Self-assembled lipid nanoparticles for targeted delivery of therapeutic agents
A lipidated antibody nanoparticle delivery system with a 40-amino acid linker enhances targeted drug delivery by improving binding efficacy and reducing adverse effects, offering a superior alternative to conventional methods.
Patent Information
- Application Number
- JP2025525303
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-07
- Filing Date
- 2023-11-07
- Publication Date
- 2025-12-22
AI Technical Summary
Existing targeted drug delivery systems, such as immunoliposomes, require large amounts of antibodies for conjugation, leading to adverse effects like immunogenicity and phagocytosis, and random orientation of antibodies increases the risk of exposure to the surrounding environment.
A self-assembling modular platform using lipidated antibody nanoparticle delivery system, utilizing a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipid-based nanoparticle delivery system comprising a lipidated antibody nanoparticle delivery system with a linker of at least 40 amino acids for enhanced binding to target cells.
The system achieves superior transduction efficiency compared to conventional methods, enabling efficient delivery of therapeutic agents to target cells with reduced immunogenicity and phagocytosis.
Smart Images

Figure 2025541601000001_ABST
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 423,069, filed November 7, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing Description An XML file entitled 97717SequenceListing.xml, filed concurrently with this application and created on November 7, 2023, consisting of 377,564 bytes, is incorporated herein by reference.
[0003] Technical Field The present invention relates to self-assembled lipid nanoparticles for targeted delivery of nucleic acids, proteins and drugs. The present invention further relates to methods of using self-assembled lipid nanoparticles, particularly in RNA therapeutics. [Background technology]
[0004] In the field of nanomedicine, lipid nanoparticles (LNPs) have become increasingly popular as a means of delivering various active agents, including nucleic acids such as siRNA and mRNA. The recent FDA approval of Onpattro® (patisiran), the first RNAi-based drug, and the recent introduction of RNA vaccines during the COVID-19 pandemic are current examples of the use of LNPs in RNA therapeutics.
[0005] Targeted drug carriers, such as immunoliposomes or immunolipid-based nanoparticles (targeted LNPs, tLNPs), are typically constructed by chemically conjugating a targeting moiety to a drug (or nucleic acid)-carrying delivery system. This process requires a large amount of antibody per conjugation, and when using different antibodies, adjustments are typically required due to the adverse effects of conjugation on antibody function. Furthermore, chemical conjugation inserts the targeting antibody in a random orientation. As a result, some antibodies are typically conjugated so that their Fc portions are exposed to the surrounding environment, which increases the risk of immunogenicity and phagocytosis by phagocytes.
[0006] To overcome these limitations, a new strategy for preparing directed antibody-targeted LNPs has been published. This strategy, called ASSET (anchored secondary scFv enabling targeting), is a self-assembling modular platform that enables the construction of targeted nanocarriers without conjugation chemistry. Self-assembly of this platform is based on a lipidated single-chain antibody fragment (scFv) derived from a membrane-anchored secondary antibody incorporated into a therapeutic-loaded lipid nanoparticle. This particle then interacts with the crystallizable fragment (Fc) domain of the primary antibody, forming a stable complex that specifically binds to target cells expressing the primary antibody's target on their surface (Kedmi et al., Nat. Nanotechnol. 13(3): 214-219, 2018, International Publication No. 2018 / 015881). The therapeutic potential of the ASSET platform has been well demonstrated, as delivery of siRNA, mRNA, and gRNA to target cells resulted in changes in cellular phenotype (Veiga et al., Nature Comm. 9: 4493, 2018; Veiga et al., JCR 313: 33-41, 2019; Rosenblum et al., Sci. Adv. 6: eabc9450, 2020).
[0007] There is an unmet need for additional delivery platforms for targeted delivery of therapeutic drugs to target cells. Summary of the Invention
[0008] The present invention provides a delivery system composition, termed lipidated antibody nanoparticle delivery (LAND), and its use for delivering therapeutic agents, such as nucleic acids, to target cells. This delivery system utilizes an antibody that functions as a cell-targeting moiety. The antibody is anchored to the lipid-based nanoparticle via a lipidated peptide moiety and a peptide linker comprising at least 40 amino acids, which offers the unexpected advantage of effective binding to target cells. In some embodiments, the linker is a combination of a functional protein, a linker, and a spacer sequence. The system of the present invention overcomes the limitations of conventional compositions and methods and represents an important advancement in precision medicine.
[0009] The present invention is based, in part, on the unexpected discovery that extending the distance between lipid nanoparticles and antibodies using a linker (e.g., a linker comprising at least 40 amino acids) results in superior efficacy in transducing target cells. In particular, the LAND platform according to the principles of the present invention has been shown to transduce target cells more efficiently than ASSET. It is generally recognized that scFv antibodies with a single antigen-binding site have lower binding efficiency compared to intact IgG antibodies with two antigen-binding sites. Surprisingly, LAND constructs incorporating primary scFv antibody targeting via a single antigen-binding site showed significantly enhanced efficacy compared to primary IgG antibody targeting via ASSET, which contains two antigen-binding sites. Thus, the self-assembling modular platform of the present invention enables the construction of a broad repertoire of targeted nanocarriers, particularly suitable for RNA therapeutics.
[0010] According to one aspect, there is provided a delivery system composition for delivering a therapeutic agent to a target cell, the delivery system comprising a lipid nanoparticle, an anchor lipid embedded in the outer surface of the lipid nanoparticle, a linker, and a lipidated antibody or fragment thereof, the linker being fused to the lipidated antibody or fragment thereof, and the fusion protein being non-covalently bound to the lipid nanoparticle via the anchor lipid such that the lipidated antibody or fragment thereof is located at an end distal to the nanoparticle. In one embodiment, the linker comprises a peptide or protein having at least 40 amino acid residues.
[0011] According to another aspect, lipid nanoparticles encapsulating a therapeutic or diagnostic agent; a primary antibody non-covalently bound to a lipid nanoparticle via a lipidated peptide moiety; A peptide linker in which one end of the linker is directly bound to the primary antibody and the other end of the linker is bound to a lipidated peptide moiety. wherein the antibody or antibody fragment is located at an end distal to the nanoparticle and binds to a target antigen on a target cell.
[0012] According to another aspect, there is provided a delivery system composition for delivering a therapeutic or diagnostic agent to a target cell, the delivery system comprising: a lipidated antibody comprising an antibody linked to a lipidated peptide moiety via a peptide linker, wherein the peptide linker comprises at least 40 amino acid residues; Lipid nanoparticles containing therapeutic or diagnostic agents; wherein the lipidated antibody is non-covalently attached to the lipid nanoparticle via the lipidated peptide moiety.
[0013] According to yet another aspect, there is provided a method of delivering a therapeutic or diagnostic agent to a subject in need thereof, comprising delivering the therapeutic or diagnostic agent to the subject by administering to the subject a composition or delivery system described herein.
[0014] According to yet another aspect, there is provided a method for treating a medical condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition or delivery system described herein, wherein the agent is a therapeutic agent, thereby treating the medical condition.
[0015] According to yet another aspect, there is provided a method of diagnosing a medical condition in a subject, comprising administering to the subject an effective amount of a composition or delivery system described herein, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.
[0016] According to yet another aspect, there is provided a use of a composition or delivery system described herein for diagnosing or treating a medical condition.
[0017] According to an embodiment of the present invention, the lipidated peptide moiety comprises an endomembrane lipidation signal.
[0018] According to an embodiment of the invention, the lipidated peptide portion of the antibody comprises the first two amino acids encoded by the E. coli NlpA gene, or the first six amino acids encoded by the E. coli NlpA gene.
[0019] According to an embodiment of the invention, the lipidated peptide portion of the antibody is selected from the group consisting of AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, Dpp B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, DsbB, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas, or fragments thereof.
[0020] According to an embodiment of the present invention, the peptide linker comprises 40 to 400 amino acid residues.
[0021] According to an embodiment of the present invention, the peptide linker comprises 40 to 300 amino acid residues.
[0022] According to an embodiment of the invention, at least 30% of the amino acid residues of the peptide linker are glycine or serine.
[0023] In one embodiment, the linker comprises a peptide or protein having 40 to 400 amino acid residues, each integer within the specified range. In another embodiment, the linker comprises a peptide or protein having 40 to 300 amino acid residues, each integer within the specified range. In yet another embodiment, the linker comprises a peptide or protein having 40 to 200 amino acid residues, each integer within the specified range. In a further embodiment, the linker comprises a peptide or protein having 40 to 100 amino acid residues, each integer within the specified range. In a specific embodiment, the linker comprises a peptide having the sequence set forth in SEQ ID NO: 11. In another specific embodiment, the linker comprises a peptide having the sequence set forth in SEQ ID NO: 12.
[0024] In some embodiments, the antibody or fragment thereof is a primary antibody or primary antibody fragment comprising an antigen-recognition domain capable of binding to an antigen expressed by a target cell. In another embodiment, the antibody or fragment thereof is a humanized or human primary antibody, antibody fragment, chimeric antibody, or nanobody, collectively referred to as a primary antibody or antibody fragment. In certain embodiments, the primary antibody or primary antibody fragment is selected from the group consisting of an anti-CD44 antibody, an anti-CD34 antibody, an anti-CD38 antibody, an anti-Ly6C antibody, an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody, an anti-CD25 antibody, an anti-CD47 antibody, an anti-CD117 antibody, an anti-CD147 antibody, an anti-EGFR antibody, and an anti-integrin β7 antibody. Each possibility represents a separate embodiment. In another embodiment, the primary antibody or primary antibody fragment is capable of binding to an antigen listed in Table 1. In another embodiment, the antibody is a secondary antibody comprising an antigen-recognition domain capable of specifically binding to the primary antibody. In another embodiment, the antibody is a secondary antibody comprising an antigen-recognition domain capable of specifically binding to a humanized or human primary antibody. In a further embodiment, the antibody is a monoclonal antibody. In a further embodiment, the antibody is lipidated at its N-terminus.
[0025] In another embodiment, the antibody fragment is selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv, dsFv, and nanobody. Each possibility represents a separate embodiment. In one embodiment, the antibody fragment is an scFv. In yet another embodiment, the antibody is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4. Each possibility represents a separate embodiment. In certain embodiments, the antibody comprises a monovalent or multivalent nanobody.
[0026] In various embodiments, the lipid nanoparticles comprise at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG-lipid. Each possibility represents a separate embodiment.
[0027] In certain embodiments, the lipid nanoparticles are selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl-N′,N′-di[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, 2-(di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propanoate (E A-PIP), di-oleyl-succinyl-serinyl-tobramycin, di-oleyl-adipyl-tobramycin, di-oleyl-suberyl-tobramycin, di-oleyl-sebacyl-tobramycin, di-oleyl-dithioglycolyl-tobramycin, monocationic lipid N-[1-(2,3-dioleoyloxy)]-N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-1,2-di-O-(1'Z,9'Z-octadecadienyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate, BGSC (bis-guanidinium-spermidine-cholesterol), BGTC (bis-guanidinium-tren-cholesterol), CDAN (N'-cholesteryloxycarbonyl 1-3,7-diazanonane-1,9-diamine), CHDTAEA (cholesteryl hemidithiodiglycolyl tris(amino(ethyl)amine), DCAT (O-(1,2-di-O-(9'Z-octadecanyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate), DC-Chol (3β[N-(N',N'-dimethylaminoethane)-carbamoyl]cobalamin) esterol), DLKD (O,O'-dilauryl N-lysyl aspartate), DMKD (O,O'-dimyristyl N-lysyl aspartate), DOG (dioleoylglycerol, DOGS (dioctadecylamidoglycylspermine), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide ornithine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine, DOSN (dioleoylsuccinylethylthioneomycin), DOSP (dioleoylsuccinylparomomycin), DOST (dioleoylsuccinyltobramycin), 1,The lipids include ionizable lipids selected from the group consisting of 2-diolcoyl-3-trimethylammoniopropane, DOTMA (N'[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride), DPPES (di-palmitoylphosphatidylethanolamide spermine), DDAB, and DODAP, or any combination thereof. Each possibility represents a separate embodiment.
[0028] In another embodiment, the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propanoate (EA-PIP), di-oleyl-succinyl-serinyl-tobramycin, di-oleyl-adipyl-tobramycin, di-oleyl-suberyl-tobramycin, di-oleyl-sebacyl-tobramycin, N,N-dimethyl-N',N'-di[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, and di-oleyl-dithioglycolyl-tobramycin, or any combination thereof. Each possibility represents a separate embodiment. Further ionizable lipids are disclosed in WO 2018 / 087753 and WO 2022 / 168085, the contents of which are hereby incorporated by reference in their entireties.
[0029] In some embodiments, the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as phosphatidylcholine (PC)), cephalin, sphingolipids, and glyceroglycolipids, or combinations thereof. Each possibility represents a separate embodiment.
[0030] In a further embodiment, the helper lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilauroyl-L-phosphatidylethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,3-dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPP E) selected from the group consisting of 1-palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), biotin-phosphatidylethanolamine, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), and dipalmitoylphosphatidylethanolamine (DPPE), or a combination thereof. Each possibility represents a separate embodiment.
[0031] In further embodiments, the PEG lipid is selected from the group consisting of DMG-PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-dimyristyloxy-propylamine; 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-distearyloxy-propylamine, or a combination thereof. Each possibility represents a separate embodiment.
[0032] In certain embodiments, the lipid nanoparticles comprise an ionizable lipid (e.g., DLinDMA, DLinMC3-DMA, or DlinKC2-DMA), a stabilizing lipid (e.g., cholesterol), a helper lipid (e.g., DSPC or DOPE), and a PEG lipid (e.g., DMG-PEG).
[0033] In some embodiments, the lipid nanoparticles comprise about 30-70% (mol%) of ionizable lipid, including values within the specified range. In other embodiments, the lipid nanoparticles comprise about 30-50% (mol%) of stabilizing lipid, including values within the specified range. In further embodiments, the lipid nanoparticles comprise about 5-20% (mol%) of helper lipid, including values within the specified range. In still further embodiments, the lipid nanoparticles comprise about 0.5-5% (mol%) of PEG lipid, including values within the specified range.
[0034] In various embodiments, the lipid nanoparticles have a particle size (diameter) ranging from about 1 to about 500 nm, inclusive of each value within the specified range. In another embodiment, the lipid nanoparticles have a particle size ranging from about 1 to about 300 nm, inclusive of each value within the specified range. In yet another embodiment, the lipid nanoparticles have a particle size ranging from about 1 to about 200 nm, inclusive of each value within the specified range. In a specific embodiment, the lipid nanoparticles have a particle size ranging from about 1 to about 100 nm, inclusive of each value within the specified range.
[0035] In certain embodiments, the anchor lipid comprises a glycerolipid. In certain embodiments, the anchor lipid comprises a disubstituted glycerolipid. In another particular embodiment, the anchor lipid is attached to the fusion protein via a cysteine residue.
[0036] In various embodiments, the delivery system composition further comprises a detectable moiety.
[0037] In another embodiment, the delivery system composition further comprises an affinity tag.
[0038] In some embodiments, the therapeutic agent is encapsulated within the lipid nanoparticle.
[0039] According to another aspect, there is provided a method for delivering a therapeutic agent to a subject in need thereof, comprising administering to the subject a delivery system composition comprising lipid nanoparticles encapsulating the therapeutic agent, an anchor lipid embedded in the outer surface of the lipid nanoparticles, a linker, and a lipidated antibody or fragment thereof, wherein the linker is fused to the lipidated antibody or fragment thereof, the fusion protein being non-covalently attached to the lipid nanoparticles via the anchor lipid such that the lipidated antibody or fragment thereof is located at an end distal to the nanoparticle, and the linker comprises a peptide or protein having at least 40 amino acid residues.
[0040] In one embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticles is in the range of about 1:50 to 50:1, including all iterations of the ratio within the specified range. In another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticles is in the range of about 1:1 to 1:25, including all iterations of the ratio within the specified range. In yet another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticles is in the range of about 45:1 to 1:1, including all iterations of the ratio within the specified range.
[0041] In some embodiments, administration is via a local route / injection (e.g., intramuscular (IM), intraperitoneal (IP), intratumoral, intradermal, intravesical, intratracheal, intrathecal, intradermal, or subcutaneous (SC) administration). In various embodiments, administration is systemic (e.g., intravenous or intraarterial). In some embodiments, the delivery system is administered as a pharmaceutical composition further comprising a pharmaceutically acceptable excipient comprising at least one of a surfactant, a suspending agent, and an emulsifying agent. Each possibility represents a separate embodiment.
[0042] In certain embodiments, the therapeutic agent is a nucleic acid or polynucleotide. In another embodiment, the therapeutic agent is DNA or mRNA encoded by the exome.
[0043] In yet another embodiment, the therapeutic agent is exome non-coding RNA. In certain embodiments, exome non-coding RNA is microRNA, long non-coding RNA (lncRNA), long non-coding intergenic RNA (lincRNA), pseudogene, circular RNA (circRNA), transfer RNA (tRNA) or interfering RNA (siRNA and shRNA). Each possibility represents a separate embodiment.
[0044] In a further embodiment, the therapeutic agent is a catalytically active or inactivated gene-editing nuclease.
[0045] In certain embodiments, the catalytically active or inactivated gene-editing nuclease is selected from meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), transposases, integrases, recombinases encoded by mobile genetic elements (MGEs), Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) nucleases, and their associated guide nucleic acids and targeting moieties. Each possibility represents a separate embodiment.
[0046] In another specific embodiment, the CRISPR-associated (Cas) nuclease is Cas9, Cas12a, Cas12b, Cas12e, Cas13, Cas13a, Cas13b, Cas14, Cas-Theta, CasX, CasY, or those listed in Table 6. Each possibility represents a separate embodiment.
[0047] In certain embodiments, the therapeutic agent is a gene editing agent, including a base editor, a prime editor, or a mobile genetic element gene writer.
[0048] In certain embodiments, the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE), including, but not limited to, a catalytically inactive Cas nuclease (dCas) or a partially inactive (Cas nickase or nCas) Cas nuclease, a cytidine deaminase, or an adenosine deaminase, and a guide RNA that confers target sequence specificity.
[0049] In certain embodiments, the base editor or gene editing agent is selected from, but not limited to, those listed in Table 2 and Table 3.
[0050] In another embodiment, the therapeutic agent is a prime editor comprised of a prime editing guide RNA (pegRNA) targeting sequence and an RNA template, and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme, where the pegRNA guide template and Cas9 nickase guide the reverse transcriptase to the target site and insert the new DNA strand from the RNA template into the target site.
[0051] In certain embodiments, the therapeutic agent is a gene writer incorporating a mobile genetic element for sequence targeting combined with an engineered integrase or transposase to integrate a nucleic acid sequence into a target sequence.
[0052] In certain embodiments, the therapeutic agent is a mobile genetic element gene writer incorporating a CRISPR-Cas9 targeting element combined with an engineered piggyBac transposase to integrate a nucleic acid sequence into a target sequence.
