Macrophage-specific promoters and uses thereof

Abstract

Described herein are compositions and methods for regulating the expression of effector molecules using engineered macrophage-specific promoters, as well as immunoresponsive cells (such as macrophages) that contain them. TIFF2025540186000109.tif104135

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 386,117, filed December 5, 2022, 63 / 459,988, filed April 17, 2023, 63 / 506,013, filed June 2, 2023, and 63 / 588,196, filed October 5, 2023, each of which is incorporated by reference herein in its entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted via EFS-Web and is incorporated herein by reference in its entirety. The XML copy was created in XX / 20XX, is named XXXXXUS_sequencelisting.xml, and is X,XXX,XXX bytes in size. [Background technology]

[0003] background Cell-based therapeutic platforms offer promising avenues for treating a variety of diseases. Engineering macrophages as cell therapy and drug delivery vehicles has gained prominence as a potential immunotherapy. These engineered macrophages are typically genetically modified to express checkpoint inhibitors (e.g., PD-1 / PD-L1 binders, SIRPα, or CD47 blockers), immunomodulatory cytokines (e.g., interferons or interleukins), chimeric antigen receptors, and / or other immunomodulatory elements under the control of constitutive promoters. Constitutive expression of these engineered elements may be undesirable and may cause undesirable toxicity.

[0004] Given these promises, improvements in cell-based therapies are needed. An active area of ​​exploration is engineering cell-based therapies to produce and / or secrete effector molecules, such as cytokines, that enhance cell-based therapies, a process referred to as armoring. Thus, additional methods of controlling and regulating the armoring of cell-based therapies are required, such as by modulating the production and / or secretion of payload effector molecules. Summary of the Invention

[0005] overview The present disclosure provides polarization state-specific promoters that allow for controlled expression of payloads only when macrophages encounter a given polarization cue. These polarization state-specific promoters can be used not only to provide selective payload expression but also to prevent macrophage polarization plasticity.

[0006] Thus, in one aspect, described herein is an engineered macrophage-specific promoter system comprising a regulatory element and a heterologous payload, wherein the regulatory element exhibits greater activity in M1 macrophages compared to M2 or M0 macrophages, and the regulatory element is or comprises an enhancer region derived from a promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages.

[0007] In some embodiments, the regulatory element is at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2500, 2600, 2800, or 3000 base pairs in length.

[0008] In some embodiments, the regulatory element is derived from a promoter of a gene, wherein the gene is selected from the group consisting of CCL19, CCR7, CXCL11, GBP5, IDO1, UBD, and UNQ6494.1. In some embodiments, the regulatory element is derived from a CCL19 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 132. In some embodiments, the regulatory element is derived from a CCR7 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 133. In some embodiments, the regulatory element is derived from a CXCL11 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 134. In some embodiments, the regulatory element is derived from the GBP5 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 135. In some embodiments, the regulatory element is derived from the IDO1 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 136. In some embodiments, the regulatory element is derived from the UBD promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 137. In some embodiments, the regulatory element is derived from the UNQ6494.1 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 138.

[0009] In some embodiments, the regulatory element comprises: i. a first transcriptional activator element set forth in SEQ ID NO:220, a second transcriptional activator element set forth in SEQ ID NO:222, a third transcriptional activator element set forth in SEQ ID NO:240, a fourth transcriptional activator element set forth in SEQ ID NO:254, and a fifth transcriptional activator element set forth in SEQ ID NO:256; and ii. no repression element selected from SEQ ID NO:226, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252. In some embodiments, the regulatory element further comprises a sixth transcriptional activator element set forth in SEQ ID NO:224 and / or a seventh transcriptional activator element set forth in SEQ ID NO:258. In some embodiments, the regulatory element further excludes SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:248, and SEQ ID NO:250. In some embodiments, the regulatory element excludes repression elements such as those set forth in SEQ ID NO:226, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252.

[0010] In some embodiments, the regulatory element comprises the sequence set forth in GTTAATGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTT (SEQ ID NO: 482) and the sequence set forth in TTTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483). In some embodiments, the regulatory element comprises a sequence set forth in GCTCTTCTAAAAATATGCGAAATGAGGTTTTTAGGGAGGTGTAGGTATGGCTGAAGAAAATCAAGGTGAATGAAGACAAGATCAATTGAGAATGTAGTTTCAGAAATAGCAAAGAAGCCAAAGTTTGAGGAAGTTAAGTGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTTTGAGACGGAGTCTCACTCTGCTGCCCAGGC (SEQ ID NO: 484), a sequence set forth in ATTTTGGTTTCAGTTTTCCTTAC (SEQ ID NO: 240), and a sequence set forth in TTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483).

[0011] In some embodiments, the regulatory element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 456. In some embodiments, the regulatory element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 457. In some embodiments, the regulatory element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 458.

[0012] In some embodiments, the regulatory element comprises: i. a first transcriptional activation element set forth in SEQ ID NO:268 and a second transcriptional activation element set forth in SEQ ID NO:270; and ii. does not comprise at least one repression element selected from SEQ ID NO:260, SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:266, SEQ ID NO:272, and SEQ ID NO:391. In some embodiments, the regulatory element comprises at least one, at least two, at least three, at least four, or at least five tandem repeats of SEQ ID NO:268 and SEQ ID NO:270. In some embodiments, the regulatory element further comprises a third transcriptional activation element set forth in SEQ ID NO:291 and / or a fourth transcriptional activation element set forth in SEQ ID NO:295. In some embodiments, the regulatory element does not comprise repression elements such as those set forth in SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:272, and SEQ ID NO:391, and optionally, the regulatory element further does not comprise SEQ ID NO:260 and / or SEQ ID NO:266. In some embodiments, the regulatory element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 459. In some embodiments, the regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 460. In some embodiments, the regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 461.

[0013] In some embodiments, the regulatory element is operably linked to a minimal promoter, optionally comprising a promoter sequence selected from minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia response element, SMAD binding element, STAT3 binding site, minCMV, YB TATA, minTK, SCP3, YB-SCP3, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof. In some embodiments, the minimal promoter comprises a YB TATA promoter sequence.

[0014] In some embodiments, the regulatory element further comprises a translation initiation site, optionally, the translation initiation site is or comprises a Kozak sequence.

[0015] In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, a cytokine, a receptor, an enzyme, a chemokine, an antibody, a fragment of an antibody, an miRNA, and an shRNA.

[0016] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising a regulatory element and a heterologous payload, wherein the regulatory element exhibits greater activity in M2 macrophages compared to M1 or M0 macrophages, and the regulatory element is or comprises an enhancer region derived from a promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages.

[0017] In some embodiments, the regulatory element is at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2500, 2600, 2800, or 3000 base pairs in length.

[0018] In some embodiments, the regulatory element is a promoter of a gene, wherein the gene is selected from the group consisting of CD28, SOCS3, PLXDC1, IL7R, and ZNF704. In some embodiments, the regulatory element is derived from the CD28 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 139. In some embodiments, the regulatory element is derived from the PLXDC1 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 140. In some embodiments, the regulatory element is derived from the ZNF704 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 141. In some embodiments, the regulatory element is derived from the IL7R promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 392. In some embodiments, the regulatory element is derived from the SOCS3 promoter. In some embodiments, the regulatory element comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to SEQ ID NO: 393.

[0019] In some embodiments, the regulatory element is a promoter of a gene, and the gene is selected from the group consisting of LNCAROD, MRC1, and ID3.

[0020] In some embodiments, the regulatory element is derived from the LNCAROD promoter. In some embodiments, the regulatory element derived from the LNCAROD promoter is a nucleotide sequence having (i) at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 414, (ii) at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 415. (iii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 416; or (iv) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 417.

[0021] In some embodiments, the regulatory element is derived from the ID3 promoter. In some embodiments, the regulatory element derived from the ID3 promoter comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:418.

[0022] In some embodiments, the regulatory element is derived from the MRC1 promoter. In some embodiments, the regulatory element derived from the MRC1 promoter comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:419.

[0023] In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, a cytokine, a receptor, an enzyme, a chemokine, an antibody, a fragment of an antibody, an miRNA, and an shRNA.

[0024] In another aspect, provided herein is an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M1 macrophages compared to the activity of a corresponding engineered macrophage-specific promoter lacking the excision in M1 macrophages.

[0025] In some embodiments, the wild-type macrophage promoter is a sequence selected from the group consisting of SEQ ID NOs: 132 to 138. In some embodiments, the wild-type macrophage promoter comprises the nucleotide sequence of SEQ ID NO: 132.

[0026] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif being selected from the group consisting of positions 63 to 73 of SEQ ID NO:132, positions 80 to 102 of SEQ ID NO:132, positions 141 to 162 of SEQ ID NO:132, positions 212 to 222 of SEQ ID NO:132, positions 229 to 251 of SEQ ID NO:132, positions 307 to 361 of SEQ ID NO:132, positions 365 to 376 of SEQ ID NO:132, positions 559 to 571 of SEQ ID NO:132, positions 617 to 633 of SEQ ID NO:132, positions 782 to 799 of SEQ ID NO:132, positions 852 to 871 of SEQ ID NO:132, positions 886 to 920 of SEQ ID NO:132, positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 90, 91, 92, 93, 95, 100, 102, 102, 103, 104, 106, 108, 116, 119, 121, 123, 132, 131, 133, 138, 143, 169, 175, 178, 182, 178, 190, 192, 190, 192, 194, 196, 20, 21, 22, 23, 24, 25, 26, 27,

[0027] In some embodiments, the excision comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif.

[0028] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 63-73 of SEQ ID NO:132.

[0029] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CTTACCTACT (SEQ ID NO: 171) at positions 63-73 of SEQ ID NO: 132.

[0030] In some embodiments, the truncation comprises a deletion of nucleotides 63-73 of SEQ ID NO:132.

[0031] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 80-102 of SEQ ID NO:132.

[0032] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AATTCAGACGACAAACCATTCT (SEQ ID NO: 173) at positions 80-102 of SEQ ID NO: 132.

[0033] In some embodiments, the truncation comprises a deletion of nucleotides 80-102 of SEQ ID NO:132.

[0034] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 141-162 of SEQ ID NO:132.

[0035] In some embodiments, the excision comprises a nucleotide substitution at positions 141-162 of SEQ ID NO: 132 comprising the sequence TTCTAAGTCCAATTCACGACA (SEQ ID NO: 175).

[0036] In some embodiments, the truncation comprises a deletion of nucleotides 141-162 of SEQ ID NO:132.

[0037] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 212-222 of SEQ ID NO:132.

[0038] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GTTGAAGCTT (SEQ ID NO: 177) at positions 212-222 of SEQ ID NO: 132.

[0039] In some embodiments, the truncation comprises a deletion of nucleotides 212-222 of SEQ ID NO:132.

[0040] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 229-251 of SEQ ID NO:132.

[0041] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GAGTCGTCAGACTCAATTATTA (SEQ ID NO: 179) at positions 229 to 251 of SEQ ID NO: 132.

[0042] In some embodiments, the truncation comprises a deletion of nucleotides 229-251 of SEQ ID NO:132.

[0043] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 307-361 of SEQ ID NO:132.

[0044] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AATTGGAACCACGTATCTACTGCATTGTAACTACAACAGCTCGAGGTATTAGAT (SEQ ID NO: 181) at positions 307 to 361 of SEQ ID NO: 132.

[0045] In some embodiments, the truncation comprises a deletion of nucleotides 307 to 361 of SEQ ID NO:132.

[0046] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 365-376 of SEQ ID NO:132.

[0047] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GGTGAATTTTC (SEQ ID NO: 183) at positions 365-376 of SEQ ID NO: 132.

[0048] In some embodiments, the truncation comprises a deletion of nucleotides 365-376 of SEQ ID NO:132.

[0049] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 559-571 of SEQ ID NO:132.

[0050] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TACTCATCACTA (SEQ ID NO: 185) at positions 559-571 of SEQ ID NO: 132.

[0051] In some embodiments, the truncation comprises a deletion of nucleotides 559 to 571 of SEQ ID NO:132.

[0052] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 617 to 633 of SEQ ID NO:132.

[0053] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGCTAGTTGTCCAATA (SEQ ID NO: 187) at positions 617 to 633 of SEQ ID NO: 132.

[0054] In some embodiments, the truncation comprises a deletion of nucleotides 617 to 633 of SEQ ID NO:132.

[0055] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 782-799 of SEQ ID NO:132.

[0056] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGTGTGTCATATAGAAT (SEQ ID NO: 189) at positions 782 to 799 of SEQ ID NO: 132.

[0057] In some embodiments, the excision comprises a deletion of nucleotides 782 to 799 of SEQ ID NO:132.

[0058] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 852-871 of SEQ ID NO:132.

[0059] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AACAGTCTAAGTCTCAAA (SEQ ID NO: 191) at positions 852 to 871 of SEQ ID NO: 132.

[0060] In some embodiments, the truncation comprises a deletion of nucleotides 852 to 871 of SEQ ID NO:132.

[0061] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 886-920 of SEQ ID NO:132.

[0062] In some embodiments, the excision comprises a nucleotide substitution at positions 886 to 920 of SEQ ID NO: 132 comprising the sequence ACTCTACGGAAGTAGCTTGTTTAAAACCTATAGT (SEQ ID NO: 193).

[0063] In some embodiments, the excision comprises a deletion of nucleotides 886 to 920 of SEQ ID NO:132.

[0064] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 933-959 of SEQ ID NO:132.

[0065] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GTTCTACTAGTACAAAGGTACCAGTA (SEQ ID NO: 195) at positions 933 to 959 of SEQ ID NO: 132.

[0066] In some embodiments, the truncation comprises a deletion of nucleotides 933 to 959 of SEQ ID NO:132.

[0067] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1002-1028 of SEQ ID NO:132.

[0068] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGAGTAAACTAACTTTCAACCGCTCT (SEQ ID NO: 197) at positions 1002 to 1028 of SEQ ID NO: 132.

[0069] In some embodiments, the excision comprises a nucleotide deletion from positions 1002 to 1028 of SEQ ID NO:132.

[0070] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1032-1045 of SEQ ID NO:132.

[0071] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TCGTTACCATCTT (SEQ ID NO: 199) at positions 1032 to 1045 of SEQ ID NO: 132.

[0072] In some embodiments, the excision comprises a deletion of nucleotides 1032 to 1045 of SEQ ID NO:132.

[0073] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1064 to 1087 of SEQ ID NO:132.

[0074] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AAACACCGTTTTGCTGTAATATC (SEQ ID NO: 201) at positions 1064 to 1087 of SEQ ID NO: 132.

[0075] In some embodiments, the truncation comprises a deletion of nucleotides 1064 to 1087 of SEQ ID NO:132.

[0076] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1169-1192 of SEQ ID NO:132.

[0077] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGCGTAGAACTTCGTAACATTAA (SEQ ID NO: 203) at positions 1169 to 1192 of SEQ ID NO: 132.

[0078] In some embodiments, the excision comprises a deletion of nucleotides from 1169 to 1192 of SEQ ID NO:132.

[0079] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1212 to 1232 of SEQ ID NO:132.

[0080] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AGATAACGCCGTCATTGTAT (SEQ ID NO: 205) at positions 1212 to 1232 of SEQ ID NO: 132.

[0081] In some embodiments, the truncation comprises a deletion of nucleotides from positions 1212 to 1232 of SEQ ID NO:132.

[0082] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1257-1275 of SEQ ID NO:132.

[0083] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAAATACGTTCCAGCTA (SEQ ID NO: 207) at positions 1257-1275 of SEQ ID NO: 132.

[0084] In some embodiments, the truncation comprises a deletion of nucleotides 1257 to 1275 of SEQ ID NO:132.

[0085] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1310 to 1333 of SEQ ID NO:132.

[0086] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence ATATACAGTGTTCAGCGTGTTAC (SEQ ID NO: 209) at positions 1310 to 1333 of SEQ ID NO: 132.

[0087] In some embodiments, the excision comprises a deletion of nucleotides 1310 to 1333 of SEQ ID NO:132.

[0088] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1381-1434 of SEQ ID NO:132.

[0089] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GACGTCTGTTAGTAGTATTACCCGTGTATTTCGGTCTTCGAGCAATTACTTTA (SEQ ID NO: 211) at positions 1381 to 1434 of SEQ ID NO: 132.

[0090] In some embodiments, the truncation comprises a deletion of nucleotides 1381 to 1434 of SEQ ID NO:132.

[0091] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1698-1753 of SEQ ID NO:132.

[0092] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GTGCATAAAAAGAAATTCACCACGAGTACCTATCTTGGTCTCGTTTGTTGCACTA (SEQ ID NO: 213) at positions 1698 to 1753 of SEQ ID NO: 132.

[0093] In some embodiments, the excision comprises a deletion of nucleotides from positions 1698 to 1753 of SEQ ID NO:132.

[0094] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1783 to 1826 of SEQ ID NO:132.

