Modified immunomodulatory drugs

Abstract

The present disclosure provides oligonucleotides and modified oligonucleotides, lipid nanoparticles comprising oligonucleotides and modified oligonucleotides, methods for reducing or suppressing an immune response in a subject undergoing nucleic acid therapy or for increasing expression of a protein encoded by a nucleic acid contained in a lipid nanoparticle, and methods for treating or preventing a genetic disease in a subject.

Description

[Technical Field]

[0001] The present disclosure provides oligonucleotides and modified oligonucleotides, lipid nanoparticles comprising oligonucleotides and modified oligonucleotides, methods for reducing or suppressing an immune response in a subject undergoing nucleic acid therapy and / or methods for increasing expression of a protein encoded by a nucleic acid contained in a lipid nanoparticle, and methods for treating a genetic disease in a subject. [Background technology]

[0002] Unwanted stimulation of the innate immune system by foreign nucleic acids is one of the barriers preventing nucleic acid-based therapeutics from reaching the market. Foreign nucleic acids can be recognized by multiple pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), which trigger signaling cascades to activate the host defense system, causing various side effects and reducing the expression of therapeutic proteins encoded by the nucleic acids.

[0003] Thus, there is a need in the art for new technologies to increase expression of a therapeutic protein encoded by the nucleic acid and / or inhibit, e.g., reduce, suppress, prevent, diminish, ameliorate, ameliorate, eliminate or prevent, an immune response following administration of a nucleic acid, e.g., a DNA or RNA-based nucleic acid therapeutic, to a subject that can express a therapeutic protein in a cell, tissue or subject for the treatment of a wide variety of diseases. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides oligonucleotides, methods, and pharmaceutical compositions (e.g., lipid nanoparticles) for inhibiting (e.g., reducing or suppressing) an immune response and / or increasing expression of a protein encoded by a nucleic acid included in the composition in a subject who may be suffering from a disease, condition, or disorder, e.g., a genetic disease, and who is undergoing gene therapy or nucleic acid therapy. In some embodiments, the pharmaceutical compositions and formulations can include one or more components that can reduce an immune response, e.g., an innate immune response, e.g., a TLR antagonist, such as a TLR9 antagonist.

[0005] In the prior art, compositions for nucleic acid therapy include a therapeutic nucleic acid covalently linked to an oligonucleotide. The compositions of the present disclosure include separate therapeutic nucleic acid and oligonucleotide molecules. After administration of the compositions, a subject experiences a surprising decrease in immune response and / or a surprising increase in expression of the protein encoded by the therapeutic nucleic acid. Furthermore, compositions comprising the modified oligonucleotides of the present disclosure cause a surprising decrease in immune response and / or a surprising increase in protein expression in a subject.

[0006] In one aspect, the present disclosure provides a modified oligonucleotide (ODN) comprising the following sequence: uuagggttagggttagggtuaggg (SEQ ID NO: 1), ttagggttagggttagggttaggg (SEQ ID NO: 2), ttcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 3), tgggcggttcaaccttca (SEQ ID NO: 4), tgactgtgaaggttagagatga (SEQ ID NO: 5), uuagggttagggttaggguuaggg (SEQ ID NO: 6), cctcattagggtgaggg (SEQ ID NO: 7), uuagggutagggttaggguuaggg (SEQ ID NO: 8), uuaggguuagggttaggguuaggg (SEQ ID NO: 9), uuaggguuaggguuaggguuaggg (SEQ ID NO: 10), uuagggttagggttagggttaggg (SEQ ID NO: 11), utcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 12), uucaaattcaaattcaaattcaaa (SEQ ID NO: 13), uucaaattcaaattcaaatucaaa (SEQ ID NO: 14), ccucattagggtgaggg (SEQ ID NO: 15), ugggcggttcaaccttca (SEQ ID NO: 16), or ugggcggttcaaccuuca (SEQ ID NO: 17); where:

[0007] The sequences are written from left to right in the 5' to 3' direction;

[0008] a is adenosine, deoxyadenosine, or a glycosylated form thereof;

[0009] c is cytidine, deoxycytidine, or a glycosylated form thereof;

[0010] g is guanosine, deoxyguanosine, or a glycosylated form thereof;

[0011] t is 5-methyluridine, thymidine, or a glycosylated form thereof;

[0012] u is uridine, deoxyuridine, or a glycosylated form thereof;

[0013] the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or combinations thereof;

[0014] At least one of the a, c, g, t, and / or u nucleosides is a sugar modification thereof independently selected from the group consisting of: [ka]

[0015] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:1.

[0016] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:2.

[0017] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:3.

[0018] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:4.

[0019] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:5.

[0020] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:6.

[0021] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:7.

[0022] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:8.

[0023] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:9.

[0024] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:10.

[0025] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:11.

[0026] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:12.

[0027] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:13.

[0028] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:14.

[0029] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:15.

[0030] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:16.

[0031] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO:17.

[0032] In another aspect, the present disclosure provides an ODN or modified ODN set forth in Table 1 below.

[0033] In another aspect, the present disclosure provides lipid nanoparticles comprising a modified ODN of any one of SEQ ID NOs: 1-17 and a therapeutic nucleic acid.

[0034] In another aspect, the present disclosure provides lipid nanoparticles comprising a modified ODN of any one of SEQ ID NOs: 1-17; a cationic lipid; a non-cationic lipid; and a therapeutic nucleic acid.

[0035] In another aspect, the present disclosure provides a method for inhibiting an immune response in a subject in need thereof, the method comprising administering to the subject lipid nanoparticles comprising a modified ODN of any one of SEQ ID NOs: 1-17 and a therapeutic nucleic acid.

[0036] In another aspect, the present disclosure provides a method for treating a disease, disorder, or condition, e.g., a genetic disease, in a subject in need thereof, the method comprising administering to the subject lipid nanoparticles comprising a modified ODN of any one of SEQ ID NOs: 1-17 and a therapeutic nucleic acid. [Brief explanation of the drawings]

[0037] [Figure 1A] 1 is a bar graph showing enhanced luciferase expression after administration of LNPs of the present disclosure. [Figure 1B]1 is a bar graph showing in vivo cytokine suppression following administration of LNPs of the present disclosure. [Figure 2A] 1 is a bar graph showing enhanced luciferase expression after administration of LPN loaded with ODN (A151 (SEQ ID NO: 19)) and mRNA, or pGL4.5. [Figure 2B] 1 is a bar graph showing plasma IFN-α cytokine concentrations after administration of LPN loaded with ODN (A151 (SEQ ID NO: 19)) and mRNA, or pGL4.5. [Figure 3A] 1 is a bar graph showing enhanced luciferase expression after administration of LPN loaded with ODN and DNA of the present disclosure. [Figure 3B] 1 is a bar graph showing plasma IFN-α concentrations after administration of LPN loaded with ODN and DNA of the present disclosure. [Figure 4A] 1 is a bar graph showing enhanced luciferase expression after administration of LPN loaded with DNA and ODN of the present disclosure. [Figure 4B] 1 is a bar graph showing plasma IFN-α concentrations after administration of LPN loaded with DNA and ODN of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0038] I. Oligodeoxynucleotides (ODNs) and Modified ODNs In one embodiment, the present disclosure provides an oligonucleotide (ODN) comprising the following sequence: uuagggttagggttagggtuaggg (SEQ ID NO: 1), ttagggttagggttagggttaggg (SEQ ID NO: 2), ttcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 3), tgggcggttcaaccttca (SEQ ID NO: 4), tgactgtgaaggttagagatga (SEQ ID NO: 5), uuagggttagggttaggguuaggg (SEQ ID NO: 6), cctcattagggtgaggg (SEQ ID NO: 7), uuagggutagggttaggguuaggg (SEQ ID NO: 8), uuaggguuagggttaggguuaggg (SEQ ID NO: 9), uuaggguuaggguuaggguuaggg (SEQ ID NO: 10), uuagggttagggttagggttaggg (SEQ ID NO: 11), utcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 12), uucaaattcaaattcaaattcaaa (SEQ ID NO: 13), uucaaattcaaattcaaatucaaa (SEQ ID NO: 14), ccucattagggtgaggg (SEQ ID NO: 15), ugggcggttcaaccttca (SEQ ID NO: 16), or ugggcggttcaaccuuca (SEQ ID NO: 17); where:

[0039] The sequences are written from left to right in the 5' to 3' direction;

[0040] a is adenosine or deoxyadenosine;

[0041] c is cytidine or deoxycytidine;

[0042] g is guanosine or deoxyguanosine;

[0043] t is 5-methyluridine or thymidine;

[0044] u is uridine or deoxyuridine;

[0045] The internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or combinations thereof.

[0046] In another embodiment (referred to as "embodiment 1"), the present disclosure provides a modified ODN comprising any one of SEQ ID NOs: 1-17, wherein:

[0047] The sequences are written from left to right in the 5' to 3' direction;

[0048] a is adenosine, deoxyadenosine, or a glycosylated form thereof;

[0049] c is cytidine, deoxycytidine, or a glycosylated form thereof;

[0050] g is guanosine, deoxyguanosine, or a glycosylated form thereof;

[0051] t is 5-methyluridine, thymidine, or a glycosylated form thereof;

[0052] u is uridine, deoxyuridine, or a glycosylated form thereof;

[0053] the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or combinations thereof;

[0054] At least one of the a, c, g, t, or u nucleosides is a sugar modification thereof independently selected from the group consisting of: [ka]

[0055] With respect to the modified ODN of embodiment 1, the present disclosure provides the following specific embodiments.

[0056] Embodiment 2. The modified ODN of embodiment 1, comprising the following sequence: uuagggttagggttagggtuaggg (SEQ ID NO: 1).

[0057] Embodiment 3. The modified ODN of embodiment 1 or 2, wherein at least four of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.

[0058] Embodiment 4. The modified ODN of embodiment 3, wherein at least six of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.

[0059] Embodiment 5. The modified ODN of embodiment 4, wherein the nucleoside is marked with an "*". u*u*a*gggttagggttagggtuag*g*g* (SEQ ID NO: 105) is a glycosylated form of u, a, and / or g.

[0060] Embodiment 6 The modified ODN of embodiment 4, wherein at least eight of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0061] Embodiment 7. The modified ODN of embodiment 6, wherein the nucleoside is marked with an "*". u*u*a*g*ggttagggttagggtua*g*g*g*(SEQ ID NO: 106) is a glycosylated form of u, a, and / or g.

[0062] Embodiment 8 The modified ODN of embodiment 6, wherein at least 10 of the a, c, g, t, and / or u nucleosides are sugar-modified.

[0063] Embodiment 9. The modified ODN of embodiment 8, wherein the nucleoside is marked with an "*". u*u*a*g*g*gttagggttagggtu*a*g*g*g*(SEQ ID NO: 107) is a glycosylated form of u, a, and / or g.

[0064] Embodiment 10 The modified ODN of embodiment 8, wherein at least 12 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0065] Embodiment 11. The modified ODN of embodiment 10, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*ttagggttagggt*u*a*g*g*g*(SEQ ID NO: 108) is a glycosylated form of u, a, t, and / or g.

[0066] Embodiment 12 The modified ODN of embodiment 10, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar-modified.

[0067] Embodiment 13. The modified ODN of embodiment 12, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*t*tagggttaggg*t*u*a*g*g*g*(Array number 109) is a glycosylated form of u, a, t, and / or g.

[0068] Embodiment 14 The modified ODN of embodiment 12, wherein at least 18 of the a, c, g, t, and / or u nucleosides are sugar-modified.

[0069] Embodiment 15. The modified ODN of embodiment 14, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*t*t*a*gggttag*g*g*t*u*a*g*g*g*(Array number 110) is a glycosylated form of u, a, t, and / or g.

[0070] Embodiment 16 The modified ODN of embodiment 14, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0071] Embodiment 17 The modified ODN of embodiment 3, wherein all of the g nucleosides are sugar-modified versions thereof.

[0072] Embodiment 18 The modified ODN of embodiment 3, wherein all of the a nucleosides are sugar-modified.

[0073] Embodiment 19. The modified ODN of embodiment 1 comprises the following sequence (also referred to as A151): ttagggttagggttagggttaggg (SEQ ID NO: 2).

[0074] Embodiment 20 The modified ODN of embodiment 19, wherein at least four of the a, g, and / or t nucleosides are sugar modified versions thereof.

[0075] Embodiment 21 The modified ODN of embodiment 20, wherein at least six of the a, g, and / or t nucleosides are sugar modified versions thereof.

[0076] Embodiment 22. The modified ODN of embodiment 21, wherein the nucleoside is marked with an "*". t*t*a*gggttagggttagggttag*g*g*(SEQ ID NO: 111) is a, g, and / or t glycosylated form.

[0077] Embodiment 23 The modified ODN of embodiment 21, wherein at least eight of the a, g, and / or t nucleosides are sugar modified versions thereof.

[0078] Embodiment 24. The modified ODN of embodiment 23, wherein the nucleoside is marked with an "*". t*t*a*g*ggttagggttagggtta*g*g*g*(SEQ ID NO: 112) is a, g, and / or t glycosylated form.

[0079] Embodiment 25 The modified ODN of embodiment 23, wherein at least 10 of the a, g, and / or t nucleosides are sugar-modified.

[0080] Embodiment 26. The modified ODN of embodiment 25, wherein the nucleoside is marked with an "*". t*t*a*g*g*gttagggttagggtt*a*g*g*g* (SEQ ID NO: 113) is a, g, and / or t glycosylated form.

[0081] Embodiment 27 The modified ODN of embodiment 25, wherein at least 12 of the a, g, and / or t nucleosides are sugar modifications thereof.