[0053] In another embodiment, donor DNA sequence is simultaneously provided to repair or insert therapeutic DNA sequence.In certain embodiments, the delivered gene editing site knocks out, repairs or suppresses the expression of harmful or abnormal nucleic acid sequence.In another specific embodiment, the delivered gene editing site knocks in, provides or enhances the expression of therapeutically useful nucleic acid sequence.
[0054] In various embodiments, the therapeutic agent is an mRNA fused to a catalytically inactivated CRISPR-associated (Cas) protein or transcriptional modifier.
[0055] In some embodiments, the mRNA fused to the transcriptional modifier is a transcriptional repressor. In other embodiments, the transcriptional repressor is a methyltransferase or a histone deacetylase. In yet other embodiments, the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Kruppel-associated box (KRAB), MeCP2-KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1, and / or SDS3. Each possibility represents a separate embodiment.
[0056] In certain embodiments, the mRNA fused to the transcriptional modifier is a transcriptional activator. In certain embodiments, the transcriptional activator is VP64, p65, and Rta, or a combination thereof (VPR), the synergistic activation mediator (SAM) activation system MS2-p65-HSF1, a DNA demethylation site, or an acetyltransferase. Each possibility represents a separate embodiment.
[0057] In certain embodiments, the delivery system compositions of the present invention are useful for knocking out, repairing, or suppressing the expression of harmful or aberrant nucleic acid sequences. In certain embodiments, the nucleic acid sequences to be knocked out, repaired, or suppressed include essential genes, growth-promoting genes, oncogenes, angiogenic genes, immunosuppressive genes, anti-apoptotic genes, therapeutic resistance genes, dominant-negative mutant genes, mutated genes, viral genes, disease-promoting miRNAs, lncRNAs, lincRNAs, pseudogenes, tRNAs, or circRNA targets, including but not limited to those listed in Table 4, with each possibility representing a separate embodiment.
[0058] In another embodiment, the delivery system compositions of the present invention are useful for knocking in, providing, or enhancing the expression of a therapeutically useful nucleic acid sequence. In certain embodiments, nucleic acid sequences useful for knocking in, providing, or enhancing the expression include, but are not limited to, tumor suppressor nucleic acid sequences, proapoptotic nucleic acid sequences, immunostimulatory nucleic acid sequences, anti-angiogenic nucleic acid sequences, anti-cancer nucleic acid sequences, useful nucleic acid sequences silenced by hypermethylation or other epigenetic mechanisms, or therapeutically sensitive nucleic acid sequences, including, but not limited to, those listed in Table 5. Each possibility represents a separate embodiment.
[0059] In yet another embodiment, the therapeutic agent is a protein, a ribonucleoprotein, or a drug.
[0060] In further embodiments, the therapeutic agent is delivered to a cell. In certain embodiments, the therapeutic agent is delivered to a pre-malignant or malignant cell. In another embodiment, the therapeutic agent is delivered to a leukocyte. In yet another embodiment, the leukocyte is a primary lymphocyte. In some embodiments, the lymphocyte is selected from a B cell and a T cell. Each possibility represents a separate embodiment.
[0061] In yet another aspect, a method is provided for treating a medical condition in a subject in need thereof, comprising administering to the subject a delivery system composition comprising lipid nanoparticles encapsulating a therapeutic agent, an anchor lipid embedded in the outer surface of the lipid nanoparticles, a linker, and a lipidated antibody or fragment thereof, wherein the linker is fused to the lipidated antibody or fragment thereof, the fusion protein being non-covalently attached to the lipid nanoparticles via the anchor lipid such that the lipidated antibody or fragment thereof is located at an end distal to the nanoparticle, and the linker comprises a peptide or protein having at least 40 amino acid residues.
[0062] In some embodiments, the condition is cancer or a pre-malignant disorder with a predisposition to cancer. In certain embodiments, the cancer is a solid tumor or a hematopoietic cancer. In another embodiment, the condition is an autoimmune or inflammatory disease, such as inflammatory bowel disease. In another embodiment, the condition is a monogenic or polygenic genetic disease. In certain embodiments, the condition is a cardiovascular, respiratory, renal-urogenital, neurological, endocrine, gastrointestinal, immune, or musculoskeletal disease. Each possibility represents a separate embodiment. In another embodiment, the condition is a disease caused by an infectious pathogen.
[0063] In another embodiment, the delivery system compositions of the invention are used for the inhibition of a target nucleic acid or gene listed in Table 4. Each possibility represents a separate embodiment.
[0064] In another embodiment, the delivery system compositions of the invention are used for therapeutic expression of a target nucleic acid or gene listed in Table 5. Each possibility represents a separate embodiment.
[0065] In another embodiment, the delivery system compositions of the invention are used for the correction or repair of a target nucleic acid or gene listed in Table 4, Table 5, or Table 7. Each possibility represents a separate embodiment.
[0066] In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence of SEQ ID NO: 13 (MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR), followed by the functional protein, followed by the amino acids of SEQ ID NO: 1 (ASGGSGGGKASGG), followed by a "secondary" scFv sequence, which has specificity for the Fc fragment of a "primary" antibody that has specificity for an antigen expressed on a cell type targeted for therapy. In some embodiments, an amino acid linker, AAAGSHHHHHH (SEQ ID NO: 19), is added to the end of the composition.
[0067] In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence of SEQ ID NO: 13 (MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR), followed by the functional protein, followed by SEQ ID NO: 6, ASGGSGGGKASGGGGGGSGGGGSGGGGS, followed by a "primary" scFv sequence, which has specificity for an antigen expressed on the cell type targeted for therapy. In some embodiments, an amino acid linker, AAAGSHHHHHH (SEQ ID NO: 19), is added to the end of the composition.
[0068] In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence of SEQ ID NO: 14 (MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGGSGGGKASGG), followed by a "secondary" scFv sequence with specificity for the Fc fragment of a "primary" antibody with specificity for an antigen expressed on a cell type targeted for therapy. In some embodiments, an amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added to the end of the composition.
[0069] In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence of SEQ ID NO: 14 followed by a "primary" scFv sequence that has specificity for an antigen expressed on the cell type targeted for therapy. In some embodiments, the composition is terminated with an amino acid linker, AAAGSHHHHHH (SEQ ID NO: 19).
[0070] In a further embodiment, the antibody comprises the amino acid sequence set forth in SEQ ID NO: 5, 8, 24, 27, 28 or 30.
[0071] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the figures and by study of the following detailed descriptions. [Brief explanation of the drawings]
[0072] [Figure 1-1]1A-1G Schematic diagrams of delivery systems according to embodiments of the present invention (FIGS. 1A-1F) and the prior art (ASSET) (FIG. 1G). FIG. 1A shows a general scheme of a delivery system in which a lipidated peptide (LP) moiety is separated from an antibody by a linker (e.g., greater than 40 amino acids), followed by (B) a primary IgG LAND, (C) a primary scFv LAND, (D) a long linker LAND (primary IgG targeting), (E) a long linker LAND (primary scFv targeting), and (F) a primary Fab LAND. "1" indicates primary IgG antibody targeting, "2" indicates primary scFv antibody targeting, and "3" indicates primary Fab antibody targeting. While not intended to be limiting, a representative description of each of these delivery systems is provided below. FIG. 1B shows a representative example of a primary IgG LAND construct. This example is composed of a lipidated peptide portion (amino acid sequence (CDQSSS) of SEQ ID NO: 17), followed by linker 1 (SEQ ID NO: 18; GGGGSGGLSGR), followed by a functional protein, followed by linker 3 (SEQ ID NO: 1; ASGGSGGGKASGG), followed by a "secondary" scFv sequence with specificity for the Fc fragment of a "primary" antibody with specificity for an antigen expressed on a cell type that is the therapeutic target. The amino acids of linker 1, functional protein, and linker 3 constitute the entire linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus. FIG. 1C shows an exemplary construct composed of a lipidated peptide portion (amino acid sequence (CDQSSS) of SEQ ID NO: 17), followed by linker 1 (amino acid sequence (GGGGGSGGLSGR) of SEQ ID NO: 18), followed by a functional protein, followed by linker 4 (amino acid sequence ASGGSGGGKASGGGGGGSGGGGSGGGGS of SEQ ID NO: 6), followed by a "primary" scFv sequence with specificity for an antigen expressed on a cell type targeted for therapy. The amino acids of linker 1, functional protein, and linker 4 constitute the entire linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.Figure ID shows an exemplary construct comprised of a lipidated peptide portion (amino acid sequence of SEQ ID NO: 17) followed by the linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGGSGGGKASGG (SEQ ID NO: 12), followed by a "secondary" scFv sequence with specificity for the Fc fragment of a "primary" antibody with specificity for an antigen expressed on a therapeutically targeted cell type. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus. Figure IE shows an exemplary construct comprised of a lipidated peptide portion (amino acid sequence of SEQ ID NO: 17) followed by the linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGGSGGGKASGG (SEQ ID NO: 12), followed by a "primary" scFv sequence with specificity for an antigen expressed on a therapeutically targeted cell type. In some embodiments, the amino acid sequence of SEQ ID NO: 19 (AAAGSHHHHHH) is present at the C-terminus. [Figure 1-2]Figure 1F shows an exemplary construct for expression of LAND in a Fab antibody format. This construct consists of a lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by an 11-amino acid linker 1 (SEQ ID NO: 18), followed by the functional protein, followed by an additional linker (20 amino acids long) (linker 4; SEQ ID NO: 6), followed by a primary Fd heavy chain. The light chain portion of the Fab is encoded by a sequence located on a separate DNA cassette and, upon transport into the E. coli periplasm, associates with the Fd portion to form a Fab covalently stabilized by an interchain disulfide bond. The Fab functions as the primary antibody and has specificity for an antigen expressed on the cell type being targeted for therapy. Figure 1G shows a prior art ASSET construct consisting of a lipidated peptide portion (amino acid sequence of SEQ ID NO: 17), followed by linker 1 (SEQ ID NO: 18), followed by a secondary antibody capable of binding to a primary antibody having specificity for an antigen expressed on the targeted cell type, followed by a further linker (linker 2; SEQ ID NO: 21), followed by a functional protein. [Figure 2] Figure 2. Analysis of fractions obtained from the purification of RG7 LAND protein. Aliquots from the Triton fraction (TF, 20 μg protein loaded), the unbound fraction from the His-Trap column (Ni-FT, 20 μg protein loaded), and purified lipidated RG7 scFv (purified, 5 μg protein loaded) were separated on a 12% SDS / polyacrylamide gel. The arrow indicates the position of the LAND protein. This is a representative gel from 24 runs. [Figure 3]Figures 3A-3B: Comparison of RG7-LAND and RG7-ASSET binding to rat IgG2a by ELISA and FACS. (A) Half of an ELISA plate was coated with Fib504 (rat IgG2a) and the other half with BSA overnight (ON) at 4°C. Plates were blocked with 300 μl / well of 3% MPBS for 1 hour at 37°C. Plates were washed three times with PBST, and purified LAND or ASSET protein, performed in triplicate, was applied in three-fold serial dilutions starting at 300 nM in PBST for 1 hour at RT. Plates were washed again, and HRP-anti-HIS / 5000 in PBST was applied for 1 hour at RT. Plates were washed, and 50 μl / well of TMB (Dako) was added. The color reaction was stopped after 5 min with 50 μl / well of 1 M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) Binding of RG7-LAND and RG7-ASSET to TK-1 cells in the presence of Fib504 mAb was measured by flow cytometry using a CytoFLEX (Beckman Coulter, USA). US = unstained cells; Cy5 = fluorescence of encapsulated siRNA. Data are means ± SD of five independent experiments. Applied proteins: ASSET attached to rat IgG2a (circles), ASSET attached to BSA (diamonds), LAND attached to rat IgG2a (triangles), and LAND attached to BSA (squares). [Figure 4]Figure 4A-B. Comparison of binding of RG7-LAND and RG7-ASSET to rat IgG2a anti-EGFR by ELISA and FACS. (A) Half of an ELISA plate was coated with anti-hEGFR (rat IgG2a clone 30-F11, BioRad) and the other half with BSA (negative specificity control), both at 2 μg / ml in PBS, 50 μl / well, overnight at 4°C. Plates were blocked with 300 μl / well of 3% MPBS for 1 hour at 37°C. Plates were washed three times with PBS containing 0.05% Tween-20 (PBST), and purified LAND or ASSET protein, performed in triplicate, was applied in 3-fold serial dilutions starting at 300 nM in PBST for 1 hour at RT. Plates were washed three times with PBST, and HRP-anti-HIS diluted 1:5000 in PBST was applied for 1 hour at RT. The plate was washed three times with PBST, and 50 μl / well of TMB (Dako) was added. After 8 minutes, the color reaction was stopped with 50 μl / well of 1 M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). Error bars indicate the standard deviation of the data. Applied proteins: ASSET attached to EGFR (circles), ASSET attached to BSA (diamonds), LAND attached to EGFR (triangles), and LAND attached to BSA (squares). (B) Binding of RG7-LAND and RG7-ASSET incorporated into LNPs to OVCAR8 cells in the presence of anti-hEGFR mAb was measured by flow cytometry (CytoFLEX, Beckman Coulter, USA). US = unstained cells; Cy5 = fluorescence of encapsulated siRNA. Representative histograms from five independent preparations. [Figure 5]Figure 5. In vitro binding of purified D1D2-Fc protein to TK-1 cells via RG7-LAND compared to RG7-ASSET, as measured by flow cytometry. D1D2-Fc-associated LNPs associate with TK-1 cells only when associated with RG7 LAND, but not with RG7 ASSET. US - unstained cells; Cy5 is the fluorescence of encapsulated siRNA. Representative histograms from five independent preparations. [Figure 6] Figures 6A-6C. In vitro binding of Erbitux-LAND, a "LAND with primary scFv targeting," to OVCAR8 (EGFR+) cells as measured by flow cytometry. (A) Binding of purified Erbitux-LAND protein in OG micelles. (B) Binding of EA-PIP LNPs incorporating purified Erbitux-LAND protein. (C) Binding of MC3 LNPs incorporating purified Erbitux-LAND protein. US - unstained cells; ASSET-RG7 (RG7 LAND protein as a negative control); ASSET-Erb (Erbitux-LAND); mCherry in A is the fluorescence of the mCherry component of LAND. Cys5 in B and C is the fluorescence of encapsulated siRNA. Representative histograms from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****P<0.0001. [Figure 7]Figure 7. Competitive binding: In vitro binding of Erbitux-LAND to OVCAR8 (EGFR+) cells measured by flow cytometry in the presence of Erbitux mAb as a competitor or Avastin as an isotype control. US - unstained cells; EA-PIP LNP (empty LNP (no scFv incorporated)); Avastin+Erb-LNP (LNP with Erbitux-LAND incorporated and incubated in the presence of the isotype control mAb Avastin); Erbitux+Erb-LNP (LNP with Erbitux-LAND incorporated and incubated in the presence of mAb Erbitux). Cys5 is the fluorescence of encapsulated siRNA. Representative histogram from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****P<0.0001. [Figure 8]Figures 8A-8B. Efficacy of LAND compared to ASSET under conditions minimizing nonspecific LNP internalization (4°C) and standard conditions (37°C). Cell viability assay: OVCAR8 cells were treated in vitro with EA-PIP LNPs (A) at 2 μg / ml LNPs for 1 hour at 4°C (minimizing nonspecific LNP internalization) or (B) at 0.2 μg / ml LNPs for 15 minutes at 37°C under standard conditions (not minimizing nonspecific LNP internalization). Cells were washed to remove non-internalized LNPs, replenished with fresh medium, and cultured for 72 hours before assessing cell viability using an XTT assay. NC5 (negative control siRNA); PLK1 (siPLK1); ASSET-EGFR (LNPs targeted with RG7-LAND protein using rat IgG2a anti-hEGFR); ASSET-Iso (LNPs targeted with RG7-LAND protein using isotype control rat IgG2a); NlpA-Erb (LNPs targeted with Erbitux-LAND); NlpA-RG7 (LNPs targeted with RG7-LAND protein without added primary antibody). Error bars represent SD of triplicate experiments. Surprisingly, as shown in Figure 8, LAND-targeted LNPs (NlpA-Erb) demonstrated statistically significant improved efficacy compared to ASSET-targeted LNPs (ASSET-EGFR) under both conditions minimizing nonspecific LNP internalization (4°C, Figure 8A) and standard conditions (37°C, Figure 8B). Analysis of variance (ANOVA) and Tukey's multiple comparison test were used to assess significance (*p<0.05; **p<0.01; ***p<0.005; ****p<0.001). [Figure 9]Figure 9A-9B. In vivo tumor cell uptake. Athymic nude mice bearing OVCAR8 tumors were intraperitoneally injected with EA-PIP LNPs encapsulating Cy5-labeled siRNA at 0.75 mg / kg. Four hours after injection, tumors were harvested for analysis. (A) Gating strategy: Single-cell suspensions extracted from tumors were stained with mCD45-FITC, and the percentage of Cy5-positive mCherry+ cells (tumor cells that had taken up LNPs) and Cy5-positive CD45+ cells (mouse leukocytes that had taken up LNPs) was determined by flow cytometry. (B) Percentage of Cys5-positive cells in tumor cells or mouse leukocytes. ASSET-EGFR (LNPs targeted with RG7 LAND protein containing rat IgG2a anti-hEGFR); ASSET-Iso (LNPs targeted with RG7 LAND protein containing isotype control rat IgG2a); NlpA-Erb (LNPs targeted with Erbitux LAND protein); NlpA-RG7 (LNPs targeted with RG7 LAND protein without added primary antibody). Error bars represent SEM (N=4). [Figure 10] Figure 10. PLK1 silencing by siRNA in tumors. Athymic nude mice bearing OVCAR8 tumors were intraperitoneally injected with EA-PIP LNPs encapsulating PLK1 siRNA or negative control siRNA at 0.75 mg / kg. Tumors were harvested for analysis by 48 hours post-injection. RNA was extracted from the tumors, and PLK1 mRNA levels were assessed by RT-PCR and compared with the human 3C gene as an internal control. All samples were normalized to mock. NC5 (negative control siRNA); PLK1 (siPLK1); ASSET-EGFR (RG7 LAND protein-targeted LNPs with rat IgG2a anti-hEGFR); ASSET-Iso (RG7 LAND protein-targeted LNPs with isotype control rat IgG2a); NlpA-Erb (Erbitux LAND protein-targeted LNPs); NlpA-RG7 (RG7 LAND protein-targeted LNPs without primary antibody). Error bars represent SD (n=4). [Figure 11]Figures 11A-11D. In vitro binding of THB-7-LAND to Z138 (CD38+) and CAG (MM) cells measured by flow cytometry. (A) THB-7-LAND micelles (binding of purified THB-7-LAND protein in OG micelles to CAG cells). (B) NlpA-LNP(EA-PIP) (binding of EA-PIP LNPs incorporating purified THB-7-LAND protein to CAG cells). (C) THB-7-LAND micelles (binding of purified THB-7-LAND protein in OG micelles to Z138 cells). (D) NlpA-LNP(EA-PIP) (binding of EA-PIP LNPs incorporating purified THB-7-LAND to Z138 cells). US - unstained cells; ASSET-RG7 (RG7 LAND protein as a negative control); ASSET-THB7(THB-7-LAND). Anti-His PE in A and C is a fluorescent label for the His component of LAND. Cys5 in B and D is the fluorescence of encapsulated siRNA. Representative histograms obtained from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****P<0.0001. [Figure 12]Figures 12A-B: Analysis of binding of RG7-LAND to rat IgG2a and BSA compared to RG7-LAND "long linker" by ELISA. (A) Half of an ELISA