the presence of the characteristic band of linear, continuous DNA compared to linear, non-contiguous, single-stranded DNA known in the art.

[0338] In some embodiments, ssDNA molecules can be delivered to target cells in vitro or in vivo by various suitable methods discussed herein. The vector alone can be applied or injected. The vector can be delivered to cells without the aid of a transfection reagent or other physical means. Alternatively, the vector can be delivered using a transfection reagent or other physical means that facilitates DNA entry into cells, such as liposomes, alcohol, polylysine-rich compounds, arginine-rich compounds, calcium phosphate, microvesicles, or microinjection.

[0339] According to some aspects, the present disclosure provides linear single-stranded DNA (ssDNA) molecules comprising at least one nucleic acid sequence of interest adjacent to at least one stem-loop structure at the 3'-end, produced by the methods described herein. According to some embodiments, the ssDNA molecule further comprises at least one stem-loop structure at the 5'-end. According to further embodiments, the stem-loop structure at the 3'-end comprises a first inverted terminal repeat (ITR), and the stem-loop structure at the 5'-end comprises a second ITR. In some embodiments, the stem-loop structure at the 3'-end comprises one or more aptamers. In some other embodiments, the stem-loop structure at the 5'-end comprises one or more aptamers. In some other embodiments, the stem-loop structures at the 3'-end and 5'-end comprise one or more aptamers. In some other embodiments, the stem-loop structures at the 3'-end and 5'-end lack viral-derived sequences. In one embodiment, the stem-loop structures at the 3' and 5' ends do not contain a 20 nt long D(-) sequence or a D(-) sequence, or any transcription binding site.

[0340] V. Pharmaceutical Compositions In another aspect, a pharmaceutical composition is provided, comprising a single-stranded DNA (ssDNA) molecule described herein and a pharmaceutically acceptable carrier or diluent.

[0341] The single-stranded DNA (ssDNA) molecules described herein can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to the subject's cells, tissues, or organs. Typically, the pharmaceutical composition comprises the single-stranded DNA (ssDNA) molecules disclosed herein and a pharmaceutically acceptable carrier. For example, the single-stranded DNA (ssDNA) molecules can be incorporated into pharmaceutical compositions suitable for the desired route of therapeutic administration (e.g., parenteral administration). Passive tissue transduction via high-pressure intravenous or intra-arterial infusion, as well as intracellular injection, such as intranuclear microinjection or intracytoplasmic injection, are also contemplated. Pharmaceutical compositions for therapeutic purposes can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for the concentration of synthetically produced single-stranded DNA (ssDNA) molecules. Sterile injectable solutions can be prepared by incorporating the required amount of synthetically produced single-stranded DNA (ssDNA) molecules into an appropriate buffer containing one or a combination of the ingredients listed above, as needed, followed by filter sterilization containing the single-stranded DNA (ssDNA) molecules, and can deliver the transgene in the nucleic acid to recipient cells, resulting in therapeutic expression of the transgene or donor sequence in the cells. The compositions can also include a pharmaceutically acceptable carrier.

[0342] Pharmaceutically active compositions containing single-stranded DNA (ssDNA) molecules can be formulated to deliver transgenes to cells, eg, cells of a subject, for a variety of purposes.

[0343] Pharmaceutical compositions for therapeutic purposes must typically be sterile and stable under manufacturing and storage conditions.The pharmaceutical compositions can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high concentrations of synthetically produced single-stranded DNA (ssDNA) molecules.Sterile injectable solutions can be prepared by incorporating the required amount of synthetically produced single-stranded DNA (ssDNA) molecules described herein into an appropriate buffer solution containing one or a combination of the ingredients listed above, as needed, followed by filtration sterilization.

[0344] The single-stranded DNA (ssDNA) molecules described herein can be incorporated into pharmaceutical compositions suitable for local, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravascular, conjunctival (e.g., extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrainterstitial, intracameral, and intravitreal), intracochlear, and mucosal (e.g., oral, rectal, nasal) administration. Passive tissue transduction via high-pressure intravenous or intra-arterial infusion, as well as intracellular injections such as intranuclear microinjection or intracytoplasmic injection, are also contemplated.

[0345] In some aspects, the methods provided herein include delivering one or more single-stranded DNA (ssDNA) molecules described herein to a host cell. Cells produced by such methods, and organisms (e.g., animals, plants, or fungi) containing or produced from such cells, are also provided herein. Nucleic acid delivery methods can include lipofection, nucleofection, microinjection, biolistics, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, and drug-enhanced uptake of DNA. Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents (e.g., TRANSFECTAM™ and LIPOFECTIN™) are commercially available. Delivery can be to cells (e.g., in vitro or ex vivo administration) or to target tissues (e.g., in vivo administration).

[0346] Various techniques and methods for delivering nucleic acids to cells are known in the art.For example, the single-stranded DNA (ssDNA) molecules described herein can be formulated into lipid nanoparticles (LNPs), lipidoids, liposomes, lipid nanoparticles, lipoplexes, or core-shell nanoparticles.Typically, LNPs are composed of nucleic acid molecules (such as the ssDNA molecules described herein), one or more ionizable or cationic lipids (or their salts), one or more nonionic or neutral lipids (such as phospholipids), molecules that prevent aggregation (such as PEG or PEG-lipid conjugates), and optionally sterols (such as cholesterol).

[0347] Another method for delivering single-stranded DNA (ssDNA) molecules into cells is by conjugating the nucleic acid with a ligand that is internalized by the cell. For example, the ligand can bind to a receptor on the cell surface and be internalized via endocytosis. The ligand can be covalently linked to a nucleotide in the nucleic acid. Exemplary conjugates for delivering nucleic acids into cells are described in WO2015 / 006740, WO2014 / 025805, WO2012 / 037254, WO2009 / 082606, WO2009 / 073809, WO2009 / 018332, WO2006 / 112872, WO2004 / 090108, WO2004 / 091515 and WO2017 / 177326.

[0348] The single-stranded DNA (ssDNA) molecules described herein can also be delivered to cells by transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include TurboFect transfection reagent (Thermo Fisher Scientific), Pro-Ject reagent (Thermo Fisher Scientific), TRANSPASS™ P protein transfection reagent (New England Biolabs), CHARIOT™ protein delivery reagent (Active Motif), PROTEOJUICE™ protein transfection reagent (EMD Millipore), 293fectin, LIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific), LIPOFECTAMINE™ (Thermo Fisher Scientific), LIPOFECTIN™ (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific), OLIGOFECTAMINE™ (Thermo Fisher Scientific), and LIPOFECTAMINE™ (Thermo Fisher Scientific). Scientific), LIPOFECTACE(TM), FUGENE(TM)(Roche, Basel, Switzerland), FUGENE(TM) HD(Roche), TRANSFECTAM(TM)(Transfectam, Promega, Madison, Wis.), TFX-10(TM)(Pr omega), TFX-20(TM) (Promega), TFX-50(TM) (Promega), TRANSFECTIN(TM) (BioRad, Hercules, Calif.), SILENTFECT(TM) (Bio-Rad), Effectene(TM) (Qiagen, Valencia, Calif.).), DC-chol (Avanti Polar Lipids), GENEPORTER™ (Gene Therapy Systems, San Diego, Calif.), DHARMAFECT1™ (Dharmacon, Lafayette, Colo.), DHARMAFECT2™ (Dharmacon), DHARMAFECT3™ (Dharmacon), DHARMAFECT4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, Mo.), and ESCORT™ IV (Sigma Chemical Co.). Nucleic acids, such as ssDNA molecules or dsDNA constructs, can also be delivered to cells by microfluidic methods known to those skilled in the art.