[0082] Embodiment 28. The modified ODN of embodiment 27, wherein the nucleoside is marked with an "*". t*t*a*g*g*g*ttagggttagggt*t*a*g*g*g* (SEQ ID NO: 114) is a, g, and / or t glycosylated form.

[0083] Embodiment 29 The modified ODN of embodiment 27, wherein at least 14 of the a, g, and / or t nucleosides are sugar-modified versions thereof.

[0084] Embodiment 30. The modified ODN of embodiment 29, wherein the nucleoside is marked with an "*". t*t*a*g*g*g*t*tagggttaggg*t*t*a*g*g*g*(SEQ ID NO: 115) is a, g, and / or t glycosylated form.

[0085] Embodiment 31 The modified ODN of embodiment 29, wherein at least 18 of the a, g, and / or t nucleosides are sugar-modified.

[0086] Embodiment 32. The modified ODN of embodiment 31, wherein the nucleoside is marked with an "*". t*t*a*g*g*g*t*t*a*gggttag*g*g*t*t*a*g*g*g*(SEQ ID NO: 116) is a, g, and / or t glycosylated form.

[0087] Embodiment 33 The modified ODN of embodiment 31, wherein all of the a, g, and t nucleosides are sugar-modified versions thereof.

[0088] Embodiment 34 The modified ODN of embodiment 19, wherein all of the g nucleosides are sugar-modified.

[0089] Embodiment 35 The modified ODN of embodiment 19, wherein all of the a nucleosides are sugar-modified.

[0090] Embodiment 36 The modified ODN of embodiment 1 comprises the following sequence (also referred to as C151): ttcaaattcaaattcaaattcaaa (SEQ ID NO: 3).

[0091] Embodiment 37 The modified ODN of embodiment 36, wherein at least four of the a, c, and / or t nucleosides are sugar modified therewith.

[0092] Embodiment 38 The modified ODN of embodiment 37, wherein at least six of the a, c, and / or t nucleosides are sugar-modified versions thereof.

[0093] Embodiment 39. The modified ODN of embodiment 38, wherein the nucleoside is marked with an "*". t*t*c*aaattcaaattcaaattca*a*a*(SEQ ID NO: 117) is a, c, and / or t glycosylated form.

[0094] Embodiment 40 The modified ODN of embodiment 38, wherein at least eight of the a, c, and / or t nucleosides are sugar modified therewith.

[0095] Embodiment 41. The modified ODN of embodiment 40, wherein the nucleoside is marked with an "*". t*t*c*a*aattcaaattcaaattc*a*a*a*(SEQ ID NO: 118) is a, c, and / or t glycosylated form.

[0096] Embodiment 42 The modified ODN of embodiment 40, wherein at least 10 of the a, c, and / or t nucleosides are sugar-modified.

[0097] Embodiment 43. The modified ODN of embodiment 42, wherein the nucleoside is marked with an "*". t*t*c*a*a*attcaaattcaaatt*c*a*a*a*(Sequence number 119) is a, c, and / or t glycosylated form.

[0098] Embodiment 44 The modified ODN of embodiment 42, wherein at least 12 of the a, c, and / or t nucleosides are sugar modified versions thereof.

[0099] Embodiment 45. The modified ODN of embodiment 44, wherein the nucleoside is marked with an "*". t*t*c*a*a*a*ttcaaattcaaat*t*c*a*a*a*(array number 120) is a, c, and / or t glycosylated form.

[0100] Embodiment 46 The modified ODN of embodiment 44, wherein at least 14 of the a, c, and / or t nucleosides are sugar-modified.

[0101] Embodiment 47. The modified ODN of embodiment 46, wherein the nucleoside is marked with an "*". t*t*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a*(array number 121) is a, c, and / or t glycosylated form.

[0102] Embodiment 48 The modified ODN of embodiment 46, wherein at least 18 of the a, c, and / or t nucleosides are sugar-modified.

[0103] Embodiment 49. The modified ODN of embodiment 48, wherein the nucleoside is marked with an "*". t*t*c*a*a*a*t*t*c*aaattca*a*a*t*t*c*a*a*a*(array number 122) is a, c, and / or t glycosylated form.

[0104] Embodiment 50 The modified ODN of embodiment 36, wherein all of the a, c, and t nucleosides are sugar-modified versions thereof.

[0105] Embodiment 51 The modified ODN of embodiment 36, wherein all of the c nucleosides are sugar-modified versions thereof.

[0106] Embodiment 52 The modified ODN of embodiment 36, wherein all of the a nucleosides are sugar-modified.

[0107] Embodiment 53. The modified ODN of embodiment 1, comprising the following sequence: tgggcggttcaaccttca (SEQ ID NO: 4).

[0108] Embodiment 54 The modified ODN of embodiment 53, wherein at least four of the a, c, g, and / or t nucleosides are sugar modified therewith.

[0109] Embodiment 55 The modified ODN of embodiment 54, wherein at least six of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0110] Embodiment 56. The modified ODN of embodiment 55, wherein the nucleoside is marked with an "*". t*g*g*gcggttcaacctt*c*a* (SEQ ID NO: 123) is a, c, g, and / or t glycosylated form.

[0111] Embodiment 57 The modified ODN of embodiment 55, wherein at least eight of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0112] Embodiment 58. The modified ODN of embodiment 57, wherein the nucleoside is marked with an "*". t*g*g*g*cggttcaacct*t*c*a* (SEQ ID NO: 124) is a, c, g, and / or t glycosylated form.

[0113] Embodiment 59 The modified ODN of embodiment 57, wherein at least 10 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0114] Embodiment 60. The modified ODN of embodiment 59, wherein the nucleoside is marked with an "*". t*g*g*g*c*ggttcaacc*t*t*c*a* (SEQ ID NO: 125) is a, c, g, and / or t glycosylated form.

[0115] Embodiment 61 The modified ODN of embodiment 59, wherein at least 12 of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0116] Embodiment 62. The modified ODN of embodiment 61, wherein the nucleoside is marked with an "*". t*g*g*g*c*g*gttcaac*c*t*t*c*a*(array number 126) is a, c, g, and / or t glycosylated form.

[0117] Embodiment 63 The modified ODN of embodiment 61, wherein at least 14 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0118] Embodiment 64. The modified ODN of embodiment 63, wherein the nucleoside is marked with an "*". t*g*g*g*c*g*g*ttcaa*c*c*t*t*c*a*(array number 127) is a, c, g, and / or t glycosylated form.

[0119] Embodiment 65 The modified ODN of embodiment 53, wherein all of the a, c, and t nucleosides are sugar-modified versions thereof.

[0120] Embodiment 66 The modified ODN of embodiment 53, wherein all of the t nucleosides are sugar-modified versions thereof.

[0121] Embodiment 67 The modified ODN of embodiment 53, wherein all of the g nucleosides are sugar-modified versions thereof.

[0122] Embodiment 68. The modified ODN of embodiment 1, comprising the following sequence: tgactgtgaaggttagagatga (SEQ ID NO: 5).

[0123] Embodiment 69 The modified ODN of embodiment 68, wherein at least four of the a, c, g, and / or t nucleosides are sugar modified therewith.

[0124] Embodiment 70 The modified ODN of embodiment 69, wherein at least six of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0125] Embodiment 71. The modified ODN of embodiment 70, wherein the nucleoside is marked with an "*". t*g*a*ctgtgaaggttagagat*g*a* (SEQ ID NO: 128) is a, g, and / or t glycosylated form.

[0126] Embodiment 72 The modified ODN of embodiment 70, wherein at least eight of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0127] Embodiment 73. The modified ODN of embodiment 72, wherein the nucleoside is marked with an "*". t*g*a*c*tgtgaaggttagaga*t*g*a*(Sequence number 129) is a, c, g, and / or t glycosylated form.

[0128] Embodiment 74 The modified ODN of embodiment 72, wherein at least 10 of the a, c, g, and / or t nucleosides are sugar modified.

[0129] Embodiment 75. The modified ODN of embodiment 74, wherein the nucleoside is marked with an "*". t*g*a*c*t*gtgaaggttagag*a*t*g*a*(array number 130) is a, c, g, and / or t glycosylated form.

[0130] Embodiment 76 The modified ODN of embodiment 74, wherein at least 12 of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0131] Embodiment 77. The modified ODN of embodiment 76, wherein the nucleoside is marked with an "*". t*g*a*c*t*g*tgaaggttaga*g*a*t*g*a*(Sequence number 131) is a, c, g, and / or t glycosylated form.

[0132] Embodiment 78 The modified ODN of embodiment 76, wherein at least 14 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0133] Embodiment 79. The modified ODN of embodiment 78, wherein the nucleoside is marked with an "*". t*g*a*c*t*g*t*gaaggttag*a*g*a*t*g*a* (SEQ ID NO: 132) is a, c, g, and / or t glycosylated form.

[0134] Embodiment 80 The modified ODN of embodiment 78, wherein at least 18 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0135] Embodiment 81. The modified ODN of embodiment 80, wherein the nucleoside is marked with an "*". t*g*a*c*t*g*t*g*aaggtta*g*a*g*a*t*g*a* (array number 133) is a, c, g, and / or t glycosylated form.

[0136] Embodiment 82 The modified ODN of embodiment 68, wherein all of the a, c, g, and t nucleosides are sugar-modified versions thereof.

[0137] Embodiment 83 The modified ODN of embodiment 68, wherein all of the t nucleosides are sugar-modified versions thereof.

[0138] Embodiment 83 The modified ODN of embodiment 68, wherein all of the g nucleosides are sugar-modified versions thereof.

[0139] Embodiment 84. The modified ODN of embodiment 1, comprising the following sequence: uuagggttagggttaggguuaggg (SEQ ID NO: 6).

[0140] Embodiment 85 The modified ODN of embodiment 84, wherein at least four of the a, u, g, and / or t nucleosides are sugar modifications thereof.

[0141] Embodiment 86 The modified ODN of embodiment 85, wherein at least six of the a, u, g, and / or t nucleosides are sugar modified versions thereof.

[0142] Embodiment 87. The modified ODN of embodiment 86, wherein the nucleoside is marked with an "*". u*u*a*gggttagggttaggguuag*g*g* (SEQ ID NO: 134) is a, g, and / or t glycosylated form.

[0143] Embodiment 88 The modified ODN of embodiment 86, wherein at least eight of the a, g, u, and / or t nucleosides are sugar modified versions thereof.

[0144] Embodiment 89. The modified ODN of embodiment 88, wherein the nucleoside is marked with an "*". u*u*a*g*ggttagggttaggguua*g*g*g* (SEQ ID NO: 135) is a, g, and / or t glycosylated form.

[0145] Embodiment 90 The modified ODN of embodiment 88, wherein at least 10 of the a, u, g, and / or t nucleosides are sugar modified versions thereof.

[0146] Embodiment 91. The modified ODN of embodiment 90, wherein the nucleoside is marked with an "*". u*u*a*g*g*gttagggttaggguu*a*g*g*g*(SEQ ID NO: 136) is a glycosylated form of a, u, g, and / or t.

[0147] Embodiment 92 The modified ODN of embodiment 90, wherein at least 12 of the a, u, g, and / or t nucleosides are sugar modifications thereof.

[0148] Embodiment 93. The modified ODN of embodiment 92, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*ttagggttagggu*u*a*g*g*g*(Sequence number 137) is a glycosylated form of a, u, g, and / or t.

[0149] Embodiment 94 The modified ODN of embodiment 92, wherein at least 14 of the a, u, g, and / or t nucleosides are sugar modified versions thereof.

[0150] Embodiment 95. The modified ODN of embodiment 94, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*t*tagggttaggg*u*u*a*g*g*g*(Array number 138) is a glycosylated form of a, u, g, and / or t.

[0151] Embodiment 96 The modified ODN of embodiment 95, wherein at least 18 of the a, u, g, and / or t nucleosides are sugar modified versions thereof.

[0152] Embodiment 97. The modified ODN of embodiment 97, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*t*t*a*gggttag*g*g*u*u*a*g*g*g*(Sequence number 139) is a glycosylated form of a, u, g, and / or t.

[0153] Embodiment 98 The modified ODN of embodiment 84, wherein all of the a, u, g, and t nucleosides are sugar-modified versions thereof.

[0154] Embodiment 99 The modified ODN of embodiment 84, wherein all of the t nucleosides are sugar-modified versions thereof.

[0155] Embodiment 100 The modified ODN of embodiment 84, wherein all of the g nucleosides are sugar-modified versions thereof.

[0156] Embodiment 101. The modified ODN of embodiment 1 comprises the following sequence (also referred to as iSG3): cctcattagggtgaggg (SEQ ID NO: 7).

[0157] Embodiment 102 The modified ODN of embodiment 101, wherein at least four of the a, c, g, and / or t nucleosides are sugar modified therewith.

[0158] Embodiment 103 The modified ODN of embodiment 102, wherein at least six of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0159] Embodiment 104. The modified ODN of embodiment 103, wherein the nucleoside is marked with an "*". c*c*t*cattagggtgag*g*g* (SEQ ID NO: 140) is a c, g, and / or t glycosylated form.

[0160] Embodiment 105 The modified ODN of embodiment 103, wherein at least eight of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0161] Embodiment 106. The modified ODN of embodiment 105, wherein the nucleoside is marked with an "*". c*c*t*c*attagggtga*g*g*g*(SEQ ID NO: 141) is a, c, g, and / or t glycosylated form.

[0162] Embodiment 107 The modified ODN of embodiment 105, wherein at least 10 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0163] Embodiment 108. The modified ODN of embodiment 107, wherein the nucleoside is marked with an "*". c*c*t*c*a*ttagggtg*a*g*g*g*(SEQ ID NO: 142) is a, c, g, and / or t glycosylated form.