plate was coated with Fib504 and the other half with BSA overnight (ON) at 4°C. Plates were blocked with 300 μl / well of 3% MPBS for 1 hour at 37°C. Plates were washed three times with PBST, and purified LAND protein, performed in triplicate, was applied in 3-fold serial dilutions starting at 300 nM in PBST for 1 hour at RT. Plates were washed again, and HRP-anti-HIS / 5000 was applied in PBST for 1 hour at RT. Plates were washed, and 50 μl / well of TMB (Dako) was added. The color reaction was stopped after 3 minutes with 50 μl / well of 1 M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) Fib504 binding data from (A) plotted as a percentage of the maximum binding signal. Representative histograms from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****P<0.0001. [Figure 13]Figure 13. Analysis of binding of RG7-LAND-targeted MC3 LNPs compared to the RG7-LAND "long linker." Binding of LNPs to TK-1 cells (expressing α4β7 integrin on their surface) via Fib504 rat IgG2a (an antibody that binds to α4β7 integrin) or a rat IgG2a isotype control was measured by flow cytometry, and Cys5 fluorescence of the encapsulated labeled siRNA was read. US - Unstained cells, LNP + WT iso (RG7 LNP prepared in RG7-LAND in the presence of isotype control rat IgG2a); LNP + WT Fib (RG7 LNP prepared in RG7-LAND in the presence of Fib504 IgG); LNP + LL iso (RG7-LAND "long linker" (45 aa) LNP prepared in RG7-LAND in the presence of isotype control rat IgG2a); LNP + LL Fib (RG7-LAND "long linker" (45 aa) LNP prepared in RG7-LAND in the presence of Fib504 IgG). Representative histograms from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****P<0.0001. [Figure 14]Figure 14. Tumor cell viability experiments demonstrate the potential of LAND primary scFv targeting for gene editing applications. Tumor-targeted primary scFv LAND LNPs delivering mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with a guide RNA inhibit the function of genes that promote tumor growth. The ability of THB-7 (anti-CD38 scFv) LAND LNPs to treat CD38+ hematopoietic cancers is demonstrated in a representative CD38-expressing mantle cell lymphoma MCL Z138 tumor model. In these studies, MCL Z138 tumor cell viability assays were performed using anti-CD38 scFv LAND LNPs carrying mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with a single guide RNA against SOX11, a cancer-promoting gene in MCL. The control group consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFv LAND LNPs, using single-guide RNAs against unrelated target genes (GFP and HPRT). There was a statistically significant decrease in viability of MCL tumor cells treated with CD38-LNP(sgSOX11) compared to all control treatments, as demonstrated by ANOVA (p<0.0001). Cell viability was less than 10% in the CD38-LNP(sgSOX11)-treated group, whereas it was greater than 90% in the control groups CD38-LNP(sgGFP), CD38-LNP(sgHPRT), and untreated groups. These results demonstrate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to suppress the function of genes that drive tumor growth for effective tumor therapy. Representative histograms are shown from four independent preparations. Significance was assessed using analysis of variance (ANOVA) and Tukey's multiple comparison test. ****p<0.0001. [Figure 15]Figure 15. To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, we performed in vivo experiments comparing tumor-targeted LNPs delivering mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with guide RNA to suppress the function of genes that promote tumor growth with isotype control LNPs. To demonstrate the ability of anti-CD38 THB-7 LAND to treat CD38+ hematopoietic cancers in vivo, we used a representative CD38-expressing mantle cell lymphoma animal model, MCL Z138. Z138 tumor cells (approximately 1 x 10 cells) were intravenously injected into SCID mice (n = 8–10 per group). In these studies, intravenous administration was initiated 10 and 15 days after tumor inoculation, containing Cas9 mRNA and a single guide RNA against SOX11-CD38-LNP (sgSOX11), at a dose of 0.5 mg / kg. Control groups included sham treatment and LNP vectors with either an irrelevant scFv specificity or an irrelevant sgRNA. Specifically, the control LNP vectors were CD38-targeted LNPs containing Cas9 mRNA and a single guide RNA directed against green fluorescent protein (GFP)—CD38-LNP (sgGFP); isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA directed against SOX11—Iso-LNP (sgSOX11); and isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA directed against GFP—Iso-LNP (sgGFP). Kaplan-Meier curves and log-rank tests demonstrated a statistically significant difference in survival rates in the CD38-LNP (sgSOX11)-treated group compared to all control treatments (p<0.001). In the CD38-LNP(sgSOX11) group, 90% of animals were alive at day 50, whereas in the control group, all animals had died by day 40. These in vivo results are consistent with the in vitro data shown in Figure 14 and further demonstrate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to suppress the function of genes that drive tumor growth for effective tumor therapy. [Figure 16-1] Figures 16A-16C To further demonstrate the potential of LAND primary scFv targeting for safe and effective gene editing, we assessed the percentage of gene editing in selected tumor cells extracted from tumor and normal liver cells after in vivo treatment in the same representative hematopoietic tumor model used in Figure 15 and described in Example 3. In these studies, intravenous administration of LAND LNPs containing Cas9 mRNA and a single guide RNA for SOX11-CD38-LNP (sgSOX11) was initiated after tumor formation at a dose of 2.0 mg / kg. Control groups included sham treatment and LNP vectors carrying either an irrelevant scFv specificity or an irrelevant sgRNA, as described above for Figure 15. As an additional control, mice (N=5 / group) were treated with a single intravenous dose of doxorubicin (DOX) at a dose of 1 mg / kg or 2.5 mg / kg. After treatment, genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next-generation sequencing (NGS). The results, shown in Figure 16A, demonstrate that treatment with the single-guide RNA against SOX11-CD38-LNP (sgSOX11) edited 95% of tumor cells, compared to 0-4% in control groups containing either untreated animals or treatment with a similarly prepared LNP vector carrying an unrelated sgRNA, as described above for Figure 15. These differences are statistically significant by analysis of variance (ANOVA) and Tukey's multiple comparison test. **P<0.001. [Figure 16-2]As shown in Figure 16B, the superiority of LAND compared to standard chemically conjugated antibody LNP targeting is demonstrated for therapeutic applications. In these evaluations, an additional treatment group was tested using anti-CD38 LNPs prepared using chemical conjugation methods. Chemically conjugated CD38-targeting LNPs (chemical CD38-LNP-sgSOX11) utilized the same lipids, Cas9 mRNA, and SOX11 sgRNA as shown in Figure 16A. Chemical conjugation of anti-CD38 to LNPs was performed as previously described (Tarab-Ravski et al., 2023). Intravenous administration using chemical CD38-LNP-sgSOX11 was also initiated at a dose of 2.0 mg / kg 10 days after tumor formation, and the results were compared to those obtained with the same treatment group shown in Figure 16A. As shown in Figure 16B, there is a statistically significant increase in tumor gene editing with LAND CD38-LNP-sgSOX11 versus chemical CD38-LNP-sgSOX11 (>95% vs. <40%). Furthermore, "extratumoral" gene editing in normal liver cells (hepatocytes and macrophages) is significantly less with LAND versus chemically conjugated LNP treatment (<4% vs. >40%). Both of these differences are statistically significant by analysis of variance (ANOVA) and Tukey's multiple comparison test (p<0.0005). The substantially superior results of LAND versus chemically conjugated antibody-targeted LNP are unexpected because the antibody used in chemically conjugated LNPs has two binding sites, whereas the lipidated scFv antibody utilized in LAND has only one. As shown in Figure 16C, the superior safety of LAND compared to standard chemotherapy is demonstrated. In these evaluations, an additional control group (N = 5 / group) received a single intravenous dose of doxorubicin (DOX) at doses of 1 mg / kg or 2.5 mg / kg. These doses are generally within the range used clinically. After treatment, genomic DNA was extracted from normal liver cells and analyzed for INDELs by next-generation sequencing (NGS).Strikingly, compared to standard chemotherapy (doxorubicin 2.5 mg / Kg, Figure 16C), which results in over 50% INDELs, "extratumoral" gene editing in normal liver cells in LAND is orders of magnitude less (less than 4% Figure 16B). [Figure 17] Figure 17. To further demonstrate the safety of LAND primary scFv therapy, liver toxicity and the percentage of gene editing were evaluated in normal hepatocytes after in vivo administration in normal mice. In these studies, anti-EGFR LAND LNPs containing Cas9 mRNA and a single guide RNA for PLK1-EGFR-LNP (sgPLK1) were administered intravenously at a dose of 2.0 mg / kg. Control groups included untreated animals and an LNP vector containing an irrelevant GFP sgRNA, as described above for Figure 15. Serum liver enzyme levels and the percentage of gene-edited hepatocytes were determined as described in Figure 16. Consistent with the results in Figure 16, the percentage of edited hepatocytes was low and not significantly different between the anti-EGFR LAND LNPs with a single guide RNA for PLK1-EGFR-LNP (sgPLK1) and the control group treated with anti-EGFR LAND LNPs with a single guide RNA for an irrelevant sgRNA for GFP, as described above for Figure 16. There were no adverse effects on serum liver enzymes, which were similar to untreated animals in all treatment groups. [Figure 18] Figure 18. In vitro binding of Erbitux-LAND "LAND with primary scFv targeting" and "LAND with primary Fab targeting" to OVCAR8 (EGFR+) cells as measured by flow cytometry. Binding of purified Erbitux-LAND protein in OG micelles. UT - unstained cells; RG7 micelles: RG7 detergent micelles as negative control; Erb micelles: primary Erbitux-scFv LAND detergent micelles; Fab micelles: primary Erbitux-Fab LAND detergent micelles; APC - anti-His: detection of fluorescent antibody only without micelles. [Figure 19]Figure 19. In vitro binding of THB-7 LAND "LAND with primary scFv targeting" and "LAND with primary Fab targeting" to Z138 (CD38+) cells as measured by flow cytometry. Binding of purified THB-7-LAND protein in pure OG micelles. UT - unstained cells; RG7 micelles: RG7 OG micelles; scFv: primary THB-7 scFv LAND OG micelles; Fab: primary THB-7 Fab LAND OG micelles; aHis: detection of His-Tag fluorescent antibody only without micelles. DETAILED DESCRIPTION OF THE INVENTION
[0073] The present invention provides a novel platform for the effective delivery of therapeutic agents to target cells. This platform, termed "LAND," offers consistent application, excellent antigen-binding efficacy, and specificity. In one embodiment, the LAND platform comprises a primary antibody associated with a lipid particle via a lipidated peptide and a peptide linker (e.g., 10-200 amino acids, 20-200 amino acids, 30-300 amino acids, or 40-400 amino acids in length). In another embodiment, the platform comprises a unique linker / spacer (which may or may not encode a functional protein) of at least 40 amino acids incorporated between the lipidated peptide portion of the antibody and the antibody itself (see Figure 1A). Surprisingly, this platform demonstrated high efficacy in transducing cells with LNPs encapsulating active agents (e.g., RNA).
[0074] Reference is now made to Figures 1B-1F, which are schematic diagrams comparing specific configurations of delivery systems according to the principles of the present invention with a conventional configuration (referred to herein as ASSET; Figure 1G). While the ASSET configuration simply utilizes a short 11-amino acid linker (Linker #1) preceding the lipidated antibody (secondary scFv), followed by an additional linker (Linker #2) and a functional protein, configurations according to the principles of the present invention utilize a longer linker (Linker #5 in D and E) or one that includes a functional protein (B and C) preceding the lipidated antibody. In certain embodiments, the antibody is encoded at the 5' end of the construct. Surprisingly, the novel configurations (Figures 1C and 1E) with a LAND primary scFv antibody targeting with a single antigen-binding site showed significantly enhanced efficacy compared to the ASSET primary IgG antibody targeting with two antigen-binding sites, which are generally considered to have superior affinity compared to the corresponding scFv fragment.
[0075] The delivery systems of the present invention are useful for targeting a variety of antigens and treating the corresponding diseases listed, including but not limited to those shown in Table 1.
[0076] [Table 1] TIFF2025541601000003.tif244161TIFF2025541601000004.tif250167TIFF2025541601000005.tif247162 TIFF2025541601000006.tif241166TIFF2025541601000007.tif248161TIFF2025541601000008.tif172170
[0077] In certain embodiments, the therapeutic agent is a base editor, prime editor, or mobile genetic element gene writer. In certain embodiments, the gene-editing nuclease is a cytosine base editor (CBE), which essentially consists of three fusion elements: a cytidine deaminase, a uracil-DNA glycosylase inhibitor (UGI), and a catalytically inactive Cas nuclease (dCas) or a partially inactive (Cas nickase or nCas) Cas nuclease. Such Cas9 mutants contain mutations that prevent the generation of double-strand breaks (DSBs). An associated single guide RNA (sgRNA) confers target sequence specificity. In certain embodiments, the CBE complex is recruited to the target DNA by the Cas protein and sgRNA, and the cytidine deaminase recognizes single-stranded DNA (ssDNA) in an R-loop structure formed by pairing between the sgRNA and the non-edited DNA strand, converting cytosine to uracil and creating a U / G pair. The mismatched U / G pairs are then sequentially converted into U / A pairs and T / A pairs by the mismatch repair (MMR) pathway. In another embodiment, the gene-editing nuclease is an adenine base editor (ABE). ABEs are similar to CBEs in both structure and base editing mechanism, except that adenosine deaminase is replaced with cytidine deaminase. In certain embodiments, the ABE complex is recruited to the target DNA through a process similar to that used by CBEs, and then adenosine deaminase converts adenosine to inosine, creating an I / T pair. MMR then sequentially converts the mismatched I / T pairs into I / C pairs and G / C pairs. Many mutants of CBEs and ABEs have been created to improve their efficiency, specificity, and reduce off-target effects. In certain embodiments, CBEs, ABEs, and other gene editing agents include, but are not limited to, those listed in Table 2 and Table 3, respectively. In certain embodiments, to silence gene expression, CBEs, ABEs and other gene editing agents are used to introduce a premature termination codon (PTC) into a target gene to prevent its expression.In certain embodiments, base editors, designated CRISPR-STOP and iSTOP, including but not limited to BE3, create in-frame stop codons in the genome by converting CAA, CAG, CGA, and / or TGG codons to TAA, TAG, and TGA stop codons. Another approach to gene expression suppression is to use ABE to mutate the start codon (ATG), thereby halting gene expression. In one embodiment, an adenine base editor designated i-Silence is used to silence a gene of interest, for example, by converting ATG to GTG or ACG using ABEmax. Conversely, the generation of disease-causing truncated proteins can be prevented by bypassing existing abnormal disease-associated PTCs with BEs. This approach, called CRISPR-pass, has been successful in preventing the generation of truncated proteins by converting PTCs to glutamine (CAA or CAG) or arginine (CGA) codons via AG or TC conversions, allowing transcription to proceed.
[0078] In addition to restoring normal gene expression and suppressing gene function, isoform-specific gene expression can also be controlled by DNA base editors. Most proteins have multiple isoforms, and alternative splicing of pre-mRNA is a key step in determining isoform type by excluding some exons from the mature transcript. Because most introns end with a G, CBEs are used in an approach called CRISPR-SKIP to convert a G to an A within the splice acceptor site by editing a C in the complementary strand of the target site. As a result, the exon is not incorporated into the mature transcript, while other exons are expressed normally.
[0079] Designing and optimizing sgRNAs for DNA base editors is more complex than CRISPR-based methods, so designing appropriate sgRNAs is crucial for their application. Currently, typical CRISPR sgRNA design programs, such as CRISPOR, CHOPCHOP, and Cas-Designer, can be used for DNA base editor sgRNAs. In particular, specialized DNA base editor tools, such as BE-Designer, sgSTOPs, beditor, SNP-CRISPR, BE-FF, and Benchling, can be used to design sgRNAs for BE. Recently, a machine learning-based sgRNA design tool called BE-Hive has become available, which provides predictions of editing efficiency and genotypic outcomes for each target across different CBEs and ABEs and different cell lines.
[0080] In another embodiment, a base editing system is utilized that recruits DNA base-modifying enzymes via RNA aptamers within gRNA molecules. In this approach, instead of fusing an effector deaminase to Cas9, the guide RNA (gRNA) component of the CRISPR-Cas9 complex is engineered as an anchor for recruitment. In this approach, the gRNA is engineered to contain an RNA aptamer, which interacts with its cognate ligand fused to an effector protein. Separating the DNA recognition element and the effector element and using an RNA aptamer for effector recruitment allows for easy reconstitution of the system by combining the individual components and simultaneously recruiting different effectors to different target sites. Heterologous BE at separate loci is easily achieved by utilizing the pairing of orthologous RNA aptamer-RNA binding proteins to recruit different DNA deaminases. In a specific embodiment, an RNA aptamer-mediated BE system, named Pin-Point, is used.
[0081] Cytosine base editors, adenine base editors and other gene editing agents suitable for particular embodiments include, but are not limited to, those contained in Tables 2 and 3 below, which are incorporated by reference and characterize their nuclease origin, mutations, if present, editing window, and PAM sequence.
[0082] [Table 2]
[0083] As listed in Table 2, Jeong et al. and Collantes et al. (both incorporated by reference) describe examples of cytosine base editors (CBEs), adenine base editors (ABEs), Pin Point RNA aptamer-mediated CBE and ABE systems that may be used in certain embodiments.
[0084] In certain embodiments, CBEs, ABEs, and other gene editing components in Table 3 are utilized, including, but not limited to, glycosylase base editors (GBEs) and C to G base editors (CGBEs), adenine transversion editors (AYBEs and AXBEs), prime editors (PEs), CRISPR-associated transposons (CASTs), CRISPR-associated serine recombinases (twinPEs and PASTEs), retrons, and SeLection by Essential-Gene Exon Knock-in (SLEEK) doi: 10.3390 / biomedicines11082168 (incorporated by reference).
[0085] [Table 3]
[0086] Another embodiment, called prime editing, uses a guide RNA template and Cas9 nickase to guide reverse transcriptase to the target site, where it creates a new DNA strand from the RNA template and inserts it into the target sequence. Prime editors allow for the generation of small insertions and deletions, in addition to the substitution of a few nucleotides at the target site. Prime editors can convert any DNA base to any other base, mediate all possible base-to-base conversions, and generate insertions and deletions (INDELs) and their combinations, without the need for a double-strand break (DSB) or donor DNA (dDNA) template. Prime editing uses a longer single guide RNA (sgRNA) known as a prime editing guide RNA (pegRNA) and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcription (RT) enzyme. Prime editing, called a "search-and-replace" base editing technique, incorporates the desired gene construct into the extension of the guide RNA, which is then converted into DNA using the RT enzyme.