[0349] Non-viral methods for in vivo or ex vivo delivery of nucleic acids include electroporation, lipofection (see U.S. Pat. Nos. 5,049,386 and 4,946,787, as well as commercially available reagents such as Transfectam™ and Lipofectin™), microinjection, biolistics, virosomes, liposomes (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res.52:4817-4820(1992); U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787), immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, and drug-enhanced uptake of DNA. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids.

[0350] The single-stranded DNA (ssDNA) molecules described herein can also be administered directly to an organism for in vivo cell transduction. Administration can be by any of the routes typically used to introduce molecules so that they ultimately contact blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and while more than one route can be used to administer a particular composition, certain routes can often provide a more immediate and effective response than other routes.

[0351] Single-stranded DNA (ssDNA) molecules can be delivered to hematopoietic stem cells by methods such as those described in US Pat. No. 5,928,638.

[0352] Delivery reagents such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present disclosure into suitable host cells. Specifically, nucleic acids encapsulated in any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, gold particles, etc. can be formulated for delivery. Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids disclosed herein.

[0353] The single-stranded DNA (ssDNA) molecules described herein can be delivered in vitro or in vivo using various delivery methods known in the art, or modifications thereof. For example, according to some embodiments, single-stranded DNA (ssDNA) molecules are delivered by transiently permeabilizing cell membranes with mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy, thereby facilitating DNA entry into targeted cells. For example, single-stranded DNA (ssDNA) molecules can be delivered by transiently disrupting cell membranes by squeezing cells through size-restricted channels or by other means known in the art. In some cases, single-stranded DNA (ssDNA) molecules alone are injected directly as naked DNA into skin, thymus, cardiac muscle, skeletal muscle, or liver cells. In some cases, single-stranded DNA (ssDNA) molecules are delivered by gene gun. Gold or tungsten spherical particles (1-3 μm in diameter) coated with capsid-free AAV vectors can be accelerated to high velocities by pressurized gas to penetrate into target tissue cells.

[0354] In some embodiments, electroporation is used to deliver closed-end DNA vectors containing single-stranded DNA (ssDNA) molecules. Electroporation causes temporary destabilization of the cell membrane of target cell tissue by inserting a pair of electrodes into the tissue, allowing DNA molecules in the medium surrounding the destabilized membrane to penetrate into the cell's cytoplasm and nucleoplasm. Electroporation has been used in vivo in many tissue types, including skin, lung, and muscle.

[0355] In some cases, single-stranded DNA (ssDNA) molecules are delivered by hydrodynamic injection, a simple and highly efficient method for the direct intracellular delivery of any water-soluble compound and particle to skeletal muscles throughout the viscera and limbs.

[0356] In some cases, single-stranded DNA (ssDNA) molecules are delivered by ultrasound by creating nanoscale pores in the membrane to facilitate intracellular delivery of DNA particles to cells of internal organs or tumors, so the size and concentration of plasmid DNA play a major role in the efficiency of the system. In some cases, single-stranded DNA (ssDNA) molecules are delivered by magnetoinfusion by using a magnetic field to concentrate nucleic acid-containing particles into target cells.

[0357] In some cases, chemical delivery systems can be used, for example, by using nanomer complexes comprising the compression of negatively charged nucleic acids with cationic liposomes / micelles or polycationic nanomer particles belonging to cationic polymers. Cationic lipids used for delivery methods include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derivative compounds, cationic polymers (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0358] Specifically contemplated herein are compositions comprising the single-stranded DNA (ssDNA) molecules described herein and a pharmaceutically acceptable carrier. According to some embodiments, the single-stranded DNA (ssDNA) molecules are formulated using a lipid delivery system, such as the liposomes described herein. According to some embodiments, such compositions are administered by any route desired by those skilled in the art. The compositions may be administered to a subject by different routes, including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, and intraarticularly, or a combination thereof. For veterinary use, the compositions may be administered in a suitably acceptable formulation in accordance with standard veterinary practice. A veterinarian can readily determine the most appropriate administration regimen and route for a particular animal. The compositions may be administered by traditional syringes, needle-free injection devices, "microprojectile bombardment gene guns," or other physical methods such as electroporation ("EP"), hydrodynamic methods, or ultrasound.

[0359] In some cases, single-stranded DNA (ssDNA) molecules are delivered by hydrodynamic injection, a simple and highly efficient method for the direct intracellular delivery of any water-soluble compound and particle to skeletal muscles throughout the viscera and limbs.

[0360] In some cases, single-stranded DNA (ssDNA) molecules are delivered by ultrasound by creating nanoscale pores in the membrane to facilitate intracellular delivery of DNA particles to cells of internal organs or tumors, so the size and concentration of the ssDNA molecules play a major role in the efficiency of the system. In some cases, single-stranded DNA (ssDNA) molecules are delivered by magnetoinfusion by using a magnetic field to concentrate nucleic acid-containing particles into target cells.

[0361] In some cases, chemical delivery systems can be used, for example, by using nanomer complexes comprising the compression of negatively charged nucleic acids with cationic liposomes / micelles or polycationic nanomer particles belonging to cationic polymers. Cationic lipids used for delivery methods include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derivative compounds, cationic polymers (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0362] A. Exosomes In some embodiments, the single-stranded DNA (ssDNA) molecules described herein are delivered by packaging them into exosomes. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after fusion of multivesicular bodies with the plasma membrane. Their surface consists of a lipid bilayer derived from the donor cell membrane, they contain cytosol derived from the cell that produced the exosome, and display membrane proteins derived from the parent cell on their surface. Exosomes are produced by various cell types, including epithelial cells, B and T lymphocytes, mast cells (MCs), and dendritic cells (DCs). In some embodiments, exosomes with diameters of 10 nm to 1 μm, 20 nm to 500 nm, 30 nm to 250 nm, or 50 nm to 100 nm are contemplated for use. Exosomes can be isolated for delivery to target cells using their donor cells or by introducing specific nucleic acids into them. Various approaches known in the art can be used to generate exosomes containing the capsid-free vectors of the present disclosure.

[0363] B. Microparticles / Nanoparticles In some embodiments, the present disclosure provides lipid nanoparticles comprising a DNA vector containing a single-stranded DNA (ssDNA) molecule described herein and an ionizable lipid. For example, lipid nanoparticle formulations prepared with and loaded with synthetic AAV obtained by the process disclosed in International Patent Application PCT / US2018 / 050042, filed September 7, 2018 (disclosed as International Patent Publication No. 2019 / 051289A1), which is incorporated herein. This can be achieved by high-energy mixing of ethanolic lipids with aqueous synthetic AAV at low pH, which protonates the ionizable lipids and provides favorable energy for synthetic AAV / lipid association and particle nucleation. The particles can be further stabilized by aqueous dilution and removal of the organic solvent. The particles can be concentrated to a desired level.