[0164] Embodiment 109 The modified ODN of embodiment 107, wherein at least 12 of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0165] Embodiment 111. The modified ODN of embodiment 109, wherein the nucleoside is marked with an "*". c*c*t*c*a*t*tagggt*g*a*g*g*g*(SEQ ID NO: 143) is a, c, g, and / or t glycosylated form.

[0166] Embodiment 111 The modified ODN of embodiment 109, wherein at least 14 of the a, c, g, and / or t nucleosides are sugar modified versions thereof.

[0167] Embodiment 112. The modified ODN of embodiment 111, wherein the nucleoside is marked with an "*". c*c*t*c*a*t*t*aggg*t*g*a*g*g*g*(SEQ ID NO: 144) is a, c, g, and / or t glycosylated form.

[0168] Embodiment 113 The modified ODN of embodiment 111, wherein all of the a, c, g, and t nucleosides are sugar-modified versions thereof.

[0169] Embodiment 114 The modified ODN of embodiment 101, wherein all of the t nucleosides are sugar-modified.

[0170] Embodiment 115 The modified ODN of embodiment 101, wherein all of the g nucleosides are sugar-modified versions thereof.

[0171] Embodiment 116. The modified ODN of embodiment 1, comprising the following sequence: uuagggutagggttaggguuaggg (SEQ ID NO: 8).

[0172] Embodiment 117 The modified ODN of embodiment 116, wherein at least four of the a, g, t and / or u nucleosides are sugar modified therewith.

[0173] Embodiment 118 The modified ODN of embodiment 117, wherein at least six of the a, g, t and / or u nucleosides are sugar modified versions thereof.

[0174] Embodiment 119. The modified ODN of embodiment 118, wherein the nucleoside is marked with an "*". u*u*a*gggutagggttaggguuag*g*g* (SEQ ID NO: 145) is a glycosylated form of u, a, and / or g.

[0175] Embodiment 120 The modified ODN of embodiment 118, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0176] Embodiment 121. The modified ODN of embodiment 120, wherein the nucleoside is marked with an "*". u*u*a*g*ggutagggttaggguua*g*g*g*(SEQ ID NO: 146) is a glycosylated form of u, a, and / or g.

[0177] Embodiment 122 The modified ODN of embodiment 120, wherein at least 10 of the a, c, g, t and / or u nucleosides are sugar-modified.

[0178] Embodiment 123. The modified ODN of embodiment 122, wherein the nucleoside is marked with an "*". u*u*a*g*g*gutagggttaggguu*a*g*g*g* (SEQ ID NO: 147) is a glycosylated form of u, a, and / or g.

[0179] Embodiment 124 The modified ODN of embodiment 122, wherein at least 12 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0180] Embodiment 125. The modified ODN of embodiment 124, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*utagggttagggu*u*a*g*g*g*(Sequence number 148) is a glycosylated form of u, a, and / or g.

[0181] Embodiment 126 The modified ODN of embodiment 124, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0182] Embodiment 127. The modified ODN of embodiment 126, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*tagggttaggg*u*u*a*g*g*g*(Sequence number 149) is a glycosylated form of u, a, and / or g.

[0183] Embodiment 128 The modified ODN of embodiment 126, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0184] Embodiment 129. The modified ODN of embodiment 128, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*t*a*gggttag*g*g*u*u*a*g*g*g*(Sequence number 150) is a glycosylated form of u, a, t, and / or g.

[0185] Embodiment 130 The modified ODN of embodiment 116, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0186] Embodiment 131 The modified ODN of embodiment 116, wherein all of the g nucleosides are sugar-modified versions thereof.

[0187] Embodiment 132 The modified ODN of embodiment 116, wherein all of the a nucleosides are sugar-modified.

[0188] Embodiment 133. The modified ODN of embodiment 1, comprising the following sequence: uuaggguuagggttaggguuaggg (SEQ ID NO: 9).

[0189] Embodiment 134 The modified ODN of embodiment 133, wherein at least four of the a, g, t and / or u nucleosides are sugar modified versions thereof.

[0190] Embodiment 135 The modified ODN of embodiment 134, wherein at least six of the a, g, t and / or u nucleosides are sugar modified versions thereof.

[0191] Embodiment 136. The modified ODN of embodiment 135, wherein the nucleoside is marked with an "*". u*u*a*ggguuagggttaggguuag*g*g* (SEQ ID NO: 151) is a glycosylated form of u, a, and / or g.

[0192] Embodiment 137 The modified ODN of embodiment 135, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0193] Embodiment 138. The modified ODN of embodiment 137, wherein the nucleoside is marked with an "*". u*u*a*g*gguuagggttaggguua*g*g*g*(SEQ ID NO: 152) is a glycosylated form of u, a, and / or g.

[0194] Embodiment 139 The modified ODN of embodiment 137, wherein at least 10 of the a, c, g, t and / or u nucleosides are sugar-modified.

[0195] Embodiment 140. The modified ODN of embodiment 139, wherein the nucleoside is marked with an "*". u*u*a*g*g*guuagggttaggguu*a*g*g*g*(SEQ ID NO: 153) is a glycosylated form of u, a, and / or g.

[0196] Embodiment 141 The modified ODN of embodiment 139, wherein at least 12 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0197] Embodiment 142. The modified ODN of embodiment 141, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*uuagggttagggu*u*a*g*g*g*(SEQ ID NO: 154) is a glycosylated form of u, a, and / or g.

[0198] Embodiment 143 The modified ODN of embodiment 141, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0199] Embodiment 144. The modified ODN of embodiment 143, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*uagggttaggg*u*u*a*g*g*g*(Array number 155) is a glycosylated form of u, a, and / or g.

[0200] Embodiment 145 The modified ODN of embodiment 143, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0201] Embodiment 146. The modified ODN of embodiment 145, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*u*a*gggttag*g*g*u*u*a*g*g*g*(Sequence number 156) is a glycosylated form of u, a, and / or g.

[0202] Embodiment 147 The modified ODN of embodiment 133, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0203] Embodiment 148 The modified ODN of embodiment 133, wherein all of the g nucleosides are sugar-modified versions thereof.

[0204] Embodiment 149 The modified ODN of embodiment 133, wherein all of the a nucleosides are sugar-modified.

[0205] Embodiment 150. The modified ODN of embodiment 1, comprising the following sequence: uuaggguuaggguuaggguuaggg (SEQ ID NO: 10).

[0206] Embodiment 151 The modified ODN of embodiment 150, wherein at least four of the a, g, and / or u nucleosides are sugar modified therewith.

[0207] Embodiment 152 The modified ODN of embodiment 151, wherein at least six of the a, g, and / or u nucleosides are sugar modified therewith.

[0208] Embodiment 153. The modified ODN of embodiment 152, wherein the nucleoside is marked with an "*". u*u*a*ggguuaggguuaggguuag*g*g* (SEQ ID NO: 157) is a glycosylated form of u, a, and / or g.

[0209] Embodiment 154 The modified ODN of embodiment 152, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0210] Embodiment 155. The modified ODN of embodiment 154, wherein the nucleoside is marked with an "*". u*u*a*g*gguuaggguuaggguua*g*g*g*(SEQ ID NO: 158) is a glycosylated form of u, a, and / or g.

[0211] Embodiment 156 The modified ODN of embodiment 154, wherein at least 10 of the a, c, g, and / or u nucleosides are sugar modified.

[0212] Embodiment 157. The modified ODN of embodiment 156, wherein the nucleoside is marked with an "*". u*u*a*g*g*guuaggguuaggguu*a*g*g*g*(SEQ ID NO: 159) is a glycosylated form of u, a, and / or g.

[0213] Embodiment 158 ​​The modified ODN of embodiment 156, wherein at least 12 of the a, c, g, and / or u nucleosides are sugar modifications thereof.

[0214] Embodiment 159. The modified ODN of embodiment 158, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*uuaggguuagggu*u*a*g*g*g*(SEQ ID NO: 160) is a glycosylated form of u, a, and / or g.

[0215] Embodiment 160 The modified ODN of embodiment 158, wherein at least 14 of the a, c, g, and / or u nucleosides are sugar modified versions thereof.

[0216] Embodiment 161. The modified ODN of embodiment 160, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*uaggguuaggg*u*u*a*g*g*g*(Array number 161) is a glycosylated form of u, a, and / or g.

[0217] Embodiment 162 The modified ODN of embodiment 160, wherein at least 18 of the a, c, g, and / or u nucleosides are sugar modified versions thereof.

[0218] Embodiment 163. The modified ODN of embodiment 162, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*u*u*a*ggguuag*g*g*u*u*a*g*g*g*(Sequence number 162) is a glycosylated form of u, a, and / or g.

[0219] Embodiment 164 The modified ODN of embodiment 150, wherein all of the a, c, g, and u nucleosides are sugar-modified versions thereof.

[0220] Embodiment 165 The modified ODN of embodiment 150, wherein all of the g nucleosides are sugar-modified versions thereof.

[0221] Embodiment 166 The modified ODN of embodiment 150, wherein all of the a nucleosides are sugar-modified.

[0222] Embodiment 167. The modified ODN of embodiment 1, comprising the following sequence: uuagggttagggttagggttaggg (SEQ ID NO: 11).

[0223] Embodiment 168 The modified ODN of embodiment 167, wherein at least four of the a, g, and / or t nucleosides are sugar modified therewith.

[0224] Embodiment 169 The modified ODN of embodiment 168, wherein at least six of the a, c, g, and / or t nucleosides are sugar modifications thereof.

[0225] Embodiment 170. The modified ODN of embodiment 169, wherein the nucleoside is marked with an "*". u*u*a*gggttagggttagggttag*g*g*(SEQ ID NO: 163) is a glycosylated form of u, a, and / or g.

[0226] Embodiment 171 The modified ODN of embodiment 169, wherein at least eight of the a, g, and / or t nucleosides are sugar modified therewith.

[0227] Embodiment 172. The modified ODN of embodiment 171, wherein the nucleoside is marked with an "*". u*u*a*g*ggttagggttagggtta*g*g*g*(SEQ ID NO: 164) is a glycosylated form of u, a, and / or g.

[0228] Embodiment 173 The modified ODN of embodiment 171, wherein at least 10 of the a, g, and / or t nucleosides are sugar modified.

[0229] Embodiment 174. The modified ODN of embodiment 173, wherein the nucleoside is marked with an "*". u*u*a*g*g*gttagggttagggtt*a*g*g*g*(SEQ ID NO: 165) is a glycosylated form of a, g, and / or u.

[0230] Embodiment 175 The modified ODN of embodiment 173, wherein at least 12 of the a, g, and / or t nucleosides are sugar modifications thereof.

[0231] Embodiment 176. The modified ODN of embodiment 175, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*ttagggttagggt*t*a*g*g*g*(SEQ ID NO: 166) is a glycosylated form of a, g, u, and / or t.

[0232] Embodiment 177 The modified ODN of embodiment 175, wherein at least 14 of the a, g, and / or t nucleosides are sugar modified versions thereof.

[0233] Embodiment 178. The modified ODN of embodiment 177, wherein the nucleoside is marked with an "*". u*u*a*g*g*g*t*tagggttaggg*t*t*a*g*g*g*(Array number 167) is a glycosylated form of a, u, g, and / or t.

[0234] Embodiment 179 The modified ODN of embodiment 167, wherein all of the a, g, and t nucleosides are sugar-modified versions thereof.

[0235] Embodiment 180 The modified ODN of embodiment 167, wherein all of the t nucleosides are sugar-modified versions thereof.

[0236] Embodiment 181 The modified ODN of embodiment 167, wherein all of the g nucleosides are sugar-modified versions thereof.

[0237] Embodiment 182. The modified ODN of embodiment 1, comprising the following sequence: utcaaattcaaattcaaattcaaa (SEQ ID NO: 12).

[0238] Embodiment 183 The modified ODN of embodiment 182, wherein at least four of the a, c, t and / or u nucleosides are sugar modified therewith.

[0239] Embodiment 184 The modified ODN of embodiment 163, wherein at least six of the a, c, t and / or u nucleosides are sugar modified therewith.

[0240] Embodiment 185. The modified ODN of embodiment 184, wherein the nucleoside is marked with an "*". u*t*c*aaattcaaattcaaattca*a*a*(SEQ ID NO: 168) is a glycosylated form of u, a, t, and / or c.

[0241] Embodiment 186 The modified ODN of embodiment 184, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0242] Embodiment 187. The modified ODN of embodiment 186, wherein the nucleoside is marked with an "*". u*t*c*a*aattcaaattcaaattc*a*a*a*(SEQ ID NO: 169) is a glycosylated form of u, a, t, and / or c.

[0243] Embodiment 188 The modified ODN of embodiment 186, wherein at least 10 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0244] Embodiment 189. The modified ODN of embodiment 188, wherein the nucleoside is marked with an "*". u*t*c*a*a*attcaaattcaaatt*c*a*a*a*(SEQ ID NO: 170) is a glycosylated form of u, a, t, and / or c.

[0245] Embodiment 190 The modified ODN of embodiment 188, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified versions thereof.

[0246] Embodiment 191. The modified ODN of embodiment 190, wherein the nucleoside is marked with an "*". u*t*c*a*a*a*ttcaaattcaaat*t*c*a*a*a*(Sequence number 171) is a glycosylated form of u, a, t, and / or c.

[0247] Embodiment 192 The modified ODN of embodiment 190, wherein at least 14 of the a, c, t, and / or u nucleosides are sugar modified versions thereof.

[0248] Embodiment 193. The modified ODN of embodiment 192, wherein the nucleoside is marked with an "*". u*t*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a*(Array number 172) is a glycosylated form of u, a, t, and / or c.