[0087] In another embodiment, termed gene writing, gene editing enzymes incorporate mobile genetic elements for targeted integration of large DNA fragments into mammalian genomes. Mobile genetic elements include, but are not limited to, transposons, retrotransposons, short interspersed nucleotide sequences (SINEs), and long interspersed nucleotide sequences (LINEs). In a specific gene writing embodiment, termed "find, cut, and move" (FiCAT), CRISPR-Cas9 targeting elements (find, cut) are combined with the payload transfer efficiency of an engineered piggyBac transposase (move). PiggyBac functional domains are engineered to increase on-target integration while reducing off-target events. In a specific embodiment, Cas9 finds and cuts the genomic insertion site, and a transposase that exhibits enhanced donor excision and reduced promiscuous DNA binding contributes to gene insertion. This system acts irreversibly by destroying the transposase's preferred recognition site during insertion. With gene writing, efficient targeted insertion of multi-kilobase DNA fragments has been achieved in mammalian genomes.
[0088] A list of endogenous pathogenic cancer-promoting genes and sequences for downmodulation by LAND therapy includes, but is not limited to, those listed in Table 4, as well as representative, non-limiting designed guide RNAs for use with Cas9 and Cas9 suppressor fusion proteins.
[0089] [Table 4] TIFF2025541601000012.tif242169
[0090] Non-limiting examples of one or more up-modulated anti-cancer genes and endogenous genomic sequences for transcriptional activation by LAND for cancer treatment include tumor suppressor genes, pro-apoptotic genes, immuno-promoting genes, therapeutic susceptibility genes, suicide genes, anti-cancer genes that are silenced by hypermethylation or other epigenetic mechanisms or secreted by the genetic activity of decoy receptors, including, but not limited to, those listed in Table 5.
[0091] [Table 5] TIFF2025541601000014.tif252168TIFF2025541601000015.tif204161
[0092] For LAND therapy, Cas and dCas nucleases may be provided as mRNA encoding the Cas / dCas nuclease (e.g., custom-made CleanCap Cas9 or dCas9 mRNA (modified) by TriLink BioTechnologies Inc.) or complexed with a guide RNA as a ribonucleoprotein (RNP) (e.g., custom-made by Aldevron Inc.). Without intending to be limiting, exemplary Cas and dCas with their protospacer adjacent motifs (PAMs) suitable for LAND therapy in activated or inactivated forms include, but are not limited to, those listed in Table 6 below.
[0093] [Table 6]
[0094] In addition to the antibody targets and diseases primarily associated with cancer and other hyperproliferative diseases listed in Table 1, which are not intended to be limiting, LAND may be applied by gene editing knockout, silencing, or correction applications using the LAND platform to genetic diseases, including, but not limited to, those listed below in Table 7. These additional diseases, associated genes, tissues / cells, and antibody targets to which the LAND platform is applicable include, but are not limited to, those listed below in Table 7.
[0095] [Table 7] TIFF2025541601000018.tif236166TIFF2025541601000019.tif247167TIFF2025541601000020.tif211170
[0096] As used herein, the term "antibody" includes not only intact molecules but also functional fragments thereof.
[0097] In one embodiment, the antibody is a primary antibody.
[0098] As used herein, the term "primary antibody" refers to an antibody (or antibody fragment, as defined herein) that specifically recognizes an antigen target of interest (e.g., a protein, peptide, carbohydrate, or other small molecule), and is typically unconjugated (unlabeled). Primary antibodies that recognize unique epitopes across a wide range of biomolecules and bind with high affinity and specificity are available as highly specific (e.g., 1 μM to 0.5 nM) monoclonal and / or polyclonal antibodies.
[0099] According to certain embodiments, the primary antibody comprises an antigen recognition domain that binds to a tissue- or tumor-specific antigen.
[0100] As used herein, "tissue-specific antigen" refers to a heterologous antigen that has organ or tissue specificity.
[0101] As used herein, "tumor (or cancer) specific antigen" refers to an antigenic substance produced in tumor cells, i.e., a substance that elicits an immune response in the host. Tumor antigens are useful for identifying tumor cells and are potential candidates for use in cancer therapy. The term also includes tumor-associated antigens.
[0102] According to certain embodiments, the antigen recognized by the primary antibody is a cell surface antigen.
[0103] In particular, the antigen recognized by the primary antibody is CD44, CD34, Ly6C, CD3, CD4, CD25, CD29 and / or Itgb7.
[0104] It will be understood that the primary antibody may refer to multiple primary antibodies that bind to different targets, for example, two, three, or four different targets, to improve specificity. Thus, one target may be a tissue-specific antigen and another target may be a tumor-specific antigen, or vice versa. Alternatively, all primary antibodies may bind to tissue (cell)-specific antigens. Alternatively, all primary antibodies may bind to tumor-specific antigens.
[0105] According to certain embodiments, the primary antibody is a monoclonal antibody.
[0106] According to certain embodiments, the primary antibody is a bispecific antibody.
[0107] According to certain embodiments, the primary antibody is conjugated to a pharmaceutical agent.
[0108] According to another embodiment, the primary antibody is conjugated to a diagnostic agent.
[0109] In another embodiment, the antibody is a secondary antibody.
[0110] As used herein, the phrase "secondary antibody" refers to an antibody that conjugates to a conserved region of a primary antibody. Thus, a secondary antibody may have specificity for the antibody species, and optionally the isotype, of the primary antibody.
[0111] Various types of secondary antibodies are available, each specific to a particular antibody class and type of fragment. Secondary antibodies can bind to portions of the entire IgG (heavy and light chains, H+L), or they can bind only to the Fab or Fc region, or only to the gamma chain. In one embodiment, the secondary antibodies described herein bind only to the Fc region of an antibody and not to the light chain of the antibody (i.e., bind with at least 10-fold, 100-fold, or 1000-fold greater affinity). Secondary antibodies specific for the IgM heavy chain (μ or Fcμ) or the lambda or kappa light chains common to all immunoglobulins (IgG, IgA, IgD, IgE, and IgM) also exist.
[0112] In one embodiment, the secondary antibody may be an antibody fragment that binds to the Fc constant region of a rat IgG2a antibody. In another embodiment, the secondary antibody may be an antibody fragment that binds to the Fc constant region of a human antibody (e.g., a human IgG antibody). The secondary antibody (or a fragment thereof, such as an scFv) may be used in a 10 μg / mL or 20 μg / mL dose to avoid exchange with serum IgG. -10 M~10 -8 It is necessary to have sufficient affinity, such as the Kd of M.
[0113] The secondary antibody may be a monoclonal or polyclonal antibody.
[0114] According to certain embodiments, the antibody (primary or secondary) is a monoclonal antibody (described in further detail herein below), such as a humanized monoclonal antibody.
[0115] The antibody can belong to any antibody class (e.g., IgG, IgA, IgD, IgE, and IgM) or isotype. According to particular embodiments, the antibody is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4.
[0116] The antibodies may be provided as intact antibodies (e.g., whole IgG) or as bivalent F(ab')2 fragments and monovalent Fab fragments, although other forms of antibody fragments may also be used herein, as described below.
[0117] As used herein, the phrase "antibody fragment" refers to a functional fragment of an antibody (e.g., Fab, F(ab')2, Fv, scFv, dsFv, or single domain molecules such as VH and VL) that is capable of binding to an epitope of an antigen.
[0118] In certain cases, the antibody or antibody fragment comprises a constant region.
[0119] Antibody fragments suitable for practicing some embodiments of the present invention include antibody fragments that essentially contain the entire variable regions of both the L and H chains, such as the complementarity determining regions (CDRs) of an immunoglobulin light chain (herein referred to as the "L chain"), the complementarity determining regions of an immunoglobulin heavy chain (herein referred to as the "H chain"), the variable region of the light chain, the variable region of the heavy chain, the light chain, the heavy chain, Fd fragments, and Fv, single-chain Fv (scFv), disulfide-stabilized Fv (dsFv), Fab, Fab', and F(ab')2.
[0120] Functional antibody fragments that contain all or essentially all of the variable regions of both the light and heavy chains are defined as follows.
[0121] (i) Fv: Defined as a genetically engineered fragment consisting of the variable region of the light chain (VL) and the variable region of the heavy chain (VH) expressed as two chains.
[0122] (ii) Single-chain Fv (“scFv”): A genetically engineered single-chain molecule containing the variable region of the light chain and the variable region of the heavy chain linked by a suitable polypeptide linker as a genetically fused single-chain molecule.
[0123] (iii) Disulfide-stabilized Fv (“dsFv”): A genetically engineered antibody comprising the variable region of a light chain and the variable region of a heavy chain linked by an engineered disulfide bond.
[0124] (iv) Fab: A fragment of an antibody molecule containing a monovalent antigen-binding site, which can be obtained by treating a whole antibody with the enzyme papain to obtain an intact L chain and an Fd fragment of the H chain consisting of its variable domain and CH1 domain.
[0125] (v) Fab': A fragment of an antibody molecule that contains a monovalent antigen-binding site of the antibody molecule, which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab' fragments are obtained per antibody molecule).
[0126] (vi) F(ab')2: A fragment of an antibody molecule (i.e., a dimer of Fab' fragments held together by two disulfide bonds) that contains a monovalent antigen-binding site of an antibody molecule, which can be obtained by treating a whole antibody with the enzyme pepsin.
[0127] (vii) Single domain antibodies are composed of a single VH or VL domain that exhibits sufficient affinity for the antigen.
[0128] In one embodiment, the fragment is an scFv.
[0129] According to certain embodiments, the polypeptide sequence of the primary or secondary antibody comprises an N-terminal sequence derived from a leader peptide recognized by the bacterial lipidation system. After removal of the leader peptide during transport through the inner membrane, the mature polypeptide contains the N-terminal sequence of the leader peptide (e.g., CDQSSS-SEQ ID NO: 17), which is targeted by the lipidation system for lipid acylation of cysteines. In one embodiment, the signal sequence is part of a bacterial (e.g., E. coli) inner membrane lipoprotein.
[0130] One example of an inner membrane lipoprotein is NlpA (new lipoprotein A). The first six amino acids of NlpA can be used as an N-terminal anchor (CDQSSS: SEQ ID NO: 17). Other examples of anchors that can be used in the present invention include the lipoprotein pullulanase of K. pneumoniae, which has a CDNSSS (SEQ ID NO: 13) mature lipoprotein anchor, the phage-encoded celB, and E. coli acrE (envC).
[0131] Examples of inner membrane proteins that can be used as protein anchors include AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GlnP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, Dpp B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, DsbB, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB, and Aas. Furthermore, a single transmembrane loop of any cytoplasmic protein can be used as a membrane anchor.
[0132] As described above, the N-terminus of the antibody is linked to the lipidated peptide moiety via a linker peptide.
[0133] The linker peptide is an amino acid sequence that serves to link the antibody and the lipidated peptide moiety. The linker peptide may contain amino acids that encode a functional protein (e.g., a detectable protein such as a fluorescent protein), or it may have no function other than to link the antibody and the lipidated peptide moiety (i.e., as a spacer).
[0134] Preferably, the linker has flexibility and length that allows the lipidated peptide portion of the antibody to penetrate (non-covalently) associate with the lipids of the particle and bind with high affinity to the antigen-binding fragment of the antibody to its target (as further detailed herein).
[0135] The linker peptide is at least 40, 50, 60, 70, 80, 90, 100 amino acids in length. In one embodiment, the linker peptide is 40-400, 40-300, 50-400, 50-300, 60-400, 60-300 amino acids in length.
[0136] In another embodiment, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the amino acids in the linker are glycine and / or serine.
[0137] In some embodiments, the linker is a combination of a functional protein, a linker, and a spacer sequence.
[0138] To express the antibodies of this aspect of the invention, the polynucleotide sequences encoding the above elements are preferably ligated into a nucleic acid construct suitable for expression in a host cell, which nucleic acid construct includes a promoter sequence that directs transcription of the polynucleotide sequence constitutively or inducibly in the cell.
[0139] An exemplary construct contemplated by the inventors is shown in Figures 1A-1F. In this construct, a lipidated peptide portion and a linker peptide of more than 40 amino acids are encoded at the 3' end of the DNA encoding the antibody, and the antibody itself is encoded towards the 5' end. According to certain embodiments, the antibody is encoded at the 5' end.
[0140] The nucleic acid constructs (also referred to herein as "expression vectors") of some embodiments of the present invention contain additional sequences (e.g., shuttle vectors) that render the vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both. In addition, typical cloning vectors may contain transcription and translation initiation sequences, transcription and translation terminators, and polyadenylation signals. By way of example, such constructs typically contain a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or portion thereof.
[0141] The nucleic acid construct of some embodiments of the present invention typically includes a signal sequence for secretion of the fusion protein from a host cell in which it is placed.
[0142] Eukaryotic promoters typically contain two types of recognition sequences: the TATA box and upstream promoter elements. The TATA box, located 25–30 base pairs upstream of the transcription start site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. Other upstream promoter elements determine the rate at which transcription is initiated.
[0143] Exemplary promoters contemplated by the present invention include, but are not limited to, polyoma, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis B virus, and cytomegalovirus promoters. According to certain embodiments, the promoter is a bacterial promoter.
[0144] Preferably, the promoters utilized in the nucleic acid constructs of some embodiments of the present invention are active in the particular cell population transformed. Examples of cell type-specific and / or tissue-specific promoters include liver-specific albumin promoters [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid-specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular T-cell receptor promoters [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulin promoters [Banerji et al. (1983) Cell 33729-740], neuron-specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreatic-specific promoters [Edlunch et al. (1985) Science 230:912-916], or mammary gland-specific promoters such as the whey promoter (US Pat. No. 4,873,316 and EP 264,166).
[0145] To increase the efficiency of mRNA translation, polyadenylation sequences can also be added to expression vectors. Accurate and efficient polyadenylation requires two distinct sequence elements: a GU- or U-rich sequence downstream of the polyadenylation site and a highly conserved six-nucleotide sequence, AAUAAA, located 11 to 30 nucleotides upstream. Suitable termination and polyadenylation signals for some embodiments of the present invention include those derived from SV40.
[0146] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 available from Invitrogen, pCI available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV available from Strategene, pTRES available from Clontech, and derivatives thereof.
[0147] Expression vectors containing regulatory elements derived from eukaryotic viruses, such as retroviruses, can also be used. SV40 vectors include pSVT7 and pMT2. Bovine papilloma virus-derived vectors include pBV-1MTHA, and Epstein-Barr virus-derived vectors include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A. + , pMTO10 / A + , pMAMneo-5, baculovirus pDSVE, and any other vector that allows for protein expression under the direction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown to be effective for expression in eukaryotic cells.
[0148] A variety of methods can be used to introduce the expression vectors of some embodiments of the present invention into stem cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989); Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995); Vega et al., Gene Targeting, CRC Press, Ann Arbor, Mich. (1995); Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et al. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. See also US Pat. Nos. 5,464,764 and 5,487,992 for further discussion of positive and negative selection methods.
[0149] Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89].
[0150] Additional bacterial systems contemplated by the present invention include, but are not limited to, Lactoccocus lactis, Pseudomonas spp., Streptomyces spp., coryneform bacteria, and halophiles.
[0151] In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Patent Application No. 5,932,447, or vectors can be used to facilitate integration of foreign DNA sequences into the yeast chromosome.
[0152] When using a plant expression vector, the expression of the coding sequence can be driven by multiple promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al. (1984) Nature 310:511-514] or the coat protein promoter of TMV [Takamatsu et al. (1987) EMBO J. 6:307-311] can be used. Alternatively, plant promoters such as the small subunit of RUBISCO [Coruzzi et al. (1984) EMBO J. 3:1671-1680 and Brogli et al., (1984) Science 224:838-843] or heat shock promoters, such as soybean hsp17.5-E or hsp17.3-B [Gurley et al. (1986) Mol. Cell. Biol. 6:559-565] can be used. These constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant viral vectors, direct DNA transformation, microinjection, electroporation, and other techniques well known to those skilled in the art. See, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.
[0153] Other expression systems, such as insect and mammalian host cell systems, which are well known in the art and described further below, can also be used in some embodiments of the present invention.
[0154] Because the antibody is lipidated, it is inserted into the membrane of the expressing cell. The membrane fraction is separated (e.g., by centrifugation), and the lipidated antibody can be extracted from the membrane using detergent and then optionally further purified (e.g., using nickel affinity chromatography).
[0155] Once isolated, the lipidated antibodies described herein may be contacted with particles to produce immunoparticles.
[0156] The contacting is carried out for a time (e.g., 6-72 hours) and under conditions (e.g., temperature) that allow the lipidated portion of the protein (e.g., the second antibody) to become inserted into the immunoparticle, it being understood that the lipidated antibody is thus non-covalently bound to the particle via its lipidated portion.
[0157] The lipidated antibodies of the present invention are attached to the outer surface of the particle, and measures are taken to attach the antibody without significantly affecting its ability to bind to its target (i.e., more than 80%, more than 90%, or more than 95% of the antibody on the particle is available for target binding and particle loading or pharmaceutical agent loading).
[0158] As used herein, the term "immunoparticle" refers to a particle that typically functions as a carrier for a drug or diagnostic agent and has antibodies linked to its surface.
[0159] As used herein, "particle" refers to a nano- to micro-structure that is not a biological cell.
[0160] The particles may be synthetic carriers, gels or other bodies or materials having an outer surface capable of carrying (e.g., encapsulating) a pharmaceutical agent. The particles may be polymeric or non-polymeric preparations.
[0161] Exemplary particles that may be used in this aspect of the invention include, but are not limited to, polymeric particles, microcapsules, liposomes, microspheres, microemulsions, nanoparticles, nanocapsules, nanospheres, nanoliposomes, nanoemulsions, and nanotubes.
[0162] In one embodiment, the particle is a biological particle (eg, a red blood cell or a cell ghost).
[0163] In another embodiment, the particle is a non-biological particle (ie, not a cell).
[0164] According to certain embodiments, the particles are nanoparticles.
[0165] As used herein, the term "nanoparticle" refers to one or more particles having a size intermediate between that of an individual atom and that of a macroscopic bulk solid. Generally, nanoparticles have a characteristic size (e.g., the diameter of a generally spherical nanoparticle, or the length of a generally elongated nanoparticle) in the submicrometer range (e.g., sizes of about 1 nm to about 500 nm, or about 1 nm to about 200 nm), or on the order of 10 nm (e.g., about 1 nm to about 100 nm). Nanoparticles may be of any shape, including, but not limited to, elongated particle shapes such as nanowires, or irregular shapes, in addition to more regular shapes such as generally spherical, hexagonal, and cubic nanoparticles. According to one embodiment, the nanoparticles are generally spherical.
[0166] The particles of this aspect of the invention may have a charged (ie, positively or negatively charged) or neutral surface.
[0167] The agent used to prepare the particles may be selected depending on the desired charge required on the outer surface of the particles.
[0168] Thus, for example, if a negatively charged surface is desired, the particles may be made from negatively charged lipids (ie, anionic phospholipids) as described herein below.
[0169] If a positively charged surface is desired, the particles may be made from positively charged lipids (ie, cationic phospholipids) as described herein below.