[0364] Typically, lipid particles are prepared with a total lipid to synthetic AAV (mass or weight) ratio of about 10:1 to 30:1. In some embodiments, the lipid to ssDNA molecule or dsDNA construct ratio (mass / mass ratio, weight / weight ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and synthetic AAV can be adjusted to provide a desired N / P ratio, e.g., an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, or higher. Generally, the overall lipid content of a lipid particle formulation can range from about 5 mg / mL to about 30 mg / mL.

[0365] An exemplary lipid nanoparticle (LNP) formulation encapsulating the ssDNA molecules described herein is shown in FIG.

[0366] Ionizable lipids are typically used to condense nucleic acid cargoes, such as ssDNA as described herein, at low pH and induce membrane association and membrane fusion.Generally, ionizable lipids are lipids that contain at least one amino group that is positively charged or becomes protonated under acidic conditions, for example, at pH 6.5 or less.Ionizable lipids are also referred to herein as cationic lipids.

[0367] Exemplary ionizable lipids are those disclosed in International PCT Patent Publication Nos. 2015 / 095340, 2015 / 199952, 2018 / 011633, 2017 / 049245, 2015 / 061467, 2012 / 040184, 2012 / 000104, 2015 / 074085, 2016 / 081029, 2017 / 004143, 2017 / 075531, 2017 / 117528, 2011 / 022460, 2013 / 148541, 2013 / 116126, No. 2011 / 153120, No. 2012 / 044638, No. 2012 / 054365, No. 2011 / 090965, No. 2 013 / 016058, 2012 / 162210, 2008 / 042973, 2010 / 129709, 2010 / 144740, 2012 / 099755, 2013 / 049328, 2013 / 086322, 2013 / 0 No. 86373, No. 2011 / 071860, No. 2009 / 132131, No. 2010 / 048536, No. 2010 / 0885 No. 37, No. 2010 / 054401, No. 2010 / 054406, No. 2010 / 054405, No. 2010 / 054384 No. 2012 / 016184, No. 2009 / 086558, No. 2010 / 042877, No. 2011 / 000106, Same No. 2011 / 000107, No. 2005 / 120152, No. 2011 / 141705, No. 2013 / 126803, No. 2006 / 007712, 2011 / 038160, 2005 / 121348, 2011 / 066651, 200 9 / 127060, 2011 / 141704, 2006 / 069782, 2012 / 031043, 2013 / 006825, 2013 / 033563, 2013 / 089151, 2017 / 099823, 2015 / 095346, and 2013 / 086354, and U.S. Patent Publication Nos. 2016 / 0311759, 2015 / 0376115, 2016 / 0151284, 2017 / 0210697, 2015 / 0140070, 2013 / 0178541,Same No. 2013 / 0303587, No. 2015 / 0141678, No. 2015 / 0239926, No. 2016 / 0376224, No. 2017 / 0119904, No. 2012 / 014989 No. 4, No. 2015 / 0057373, No. 2013 / 0090372, No. 2013 / 0274523, No. 2013 / 0274504, No. 2013 / 0274504, No. 2009 / 0023 No. 673, No. 2012 / 0128760, No. 2010 / 0324120, No. 2014 / 0200257, No. 2015 / 0203446, No. 2018 / 0005363, No. 2014 / 0 308304, 2013 / 0338210, 2012 / 0101148, 2012 / 0027796, 2012 / 0058144, 2013 / 0323269, 2011 / 0117125, 2011 / 0256175, 2012 / 0202871, 2011 / 0076335, 2006 / 0083780, 2013 / 0123338, 2 015 / 0064242, 2006 / 0051405, 2013 / 0065939, 2006 / 0008910, 2003 / 0022649, 2010 / 0130588, Nos. 2013 / 0116307, 2010 / 0062967, 2013 / 0202684, 2014 / 0141070, 2014 / 0255472, 2014 / 0039032, 2018 / 0028664, 2016 / 0317458, and 2013 / 0195920, the contents of all of which are incorporated herein by reference in their entireties.

[0368] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), having the following structure: [ka]

[0369] The lipid DLin-MC3-DMA is described in Jayaraman et al., Angew. Chem. Int. Ed Engl. (2012), 51(34):8529-8533, the contents of which are incorporated herein by reference in their entirety.

[0370] In some embodiments, the ionizable lipid is the lipid ATX-002, described in WO2015 / 074085, the contents of which are incorporated herein by reference in their entirety.

[0371] In some embodiments, the ionizable lipid is (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, as described in WO2012 / 040184, the contents of which are incorporated herein by reference in their entirety.

[0372] In some embodiments, the ionizable lipid is compound 6 or compound 22, as described in WO2015 / 199952, the contents of which are incorporated herein by reference in their entirety.

[0373] Without limitation, the ionizable lipids can comprise 20-90 mol% of the total lipids present in the lipid nanoparticles. For example, the ionizable lipid molar content can be 20-70 mol%, 30-60 mol%, or 40-50 mol% of the total lipids present in the lipid nanoparticles. In some embodiments, the ionizable lipids comprise about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles.

[0374] In some embodiments, the lipid nanoparticles can further comprise a non-cationic lipid. Non-ionic lipids include amphipathic lipids, neutral lipids, and anionic lipids. Thus, the non-cationic lipid can be a neutral uncharged lipid, a zwitterionic lipid, or an anionic lipid. Non-cationic lipids are typically used to enhance membrane fusion.

[0375] Exemplary non-cationic lipids contemplated for use in the methods and compositions comprising DNA vectors, including synthetic vectors produced using the synthetic processes described herein, are described in International Patent Application Nos. PCT / US2018 / 050042, filed September 7, 2018 (published as International Patent Publication No. 2019 / 051289A1), and PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. 2019 / 113310A1), each of which is incorporated herein in its entirety.

[0376] Exemplary non-cationic lipids are described in International Patent Application Publication No. 2017 / 099823 and U.S. Patent Application Publication No. 2018 / 0028664, the contents of both of which are incorporated herein by reference in their entireties.

[0377] The non-cationic lipids can comprise 0-30 mol% of the total lipids present in the lipid nanoparticles. For example, the non-cationic lipid content is 5-20 mol% or 10-15 mol% of the total lipids present in the lipid nanoparticles. In various embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 2:1 to about 8:1.

[0378] In some embodiments, the lipid nanoparticles do not contain any phospholipids. In some aspects, the lipid nanoparticles can further comprise components such as sterols to provide membrane integrity.

[0379] One exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Exemplary cholesterol derivatives are described in International Patent Application No. 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, the contents of both of which are incorporated herein by reference in their entirety.

[0380] Components that provide membrane integrity, such as sterols, can comprise 0-50 mol% of the total lipids present in the lipid nanoparticles. In some embodiments, such components comprise 20-50 mol%, 30-40 mol% of the total lipid content of the lipid nanoparticles.