[0249] Embodiment 194 The modified ODN of embodiment 192, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0250] Embodiment 195. The modified ODN of embodiment 194, wherein the nucleoside is marked with an "*". u*t*c*a*a*a*t*t*caaattcaa*a*t*t*c*a*a*a*(array number 173) is a glycosylated form of u, a, t, and / or c.

[0251] Embodiment 196 The modified ODN of embodiment 182, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.

[0252] Embodiment 197 The modified ODN of embodiment 182, wherein all of the t nucleosides are sugar-modified versions thereof.

[0253] Embodiment 198 The modified ODN of embodiment 192, wherein all of the a nucleosides are sugar-modified.

[0254] Embodiment 199. The modified ODN of embodiment 1, comprising the following sequence: uucaaattcaaattcaaattcaaa (SEQ ID NO: 13).

[0255] Embodiment 200 The modified ODN of embodiment 199, wherein at least four of the a, c, t and / or u nucleosides are sugar modified therewith.

[0256] Embodiment 201 The modified ODN of embodiment 200, wherein at least six of the a, c, t, and / or u nucleosides are sugar modified therewith.

[0257] Embodiment 202. The modified ODN of embodiment 201, wherein the nucleoside is marked with an "*". u*u*c*aaattcaaattcaaattca*a*a*(SEQ ID NO: 174) is a glycosylated form of u, a, and / or c.

[0258] Embodiment 203 The modified ODN of embodiment 201, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0259] Embodiment 204. The modified ODN of embodiment 203, wherein the nucleoside is marked with an "*". u*u*c*a*aattcaaattcaaattc*a*a*a*(SEQ ID NO: 175) is a glycosylated form of u, a, and / or c.

[0260] Embodiment 205 The modified ODN of embodiment 203, wherein at least 10 of the a, c, t and / or u nucleosides are sugar-modified.

[0261] Embodiment 206. The modified ODN of embodiment 205, wherein the nucleoside is marked with an "*". u*u*c*a*a*attcaaattcaaatt*c*a*a*a*(SEQ ID NO: 176) is a glycosylated form of u, a, t, and / or c.

[0262] Embodiment 207 The modified ODN of embodiment 205, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified versions thereof.

[0263] Embodiment 208. The modified ODN of embodiment 207, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*ttcaaattcaaat*t*c*a*a*a*(SEQ ID NO: 177) is a glycosylated form of u, a, t, and / or c.

[0264] Embodiment 209 The modified ODN of embodiment 207, wherein at least 14 of the a, c, t, and / or u nucleosides are sugar modified versions thereof.

[0265] Embodiment 210. The modified ODN of embodiment 209, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a*(array number 178) is a glycosylated form of u, a, t, and / or c.

[0266] Embodiment 211 The modified ODN of embodiment 209, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0267] Embodiment 212. The modified ODN of embodiment 209, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*t*t*caaattcaa*a*t*t*c*a*a*a*(Array number 179) is a glycosylated form of u, a, t, and / or c.

[0268] Embodiment 213 The modified ODN of embodiment 199, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.

[0269] Embodiment 214 The modified ODN of embodiment 199, wherein all of the t nucleosides are sugar-modified versions thereof.

[0270] Embodiment 215 The modified ODN of embodiment 199, wherein all of the a nucleosides are sugar-modified.

[0271] Embodiment 216. The modified ODN of embodiment 1, comprising the following sequence: uucaaattcaaattcaaatucaaa (SEQ ID NO: 14).

[0272] Embodiment 217 The modified ODN of embodiment 216, wherein at least four of the a, c, t and / or u nucleosides are sugar modified therewith.

[0273] Embodiment 218 The modified ODN of embodiment 217, wherein at least six of the a, c, t and / or u nucleosides are sugar modified versions thereof.

[0274] Embodiment 219. The modified ODN of embodiment 218, wherein the nucleoside is marked with an "*". u*u*c*aaattcaaattcaaatuca*a*a*(SEQ ID NO: 180) is a glycosylated form of u, a, and / or c.

[0275] Embodiment 220 The modified ODN of embodiment 218, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0276] Embodiment 221. The modified ODN of embodiment 220, wherein the nucleoside is marked with an "*". u*u*c*a*aattcaaattcaaatuc*a*a*a*(SEQ ID NO: 181) is a glycosylated form of u, a, and / or c.

[0277] Embodiment 222 The modified ODN of embodiment 220, wherein at least 10 of the a, c, t and / or u nucleosides are sugar-modified.

[0278] Embodiment 223. The modified ODN of embodiment 222, wherein the nucleoside is marked with an "*". u*u*c*a*a*attcaaattcaaatu*c*a*a*a*(SEQ ID NO: 182) is a glycosylated form of u, a, and / or c.

[0279] Embodiment 224 The modified ODN of embodiment 222, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0280] Embodiment 225. The modified ODN of embodiment 224, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*ttcaaattcaaat*u*c*a*a*a*(SEQ ID NO: 183) is a glycosylated form of u, a, t, and / or c.

[0281] Embodiment 226 The modified ODN of embodiment 224, wherein at least 14 of the a, c, t, and / or u nucleosides are sugar modified versions thereof.

[0282] Embodiment 227. The modified ODN of embodiment 226, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*t*tcaaattcaaa*t*u*c*a*a*a*(Array number 184) is a glycosylated form of u, a, t, and / or c.

[0283] Embodiment 228 The modified ODN of embodiment 226, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0284] Embodiment 229. The modified ODN of embodiment 228, wherein the nucleoside is marked with an "*". u*u*c*a*a*a*t*t*caaattcaa*a*t*u*c*a*a*a*(Array number 185) is a glycosylated form of u, a, t, and / or c.

[0285] Embodiment 230 The modified ODN of embodiment 216, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.

[0286] Embodiment 231 The modified ODN of embodiment 216, wherein all of the t nucleosides are sugar-modified versions thereof.

[0287] Embodiment 232 The modified ODN of embodiment 216, wherein all of the a nucleosides are sugar-modified.

[0288] Embodiment 233. The modified ODN of embodiment 1, comprising the following sequence: ccucattagggtgaggg (SEQ ID NO: 15).

[0289] Embodiment 234 The modified ODN of embodiment 233, wherein at least four of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0290] Embodiment 235 The modified ODN of embodiment 234, wherein at least six of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0291] Embodiment 236. The modified ODN of embodiment 235, wherein the nucleoside is marked with an "*". c*c*u*cattagggtgag*g*g*(SEQ ID NO: 186) is a glycosylated form of u, g, and / or c.

[0292] Embodiment 237 The modified ODN of embodiment 235, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0293] Embodiment 238. The modified ODN of embodiment 237, wherein the nucleoside is marked with an "*". c*c*u*c*attagggtga*g*g*g*(SEQ ID NO: 187) is a glycosylated form of u, a, g, and / or c.

[0294] Embodiment 239 The modified ODN of embodiment 237, wherein at least 10 of the a, c, t and / or u nucleosides are sugar-modified.

[0295] Embodiment 240. The modified ODN of embodiment 239, wherein the nucleoside is marked with an "*". c*c*u*c*a*ttagggtg*a*g*g*g*(SEQ ID NO: 188) is a glycosylated form of u, a, g, and / or c.

[0296] Embodiment 241 The modified ODN of embodiment 239, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0297] Embodiment 242. The modified ODN of embodiment 241, wherein the nucleoside is marked with an "*". c*c*u*c*a*t*tagggt*g*a*g*g*g*(SEQ ID NO: 189) is a glycosylated form of u, a, g, t, and / or c.

[0298] Embodiment 243 The modified ODN of embodiment 241, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0299] Embodiment 244. The modified ODN of embodiment 243, wherein the nucleoside is marked with an "*". c*c*u*c*a*t*t*aggg*t*g*a*g*g*g*(SEQ ID NO: 190) is a glycosylated form of u, a, g, t, and / or c.

[0300] Embodiment 245 The modified ODN of embodiment 233, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0301] Embodiment 246 The modified ODN of embodiment 233, wherein all of the t nucleosides are sugar-modified versions thereof.

[0302] Embodiment 247 The modified ODN of embodiment 233, wherein all of the a nucleosides are sugar-modified.

[0303] Embodiment 248. The modified ODN of embodiment 1, comprising the following sequence: ugggcggttcaaccttca (SEQ ID NO: 16).

[0304] Embodiment 249 The modified ODN of embodiment 248, wherein at least four of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0305] Embodiment 250 The modified ODN of embodiment 249, wherein at least six of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0306] Embodiment 251. The modified ODN of embodiment 250, wherein the nucleoside is marked with an "*". u*g*g*gcggttcaacctt*c*a* (SEQ ID NO: 191) is a glycosylated form of u, a, g, t, and / or c.

[0307] Embodiment 252 The modified ODN of embodiment 250, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0308] Embodiment 253. The modified ODN of embodiment 252, wherein the nucleoside is marked with an "*". u*g*g*g*cggttcaacct*t*c*a* (SEQ ID NO: 192) is a glycosylated form of u, a, g, t, and / or c.

[0309] Embodiment 254 The modified ODN of embodiment 252, wherein at least 10 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0310] Embodiment 255. The modified ODN of embodiment 254, wherein the nucleoside is marked with an "*". u*g*g*g*c*ggttcaacc*t*t*c*a* (SEQ ID NO: 193) is a glycosylated form of u, a, g, t, and / or c.

[0311] Embodiment 256 The modified ODN of embodiment 254, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0312] Embodiment 257. The modified ODN of embodiment 256, wherein the nucleoside is marked with an "*". u*g*g*g*c*g*gttcaac*c*t*t*c*a*(Sequence number 194) is a glycosylated form of u, a, g, t, and / or c.

[0313] Embodiment 258 The modified ODN of embodiment 256, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0314] Embodiment 259. The modified ODN of embodiment 258, wherein the nucleoside is marked with an "*". u*g*g*g*c*g*g*ttcaa*c*c*t*t*c*a*(Array number 195) is a glycosylated form of u, a, g, t, and / or c.

[0315] Embodiment 260 The modified ODN of embodiment 248, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0316] Embodiment 261 The modified ODN of embodiment 248, wherein all of the t nucleosides are sugar-modified versions thereof.

[0317] Embodiment 262 The modified ODN of embodiment 248, wherein all of the g nucleosides are sugar-modified versions thereof.

[0318] Embodiment 263. The modified ODN of embodiment 1, comprising the following sequence: ugggcggttcaaccuuca (SEQ ID NO: 17).

[0319] Embodiment 264 The modified ODN of embodiment 263, wherein at least four of the a, c, g, t and / or u nucleosides are sugar modified therewith.

[0320] Embodiment 265 The modified ODN of embodiment 264, wherein at least six of the a, c, g, t and / or u nucleosides are sugar modified versions thereof.

[0321] Embodiment 266. The modified ODN of embodiment 265, wherein the nucleoside is marked with an "*". u*g*g*gcggttcaaccuu*c*a* (SEQ ID NO: 196) is a glycosylated form of u, a, g, and / or c.

[0322] Embodiment 267 The modified ODN of embodiment 265, wherein at least eight of the a, c, t and / or u nucleosides are sugar modified therewith.

[0323] Embodiment 268. The modified ODN of embodiment 267, wherein the nucleoside is marked with an "*". u*g*g*g*cggttcaaccu*u*c*a* (SEQ ID NO: 197) is a glycosylated form of u, a, g, and / or c.

[0324] Embodiment 269 The modified ODN of embodiment 267, wherein at least 10 of the a, c, t and / or u nucleosides are sugar-modified therewith.

[0325] Embodiment 270. The modified ODN of embodiment 269, wherein the nucleoside is marked with an "*". u*g*g*g*c*ggttcaacc*u*u*c*a* (SEQ ID NO: 198) is a glycosylated form of u, a, g, and / or c.

[0326] Embodiment 271 The modified ODN of embodiment 269, wherein at least 12 of the a, c, t and / or u nucleosides are sugar modified therewith.

[0327] Embodiment 272. The modified ODN of embodiment 271, wherein the nucleoside is marked with an "*". u*g*g*g*c*g*gttcaac*c*u*u*c*a*(Sequence number 199) is a glycosylated form of u, a, g, and / or c.

[0328] Embodiment 273 The modified ODN of embodiment 271, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar modified versions thereof.

[0329] Embodiment 274. The modified ODN of embodiment 273, wherein the nucleoside is marked with an "*". u*g*g*g*c*g*g*ttcaa*c*c*u*u*c*a*(array number 200) is a glycosylated form of u, a, g, and / or c.

[0330] Embodiment 275 The modified ODN of embodiment 263, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

[0331] Embodiment 276 The modified ODN of embodiment 263, wherein all of the t nucleosides are sugar-modified versions thereof.

[0332] Embodiment 277 The modified ODN of embodiment 263, wherein all of the a nucleosides are sugar-modified versions thereof.