[0170] As mentioned above, uncharged particles are also contemplated by the present invention. Such particles may be made from neutral lipids such as phosphatidylethanolamine or dioleylphosphatidylethanolamine (DOPE).
[0171] It should be understood that different lipid combinations can be used to make particle of the present invention, including the mixture of multiple cationic lipids, the mixture of multiple anionic lipids, the mixture of multiple neutral lipids, the mixture of at least one cationic lipid and at least one anionic lipid, the mixture of at least one cationic lipid and at least one neutral lipid, the mixture of at least one anionic lipid and at least one neutral lipid and the combinations described above.In addition, polymer-lipid based formulations can also be used.
[0172] There are many polymers that may be attached to lipids. Polymers typically used as lipid-modifying agents include, but are not limited to, polyethylene glycol (PEG), polysialic acid, polylactic acid (also called polylactide), polyglycolic acid (also called polyglycolide), polylactic-polyglycolic acid, polyvinyl alcohol, polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxyethryloxazolyl, polyhydroxypropyloxazoline, polyaspartalide, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinyl methyl ether, polyhydroxyethyl acrylate, derivatized celluloses (such as hydroxymethyl cellulose or hydroxyethyl cellulose).
[0173] The polymers may be used as homopolymers or as block or random copolymers.
[0174] Particles may also contain other components. Examples of such other components include, but are not limited to, fatty alcohols, fatty acids, and / or cholesterol esters, or any other pharmaceutically acceptable excipients that can affect surface charge, membrane fluidity, and assist the incorporation of bioactive lipids into lipid aggregates. Examples of sterols include cholesterol, cholesterol hemisuccinate, cholesterol sulfate, or any other cholesterol derivatives. Preferred lipid aggregates according to the present invention include those that form micelles (typically when no lipid matrix aggregates exist) or those that form liposomes (typically when lipid matrix exists).
[0175] In one embodiment, the particles are lipid-based nanoparticles. The core of the particle may be hydrophilic or hydrophobic. The core of a lipid-based nanoparticle may contain some lipid so that it is not completely hydrophilic.
[0176] In certain embodiments, the particle is a liposome.As used herein and recognized in the art, liposome includes any synthetic (i.e., non-naturally occurring) structure that is composed of a lipid bilayer that encloses a volume.Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, etc.Liposomes may be prepared by any method known in the art (Monkkonen, J., 1994, J. Drug Target, 2:299-308;Monkkonen, J. et al., 1993, Calcif. Tissue Int., 53:139-145;Lasic D D., Liposomes Technology Inc., Elsevier, 1993, 63-105. (chapter 3);Winterhalter M, Lasic DD, Chem Phys Lipids, 1993 September;64(1-3):35-43).
[0177] Liposomes may be unilamellar or multilamellar. Unilamellar liposomes may be preferred in some cases due to their high surface area per lipid weight. Suitable liposomes according to the present invention are preferably non-toxic. Liposomes may be made from a single phospholipid or a mixture of phospholipids. Liposomes may also contain other lipid materials, such as cholesterol. Acidic phospholipids or sphingolipids or other synthetic lipids may be used to create liposomes with a negative surface potential. Preferably, the lipid has a high partition coefficient into the lipid bilayer and a low desorption rate from the lipid assembly. Exemplary phospholipids that may be used to create liposomes with a negative surface potential include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylcholine, and phosphatidylglycerol.
[0178] Other negatively charged lipids that are not liposome-forming lipids but may also be used include sphingolipids, such as cerebroside sulfate, and various gangliosides.
[0179] The most commonly used and commercially available lipid derivatized lipopolymers are based on phosphatidylethanolamine (PE), usually distearylphosphatidylethanolamine (DSPE).
[0180] The lipid phase of the liposome may comprise a physiologically acceptable liposome-forming lipid, or a combination of physiologically acceptable liposome-forming lipids for medical or veterinary use. Liposome-forming lipids typically have a glycerol backbone in which at least one of the hydroxyl groups is replaced with an acyl chain, a phosphate group, or a combination or derivative thereof, and may contain a chemically reactive group (such as an amine, imine, acid ester, aldehyde, or alcohol) at the head group position. The acyl chain typically ranges from 12 to about 24 carbon atoms in length, with fully hydrogenated, partially hydrogenated, or non-hydrogenated lipids having various degrees of saturation. Furthermore, the lipid matrix may be naturally occurring, semi-synthetic, or fully synthetic lipids, and may be neutral, negatively, or positively charged.
[0181] According to one embodiment, the lipid phase comprises a phospholipid.
[0182] The phospholipid may be a glycerophospholipid. Examples of glycerophospholipids include, but are not limited to, phosphatidylglycerols (PG) including dimyristoylphosphatidylglycerol (DMPG); phosphatidylcholines (PC) including egg yolk phosphatidylcholine and dimyristoylphosphatidylcholine (DMPC), phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM), and derivatives thereof.
[0183] Another group of lipid matrices for use in the present invention includes cationic lipids (monocationic or polycationic lipids), which typically consist of a lipophilic portion, such as a sterol or the same glycerol backbone, with two acyl chains, or two alkyl chains, or one acyl chain and one alkyl chain contributing to the hydrophobic region of the amphoteric molecule, forming a lipid with an overall net positive charge.
[0184] Preferably, the head group of the lipid is positively charged. Monocationic lipids may include, for example, 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxy-3-(trimethylaniline)propane (DOTAP), N-[-1-(2,3-ditetradecyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N-[1-(2,3-dioleyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), N-[1-(2,3-dioleyloxy)propyl];-N,N,N-trimethylammonium chloride (DOTMA);3;N-(N',N'-dimethylaminoethane)carbamoly]; cholesterol (DC-Chol), and I-dimethyl-dioctadecylammonium (DDAB).
[0185] Examples of polycationic lipids include those with spermine or spermidine attached to a lipophilic moiety similar to that of the monocationic lipids, including, but not limited to, N-[2-[[2,5-bis[3-aminopropyl)amino]-1-oxopentyl]amino]ethyl]N,N-dimethyl-2,3-bis(1-oxo-9-octadecenyl)oxy];-1-propanaminium (DOSPA), and ceramide carbamoyl spermine (CCS).
[0186] Cationic lipids can be used alone or in combination with cholesterol, neutral phospholipids, or other known lipid assembly components. Additionally, cationic lipids can form part of derivatized phospholipids, such as the neutral lipid dioleoylphosphatidylethanolamine (DOPE) derivatized with polylysine to form cationic lipopolymers.
[0187] The diameter of the liposomes used is preferably in the range of 50-200 nM, more preferably 20-100 nM. Extrusion, homogenization, or exposure to ultrasonic irradiation may be used to size the liposomes. Convenient homogenizers include a microfluidizer (Microfluidics of Boston, Boston, MA, USA) or a microfluidic micromixer (Precision NanoSystems, Vancouver, BC, Canada). A typical homogenization process involves recirculating liposomes through a standard emulsion homogenizer until a selected liposome size is observed. The size distribution can be monitored by conventional laser beam particle size discrimination. Extrusion of liposomes through a small-pore polycarbonate membrane or an asymmetric ceramic membrane is an effective method for reducing liposome size to a relatively well-defined size distribution. Typically, the suspension is cycled through the membrane one or more times until the desired liposome size distribution is achieved. The liposomes may be passed through successively smaller pore membranes to gradually reduce the size of the liposomes.
[0188] According to another embodiment, the particles are nanoparticles. Preferably, the nanoparticles have a diameter of less than 100 nm and can be spherical, non-spherical, or polymeric particles. In a preferred embodiment, the polymer used to prepare the nanoparticles is biocompatible and biodegradable, such as poly(DL-lactide-co-glycolide) polymer (PLGA). However, other polymers that may be used to prepare nanoparticles include, but are not limited to, PLA (polylactic acid) and its copolymers, polyanhydrides, polyalkyl-cyanoacrylates (such as polyisobutyl cyanoacrylate), polyethylene glycol, polyethylene oxide and their derivatives, chitosan, albumin, gelatin, etc.
[0189] The particles of the present invention may be modified (e.g., by PEGylation) to increase circulation half-life, decrease clearance, extend the scavenging window, or enable antibody binding. The PEG incorporated into the particles may be characterized by any of a variety of combinations of chemical composition and / or molecular weight, depending on the application and purpose.
[0190] It will be appreciated that once the antibody is bound to the particle (and its cargo is carried), it may be packaged into a container and made into a universal kit for in vivo delivery of pharmaceutical agents.
[0191] Drugs or therapeutic agents that may be loaded onto the particles include, but are not limited to, anti-cancer drugs (e.g., chemotherapy, radioisotopes, immunotherapy), antibiotics, enzymes, antioxidants, lipid absorption inhibitors, hormones, anti-inflammatory drugs, steroids, vasodilators, angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, smooth muscle cell proliferation and migration inhibitors, platelet aggregation inhibitors, anticoagulants, chemical mediator release inhibitors, endothelial cell proliferation promoters or inhibitors, aldose reductase inhibitors, glomerular mesangial cell proliferation inhibitors, lipoxygenase inhibitors, immunosuppressants, immunoenhancing agents, antivirals, Maillard reaction inhibitors, amyloidosis inhibitors, nitric oxide synthesis inhibitors, AGE (advanced glycation end products) inhibitors, radical scavengers, proteins, peptides; glycosaminoglycans and derivatives thereof; and oligosaccharides, polysaccharides, and derivatives thereof.
[0192] In another embodiment, the particles carry a diagnostic agent.
[0193] Exemplary diagnostic agents include in vivo diagnostic agents such as x-ray contrast agents, ultrasound diagnostic agents, nuclear medicine isotope-labeled agents, and nuclear magnetic resonance diagnostic agents.
[0194] The loading of the pharmaceutical agent by the particles can occur simultaneously with the assembly of the particles or after the assembly of the particles.
[0195] Therefore, in a preferred embodiment, for example, when the pharmaceutical agent is nucleic acid, such as DNA, RNA, siRNA, plasmid DNA, short hairpin RNA, small RNA (stRNA), microRNA (miRNA), RNA mimic or heterochromatic siRNA, the target nucleic acid agent has a charged backbone that prevents efficient encapsulation into lipid particles.Therefore, the target nucleic acid agent can be condensed with cationic polymer, such as PEI, polyamine spermidine and spermine, or cationic peptide, such as protamine and polylysine, before being encapsulated into lipid particles.In one embodiment, the pharmaceutical agent is not condensed with cationic polymer.
[0196] In another embodiment, the agent of interest is encapsulated in the lipid particles as follows: The immunoparticles are provided in a lyophilized state; The agent of interest is in an aqueous solution; The aqueous solution of the agent of interest is used to rehydrate the lyophilized lipid particles; The agent of interest is then encapsulated in the rehydrated lipid particles.
[0197] In one embodiment, multiple agents of interest may be delivered by the immunoparticles (e.g., lipid-based particles) of this aspect of the invention. For example, two or more agents may be delivered, where both (or all) of the agents are hydrophilic. In another example, two or more agents may be delivered, where both (or all) of the agents are hydrophobic.
[0198] In one embodiment, two cargo agents of interest may be delivered by an immunoparticle (e.g., a lipid-based particle). One of the cargo agents may be hydrophobic and the other may be hydrophilic. The hydrophobic agent may be added to the lipid particle during its formation. The hydrophobic agent associates with the lipid portion of the lipid particle. The hydrophilic agent is added to an aqueous solution to rehydrate the lyophilized lipid particle. In an exemplary embodiment of dual agent delivery, the condensed siRNA is encapsulated in a liposome, and the poorly water-soluble drug is associated with the lipid portion of the lipid particle. As used herein, "poorly soluble in aqueous solution" refers to a composition that is less than 10% soluble in water.
[0199] Any suitable lipid:pharmaceutical agent ratio that is effective is contemplated by the present invention. Preferred lipid:pharmaceutical agent molar ratios include about 2:1 to about 30:1, about 5:1 to about 100:1, about 10:1 to about 40:1, and about 15:1 to about 25:1.
[0200] According to certain embodiments, the fusion protein: siRNA weight ratio is about 1:20, 1:30, 1:36, or 1:50.
[0201] Preferred loading efficiencies of pharmaceutical agents are about 50%, about 60%, about 70% or more, in terms of the percent of encapsulated pharmaceutical agent. In one embodiment, the loading efficiency of hydrophilic drugs is in the range of 50-100%. Preferred loading efficiencies of pharmaceutical agents associated with the lipid portion of the lipid particle, e.g., pharmaceutical agents that are poorly soluble in aqueous solution, are about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, in terms of the percent of encapsulated pharmaceutical agent. In one embodiment, the loading efficiency of hydrophobic drugs in the lipid layer is in the range of 80-100%.
[0202] As used herein, "carry" refers to encapsulate or absorb.
[0203] As used herein, the term "encapsulated" refers to the distribution of a pharmaceutical agent in the interior of a particle. Preferably, the pharmaceutical agent is uniformly distributed. Uniform distribution of a pharmaceutical agent in a polymer particle is known as matrix encapsulation. However, due to the manufacturing process, it is also expected that a small amount of pharmaceutical agent may also be present on the outside of the particle and / or may be mixed with the polymer that makes up the shell of the particle.
[0204] As used herein, "absorbed" refers to the binding of a pharmaceutical agent to the outer surface of a particle.
[0205] The desired amount of drug loaded on the particles varies depending on the type of drug, but it is preferable to be able to load the drug on the particles with high loading efficiency.
[0206] When the lipidated secondary antibody is conjugated to the particle via a lipidated peptide moiety, the present invention further contemplates contacting the primary antibody with the immunoparticle.
[0207] According to certain embodiments, immunoconjugation between a primary antibody and a secondary antibody refers to an antibody (i.e., secondary antibody)-antigen (i.e., primary antibody)-based interaction. The antibody-antigen binding is a non-covalent, reversible interaction (specific binding typically in the range of 1 μM to 0.1 nM), which fully preserves the function of the primary antibody to bind to the epitope. According to certain embodiments, the immunoconjugation is performed ex-vivo.
[0208] The weight ratio of secondary antibody to primary antibody is typically 1:1, although other ratios such as 1:2, 2:1, 1:3, 3:1, etc. are contemplated.
[0209] Conditions for effecting immunoconjugation are well known in the art and require physiological conditions, avoiding high salt concentrations and extremes of pH, which can interfere with antigen-antibody binding by weakening electrostatic interactions and / or hydrogen bonds.
[0210] Methods for producing polyclonal and monoclonal antibodies (either the primary or secondary antibodies described herein) and fragments thereof are well known in the art (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
[0211] Antibody fragments according to some embodiments of the invention can be produced by proteolytic hydrolysis of the antibody or by expression of DNA encoding the fragment in E. coli or mammalian cells (e.g., Chinese hamster ovary cell culture or other protein expression systems). Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. For example, antibodies can be obtained by enzymatic cleavage with pepsin to produce a 5S fragment designated F(ab'). This fragment can be further cleaved using a thiol reducing agent, and optionally, a blocking group for the sulfhydryl groups resulting from cleavage of disulfide bonds, to produce a 3.5S monovalent Fab' fragment. Alternatively, enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly. These methods are described, for example, in U.S. Pat. Nos. 4,036,945 and 4,331,647 by Goldenberg and the references contained therein, which are incorporated herein by reference in their entireties. See also Porter, RR [Biochem. J. 73: 119-126 (1959)]. Other methods for cleaving antibodies, such as isolating heavy chains to form monovalent light heavy chain fragments, further cleaving the fragments, or other enzymatic, chemical, or genetic techniques may also be used so long as the fragments bind to the antigen recognized by the intact antibody.
[0212] An Fv fragment consists of a combination of a VH chain and a VL chain. The linkage may be non-covalent, as described by Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659-62 (19720)]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linking with chemicals such as glutaraldehyde. Preferably, the Fv fragment comprises a VH chain and a VL chain connected by a peptide linker. These single-chain antigen-binding proteins (sFv) are produced by constructing a structural gene containing DNA sequences encoding the VH and VL domains connected by an oligonucleotide. The structural gene is inserted into an expression vector and then transformed into a host cell such as E. coli. The recombinant host cell synthesizes a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing sFvs are described, for example, in [Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al. al., Bio / Technology 11:1271-77 (1993), and in U.S. Pat. No. 4,946,778, which are incorporated herein by reference in their entireties.
[0213] Another form of antibody fragment is a peptide encoding a single complementarity-determining region (CDR). A CDR peptide ("minimal recognition unit") can be obtained by constructing a gene encoding the CDR of the antibody of interest. Such a gene can be produced, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
[0214] Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab') or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from the non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibodies) in which residues forming the recipient's complementarity-determining regions (CDRs) are replaced by residues from the CDRs of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some examples, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are absent from the recipient antibody and from the imported CDR or framework sequences. In general, humanized antibodies comprise substantially all of at least one, and typically two, variable domains, with all or substantially all of the CDR regions corresponding to those of a non-human immunoglobulin and all or substantially all of the FR regions conforming to human immunoglobulin consensus sequences. The humanized antibody optimally also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Fc) [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
[0215] Methods for humanizing non-human antibodies are well known in the art. Generally, humanized antibodies have one or more amino acid residues introduced into them from a non-human source. These non-human amino acid residues are often referred to as imported residues and are typically taken from imported variable domains. Humanization can be performed essentially by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, following the method of Winter and coworkers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)]. Thus, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567) in which substantially all of the human variable regions are replaced with the corresponding sequences of a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
[0216] Human antibodies can also be produced using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)). The techniques of Cole et al. and Boerner et al. are also available for the production of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86-95). (1991)]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. After challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, and 5,661,016, as well as in the following scientific publications: Marks et al., Bio / Technology 10,: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).
[0217] The immunoparticles of the present invention are typically used for pharmaceutical purposes and are therefore typically non-immunogenic to the subject being treated.
[0218] The particles of the present invention may be administered to a subject by themselves or as part of a pharmaceutical composition to treat a disease. As used herein, the term "pharmaceutical composition" refers to a formulation of particles that encapsulates an active ingredient described herein together with other chemical components, such as physiologically suitable carriers and excipients.
[0219] According to certain embodiments, the pharmaceutical agent is a therapeutic agent, as described herein above.
[0220] The purpose of a pharmaceutical composition is to facilitate administration of an active ingredient to a subject.
[0221] As used herein, the term "active ingredient" refers to a pharmaceutical agent.
[0222] Hereinafter, the terms "physiologically acceptable carrier" and "pharmaceutically acceptable carrier", which may be used interchangeably, refer to a carrier or diluent that does not cause significant irritation to a subject and does not impair the biological activity and properties of the administered active ingredient. Adjuvants are included in these terms.
[0223] As used herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the active ingredient of the present invention. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, various types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols. The pharmaceutical composition may advantageously be in the form of a foam or gel.
[0224] Suitable routes of administration may include, for example, inhalation, oral, buccal, rectal, transmucosal, topical, transdermal, intradermal, nasal, intestinal and / or parenteral routes; intramuscular, subcutaneous and / or intraspinal injection routes; intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, and / or intraocular injection routes.