[0381] In some aspects, the lipid nanoparticles can further comprise polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit aggregation and / or provide steric stabilization of the lipid nanoparticles. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, for example, a (methoxypolyethylene glycol)-conjugated lipid. Exemplary PEG-lipid conjugates include PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanoamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbamate, N-(carbonyl-methoxy Examples of PEG-lipid conjugates include, but are not limited to, polyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are described in, for example, US 5,885,613, US 6,287,591, US 2003 / 0077829, US 2003 / 0077829, US 2005 / 0175682, US 2008 / 0020058, US 2011 / 0117125, US 2010 / 0130588, US 2016 / 0376224, and US 2017 / 0119904, the contents of all of which are incorporated herein by reference in their entirety.

[0382] In some embodiments, the PEG-lipid is a compound disclosed in US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety.

[0383] In some embodiments, PEG-lipids are disclosed in US20150376115 or US2016 / 0376224, the contents of both of which are incorporated herein by reference in their entireties.

[0384] The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be, for example, PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol(1-[8'-(cholest-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some examples, the PEG-lipid can be selected from the group consisting of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0385] Lipids conjugated with molecules other than PEG can also be used instead of PEG-lipids.For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (CPL) conjugates can be used instead of or in addition to PEG-lipids.Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer lipids, are described in International Patent Application Publications Nos. 1996 / 010392, 1998 / 051278, 2002 / 087541, 2005 / 026372, and 2008 / 147438. No. 2009 / 086558, No. 2012 / 000104, No. 2017 / 117528, No. 2017 / 099823, No. 2015 / 199952, No. 2017 / 004143, No. 2015 / 095346, No. 2012 / 000104, No. 2012 / 000104, and No. 2010 / 006282 No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2013 / 0303587, U.S. Patent Application Publication No. 2018 / 0028664, U.S. Patent Application Publication No. 2015 / 0376115, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2016 / 0317458 , 2013 / 0303587, 2013 / 0303587, and 20110123453, and U.S. Patent Nos. 5,885,613, 6,287,591, 6,320,017, and 6,586,559, the contents of all of which are incorporated herein by reference in their entireties.

[0386] In some embodiments, the one or more additional compounds can be therapeutic agents. The therapeutic agent can be selected from any class suitable for the therapeutic purpose. In other words, the therapeutic agent can be selected according to the therapeutic purpose and the desired biological effect. For example, if the synthetic AAV in the LNPs is useful for treating cancer, the additional compound can be an anti-cancer agent (e.g., a chemotherapeutic agent, a targeted cancer therapy (including, but not limited to, a small molecule, an antibody, or an antibody-drug conjugate)). In another example, if the LNPs comprising the synthetic AAV are useful for treating an infectious disease, the additional compound can be an anti-bacterial agent (e.g., an antibiotic or an antiviral compound). In yet another example, if the LNPs comprising the synthetic AAV are useful for treating an immune disease or disorder, the additional compound can be a compound that modulates the immune response (e.g., an immunosuppressant, an immunostimulatory compound, or a compound that modulates one or more specific immune pathways). In some embodiments, different cocktails of different lipid nanoparticles containing different compounds, such as synthetic AAVs encoding different proteins, or different compounds, such as therapeutic agents, can be used in the compositions and methods of the present disclosure.

[0387] In some embodiments, the additional compound is an immunomodulatory agent, e.g., the additional compound is an immunosuppressant, hi some embodiments, the additional compound is an immunostimulatory agent.

[0388] Also provided herein are pharmaceutical compositions comprising synthetically produced single-stranded DNA (ssDNA) molecules encapsulated in lipid nanoparticles described herein and a pharmaceutically acceptable carrier or excipient.

[0389] In some aspects, the present disclosure provides lipid nanoparticle formulations further comprising one or more pharmaceutical excipients, hi some embodiments, the lipid nanoparticle formulation further comprises sucrose, Tris, trehalose, and / or glycine.

[0390] The single-stranded DNA (ssDNA) molecules described herein can be complexed with the lipid portion of the particle or encapsulated in the lipid portion of the lipid nanoparticle. In some embodiments, the DNA vector containing the single-stranded DNA (ssDNA) molecule can be completely encapsulated in the lipid portion of the lipid nanoparticle, thereby protecting it from degradation by nucleases, for example, in aqueous solution. In some embodiments, the DNA vector containing the single-stranded DNA (ssDNA) molecule in the lipid nanoparticle is not substantially degraded after exposing the lipid nanoparticle to nucleases at 37°C for at least about 20, 30, 45, or 60 minutes. In some embodiments, the synthetic AAV in the lipid nanoparticle is not substantially degraded after incubating the particle in serum at 37°C for at least about 30, 45, or 60 minutes, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.

[0391] In certain embodiments, the lipid nanoparticles are substantially non-toxic to a subject, e.g., a mammal, such as a human. In some aspects, the lipid nanoparticle formulation is a lyophilized powder.

[0392] In some embodiments, lipid nanoparticles are solid core particles having at least one lipid bilayer. In other embodiments, lipid nanoparticles have a non-bilayer structure, i.e., a non-lamellar (i.e., non-bilayer) morphology. Non-bilayer morphologies can include, but are not limited to, three-dimensional tubes, rods, cubic symmetries, etc. For example, the morphology (lamellar vs. non-lamellar) of lipid nanoparticles can be readily assessed and characterized using cryo-TEM analysis, for example, as described in US2010 / 0130588, the contents of which are incorporated herein by reference in their entirety.

[0393] In some further embodiments, lipid nanoparticles having a non-lamellar morphology are electron dense. In some aspects, the present disclosure provides lipid nanoparticles that are either unilamellar or multilamellar. In some aspects, the present disclosure provides lipid nanoparticle formulations comprising multivesicular particles and / or bubble-based particles.

[0394] By controlling the composition and concentration of lipid components, it is possible to control the rate at which lipid conjugates are exchanged from lipid particles, and then the rate at which lipid nanoparticles become fusogenic.In addition, other variables, including, for example, pH, temperature, or ionic strength, can be used to vary and / or control the rate at which lipid nanoparticles become fusogenic.Other methods that can be used to control the rate at which lipid nanoparticles become fusogenic will be clear to those skilled in the art based on this disclosure.It will also be clear that by controlling the composition and concentration of lipid conjugates, it is possible to control the size of lipid particles.

[0395] The pKa of formulated cationic lipids can correlate with the effectiveness of LNPs for delivery of nucleic acids (see Jayaraman et al., Angewandte Chemie, International Edition (2012), 51(34), 8529-8533; Semple et al., Nature Biotechnology 28, 172-176 (2010), both of which are incorporated herein by reference in their entireties). A preferred range of pKa is about 5 to about 7. The pKa of cationic lipids can be determined in lipid nanoparticles using an assay based on the fluorescence of 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS). Generally, lipid nanoparticles comprise an ionizable amino lipid (e.g., heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, DLin-MC3-DMA, phosphatidylcholine (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol, and a coating lipid (polyethylene glycol-dimyristolglycerol, PEG-DMG) (e.g., as disclosed in Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3):498-507).