[0333] Embodiment 278. The modified ODN of any one of embodiments 1 to 277, comprising SMN1. With reference to the sequences in Table 1, SMN1 corresponds to the modified nucleoside designated "(M)". For example, "G(M)" refers to: [ka]

[0334] Embodiment 279. The modified ODN of any one of embodiments 1 to 278, comprising SMN2. With reference to the sequences in Table 1, SMN2 corresponds to the modified nucleoside designated "(F)". For example, "G(F)" refers to: [ka]

[0335] Embodiment 280. The modified ODN of any one of embodiments 1 to 279, comprising SMN3. With reference to the sequences in Table 1, SMN3 corresponds to the modified nucleoside designated "(m)". For example, "G(m)" refers to: [ka]

[0336] Embodiment 281. The modified ODN of any one of embodiments 1 to 280, comprising SMN4. With reference to the sequences in Table 1, SMN4 corresponds to the modified nucleoside designated "(L)". For example, "G(L)" refers to: [ka]

[0337] Embodiment 282. The modified ODN of any one of embodiments 1 to 281, comprising SMN5. With reference to the sequences in Table 1, SMN5 corresponds to the modified nucleoside designated "(H)". For example, "G(H)" refers to: [ka]

[0338] Embodiment 283. The modified ODN of any one of embodiments 1 to 282, comprising SMN6. With reference to the sequences in Table 1, SMN6 corresponds to the modified nucleoside designated "(E)". For example, "G(E)" refers to: [ka]

[0339] Embodiment 284. The modified ODN of any one of embodiments 1 to 283, comprising SMN7. With reference to the sequences in Table 1, SMN7 corresponds to the modified nucleoside designated "n". For example, "g" refers to: [ka]

[0340] Embodiment 285. The modified ODN of any one of embodiments 1 to 284, comprising SMN8. With reference to the sequences in Table 1, SMN8 corresponds to the modified nucleoside designated "N". For example, "G" refers to: [ka]

[0341] Embodiment 286. The modified ODN of any one of embodiments 1 to 285, comprising SMN9. With reference to the sequences in Table 1, SMN9 corresponds to the modified nucleoside designated "(n)". For example, "(g)" refers to: [ka]

[0342] Embodiment 287. The modified ODN of any one of embodiments 1 to 286, wherein each internucleoside linkage is a phosphorothioate linkage.

[0343] Embodiment 288. The modified ODN of any one of embodiments 1 to 287, wherein at least one internucleoside linkage is a phosphorodithioate linkage.

[0344] Embodiment 289. The modified ODN of any one of embodiments 1 to 286, wherein each internucleoside linkage is a phosphodiester bond.

[0345] With reference to the sequences in Table 1, an internucleoside "^" indicates the presence of a phosphorothioate linkage at that position in the ODN, and "^^" indicates the presence of a phosphorodithioate linkage as shown below: U(M)^U(M)^^A(M)^G(M) (SEQ ID NO: 18): [ka]

[0346] Embodiment 290. An ODN or modified ODN comprising a sequence set forth in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]

[0347] The ODNs and modified ODNs disclosed in this section are collectively referred to as "ODNs of the Disclosure," and individually as "ODN of the Disclosure."

[0348] II. Lipid Nanoparticles (LNPs) As used herein, the term "lipid nanoparticle" or "LNP" includes lipid formulations that can be used to deliver therapeutic agents, such as the therapeutic nucleic acids and / or ODNs of the present disclosure, to a desired target site, e.g., a cell, tissue, organ, etc., within a subject in need thereof. LNPs are described, for example, in US2021 / 0052646.

[0349] In one embodiment, the present disclosure provides lipid nanoparticles comprising one or more ODNs of the present disclosure and therapeutic nucleic acids, such as DNA or RNA.In some embodiments, therapeutic agents such as therapeutic nucleic acids can be encapsulated in particles, thereby protecting them from enzymatic degradation.In some embodiments, one or more ODNs of the present disclosure and therapeutic nucleic acids are not covalently linked to each other.In some embodiments, one or more ODNs of the present disclosure and therapeutic nucleic acids are encapsulated in the same lipid nanoparticle.In some embodiments, one or more ODNs of the present disclosure and therapeutic nucleic acids are encapsulated in separate lipid nanoparticles.

[0350] In other embodiments, the present disclosure provides lipid nanoparticles comprising one or more ODNs of the present disclosure, a therapeutic nucleic acid, and a cationic lipid.

[0351] In other embodiments, the present disclosure provides lipid nanoparticles comprising one or more ODNs of the present disclosure, a therapeutic nucleic acid, a cationic lipid, and a non-cationic lipid.

[0352] In some embodiments, the average diameter of the LNPs is less than 1 μm.

[0353] The LNPs described in this section are collectively referred to as the "LNPs of the Disclosure" and individually as a "LNP of the Disclosure."

[0354] III. Cationic lipids In the present disclosure, "cationic lipid" refers to a lipid that has a net positive charge at a selected pH. The cationic lipid used in the lipid nanoparticles of the present disclosure is not particularly limited. For example, cationic lipids described in WO2015 / 011633, WO2016 / 021683, WO2011 / 153493, WO2013 / 126803, WO2010 / 054401, WO2010 / 042877, WO2016 / 104580, WO2015 / 005253, WO2014 / 007398, WO2017 / 117528, WO2017 / 075531, WO2017 / 00414, WO2015 / 199952, US2015 / 0239834, WO2019 / 131839, or WO2020 / 032184 can be in the lipid nanoparticles of the present disclosure.

[0355] In one embodiment, the cationic lipids used in the LNPs of the present disclosure are described in WO2015 / 011633.

[0356] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka] [ka] [ka]

[0357] and salts thereof.

[0358] In other embodiments, the cationic lipids used in the LNPs of the present disclosure are described in WO2016 / 021683.

[0359] In other embodiments, the cationic lipid used in the LNPs of the present disclosure is a compound of the following formula: [ka] During the ceremony,

[0360] W is the formula -NR 1 R 2 or formula-N + R 3 R 4 R 5 (Z - ) and

[0361] R 1 and R 2 are each independently, C 1-4 is an alkyl group or a hydrogen atom,

[0362] R 3 , R 4 and R 5 are each independently, C 1-4 is an alkyl group,

[0363] Z - is an anion,

[0364] X is an optionally substituted C 1-6 is an alkylene group,

[0365] Y A , Y B and Y C are each independently an optionally substituted methine group;

[0366] LA , L B and L C are each independently an optionally substituted methylene group or a bond;

[0367] R A1 , R A2 , R B1 , R B2 , R C1 and R C2 each independently represents an optionally substituted C 4-10 It is an alkyl group or a salt thereof.

[0368] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka]

[0369] and salts thereof.

[0370] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka]

[0371] and salts thereof.

[0372] In other embodiments, the cationic lipid used in the LNPs of the present disclosure is a compound of formula (II): [ka] During the ceremony,

[0373] n is an integer from 2 to 5,

[0374] R is a linear C 1-5 Alkyl group, linear C 7-11 Alkenyl group or straight chain C 11 is an alkadienyl group,

[0375] Each wavy line independently represents a cis or trans bond, or a salt thereof.

[0376] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka]

[0377] and salts thereof.

[0378] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka]

[0379] and salts thereof.

[0380] In other embodiments, the cationic lipid used in the LNPs of the present disclosure is a compound of formula (III): [ka] During the ceremony,

[0381] n1 is an integer from 2 to 6,

[0382] n2 is an integer from 0 to 2,

[0383] n3 is an integer from 0 to 2,

[0384] L is -C(O)O- or -NHC(O)O-;

[0385] Ra is a linear C 5-13 Alkyl group, linear C 13-17 Alkenyl group or straight chain C 17 is an alkadienyl group,

[0386] Rb is a linear C 2-9 is an alkyl group,

[0387] Rc is a hydrogen atom or a linear C 2-9 is an alkyl group,

[0388] Rd is a hydrogen atom or a linear C 2-9 is an alkyl group,

[0389] Re is a linear C 2-9 is an alkyl group,

[0390] Rf is linear C 2-9 It is an alkyl group or a salt thereof.

[0391] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka] [ka] [ka]

[0392] and salts thereof.

[0393] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka]

[0394] and salts thereof.

[0395] In other embodiments, the cationic lipids used in the LNPs of the present disclosure are described in WO2011 / 153493.

[0396] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

[0397] In other embodiments, cationic lipids for use in the LNPs of the present disclosure are set forth in the table below: [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22 Table 2-23 Table 2-24 [Table 2-25]

[0398] and salts thereof.

[0399] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka]

[0400] and salts thereof.

[0401] In other embodiments, the cationic lipids used in the LNPs of the present disclosure are described in WO2013 / 126803.

[0402] In other embodiments, cationic lipids used in the LNPs of the present disclosure include: [ka] [ka] [ka] [ka]

[0403] and salts thereof.

[0404] In other embodiments, the cationic lipid used in the LNPs of the present disclosure is: [ka]

[0405] and its salts.

[0406] In other embodiments, the cationic lipids used in the LNPs of the present disclosure include those described in Dong et al., Proc Natl Acad Sci USA. 2014 Apr.15;111(15):5753, examples thereof include K-E12, H-A12, Y-E12, G-O12, K-A12, R-A12, cKK-E12, cPK-E12, PK1K-E12, PK500-E12, cQK-E12, cKK-A12, KK-A12, PK-4K-E12, cWK-E12, PK500-O12, PK1K-O12, cYK-E12, cDK-E12, cSK-E12, cEK-E12, cMK-E12, cKK-012, cIK-E12, cKK-E10, cKK-E14, and cKK-E16.

[0407] In other embodiments, cationic lipids used in the LNPs of the present disclosure include C14-98, C18-96, C14-113, C14-120, C14-120, C14-110, C16-96, and C12-200, as described in Love KT et al. (Proc Natl Acad Sci USA. 2010 May 25;107(21):9915).

[0408] In other embodiments, the cationic lipid used in the LNPs of the present disclosure is a compound of formula (I): [ka] During the ceremony,

[0409] L 1 is C 1-22 Alkylene group, C 2-22 Alkenylene group or C 3-22 is an alkadienylene group,

[0410] n is an integer of 0 or 1,

[0411] R1 teeth

[0412] (1) a hydrogen atom,

[0413] (2) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 1-22 alkyl groups,

[0414] (3) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 2-22 an alkenyl group, or

[0415] (4) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 3-22 is an alkadienyl group, R 2 -CH2-O-CO-R 5 , -CH2-CO-OR 5 or -R 5 and R 3 is a hydrogen atom, -CH2-O-CO-R 6 , -CH2-CO-OR 6 or -R 6 and R 4 is a hydrogen atom, -CH2-O-CO-R 7 , -CH2-CO-OR 7 or -R 7 and R 5 , R 6 and R 7 are each independently

[0416] (1) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 1-22 alkyl groups,

[0417] (2) Linear C 1-22Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 2-22 alkenyl groups,

[0418] (3) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 3-22 an alkadienyl group, R8 and R9 each independently represent C 1-6 an alkyl group, or

[0419] (4)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0420] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0421] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 represents an alkadienyl group,

[0422] R8 and R9 are each independently C 1-6 It is an alkyl group or a salt thereof.

[0423] L 1 is C 1-22 Alkylene group, C 2-22 Alkenylene group or C 3-22 is an alkadienylene group,

[0424] L 1 is preferably C 1-22 is an alkylene group,

[0425] L 1 is preferably C 1-12 is an alkylene group,

[0426] L 1 is more preferably C 1-6 is an alkylene group,

[0427] n is an integer of 0 or 1,

[0428] n is preferably an integer equal to 1;

[0429] R 1 teeth

[0430] (1) a hydrogen atom,

[0431] (2) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 1-22 alkyl groups,

[0432] (3) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 2-22 an alkenyl group, or

[0433] (4) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 3-22 is an alkadienyl group,

[0434] R 1 is preferably

[0435] (1) a hydrogen atom,

[0436] (2) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 6-12 alkyl group) substituted with a straight chain C1-22 Alkyl groups (preferably straight chain C 6-12 alkyl group), or

[0437] (3) optionally one or two straight-chain C 2-22 Alkenyl groups (preferably straight chain C 6-12 Alkenyl)-substituted linear C 2-22 Alkenyl groups (preferably straight chain C 6-12 alkenyl group),

[0438] R 1 is particularly preferably a hydrogen atom,

[0439] R 2 is -CH2-O-CO-R 5 , -CH2-CO-OR 5 or -R 5 and

[0440] R 2 is preferably —CH—O—CO—R 5 or -R 5 and

[0441] R 2 is more preferably —CH—O—CO—R 5 and

[0442] R 3 is a hydrogen atom, -CH2-O-CO-R 6 , -CH2-CO-OR 6 or -R 6 and

[0443] R 3 is preferably a hydrogen atom or —CH—O—CO—R 6 or -R 6 and

[0444] R 3 is more preferably —CH—O—CO—R 6 and

[0445] R 4is a hydrogen atom, -CH2-O-CO-R 7 , -CH2-CO-OR 7 or -R 6 and

[0446] R 4 is preferably a hydrogen atom or —CH—O—CO—R 7 is.

[0447] R 4 is more preferably —CH—O—CO—R 7 and

[0448] R 5 , R 6 and R 7 are each independently

[0449] (1) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 1-22 alkyl groups,

[0450] (2) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 2-22 alkenyl groups,

[0451] (3) Linear C 1-22 Alkyl groups and linear C 2-22 A straight chain C optionally substituted with one or two substituents selected from alkenyl groups 3-22 an alkadienyl group, or

[0452] (4)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 is.

[0453] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0454] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 represents an alkadienyl group,

[0455] R 5 , R 6 and R 7 are each independently preferably

[0456] (1) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 1-10 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 4-18 alkyl group),

[0457] (2) Linear C 2-22 Alkenyl groups (preferably straight chain C 4-18 alkenyl group),

[0458] (3) Linear C 3-22 Alkadienyl groups (preferably straight-chain C 4-18 alkadienyl group), or

[0459] (4)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0460] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0461] R 11 is H, optionally substituted C 1-18Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 represents an alkadienyl group,

[0462] R 5 , R 6 and R 7 are each independently, more preferably

[0463] (1) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 1-10 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 4-18 alkyl group),

[0464] (2) Linear C 2-22 Alkenyl groups (preferably straight chain C 4-18 alkenyl group), or

[0465] (3)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0466] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0467] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 Represents an alkadienyl group.

[0468] R8 and R9 are each independently C 1-6 is an alkyl group,

[0469] R8 and R9 are each independently C 1-3It is an alkyl group (preferably methyl).