[0095] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AAAAACTACCAACCAGTTATCATTTCTCTGTGTAATATCTGAA (SEQ ID NO: 215) at positions 1783 to 1826 of SEQ ID NO: 132.

[0096] In some embodiments, the excision comprises a nucleotide deletion from positions 1783 to 1826 of SEQ ID NO:132.

[0097] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1909-1927 of SEQ ID NO:132.

[0098] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGCAGAATATCGATATCT (SEQ ID NO: 217) at positions 1909 to 1927 of SEQ ID NO: 132.

[0099] In some embodiments, the excision comprises a deletion of nucleotides from position 1909 to position 1927 of SEQ ID NO:132.

[0100] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif corresponds to positions 1946-1961 of SEQ ID NO:132.

[0101] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGAATAGCACCTATA (SEQ ID NO: 219) at positions 1946 to 1961 of SEQ ID NO: 132.

[0102] In some embodiments, the excision comprises a deletion of nucleotides 1946 to 1961 of SEQ ID NO:132.

[0103] In some embodiments, the excision comprises excision of at least two nucleotide motifs.

[0104] In some embodiments, the excision comprises excision of at least three nucleotide motifs.

[0105] In some embodiments, the excision comprises excision of at least four nucleotide motifs.

[0106] In some embodiments, the excision comprises excision of at least five nucleotide motifs.

[0107] In some embodiments, the at least five nucleotide motifs are a nucleotide motif corresponding to positions 365 to 376 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1169 to 1192 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1212 to 1232 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1257 to 1275 of SEQ ID NO: 132; and a nucleotide motif corresponding to positions 1381 to 1434 of SEQ ID NO:132.

[0108] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GGTGAATTTTC (SEQ ID NO: 183) at positions 365-376 of SEQ ID NO: 132.

[0109] In some embodiments, excision of the nucleotide motif corresponding to positions 365-376 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0110] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGCGTAGAACTTCGTAACATTAA (SEQ ID NO: 203) at positions 1169 to 1192 of SEQ ID NO: 132.

[0111] In some embodiments, excision of the nucleotide motif corresponding to positions 1169 to 1192 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0112] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AGATAACGCCGTCATTGTAT (SEQ ID NO: 205) at positions 1212 to 1232 of SEQ ID NO: 132.

[0113] In some embodiments, excision of the nucleotide motif corresponding to positions 1212 to 1232 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0114] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAAATACGTTCCAGCTA (SEQ ID NO: 207) at positions 1257-1275 of SEQ ID NO: 132.

[0115] In some embodiments, excision of the nucleotide motif corresponding to positions 1257 to 1275 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0116] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GACGTCTGTTAGTAGTATTACCCGTGTATTTCGGTCTTCGAGCAATTACTTTA (SEQ ID NO: 211) at positions 1381 to 1434 of SEQ ID NO: 132.

[0117] In some embodiments, excision of the nucleotide motif corresponding to positions 1381 to 1434 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0118] In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence of SEQ ID NO:123.

[0119] In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence of SEQ ID NO:125.

[0120] In some embodiments, the engineered macrophage-specific promoter is a sequence corresponding to positions 1002 to 1028 of SEQ ID NO: 132; a sequence corresponding to positions 1310 to 1333 of SEQ ID NO: 132; and a sequence corresponding to positions 1909 to 1927 of SEQ ID NO: 132.

[0121] In some embodiments, the excision comprises excision of at least six nucleotide motifs.

[0122] In some embodiments, the excision comprises excision of at least seven nucleotide motifs.

[0123] In some embodiments, the excision comprises excision of at least 8 nucleotide motifs.

[0124] In some embodiments, the at least eight nucleotide motifs are a nucleotide motif corresponding to positions 365 to 376 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1169 to 1192 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1212 to 1232 of SEQ ID NO: 132; a nucleotide motif corresponding to positions 1257 to 1275 of SEQ ID NO: 132; and a nucleotide motif corresponding to positions 1381 to 1434 of SEQ ID NO:132. a sequence corresponding to positions 1002 to 1028 of SEQ ID NO: 132; a sequence corresponding to positions 1310 to 1333 of SEQ ID NO: 132; It includes a sequence corresponding to positions 1909 to 1927 of SEQ ID NO: 132.

[0125] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GGTGAATTTTC (SEQ ID NO: 183) at positions 365-376 of SEQ ID NO: 132.

[0126] In some embodiments, excision of the nucleotide motif corresponding to positions 365-376 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0127] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGCGTAGAACTTCGTAACATTAA (SEQ ID NO: 203) at positions 1169 to 1192 of SEQ ID NO: 132.

[0128] In some embodiments, excision of the nucleotide motif corresponding to positions 1169 to 1192 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0129] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AGATAACGCCGTCATTGTAT (SEQ ID NO: 205) at positions 1212 to 1232 of SEQ ID NO: 132.

[0130] In some embodiments, excision of the nucleotide motif corresponding to positions 1212 to 1232 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0131] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAAATACGTTCCAGCTA (SEQ ID NO: 207) at positions 1257-1275 of SEQ ID NO: 132.

[0132] In some embodiments, excision of the nucleotide motif corresponding to positions 1257 to 1275 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0133] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GACGTCTGTTAGTAGTATTACCCGTGTATTTCGGTCTTCGAGCAATTACTTTA (SEQ ID NO: 211) at positions 1381 to 1434 of SEQ ID NO: 132.

[0134] In some embodiments, excision of the nucleotide motif corresponding to positions 1381 to 1434 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0135] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGAGTAAACTAACTTTCAACCGCTCT (SEQ ID NO: 197) at positions 1002 to 1028 of SEQ ID NO: 132.

[0136] In some embodiments, excision of the nucleotide motif corresponding to positions 1002 to 1028 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0137] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence ATATACAGTGTTCAGCGTGTTAC (SEQ ID NO: 209) at positions 1310 to 1333 of SEQ ID NO: 132.

[0138] In some embodiments, excision of the nucleotide motif corresponding to positions 1310 to 1333 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0139] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGCAGAATATCGATATCT (SEQ ID NO: 217) at positions 1909 to 1927 of SEQ ID NO: 132.

[0140] In some embodiments, excision of the nucleotide motif corresponding to positions 1909 to 1927 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0141] In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence of SEQ ID NO:124.

[0142] In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence of SEQ ID NO:126.

[0143] In some embodiments, the wild-type macrophage promoter comprises the nucleotide sequence of SEQ ID NO:136.

[0144] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif being selected from the group consisting of positions 133 to 144 of SEQ ID NO:136, positions 200 to 217 of SEQ ID NO:136, positions 225 to 247 of SEQ ID NO:136, positions 303 to 325 of SEQ ID NO:136, positions 332 to 342 of SEQ ID NO:136, positions 391 to 413 of SEQ ID NO:136, positions 423 to 460 of SEQ ID NO:136, positions 467 to 477 of SEQ ID NO:136, positions 693 to 717 of SEQ ID NO:136, positions 723 to 730 of SEQ ID NO:136, positions 743 to 750 of SEQ ID NO:136, positions 762 to 775 of SEQ ID NO:136, positions 781 to 791 of SEQ ID NO:136, positions 800 to 810 of SEQ ID NO:136, positions 825 to 830 of SEQ ID NO:136, positions 840 to 850 of SEQ ID NO:136, positions 862 to 870 of SEQ ID NO:136, positions 881 to 891 of SEQ ID NO:136, positions 892 to 900 of SEQ ID NO:136, positions 901 to 910 of SEQ ID NO:136, positions 925 to 930 of SEQ ID NO:136, positions 941 to 950 of SEQ ID NO:136, positions 962 to 970 of SEQ ID NO:136, positions 983 to 991 positions 738 to 761 of SEQ ID NO: 136, positions 838 to 861 of SEQ ID NO: 136, positions 1229 to 1246 of SEQ ID NO: 136, positions 1286 to 1309 of SEQ ID NO: 136, positions 1413 to 1431 of SEQ ID NO: 136, positions 1456 to 1473 of SEQ ID NO: 136, positions 1530 to 1544 of SEQ ID NO: 136, positions 1577 to 1590 of SEQ ID NO: 136, positions 1816 to 1836 of SEQ ID NO: 136, positions 1852 to 1872 of SEQ ID NO: 136, and positions 1876 to 1896 of SEQ ID NO: 136.

[0145] In some embodiments, the excision comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif.

[0146] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 133-144 of SEQ ID NO:136.

[0147] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CTTACCTACTA (SEQ ID NO: 221) at positions 133-144 of SEQ ID NO: 136.

[0148] In some embodiments, the truncation comprises a deletion of nucleotides 133-144 of SEQ ID NO:136.

[0149] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 200-217 of SEQ ID NO:136.

[0150] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAATTCGTCCGATAGAT (SEQ ID NO: 223) at positions 200-217 of SEQ ID NO: 136.

[0151] In some embodiments, the truncation comprises a deletion of nucleotides 200-217 of SEQ ID NO:136.

[0152] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 225-247 of SEQ ID NO:136.

[0153] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AATTCAGACGACAAACCATTCT (SEQ ID NO: 225) at positions 225-247 of SEQ ID NO: 136.

[0154] In some embodiments, the truncation comprises a deletion of nucleotides 225-247 of SEQ ID NO:136.

[0155] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 303-325 of SEQ ID NO:136.

[0156] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TTCTAAGTCCAATTCACGACAA (SEQ ID NO: 227) at positions 303 to 325 of SEQ ID NO: 136.

[0157] In some embodiments, the excision comprises a deletion of nucleotides 303 to 325 of SEQ ID NO:136.

[0158] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 332-342 of SEQ ID NO:136.

[0159] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GTTGAAGCTT (SEQ ID NO: 229) at positions 332-342 of SEQ ID NO: 136.

[0160] In some embodiments, the excision comprises a deletion of nucleotides 332-342 of SEQ ID NO:136.

[0161] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 391-413 of SEQ ID NO:136.

[0162] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AGTCGTCAGACTCAATTATTAC (SEQ ID NO: 231) at positions 391-413 of SEQ ID NO: 136.

[0163] In some embodiments, the truncation comprises a deletion of nucleotides 391 to 413 of SEQ ID NO:136.

[0164] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 423-460 of SEQ ID NO:136.

[0165] In some embodiments, the excision comprises a nucleotide substitution at positions 423 to 460 of SEQ ID NO: 136 comprising the sequence TCCCTAGCGATCGAAGTTGATAAAACCTAAGTTTTGT (SEQ ID NO: 233).

[0166] In some embodiments, the truncation comprises a deletion of nucleotides 423 to 460 of SEQ ID NO:136.

[0167] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 467-477 of SEQ ID NO:136.

[0168] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GCCTTCATAA (SEQ ID NO: 235) at positions 467-477 of SEQ ID NO: 136.

[0169] In some embodiments, the truncation comprises a deletion of nucleotides 467-477 of SEQ ID NO:136.

[0170] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 693 to 717 of SEQ ID NO:136.

[0171] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TCTCGCTAATAGGAGTAAGATACA (SEQ ID NO: 237) at positions 693 to 717 of SEQ ID NO: 136.

[0172] In some embodiments, the excision comprises a deletion of nucleotides 693 to 717 of SEQ ID NO:136.

[0173] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 738-761 of SEQ ID NO:136.

[0174] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TTCTGCTGCAAGACCTATACTAT (SEQ ID NO: 239) at positions 738-761 of SEQ ID NO: 136.

[0175] In some embodiments, the truncation comprises a deletion of nucleotides 738 to 761 of SEQ ID NO:136.

[0176] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 838-861 of SEQ ID NO:136.

[0177] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CCACATTGCTATAGTGCTGTATA (SEQ ID NO: 241) at positions 838-861 of SEQ ID NO: 136.

[0178] In some embodiments, the truncation comprises a deletion of nucleotides 838 to 861 of SEQ ID NO:136.

[0179] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 1229-1246 of SEQ ID NO:136.

[0180] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGCGTACCAGAATATTT (SEQ ID NO: 243) at positions 1229 to 1246 of SEQ ID NO: 136.

[0181] In some embodiments, the truncation comprises a deletion of nucleotides 1229 to 1246 of SEQ ID NO:136.

[0182] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1286-1309 of SEQ ID NO:136.

[0183] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGGTCACTATCACGTATATACCA (SEQ ID NO: 245) at positions 1286 to 1309 of SEQ ID NO: 136.

[0184] In some embodiments, the excision comprises a deletion of nucleotides from positions 1286 to 1309 of SEQ ID NO:136.

[0185] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1413 to 1431 of SEQ ID NO:136.

[0186] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGAGTTCGATAATACACT (SEQ ID NO: 247) at positions 1413 to 1431 of SEQ ID NO: 136.

[0187] In some embodiments, the truncation comprises a deletion of nucleotides 1413 to 1431 of SEQ ID NO:136.

[0188] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1456-1473 of SEQ ID NO:136.

[0189] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AATACTGGTGCTTCAAT (SEQ ID NO: 249) at positions 1456 to 1473 of SEQ ID NO: 136.

[0190] In some embodiments, the truncation comprises a deletion of nucleotides from positions 1456 to 1473 of SEQ ID NO:136.

[0191] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 1530 to 1544 of SEQ ID NO:136.

[0192] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CCGATAGAAAGAAT (SEQ ID NO: 251) at positions 1530 to 1544 of SEQ ID NO: 136.

[0193] In some embodiments, the excision comprises a deletion of nucleotides 1530 to 1544 of SEQ ID NO:136.

[0194] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, the motif corresponding to positions 1577-1590 of SEQ ID NO:136.

[0195] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGTCTGTATAAAG (SEQ ID NO: 253) at positions 1577-1590 of SEQ ID NO: 136.

[0196] In some embodiments, the excision comprises a deletion of nucleotides from positions 1577 to 1590 of SEQ ID NO:136.

[0197] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1816-1836 of SEQ ID NO:136.

[0198] In some embodiments, the excision comprises a nucleotide substitution at positions 1816 to 1836 of SEQ ID NO: 136 comprising the sequence TGTTAAGCATACTAAACTGT (SEQ ID NO: 255).

[0199] In some embodiments, the excision comprises a nucleotide deletion from positions 1816 to 1836 of SEQ ID NO:136.

[0200] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1852-1872 of SEQ ID NO:136.

[0201] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TTTCGAGCGACGCTTAATAT (SEQ ID NO: 257) at positions 1852 to 1872 of SEQ ID NO: 136.

[0202] In some embodiments, the excision comprises a nucleotide deletion from positions 1852 to 1872 of SEQ ID NO:136.

[0203] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:136, wherein the motif corresponds to positions 1876-1896 of SEQ ID NO:136.

[0204] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAGATAGTACGGGTTCCATA (SEQ ID NO: 259) at positions 1876 to 1896 of SEQ ID NO: 136.

[0205] In some embodiments, the excision comprises a nucleotide deletion from positions 1876 to 1896 of SEQ ID NO:136.

[0206] In some embodiments, the wild-type macrophage promoter comprises the nucleotide sequence of SEQ ID NO:137.

[0207] In some embodiments, the engineered macrophage-specific promoter comprises: i. a first transcriptional activation element set forth in SEQ ID NO:220, a second transcriptional activation element set forth in SEQ ID NO:222, a third transcriptional activation element set forth in SEQ ID NO:240, a fourth transcriptional activation element set forth in SEQ ID NO:254, and a fifth transcriptional activation element set forth in SEQ ID NO:256; and ii. does not comprise at least one repression element selected from SEQ ID NO:226, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252. In some embodiments, the engineered macrophage-specific promoter further comprises a sixth transcriptional activation element set forth in SEQ ID NO:224 and / or a seventh transcriptional activation element set forth in SEQ ID NO:258. In some embodiments, the engineered macrophage-specific promoter does not further comprise SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:248, and SEQ ID NO:250. In some embodiments, the engineered macrophage-specific promoter does not contain repression elements such as those set forth in SEQ ID NO:226, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252.

[0208] In some embodiments, the engineered macrophage-specific promoter comprises the sequence set forth in GTTAATGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTT (SEQ ID NO: 482) and the sequence set forth in TTTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483). In some embodiments, an engineered macrophage-specific promoter comprises the sequence set forth in GCTCTTCTAAAAATATGCGAAATGAGGTTTTTAGGGAGGTGTAGGTATGGCTGAAGAAAATCAAGGTGAATGAAGACAAGATCAATTGAGAATGTAGTTTCAGAAATAGCAAAGAAGCCAAAGTTTGAGGAAGTTAAGTGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTTTGAGACGGAGTCTCACTCTGCTGCCCAGGC (SEQ ID NO: 484), the sequence set forth in ATTTTGGTTTCAGTTTTCCTTAC (SEQ ID NO: 240), and the sequence set forth in TTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483).

[0209] In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 456. In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 457. In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 458.