[0396] In some embodiments, the lipid nanoparticles have an average diameter of about 10 to about 1000 nm. In some embodiments, the lipid nanoparticles have a diameter of less than 300 nm. In some embodiments, the lipid nanoparticles have a diameter of about 10 to about 300 nm. In some embodiments, the lipid nanoparticles have a diameter of less than 200 nm. In some embodiments, the lipid nanoparticles have a diameter of about 25 to about 200 nm. In some embodiments, the lipid nanoparticle preparation (e.g., a composition comprising a plurality of lipid nanoparticles) has a size distribution with an average size (e.g., diameter) of about 40 nm to about 200 nm, more typically with an average size of about 100 nm or less (e.g., diameters of 100 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm, and 45 nm).

[0397] Various lipid nanoparticles known in the art can be used to deliver single-stranded DNA (ssDNA) molecules.For example, various delivery methods using lipid nanoparticles are described in US Patent No. 9,404,127, US Patent No. 9,006,417 and US Patent No. 9,518,272.

[0398] In some embodiments, single-stranded DNA (ssDNA) molecules are delivered by gold nanoparticles. Generally, nucleic acids can be covalently bound to gold nanoparticles or non-covalently bound to gold nanoparticles (e.g., by charge-charge interactions) (e.g., as described in Ding et al. (2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 22(6); 1075-1083). In some embodiments, gold nanoparticle-nucleic acid conjugates are produced using methods such as those described in U.S. Pat. No. 6,812,334.

[0399] In some embodiments, the ssDNA molecules described herein can be easily formulated into highly concentrated chitosan-nucleic acid polyplex compositions and orally administered in DNA enteric-coated pills as described in U.S. Patent Nos. 8,846,102, 9,404,088, and 9,850,323, each of which is incorporated herein in its entirety. In some embodiments, the lipid nanoparticles described herein are conjugated (e.g., covalently attached to an agent that increases cellular uptake). An "agent that increases cellular uptake" is a molecule that facilitates the transport of nucleic acids or lipid nanoparticles across lipid membranes. For example, lipid nanoparticles can be conjugated to a cell-penetrating peptide (CPP) (e.g., penetratin, TAT, Syn1B, etc.) and / or a polyamine (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv. 4(7); 791-809.

[0400] In some embodiments, the lipid nanoparticles described herein are conjugated to a polymer (e.g., a polymer molecule) or a folate molecule (e.g., a folic acid molecule). In general, delivery of polymer-conjugated nucleic acids, lipids, and nanoparticles is known in the art and described, for example, in WO 2000 / 34343 and WO 2008 / 022309. In some embodiments, the lipid and / or lipid nanoparticles are conjugated to a poly(amide) polymer, as described, for example, in U.S. Pat. No. 8,987,377. In some embodiments, the lipid and / or lipid nanoparticles described by the present disclosure are conjugated to a folic acid molecule, as described in U.S. Pat. No. 8,507,455.

[0401] In some embodiments, the lipids and / or lipid nanoparticles are conjugated to carbohydrates, for example, as described in U.S. Patent No. 8,450,467. In some embodiments, the lipids and / or lipid nanoparticles are conjugated to GalNAc. In some embodiments, the lipids and / or lipid nanoparticles are conjugated to antibodies, for example, single-chain antibodies such as scFv.

[0402] C. Nanocapsules Alternatively, nanocapsule formulations of single-stranded DNA (ssDNA) molecules as described herein can be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0403] D. Liposomes The single-stranded DNA (ssDNA) molecules described herein can be loaded into liposomes for delivery to cells or target organs in a subject. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of pharmaceutical development. They function by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of phospholipids, particularly compounds with phosphatidylcholine groups, although these compositions can also contain other lipids.

[0404] The formation and use of liposomes are generally known to those skilled in the art. Liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for preparing liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434, 5,552,157, 5,565,213, 5,738,868, and 5,795,587).

[0405] The single-stranded DNA (ssDNA) molecules described herein can be added to liposomes and delivered to cells, such as cells requiring transgene expression. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of pharmaceutical development. They function by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of phospholipids, particularly compounds with phosphatidylcholine groups, although these compositions can also contain other lipids.

[0406] In some embodiments, the present disclosure provides liposomal formulations containing one or more compounds bearing polyethylene glycol (PEG) functional groups (so-called "PEGylated compounds"), which can reduce the immunogenicity / antigenicity of the compounds, provide hydrophilic and hydrophobic properties to the compounds, and reduce dosing frequency. Alternatively, the liposomal formulations simply contain polyethylene glycol (PEG) polymers as additional components. In such embodiments, the molecular weight of the PEG or PEG functional group can be between 62 Da and about 5,000 Da.

[0407] In some aspects, the present disclosure provides liposomal formulations that deliver APIs with sustained- or controlled-release profiles over a period of hours to weeks. In some related aspects, the liposomal formulations can include aqueous chambers bounded by a lipid bilayer. In other related aspects, the liposomal formulations encapsulate APIs with components that undergo a physical transition at elevated temperatures, releasing the API over a period of hours to weeks.

[0408] In some embodiments, the liposomal formulation comprises sphingomyelin and one or more lipids disclosed herein. In some embodiments, the liposomal formulation comprises an Optisome.

[0409] In some aspects, the present disclosure provides lipids such as N-(carbonylmethoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn-glycero-phosphoethanolamine), MPEG (methoxypolyethylene glycol) conjugated lipids, HSPC (hydrogenated soy phosphatidylcholine), PEG (polyethylene glycol), DSPE (distearoyl-sn-glycero-phosphoethanolamine), DSPC (distearoylphosphatidylcholine), DOPC (dioleoylphosphatidylcholine), DPPG (dipalmitoylphosphatidylglycerol), EPC (egg phosphatidylcholine), DOPS (dioleoyl The present invention provides a liposome formulation comprising one or more lipids selected from dioleoylphosphatidylserine (DPPG), POPC (palmitoyloleoylphosphatidylcholine), SM (sphingomyelin), MPEG (methoxypolyethylene glycol), DMPC (dimyristoylphosphatidylcholine), DMPG (dimyristoylphosphatidylglycerol), DSPG (distearoylphosphatidylglycerol), DEPC (dierucoylphosphatidylcholine), DOPE (dioleoyl-sn-glycero-phosphoethanolamine), cholesteryl sulfate (CS), dipalmitoylphosphatidylglycerol (DPPG), DOPC (dioleoyl-sn-glycero-phosphatidylcholine), or a combination thereof.

[0410] In some embodiments, the present disclosure provides a liposome formulation comprising a phospholipid, cholesterol, and a PEGylated lipid in a molar ratio of 56:38:5. In some embodiments, the overall lipid content of the liposome formulation is 2-16 mg / mL. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid comprising a phosphatidylcholine functional group, a lipid comprising an ethanolamine functional group, and a PEGylated lipid. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid comprising a phosphatidylcholine functional group, a lipid comprising an ethanolamine functional group, and a PEGylated lipid in a molar ratio of 3:0.015:2, respectively. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid comprising a phosphatidylcholine functional group, cholesterol, and a PEGylated lipid. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid comprising a phosphatidylcholine functional group and cholesterol. In some embodiments, the PEGylated lipid is PEG-2000-DSPE. In some aspects, the present disclosure provides a liposome formulation comprising DPPG, soy PC, an MPEG-DSPE lipid conjugate, and cholesterol.