[0470] Preferably, compound (I) is a compound of formula (I) above, wherein

[0471] L 1 is C 1-22 Alkylene group (preferably C 1-12 an alkylene group, more preferably a Ce alkylene group),

[0472] n is an integer equal to 1,

[0473] R 1 teeth

[0474] (1) a hydrogen atom,

[0475] (2) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 6-12 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 6-12 alkyl group), or

[0476] (3) optionally one or two straight-chain C 2-22 Alkenyl groups (preferably straight chain C 6-12 Alkenyl group) substituted with a straight chain C 2-22 Alkenyl groups (preferably straight chain C 6-12 alkenyl group), R 2 -CH2-O-CO-R 5 or -R 5 and R 3 is a hydrogen atom or -CH2-O-CO-R 6 or -R 6 and R 4 is a hydrogen atom or -CH2-O-CO-R 7 and R 5 , R 6 and R 7 are each independently

[0477] (1) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 1-10 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 4-18 alkyl group),

[0478] (2) Linear C 2-22 Alkenyl groups (preferably straight chain C 4-18 alkenyl group),

[0479] (3) Linear C 3-22 Alkadienyl groups (preferably straight-chain C 4-18 alkadienyl group), or

[0480] (4)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0481] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0482] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 R8 and R9 each independently represent an alkadienyl group. 1-6 Alkyl group (preferably C 1-3 alkyl groups, particularly preferably methyl).

[0483] In another embodiment, compound (I) is a compound of formula (I) above, wherein:

[0484] L 1 is C 1-12 Alkylene group (preferably C 1-6 alkylene group), n is an integer equal to 1, R 1 is a hydrogen atom, R 2 -CH2-O-CO-R 5 and R 3 -CH2-O-CO-R 6 and R 4 -CH2-O-CO-R 7 and R 5 , R 6 and R 7 are each independently

[0485] (1) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 1-10 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 4-18 alkyl group),

[0486] (2) Linear C 2-22 Alkenyl groups (preferably straight chain C 4-18 alkenyl group),

[0487] (3) Linear C 3-22 Alkadienyl groups (preferably straight-chain C 4-18 alkadienyl group), or

[0488] (4)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0489] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0490] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C3-18 Alkenyl group or optionally substituted C 15-18 represents an alkadienyl group, R8 and R9 are each independently C 1-6 Alkyl group (preferably C 1-3 alkyl groups, particularly preferably methyl).

[0491] In another embodiment, compound (I) is a compound of formula (I) above, wherein:

[0492] L 1 is C 1-6 is an alkylene group,

[0493] n is an integer equal to 1, R 1 is a hydrogen atom, R 2 -CH2-O-CO-R 5 and R 3 -CH2-O-CO-R 6 can be, R 4 -CH2-O-CO-R 7 and R 5 , R 6 and R 7 are each independently

[0494] (1) Optionally, one or two straight chain C 1-22 Alkyl groups (preferably straight chain C 1-10 alkyl group) substituted with a straight chain C 1-22 Alkyl groups (preferably straight chain C 4-18 alkyl group),

[0495] (2) Linear C 2-22 Alkenyl groups (preferably straight chain C 4-18 alkenyl group), or

[0496] (3)-R 10 -CO-OR 11 or -R 10 -O-CO-R 11 and

[0497] R 10 is an arbitrarily substituted C 1-16 Alkylene group, optionally substituted C 4-16 Alkenylene group or optionally substituted C 7-16 represents an alkadienylene group,

[0498] R 11 is H, optionally substituted C 1-18 Alkyl groups, optionally substituted C 3-18 Alkenyl group or optionally substituted C 15-18 represents an alkadienyl group, R8 and R9 are each independently C 1-3 It is an alkyl group (preferably methyl).

[0499] In other embodiments, the cationic lipids used in the lipid nanoparticles of the present disclosure include those in Table 2. [Table 3-1] [Table 3-2]

[0500] In some embodiments, the salt of the above-mentioned cationic lipid is pharmacologically acceptable salt.Examples thereof include salts with inorganic bases (for example, alkali metal salts such as sodium salt, potassium salt, etc.; alkaline earth metal salts such as calcium salt, magnesium salt, etc.; aluminum salt, ammonium salt), salts with organic bases (for example, trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, tromethamine [tris(hydroxymethyl)methylamine], tert-butylamine, cyclohexylamine, benzylamine, dicyclohexylamine, N,N- salts with dibenzylethylenediamine), salts with inorganic acids (for example, salts with hydrofluoric acid, hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, sulfuric acid, phosphoric acid), salts with organic acids (salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid), salts with basic amino acids (salts with arginine, lysine, ornithine), or salts with acidic amino acids (salts with aspartic acid, glutamic acid).

[0501] The ratio (mol %) of cationic lipids to the total lipids present in the lipid nanoparticles of the present disclosure is, for example, about 10% to about 80%, about 20% to about 70%, or about 40% to about 60%, but is not limited to these ratios.

[0502] The cationic lipids may be used alone or in combination of two or more thereof. When a plurality of cationic lipids are used, the total ratio of the cationic lipids is, for example, as described above.

[0503] IV. Non-cationic lipids In the present disclosure, the term "non-cationic lipid" refers to a lipid other than a cationic lipid, which is a lipid that does not have a net positive charge at a selected pH, such as physiological pH. Examples of non-cationic lipids used in the lipid nanoparticles of the present disclosure include phospholipids, steroids, PEG lipids, etc.

[0504] To enhance delivery of nucleic acid payloads to target cells, tissues, and organs, phospholipids are not particularly limited as long as they stably retain nucleic acids and do not inhibit fusion with cell membranes (cell membranes and organelle membranes). Examples include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and dilinolenoylphosphatidylcholine.

[0505] Phospholipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), palmitoyloleoylphosphatidylglycerol (POPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal). In some embodiments, the phospholipid is DOPC, DPPC, POPC, or DOPE.

[0506] The ratio (mol %) of phospholipids to all lipids present in the lipid nanoparticles of the present disclosure can be, for example, about 0% to about 90%, about 5% to about 30%, or about 8% to about 15%.

[0507] The above phospholipids may be used alone or in combination of two or more thereof. When multiple phospholipids are used, the total ratio of the phospholipids is as described above.

[0508] Steroids include cholesterol, 5α-cholestanol, 5β-coprostanol, cholesteryl-(2'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, 6-ketocholestanol, 5α-cholestane, cholestenone, 5α-cholestanone, 5β-cholestanone, and cholesteryl decanoate. In some embodiments, the steroid is cholesterol.

[0509] When a steroid is present, the ratio (mol %) of the steroid to the total lipids present in the lipid nanoparticles of the present disclosure can be, for example, about 10% to about 60%, about 12% to about 58%, or about 20% to about 55%.

[0510] The above steroids may be used alone or in combination of two or more thereof. When multiple steroids are used, the total ratio of the steroids is as described above.

[0511] As used herein, the term "PEG lipid" refers to any complex of polyethylene glycol (PEG) and lipid. The PEG lipid is not particularly limited as long as it has the effect of suppressing aggregation of the lipid nanoparticles of the present disclosure. Examples of such PEGs include PEG-DAA conjugated with dialkyloxypropyl, PEG-DAG conjugated with diacylglycerol (e.g., SUNBRIGHT GM-020 (NOF CORPORATION)), PEG-PE conjugated with phospholipids such as phosphatidylethanolamine, PEG-Cer conjugated with ceramide, PEG-cholesterol conjugated with cholesterol, or derivatives thereof, or mixtures thereof, mPEG2000-1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG), 1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6-dioxaotanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG), and the like. PEG lipids include PEG-DGA, PEG-DAA, PEG-PE, PEG-Cer, and mixtures thereof, such as PEG-DAA conjugates selected from the group consisting of PEG-didecyloxypropyl conjugates, PEG-dilauryloxypropyl conjugates, PEG-dimyristyloxypropyl conjugates, PEG-dipalmityloxypropyl conjugates, PEG-distearyloxypropyl conjugates, and mixtures thereof.

[0512] The ratio (mol %) of PEG lipid to the total lipid present in the lipid nanoparticles of the present disclosure can be, for example, about 0% to about 20%, about 0.1% to about 5%, or about 0.7% to about 2%.

[0513] The ratio (mol %) of the terminally reactive PEG lipids in the total PEG lipids is, for example, about 10% to about 100%, about 20% to about 100%, or about 30% to about 100%.

[0514] The above PEG lipids may be used alone or in combination of two or more thereof. When multiple PEG lipids are used, the total ratio of the PEG lipids is as described above.

[0515] V. Therapeutic Nucleic Acids Immune responses, such as innate immune responses, to therapeutic nucleic acids can be attenuated by the methods and related compositions comprising the ODNs of the present disclosure.Therefore, these methods and compositions can enhance the efficacy of therapeutic nucleic acid molecule treatment, and may provide long-term therapeutic effects even with repeated administration of nucleic acid therapeutic agents.

[0516] Without being bound by any particular theory, the ODNs of the present disclosure can increase the expression of a protein encoded by a therapeutic nucleic acid, or reduce an immune response caused by the therapeutic nucleic acid, or both.

[0517] In one embodiment, the present disclosure provides a method for increasing the expression of a protein encoded by a therapeutic nucleic acid in a subject in need thereof, the method comprising administering an ODN or an LNP of the present disclosure to the subject.In some embodiments, the protein expression level achieved by administering a therapeutic nucleic acid in a subject increases by at least 10% after administering an LNP of the present disclosure, for example, an LNP comprising a therapeutic nucleic acid and an ODN of the present disclosure to the subject, compared to an LNP comprising a therapeutic nucleic acid but not an ODN of the present disclosure.In some embodiments, after administering an ODN or an LNP of the present disclosure, protein expression increases by at least 25%, at least 50%, at least 75%, at least 100%, at least 125%, at least 150%, at least 175%, at least 200%, at least 250%, at least 500%, at least 750%, at least 1000%, or at least 1500%.Any method known in the art for quantifying a specific protein in a patient or a biological sample collected from a patient can be used in the method of the present disclosure. Examples include, but are not limited to, PCR (polymerase chain reaction) or RT-PCR, flow cytometry, Northern blot, Western blot, immunoassays such as ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), Simoa™, gene chip analysis of RNA expression, immunohistochemistry, immunofluorescence, or mass spectrometry.

[0518] Nucleic acids generally have poor pharmacological properties because they are large, highly charged, rapidly degraded and eliminated from the body, recognized as foreign substances by the body, and targeted by immune responses (e.g., innate immune responses). Therefore, certain nucleic acids, such as therapeutic nucleic acids or nucleic acids used for research purposes (e.g., antisense oligodeoxynucleotides or viral vectors), often induce immune responses in vivo. The present disclosure provides pharmaceutical compositions and methods that maximize the durability of therapeutic nucleic acids in conditions where the target recipient's immune response is weakened, thereby increasing expression levels and improving, reducing, or eliminating such immune responses, thereby enhancing the efficacy of therapeutic nucleic acids. Without being bound by theory, this may also minimize potential adverse events that may lead to organ damage or other toxicity during nucleic acid therapy. In some embodiments, the compositions and methods provided herein relate to administering a modified ODN in combination with a therapeutic nucleic acid as a specific component for reducing an immune response, e.g., an innate immune response, thereby reducing the immune response caused by the presence of the therapeutic nucleic acid.

[0519] Immunogenic / immunostimulatory nucleic acids can include both deoxyribonucleic acid and ribonucleic acid. In the case of deoxyribonucleic acid (DNA), specific sequences or motifs have been shown to induce immune stimulation in mammals. These sequences or motifs include, but are not limited to, CpG motifs, pyrimidine-rich sequences, and palindromic sequences. CpG motifs in deoxyribonucleic acid are often recognized by endosomal Toll-like receptor 9 (TLR-9), thereby inducing both innate and adaptive immune pathways. Certain immunostimulatory ribonucleic acid (RNA) sequences are thought to bind to Toll-like receptors 6 and 7 (TLR-6 and TLR-7) and activate inflammatory responses via immune responses (e.g., innate immune responses). Furthermore, double-stranded RNA often exhibits immunostimulatory activity by binding to TLR-3. Therefore, foreign nucleic acid molecules, whether derived from pathogens or for therapeutic purposes, can be highly immunogenic in vivo.

[0520] Provided herein is the characterization and development of nucleic acid molecules for potential therapeutic applications in conjunction with the inhibition, e.g., prevention, reduction, reduction, suppression, amelioration, mitigation, prevention, or elimination, of an immune response (e.g., an innate immune response). In some embodiments, chemical modifications of oligodeoxynucleotides to alter and improve in vivo properties (delivery, stability, longevity, folding, target specificity), as well as biological functions and mechanisms directly relevant to therapeutic applications, are described where appropriate.

[0521] As used herein, the terms "nucleic acid therapeutic agent," "therapeutic nucleic acid," and "TNA" are used interchangeably and refer to any therapeutic agent that uses a nucleic acid as an active ingredient in a therapeutic agent to treat a disease or disorder. For example, therapeutic nucleic acid may refer to an RNA-based therapeutic agent and / or a DNA-based therapeutic agent. Non-limiting examples of RNA-based therapeutic agents include mRNA, antisense RNA and oligodeoxynucleotides, ribozymes, aptamers, interfering RNA (RNAi), dicer substrate dsRNA, small hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), and microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigene, viral DNA (e.g., lentivirus or AAV genome) or nonviral synthetic DNA vector, closed linear double-stranded DNA (ceDNA / CELiD), plasmid, nanoplasmid™, bacmid, Doggybone (dbDNA™) DNA vector, minimal immunologically defined gene expression (MIDGE) vector, nonviral ministring DNA vector (linear covalently closed DNA vector), or dumbbell DNA minimal vector ("dumbbell DNA").