[0210] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif being selected from the group consisting of positions 43 to 60, 107 to 120 of SEQ ID NO:137, 210 to 230 of SEQ ID NO:137, 345 to 407 of SEQ ID NO:137, 427 to 457 of SEQ ID NO:137, 468 to 484 of SEQ ID NO:137, 560 to 582 of SEQ ID NO:137, 730 to 746 of SEQ ID NO:137, 809 to 820 of SEQ ID NO:137, and the like. The sequence includes a sequence selected from the group consisting of positions 827 to 837 of SEQ ID NO: 137, positions 858 to 878 of SEQ ID NO: 137, positions 1291 to 1302 of SEQ ID NO: 137, positions 1321 to 1341 of SEQ ID NO: 137, positions 1435 to 1463 of SEQ ID NO: 137, positions 1530 to 1541 of SEQ ID NO: 137, positions 1707 to 1718 of SEQ ID NO: 137, positions 1834 to 1863 of SEQ ID NO: 137, positions 1870 to 1882 of SEQ ID NO: 137, and positions 1913 to 1929 of SEQ ID NO: 137.

[0211] In some embodiments, the engineered macrophage-specific promoter comprises i. a first transcriptional activation element set forth in SEQ ID NO:268 and a second transcriptional activation element set forth in SEQ ID NO:270, and ii. does not comprise at least one repression element selected from SEQ ID NO:260, SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:266, SEQ ID NO:272, and SEQ ID NO:391. In some embodiments, the engineered macrophage-specific promoter comprises at least one, at least two, at least three, at least four, or at least five tandem repeats of SEQ ID NO:268 and SEQ ID NO:270. In some embodiments, the engineered macrophage-specific promoter further comprises a third transcriptional activation element set forth in SEQ ID NO:291 and / or a fourth transcriptional activation element set forth in SEQ ID NO:295. In some embodiments, the engineered macrophage-specific promoter does not comprise repression elements such as those set forth in SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:272, and SEQ ID NO:391, and optionally the engineered macrophage-specific promoter does not further comprise SEQ ID NO:260 and / or SEQ ID NO:266. In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identical to SEQ ID NO: 459. In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence set forth in SEQ ID NO: 460. In some embodiments, the engineered macrophage-specific promoter comprises the nucleotide sequence set forth in SEQ ID NO: 461.

[0212] In some embodiments, the engineered macrophage-specific promoter is operably linked to a minimal promoter, optionally comprising the sequence of a promoter selected from minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia responsive element, SMAD binding element, STAT3 binding site, minCMV, YB TATA, minTK, SCP3, YB-SCP3, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof. In some embodiments, the YB TATA promoter sequence comprises a minimal promoter.

[0213] In some embodiments, the engineered macrophage-specific promoter further comprises a translation start site, optionally, the translation start site is or comprises a Kozak sequence.

[0214] In some embodiments, the excision comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif.

[0215] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 43-60 of SEQ ID NO:137.

[0216] In some embodiments, the excision comprises a nucleotide substitution at positions 43-60 of SEQ ID NO: 137 comprising the sequence CTTACCTACTAGGTTAA (SEQ ID NO: 261).

[0217] In some embodiments, the truncation comprises a deletion of nucleotides 43 to 60 of SEQ ID NO:137.

[0218] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 107-120 of SEQ ID NO:137.

[0219] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence ACTCGAATTCAGA (SEQ ID NO: 263) at positions 107-120 of SEQ ID NO: 137.

[0220] In some embodiments, the truncation comprises a deletion of nucleotides 107-120 of SEQ ID NO:137.

[0221] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 210-230 of SEQ ID NO:137.

[0222] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence ATTCTAGCCTTACAGCCTAA (SEQ ID NO: 265) at positions 210-230 of SEQ ID NO: 137.

[0223] In some embodiments, the truncation comprises a deletion of nucleotides 210-230 of SEQ ID NO:137.

[0224] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 345 to 407 of SEQ ID NO:137.

[0225] In some embodiments, the excision comprises a nucleotide substitution at positions 345 to 407 of SEQ ID NO: 137 comprising the sequence ACCTACGGAAGTAGCTTGTTTAAAACCTATAGTCTCTTCGGAGTCGTTCTACTAGTACAAA (SEQ ID NO: 267).

[0226] In some embodiments, the truncation comprises a deletion of nucleotides 345 to 407 of SEQ ID NO:137.

[0227] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 427-457 of SEQ ID NO:137.

[0228] In some embodiments, the excision comprises a nucleotide substitution at positions 427 to 457 of SEQ ID NO: 137 comprising the sequence TGAGTAAACTAACTTTCAACCGCTCTTCGT (SEQ ID NO: 269).

[0229] In some embodiments, the truncation comprises a deletion of nucleotides 427 to 457 of SEQ ID NO:137.

[0230] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 468-484 of SEQ ID NO:137.

[0231] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CTTAAACACCGTTTTG (SEQ ID NO: 271) at positions 468 to 484 of SEQ ID NO: 137.

[0232] In some embodiments, the truncation comprises a deletion of nucleotides 468 to 484 of SEQ ID NO:137.

[0233] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 560-582 of SEQ ID NO:137.

[0234] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CTGTAATATCATCCGCTCTTTA (SEQ ID NO: 273) at positions 560-582 of SEQ ID NO: 137.

[0235] In some embodiments, the truncation comprises a deletion of nucleotides 560 to 582 of SEQ ID NO:137.

[0236] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 730-746 of SEQ ID NO:137.

[0237] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TGATCGGCCAATATTT (SEQ ID NO: 274) at positions 730 to 746 of SEQ ID NO: 137.

[0238] In some embodiments, the truncation comprises a deletion of nucleotides 730 to 746 of SEQ ID NO:137.

[0239] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 809-820 of SEQ ID NO:137.

[0240] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAGAACTTCGT (SEQ ID NO:276) at positions 809-820 of SEQ ID NO:137.

[0241] In some embodiments, the truncation comprises a deletion of nucleotides 809-820 of SEQ ID NO:137.

[0242] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 827-837 of SEQ ID NO:137.

[0243] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AACATTAAGT (SEQ ID NO:278) at positions 827-837 of SEQ ID NO:137.

[0244] In some embodiments, the truncation comprises a deletion of nucleotides 827-837 of SEQ ID NO:137.

[0245] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 858-878 of SEQ ID NO:137.

[0246] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TAGATAACGCCGTCATTGTA (SEQ ID NO: 280) at positions 858-878 of SEQ ID NO: 137.

[0247] In some embodiments, the truncation comprises a deletion of nucleotides from position 858 to position 878 of SEQ ID NO:137.

[0248] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1291-1302 of SEQ ID NO:137.

[0249] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TTTCTCTAACG (SEQ ID NO: 282) at positions 1291-1302 of SEQ ID NO: 137.

[0250] In some embodiments, the excision comprises a deletion of nucleotides 1291 to 1302 of SEQ ID NO:137.

[0251] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1321-1341 of SEQ ID NO:137.

[0252] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CTAACATCGTTCTCAGCTAA (SEQ ID NO: 284) at positions 1321 to 1341 of SEQ ID NO: 137.

[0253] In some embodiments, the truncation comprises a deletion of nucleotides 1321 to 1341 of SEQ ID NO:137.

[0254] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1435 to 1463 of SEQ ID NO:137.

[0255] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence TATACAGTGTTCAGCGTGTTACTTGTGA (SEQ ID NO: 286) at positions 1435 to 1463 of SEQ ID NO: 137.

[0256] In some embodiments, the truncation comprises a deletion of nucleotides 1435 to 1463 of SEQ ID NO:137.

[0257] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 1530-1541 of SEQ ID NO:137.

[0258] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CGTACAAGTAT (SEQ ID NO: 288) at positions 1530 to 1541 of SEQ ID NO: 137.

[0259] In some embodiments, the excision comprises a deletion of nucleotides 1530 to 1541 of SEQ ID NO:137.

[0260] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1707-1718 of SEQ ID NO:137.

[0261] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence AGTCTCTGAAT (SEQ ID NO: 290) at positions 1707-1718 of SEQ ID NO: 137.

[0262] In some embodiments, the excision comprises a deletion of nucleotides 1707-1718 of SEQ ID NO:137.

[0263] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1834 to 1863 of SEQ ID NO:137.

[0264] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence CCCTATATAATACCCGCTAGCATACAAAT (SEQ ID NO: 292) at positions 1834 to 1863 of SEQ ID NO: 137.

[0265] In some embodiments, the excision comprises a deletion of nucleotides from positions 1834 to 1863 of SEQ ID NO:137.

[0266] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, the motif corresponding to positions 1870-1882 of SEQ ID NO:137.

[0267] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence GTTGCTCATATA (SEQ ID NO: 294) at positions 1870 to 1882 of SEQ ID NO: 137.

[0268] In some embodiments, the excision comprises a deletion of nucleotides from positions 1870 to 1882 of SEQ ID NO:137.

[0269] In some embodiments, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:137, wherein the motif corresponds to positions 1913 to 1929 of SEQ ID NO:137.

[0270] In some embodiments, the excision comprises a nucleotide substitution comprising the sequence ACGTCTGTTAGTAGTA (SEQ ID NO: 296) at positions 1913 to 1929 of SEQ ID NO: 137.

[0271] In some embodiments, the truncation comprises a deletion of nucleotides from positions 1913 to 1929 of SEQ ID NO:137.

[0272] In another aspect, provided herein is an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M2 macrophages compared to the activity of a corresponding engineered macrophage-specific promoter lacking the excision in M2 macrophages.

[0273] In some embodiments, the wild-type macrophage promoter is a sequence selected from the group consisting of SEQ ID NOs: 139-141, 392, and 393.

[0274] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits greater activity in M1 macrophages compared to M2 or M0 macrophages, or exhibits greater activity in M2 macrophages compared to M1 or M0 macrophages.

[0275] In some embodiments, the engineered macrophage-specific promoter comprises at least two, at least three, at least four, or at least five regulatory elements. In some embodiments, the engineered macrophage-specific promoter comprises at least five regulatory elements. In some embodiments, each of the at least five regulatory elements is different. In some embodiments, each of the at least five regulatory elements is identical.

[0276] In some embodiments, the engineered macrophage-specific promoter exhibits increased activity in M1 macrophages compared to M2 macrophages.

[0277] In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 297-313 and 372-390.

[0278] In some embodiments, the engineered macrophage-specific promoter comprises (i) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:440; (ii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:441. (iii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 442; (iv) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 443.

[0279] In some embodiments, the engineered macrophage-specific promoter exhibits increased activity in M2 macrophages compared to M1 macrophages, M0 macrophages, or both M1 and M0 macrophages.

[0280] In some embodiments, the engineered macrophage-specific promoter comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 97.5%, 98%, 99%, or 100% identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 314-371.

[0281] In some embodiments, the engineered macrophage-specific promoter is a nucleotide sequence having (i) at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:420; (ii) at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:421; (iii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 422; (iv) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 423. (v) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 424; (vi) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 425. (vii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 426; (viii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 427;(ix) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 428; (x) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 429; (xi) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 430; (xii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 431; (xiii) a nucleotide sequence having at least 75% to SEQ ID NO: 432. , at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 433; (xiv) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 433; (xv) a nucleotide sequence having at least 75%, at least 80%, to SEQ ID NO: 434; (xvi) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 435; (xvii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 436;(xviii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 437; (xix) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 438; (xx) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 439.

[0282] In some embodiments, the engineered macrophage-specific promoter further comprises a minimal promoter operably linked to the engineered macrophage-specific promoter. In some embodiments, the minimal promoter is derived from a promoter selected from the group consisting of minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia responsive element, SMAD binding element, STAT3 binding site, minCMV, YB TATA, minTK, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof.

[0283] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein i. the at least one regulatory element comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:420, and the minimal promoter comprises the sequence of a promoter selected from the group consisting of minTK promoter, SCP3 promoter, and hybrid YBTATA-SCP3 ("YB-SCP3") promoter; ii. the at least one regulatory element comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:425, and the minimal promoter comprises the sequence of a promoter selected from the group consisting of minTK promoter, SCP3 promoter, and hybrid YBTATA-SCP3 ("YB-SCP3") promoter. at least one regulatory element comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 426, and the minimal promoter comprises a sequence of a YB-SCP3 promoter; iv. at least one regulatory element comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 427, and the minimal promoter comprises a sequence of a minCMV promoter; or v.At least one regulatory element comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 423, and the minimal promoter comprises the sequence of a minTK promoter.

[0284] In some embodiments, minTK comprises a nucleotide sequence having at least 80% identity to SEQ ID NO: 448. In some embodiments, minTK comprises the nucleotide sequence set forth in SEQ ID NO: 448. In some embodiments, SCP3 comprises a nucleotide sequence having at least 80% identity to SEQ ID NO: 449. In some embodiments, SCP3 comprises the nucleotide sequence set forth in SEQ ID NO: 449. In some embodiments, YB-SCP3 comprises a nucleotide sequence having at least 80% identity to SEQ ID NO: 450. In some embodiments, YB-SCP3 comprises the nucleotide sequence set forth in SEQ ID NO: 450. In some embodiments, minCMV comprises a nucleotide sequence having at least 80% identity to SEQ ID NO: 447. In some embodiments, minCMV comprises the nucleotide sequence set forth in SEQ ID NO: 447.

[0285] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein the at least one regulatory element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 420. In some embodiments, the at least one regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 420.

[0286] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein the at least one regulatory element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 425. In some embodiments, the at least one regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 425.

[0287] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein the at least one regulatory element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 426. In some embodiments, the at least one regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 426.

[0288] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein the at least one regulatory element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 427. In some embodiments, the at least one regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 427.

[0289] In some embodiments, the engineered macrophage-specific promoter comprises at least one regulatory element, wherein the at least one regulatory element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 423. In some embodiments, the at least one regulatory element comprises the nucleotide sequence set forth in SEQ ID NO: 423.

[0290] In some embodiments, the minimal promoter further comprises flanking sequences.

[0291] In some embodiments, the engineered macrophage-specific promoter further comprises at least one inert sequence, hi some embodiments, the inert sequence is derived from an insulating element.

[0292] In some embodiments, the engineered macrophage-specific promoter further comprises at least one molecular barcode.

[0293] In some embodiments, the M2 macrophage is selected from the group consisting of an M2a macrophage, an M2b macrophage, and an M2c macrophage.

[0294] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and a heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:132.

[0295] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:133.

[0296] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:134.

[0297] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:135.

[0298] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:136.

[0299] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:137.

[0300] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:138.

[0301] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:139.

[0302] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:140.

[0303] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload, wherein the at least one regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:141.

[0304] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:392.

[0305] In another aspect, provided herein is an engineered macrophage-specific promoter system comprising at least one regulatory element and at least one heterologous payload comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:393.

[0306] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:142.

[0307] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:143.

[0308] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:144.

[0309] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:145.

[0310] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:146.

[0311] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:147.

[0312] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:148.

[0313] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:149.

[0314] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:150.

[0315] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:151.

[0316] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:152.

[0317] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:153.

[0318] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:154.

[0319] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:155.

[0320] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:156.

[0321] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:157.

[0322] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:158.

[0323] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:159.

[0324] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:160.

[0325] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:161.

[0326] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:162.

[0327] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:163.

[0328] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1.

[0329] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2.

[0330] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:3.

[0331] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:4.

[0332] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:5.

[0333] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:6.

[0334] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:7.

[0335] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:8.

[0336] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:9.

[0337] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:10.

[0338] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:11.

[0339] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:12.

[0340] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:13.

[0341] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:14.

[0342] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:15.

[0343] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:16.

[0344] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:17.

[0345] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:18.

[0346] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:19.

[0347] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20.

[0348] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:21.

[0349] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:22.

[0350] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:23.

[0351] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:24.

[0352] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:25.

[0353] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:26.

[0354] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:27.

[0355] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:28.

[0356] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:29.

[0357] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:30.

[0358] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:81.

[0359] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:82.

[0360] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:88.

[0361] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:89.

[0362] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:90.

[0363] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:91.

[0364] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:92.

[0365] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:96.

[0366] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:97.

[0367] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:119.

[0368] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:120.

[0369] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:121.

[0370] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:122.

[0371] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:297.

[0372] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:298.

[0373] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:299.

[0374] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:300.

[0375] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:301.

[0376] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:302.

[0377] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:303.

[0378] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:304.

[0379] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:305.

[0380] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:306.

[0381] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:307.

[0382] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:308.

[0383] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:309.

[0384] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:310.

[0385] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:311.

[0386] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:312.

[0387] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:313.

[0388] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:372.

[0389] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:373.

[0390] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:374.

[0391] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:375.

[0392] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:376.

[0393] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:377.

[0394] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:378.

[0395] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:379.

[0396] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:380.

[0397] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:381.

[0398] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:382.

[0399] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:383.

[0400] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:384.

[0401] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:385.

[0402] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:386.

[0403] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:387.

[0404] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:388.