[0411] In some embodiments, the present disclosure provides liposome formulations comprising one or more lipids comprising a phosphatidylcholine functional group and one or more lipids comprising an ethanolamine functional group. In some embodiments, the present disclosure provides liposome formulations comprising one or more of a lipid comprising a phosphatidylcholine functional group, a lipid comprising an ethanolamine functional group, and a sterol, such as cholesterol. In some embodiments, the liposome formulation comprises DOPC / DEPC and DOPE.

[0412] In some aspects, the present disclosure provides liposome formulations further comprising one or more pharmaceutical excipients, for example, sucrose and / or glycine.

[0413] In some embodiments, the present disclosure provides liposomal formulations that are either unilamellar or multilamellar. In some embodiments, the present disclosure provides liposomal formulations that include multivesicular particles and / or bubble-based particles. In some embodiments, the present disclosure provides liposomal formulations that are larger than the relative size of common nanoparticles and are approximately 150-250 nm in size. In some embodiments, the liposomal formulation is a lyophilized...

Claims

1. 1. A method for generating linear single-stranded DNA (ssDNA) molecules comprising at least one nucleic acid sequence of interest flanked at its 3′ end by at least one stem-loop structure comprising at least one stem and at least one loop, said method comprising: (a) contacting a double-stranded, closed-end DNA (ceDNA) molecule containing the at least one nucleic acid sequence of interest with an endonuclease; (b) contacting the double-stranded ceDNA with an exonuclease; thereby producing said linear ssDNA molecule.

2. The method of claim 1 , wherein the ceDNA molecule further comprises at least one promoter.

3. The method of claim 2 , wherein the promoter comprises a transcription start site (TSS).

4. The method of any one of claims 1 to 3, wherein the ceDNA molecule further comprises at least one enhancer.

5. The method of any one of claims 2 to 4, wherein the promoter is double-stranded in the ssDNA molecule.

6. The method of any one of claims 3 to 5, wherein the TSS is double-stranded in the ssDNA molecule.

7. The method of any one of claims 4 to 6, wherein the enhancer is double-stranded in the ssDNA molecule.

8. The method of any one of claims 1 to 7, wherein the ssDNA molecule further comprises at least one stem-loop structure comprising at least one stem and one loop at the 5' end.

9. The method according to any one of claims 1 to 8, wherein the at least one stem-loop structure at the 3'-end comprises at least two stem-loop structures and / or the at least one stem-loop structure at the 5'-end comprises at least two stem-loop structures.

10. The method of any one of claims 1 to 9, wherein the ceDNA molecule comprises one or more endonuclease recognition sequences.

11. The method according to any one of claims 1 to 10, wherein the stem-loop structure at the 3' end comprises one or more endonuclease recognition sequences.

12. The method according to any one of claims 8 to 11, wherein the stem-loop structure at the 5' end comprises one or more endonuclease recognition sequences.

13. The one or more endonuclease recognition sequences may be 5'-CCAA-3' (Nb.BtsI) (Nb.BsrDI) (Nt.CviPII), 5'-CCAAGC-3' (Nb.BbvCI), 5'-CCAACC-3' (Nb.BbvCI), 5'-CCAAGAGTCNNNN-3' (Nt.BstNBI-N can be A, G, C, or T). 5'-CCAAG-3' (Nb.BsmI), 5'-CCAAC-3' (Nb.BssSI), 5'-CCAAGGATCNNNN-3' (Nt.AlwI), CCAAGTCTCN-3' (Nt.BsmAI), and CCAAGCTCTTCN-3' (Nt.BspQI).

14. The method according to any one of claims 1 to 13, wherein the terminal residue of the stem-loop structure at the 3' end is capable of priming replication and / or transcription in the nucleus of a host cell.

15. The method of claim 14, wherein the 3' terminal residue comprises a free -OH.

16. 16. The method of any one of claims 1 to 15, wherein contacting the double-stranded ceDNA molecule with the endonuclease creates one or more nicks in the sense strand of the nucleic acid sequence of interest, thereby creating a nicked ceDNA molecule.

17. 17. The method of claim 16, wherein the one or more nicks in the sense strand of the target nucleic acid sequence are located 5' upstream of the target nucleic acid sequence, within the target nucleic acid sequence, and / or 3' upstream of the target nucleic acid sequence.

18. 18. The method of claim 16 or 17, wherein the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest.

19. The method of any one of claims 16 to 18, wherein the one or more nicks in the sense strand of the target nucleic acid sequence are located 3' downstream of the target nucleic acid sequence.

20. 20. The method of any one of claims 16 to 19, wherein the one or more nicks in the sense strand of the nucleic acid sequence of interest are located within the nucleic acid sequence of interest.

21. The method of any one of claims 1 to 20, wherein the sense strand further comprises at least one phosphorothioate (PS) modified nucleotide downstream of the expression cassette.

22. The method of any one of claims 1 to 21, wherein the sense strand further comprises at least two PS-modified nucleotides downstream of the expression cassette.

23. The method of any one of claims 1 to 22, wherein the sense strand further comprises at least three PS-modified nucleotides downstream of the expression cassette.

24. The method of any one of claims 1 to 23, wherein the sense strand further comprises at least four PS-modified nucleotides downstream of the expression cassette.

25. The method of any one of claims 1 to 24, wherein the sense strand further comprises at least five PS-modified nucleotides downstream of the expression cassette.

26. 26. The method of any one of claims 1 to 25, wherein the sense strand further comprises at least one phosphorothioate (PS) modified nucleotide upstream of the expression cassette.

27. 27. The method of any one of claims 1 to 26, wherein the sense strand further comprises at least two PS-modified nucleotides upstream of the expression cassette.

28. 28. The method of any one of claims 1 to 27, wherein the sense strand further comprises at least three PS-modified nucleotides upstream of the expression cassette.

29. 29. The method of any one of claims 1 to 28, wherein the sense strand further comprises at least four PS-modified nucleotides upstream of the expression cassette.

30. 30. The method of any one of claims 1 to 29, wherein the sense strand further comprises at least five PS-modified nucleotides upstream of the expression cassette.

31. 31. The method of any one of claims 1 to 30, wherein contacting the nicked ceDNA molecule with an exonuclease generates a stretch of single-stranded DNA (ssDNA) corresponding to the nucleic acid sequence of interest in the double-stranded ceDNA molecule.

32. The method of any one of claims 1 to 31, wherein the endonuclease is a type II restriction enzyme.

33. 33. The method of any one of claims 1 to 32, wherein the endonuclease is selected from the group consisting of Nb.BtsI, Nb.BsrDI, Nt.CviPII, Nb.BbvC1, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, Nb.BssSI, Nt.AlwI, Nt.BsmA1, Nt.BspQI, and endonuclease V (Endo V).

34. 34. The method of claim 32 or 33, wherein the type II restriction enzyme is Nb.BbvCI.

35. 34. The method of claim 32 or 33, wherein the endonuclease is Endo V.