[0522] Exemplary therapeutic nucleic acids of the present disclosure that may be immunostimulatory and require the use of ODNs of the present disclosure include, but are not limited to, minigenes, plasmids, minicircles, small interfering RNAs (siRNAs), microRNAs (miRNAs), antisense oligodeoxynucleotides (ASOs), ribozymes, end-closed double-stranded DNA (e.g., ceDNA, CELiDs, linear covalently closed DNA ("ministring"), Doggybone (dbDNA™), protelomere-closed DNA, or dumbbell-shaped linear DNA), Dicer substrate dsRNA, small hairpin RNAs (shRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), mRNAs, tRNAs, rRNAs, and DNA viral vectors, viral RNA vectors, and any combination thereof. Other therapeutic nucleic acids are known in the art. See, e.g., US20220119840.

[0523] The present disclosure also contemplates siRNA or miRNA as nucleic acid therapeutics, which can downregulate the intracellular levels of specific proteins through a process called RNA interference (RNAi). When siRNA or miRNA is introduced into the cytoplasm of a host cell, these double-stranded RNA structures can bind to a protein called RISC. The sense strand of the siRNA or miRNA is removed by the RISC complex. When the RISC complex binds to complementary mRNA, it cleaves the mRNA and releases the cleaved strand. RNAi induces specific destruction of mRNA, resulting in downregulation of the corresponding protein.

[0524] Antisense oligodeoxynucleotides (ASOs) and ribozymes, which inhibit mRNA-to-protein translation, are potential nucleic acid therapeutics. In the case of antisense constructs, these single-stranded deoxynucleotides possess sequences complementary to the target protein mRNA sequence and can bind to the mRNA through Watson-Crick base pairing. This binding prevents translation of the target mRNA and / or triggers RNase H degradation of the mRNA transcript. As a result, antisense oligodeoxynucleotides have increased specificity of action (i.e., downregulation of specific disease-related proteins).

[0525] In any of the methods provided herein, the therapeutic nucleic acid can be a therapeutic RNA.The therapeutic RNA can be an inhibitor of mRNA translation, an RNA interference (RNAi) agent, a catalytically active RNA molecule (ribozyme), a transfer RNA (tRNA) or mRNA transcript (ASO), or an RNA that binds to protein or other molecular ligands (aptamers).In any of the methods provided herein, the RNAi agent can be double-stranded RNA, single-stranded RNA, microRNA, short interfering RNA, short hairpin RNA, or triplex-forming oligodeoxynucleotide.

[0526] According to some embodiments, the therapeutic nucleic acid is a closed-end double-stranded DNA, such as ceDNA. According to some embodiments, the expression and / or production of the therapeutic protein in cells is derived from a non-viral DNA vector, such as a ceDNA vector. A distinct advantage of ceDNA vectors over traditional AAV vectors and even lentiviral vectors for expressing therapeutic proteins is that there is no size constraint on the heterologous nucleic acid sequence encoding the protein of interest. Thus, even large therapeutic proteins can be expressed from a single ceDNA vector. In this way, ceDNA vectors can be used to express therapeutic proteins in subjects in need thereof.

[0527] Generally, the ceDNA vectors for expression of therapeutic proteins disclosed herein comprise, in a 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR. The ITR sequences are selected from either: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetrically modified ITR); (ii) two modified ITRs in which the mod-ITR pair have different three-dimensional spatial configurations relative to each other (e.g., an asymmetrically modified ITR); (iii) a symmetric or substantially symmetric WT-WT ITR pair (each WT-ITR has the same three-dimensional spatial configuration); or (iv) a symmetric or substantially symmetric modified ITR pair (each mod-ITR has the same three-dimensional spatial configuration).

[0528] VI. Treatment method The present disclosure provides a method for preventing, reducing, or eliminating an unwanted immune response (e.g., an innate immune response) in a subject (e.g., a human subject) by administering to the subject at least one component capable of reducing an immune response (e.g., an innate immune response), such as an ODN of the present disclosure, and a nucleic acid (e.g., a therapeutic nucleic acid or a nucleic acid used for research purposes), wherein the administration of the component capable of reducing an immune response (e.g., an innate immune response) and the administration of the nucleic acid are temporally correlated to provide modulation of the immune response (e.g., an innate immune response) when the administration of the two agents is provided in combination. These two agents can be administered simultaneously in a co-formulated formulation, such as an LNP, simultaneously in different formulations, or separately at different times. As described above, the combination of agents in the LNP of the present disclosure can (i) increase the expression of a protein encoded by a therapeutic nucleic acid in a subject, or (ii) increase the expression of a protein encoded by a therapeutic nucleic acid in a subject and reduce an immune response.

[0529] In one embodiment, the present disclosure provides a method for inhibiting, e.g., preventing, reducing, suppressing, improving, alleviating, preventing, or eliminating, an immune response in a subject in need thereof, the method comprising administering an ODN or LNP of the present disclosure to the subject. In some embodiments, the immune response in a subject that would be caused by administration of a therapeutic nucleic acid is reduced by at least 5% after administration of an LNP of the present disclosure, e.g., an LNP comprising a therapeutic nucleic acid and an ODN of the present disclosure, compared to an LNP comprising a therapeutic nucleic acid but not an ODN of the present disclosure. In some embodiments, the immune response is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 99% after administration of an LNP of the present disclosure. The reduction of immune response can be measured by, for example, determining the level of inflammatory cytokines, such as IFNα, in the subject before administering the ODN or LNP of the present disclosure, and again after administering the ODN or LNP of the present disclosure.The method used to measure the expression level of inflammatory cytokines is well known in the art.

[0530] In other embodiments, the present disclosure provides a method for treating or preventing a disease, disorder, or condition in a subject in need thereof, the method comprising administering an ODN or LNP of the present disclosure to the subject. In some embodiments, the disease, disorder, or condition is a genetic disease. In some embodiments, the genetic disease is Duchenne muscular dystrophy (DMD), Gaucher disease, Fabry disease, ornithine transcarbamylase deficiency, hemophilia (hemophilia A or hemophilia B), cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, genetic disorders of liver metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, or Tay-Sachs disease.

[0531] VII.Definition In order that this specification may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0532] It should be noted that the term "a" element or "an" element refers to one or more of that element; for example, "a nucleotide sequence" is understood to refer to one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0533] Furthermore, as used herein, "and / or" shall be construed as specifically disclosing the two specified features or components, with or without the other. Thus, the term "and / or," when used herein in phrases such as "A and / or B," is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or," when used in phrases such as "A, B, and / or C," is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0534] Whenever an embodiment is described herein using the term "comprising," it is understood that otherwise similar embodiments described using the terms "consisting of" and / or "consisting essentially of" are also provided.

[0535] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press provide those skilled in the art with a general dictionary for many of the terms used in this disclosure.

[0536] Units, prefixes, and symbols are indicated in the form recognized by the International System of Units (SI). Numerical ranges are inclusive of the numbers defining the range. Unless otherwise specified, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of this disclosure, which may be retained by reference to the entire specification. Accordingly, the terms defined immediately below are more fully defined by reference to the entire specification.

[0537] The term "about" is used herein to mean approximately, roughly, in the vicinity of, or within a range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the recited numerical values. Generally, the term "about" can modify numerical values ​​above and below the stated value by a variance (increase or decrease) of ±10%.

[0538] The term "oligonucleotide" or "ODN" refers to an oligomer or polymer of nucleosides, such as naturally occurring nucleosides and / or modified nucleosides, covalently linked to each other via internucleoside linkages. ODNs useful in the present disclosure may include at least one non-natural nucleoside.

[0539] As used herein, the term "nucleoside" refers to a glycoside containing a sugar moiety and a base moiety, and can therefore be used to refer to nucleotide units that are covalently linked by internucleoside bonds between the nucleosides of an ODN. In the field of biotechnology, the term "nucleotide" is often used to refer to nucleic acid monomers or units.

[0540] As one of skill in the art will recognize, the 5' terminal nucleoside of an oligonucleotide can include a 5' terminal group, but does not include a 5' internucleoside linkage group.

[0541] As used herein, the terms "administration," "administering," and variations thereof refer to the introduction of a composition (e.g., LNP) or agent (e.g., a therapeutic nucleic acid) into a subject, including simultaneous and sequential introduction of one or more compositions or agents. "Administration" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also includes in vitro and ex vivo treatments. Introduction of a composition or agent of the present disclosure into a subject may be by any suitable route, including oral, intrapulmonary, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intratumoral, or topical. Introduction of a composition or agent into a subject may be by electroporation. Administration includes self-administration and administration by another. Administration can be by any appropriate route. A suitable route of administration allows the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition or agent is administered by introducing the composition or agent into the subject's vein.

[0542] As used herein, an "effective amount" or "therapeutically effective amount" of an active or therapeutic agent, such as an immunosuppressant and / or a therapeutic nucleic acid, is an amount sufficient to produce a desired effect, such as normalization or reduction of an immune response (e.g., an innate immune response) and expression or inhibition of expression of a target sequence, compared to expression levels detected in the absence of the therapeutic nucleic acid and / or immunosuppressant. Suitable assays for measuring expression of a target gene or target sequence include, for example, examination of protein or RNA levels using techniques known to those skilled in the art, such as dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, and phenotypic assays known to those skilled in the art. However, dosage levels are based on a variety of factors, including the type of injury, the patient's age, weight, sex, and health status, the severity of symptoms, the route of administration, and the specific active agent used. Thus, dosage regimens can vary widely but can be routinely determined by a physician using standard methods. Furthermore, the terms "therapeutic amount," "therapeutically effective amount," and "pharmaceutically effective amount" include prophylactic or preventative amounts of the compositions of the present disclosure. In prophylactic or preventative applications of the present disclosure, pharmaceutical compositions or medicaments are administered to a patient susceptible to or at risk of a disease, disorder, or condition in an amount sufficient to eliminate or reduce the risk, lessen the severity, or delay the onset of the disease, disorder, or condition, including the biochemical, histological, and / or behavioral symptoms of the disease, disorder, or condition, its complications, and intermediate pathological phenotypes present during the development of the disease, disorder, or condition. Generally, it is desirable to use a maximum dose, i.e., the highest safe dose based on medical judgment. As used herein, the terms "dose" and "administered amount" are used interchangeably.

[0543] As used herein, the term "therapeutic effect" refers to a therapeutic outcome that is deemed desirable and beneficial. Therapeutic effect may include, directly or indirectly, the inhibition, reduction, or elimination of disease symptoms. Therapeutic effect may also include, directly or indirectly, the inhibition, reduction, or elimination of the progression of disease symptoms.

[0544] As used herein, the phrase "genetic disease" refers to a disease, particularly a condition present from birth, caused, in part or in whole, directly or indirectly, by one or more abnormalities in the genome. The abnormality may be a mutation, insertion, or deletion. The abnormality may affect the coding sequence of a gene or its regulatory sequence. The genetic disease may be, but is not limited to, Duchenne muscular dystrophy (DMD), Gaucher disease, Fabry disease, ornithine transcarbamylase deficiency, hemophilia (hemophilia A or hemophilia B), cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, inherited disorders of liver metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease. [Example]

[0545] General method Synthesis of ODNs ODNs were synthesized using publicly known automated synthesis systems, such as FOCUS (Aapptec) and AKTA oligopilot plus 10 / 100 (GE Healthcare).

[0546] Lipid nanoparticle formulations The lipid particles of the present disclosure can be produced by mixing a nucleic acid payload with lipid component(s), with or without an ODN of the present disclosure, and then applying known methods for preparing lipid nanoparticles. For example, lipid nanoparticles can be produced as a lipid particle dispersion by dissolving the mixed lipid components, including a cationic lipid (shown in Table 2), in an organic solvent and mixing the resulting organic solvent solution with water or a buffer, for example, by emulsification. The aqueous phase contains a nucleic acid payload, such as DNA encoding luciferase, with or without an ODN of the present disclosure. Mixing can be performed using a microfluidic mixing system, for example, the NanoAssemblr device (Precision NanoSystems). The resulting lipid particles may be subjected to desalting or dialysis and sterile filtration. pH and osmolality adjustments can also be performed as needed.

[0547] LNP evaluation The particle size of the lipid nanoparticles (in the composition) can be measured by known methods. For example, the particle size can be calculated as the Z-average particle size by performing cumulant analysis of the autocorrelation function using a particle size measurement device, Zetasizer Nano ZS (Malvern Instruments), based on dynamic light scattering measurement technology. The particle size (average particle size) of the lipid particles (in the composition) is, for example, 10 to 200 nm, e.g., 60 to 170 nm.

[0548] The concentration and encapsulation rate of nucleic acid in the composition of the present disclosure can be measured by known methods. For example, nucleic acid can be fluorescently labeled using Quant-iT™ RiboGreen® (Invitrogen Corp.) and the concentration and encapsulation rate can be determined by measuring the fluorescence intensity. The concentration of nucleic acid in the composition can be calculated using a calibration curve prepared from an aqueous solution of nucleic acid with a known concentration. The encapsulation rate can be calculated based on the difference in fluorescence intensity between the presence and absence of Triton X100 (a surfactant that destroys lipid nanoparticles). The concentration of nucleic acid in the composition refers to the total concentration of nucleic acid encapsulated in lipid nanoparticles and unencapsulated nucleic acid. The encapsulation rate refers to the ratio of nucleic acid encapsulated in lipid nanoparticles to the total nucleic acid in the composition.

[0549] ODN The ODNs and modified ODNs in Table 1 were prepared using known methods. MS was measured using a mass spectrometer or LC / MS. The ionization methods used were MALDI, FAB, ESI, or APCI. The data represent actual measurements or values ​​calculated by deconvolution analysis. Molecular ion peaks are generally observed, but fragment ions may also be observed. In the case of salts, free molecular ion peaks or fragment ion peaks are generally observed.