[0405] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:389.

[0406] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:390.

[0407] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:314.

[0408] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:315.

[0409] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:316.

[0410] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:317.

[0411] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:318.

[0412] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:319.

[0413] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:320.

[0414] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:321.

[0415] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:322.

[0416] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:323.

[0417] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:324.

[0418] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:325.

[0419] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:326.

[0420] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:327.

[0421] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:328.

[0422] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:329.

[0423] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:330.

[0424] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:331.

[0425] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:332.

[0426] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:333.

[0427] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:334.

[0428] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:335.

[0429] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:336.

[0430] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:337.

[0431] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:338.

[0432] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:339.

[0433] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:340.

[0434] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:341.

[0435] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:342.

[0436] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:343.

[0437] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:344.

[0438] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:345.

[0439] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:346.

[0440] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:347.

[0441] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:348.

[0442] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:349.

[0443] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:350.

[0444] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:351.

[0445] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:352.

[0446] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:353.

[0447] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:354.

[0448] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:355.

[0449] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:356.

[0450] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:357.

[0451] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:358.

[0452] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:359.

[0453] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:360.

[0454] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:361.

[0455] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:362.

[0456] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:363.

[0457] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:364.

[0458] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:365.

[0459] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:366.

[0460] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:367.

[0461] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:368.

[0462] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:369.

[0463] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:370.

[0464] In another aspect, provided herein is an engineered macrophage-specific promoter comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:371.

[0465] In another aspect, provided herein is an engineered macrophage-specific promoter system according to any one of the preceding embodiments, or a heterologous construct comprising the engineered macrophage-specific promoter according to any one of the preceding embodiments operably linked to a polynucleotide comprising a nucleotide sequence encoding a polypeptide.

[0466] In some embodiments, the polypeptide comprises at least one effector molecule, hi some embodiments, the polypeptide comprises a first effector molecule and a second effector molecule.

[0467] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a first effector molecule, a linker nucleotide sequence, and a nucleotide sequence encoding a second effector.

[0468] In some embodiments, the linker nucleotide sequence encodes one or more 2A ribosomal skipping elements, in some embodiments, the one or more 2A ribosomal skipping elements comprise an element each selected from the group consisting of P2A, T2A, E2A, and F2A.

[0469] In some embodiments, the effector molecule is selected from a therapeutic class, wherein the therapeutic class is selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, polynucleotide molecules, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, transcription factors, antibodies, peptides, and enzymes.

[0470] In some embodiments, the transcription factor is a master regulator. In some embodiments, the transcription factor is a master regulator of M1 macrophage polarization. In some embodiments, the transcription factor is IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof. In some embodiments, the transcription factor is IRF7 or a derivative thereof, and optionally, the transcription factor comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 401, or the amino acid sequence of the transcription factor is SEQ ID NO: 401. In some embodiments, the transcription factor is p65 / RelA or a derivative thereof, and optionally the transcription factor comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:403, or the amino acid sequence of the transcription factor is SEQ ID NO:403.

[0471] In some embodiments, the transcription factor is a master regulator of polarization into M2 macrophages.

[0472] In some embodiments, at least one or each effector molecule comprises a cytokine.

[0473] In some embodiments, the cytokine is modified to include a membrane-binding domain, which is or includes a transmembrane-intracellular or transmembrane domain of a protein selected from the group consisting of PDGFR-beta, CD8, CD28, CD3 zeta chain, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, LNGFR, NKG2D, EpoR, TNFR2, B7-1, and BTLA, or a functional portion thereof.

[0474] In some embodiments, the membrane binding domain is or comprises the transmembrane domain of a B7-1 protein, or a functional portion thereof.

[0475] In some embodiments, the cytokine is IFN gamma.

[0476] In some embodiments, the cytokine and the binding domain are linked by a linker.

[0477] In some embodiments, the cytokine is selected from the group consisting of IL-1 alpha, IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL-12p40, IL-12p35, IL13, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, GM-CSF, TGF-beta, M-CSF, and TNF-alpha. In some embodiments, the cytokine is selected from the group consisting of IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha.

[0478] In some embodiments, the cytokine is a master regulator of M1 macrophage polarization. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the cytokine is IFN-gamma or a derivative thereof, and optionally, the cytokine comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 395, or the amino acid sequence of the cytokine is SEQ ID NO: 395. In some embodiments, the cytokine is TNF-α or a derivative thereof, and optionally the cytokine comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 397, or the amino acid sequence of the cytokine is SEQ ID NO: 397. In some embodiments, the cytokine is IL-12, an IL12p70 fusion protein, or a derivative thereof, and optionally the cytokine comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 399, or the amino acid sequence of the transcription factor is SEQ ID NO: 399.

[0479] In some embodiments, the cytokine is a master regulator of M2 macrophage polarization. In some embodiments, the cytokine is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof. In some embodiments, the cytokine is IL-10 or a derivative thereof, and optionally, the cytokine comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 405, or the amino acid sequence of the transcription factor is SEQ ID NO: 405. In some embodiments, the cytokine is IL-4 or a derivative thereof, and optionally the cytokine comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 407, or the amino acid sequence of the transcription factor is SEQ ID NO: 407.

[0480] In some embodiments, at least one or each effector molecule comprises a chemokine, hi some embodiments, the chemokine is selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, a CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1.

[0481] In some embodiments, at least one or each effector molecule comprises a homing molecule selected from the group consisting of anti-integrin α4, β7, anti-MAdCAM, CCR9, CXCR4, SDFl, MMP-2, CXCR1, CXCR7, CCR2, CCR4, and GPR15.

[0482] In some embodiments, at least one or each effector molecule comprises a growth factor, hi some embodiments, the growth factor is selected from the group consisting of FLT3L and GM-CSF.

[0483] In some embodiments, at least one or each effector molecule comprises a co-activator molecule, hi some embodiments, the co-activator molecule is selected from the group consisting of c-Jun, 4-1BBL, and CD40L.

[0484] In some embodiments, at least one or each effector molecule comprises a tumor microenvironment modifier, hi some embodiments, the tumor microenvironment modifier is selected from the group consisting of adenosine deaminase, a TGF-beta inhibitor, an immune checkpoint inhibitor, a VEGF inhibitor, and HPGE2.

[0485] In some embodiments, each of the first effector molecule and the second effector molecule is from a different therapeutic class, hi some embodiments, each effector molecule is a human-derived effector molecule.

[0486] Provided herein are heterologous constructs for transitioning macrophages from an M1 state to an M2 state, comprising either (i) a regulatory element derived from the promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages, or (ii) an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M1 macrophages compared to the activity of a corresponding macrophage-specific promoter lacking the excision in M1 macrophages, or (iii) an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits higher activity in M1 macrophages compared to M2 or M0 macrophages, and (b) a heterologous payload encoding a master regulator of M2 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof. In some embodiments, the master regulator of M2 macrophage polarization is IL-10. In some embodiments, (a) is a regulatory element derived from the CCL19 promoter, optionally comprising the nucleotide sequence of SEQ ID NO: 132. In some embodiments, the M2 state is an M2c state, an M2a state, or an M2b state.

[0487] Provided herein is a heterologous construct for stabilizing macrophages in an M1 polarization state, comprising: (a) either (i) a regulatory element derived from the promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages, or (ii) an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M1 macrophages compared to the activity of a corresponding macrophage-specific promoter lacking the excision in M1 macrophages, or (iii) an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits higher activity in M1 macrophages compared to M2 or M0 macrophages; and (b) a heterologous payload encoding a master regulator of M1 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M1 macrophage polarization is a cytokine. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the cytokine is IFN-gamma or a derivative thereof. In some embodiments, the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof. In some embodiments, (a) is a regulatory element derived from the UBD1 promoter, the IDO1 promoter, or the CCL19 promoter. In some embodiments, (a) is a regulatory element derived from the UBD1 promoter, and optionally, the regulatory element derived from the UBD1 promoter comprises the sequence of SEQ ID NO: 137.In some embodiments, (a) is a regulatory element derived from the IDO1 promoter, and optionally, the regulatory element derived from the IDO1 promoter comprises the sequence of SEQ ID NO: 136; in some embodiments, (a) is a regulatory element derived from the CCL19 promoter, and optionally, the regulatory element derived from the CCL19 promoter comprises the sequence of SEQ ID NO: 123 or 125.

[0488] Also provided herein is a heterologous construct for transitioning macrophages from an M2 state to an M1 state, comprising: (a) an engineered macrophage-specific promoter comprising (i) a regulatory element derived from a promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, or (ii) an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M2 macrophages compared to the activity of a corresponding macrophage-specific promoter lacking the excision in M2 macrophages. The present invention also includes (a) a macrophage-specific promoter, or (b) an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits higher activity in M2 macrophages compared to M1 or M0 macrophages, and (c) a heterologous payload encoding a master regulator of M1 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M1 macrophage polarization is a cytokine. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof. In some embodiments, the master regulator of M1 macrophage polarization is IRF7 or a derivative thereof. In some embodiments, the derivative of IRF7 comprises IRF7 operably linked to a degron domain.In some embodiments, the degron domain is selected from the group consisting of a PEST domain, an HCV NS4 degron, a GRR (residues 352-408 of human p105), a DRR (residues 210-295 of yeast Cdc34), a SNS (tandem repeats of SP2 and NB of influenza A or influenza B (SP2-NB-SP2)), a RPB (four copies of residues 1688-1702 of yeast RPB), a SPmix (a tandem repeat of SP1 and SP2 of the influenza A virus M2 protein), a tandem repeat of SP2 of the influenza A virus M2 protein, and a tandem repeat of SP2 of the yeast RPB. repeat (SP2-SP1-SP2-SP1-SP2)), NS2 (three copies of residues 79–93 of influenza A virus NS protein), ODC (residues 106–142 of ornithine decarboxylase), Nek2A, mouse ODC (residues 422–461), mouse ODC_DA (residues 422–461 of mODC containing D433A and D434A point mutations), APC / C degron, COP1 The degron domain is selected from E3 ligase-binding degron motifs, CRL4-Cdt2-binding PIP degrons, actinfilin-binding degrons, KEAP1-binding degrons, KLHL2- and KLHL3-binding degrons, MDM2-binding motifs, N-degrons, hydroxyproline modifications in hypoxia signaling, plant hormone-dependent SCF-LRR-binding degrons, SCF ubiquitin ligase-binding phosphodegrons, plant hormone-dependent SCF-LRR-binding degrons, DSGxxS (SEQ ID NO: 190) phospho-dependent degrons, Siah-binding motifs, SPOP SBC docking motifs, PCNA-binding PIP boxes, and derivatives thereof. In some embodiments, the degron domain is a PEST domain, and optionally, the PEST comprises the amino acid sequence of SEQ ID NO: 501 or a derivative thereof.In some embodiments, the engineered macrophage-specific promoter comprises a regulatory element selected from (i) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 420, or (ii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 427. In some embodiments, the engineered macrophage-specific promoter comprises a regulatory element having at least 95% sequence identity to SEQ ID NO: 420, and optionally 100% sequence identity to SEQ ID NO: 420. In some embodiments, the regulatory element is operably linked to a minTK minimal promoter or an SCP3 minimal promoter. In some embodiments, the engineered macrophage-specific promoter comprises a regulatory element having at least 95% sequence identity to SEQ ID NO: 427, and optionally having 100% sequence identity to SEQ ID NO: 427. In some embodiments, the regulatory element is operably linked to a minCMV promoter.

[0489] Also provided herein is a heterologous construct for stabilizing macrophages in an M2-polarized state, comprising: (a) either (i) a regulatory element derived from the promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, or (ii) an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M2 macrophages compared to the activity of a corresponding macrophage-specific promoter lacking the excision in M2 macrophages, or (iii) an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits higher activity in M2 macrophages compared to M1 or M0 macrophages; and (b) a heterologous payload encoding a master regulator of M2 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof. In some embodiments, the M2 state is an M2c state, an M2a state, or an M2b state.

[0490] In another aspect, provided herein is a vector comprising a heterologous construct according to any one of the above embodiments.

[0491] In another aspect, provided herein is a dual expression vector comprising a heterologous construct of any one of the above embodiments and a second construct comprising a nucleotide sequence encoding an activating immunoreceptor.

[0492] In another aspect, provided herein is an immunoresponsive cell comprising the heterologous construct, the vector, or the dual expression vector of any one of the above embodiments. In some embodiments, the immunoresponsive cell is selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor-infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells.

[0493] In some embodiments, the immunoresponsive cells are macrophages. In some embodiments, the macrophages are tumor-resident macrophages. In some embodiments, the immunoresponsive cells express an activating immunoreceptor. In some embodiments, the activating immunoreceptor comprises an antigen recognition receptor. In some embodiments, the immunoresponsive cells are autologous. In some embodiments, the immunoresponsive cells are allogeneic.

[0494] In another aspect, provided herein is a pharmaceutical composition comprising the vector of the above embodiments, the dual expression vector described in the above embodiments, the immunoresponsive cell of any one of the above embodiments, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

[0495] In another aspect, provided herein are methods for increasing expression of a target gene, the method comprising using an engineered macrophage-specific promoter described in any one of the above embodiments, a vector of the above embodiments, or a dual expression vector of the above embodiments to increase expression of the target gene. In some embodiments, the target gene is an immunomodulatory gene.

[0496] In another aspect, provided herein is a method of treating a subject in need thereof, the method comprising administering a therapeutically effective amount of a vector of the above embodiments, a dual expression vector according to the above embodiments, an immunoresponsive cell according to any one of the above embodiments, or a pharmaceutical composition according to the above embodiments.

[0497] In another aspect, provided herein is a kit for treating and / or preventing a disease or disorder, comprising an immunoresponsive cell according to any one of the above embodiments.

[0498] In another aspect, provided herein is a kit for treating and / or preventing tumors, comprising the immunoresponsive cells of any one of the above embodiments. In some embodiments, the kit further comprises instructions for using the immunoresponsive cells to treat and / or prevent tumors in a subject.

[0499] In another aspect, provided herein is a kit for treating and / or preventing tumors, comprising a pharmaceutical composition according to the above embodiments.

[0500] In another aspect, provided herein is a kit for treating and / or preventing a disease or disorder, comprising a pharmaceutical composition according to the above embodiments.

[0501] In some embodiments, the kit of any one of the above aspects further comprises instructions for using the pharmaceutical composition for treating and / or preventing a tumor in a subject.

[0502] The present disclosure further provides an engineered macrophage-specific promoter system comprising a regulatory element derived from the promoter of a gene selected from the group consisting of CCL19, CCR7, CXCL11, GBP5, IDO1, UBD, and UNQ6494.1, and a heterologous payload, wherein the regulatory element exhibits higher activity in M1 macrophages compared to M2 or M0 macrophages. In some embodiments, the regulatory element is or includes an enhancer region derived from the promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages. In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, cytokine, receptor, enzyme, chemokine, antibody, antibody fragment, miRNA, and shRNA. In some embodiments, the M2 macrophage is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages. In some embodiments, the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 132-138.

[0503] The present disclosure provides, in some embodiments, an engineered macrophage-specific promoter system comprising a regulatory element that is or includes an enhancer region derived from the promoter of a gene that is more highly expressed in M1 macrophages than in M2 or M0 macrophages, and a heterologous payload, wherein the regulatory element exhibits higher activity in M1 macrophages than in M2 or M0 macrophages. In some embodiments, the regulatory element is derived from the promoter of a gene selected from the group consisting of CCL19, CCR7, CXCL11, GBP5, IDO1, UBD, and UNQ6494.1. In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, cytokine, receptor, enzyme, chemokine, antibody, antibody fragment, miRNA, and shRNA. In some embodiments, the M2 macrophage is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages. In some embodiments, the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 132-138.

[0504] The present disclosure also provides an engineered macrophage-specific promoter system comprising a regulatory element derived from the promoter of a gene selected from the group consisting of CD28, SOCS3, PLXDC1, IL7R ZNF704, LNCAROD, MRC1, and ID3, and a heterologous payload, wherein the regulatory element exhibits higher activity in M2 macrophages compared to M1 or M0 macrophages. In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, cytokine, receptor, enzyme, chemokine, antibody, antibody fragment, miRNA, and shRNA. In some embodiments, the regulatory element is or includes an enhancer region derived from the promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, and in some embodiments, the M2 macrophages are selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages. In some embodiments, the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 139-141, 392, 393, and 414-419.

[0505] The present disclosure also provides, in some embodiments, an engineered macrophage-specific promoter system comprising a regulatory element that is or includes an enhancer region derived from the promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, and a heterologous payload, wherein the regulatory element exhibits higher activity in M2 macrophages compared to M1 or M0 macrophages. In some embodiments, the heterologous payload is selected from the group consisting of a transcription factor, cytokine, receptor, enzyme, chemokine, antibody, antibody fragment, miRNA, and shRNA. In some embodiments, the regulatory element is derived from the promoter of a gene selected from the group consisting of CD28, SOCS3, PLXDC1, IL7R ZNF704, LNCAROD, MRC1, and ID3. In some embodiments, the M2 macrophage (e.g., used as a comparison) is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages. In some embodiments, the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 139-141, 392, 393, and 414-419.