36. 36. The method of any one of claims 1 to 35, wherein the double-stranded ceDNA molecule comprises at least one deoxyinosine residue.

37. 37. The method of claim 36, wherein the deoxyinosine residue is present in the at least one stem-loop structure at the 3' end, two bases upstream of the desired nick site.

38. 38. The method of any one of claims 1 to 37, wherein the double-stranded ceDNA molecule comprises at least one uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue that is nicked by the endonuclease, and wherein the endonuclease has enzymatic activity against the uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue.

39. 39. The method of any one of claims 36 to 38, wherein the endonuclease nicks the DNA at a second phosphodiester bond 3' to a uridine-, inosine-, xanthosine-, and / or oxanosine-containing residue.

40. 40. The method of any one of claims 1 to 39, wherein the exonuclease is T7 exonuclease.

41. 40. The method of any one of claims 1 to 39, wherein the exonuclease is exonuclease III (Exo III).

42. (1) performing rolling circle amplification (RCA) using double-stranded DNA (dsDNA) molecules, thereby generating intermediate dsDNA molecules; (2) performing cell-free enzymatic synthesis using the intermediate dsDNA molecule, thereby producing the ceDNA molecule; The method of any one of claims 1 to 41, wherein steps (1) and (2) are performed before steps (a) and (b).

43. 43. The method of claim 42, further comprising the step of: (3) purifying the ceDNA molecule after step (2) and before step (a).

44. The RCA step (1) 44. The method of claim 42 or 43, comprising the step of: (i) contacting the dsDNA molecule with a primer and a DNA polymerase.

45. Step (2) is (i) contacting the intermediate dsDNA molecule with a restriction endonuclease to generate a cleaved intermediate dsDNA molecule; (ii) contacting the cleaved intermediate dsDNA molecule with an oligonucleotide comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule and with a ligase.

46. 46. ​​The method of Claim 45, wherein step (ii) further comprises contacting the cleaved intermediate dsDNA molecule with at least two oligonucleotides, each oligonucleotide comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule.

47. 47. The method of claim 46, wherein the at least two oligonucleotides each comprise the same end.

48. 47. The method of claim 46, wherein the at least two oligonucleotides each comprise a different end.

49. 48. The method of claim 46 or 47, wherein the at least two oligonucleotides are the same.

50. 49. The method of claim 46 or 48, wherein the at least two oligonucleotides are different.

51. Step (2) is 51. The method of any one of claims 45 to 50, further comprising the step of (iii) ligating said at least one oligonucleotide to said cleaved dsDNA intermediate.

52. 52. The method of any one of claims 1 to 51, wherein the at least one stem at the 3' end comprises a partial DNA duplex of 4 to 500 nucleotides.

53. 53. The method of any one of claims 1 to 52, wherein the at least one stem at the 3' end comprises a partial DNA duplex of 4 to 5 nucleotides.

54. 54. The method of any one of claims 8 to 53, wherein the at least one stem at the 5' end comprises a partial DNA duplex of 4 to 500 nucleotides.

55. 55. The method of any one of claims 8 to 54, wherein the at least one stem at the 5' end comprises a partial DNA duplex of 4 to 5 nucleotides.

56. 56. The method of any one of claims 1 to 55, wherein the at least one loop at the 3' end comprises 3 to 500 unlinked nucleotides.

57. 57. The method of any one of claims 1 to 56, wherein the at least one loop at the 3' end comprises a minimum of three unlinked nucleotides.

58. 58. The method of any one of claims 8 to 57, wherein the at least one loop at the 5' end comprises 3 to 500 unlinked nucleotides.

59. 59. The method of any one of claims 8 to 58, wherein the at least one loop at the 5' end comprises at least three unlinked nucleotides.

60. 60. The method of any one of claims 1 to 59, wherein the ssDNA comprises at least two stem-loop structures at the 3' end.

61. 61. The method of any one of claims 1 to 60, wherein the ssDNA comprises at least three stem-loop structures at the 3' end.

62. The method of any one of claims 1 to 61, wherein the ssDNA comprises at least four or more stem-loop structures at the 3' end.

63. 63. The method of any one of claims 1 to 62, wherein the ssDNA comprises at least two stem-loop structures at the 3' end.

64. 64. The method of any one of claims 1 to 63, wherein the ssDNA comprises at least three stem-loop structures at the 3' end.

65. The method of any one of claims 1 to 64, wherein the ssDNA comprises at least four or more stem-loop structures at the 3' end.

66. 66. The method of any one of claims 8 to 65, wherein the ssDNA comprises at least one bubble structure at the 5' end.

67. 67. The method of any one of claims 8 to 66, wherein the ssDNA comprises at least two stem-loop structures at the 5' end.

68. 68. The method of any one of claims 8 to 67, wherein the ssDNA comprises at least three stem-loop structures at the 5' end.

69. The method of any one of claims 8 to 68, wherein the ssDNA comprises at least four or more stem-loop structures at the 5' end.

70. 70. The method of any one of claims 1 to 69, wherein the at least one stem-loop structure at the 3' end comprises a hairpin DNA structure.

71. 71. The method of any one of claims 1 to 70, wherein the at least one stem-loop structure at the 3' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

72. 72. The method of any one of claims 1 to 71, wherein the at least one stem-loop structure at the 3' end does not include the A region or the A' region that would be present in a wild-type AAV ITR.

73. 73. The method of any one of claims 1 to 72, wherein the at least one stem-loop structure at the 3' end does not include the A region, the A' region, the D region, or the D' region that would be present in a wild-type AAV ITR.

74. 74. The method of any one of claims 1 to 73, wherein the at least one stem-loop structure at the 3' end does not include region A, region A', region B, region B', region C, region C', region D, or region D' that would be present in a wild-type AAV ITR.

75. 75. The method of any one of claims 8 to 74, wherein the at least one stem-loop structure at the 5' end does not include the A region or the A' region that would be present in a wild-type AAV ITR.

76. 76. The method of any one of claims 8 to 75, wherein the at least one stem-loop structure at the 5' end does not include the A region, the A' region, the D region, or the D' region that would be present in a wild-type AAV ITR.

77. 77. The method of any one of claims 8 to 76, wherein the at least one stem-loop structure at the 5' end does not include region A, region A', region B, region B', region C, region C', region D, or region D' that would be present in a wild-type AAV ITR.

78. 78. The method of any one of claims 1 to 77, wherein the at least one stem-loop structure at the 3' end does not contain a rep binding element (RBE) that would be present in a wild-type AAV ITR.

79. 79. The method of any one of claims 1 to 78, wherein the at least one stem-loop structure at the 3' end does not contain a terminal resolution site (trs) that would be present in a wild-type AAV ITR.

80. 80. The method of any one of claims 8 to 79, wherein the at least one stem-loop structure at the 5' end does not contain a rep binding element (RBE) that would be present in a wild-type AAV ITR.

81. 81. The method of any one of claims 8 to 80, wherein the at least one stem-loop structure at the 5' end does not contain a terminal resolution site (trs) that would be present in a wild-type AAV ITR.

82. 82. The method of any one of claims 1 to 81, wherein the ssDNA molecule does not contain any viral-derived sequences.