[0225] The pharmaceutical compositions may be manufactured by processes well known in the art, for example, by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
[0226] Thus, pharmaceutical compositions for use according to the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers, including excipients and adjuvants that facilitate processing of the active ingredient into a pharmaceutically usable preparation. The appropriate formulation will vary depending on the selected route of administration.
[0227] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.
[0228] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0229] For oral administration, pharmaceutical compositions can be easily formulated by combining the active ingredient with pharmaceutically acceptable carriers known in the art. Such carriers allow the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral ingestion by patients. Pharmaceutical preparations for oral administration can be prepared by using solid excipients, optionally milling the resulting mixture, adding appropriate excipients as needed, and then processing the granular mixture to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carbomethylcellulose; and / or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof such as sodium alginate.
[0230] Sugar-coated core is provided with suitable coating.For this purpose, can be used concentrated sugar solution, which optionally contains gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solution and suitable organic solvent or solvent mixture.For identifying or characterizing different combinations of dosage of active ingredient, dyes or pigments can be added to tablet or sugar-coated coating.
[0231] Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules may contain the active ingredient mixed with a filler such as lactose, a binder such as starch, a lubricant such as talc or magnesium stearate, and optionally, a stabilizer. In soft capsules, the active ingredient may be dissolved or suspended in a suitable liquid such as fatty oils, liquid paraffin, or liquid polyethylene glycol. Additionally, stabilizers may be added. All formulations for oral administration should be in a dosage appropriate for the selected route of administration.
[0232] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0233] For administration via the inhalation route, the active ingredient for use according to the present invention can be delivered in the form of an aerosol / spray mist from a pressurized pack or nebulizer using a suitable propellant, for example, a fluorochlorohydrocarbon such as dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane, etc.; carbon dioxide; or a volatile hydrocarbon such as butane, propane, isobutane, etc., or a mixture thereof. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges (e.g., gelatin) for use in a dispenser may be formulated containing a powder mix of the active ingredient and a suitable powder base such as lactose or starch.
[0234] The pharmaceutical composition may be formulated for parenteral administration, for example, by bolus injection or continuous infusion. The formulation for injection may be provided in unit dosage form (optionally with added preservatives), for example, in ampoules or multi-dose containers. The composition may be a suspension, solution, or emulsion in an oily or aqueous vehicle, and may contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.
[0235] Pharmaceutical compositions for parenteral administration may include aqueous solutions of water-soluble active ingredients. Furthermore, suspensions of the active ingredients may be prepared as appropriate oily or aqueous injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides, or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the active ingredients, allowing for the preparation of highly concentrated solutions.
[0236] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water-based solution, before use.
[0237] The pharmaceutical compositions may also be formulated in rectal compositions such as suppositories or retention enemas, using, eg, conventional suppository bases such as cocoa butter or other glycerides.
[0238] The pharmaceutical composition should contain the active ingredient in an amount effective to achieve treatment of the disease.
[0239] Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
[0240] For any preparation used in the method of the present invention, therapeutically effective amount or dosage can be estimated first from in vitro assay and cell culture assay.For example, particles containing lysosomal enzymes can be tested for in vitro activity in plasma or other plasma-mimicking environments.For example, dosage can be formulated in animal models to achieve desired tissue concentration or titer.This information can be used to more accurately determine the useful dosage in humans.
[0241] The toxicity and therapeutic effects of the active ingredients described herein can be determined by standard pharmaceutical methods in vitro, in cell cultures, or in experimental animals. Data obtained from these in vitro and cell culture assays and animal experiments can be used to formulate a range of dosages for use in humans. Dosages may vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration, and dosage can be chosen by the individual physician in consideration of the patient's condition (see, for example, Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. 1).
[0242] Dosage and administration intervals may be individually adjusted to achieve plasma or tissue levels of the active ingredient sufficient to achieve the desired therapeutic effect (minimum effective concentration, MEC). The MEC varies for each formulation but can be estimated from in vitro data. The dose required to achieve the MEC varies depending on individual characteristics and the route of administration. Detection assays can be used to measure plasma concentrations.
[0243] Depending on the severity and responsiveness of the condition to be treated, administration can be single or multiple and the duration of treatment can be from several days to several weeks, or until a cure or diminution of the disease state is achieved.
[0244] The amount of composition administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, and the judgment of the prescribing physician.
[0245] The compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA-approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also contain a notice on the container in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects the approval by the government of the composition or form of administration for humans or animals. Such notice may, for example, be the notice on the labeling approved by the U.S. Food and Drug Administration for prescription drugs or the notice on the approved package insert.
[0246] The immunoparticles of the present invention may be used to deliver pharmaceutical agents to a subject in need thereof. Both therapeutic and diagnostic applications are contemplated herein.
[0247] The subjects that can be treated by the methods described herein are typically mammalian subjects, for example, humans.
[0248] The present teachings can be used in a variety of clinical applications that would benefit from the implementation of such a simple and cost-effective platform.
[0249] It is anticipated that many related particles will be developed during the life of the patent resulting from this application, and the scope of the term immunoparticle is intended to include all such new technologies a priori.
[0250] As used herein, the term "about" refers to ±10%.
[0251] The terms "comprises," "comprising," "includes," "including," "having," and their conjugations mean "including but not limited to."
[0252] The term "consisting of" means "including and limited to."
[0253] The term "consisting essentially of" means that a composition, method, or structure may include additional ingredients, steps, and / or portions, but only if they do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.
[0254] As used herein, the singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
[0255] Throughout this application, various embodiments of the present invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present invention. Accordingly, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values within that range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values within that range, e.g., 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0256] Whenever a range of values is given herein, it is meant to include any cited number (decimal or integer) within the range given. The phrases "range / range between" a first and second indicated value and "range to / range to" a first indicated value "from" a second indicated value are used interchangeably herein and are meant to include the first and second indicated values and all decimals and integers therebetween.
[0257] As used herein, the term "method" refers to methods, means, techniques and procedures for accomplishing a given task, including but not limited to methods, means, techniques and procedures known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine, or readily developed from methods, means, techniques and procedures known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine.
[0258] As used herein, the term "treating" includes arresting, substantially inhibiting, slowing, or reversing the progression of a condition, or substantially ameliorating the clinical or cosmetic symptoms of a condition, or substantially preventing the appearance of clinical or cosmetic symptoms of a condition.
[0259] It is understood that certain features of the invention, which are for clarity described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are for brevity described in the context of a single embodiment, may also be provided separately or in any suitable subcombination, or as appropriate with any other described embodiment of the invention. Certain features described in the context of various embodiments are not considered essential features of those embodiments, unless the embodiment is inoperable without those elements.
[0260] The following examples are presented to more fully illustrate some embodiments of the present invention. However, they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art can readily devise numerous variations and modifications of the principles disclosed herein without departing from the scope of the invention. [Example]
[0261] Example 1 Inflammatory bowel disease (IBD) is a general category that includes multiple forms of inflammatory diseases and conditions affecting various parts of the gastrointestinal (GI) tract. Despite decades of research in both animals and humans, current treatments remain disappointing and do not provide a cure. Novel therapies, such as antibodies against TNF-α, have revolutionized IBD treatment, but not all patients respond to these therapies, and initial responders may become unresponsive to treatment over time due to the development of an antibody-drug antibody (ADA) response (Dammes et al. Nature Nanotech. 16:1030-1038, 2021).
[0262] To establish a cure for IBD, blocking cytokines or receptors with antibodies alone is insufficient and often only provides temporary relief of symptoms. Altering the expression of specific genes in inflammatory leukocytes, thereby altering their behavior, may restore balance to the intestinal immune response in the long term. Recently, specific delivery of siRNA to an activation-sensitive receptor expressed on gut-homing leukocytes in a mouse model of colitis was demonstrated. This was achieved by using a targeting moiety that recognizes only a specific protein conformation, namely the high-affinity (HA) conformation of integrin α4β7. Gut-homing leukocytes utilize this crucial gut-homing receptor to adhere to the intestinal endothelium.
[0263] Integrin function depends on its conformational state (Yu et al., J. Cell Bio. 196(1): 131-146, 2012). Upon stimulation, integrins undergo conformational changes that dramatically increase their affinity for their ligands. Integrin α4β7 can bind both vascular endothelial cell adhesion molecule 1 (VCAM-1) for homing to peripheral tissues and mucosal vascular address of cell adhesion molecule 1 (MAdCAM-1) for homing to intestinal tissues, but not simultaneously. Whether integrin α4β7 has affinity for VCAM-1 or MAdCAM-1 depends on the specific stimulus, subsequent signaling, and the type of conformational change. Because only leukocytes that actively home to intestinal tissues possess the α4β7 integrin in the HA conformation, it would be desirable to target integrin α4β7-expressing cells in a conformation-dependent manner, in contrast to commercially available monoclonal antibodies (anti-α4β7 integrin antibodies) such as natalizumab and vedolizumab, which are conformation-insensitive.
[0264] To this end, a recombinant fusion protein containing two domains of the intestinal endothelial ligand MAdCAM-1 was generated. MAdCAM-1 was used to design the targeting moiety of LNPs because of its high affinity for integrin α4β7 in its HA conformation. MAdCAM-1 is a multidomain protein that is naturally involved in both the initial anchoring and firm adhesion of leukocytes to the intestinal endothelium. To maximize specificity, only the integrin-binding domains D1 and D2 were used. To protect the integrin-binding domain while anchoring the protein to the LNPs, a monoclonal secondary antibody against rat IgG2a (referred to herein as RG7) was used as a linker between the LNPs and the MAdCAM-D1D2 protein. The RG7 linker was chemically conjugated to the LNPs using maleimide / thiol chemistry, and the MAdCAM-D1D2 protein was recombinantly fused to the Fc region of rat IgG2a. In this way, the RG7 antibody binds to the MACAM-1 protein through its affinity for the rat IgG2a domain, while domains D1 and D2 are free to bind to the α4β7 integrin. This conjugation strategy was compared with two other conjugations: direct conjugation of the D1D2 recombinant protein to DSPE-PEG-maleimide lipids using reduced cysteine residues, or conjugation using ASSET.
[0265] Chemical conjugation of RG7 IgG to LNPs was effective in delivering siRNA to leukocytes, whereas delivery via RG7-ASSET was less effective. To overcome the challenge of successfully delivering siRNA to leukocytes using LNPs incorporating lipidated RG7 scFv and conjugated with D1D2-Fc, a LAND was created based on the construct shown in Figure 1B (primary IgG targeting by secondary scFv LAND), in which the primary IgG targeting moiety was replaced with MAdCAM-D1D2 protein recombinantly fused to the Fc region of rat IgG2a. In the original ASSET design, the scFv was placed immediately after the NlpA lipid sequence (lipidated peptide portion—SEQ ID NO: 17) and the first 11 amino acid linker (Linker #1; SEQ ID NO: 18), and before the second 11 amino acid linker (Linker #2; SEQ ID NO: 21) followed by the functional protein (mCherry—SEQ ID NO: 22). In LAND, the order of the scFv and mCherry was swapped, creating a new linker containing 13 amino acids (Linker 3: ASGGSGGGKASGG, SEQ ID NO: 1).
[0266] Molecular cloning: The original plasmid for expressing the original ASSET-RG7 protein in E. coli was constructed as described by Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). All other plasmids described herein were constructed in a similar manner using PCR amplification and Gibson assembly (Gibson et al., Nat. Methods 6(5): 343-345, 2009). For verification, the nucleotide sequences of all plasmids (before use in protein production) were determined using an ABI 3500xl Genetic analyzer (Applied Biosystems, USA) according to the supplier's recommendations.
[0267] The coding sequences for all components were cloned into a pET30a plasmid backbone with kanamycin resistance. Expression was performed in the New England Biolabs E. coli strain Lemo21(DE3). Lemo21(DE3) is an E. coli strain suitable for the expression of difficult recombinant proteins under the control of a tunable T7 promoter. The sequence of the RG7-LAND open reading frame is set forth in SEQ ID NO:2 (DNA sequence) and SEQ ID NO:3 (amino acid sequence).
[0268] Expression and purification of lipidated RG7-LAND protein was performed as described by Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018), which is described in detail below.
[0269] Materials for producing lipidated scFv micelles Buffer A1 (40 ml for each 500 ml culture): 20 mM Tris, pH 8.0 (50-fold dilution of 1 M stock solution), 10 mM EDTA (50-fold dilution of 0.5 M stock solution), 4 mg lysozyme (100 μg / ml), protease inhibitor cocktail (cOmplete, Roche). Buffer A2 (20 ml for each insoluble pellet from a 500 ml volume of culture): 20 mM Tris (pH 8.0) (50-fold dilution of a 1 M stock solution), 1% Triton X-100 surfactant (25% stock solution), and 25% 150 mM NaCl (5 M stock solution). Buffer A3: 150 mM NaCl, 20 mM Tris (pH 8.0), 1.4% octyl glucoside surfactant (OG, manufactured by Sigma (now Roche), Israel).
[0270] Production of lipidated scFv Day 1: Lemo21 / pET30a-RA-RG7 cells were grown in 2 L shake flasks containing 500 ml of LB and 50 μg / ml kanamycin at 37°C with 240 RPM shaking. When cells reached an OD600 of 0.9, they were induced with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) overnight (ON) at 18°C.
[0271] Day 2: Induced cells were harvested by centrifugation at 4,000 RPM for 20 minutes in an SLC3000 Sorvall rotor at 4°C. The pellet was frozen and stored at -80°C. After 2+ hours at -80°C, the cell pellet was thawed on ice and suspended in 40 ml of Buffer A1 using a cell spreader. After 30 minutes of intermittent shaking at room temperature, cells were disrupted by homogenization for 20 seconds with the large probe of a Tissuemizer (a stainless steel blade electric tissue homogenizer). The cells were then sonicated on ice using the large sonicator probe for three 30-second cycles with at least 1 minute between cycles. To remove soluble proteins in the lysate, the lysate was centrifuged at 16,000 RPM for 30 minutes at 4°C in a Sorvall SS34 rotor using a Sorvall SS34 tube. The pellet (containing the lysed E. coli cell membrane fraction and other insoluble proteins) was homogenized in 20 ml of Buffer A2 by grinding with the small probe of a Tissuemizer at maximum speed for 1 minute. To completely extract the lipidated scFv from the cell membrane, the extract was then sonicated on ice for 1 minute at 50% power (approximately 5 on the power scale) using the small probe of a sonicator. The extract was further incubated at room temperature (RT), rotated for 30 minutes, and then centrifuged at 16,000 RPM for 30 minutes at 4°C in a Sorvall SS34 tube. The supernatant was designated the Triton fraction (TF). The pellet, containing other insoluble proteins (e.g., inclusion bodies), was discarded. The Triton fraction was adjusted to 5 mM imidazole (ID). A 1 ml His-Trap column (GE Healthcare, Life Sciences) was equilibrated with 10 column volumes (CV) of Buffer A1 (column loading buffer) adjusted to 5 mM ID, and TF was loaded at 0.5 ml / min. The column was washed and eluted at 1 ml / min. The unbound fraction (Ni-FT, shown at the bottom of Figure 2) contained approximately the same amount of total protein but no LAND protein. The column was washed with 10 CV of Buffer A2 containing 5 mM ID. The column was washed with 10 CV of Buffer A3 containing 5 mM ID.The latter wash was performed to replace the Triton X-100 detergent with OG detergent. The column was washed with 10 CV of Buffer A3 containing 20 mM ID. The column was eluted with 2 x 5 ml of Buffer A3 containing 250 mM ID.
[0272] The combined 10 ml of eluate was concentrated to approximately 2.5 ml using a Centricon 10000 (Centrifugal Filter Unit, Merck, Israel) by spinning at 3,000 RPM in a swing-out rotor at 18°C. To desalt (buffer exchange into ID-free Buffer A3), a 10 ml Zeba desalting column (Thermo Fisher Scientific, USA) was equilibrated with Buffer A3 (x3). The concentrated LAND protein was then loaded and collected by centrifugation. All centrifugations were performed at 1,000 × g for 2 min at 4°C. Protein concentration was determined using a protein assay kit (e.g., Bradford). Nanodrop measurements at 280 nm proved to be relatively unreliable at this step. Protein concentration was adjusted to 0.5 mg / ml with Buffer A3.
[0273] Cholesterol (Avanti Polar lipids, USA) was added to 250 mM (from a 38.7 mM EtOH stock solution), and the OG micelles were further rotated at 100 RPM for 30 minutes at room temperature. 100 μl aliquots were made and stored at -80°C. The resulting final product was lipoproteins associated with OG surfactant micelles stabilized by cholesterol. When these micelles were mixed with LNPs, the micelles incorporated into the LNPs and became permanent components of the LNPs. An aliquot from a typical purification analyzed by SDS / PAGE is shown in Figure 2.
[0274] Preparation of LNPs LNP preparation was essentially as described by Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). Two ionizable lipids were used: Dlin-MC3-DMA (MC3) was synthesized according to Cohen et al. (ACS Nano 9(2): 1581-1591, 2015), and EA-PIP (lipid 10) was synthesized according to Ramishetti et al. (Adv Mater 32(12): e1906128, 2020). All other lipids were obtained from Avanti Polar lipids. Briefly, one volume of lipid mixture (ionizable lipid, DSPC, cholesterol, DMG-PEG in a 50:10.5:38.5:1.4 molar ratio) in ethanol and three volumes of siRNA in acetate buffer (1:16 w / w siRNA to lipid) were injected into a microfluidic mixer, Nanoassemblyr (Precision Nanosystems, Vancouver, BC) at a total flow rate of 12 ml / min.
[0275] The resulting mixture was dialyzed against phosphate-buffered saline (PBS) (pH 7.4) for 16 hours to remove ethanol and residual unincorporated lipids. Cy5-labeled particles were prepared using scrambled control siRNA (siNC) and Cy5-labeled siNC at a 1:1 ratio. The ASSET technology was utilized to prepare targeted LNPs or isotype control LNPs. Briefly, ASSET or LAND OG micelles were incubated with LNPs at 4°C for 48 hours to allow their incorporation into LNPs (1:36, ASSET or LAND protein:siRNA weight ratio). Typically, 40 ng of purified lipidated scFv-containing OG micelles were mixed with 1 μl of LNP. The incorporation of lipidated scFv into LNPs was measured by mCherry fluorescence and ELISA.
[0276] To evaluate the cell targeting potential of ASSET compared with LAND, we performed a series of experiments. First, we compared the antigen binding of RG7-ASSET and RG7-LAND to rat IgG2a by ELISA and FACS. Second, we compared the targeting ability of RG7-ASSET and RG7-LAND to TK-1 cells (which express the α4β7 integrin on their surface) using D1D2-Fc.
[0277] Materials for flow cytometry experiments Cell line: TK-1 (or other cells described in the Examples). Targeting moiety: D1D2-Fc (MAdCAM fused to rat IgG2a Fc as described by Dammes et al. (Nature Nanotech. 16:1030-1038, 2021)). Isotype control: rat IgG2a that does not bind to TK1 cells. LNP: MC3 lipid (+ Cy5 fluorescently labeled siRNA).