[0506] The present disclosure provides engineered macrophage-specific promoters comprising excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M1 macrophages compared to the activity of the corresponding macrophage-specific promoter lacking excision in M1 macrophages. In some embodiments, the corresponding macrophage-specific promoter lacking excision in M1 macrophages is a wild-type macrophage promoter, wherein the wild-type macrophage promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 132-138, and the engineered macrophage-specific promoter comprises a motif within the nucleotide sequence of SEQ ID NO: 132, including positions 63-73 of SEQ ID NO: 132, positions 80-102 of SEQ ID NO: 132, positions 14-16 of SEQ ID NO: 132, and positions 16-18 of SEQ ID NO: 132. positions 1 to 162, positions 212 to 222 of SEQ ID NO: 132, positions 229 to 251 of SEQ ID NO: 132, positions 307 to 361 of SEQ ID NO: 132, positions 365 to 376 of SEQ ID NO: 132, positions 559 to 571 of SEQ ID NO: 132, positions 617 to 633 of SEQ ID NO: 132, positions 782 to 799 of SEQ ID NO: 132, positions 852 to 871 of SEQ ID NO: 132, positions 886 to 920 of SEQ ID NO: 132, positions 933 to 959 of SEQ ID NO: 132, positions 1002 to 1028 of SEQ ID NO: 132, Positions 1032 to 1045 of SEQ ID NO: 132, positions 1064 to 1087 of SEQ ID NO: 132, positions 1169 to 1192 of SEQ ID NO: 132, positions 1212 to 1232 of SEQ ID NO: 132, positions 1257 to 1275 of SEQ ID NO: 132, positions 1310 to 1333 of SEQ ID NO: 132, positions 1381 to 1434 of SEQ ID NO: 132, positions 1698 to 1753 of SEQ ID NO: 132, positions 1783 to 1826 of SEQ ID NO: 132, positions 1909 to 1927 of SEQ ID NO: 132, positions 1946 to 1950 of SEQ ID NO: 132 the motif, and / or a motif within the nucleotide sequence of SEQ ID NO: 136, comprising a sequence selected from the group consisting of positions 133 to 144 of SEQ ID NO: 136, positions 200 to 217 of SEQ ID NO: 136, positions 225 to 247 of SEQ ID NO: 136, positions 303 to 325 of SEQ ID NO: 136, positions 332 to 342 of SEQ ID NO: 136, positions 391 to 413 of SEQ ID NO: 136, positions 423 to 460 of SEQ ID NO: 136, positions 467 to 477 of SEQ ID NO: 136;positions 693 to 717 of SEQ ID NO: 136, positions 738 to 761 of SEQ ID NO: 136, positions 838 to 861 of SEQ ID NO: 136, positions 1229 to 1246 of SEQ ID NO: 136, positions 1286 to 1309 of SEQ ID NO: 136, positions 1413 to 1431 of SEQ ID NO: 136, positions 1456 to 1473 of SEQ ID NO: 136, positions 1530 to 1544 of SEQ ID NO: 136, The motif, and / or a motif in the nucleotide sequence of SEQ ID NO: 137, comprising a sequence selected from the group consisting of positions 1577 to 1590 of SEQ ID NO: 136, positions 1816 to 1836 of SEQ ID NO: 136, positions 1852 to 1872 of SEQ ID NO: 136, and positions 1876 to 1896 of SEQ ID NO: 136, and the motif is selected from the group consisting of positions 43 to 60, positions 107 to 120 of SEQ ID NO: 137, positions 210 to 230 of SEQ ID NO: 137, positions 345 to 407 of SEQ ID NO: 137, positions 427 to 457 of SEQ ID NO: 137, positions 468 to 484, positions 560 to 582 of SEQ ID NO: 137 positions 730 to 746 of SEQ ID NO: 137, positions 809 to 820 of SEQ ID NO: 137, positions 827 to 837 of SEQ ID NO: 137, positions 858 to 878 of SEQ ID NO: 137, positions 1291 to 1302 of SEQ ID NO: 137, positions 1321 to 1341 of SEQ ID NO: 137, positions 1435 to 1463 of SEQ ID NO: 137, positions 1530 to 1541 of SEQ ID NO: 137, positions 1707 to 1718 of SEQ ID NO: 137, positions 1834 to 1863 of SEQ ID NO: 137, positions 1870 to 1882 of SEQ ID NO: 137, and positions 1913 to 1929 of SEQ ID NO: 137. In some embodiments, the excision comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif.

[0507] The present disclosure provides an engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits higher activity in M1 macrophages compared to M2 or M0 macrophages, or higher activity in M2 macrophages compared to M1 or M0 macrophages. In some embodiments, the engineered macrophage-specific promoter comprises at least two, at least three, at least four, or at least five regulatory elements. In some embodiments, each of the regulatory elements is the same or different. In some embodiments, the M2 macrophage is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages.

[0508] In some embodiments, the at least one regulatory element is a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs:297-313; a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs:372-390; a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs:440-443; The present invention includes a nucleotide sequence selected from a nucleotide sequence having at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 314 to 371, and a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 420 to 439.

[0509] In some embodiments, the provided engineered macrophage-specific promoter further comprises a minimal promoter operably linked to the engineered macrophage-specific promoter. In some embodiments, the minimal promoter is derived from a promoter selected from the group consisting of minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia responsive element, SMAD binding element, STAT3 binding site, minCMV, YB TATA, minTK, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats.

[0510] The present disclosure provides engineered macrophage-specific promoters comprising at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1-29, 81-82, 88-97, 119-122, 132-138, 142-163, 97-313, 139-141, 314-371, 390, 392-393, and 420-443. In some embodiments, the regulatory element or engineered macrophage-specific promoter is operably linked to a minimal promoter. In some embodiments, the minimal promoter comprises a sequence of a promoter selected from minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia response element, SMAD binding element, STAT3 binding site, minCMV, YB TATA, minTK, SCP3, YB-SCP3, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof. In some embodiments, the engineered macrophage-specific promoter system further comprises a translation start site. In some embodiments, the translation start site is or comprises a Kozak sequence.

[0511] In some embodiments, the regulatory element or engineered macrophage-specific promoter comprises a first transcriptional activating element set forth in SEQ ID NO:220, a second transcriptional activating element set forth in SEQ ID NO:222, a third transcriptional activating element set forth in SEQ ID NO:240, a fourth transcriptional activating element set forth in SEQ ID NO:254, and a fifth transcriptional activating element set forth in SEQ ID NO:256, and does not comprise at least one repression element selected from SEQ ID NO:226, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252. In some embodiments, the regulatory element or engineered macrophage-specific promoter further comprises a sixth transcriptional activating element set forth in SEQ ID NO:224 and / or a seventh transcriptional activating element set forth in SEQ ID NO:258. In some embodiments, the regulatory element or engineered macrophage-specific promoter further does not comprise SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:248, and SEQ ID NO:250. In some embodiments, the regulatory elements or engineered macrophage-specific promoter do not include repression elements such as those set forth in SEQ ID NO:226, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252.In some embodiments, the regulatory element or engineered macrophage-specific promoter is a sequence set forth in GTTAATGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTT (SEQ ID NO: 482), and a sequence set forth in TTTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483), or a sequence set forth in GCTCTTCTAAAAATATGCGAAATGAGGTTTTTAGGGAGGTGTAGGTATGGCTGAAGAAAATCAAGGTGAATGAAGACAAGATCAATTGAGAATGTAGTTTCAGAAATAGCAAAGAAGCCAAAGTTTGAGGAAGTTAAGTGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAG or a first transcriptional activation element set forth in SEQ ID NO:268 and a second transcriptional activation element set forth in SEQ ID NO:270, and does not comprise at least one repression element selected from SEQ ID NO:260, SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:266, SEQ ID NO:272, and SEQ ID NO:391, or from at least one, at least two, at least three, at least four, or at least five tandem repeats of SEQ ID NO:268 and SEQ ID NO:270. In some embodiments, the regulatory element or engineered macrophage-specific promoter further comprises a third transcriptional activation element set forth in SEQ ID NO:291 and / or a fourth transcriptional activation element set forth in SEQ ID NO:295.In some embodiments, the regulatory element or engineered macrophage-specific promoter does not comprise repression elements such as those set forth in SEQ ID NO: 262, SEQ ID NO: 264, SEQ ID NO: 272, and SEQ ID NO: 391. In some embodiments, the regulatory element or engineered macrophage-specific promoter further does not comprise SEQ ID NO: 260 and / or SEQ ID NO: 266.

[0512] The present disclosure provides heterologous constructs comprising any of the engineered macrophage-specific promoter systems described herein or any of the engineered macrophage-specific promoters described herein. In some embodiments, the engineered macrophage-specific promoter systems described herein or the engineered macrophage-specific promoters described herein are operably linked to a heterologous payload. In some embodiments, the heterologous payload is a polynucleotide comprising a nucleotide sequence encoding a polypeptide. In some embodiments, the polypeptide comprises at least one effector molecule. In some embodiments, the polypeptide comprises a first effector molecule and a second effector molecule. In some embodiments, the engineered macrophage-specific promoter comprises a regulatory element selected from a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 420 and a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 427. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a first effector molecule, a linker nucleotide sequence, and a nucleotide sequence encoding a second effector. In some embodiments, the linker nucleotide sequence encodes one or more 2A ribosomal skipping elements. In some embodiments, the one or more 2A ribosomal skipping elements comprise elements each selected from the group consisting of P2A, T2A, E2A, and F2A.

[0513] In some embodiments, the or each effector molecule is selected from a therapeutic class, the therapeutic class being selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, polynucleotide molecules, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, transcription factors, antibodies, peptides, and enzymes. In some embodiments, the transcription factor is a master regulator. In some embodiments, the transcription factor is a master regulator of M1 macrophage polarization. In some embodiments, the transcription factor is IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof. In some embodiments, the transcription factor is a master regulator of M2 macrophage polarization. In some embodiments, the or each effector molecule is or comprises a cytokine, chemokine, homing molecule, growth factor, or tumor microenvironment modifier. In some embodiments, the cytokine is selected from the group consisting of IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha. In some embodiments, the cytokine is a master regulator of M1 macrophage polarization. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the cytokine is a master regulator of M2 macrophage polarization. In some embodiments, the cytokine is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof. In some embodiments, the chemokine is selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and CXCL1.In some embodiments, the homing molecule is selected from the group consisting of anti-integrin α4, β7, anti-MAdCAM, CCR9, CXCR4, SDFI, MMP-2, CXCR1, CXCR7, CCR2, CCR4, and GPR15. In some embodiments, the growth factor is selected from the group consisting of FLT3L and GM-CSF. In some embodiments, the co-activating molecule is selected from the group consisting of c-Jun, 4-1BBL, and CD40L. In some embodiments, the tumor microenvironment modifier is selected from the group consisting of adenosine deaminase, TGF-beta inhibitor, immune checkpoint inhibitor, VEGF inhibitor, and HPGE2. In some embodiments, each of the first effector molecule and the second effector molecule is from a different therapeutic class. In some embodiments, each effector molecule is a human-derived effector molecule. In some embodiments, the cytokine is modified to include a membrane-binding domain. In some embodiments, the membrane-binding domain is or includes a transmembrane-intracellular domain or a transmembrane domain of a protein selected from the group consisting of PDGFR-beta, CD8, CD28, CD3 zeta chain, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, LNGFR, NKG2D, EpoR, TNFR2, B7-1, and BTLA, or a functional portion thereof. In some embodiments, the master regulator of M1 macrophage polarization is IRF7 or a derivative thereof. In some embodiments, the derivative of IRF7 includes IRF7 operably linked to a degron domain.In some embodiments, the degron domain is selected from the group consisting of a PEST domain, an HCV NS4 degron, a GRR (residues 352-408 of human p105), a DRR (residues 210-295 of yeast Cdc34), a SNS (tandem repeats of SP2 and NB of influenza A or influenza B (SP2-NB-SP2)), a RPB (four copies of residues 1688-1702 of yeast RPB), a SPmix (a tandem repeat of SP1 and SP2 of the influenza A virus M2 protein), a tandem repeat of SP2 of the influenza A virus M2 protein, and a tandem repeat of SP2 of the yeast RPB. repeat (SP2-SP1-SP2-SP1-SP2)), NS2 (three copies of residues 79–93 of influenza A virus NS protein), ODC (residues 106–142 of ornithine decarboxylase), Nek2A, mouse ODC (residues 422–461), mouse ODC_DA (residues 422–461 of mODC containing D433A and D434A point mutations), APC / C degron, COP1 The degron domain is selected from E3 ligase binding degron motif, CRL4-Cdt2 binding PIP degron, actinfilin binding degron, KEAP1 binding degron, KLHL2 and KLHL3 binding degron, MDM2 binding motif, N-degron, hydroxyproline modification in hypoxia signal transduction, plant hormone-dependent SCF-LRR binding degron, SCF ubiquitin ligase binding phosphodegron, plant hormone-dependent SCF-LRR binding degron, DSGxxS (SEQ ID NO: 190) phospho-dependent degron, Siah binding motif, SPOP SBC docking motif, PCNA binding PIP box, and its derivatives.In some embodiments, the degron domain is a PEST domain.In some embodiments, the PEST comprises the amino acid sequence of SEQ ID NO: 501 or its derivatives.

[0514] The present disclosure provides a heterologous construct for transitioning macrophages from the M1 state to the M2 state, comprising either a regulatory element derived from a promoter of a gene more highly expressed in M1 macrophages compared to M2 or M0 macrophages as provided herein, or an engineered macrophage-specific promoter as provided herein, and a heterologous payload encoding a master regulator of M2 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof. In some embodiments, the master regulator of M2 macrophage polarization is IL-10. In some embodiments, the M2 state is an M2c state, an M2a state, or an M2b state. In some embodiments, (a) is a regulatory element derived from the CCL19 promoter. In some embodiments, (a) comprises the nucleotide sequence of SEQ ID NO:132.

[0515] The present disclosure provides heterologous constructs for stabilizing macrophages in an M1 polarization state, comprising any of regulatory elements derived from promoters of genes that are more highly expressed in M1 macrophages compared to M2 or M0 macrophages. In some embodiments, the heterologous constructs comprise a regulatory element derived from the UBD1 promoter, IDO1 promoter, or CCL19 promoter described herein, or an engineered macrophage-specific promoter described herein, and a heterologous payload encoding a master regulator of M1 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M1 macrophage polarization is a cytokine. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof.

[0516] The present disclosure provides a heterologous construct for transitioning macrophages from an M2 state to an M1 state, comprising a regulatory element derived from a promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, as described herein, or one of the engineered macrophage-specific promoters described herein, and a heterologous payload encoding a master regulator of M1 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the master regulator of M1 macrophage polarization is a cytokine. In some embodiments, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1alpha, IL-1beta, or a derivative thereof. In some embodiments, the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof.

[0517] The present disclosure provides a heterologous construct for stabilizing macrophages in an M2 polarization state, comprising a regulatory element derived from a promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, as described herein, or one of the engineered macrophage-specific promoters described herein, and a heterologous payload encoding a master regulator of M2 macrophage polarization, wherein the regulatory element or engineered macrophage-specific promoter (a) is operably linked to the heterologous payload and configured to induce expression of the heterologous payload. In some embodiments, the M2 state is an M2c state, an M2a state, or an M2b state. In some embodiments, the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof.

[0518] The present disclosure provides vectors comprising any of the heterologous constructs described herein.

[0519] The present disclosure provides dual expression vectors comprising any of the heterologous constructs provided herein and a second construct comprising a nucleotide sequence encoding an activating immunoreceptor.

[0520] The present disclosure provides immunoresponsive cells comprising any heterologous construct described herein, any vector described herein, or any dual expression vector described herein. In some embodiments, the immunoresponsive cells are selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor-infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelets, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells. In some embodiments, the immunoresponsive cells are macrophages. In some embodiments, the macrophages are tumor-resident macrophages. In some embodiments, the immunoresponsive cells are autologous or allogeneic. In some embodiments, the immunoresponsive cells express an activating immunoreceptor. In some embodiments, the activating immunoreceptor comprises an antigen-recognition receptor.

[0521] The present disclosure provides pharmaceutical compositions comprising any vector described herein, any dual expression vector described herein, or any immunoresponsive cell described herein, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

[0522] The present disclosure provides methods of increasing expression of a target gene, the methods comprising using any engineered macrophage-specific promoter described herein, any vector described herein, or any dual expression vector described herein to increase expression of the target gene. In some embodiments, the target gene is an immunomodulatory gene.