83. 83. The method of any one of claims 1 to 82, wherein the at least one stem-loop structure at the 3' end comprises one or more nucleotides modified to be exonuclease resistant.

84. 84. The method of claim 83, wherein the nucleotides modified to be exonuclease resistant are selected from the group consisting of phosphorothioate modified nucleotides, locked nucleic acid (LNA) modified nucleotides, 2'-O-methyl (m) modified nucleotides, 2'-O-methoxyethyl (E) modified nucleotides, 2'-fluoro (F) modified nucleotides, and combinations thereof.

85. 85. The method of any one of claims 1 to 84, wherein the at least one stem-loop structure at the 3' end and / or the at least one stem-loop structure at the 5' end each independently comprises a functional moiety.

86. 86. The method of any one of claims 8 to 85, wherein the at least one stem-loop structure at the 5' end comprises a hairpin DNA structure.

87. 87. The method of any one of claims 8 to 86, wherein the at least one stem-loop structure at the 5' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

88. 88. The method of any one of claims 8 to 87, wherein the stem structure at the 5' end comprises one or more nucleotides modified to be exonuclease resistant.

89. 89. The method of claim 88, wherein the nucleotide modified to be exonuclease resistant is a PS-modified nucleotide.

90. 90. The method of any one of claims 8 to 89, wherein the at least one loop structure at the 5' end further comprises one or more nucleic acids to stabilize the end.

91. The method according to any one of claims 8 to 90, wherein the at least one loop structure at the 5' end further comprises one or more chemically modified nucleic acids.

92. 92. The method of any one of claims 36 to 91, wherein the deoxyinosine residue is located at position -1i, -2i, -5i, or -7i relative to SEQ ID NO:

7.

93. 93. The method of any one of claims 36 to 92, wherein the deoxycytosine residue is located at position -1i or -7i relative to SEQ ID NO:

7.

94. 94. The method of any one of claims 1 to 93, wherein the ssDNA molecule is capable of being transported across the nuclear membrane from the cytosol into the nucleus of a host cell.

95. 95. The method of any one of claims 1 to 94, wherein the ssDNA molecule further comprises at least one functional moiety.

96. 95. The method of any one of claims 1 to 94, wherein the at least one stem-loop structure at the 3' end comprises at least one functional moiety.

97. The method of any one of claims 8 to 96, wherein the at least one stem-loop structure at the 5' end comprises at least one functional moiety.

98. 98. The method of any one of claims 95 to 97, wherein said at least one functional moiety is an aptamer.

99. 99. The method of any one of claims 8 to 98, wherein the loop at the 5' end and / or the 3' end further comprises one or more aptamers.

100. 100. The method of claim 98 or 99, wherein the aptamer is encoded by the ceDNA molecule and the aptamer forms a secondary aptamer structure in the ssDNA molecule.

101. The method of any one of claims 98 to 100, wherein the aptamer is a CH4-1 aptamer.

102. 102. The method of any one of claims 1 to 101, wherein said at least one loop at the 3' end and / or 5' end further comprises one or more synthetic ribozymes.

103. 103. The method of claim 101 or 102, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more antisense oligonucleotides (ASO).

104. 104. The method of any one of claims 1 to 103, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more short interfering RNAs (siRNAs).

105. 105. The method of any one of claims 1 to 104, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more antiviral nucleoside analogs (ANA).

106. 106. The method of any one of claims 1 to 105, wherein said at least one loop at the 3' end and / or 5' end further comprises one or more triplex forming oligonucleotides.

107. 107. The method of any one of claims 1 to 106, wherein the at least one loop at the 3' end and / or 5' end further comprises one or more gRNAs or gDNAs.

108. The method of any one of claims 1 to 107, wherein said at least one loop at the 3' end and / or 5' end further comprises one or more molecular probes.

109. 109. The method of any one of claims 1 to 108, wherein the ssDNA molecule lacks any viral capsid protein coding sequence.

110. 110. The method of any one of claims 1 to 109, wherein the ssDNA molecule comprises a first ITR and a second ITR, and the ITRs do not comprise any viral-derived sequences.

111. 111. The method of any one of claims 1 to 110, wherein the ssDNA molecule does not contain any viral-derived sequences.

112. 112. The method of any one of claims 1 to 111, wherein the ssDNA molecule comprises a first ITR and a second ITR, wherein the ITRs are synthetic.

113. 113. The method of any one of claims 1 to 112, wherein the ssDNA molecule is synthetically produced in vitro.

114. 114. The method of any one of claims 1 to 113, wherein the ssDNA molecule is synthetically produced in vitro in a cell-free environment.

115. 115. The method of any one of claims 1 to 114, wherein the ssDNA molecule does not activate or only minimally activates immune pathways.

116. 116. The method of claim 115, wherein the immune pathway is an innate immune pathway.

117. 117. The method of claim 115 or 116, wherein the immune pathway is an innate immune pathway selected from the group consisting of the cGAS / STING pathway, the TLR9 pathway, the inflammasome-mediated pathway, and combinations thereof.

118. 118. The method of any one of claims 1 to 117, wherein the nucleic acid sequence of interest is a therapeutic protein or a therapeutic fragment thereof.

119. 119. The method of claim 118, wherein the at least one therapeutic protein is selected from the group consisting of an antibody, an enzyme, a clotting factor, a transcription factor, a replication factor, a growth factor, a hormone, and a fusion protein.

120. The at least one therapeutic protein is effective in treating melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell disease, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g., Hurler syndrome (MPS I), Scheie syndrome (MPS I S), Hurler-Scheie syndrome (MPS I H-S), Hunter syndrome (MPS II), Sanfilippo syndromes A, B, C, and D (MPS III MPS A, B, C, and D), Morquio syndrome types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), hyaluronidase deficiency (MPSIX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I and II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, 120. The method of claim 118 or 119, wherein the method is useful for treating a genetic disorder selected from the group consisting of Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber's congenital amaurosis, Stargardt's macular dystrophy (ABCA4), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency.

121. 121. A linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure at the 3' end, produced by the method of any one of claims 1 to 120.

122. A lipid nanoparticle comprising the ssDNA molecule of claim 121 and a lipid.

123. A pharmaceutical composition comprising the ssDNA molecule of claim 121 or the lipid nanoparticle composition of claim 122, and a pharmaceutically acceptable excipient.

124. A host cell comprising the ssDNA molecule of claim 121 or the lipid nanoparticle of claim 122.

125. A method for treating a genetic disorder in a subject, comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123.

126. A method for delivering a therapeutic gene and / or a therapeutic protein to a subject, comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123.

127. A method for delivering a therapeutic gene and / or a therapeutic protein to a cell, comprising contacting the cell with the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123, thereby delivering the therapeutic gene and / or therapeutic protein to the cell.

128. A method for delivering a therapeutic gene to the nucleus of a cell, comprising contacting the cell with the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123, thereby delivering the therapeutic gene and / or therapeutic protein to the nucleus of the cell.

129. A method for minimizing an immune response in a subject being treated with a therapeutic gene or therapeutic protein, comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123, wherein the nucleic acid of interest encodes the therapeutic gene or therapeutic protein.

Images