[0278] FACS samples: 1. Unstained cells (US in all flow cytometry plots) 2. [TK-1 + isotype control] + LNP-RG7 ASSET 3.[TK-1+D1D2-Fc]+LNP-RG7 ASSET 4. [TK-1 + isotype control] + LNP-RG7 LAND 5. [TK-1+D1D2-Fc]+LNP-RG7 LAND Flow cytometry protocol:
[0279] Day 0: ASSET and LAND proteins were added to MC3 / Cy5 LNPs at 40 ng / ml. Proteins tested: A.RG7 ASSET B. RG7 LAND (or other lipidated scFvs described in the Examples) The tubes were vortexed briefly and incubated at 4°C for 48 hours.
[0280] Day 2: TK-1 cells were activated according to Yang et al. (Scand J Immunol 42(2): 235-247, 1995). Briefly, activation involved the treatment of cells with Mn 2+ Exposure to ions is required, which converts the α4β7 integrin to the HA conformation (compatible with MAdCAM-1 binding). Flow cytometry experiments were performed using a CytoFLEX (Beckman Coulter, USA).
[0281] Cell preparation and analysis protocol for flow cytometry: Cells were washed with PBS (0.5-1 million cells / sample) and collected by spinning at 300 x g for 5 minutes. Cells were then washed with 100 μl / sample of resuspension buffer (HBSS (w / o) containing 10 mM HEPES buffer, 2 mM CaCl2, and 2 mM MgCl2). Cells were then incubated with preincubation buffer (HBSS (w / o) containing 10 mM HEPES buffer and 2 mM EDTA). Cells were incubated at RT for 30 minutes with gentle rotation (100 μl / sample). ASSET-LNP or LAND-LNP were added to the 100 μl / sample of ... The cells were incubated with a type control at 1 μg / sample for 30 minutes at room temperature. The cells were washed with PBS to remove EDTA. The cells were then incubated with 100 μl / sample of activation buffer (complete medium containing 2 mM CaCl2 and 2 mM MnCl2) to switch the cell surface α4β7 integrin to the active conformation for MAdCAM binding. ASSET-LNP or LAND-LNP was immediately added to the cells and incubated on ice for 20 minutes. The cells were washed with PBS and analyzed by flow cytometry (Cy5 channel) using a CytoFLEX (Beckman Coulter, USA).
[0282] Method using anti-EGFR antibody These experiments demonstrated that the targeted cells were OVCAR8 (EGFR +The primary antibody was a commercially available rat IgG2a anti-human EGFR (anti-hEGFR, clone 30-F11, Bio-Rad).
[0283] result: We first performed a direct comparison of purified OG micelles of RG7-ASSET and RG7-LAND in binding to Fib504 rat IgG2a. As shown in Figure 3A, RG7-LAND and RG7-ASSET bound with similar (but not identical) affinities, with RG7-LAND having a higher apparent affinity (IC50) of 18 nM, while RG7-ASSET had an IC50 of 36 nM. Direct comparison of purified OG micelles of RG7-ASSET and RG7-LAND in binding to anti-human EGFR rat IgG2a yielded similar results (Figure 4A). RG7 LAND binding to anti-human EGFR rat IgG2a exhibited an IC50 of approximately 100 nM. 50 RG7-ASSET binding exhibits a higher apparent affinity (IC) of approximately 80 nM compared to RG7-ASSET binding. 50 ) was shown.
[0284] Next, we prepared MC3 nanoparticles incorporating either the RG7-LAND or RG7-ASSET lipidated scFv and compared their ability to direct Fib504 rat IgG2a-mediated cell binding. Flow cytometry experiments were performed as described above. The flow cytometry results are shown in Figure 3B. As shown, the RG7-LAND configuration improved binding to TK-1 cells in the presence of a Fib504-targeting primary antibody compared to the RG7-ASSET configuration.
[0285] Next, a similar experiment was performed using anti-human EGFR rat IgG2a as the primary antibody. +OVCAR8 cells were used as target cells. MC3 nanoparticles incorporating RG7-LAND or RG7-ASSET proteins were prepared and evaluated for their ability to direct rat IgG2a-mediated binding to OVCAR8 cells. Flow cytometry results are shown in Figure 4B. As shown, the RG7-LAND configuration improved cell binding in the presence of an anti-human EGFR-targeting primary antibody compared to the RG7-ASSET configuration.
[0286] Further comparison of the ability to direct cell binding via MAdCAM-1 D1-D2-Fc was performed by flow cytometry. As shown in Figure 5, D1D2-Fc incorporated into LNPs via RG7-LAND enabled binding to activated TK-1 cells, whereas incorporation via RG7-ASSET did not.
[0287] Example 2 "LAND with primary scFv targeting" based on the anti-EGFR antibody Erbitux As shown in Figure 1C (LAND with primary scFv targeting), we generated lipidated scFv derived from a cell-binding antibody. Erbitux (cetuximab), a therapeutic chimeric monoclonal antibody that binds to the human epidermal growth receptor (EGFR), was first used. An expression vector was constructed by replacing the RG7 scFv sequence in the LAND (Figure 1B) plasmid with the coding sequence of the Erbitux scFv. The sequence of the Erbitux-LAND open reading frame is set forth in SEQ ID NO: 4 (DNA sequence) and SEQ ID NO: 5 (amino acid sequence). Notably, in the "LAND with primary scFv targeting" construct, "Linker #3" (shown in Figure 1B) was extended from 13 amino acid residues to 28 amino acid residues (Linker 4: ASGGSGGGKASGGGGGGSGGGGSGGGGS, SEQ ID NO: 6). Example 2 is a representative example of Figure 1C.
[0288] Erbitux-LAND protein was produced, purified, and functionally tested by flow cytometry as described in the general protocol above. SEQ ID NO: 4: DNA sequence encoding Erbitux-LAND (anti-human EGFR) (LAND with primary scFv targeting) SEQ ID NO: 5: Amino acid sequence of Erbitux-LAND (anti-human EGFR) (LAND with primary scFv targeting)
[0289] Methods: Flow cytometry experiments were performed essentially as described in Example 1, except that OVCAR8 cells (EGFR-positive ovarian cancer cell line) were used. 2+ Cells were not activated with IL-1 or IL-2. Instead, cells were incubated with LNP or OG micelles in complete medium (containing 10% FBS). Binding of Erbitux-LAND OG micelles to cells was monitored by measuring mCherry fluorescence. Binding of LAND-incorporated LNPs was monitored by measuring Cy5 fluorescence of labeled siRNA encapsulated in the LNPs.
[0290] result: As shown in Figure 6, LAND ("LAND with primary scFv targeting") protein micelles and LNPs prepared from two different lipids (EA-PIP and MC3) bound to OVCAR8 cells. These results suggest that the lipidated Erbitux scFv was functional and effective in cell targeting. Furthermore, the specificity of binding of Erbitux-targeted LNPs was further verified by competition using Erbitux mAb as a competitor in flow cytometry experiments. Competition for binding of Erbitux-LAND-targeted LNPs to OVCAR8 cells was demonstrated. As shown in Figure 7, the binding signal of Erbitux-LAND-targeted LNPs to OVCAR8 cells was inhibited (shifted to the left) in the presence of Erbitux mAb compared to the signal obtained in the presence of Avastin, an anti-VEGF mAb that does not bind to these cells, which served as an isotype control.
[0291] To further evaluate the potential therapeutic efficacy of Erbitux-LAND (NlpA-Erb = Erbitux "LAND with primary scFv targeting") in killing tumor cells compared with Erbitux-ASSET (Erbitux ASSET with primary IgG targeting), we performed cell viability assays comparing different EGFR-targeting LNPs and isotype control LNPs. LNPs contained siRNA PLK1 (PLK1 is a kinase required for mitosis) or negative control siRNA. Inhibition of PLK1 function leads to G2-M cell cycle arrest and cell death (Rosenblum et al., Sci. Adv. 6: eabc9450, 2020). The efficacy of LAND was compared to ASSET under conditions that minimize nonspecific internalization of LNPs (4°C) and under standard conditions (37°C). OVCAR8 cells were treated in vitro with EA-PIP LNPs at 2 μg / ml LNPs (to minimize nonspecific LNP internalization) for 1 h at 4°C, non-internalized LNPs were removed by washing, replenished with fresh medium, and cultured for 72 h before assessing cell viability using the XTT assay.
[0292] The results are shown in Figure 8. In Figure 8A, treatment of OVCAR8 cells with LNP for 1 hour at 4°C reduces nonspecific uptake of LNP, primarily reflecting antibody-mediated internalization of LNP. Under these conditions, LNPs targeted with Erbitux-LAND and encapsulating siPLK1 were more effective than LNPs targeted with RG7-LAND as a negative control. More importantly, LNPs targeted with Erbitux-LAND were statistically more effective than LNPs targeted with RG7-LAND combined with an anti-EGFR primary antibody (ASSET primary IgG targeting). This demonstrates that the Erbitux-LAND "LAND with primary scFv targeting" approach promotes antibody-mediated LNP internalization more efficiently than the earlier ASSET, which incorporated a primary IgG targeting mAb. This result was most unexpected, as intact IgG molecules are known to have higher avidity than their corresponding scFv fragments (or, as in this case, scFvs derived from IgGs with similar affinity and specificity). As shown in Figure 8B, statistically superior efficacy of Erbitux-LAND(NlpA-Erb) compared to Erbitux-ASSET was also demonstrated under standard conditions (37°C). Surprisingly, under both conditions minimizing nonspecific LNP internalization (4°C, Figure 8A) and standard conditions (37°C, Figure 8B), LAND-targeted LNP(NlpA-Erb) demonstrated statistically significant improved efficacy compared to ASSET-targeted LNP(ASSET-EGFR) (Figure 8C). * p<0.05; ** p<0.01; *** p<0.005; **** p<0.001).
[0293] The statistically superior efficacy of primary scFv LANDs with primary scFv targeting compared to conventional ASSET compositions (see Figure 1G) is surprising because the intact IgG molecules with two antigen-binding sites used in ASSET are known to have higher avidity than the scFv fragments used in LANDs with primary scFv targeting.
[0294] To study the potential of Erbitux-LAND to treat cancer models in vivo, we used an OVCAR8 xenograft model in nude mice. Xenografts consisted of 3 x 10 mCherry-expressing cells suspended in 200 μl of PBS. 6 OVCAR8 cells were induced by intraperitoneal injection into 8-10 week-old female athymic nude mice on day 0.
[0295] On day 14, the mice were imaged using the In Vivo Imaging System IVIS-Lumina III (Perkin Elmer, USA) and divided into groups so that the tumor burden based on mCherry signal was evenly distributed among the groups.
[0296] For cellular uptake studies, EA-PIP LNPs encapsulating Cy5-labeled siNCs (negative control, siRNA that does not silence any genes in these cells) were injected intraperitoneally at 0.75 mg / kg in a total volume of 200 μl per mouse. Mice received a single dose on day 18, and tumors were harvested 4 hours after injection and analyzed for LNP uptake by flow cytometry. The gating strategy and cellular uptake ratios are shown in Figure 9.
[0297] Flow cytometry data were analyzed to identify Cy5-positive mCherry + The ratio of cells (tumor cells that have incorporated LNPs) and Cy5-positive CD45 +The ratio of tumor cells (mouse leukocytes) that had taken up LNPs was determined. As shown in Figure 9, no statistically significant differences were observed between any of the groups. However, a trend toward selective uptake by tumor cells was observed in the Erbitux-LAND (labeled NlpA-Erb in Figure 9) group compared to its control (NlpA-RG7) and ASSET-EGFR groups.
[0298] The ability of different EGFR-targeting LNPs to induce gene silencing in tumors in vivo was evaluated. LNPs encapsulating siPLK1 or control siRNA were injected intraperitoneally at 0.75 mg / kg in a total volume of 200 μl per mouse. Mice received a single dose on day 16. The extent of PLK1 silencing in tumors was determined by RT-PCR. Tumors were harvested on day 18 for RNA extraction.
[0299] As shown in Figure 10, the "early ASSET" approach demonstrated improved selectivity in tumor uptake compared to the isotype control in this model. Tumors from mice treated with Erbitux-LAND-targeted siPLK1 LNPs (labeled NlpA-Erb in Figure 10) showed lower PLK1 mRNA levels compared to the control NlpA-RG7. Such selectivity was not observed in mice treated with LNPs targeted with the RG7 ASSET protein combined with rat IgG2a anti-human EGFR or isotype control. Consistent with the in vitro results shown in Figure 8, the in vivo data in Figure 10 were also surprising, as intact IgG molecules are known to have higher avidity than monovalent scFv fragments. Only the Erbitux-LAND construct, but not the ASSET-EGFR construct, demonstrated statistically significant efficacy compared to their controls.
[0300] Taken together, these experiments demonstrate that LANDs with primary scFv antigen targeting have statistically superior efficacy compared to earlier ASSET LNPs utilizing lipidated secondary scFvs and primary IgG antigen targeting. The superior efficacy, combined with the simpler LAND architecture, makes LNP targeting with lipidated primary scFvs an attractive approach compared to ASSET, which requires both a primary IgG and a combined lipidated scFv (secondary). Importantly, the superior efficacy of LANDs with primary scFv targeting is surprising, since intact IgG molecules are known to have higher avidity than monovalent scFv fragments (or, as in this case, IgG-derived scFvs with similar affinity and specificity) used in LANDs with primary scFv targeting. The ability to obtain superior or equivalent efficacy using primary scFv targeting (LAND) (compared to secondary scFv targeting (ASSET)) is important because secondary scFv targeting requires the production and conjugation of an additional targeting IgG antibody, which substantially adds to the complexity and cost of manufacturing the final product.
[0301] Example 3 "LAND with primary scFv targeting" based on the anti-CD38 antibody THB-7 To further evaluate the general applicability of LAND with primary scFv targeting, we tested a LAND scFv primary targeting construct based on the anti-CD38 antibody THB-7. This is another example corresponding to composition type "C" shown in Figure 1C, and contains a functional protein and a "primary" scFv sequence with specificity for an antigen expressed on the cell type targeted for therapy. CD38 is expressed on the surface of immature hematopoietic cells, including immature B cells. Its expression is tightly regulated during B cell development. CD38 is expressed on myeloid progenitor cells but not on mature B cells. CD38 is also overexpressed in many B cell neoplasms, including mantle cell lymphoma (MCL) and multiple myeloma (MM) cells. CD38 has been shown to be a suitable target for antibody-mediated delivery of therapeutic siRNA to MCL. siRNA-LNPs coated with anti-CD38 monoclonal antibody (anti-CD38 mAb THB-7) showed specific MCL binding in vitro (MCL cell lines and primary MCL lymphoma) and in vivo (mice xenografted with human MCL cell lines) (Weinstein et al., PNAS 113(1): E16-22, 2016). Here, THB-7 mAb was chemically conjugated to MC3 LNPs.
[0302] A THB-7-based lipidated scFv (THB-7-LAND), a "LAND with primary scFv targeting," was prepared equivalently to Erbitux-LAND "LAND with primary scFv targeting" based on Figure 1C. The sequence of the open reading frame of THB-7 LAND is set forth in SEQ ID NO: 7 (DNA sequence) and SEQ ID NO: 8 (amino acid sequence). The lipidated THB-7 scFv was incorporated into EA-PIP LNPs and analyzed by flow cytometry for CD38 activity. + Binding to Z138 (MCL) cells and CAG (MM) cells was assessed. SEQ ID NO: 7: DNA sequence encoding THB-7-LAND (anti-CD38) (LAND with primary scFv targeting) SEQ ID NO: 8: Amino acid sequence of THB-7-LAND (anti-CD38) (LAND with primary scFv targeting)
[0303] Methods: Flow cytometry experiments were performed as follows. Materials for flow cytometry experiments Cell lines: CAG and Z138 Targeting moiety: THB-7 LAND Isotype control: RG7 LAND LNP: EA-PIP lipid (+ Cy5 fluorescently labeled siRNA)
[0304] FACS samples: 1. Unstained (US); 2. LNP containing CAG / Z138+RG7-LAND; 3. LNP containing CAG / Z138+THB-7-LAND; 4. CAG / Z138+RG7-LAND OG micelles (+anti-His-PE antibody for detection of LAND protein contained in OG micelles); 5.CAG / Z138+THB-7-LAND OG micelles (+anti-His-PE antibody).
[0305] Day 0: RG7-LAND and THB-7-LAND proteins were added to EA-PIP / Cy5 LNP at 40 ng / ml (for Z138 cells) and 60 ng / ml (for CAG cells). The tubes were vortexed briefly and incubated at 4°C for 48 hours. Day 2: Flow cytometry experiments were performed using CytoFLEX (Beckman Coulter, USA).
[0306] FACS protocol: Cells were washed with PBS (0.5-1 million cells / sample) and spun at 300 x g for 5 minutes. Cells were then incubated with complete medium containing one of RG7-LAND-LNP, THB-7-LAND-LNP, or LAND micelles for 20 minutes on ice. Cells were washed with PBS. One microgram of anti-His-PE antibody diluted in FACS buffer (1% BSA + PBS) was added to the LAND micelles-incubated cells and incubated on ice for 30 minutes. Cells were washed with PBS and analyzed by flow cytometry (reading in the Cy5 channel).
[0307] Results: As shown in Figure 11, similar to Erbitux-LAND, protein micelles incorporating THB-7-LAND and EA-PIP LNPs (labeled ASSET-THB7 in Figures 11A and 11C) bound to Z138 (MCL) and CAG (MM) cells, whereas control RG7 OG micelles or LNPs (labeled ASSET-RG7 in Figures 11A and 11C) did not. These results demonstrate the function and efficacy of lipidated THB-7 scFv in targeting hematopoietic cell subtypes, particularly malignant B cells.
[0308] Example 4 Example 4 evaluates additional LAND constructs (wherein the linker does not encode another functional protein, e.g., a detectable protein) and their potential therapeutic uses. Example 4 is represented by Figures "1D" and "1E."
[0309] These LAND expression vectors are constructed by replacing the mCherry coding sequence of the pET30a RG7 expression plasmid with the coding sequence of a 45 amino acid linker, as shown schematically in Figures 1D and 1E. The 69 amino acid RG7-LAND "long linker" sequence spans between the lipidation peptide and the scFv (linker #5 in Figures 1D and 1E); (protein sequence SEQ ID NO: 10, DNA sequence SEQ ID NO: 9).
[0310] An example of a construct shown in Figure 1E containing a long linker with scFv specificity for the EGFR antigen recognized by Erbitux is as follows: SEQ ID NO: 15 is a DNA sequence encoding an exemplary Erbitux-LAND "long linker" (anti-human EGFR). SEQ ID NO: 16 is the amino acid sequence of an exemplary Erbitux-LAND "long linker" (anti-human EGFR).
[0311] Another example of a construct containing a long linker with scFv specificity for the CD38 antigen recognized by THB-7 shown in Figure IE is shown below. SEQ ID NO: 17. DNA sequence encoding THB-7-LAND "long linker" (anti-CD38). SEQ ID NO: 18. Amino acid sequence of THB-7-LAND "long linker" (anti-CD38).