[0523] The present disclosure also provides a method of treating a subject in need thereof, the method comprising administering a therapeutically effective amount of any vector described herein, any dual expression vector described herein, any immunoresponsive cell described herein, or any pharmaceutical composition described herein.

[0524] The present disclosure provides a kit for treating and / or preventing a disease or disorder, comprising any of the immunoresponsive cells described herein or any of the pharmaceutical compositions described herein. In some embodiments, the kit further comprises instructions for using the immunoresponsive cells to treat and / or prevent a disease or disorder in a subject. In some embodiments, the disease is cancer. [Brief explanation of the drawings]

[0525] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0526] [Figure 1] Figure 1 shows the fluorescence levels of a fluorescent reporter controlled by a native promoter associated with the macrophage phenotype linked to a fluorescent protein reporter. The x-axis shows the reporter expression level from cells transduced with that promoter-reporter pair normalized to cells transduced without virus (NV). The y-axis shows the activity of M1-polarized cells divided by either M0 (circles) or M2c (squares). [Figure 2] FIG. 2 is a schematic diagram of the manipulation of native macrophage promoter sequences and the selective excision of regulatory motifs. [Figure 3]Figure 3 shows the fluorescence levels of a fluorescent reporter regulated by an engineered macrophage-specific promoter, comparing M1 and M2 macrophage selectivity. The color (grayscale) indicates the reporter expression level from cells transduced with that promoter-reporter pair normalized to cells transduced without virus (NV). [Figure 4] Figure 4 shows the fluorescence levels of fluorescent reporters regulated by selected engineered macrophage-specific promoters. Color (grayscale) indicates reporter expression levels from cells transduced with that promoter-reporter pair normalized to cells transduced without virus (NV). The x-axis shows expression in M1-polarized cells divided by M0 polarization, and the y-axis shows expression in M1-polarized cells divided by M2c polarization. SB07683 is a constitutive control, SB06353 is the original native promoter, and SB08123–SB08126 are engineered promoters. [Figure 5] Figure 5 shows the rescreening of native promoters associated with the macrophage phenotype linked to fluorescent protein reporters using the VPX accessory protein during lentiviral packaging for improved transduction efficiency. [Figure 6] Figure 6 shows the fluorescence of selected native macrophage promoter sequences determined from bulk RNA-seq data identified from both protein-coding and non-coding genes. [Figure 7] Figure 7 shows the fluorescence levels of fluorescent reporters regulated by selected native M2 macrophage promoters. The x-axis shows reporter expression levels from cells transduced with that promoter-reporter pair normalized to cells transduced without virus (NV). The y-axis shows activity of M2c-polarized cells divided by either M0 (circles) or M1 (triangles). [Figure 8]FIG. 8 is a schematic diagram showing engineered enhancers made with arrays of transcription factor (TF) binding sites up to 100 bp in length and selected based on motif enrichment analysis. [Figure 9] Figure 9 is a schematic diagram of primer binding sites for MPRA-based next-generation sequencing analysis of our integrated promoter library constructs. Open arrows indicate primer binding sites used in next-generation sequencing (NGS). [Figure 10] FIG. 10 outlines the general protocol for screening engineered promoter sequences. [Figure 11A] Figures 11A-C show engineered promoters identified from a promoter library that are selective for the M1 vs. M0 polarization state (Figure 11A), the M2c vs. M0 polarization state (Figure 11B), and the M1 vs. M2c polarization state (Figure 11C). [Figure 11B] See legend to Figure 11A. [Figure 11C] See legend to Figure 11A. [Figure 12] Figures 12A-C show heat maps of engineered promoters identified from the promoter library that are selective for M1 vs. M0 polarization states (Figure 12A), M2c vs. M0 polarization states (Figure 12B), and M1 vs. M2c polarization states (Figure 12C), demonstrating distinct patterns of motif enrichment. [Figure 13-1] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-2] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-3] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-4] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-5] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-6] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-7] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-8] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-9] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-10] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-11] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-12] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-13] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-14] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-15] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-16] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-17] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 13-18] FIG. 13 provides selected hits from the SB07479 targeted M1 library screen. [Figure 14] FIG. 14 shows macrophage polarization towards M1 or M2 states, and phenotypic plasticity of macrophages between M1 and M2 states. [Figure 15] FIG. 15 shows exemplary promoter system designs to maintain macrophages in a stable M2 state or to direct M1 macrophages from an M1 to an M2 phenotype. [Figure 16] FIG. 16 shows exemplary promoter system designs to maintain macrophages in a stable M1 state or to direct M2 macrophages from an M2 to an M1 phenotype. [Figure 17] Figure 17 shows polarization state-selective activity and promoter strength analyzed by flow cytometry. The color scale indicates promoter strength (normalized to the EFS constitutive promoter). The x-axis indicates M1 / M0 state selectivity, and the y-axis indicates M1 / M2c state selectivity. SB07683 is a constitutive control, SB09385 contains the original native IDO1 promoter sequence (has the same IDO1 promoter sequence as SB05125), and SB09386–SB09405 contain promoter-truncated variants of the IDO1 promoter (see Tables 1 and 2). [Figure 18] Figure 18 shows polarization state-selective activity and promoter strength analyzed by flow cytometry. The color scale indicates promoter strength (normalized to the EFS constitutive promoter). The x-axis indicates M1 / M0 state selectivity, and the y-axis indicates M1 / M2c state selectivity. SB07683 is a constitutive control, SB09406 contains the original native UBD1 promoter sequence (has the same UBD1 promoter sequence as SB05132), and SB09407–SB09425 contain truncated variants of the UBD1 native promoter (see Tables 1 and 2). [Figure 19] Figure 19 shows polarization state-selective activity and promoter strength analyzed by flow cytometry. The color scale indicates promoter strength (normalized to the EFS constitutive promoter). The x-axis indicates M1 / M0 state selectivity, and the y-axis indicates M1 / M2c state selectivity. SB07683 is a constitutive control. [Figure 20A]Figures 20A-B show the results of an experiment screening for candidate master regulators of M1 state polarization in macrophages. Figure 20A shows the principal component loadings of the quantitative variables, and Figure 20B shows the principal component analysis of the candidate master regulators. [Figure 20B] See legend to Figure 20A. [Figure 21] FIG. 21 shows a schematic of the experimental design for candidate M1 phenotype locking circuit screening. [Figure 22A] Figures 22A-C show the results of an experiment screening candidate M1 phenotype-locking circuits. Figure 22A shows the principal component loadings of the quantitative variables. Figure 22B shows the aggregate phenotype in the two-dimensional principal component space of all candidate M1-locking circuits across all polarization conditions. Figure 22C shows the aggregate phenotype in the two-dimensional principal component space of selected candidate M1-locking circuits, as well as positive controls. [Figure 22B] See legend to Figure 22A. [Figure 22C] See legend to Figure 22A. [Figure 23] Figure 23 shows polarization state-selective activity and promoter strength analyzed by GFP expression. The color scale indicates promoter strength as fold change relative to no virus. [Figure 24] Figure 24 shows IL-10 expression induced by M1 polarizing conditions compared to M0 polarizing conditions. M0, M1 low, M1+ (without LPS), and M1++ (with LPS) are shown for each time point from left to right, respectively. [Figure 25] FIG. 25 shows the assessment of changes in cell phenotype due to phenotypic switch circuit activity. [Figure 26] FIG. 26 shows the results of a new M2 state-selective promoter screen. [Figure 27] FIG. 27 shows the results of an additional round of screening of new M2 state-selective promoters. [Figure 28A] Figures 28A and 28B show state-selective promoter activity and strength of engineered M2 promoters derived from ATAC-Seq nominated enhancers. [Figure 28B] See legend to Figure 28A. [Figure 29] FIG. 29 shows the state-selective promoter activity and strength of the engineered M2 promoter derived from the MPRA library screen. [Figure 30] Figure 30 shows state-selective promoter activity and strength of the engineered M2 promoter derived from the re-engineered ATAC-Seq nominated enhancer. [Figure 31] Figure 31 shows the promoter activity of enhancers 1-8 paired with alternative core promoters, minPros 1-6. In each section (separated by dashed vertical lines), the activity of minPRO paired with enhancers 1-8 is shown from left to right, respectively (e.g., minPRO1 with enhancer 1, minPRO1 with enhancer 2, minPRO1 with enhancer 3, etc.). Each group of three identically colored bars represents a single enhancer and minimal promoter pair tested in the M0, M1, and M2c polarization states, respectively (the x-axis in Figure 31 shows only the M0 label, while the promoter activity of each construct is shown from left to right as three identically colored lines representing activity in the M0, M1, and M2c polarization states). [Figure 32] Figure 32 shows state-selective promoter activity and strength of selected enhancers (selected from enhancers 1-8) paired with alternative core promoters (selected from minPros 1-6). [Figure 33] Figure 33 shows state-selective promoter activity and strength of selected enhancers (selected from enhancers 1-8) paired with alternative core promoters (selected from minPros 1-6). [Figure 34A]Figure 34A shows functional regions of the IDO1 native promoter sequence mapped from the excision screening experiment of Example 2. Illustrated activating elements include SB09386, SB09387, SB09396, SB09403, and SB09404. Illustrated repressing elements include SB09389, SB09393, SB09394, SB09395, SB09399, and SB09402. Illustrated non-specific activating elements include SB09388 and SB09405. [Figure 34B] Figure 34B shows an exemplary map of selected re-engineered IDO1 promoters (construct IDs SB12087, SB12090, and SB12091). Illustrated activating elements include SB09386, SB09387, SB09396, SB09403, and SB09404. Illustrated repressing elements include SB09389, SB09393, SB09394, SB09395, SB09399, and SB09402. Illustrated non-specific activating elements include SB09388 and SB09405. [Figure 34C] FIG. 34C shows the state-selective promoter activity and strength of selected re-engineered IDO1 promoters. [Figure 34D] Figure 34D shows the state-selective promoter activity and strength of selected re-engineered IDO1 promoters compared to the native IDO1 promoter and a single truncated IDO1 promoter. The third generation Pros of SB12087, SB12090, and SB12091 are shown in the graph. [Figure 35A] Figure 35A shows functional regions of the UBD1 native promoter sequence mapped from the excision screening experiment in Example 3. Activating elements illustrated include SB09411, SB09412, SB09423, and SB09425. Leaky elements illustrated include SB09407, SB09408, SB09409, SB09410, SB09413, and SB09414. [Figure 35B]Figure 35B shows an exemplary map of selected re-engineered UBD1 promoters (construct IDs SB12093, SB12094, SB12095, SB12096, SB12097, SB12098, and SB12099). Illustrated activating elements include SB09411, SB09412, SB09423, and SB09425. Illustrated leaky elements include SB09407, SB09408, SB09409, SB09410, SB09413, and SB09414. [Figure 35C] Figure 35C shows the state-selective promoter activity and strength of selected re-engineered UBD1 promoters. [Figure 35D] FIG. 35D shows the state-selective promoter activity and strength of selected re-engineered UBD1 promoters compared to the native UBD1 promoter and the single truncated UBD1 promoter. [Figure 36] FIG. 36 shows the expression of M1-associated markers in M0 polarized cells previously transduced with constructs expressing soluble IFNg, bound IFNg, or mCherry under the control of the constitutive EFS promoter. [Figure 37] FIG. 37 shows the expression of M2-associated markers in M0 and M2c polarized cells previously transduced with constructs expressing soluble IFNg, bound IFNg, or mCherry under the control of the constitutive EFS promoter. [Figure 38] Figure 38 shows the aggregate phenotype in two-dimensional principal component space of selected candidate M1-locked circuits expressing soluble IFNg across three polarization conditions: M0 "basal," M1→M0 "repolarization," and M1→M01 "target" conditions. [Figure 39] Figure 39 shows the aggregate phenotype in two-dimensional principal component space of selected candidate M1-locked circuits expressing soluble IFNg across three polarization conditions: M2c "polarized", M1→M2c "transpolarized", and M1→M1 "targeted". [Figure 40]Figure 40 shows the aggregate phenotype in two-dimensional principal component space of selected candidate M1-locked circuits expressing membrane-bound IFNg across three polarization conditions: M0 "basal," M1→M0 "repolarization," and M1→M1 "target" conditions. [Figure 41] Figure 41 shows the aggregate phenotype in two-dimensional principal component space of selected candidate M1-locked circuits expressing membrane-bound IFNg across three polarization conditions: M2c "polarized", M1→M2c "transpolarized", and M1→M1 "targeted". [Figure 42] Figure 42 shows the performance of SB11463 against TNF-alpha, GRO-alpha, and IL-6. [Figure 43] Figure 43 shows the performance of SB11503 against TNF alpha, GRO alpha, and IL6. [Figure 44] Figures 44A and 44B show the performance of soluble and membrane-bound IFNg payload gene circuits in locking TNFalpha production under repolarizing conditions (M1→M0). [Figure 45] Figures 45A and 45B show the performance of soluble and membrane-bound IFNg payload gene circuits in locking TNFalpha production under transpolarizing conditions (M1→M2c). [Figure 46A] Figures 46A-46D show the results of experiments testing various M2→M1 phenotype switch constructs. [Figure 46B] See legend to Figure 46A. [Figure 46C] See legend to Figure 46A. [Figure 46D] See legend to Figure 46A. DETAILED DESCRIPTION OF THE INVENTION

[0527] definition Terms used in the claims and specification, unless otherwise specified, are defined as set forth below.

[0528] The term "macrophage-specific promoter" refers to a promoter determined to have higher activity in one macrophage polarization state than in another. Macrophages can transition between different polarization states, such as M1 or M2 macrophage polarization states. For example, in some embodiments, a macrophage-specific promoter has higher activity in M1-polarized macrophages compared to M2-polarized macrophages. In some embodiments, polarization of M2 macrophages can transition M2 macrophages to different M2 macrophage subtypes in response to stimulatory cues. These may include, but are not limited to, M2a, M2b, or M2c subtypes.

[0529] The term "ameliorating" refers to any therapeutically beneficial result in the treatment of a disease state, for example, a cancer disease state, including prevention, reduction in severity or progression, remission, or cure thereof.

[0530] The term "in vitro" refers to processes that occur in living cells grown separate from a living organism, for example, grown in tissue culture.

[0531] The term "in vivo" refers to a process that occurs within a living organism.

[0532] As used herein, the term "mammal" includes both human and non-human animals, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0533] The term "percent identity" in the context of two or more nucleic acid or polypeptide sequences refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence, have a certain percentage of the same nucleotides or amino acid residues, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0534] For sequence comparison, typically, one sequence acts as the reference sequence with which test sequence is compared.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, and if necessary, subsequence coordinates are designated, and sequence algorithm program parameters are designated.By sequence comparison algorithm, then, based on designated program parameters, the sequence identity percentage of test sequence and reference sequence is calculated.

[0535] Optimal alignment of sequences for comparison can be achieved, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0536] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0537] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0538] The term "therapeutically effective amount" is an amount effective for ameliorating symptoms of disease. A therapeutically effective amount can be a "prophylactically effective amount" since prevention can be considered treatment.

[0539] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0540] Polarization-specific promoters and truncation variants In one aspect, described herein are polarization state-specific promoters (e.g., M1, M2, M0) for use in engineered macrophages.

[0541] As used herein, "excision" refers to deletion using any means of nucleotide deletion known in the art (e.g., molecular cloning, CRISPR, etc.).Excision can further include replacing a segment of nucleotide sequence with a transcriptionally inactive segment of the same length.In some embodiments, excision of nucleotide motif increases promoter activity and / or selectivity (e.g., promoter downstream transcription level after stimulation), and the increase in activity and / or selectivity is compared with the promoter that lacks such excision.

[0542] Methods for quantifying transcription levels are known in the art and include, but are not limited to, mRNA analysis using reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), fluorescent reporters, colorimetric reporters, etc. In some embodiments, excision increases inducibility by at least 0.5-fold, at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold. It is contemplated herein that changes in the inducibility of engineered promoters may depend on the test system, e.g., the cell type containing the promoter.

[0543] In some embodiments, the excision comprises the substitution of a second nucleotide motif at the site of excision (i.e., a second nucleotide motif sequence is inserted at the site of excision). In some embodiments, the introduction of the second nucleotide motif at the excision site does not introduce a new regulatory site (e.g., a transcription factor binding site) in the engineered promoter. Such engineered promoters that comprise a deletion or substitution of a nucleotide motif at the site of excision, as provided herein, are referred to herein as "excision variants."

[0544] In some embodiments, any of the promoters described herein may further comprise a translation start site, e.g., a consensus Kozak sequence, at the 3' end of the promoter. An exemplary consensus Kozak sequence may be or may include the nucleotide sequence GCCACC. In some embodiments, the translation start site (e.g., Kozak sequence) comprises a spacer sequence adjacent to the 5' and / or 3' end. In some embodiments, the spacer sequence comprises the nucleotide sequence ACGCGTACCGGTGTC (SEQ ID NO: 496). In some embodiments, the translation start site with an adjacent spacer sequence comprises the nucleotide sequence ACGCGTACCGGTGTCGCCACC (SEQ ID NO: 497). In some embodiments, the promoters described herein do not comprise a translation start site.