[0550] Electrophoresis uses an electric field to move charged molecules through a gel matrix, separating them based on their size or radius of gyration. A reference ladder of determined size is used to determine the size of the sample. Example 63 was too large to be readily measured by MS, so electrophoresis was used.

[0551] Example 1 Evaluation of in vivo cytokine suppression and enhanced luciferase expression after administration of LNPs of the present disclosure Lipid nanoparticles loaded with luciferase-encoding DNA (CAG or CMV promoter) alone, lipid nanoparticles loaded with the disclosed ODN and luciferase-encoding DNA (CAG or CMV promoter), or vehicle (10% sucrose in PBS) as a control were intravenously administered into the tail of ICrl:CD1 (ICR) mice (10 mL / kg i.v.). After lipid particle administration, the mice were placed in an IVIS (in vivo imaging system) device (PerkinElmer) under isoflurane inhalation anesthesia and were intraperitoneally administered luciferin (15 mg / mL) (10 mL / kg). Luminescence images were taken from the ventral (supine) position of the mice 15 minutes after luciferin administration. Luminescence was digitized using the IVIS software and evaluated using total luminous flux values. Higher luminescence indicates stronger expression of the protein encoded by the DNA encapsulated in the lipid particles. The measurement results are also shown in Table 3 and Figure 1A.

[0552] Inflammatory cytokines (IFNα and IP10) were measured using plasma samples collected 4 hours after administration. Plasma samples were processed with the U-PLEX Biomarker Group 1 (ms) assay, SECTOR reagent, and analyzed on a SECTOR Imager 2400. The measurement results are also shown in Table 4 and Figure 1B. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 5-1] [Table 5-2]

[0553] Example 2 Evaluation of in vivo cytokine suppression and enhanced luciferase expression after administration of LNPs of the present disclosure - mRNA or pGL4.5 LNPs loaded with vehicle (10% sucrose in PBS) as a control, luciferase-encoding mRNA (or luciferase-encoding pGL4.5) alone, or A151 (SEQ ID NO: 19) and luciferase-encoding mRNA or luciferase-encoding pGL4.5 were intravenously administered into the tail of ICrl:CD1 (ICR) mice (10 mL / kg i.v.). After lipid particle administration, the mice were placed in an IVIS (in vivo imaging system) device (PerkinElmer) under isoflurane inhalation anesthesia and intraperitoneally administered luciferin (15 mg / mL) (10 mL / kg). Luminescence images were taken from the ventral (supine) position of the mice 15 minutes after luciferin administration. Luminescence was digitized using the IVIS software and evaluated using total luminous flux values. Higher luminescence indicates stronger expression of the protein encoded by the DNA encapsulated in the lipid particles. The measurement results are also shown in Table 5 and Figure 2A.

[0554] Inflammatory cytokines (IFNα and IP10) were measured using plasma samples collected 4 hours after administration. Plasma samples were processed with the U-PLEX Biomarker Group 1 (ms) assay, SECTOR reagent, and analyzed on a SECTOR Imager 2400. The results are also shown in Table 6 and Figure 2B. [Table 6] [Table 7]

[0555] Example 3 Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of lipid particles and DNA loaded with ODN of the present disclosure Vehicle (10% sucrose in PBS) as a control, lipid nanoparticles loaded with luciferase-encoding DNA (CAG promoter) alone, or lipid nanoparticles loaded with luciferase-encoding DNA (CAG promoter) and the ODN of the present disclosure were intravenously administered to ICrl:CD1 (ICR) mice via the tail vein (10 mL / kg i.v.). After lipid particle administration, the mice were placed in an IVIS (in vivo imaging system) device (PerkinElmer) under isoflurane inhalation anesthesia and luciferin (15 mg / mL) was intraperitoneally administered (10 mL / kg). Luminescence images were taken from the ventral (supine) position of the mice 15 minutes after luciferin administration. Luminescence was digitized using IVIS software and evaluated using total luminous flux values. Higher luminescence indicates stronger expression of the protein encoded by the DNA encapsulated in the lipid particles. The measurement results are also shown in Table 7 and Figure 3A.

[0556] Inflammatory cytokines (IFNα and IP10) were measured using plasma samples collected 4 hours after administration. Plasma samples were processed with the U-PLEX Biomarker Group 1 (ms) assay, SECTOR reagent, and analyzed on a SECTOR Imager 2400. The results are also shown in Table 8 and Figure 3B. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 9-1] [Table 9-2]

[0557] Example 4 Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of lipid particles and DNA loaded with ODN of the present disclosure (ODNs with various repeat unit numbers) Lipid nanoparticles loaded with luciferase-encoding DNA (CAG promoter) and various repeat unit numbers, A151-, C151-, or iSG3-, were intravenously administered into the tail of ICrl:CD1 (ICR) mice (10 mL / kg i.v.). After lipid particle administration, the mice were placed in an in vivo imaging system (IVIS) (PerkinElmer) under isoflurane inhalation anesthesia and luciferin (15 mg / mL) was intraperitoneally administered (10 mL / kg). Luminescence images were taken from the ventral (supine) position of the mice 15 minutes after luciferin administration. Luminescence was digitized using the IVIS software and evaluated using total flux values. Higher luminescence indicates stronger expression of the protein encoded by the DNA encapsulated in the lipid particles. The measurement results are also shown in Table 9 and Figure 4A.

[0558] Inflammatory cytokines (IFNα and IP10) were measured using plasma samples collected 4 hours after administration. Plasma samples were processed with the U-PLEX Biomarker Group 1 (ms) assay, SECTOR reagent, and analyzed on a SECTOR Imager 2400. The results are also shown in Table 10 and Figure 4B. [Table 10] [Table 11]

[0559] While the methods, compounds, and compositions have been described in detail herein, it will be understood by those skilled in the art that the invention can be practiced within a wide and equivalent range of conditions, formulations, and other parameters without affecting the scope of the methods, compounds, and compositions provided herein, or any of the embodiments thereof. All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.

Claims

1. A modified oligonucleotide (ODN) comprising the following sequence: uuagggttagggttagggtuaggg (SEQ ID NO: 1), ttagggttagggttagggttaggg (SEQ ID NO: 2), ttcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 3), tgggcggttcaaccttca (SEQ ID NO: 4), tgactgtgaaggttagagatga (SEQ ID NO: 5), uuagggttagggttaggguuaggg (SEQ ID NO: 6), cctcattagggtgaggg (SEQ ID NO: 7), uuagggutagggttaggguuaggg (SEQ ID NO: 8), uuaggguuagggttaggguuaggg (SEQ ID NO: 9), uuaggguuaggguuaggguuaggguuaggg (SEQ ID NO: 10), uuagggttagggttagggttaggg (SEQ ID NO: 11), utcaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 12), uucaaattcaaattcaaattcaaattcaaa (SEQ ID NO: 13), uucaaattcaaattcaaatucaaa (SEQ ID NO: 14), ccucattagggtgaggg (SEQ ID NO: 15), ugggcggttcaaccttca (SEQ ID NO: 16), or ugggcggttcaaccuuca (SEQ ID NO: 17); where: The sequences are written left to right in the 5' to 3' direction; a is adenosine, deoxyadenosine, or a glycosylated form thereof; c is cytidine, deoxycytidine, or a glycosylated form thereof; g is guanosine, deoxyguanosine, or a glycosylated form thereof; t is 5-methyluridine, thymidine, or a glycosylated form thereof; u is uridine, deoxyuridine, or a glycosylated form thereof; the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or combinations thereof; At least one of the a, c, g, t, or u nucleosides is a sugar modification thereof independently selected from the group consisting of: 【Chemistry 1】

2. The modified ODN of claim 1 comprising the following sequence: uuagggttagggttagggtuaggg (SEQ ID NO: 1).

3. The modified ODN of claim 1 or 2, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified.

4. The modified ODN of claim 3, wherein at least six of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.

5. The nucleosides marked with "*" u*u*a*gggttaggggttaggtuag*g*g* The modified ODN of claim 4, wherein is a sugar modified with u, a, and / or g.

6. The modified ODN of claim 4, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified.

7. The nucleosides marked with "*" u*u*a*g*ggttaggggttaggggtua*g*g*g* The modified ODN of claim 6, wherein is a sugar modified with u, a, and / or g.

8. The modified ODN of claim 6, wherein at least 10 of the a, c, g, t and / or u nucleosides are sugar-modified.

9. The nucleosides marked with "*" u*u*a*g*g*gttaggggttaggtu*a*g*g*g* The modified ODN of claim 8, wherein is a sugar modified with u, a, and / or g.

10. The modified ODN of claim 8, wherein at least 12 of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.

11. The nucleosides marked with "*" u*u*a*g*g*g*ttaggggttagggu*u*a*g*g*g* The modified ODN of claim 10, wherein is a sugar modified with u, a, and / or g.

12. The modified ODN of claim 10, wherein at least 14 of the a, c, g, t, and / or u nucleosides are sugar-modified.

13. The nucleosides marked with "*" u*u*a*g*g*g*u*tagggttagg*u*u*a*g*g*g* The modified ODN of claim 12, wherein is a sugar modified with u, a, and / or g.

14. The modified ODN of claim 12, wherein at least 18 of the a, c, g, t and / or u nucleosides are sugar-modified.

15. The nucleosides marked with "*" u*u*a*g*g*g*u*u*a*gggttag*g*g*u*u*a*g*g*g* The modified ODN of claim 14, wherein is a sugar modified with u, a, and / or g.

16. The modified ODN of claim 14, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.

17. The modified ODN of claim 3, wherein all of the g nucleosides are sugar-modified.

18. The modified ODN of claim 3, wherein all of the a-nucleosides are sugar-modified.

19. The modified ODN of any one of claims 1 to 18, comprising SMN1.

20. The modified ODN of any one of claims 1 to 19, comprising SMN2.

21. The modified ODN of any one of claims 1 to 20, comprising SMN3.

22. The modified ODN of any one of claims 1 to 21, comprising SMN4.

23. The modified ODN of any one of claims 1 to 22, comprising SMN5.

24. The modified ODN of any one of claims 1 to 23, comprising SMN6.

25. The modified ODN of any one of claims 1 to 24, comprising SMN7.

26. The modified ODN of any one of claims 1 to 25, comprising SMN8.

27. The modified ODN of any one of claims 1 to 26, comprising SMN9.

28. The modified ODN of any one of claims 1 to 27, wherein each internucleoside linkage is a phosphorothioate linkage.

29. The modified ODN of any one of claims 1 to 27, wherein at least one internucleoside linkage is a phosphorodithioate linkage.

30. An ODN or modified ODN comprising the sequence set forth in Table 1.

31. Lipid nanoparticles comprising: (a) the ODN or modified ODN according to any one of claims 1 to 30; (c) a cationic lipid; (d) a non-cationic lipid; and (b) Therapeutic nucleic acids.

32. The cationic lipid is a compound of formula (I): 【Chemistry 2】 During the ceremony, L １ is C １－２２ Alkylene group, C ２－２２ Alkenylene group or C ３－２２ is an alkadienylene group, n is an integer of 0 or 1; R １ teeth (1) a hydrogen atom, (2) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; １－２２ alkyl groups, (3) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; ２－２２ an alkenyl group, or (4) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; ３－２２ is an alkadienyl group, R ２ is -CH ２ -O-CO-R ５ , -CH ２ -CO-O-R ５ or -R ５ and R ３ is a hydrogen atom, -CH ２ -O-CO-R ６ , -CH ２ -CO-O-R ６ or -R ６ and R ４ is a hydrogen atom, -CH ２ -O-CO-R ７ , -CH ２ -CO-O-R ７ or -R ６ and R ５ , R ６ and R ７ are each independently (1) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; １－２２ alkyl groups, (2) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; ２－２２ alkenyl groups, (3) Linear C １－２２ Alkyl groups and linear C ２－２２ a straight-chain C optionally substituted with one or two substituents selected from alkenyl groups; ３－２２ an alkadienyl group, or (4)-R １０ -CO-O-R １１ or -R １０ -O-CO-R １１ and R １０ is an optionally substituted C １－１６ Alkylene group, optionally substituted C ４－１６ alkenylene group or optionally substituted C ７－１６ is an alkadienylene group, R １１ is H, optionally substituted C １－１８ alkyl groups, optionally substituted C ３－１８ alkenyl group or optionally substituted C １５－１８ is an alkadienyl group, and R ８ and R ９ are each independently １－６ The lipid nanoparticle of claim 31, which is an alkyl group, or a salt thereof.

33. 32. The lipid nanoparticle of claim 31 , wherein the cationic lipid is any one or more of the cationic lipids in Table 2.

34. The lipid nanoparticle of any one of claims 31 to 33, wherein the non-cationic lipid is a phospholipid, cholesterol and / or PEG lipid.

35. The lipid nanoparticle of any one of claims 31 to 34, wherein the therapeutic nucleic acid is a DNA or RNA-based therapeutic nucleic acid.

36. The lipid nanoparticle of any one of claims 31 to 34, wherein the therapeutic nucleic acid and the ODN or modified ODN are not covalently bound to each other.

37. A method for inhibiting an immune response in a subject in need thereof, comprising administering to the subject lipid nanoparticles described in any one of claims 31 to 36.

38. A method for treating or preventing a disease, disorder, or condition in a subject in need thereof, the method comprising administering to the subject a lipid nanoparticle described in any one of claims 31 to 36.

39. 39. The method of claim 38, wherein the disease, disorder, or condition is a genetic disease.

40. 40. The method of claim 39, wherein the genetic disease is Duchenne muscular dystrophy (DMD), Gaucher disease, Fabry disease, ornithine transcarbamylase deficiency, hemophilia, cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, inherited disorders of liver metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, or Tay-Sachs disease.

Images