[0545] The sequences of exemplary native and engineered promoters are provided below in Table 1. The sequences of the wild-type excision motif and the second nucleotide motif used to substitute for the excision variant (where appropriate) are provided in Table 2.

[0546] Table 1. DNA sequences of exemplary native and engineered promoters TIFF2025540186000002.tif213164TIFF2025540186000003.tif255160TIFF2025540186000004.tif255160TIFF2025540186000005.tif255159TIFF2025540186000006.tif255160TIFF2025540186000007.tif255159TIFF2025540186000008.tif255160TIFF2025540186000009.tif255159TIFF2025540186000010.tif255160TIFF2025540186000011.tif255160TIFF2025540186000012.tif255159TIFF2025540186000013.tif255160TIFF2025540186000014.tif255159TIFF2025540186000015.tif255160TIFF2025540186000016.tif255159TIFF2025540186000017.tif255160TIFF2025540186000018.tif255159TIFF2025540186000019.tif255160TIFF2025540186000020.tif255160TIFF2025540186000021.tif255159TIFF2025540186000022.tif255160TIFF2025540186000023.tif255159TIFF2025540186000024.tif255160TIFF2025540186000025.tif255159TIFF2025540186000026.tif255160TIFF2025540186000027.tif255159TIFF2025540186000028.tif255160TIFF2025540186000029.tif255160TIFF2025540186000030.tif255159TIFF2025540186000031.tif255160TIFF2025540186000032.tif255159TIFF2025540186000033.tif255160TIFF2025540186000034.tif255159TIFF2025540186000035.tif247154TIFF2025540186000036.tif255159TIFF2025540186000037.tif255160TIFF2025540186000038.tif255160TIFF2025540186000039.tif255159TIFF2025540186000040.tif255160TIFF2025540186000041.tif255159TIFF2025540186000042.tif255160TIFF2025540186000043.tif255159TIFF2025540186000044.tif255160TIFF2025540186000045.tif255159TIFF2025540186000046.tif255160TIFF2025540186000047.tif255160TIFF2025540186000048.tif255159TIFF2025540186000049.tif255160TIFF2025540186000050.tif255159TIFF2025540186000051.tif255160TIFF2025540186000052.tif255159TIFF2025540186000053.tif255160TIFF2025540186000054.tif255159TIFF2025540186000055.tif255160TIFF2025540186000056.tif255160TIFF2025540186000057.tif255159TIFF2025540186000058.tif255160TIFF2025540186000059.tif255159TIFF2025540186000060.tif255160TIFF2025540186000061.tif255159TIFF2025540186000062.tif255160TIFF2025540186000063.tif255159TIFF2025540186000064.tif255160TIFF2025540186000065.tif255159TIFF2025540186000066.tif255160TIFF2025540186000067.tif127164.

[0547] (Table 2) DNA sequences of the wild-type excision motif and second nucleotide motif for promoter excision variants with substitutions described in Table 1 above. For clarity: SB07097-SB07121 are promoter excision variants of SB05116, SB09386-SB09405 are promoter excision variants of SB05125, and SB09407-SB09425 are promoter excision variants of SB05132. TIFF2025540186000068.tif113166TIFF2025540186000069.tif255160TIFF2025540186000070.tif255159TIFF2025540186000071.tif255162

[0548] In some embodiments, a promoter of this disclosure may comprise one or more transcriptional activation elements. In some embodiments, the transcriptional activation element is or comprises a nucleotide sequence as set forth in Table 2. In some embodiments, a promoter of this disclosure comprises at least one transcriptional activation element. In some embodiments, a promoter of this disclosure comprises at least two transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least three transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least four transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least five transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least six transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least seven transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least eight transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least nine transcriptional activation elements. In some embodiments, a promoter of this disclosure comprises at least 10 transcriptional activation elements. In some embodiments, two or more transcriptional activation elements are contiguous. In some embodiments, two or more transcriptional activation elements are non-contiguous.

[0549] In some embodiments, a promoter of this disclosure does not contain one or more repression elements. In some embodiments, the repression element is or contains a nucleotide sequence set forth in Table 2. In some embodiments, a promoter of this disclosure does not contain at least one repression element. In some embodiments, a promoter of this disclosure does not contain at least two repression elements. In some embodiments, a promoter of this disclosure does not contain at least three repression elements. In some embodiments, a promoter of this disclosure does not contain at least four repression elements. In some embodiments, a promoter of this disclosure does not contain at least five repression elements. In some embodiments, a promoter of this disclosure does not contain at least six repression elements. In some embodiments, a promoter of this disclosure does not contain at least seven repression elements. In some embodiments, a promoter of this disclosure does not contain at least eight repression elements. In some embodiments, a promoter of this disclosure does not contain at least nine repression elements. In some embodiments, a promoter of this disclosure does not contain at least ten repression elements. In some embodiments, two or more repression elements are contiguous. In some embodiments, two or more repression elements are non-contiguous.

[0550] In some embodiments, a promoter of the present disclosure may comprise an excision of at least two nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least three nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least four nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least five nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least six nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least seven nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least eight nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least nine nucleotide motifs relative to a promoter from Table 1. In some embodiments, a promoter of the present disclosure may comprise an excision of at least ten nucleotide motifs relative to a promoter from Table 1. In some embodiments, the nucleotide motifs are selected from Table 2. In certain embodiments, the promoters of the present disclosure comprise excisions and substitutions of nucleotide motifs as shown in Table 2.

[0551] In some embodiments, an engineered promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the nucleotide motif is selected from Table 2.

[0552] In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 143. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 144. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 145. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 146. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 147. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 148. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 149.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 150. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 151. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 152. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 153. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 154. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 155. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 156.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 157. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 158. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 159. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 160. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 161. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 162. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 163.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3.

[0553] In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 143. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 144. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 145. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 146. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 147. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 148. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 149. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 150. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 151. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 152. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 153. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 154. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 155. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 156. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 157. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 158. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 159. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 160.In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 161. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 162. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 163. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 3.

[0554] In some embodiments, an engineered promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 136. In some embodiments, the nucleotide motif is selected from Table 2.

[0555] In some embodiments, an engineered promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 392. In some embodiments, the nucleotide motif is selected from Table 2.

[0556] In some embodiments, an engineered promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 393. In some embodiments, the nucleotide motif is selected from Table 2.

[0557] In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 8. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 9. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:10.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 12. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 13. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 15. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 16. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:17.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 18. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 19. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 22. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 23. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:24.

[0558] In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 456. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 457. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 458.

[0559] In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 4. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 15. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 22.In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 24. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 456. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 457. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 458.

[0560] In some embodiments, an engineered promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, an engineered promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 137. In some embodiments, the nucleotide motif is selected from Table 2.

[0561] In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 25. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 27. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 28. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 29. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 30. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:81.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 82. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 88. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 89. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 90. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 91. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 92. In some embodiments, an engineered promoter excision variant of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:96.In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 97. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 119. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 120. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 121. In some embodiments, engineered promoter excision variants of the present disclosure comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 122.

[0562] In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 459. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 460. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 461. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 462. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 463. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 464.In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:465.

[0563] In some embodiments, promoter truncation variants of the present disclosure do not comprise a substitution at the excision. In some embodiments, promoter truncation variants of the present disclosure comprise a deletion at the excision. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence selected from the group having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 297-390. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 297. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 298. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 299.

[0564] In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 25. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 26. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 27. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 28. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 29. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 30. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 81. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 82. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 88. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 89. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 90. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 91. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 92. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 96. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 97. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 119. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 120. In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 121.In some embodiments, an engineered promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 122.

[0565] In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 459. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 460. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 461. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 462. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 463. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 464. In some embodiments, an engineered macrophage-specific promoter or macrophage-specific promoter system of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 465.

[0566] In some embodiments, the promoter excision variants of the present disclosure do not comprise a substitution at the excision, hi some embodiments, the promoter excision variants of the present disclosure comprise a deletion at the excision.

[0567] In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 297-390. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 297. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 298. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 299.

[0568] In some embodiments, an engineered promoter (e.g., a promoter truncation variant or an engineered promoter) of the present disclosure comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 297-390. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 297. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 298. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 299.

[0569] In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 297. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 298. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 299. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 301. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 302. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:303.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 304. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 305. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 306. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 307. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 308. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 309. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:310.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 311. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 312. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 313. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 314. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 315. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 316. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:317.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 318. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 319. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 320. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 321. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 322. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 323. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:324.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 325. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 326. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 327. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 328. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 329. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 330. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:331.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 332. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 333. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 334. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 335. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 336. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 337. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 338. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 339. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 340. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:341.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 342. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 343. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 344. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 345. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 346. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 347. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:348.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 349. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 350. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 351. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 352. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 353. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 354. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:355.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 356. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 357. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 358. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 359. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 360. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 361. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:362.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 363. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 364. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 365. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 366. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 367. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 368. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:369.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 370. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 371. In some embodiments, an engineered promoter of the present disclosure comprises at least 80%, at least 85%, or at least 100% sequence identity to SEQ ID NO: 372. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 373. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 374. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 375. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 376. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 377. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:378.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 379. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 380. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 381. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 382. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 383. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 384. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:385.In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 386. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 387. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 388. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 389. In some embodiments, an engineered promoter of the present disclosure comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 390.

[0570] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 300. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 301. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 302. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 303. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 304.

[0571] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 305. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 306. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 307. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 308. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 309.

[0572] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 310. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 311. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 312. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 313. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 314. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 315. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 316. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 317. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 318. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 319. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 320. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 321. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO:322.

[0573] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 323. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 324. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 325. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 326. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 327.

[0574] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 328. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 329. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 330. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 331. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 332. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 333. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 334. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 335. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 336. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 337. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 338. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 339. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 340. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 341. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 342. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 343. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 344. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 345. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 346. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 347. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 348.In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 349. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 350. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 351. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 352. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 353. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 354. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 355. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 356. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 357. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 358. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 359. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 360. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 361. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 362. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 363. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 364. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 365. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 366. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 367. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 368. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 369.In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 370. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 371. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 372. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 373. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 374. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 375. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 376. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 377. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 378. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 379. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 380. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 381. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 382. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 383. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 384. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 385. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 386. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 387. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 388. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 389. In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 390.

[0575] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence set forth in GTTAATGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTT (SEQ ID NO: 482) and the nucleotide sequence set forth in TTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483).

[0576] In some embodiments, an engineered promoter of the present disclosure comprises the nucleotide sequence set forth in GCTCTTCTAAAAATATGCGAAATGAGGTTTTTAGGGAGGTGTAGGTATGGCTGAAGAAAATCAAGGTGAATGAAGACAAGATCAATTGAGAATGTAGTTTCAGAAATAGCAAAGAAGCCAAAGTTTGAGGAAGTTAAGTGGCTAGGGATAACATTGAGGCACTAAAGCATTATTGGTTCTGCAGTCAAGGGTAGGATAGATTGTTTTTTTTTTTTTTGAGACGGAGTCTCACTCTGCTGCCCAGGC (SEQ ID NO: 484), the nucleotide sequence set forth in ATTTTGGTTTCAGTTTTCCTTAC (SEQ ID NO: 240), or the nucleotide sequence set forth in TTTGTGGTTTTATTGGTTTTCATATTACAAACAAAGAAACTAGAAAATGAAACCATTCCAAAAGTGGAAGTAATTTCTCA (SEQ ID NO: 483).

[0577] In some embodiments, an engineered promoter of the present disclosure comprises a first transcriptional activator element set forth in SEQ ID NO: 220, a second transcriptional activator element set forth in SEQ ID NO: 222, a third transcriptional activator element set forth in SEQ ID NO: 240, a fourth transcriptional activator element set forth in SEQ ID NO: 254, and a fifth transcriptional activator element set forth in SEQ ID NO: 256. In some embodiments, an engineered promoter of the present disclosure comprises a first transcriptional activator element set forth in SEQ ID NO: 220, a second transcriptional activator element set forth in SEQ ID NO: 222, a third transcriptional activator element set forth in SEQ ID NO: 240, a fourth transcriptional activator element set forth in SEQ ID NO: 254, and a fifth transcriptional activator element set forth in SEQ ID NO: 256, and does not comprise at least one repression element selected from the following: SEQ ID NO: 226, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 246, and SEQ ID NO: 252. In some embodiments, an engineered promoter of the present disclosure comprises a first transcriptional activation element set forth in SEQ ID NO:220, a second transcriptional activation element set forth in SEQ ID NO:222, a third transcriptional activation element set forth in SEQ ID NO:240, a fourth transcriptional activation element set forth in SEQ ID NO:254, and a fifth transcriptional activation element set forth in SEQ ID NO:256, and does not comprise repression elements set forth in SEQ ID NO:226, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252. In some embodiments, the engineered promoter further comprises a sixth transcriptional activation element set forth in SEQ ID NO:224. In som...

Claims

1. 1. An engineered macrophage-specific promoter system, comprising: a. a regulatory element derived from the promoter of a gene selected from the group consisting of CCL19, CCR7, CXCL11, GBP5, IDO1, UBD, and UNQ6494.1; b. Optionally, a heterologous payload selected from the group consisting of a transcription factor, a cytokine, a receptor, an enzyme, a chemokine, an antibody, a fragment of an antibody, a miRNA, and an shRNA. wherein the regulatory element exhibits higher activity in M1 macrophages compared to M2 or M0 macrophages, and the regulatory element is or comprises an enhancer region derived from a promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages; Optionally, the M2 macrophage is selected from the group consisting of M2a macrophage, M2b macrophage, and M2c macrophage, and optionally the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 132-138; The engineered macrophage-specific promoter system.

2. 1. An engineered macrophage-specific promoter system, comprising: a. a regulatory element derived from the promoter of a gene selected from the group consisting of CD28, SOCS3, PLXDC1, IL7R ZNF704, LNCAROD, MRC1, and ID3; b. Optionally, a heterologous payload selected from the group consisting of a transcription factor, a cytokine, a receptor, an enzyme, a chemokine, an antibody, a fragment of an antibody, a miRNA, and an shRNA. Including, the regulatory element exhibits higher activity in M2 macrophages compared to M1 or M0 macrophages, and the regulatory element is or comprises an enhancer region derived from a promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, optionally wherein the M2 macrophage is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages, and optionally wherein the regulatory element comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 139-141, 392, 393, and 414-419; The engineered macrophage-specific promoter system.

3. an engineered macrophage-specific promoter comprising an excision of at least one nucleotide motif, wherein the excision increases the specific activity of the engineered macrophage-specific promoter in M1 macrophages compared to the activity of a corresponding macrophage-specific promoter lacking excision in M1 macrophages; optionally, the corresponding macrophage-specific promoter lacking excision in M1 macrophages is a wild-type macrophage promoter, wherein the wild-type macrophage promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 132-138; and wherein the engineered macrophage-specific promoter comprises: i) a motif within the nucleotide sequence of SEQ ID NO:132, comprising positions 63 to 73 of SEQ ID NO:132, positions 80 to 102 of SEQ ID NO:132, positions 141 to 162 of SEQ ID NO:132, positions 212 to 222 of SEQ ID NO:132, positions 229 to 251 of SEQ ID NO:132, positions 307 to 361 of SEQ ID NO:132, positions 365 to 376 of SEQ ID NO:132, positions 559 to 571 of SEQ ID NO:132, positions 617 to 633 of SEQ ID NO:132, positions 782 to 799 of SEQ ID NO:132, positions 852 to 871 of SEQ ID NO:132, positions 886 to 920 of SEQ ID NO:132, positions 933 to 959 of SEQ ID NO:132, positions 1003 to 1009 of SEQ ID NO:132, positions 1010 to 1020 of SEQ ID NO:132, positions 1020 to 1021 of SEQ ID NO:132, positions 1030 to 1040 of SEQ ID NO:132, positions 1041 to 1042 of SEQ ID NO:132, positions 1050 to 1050 of SEQ ID NO:132, positions 1060 to 1062 of SEQ ID NO:132, positions 1070 to 1072 of SEQ ID NO:132, positions 1080 to 1082 of SEQ ID NO:132, positions 1090 to 1092 of SEQ ID NO:132, positions 1100 to 1111 of S the motif comprising a sequence selected from the group consisting of positions 1002 to 1028 of SEQ ID NO:132, positions 1032 to 1045 of SEQ ID NO:132, positions 1064 to 1087 of SEQ ID NO:132, positions 1169 to 1192 of SEQ ID NO:132, positions 1212 to 1232 of SEQ ID NO:132, positions 1257 to 1275 of SEQ ID NO:132, positions 1310 to 1333 of SEQ ID NO:132, positions 1381 to 1434 of SEQ ID NO:132, positions 1698 to 1753 of SEQ ID NO:132, positions 1783 to 1826 of SEQ ID NO:132, positions 1909 to 1927 of SEQ ID NO:132, and positions 1946 to 1961 of SEQ ID NO:132; and / or ii) A motif within the nucleotide sequence of SEQ ID NO:136, comprising positions 133 to 144 of SEQ ID NO:136, positions 200 to 217 of SEQ ID NO:136, positions 225 to 247 of SEQ ID NO:136, positions 303 to 325 of SEQ ID NO:136, positions 332 to 342 of SEQ ID NO:136, positions 391 to 413 of SEQ ID NO:136, positions 423 to 460 of SEQ ID NO:136, positions 467 to 477 of SEQ ID NO:136, positions 693 to 717 of SEQ ID NO:136, positions 738 to 761 of SEQ ID NO:136, positions 838 to 842 of SEQ ID NO:136 positions 1229 to 1246 of SEQ ID NO:136, positions 1286 to 1309 of SEQ ID NO:136, positions 1413 to 1431 of SEQ ID NO:136, positions 1456 to 1473 of SEQ ID NO:136, positions 1530 to 1544 of SEQ ID NO:136, positions 1577 to 1590 of SEQ ID NO:136, positions 1816 to 1836 of SEQ ID NO:136, positions 1852 to 1872 of SEQ ID NO:136, and positions 1876 to 1896 of SEQ ID NO:136; and / or iii) a motif within the nucleotide sequence of SEQ ID NO:137, comprising positions 43 to 60, 107 to 120 of SEQ ID NO:137, 210 to 230 of SEQ ID NO:137, 345 to 407 of SEQ ID NO:137, 427 to 457 of SEQ ID NO:137, 468 to 484, 560 to 582 of SEQ ID NO:137, 730 to 746 of SEQ ID NO:137, 809 to 820 of SEQ ID NO:137, 827 to 837 of SEQ ID NO:137, positions 858 to 878 of SEQ ID NO:137, positions 1291 to 1302 of SEQ ID NO:137, positions 1321 to 1341 of SEQ ID NO:137, positions 1435 to 1463 of SEQ ID NO:137, positions 1530 to 1541 of SEQ ID NO:137, positions 1707 to 1718 of SEQ ID NO:137, positions 1834 to 1863 of SEQ ID NO:137, positions 1870 to 1882 of SEQ ID NO:137, and positions 1913 to 1929 of SEQ ID NO:

137. Including, Optionally, the excision comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif. The engineered macrophage-specific promoter.

4. 1. An engineered macrophage-specific promoter comprising at least one regulatory element, wherein the regulatory element exhibits greater activity in M1 macrophages compared to M2 or M0 macrophages, or exhibits greater activity in M2 macrophages compared to M1 or M0 macrophages, optionally wherein the engineered macrophage-specific promoter comprises at least two, at least three, at least four, or at least five regulatory elements, optionally wherein each of the regulatory elements is the same or different, and optionally wherein the M2 macrophage is selected from the group consisting of M2a macrophages, M2b macrophages, and M2c macrophages.

5. the at least one regulatory element i) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 297-313; ii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 372-390; iii) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 440-443; iv) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 314-371; v) a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 420-439. comprising a nucleotide sequence selected from Optionally, the engineered macrophage-specific promoter further comprises a minimal promoter operably linked to the engineered macrophage-specific promoter, and optionally, the minimal promoter is selected from the group consisting of minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia response element, SMAD binding element, STAT3 binding site, minCMV, YB Derived from a promoter selected from the group consisting of TATA, minTK, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof; The engineered macrophage-specific promoter of any one of claims 1 to 4.

6. and at least one regulatory element comprising a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1-29, 81-82, 88-97, 119-122, 132-138, 142-163, 97-313, 139-141, 314-371, 390, 392-393, and 420-443. a promoter, wherein optionally the regulatory element or the engineered macrophage-specific promoter is operably linked to a minimal promoter, and optionally the minimal promoter is selected from the group consisting of minP, NFkB response element, CREB response element, NFAT response element, SRF response element 1, SRF response element 2, API response element, TCF-LEF response element promoter fusion, hypoxia response element, SMAD binding element, STAT3 binding site, minCMV, YB The engineered macrophage-specific promoter comprises the sequence of a promoter selected from TATA, minTK, SCP3, YB-SCP3, inducible molecule responsive promoter, CMV, EFS, SFFV, SV40, MND, PGK, UbC, hEFlaVl, hCAGG, hEFlaV2, hACTb, heIF4A1, hGAPDH, hGRP78, hGRP94, hHSP70, hKINb, hUBIb, and tandem repeats thereof, optionally wherein the engineered macrophage-specific promoter system further comprises a translation start site, and optionally wherein the translation start site is or comprises a Kozak sequence.

7. the regulatory element or the engineered macrophage-specific promoter is a) comprising a first transcriptional activator element set forth in SEQ ID NO:220, a second transcriptional activator element set forth in SEQ ID NO:222, a third transcriptional activator element set forth in SEQ ID NO:240, a fourth transcriptional activator element set forth in SEQ ID NO:254, and a fifth transcriptional activator element set forth in SEQ ID NO:256, and excluding at least one repression element selected from SEQ ID NO:226, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252, and optionally excluding a sixth transcriptional activator element set forth in SEQ ID NO:224 and / or a seventh transcriptional activator element set forth in SEQ ID NO:258 and optionally, the regulatory element or the engineered macrophage-specific promoter does not further comprise a repression element as set forth in SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:248, and SEQ ID NO:250; and optionally, the regulatory element or the engineered macrophage-specific promoter does not comprise a repression element as set forth in SEQ ID NO:226, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:246, and SEQ ID NO:252 .... and or the sequence described in and The sequence described in or b) comprising a first transcriptional activating element set forth in SEQ ID NO:268 and a second transcriptional activating element set forth in SEQ ID NO:270, and not comprising at least one repressing element selected from SEQ ID NO:260, SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:266, SEQ ID NO:272, and SEQ ID NO:391, or from at least one, at least two, at least three, at least four, or at least five tandem repeats of SEQ ID NO:268 and SEQ ID NO:270; optionally, further comprising a third transcriptional activation element set forth in SEQ ID NO:291 and / or a fourth transcriptional activation element set forth in SEQ ID NO:295; Optionally, the regulatory element or the engineered macrophage-specific promoter does not comprise a repression element such as set forth in SEQ ID NO:262, SEQ ID NO:264, SEQ ID NO:272, and SEQ ID NO:391, and optionally, the regulatory element or the engineered macrophage-specific promoter does not further comprise SEQ ID NO:260 and / or SEQ ID NO:

266.

4. The engineered macrophage-specific promoter system of claim 1 or 3.

8. A heterologous construct comprising: i) an engineered macrophage-specific promoter system according to claim 1 or 2, or ii) The engineered macrophage-specific promoter of any one of claims 3 to 7 operably linked to a heterologous payload, optionally wherein the heterologous payload is a polynucleotide comprising a nucleotide sequence encoding a polypeptide, and optionally wherein the polypeptide comprises at least one effector molecule. Including, Optionally, the polypeptide comprises a first effector molecule and a second effector molecule; Optionally, the engineered macrophage-specific promoter comprises a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:420, and at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:

427. % sequence identity to the first effector molecule, optionally wherein the polynucleotide comprises a nucleotide sequence encoding the first effector molecule, a linker nucleotide sequence, and a nucleotide sequence encoding the second effector, optionally wherein the linker nucleotide sequence encodes one or more 2A ribosomal skipping elements, optionally wherein the one or more 2A ribosomal skipping elements comprise elements each selected from the group consisting of P2A, T2A, E2A, and F2A. The heterologous construct.

9. the or each effector molecule is selected from a therapeutic class, said therapeutic class being selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, polynucleotide molecules, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, transcription factors, antibodies, peptides, and enzymes; optionally, said transcription factor is a master regulator; optionally, said transcription factor is a master regulator of M1 macrophage polarization; optionally, said transcription factor is IRF7 or or a derivative thereof, or p65 / RelA or a derivative thereof, optionally wherein said transcription factor is a master regulator of M2 macrophage polarization, and optionally wherein the or each effector molecule is or comprises a cytokine, a chemokine, a homing molecule, a growth factor, a tumor microenvironment modifier, while optionally wherein said cytokine is IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, an IL12p70 fusion protein, IL15, selected from the group consisting of IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha, optionally wherein said cytokine is a master regulator of M1 macrophage polarization, optionally wherein said cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1 alpha, IL-1 beta, or a derivative thereof, optionally Alternatively, the cytokine is a master regulator of M2 macrophage polarization, optionally the cytokine is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof, optionally the chemokine is selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and CXCL1, and optionally the homing molecule is anti-integrin alpha4,beta7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15; optionally, the growth factor is selected from the group consisting of FLT3L and GM-CSF; optionally, the co-activation molecule is selected from the group consisting of c-Jun, 4-1BBL, and CD40L; optionally, the tumor microenvironment modifier is selected from the group consisting of adenosine deaminase, TGF beta inhibitors, immune checkpoint inhibitors, VEGF inhibitors, and HPGE2; optionally, each of the first effector molecule and the second effector molecule is from a separate therapeutic class; and optionally, each effector molecule is a human-derived effector molecule; Optionally, the cytokine is modified to comprise a membrane-binding domain, and optionally, the membrane-binding domain is or comprises a transmembrane-intracellular and / or transmembrane domain of a protein selected from PDGFR-beta, CD8, CD28, CD3 zeta chain, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, LNGFR, NKG2D, EpoR, TNFR2, B7-1, and BTLA, or a functional portion thereof; optionally, the master regulator of M1 macrophage polarization is IRF7 or a derivative thereof; optionally, the derivative of IRF7 comprises IRF7 operably linked to a degron domain; and optionally, the degron domain is selected from a PEST domain, an HCV NS4 degron, GRR (residues 352-408 of human p105), DRR (residues 210-295 of yeast Cdc34), SNS (tandem repeats of SP2 and NB of influenza A or B (SP2-NB-SP2)), RPB (four copies of residues 1688-1702 of yeast RPB), SPmix (tandem repeats of SP1 and SP2 of influenza A virus M2 protein (SP2-SP1-SP2-SP1-SP2)), NS2 (three copies of residues 79-93 of influenza A virus NS protein), ODC (residues 106-142 of ornithine decarboxylase), Nek2A, mouse ODC (residues 422-461),Mouse ODC_DA (residues 422-461 of mODC containing D433A and D434A point mutations), APC / C degron, COP1 E3 ligase-binding degron motif, CRL4-Cdt2-binding PIP degron, actinfilin-binding degron, KEAP1-binding degron, KLHL2- and KLHL3-binding degron, MDM2-binding motif, N-degron, hydroxyproline modification in hypoxia signaling, plant hormone-dependent SCF-LRR-binding degron, SCF ubiquitin ligase-binding phosphodegron, plant hormone-dependent SCF-LRR-binding degron, DSGxxS (SEQ ID NO: 190) phospho-dependent degron, Siah-binding motif, SPOP 9. The heterologous construct of claim 8, wherein the degron domain is selected from an SBC docking motif, a PCNA-binding PIP box, and derivatives thereof, and optionally the degron domain is a PEST domain, and optionally the PEST comprises the amino acid sequence of SEQ ID NO: 501 or a derivative thereof.

10. A heterologous construct for inducing macrophages to transition from an M1 state to an M2 state, comprising: i) as applied to claim 1, said regulatory element is derived from the promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages, or ii) The engineered macrophage-specific promoter of any one of claims 3 to 7. either, and Heterologous payload encoding a master regulator of M2 macrophage polarization Including, the regulatory element or the engineered macrophage-specific promoter of (a) is operably linked to and configured to induce expression of the heterologous payload, and optionally the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof; optionally the master regulator of M2 macrophage polarization is IL-10; optionally the M2 state is an M2c state, an M2a state, or an M2b state; and optionally (a) is a regulatory element derived from a CCL19 promoter, and optionally comprises the nucleotide sequence of SEQ ID NO:

132. The heterologous construct.

11. A heterologous construct for stabilizing macrophages in an M1 polarized state, comprising: i) said regulatory element derived from a promoter of a gene that is more highly expressed in M1 macrophages compared to M2 or M0 macrophages, optionally derived from the UBD1 promoter, the IDO1 promoter, or the CCL19 promoter, as applied to claim 2; or ii) The engineered macrophage-specific promoter of any one of claims 3 to 7. and a heterologous payload encoding a master regulator of M1 macrophage polarization. Including, wherein the regulatory element or the engineered macrophage-specific promoter of (a) is operably linked to the heterologous payload and configured to drive expression of the heterologous payload, and optionally the master regulator of M1 macrophage polarization is a cytokine, optionally the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1 alpha, IL-1 beta, or a derivative thereof, and optionally the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof; The heterologous construct.

12. A heterologous construct for inducing macrophages to transition from an M2 state to an M1 state, comprising: i) as applied to claim 2, said regulatory element is derived from the promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, or ii) The engineered macrophage-specific promoter of any one of claims 3 to 7. and a heterologous payload encoding a master regulator of M1 macrophage polarization. Including, wherein the regulatory element or the engineered macrophage-specific promoter of (a) is operably linked to and configured to induce expression of the heterologous payload, and optionally, the master regulator of M1 macrophage polarization is a cytokine, optionally, the cytokine is IFN-gamma, IFN-alpha, TNF-alpha, GM-CSF, IL-12, IL-12p70, IL-12p40, IL-12p35, IL-6, IL-23, IL-1 alpha, IL-1 beta, or a derivative thereof, and optionally, the master regulator of M1 macrophage polarization is a transcription factor selected from IRF7 or a derivative thereof, or p65 / RelA or a derivative thereof; The heterologous construct.

13. A heterologous construct for stabilizing macrophages in an M2 polarized state, comprising: i) as applied to claim 2, said regulatory element is derived from the promoter of a gene that is more highly expressed in M2 macrophages compared to M1 or M0 macrophages, or ii) The engineered macrophage-specific promoter of any one of claims 3 to 7. and a heterologous payload encoding a master regulator of M2 macrophage polarization. Including, the regulatory element or the engineered macrophage-specific promoter of (a) is operably linked to and configured to induce expression of the heterologous payload, and optionally the M2 state is an M2c state, an M2a state, or an M2b state, and optionally the master regulator of M2 macrophage polarization is IL-10, IL-4, IL-13, IL-21, TGF-beta, M-CSF, or a derivative thereof; The heterologous construct.

14. A vector comprising a heterologous construct according to any one of claims 8 to 13.

15. 15. A dual expression vector comprising the heterologous construct of claim 14 and a second construct comprising a nucleotide sequence encoding an activating immunoreceptor.

16. 16. An immunoresponsive cell comprising the heterologous construct of any one of claims 8 to 13, the vector of claim 14, or the dual expression vector of claim 15, optionally wherein the immunoresponsive cell is a T cell, CD8+ T cell, CD4+ T cell, gamma delta T cell, cytotoxic T lymphocyte (CTL), regulatory T cell, virus-specific T cell, natural killer T (NKT) cell, natural killer (NK) cell, B cell, tumor infiltrating lymphocyte (TIL), innate lymphoid cell, mast cell, eosinophil, basophil, neutrophil, myeloid cell, macrophage, monocyte, dendritic cell, the immunoresponsive cell is selected from the group consisting of a blastocyte, a red blood cell, a platelet cell, a human embryonic stem cell (ESC), an ESC-derived cell, a pluripotent stem cell, a mesenchymal stromal cell (MSC), an induced pluripotent stem cell (iPSC), and an iPSC-derived cell; optionally, the immunoresponsive cell is a macrophage; optionally, the macrophage is a tumor-resident macrophage; optionally, the immunoresponsive cell is autologous or allogeneic; optionally, the immunoresponsive cell expresses an activating immunoreceptor; and optionally, the activating immunoreceptor comprises an antigen-recognizing receptor.

17. A pharmaceutical composition comprising the vector of claim 14, the dual expression vector of claim 15, or the immunoresponsive cell of claim 16, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

18. 16. A method for increasing expression of a target gene, comprising using the engineered macrophage-specific promoter of any one of claims 1 to 7, the vector of claim 14, or the dual expression vector of claim 15 to increase expression of the target gene, optionally wherein the target gene is an immunomodulatory gene.

19. A method of treating a subject in need thereof, comprising administering a therapeutically effective amount of the vector described in claim 14, the dual expression vector described in claim 15, the immunoresponsive cell described in claim 16, or the pharmaceutical composition described in claim 17.

20. 18. A kit for treating and / or preventing a disease or disorder, comprising the immunoresponsive cell of claim 16 or the pharmaceutical composition of claim 17, optionally further comprising instructions for using the immunoresponsive cell to treat and / or prevent a disease or disorder in a subject, optionally wherein the disease is cancer.

Images