[0312] In a representative experiment, RG7-LAND "long linker" protein was expressed in E. coli and purified by His-Trap Ni-NTA chromatography, as described above for other LAND proteins. Purified RG7-LAND and RG7-LAND "long linker" in OG micelles were assessed for binding to Fib504 (a rat IgG2a anti-human β7 integrin conjugated by RG7 scFv) by ELISA. ELISA was performed as follows: 96-well ELISA plates (Nunc, Sweden) were coated overnight at 4°C with 5 μg / ml of antigen (RG7-conjugated Fib504 rat IgG2a) diluted in PBS. After washing once with PBS containing 0.05% Tween 20 (PBST), the plates were blocked with 3% skim milk in PBS for 1 h at 37°C. After another wash with PBST, a high initial concentration (50 nM) of purified LAND protein in OG micelles was applied to the plate in 3-fold serial dilutions. The plate was incubated at RT for 1 h. Next, the plate was washed three times with PBST, and the appropriate HRP-conjugated secondary Ab (HRP-conjugated anti-His tag antibody) diluted 1:5000 in PBST was added and incubated at RT for 1 h. After washing three times with PBST, ELISA was performed and developed with TMB peroxidase substrate solution. Color development was stopped by adding 1 M H2SO4, and absorbance was measured at 450 nm using an EMax® Plus microplate reader (Molecular Devices, USA).
[0313] The results are shown in Figure 12. As shown in the figure, the RG7-LAND "long linker" (IC of 4 nM) 50 ) is RG7-LAND (8nM IC 50 ), suggesting that the design of a longer linker was effective for the function of the LAND protein in antigen binding.
[0314] Next, EA-PIP LNPs were prepared using RG7-LAND or the RG7-LAND "long linker." Binding to TK-1 cells (expressing β7 integrin) in the presence of Fib504 (anti-β7 integrin) rat IgG2 or an isotype control was assessed by flow cytometry. Flow cytometry was performed as described in Example 1 above, with the following differences: Cells were incubated with Mn 2+ Instead, they were incubated with LNP or OG micelles in complete medium (containing 10% FBS). The results are shown in Figure 13. As shown, RG7-LAND "long linker" (labeled "LL FIB" in Figure 13) bound better than RG7-LAND (labeled "WT FIB" in Figure 13), further suggesting that the long linker design is effective for the function of LAND with "long linker" proteins in antigen binding.
[0315] Overall, LNPs prepared with the RG7-LAND "long linker" bound better to cells than LNPs prepared with the original RG7-LAND (containing mCherry). Therefore, the design of the long linker was effective in improving the function of the LAND protein in antigen binding.
[0316] Example 5 To demonstrate the potential of primary scFv targeting of LAND for gene editing applications, a cell viability experiment similar to that described in Example 2 was performed comparing tumor-targeted primary scFv LNPs with isotype control LNPs. Tumor cells expressing one of the primary scFVs listed in Table 1 were used for targeting, but instead of carrying PLK1 siRNA and a control, these LNPs delivered mRNA encoding the CRISPR base editor BE3 with a guide RNA directed to the PLK1 region to convert CAA, CAG, CGA, and TGG codons to stop codons when the targeted base was within the appropriate distance (13–17 bp) from the protospacer adjacent motif (PAM). The following guide RNA, genomic coordinates, and targeting codons for PLK1 were utilized: The lowercase base in the PAM:NGG column indicates the targeted base for editing.
[0317] [Table 8]
[0318] Control groups included LNPs without guide RNA, LNPs with an irrelevant guide RNA, uncoated LNPs, or LNPs with a lipidated isotype control scFV. Methods for preparing antitumor scFV LAND LNPs are described in Examples 1-4, and methods for performing cell viability assays are described in Example 2. Consistent with the experiments in Example 2, LANDs with primary scFv targeting showed a statistically significant increase in efficacy compared to the control, demonstrating the utility of LANDs for gene editing applications incorporating inactivated CRISPR / Cas systems such as base editors.
[0319] To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, cell viability experiments similar to those described in Examples 2 and 5 were performed to evaluate the tumor-targeting primary scFv LAND LNPs that deliver mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with guide RNA to inhibit the function of genes that promote tumor growth. + To demonstrate the potential for treating hematopoietic cancers, we used a representative CD38-expressing mantle cell lymphoma (MCL Z138) tumor model. In these studies, we performed MCL Z138 tumor cell viability assays using anti-CD38 scFv LAND LNPs carrying mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with single-guide RNA against SOX11, a cancer-promoting gene in MCL. Control groups consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFv LAND along with single-guide RNA against unrelated target genes (GFP and HPRT). The following single-guide RNAs were utilized: i.SOX11 - SEQ ID NO: 38 GGCGGTGCCAAGACCTCCAA ii. PLK1 - SEQ ID NO: 39 ACCTCGGGAGCTATGTAATT iii. EGFP—SEQ ID NO: 40 GACCAGGAUGGGCACCACCC and SEQ ID NO: 41 CCGGCAAGCTGCCCGTGCCC iv. HPRT - SEQ ID NO: 42 AATTATGGGGATTACTAGGA
[0320] The method for preparing anti-CD38 scFv LAND LNPs is described in Example 3, and the method for performing the cell viability assay is described in Example 2. As shown in Figure 14, ANOVA showed a statistically significant decrease in the viability of MCL tumor cells treated with CD38-LNP(sgSOX11) compared to all control treatments (p<0.05). Cell viability was less than 10% in the CD38-LNP(sgSOX11)-treated group, while it was greater than 90% in the control CD38-LNP(sgGFP), CD38-LNP(sgHPRT), and untreated groups. These results demonstrate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to suppress the function of genes that promote tumor growth for effective tumor therapy. To demonstrate the efficacy of LAND against CD33-positive diseases, including but not limited to acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS), similar experiments were performed in representative CD33-expressing hematopoietic cells such as HL60 and MV4-11. In these studies, HL60 or MV4-11 tumor cell viability assays were performed using anti-CD33 scFV LAND LNPs carrying mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with a single guide RNA against PLK1, an essential gene in AML and MDS. Control groups consisted of untreated HL60 and MV4-11 cells and those treated with identically prepared anti-CD33 scFV LAND along with single guide RNA against unrelated target genes (GFP and HPRT). The method for preparing anti-CD33 scFV LAND LNPs is described in Example 3, and the method for performing the cell viability assay is described in Example 2. ANOVA shows that there is a statistically significant decrease in viability of CD33-expressing tumor cells treated with CD33-LNP(sgPLK1) compared to all control treatments.
[0321] Example 6 To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, an in vivo experiment was performed comparing tumor-targeted LNPs with isotype control LNPs (delivering mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) along with guide RNA to inhibit the function of genes that promote tumor growth). The same single guide RNA sequence as described in Example 6 was also utilized in the in vivo experiment described in Example 7. CD38 + To demonstrate the ability of anti-CD38 THB-7 LAND to treat hematopoietic cancers in vivo, we used a representative CD38-expressing mantle cell lymphoma animal model, MCL Z138. Z138 tumor cells (approximately 1 × 10 6 SCID mice (n = 8-10 per group) are intravenously injected with Cas9 mRNA and LNP prepared as described in Example 3 at a dose of 0.5 mg / kg containing a single guide RNA for SOX11-CD38-LNP (sgSOX11), starting 10 and 15 days after tumor formation. Control groups include sham treatment and LNP vectors carrying either an irrelevant scFv specificity or an irrelevant sgRNA. Specifically, the control LNP vectors are CD38-targeted LNP containing Cas9 mRNA and a single guide RNA against green fluorescent protein (GFP)—CD38-LNP (sgGFP); isotype control scFv LNP containing Cas9 mRNA and a single guide RNA against SOX11—Iso-LNP (sgSOX11); and isotype control scFv LNP containing Cas9 mRNA and a single guide RNA against GFP—Iso-LNP (sgGFP). To demonstrate the efficacy of LAND against CD33-positive diseases, including but not limited to acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS), similar experiments are performed using representative CD33-expressing hematopoietic animal tumor models, such as HL60 and MV4-11. HL60 and MV4-11 tumor cells (approximately 1–5 × 10) are used. 6Cells) are injected intravenously or subcutaneously into immunodeficient mice (n = 8-10 per group). In these studies, intravenous administration begins 10 and 15 days after tumor inoculation, with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg / kg containing Cas9 mRNA and a single guide RNA against PLK1-CD33-LNP (sgPLK1). Control groups include sham treatment and LNP vectors with either an irrelevant scFv specificity or an irrelevant sgRNA. Specifically, the control LNP vectors are CD33-targeted LNP containing Cas9 mRNA and a single guide RNA directed against green fluorescent protein (GFP)—CD33-LNP (sgGFP); isotype control scFv LNP containing Cas9 mRNA and a single guide RNA directed against PLK1—Iso-LNP (sgPLK1); and isotype control scFv LNP containing Cas9 mRNA and a single guide RNA directed against GFP—Iso-LNP (sgGFP).
[0322] The group treated with LAND tumor-targeted LNP(sgSOX11) showed a statistically significant improvement in survival compared to all control treatments, as shown by Kaplan-Meier curves and log-rank tests. As shown in Figure 15, the group treated with CD38-LNP(sgSOX11) showed a statistically significant improvement in survival compared to all control treatments, as shown by Kaplan-Meier curves and log-rank tests (p<0.0001). In the CD38-LNP(sgSOX11) group, 90% of animals were alive at day 50, whereas all animals in the control group had died by day 40. These in vivo results are consistent with the in vitro data shown in Example 6 and further demonstrate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to inhibit the function of genes that promote tumor growth for effective tumor therapy.
[0323] To further demonstrate the potential of LAND primary scFv targeting for safe and effective gene editing, we evaluated the percentage of gene editing in selected tumor cells extracted from tumors and normal liver (hepatocytes and macrophages) after in vivo treatment in the same representative hematopoietic tumor model used in Example 3. In these studies, intravenous administration of LAND LNPs containing Cas9 mRNA prepared as described in Example 3 and a single guide RNA for SOX11-CD38-LNP (sgSOX11) was initiated after tumor formation at a dose of 2.0 mg / kg. Control groups included sham treatment and LNP vectors carrying either an irrelevant scFv specificity or an irrelevant sgRNA, as shown in Figure 15. As an additional control, mice (N=5 / group) were treated with a single intravenous dose of doxorubicin (DOX) at a dose of 1 mg / kg or 2.5 mg / kg. After treatment, genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next-generation sequencing (NGS).
[0324] MCL(GFP +Genomic DNA was extracted from single-cell suspensions of 005 (005) cells using QuickExtract DNA Extraction Solution (Lucigen Inc.) according to the manufacturer's protocol and amplified by two rounds of polymerase chain reaction (PCR) using locus-specific primers containing universal tails that added sample-specific P5 and P7 indices for Illumina sequencing. After PCR, 1x SPRI (solid-phase reversible immobilization) bead cleanup and library quantification by quantitative PCR (IDT) were performed before sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry; 150 base pair (bp) paired-end reads; Illumina, San Diego, CA, USA). Data were analyzed using a custom-built pipeline. Data were demultiplexed (Picard tools v2.9; github.com / broadinstitute / picard); forward and reverse reads were merged into extended amplicons (flash v1.2.11); and reads were aligned to the GRCh38 reference genome (bwa mem v0.7.15) and assigned to targets (bedtools tags v2.25). For reads with >30% bases of target quality, a custom python program identified INDELs based on gap alignments between the read and the target. Edits were calculated as the percentage of all reads containing INDELs within an 8-bp window around the cut site. The results are shown in Figure 16A and demonstrate that treatment with single guide RNA against SOX11--CD38-LNP (sgSOX11) results in editing of 95% of tumor cells, compared to 0-4% of tumor cells in control groups, including either untreated animals or treatment with an identically prepared LNP vector carrying an irrelevant sgRNA as shown in Figure 15. These differences are statistically significant by one-way analysis of variance (ANOVA) and Tukey's multiple comparison test. ** P<0.001.
[0325] The superiority of LAND compared to standard chemical conjugation antibody LNP targeting methods was also demonstrated in in vivo gene editing procedures. In these evaluations, an additional treatment group was tested using anti-CD38-targeted LNPs prepared using chemical conjugation methods. Chemically conjugated CD38-targeted LNPs (chemical CD38-LNP-sgSOX11) utilized the same lipids, Cas9 mRNA, and SOX11 sgRNA, as shown in Figure 16A. Chemical conjugation of anti-CD38 to LNPs was performed as previously described by Tarab-Ravski et al. (2023). Briefly, anti-human CD38 IgG antibody (clone THB-7, BioXCell) was added at 1 × 10 3 m dithiothreitol (Sigma-Aldrich) and 5 × 10 3The antibody was reduced with m EDTA (Sigma-Aldrich) for 1 hour at room temperature. Dithiothreitol was then removed using a 7K Zeba spin desalting column (ThermoFischer Scientific) according to the manufacturer's protocol. The reduced antibody was immediately added to LNP at an antibody / LNP ratio of 1:40.7 (mg / mg) and incubated with gentle shaking for 2 hours at room temperature and overnight at 4°C. To remove free, unbound mAb, the LNP was loaded onto CL4B Sepharose beads (Sigma-Aldrich) and purified using a gravity-fed gel filtration chromatography column (BioRad Laboratories) with PBS as the mobile phase. Fractions were collected using an FC-203B fraction collector (Gilson). The anti-CD38 LNP fraction was collected in a 100K Amicon tube (Millipore) and concentrated to the original volume. Intravenous administration of chemical CD38-LNP-sgSOX11 was also initiated at a dose of 2.0 mg / kg after tumor formation, and the results were compared with those obtained with the same treatment group, shown in Figure 16A. As shown in Figure 16B, a statistically significant increase in tumor gene editing was observed with LAND CD38-LNP-sgSOX11 versus chemical CD38-LNP-sgSOX11 (>95% vs. <40%). Furthermore, "off-tumor" gene editing in normal liver cells (hepatocytes and macrophages) was significantly less with LAND versus chemically conjugated LNP treatment (<4% vs. >40%). Both were statistically significant by analysis of variance (ANOVA) with Tukey's multiple comparison test (p<0.0005). The significantly better results for LAND versus chemically conjugated antibody-targeted LNPs were unexpected because the lipidated scFv antibody utilized in LAND has only one binding site, compared with two binding sites for the antibody used in chemically conjugated LNPs.
[0326] As shown in Figure 16B, the superiority of LAND compared to standard chemically conjugated antibody LNP targeting is demonstrated for therapeutic applications. In these evaluations, an additional treatment group was tested using anti-CD38 LNPs prepared using chemical conjugation methods. Chemically conjugated CD38-targeting LNPs (chemical CD38-LNP-sgSOX11) utilized the same lipids, Cas9 mRNA, and SOX11 sgRNA as shown in Figure 16A. Chemical conjugation of anti-CD38 to LNPs was performed as previously described (Tarab-Ravski et al., 2023). Intravenous administration using chemical CD38-LNP-sgSOX11 was also initiated at a dose of 2.0 mg / kg 10 days after tumor formation, and the results were compared to those obtained with the same treatment group shown in Figure 16A. As shown in Figure 16B, there is a statistically significant increase in tumor gene editing with LAND CD38-LNP-sgSOX11 versus chemical CD38-LNP-sgSOX11 (>95% vs. <40%). Furthermore, "extratumoral" gene editing in normal liver cells (hepatocytes and macrophages) is significantly less with LAND versus chemically conjugated LNP treatment (<4% vs. >40%). Both of these differences are statistically significant by analysis of variance (ANOVA) and Tukey's multiple comparison test (p<0.0005). The substantially superior results of LAND versus chemically conjugated antibody-targeted LNP are unexpected because the antibody used in chemically conjugated LNPs has two binding sites, whereas the lipidated scFv antibody utilized in LAND has only one binding site.
[0327] As shown in Figure 16C, the superior safety of LAND compared to standard chemotherapy was demonstrated. In these evaluations, an additional control group (N = 5 / group) received a single intravenous dose of doxorubicin (DOX) at a dose of 1 mg / kg or 2.5 mg / kg. These doses are generally within the range used clinically. After treatment, genomic DNA was extracted from normal hepatocytes and analyzed for INDELs by next-generation sequencing (NGS). Remarkably, "extratumoral" gene editing in normal hepatocytes with LAND was orders of magnitude less (less than 4%; Figure 16B) compared to standard chemotherapy, which resulted in over 50% INDELs (doxorubicin 2.5 mg / kg, Figure 16C).
[0328] Example 7 To further demonstrate the safety of LAND primary scFv therapy, liver toxicity and the percentage of gene editing in normal hepatocytes after in vivo administration in normal mice were evaluated. In these studies, anti-EGFR LAND LNPs containing Cas9 mRNA and a single guide RNA for PLK1-EGFR-LNP (sgPLK1) were administered intravenously at a dose of 2.0 mg / kg. Control groups included untreated animals and an LNP vector containing an irrelevant GFP sgRNA, as described above for Figure 15. Serum liver enzyme levels and the percentage of gene-edited liver hepatocytes and macrophages were determined as described in Figure 16. As shown in Figure 17, the percentage of edited liver cells was low and not significantly different between the anti-EGFR LAND LNPs with a single guide RNA for PLK1-EGFR-LNP (sgPLK1) and the control group treated with anti-EGFR LAND LNPs with a single guide RNA for an irrelevant sgRNA for GFP, as described above for Figure 16. Serum liver enzymes were not adversely affected and were similar to untreated animals in all treatment groups. The results in Example 7 (Figure 16) and Example 8 (Figure 17), using LAND constructs against very different antibody targets, demonstrated very high levels of specific gene editing with minimal effects in normal tissues, supporting the general applicability of this technology.
[0329] Abstract: Cellular and disease models are representative of clinical tissues and cellular targets suitable for LAND therapy. In particular, in vivo disease models are known to be highly invasive and generally resistant to conventional treatments. The statistically superior efficacy of the LAND antibody-targeted LNP composition and method (with one antigen-binding site per targeting molecule) compared with ASSET and chemically conjugated antibody-targeted LNPs (with two antigen-binding sites per targeting molecule) is unexpected. The statistically superior efficacy of LAND has been demonstrated for a wide range of RNA therapeutics, including but not limited to siRNA, mRNA, and gene editing therapies for a wide variety of antigen targets and diseases.
[0330] Example 8 Primary Fab LAND (LAN with primary Fab targeting - Erbitux-Fab-LAND) All of the ASSET and LAND proteins shown so far contained secondary or primary scFvs. To further demonstrate the robustness and flexibility of LAND, we prepared and evaluated LAND proteins that used Fab' for cell targeting. These are referred to as "primary Fab LANDs (LANDs with primary Fab targeting)."
[0331] Figure 1F shows the system used in Examples 8 and 9. The vector in this system contains two expression cassettes, each independently controlled at the transcriptional level by a T7 promoter, in a configuration known as "pET-Duet" (biocompare.com / Product-Reviews / 40993-Co-expression-with-pETDuet-1-Duet-Expression-System-From-Novagen / ). Upon induction of protein expression (with IPTG), the two proteins are transported separately across the inner membrane. The heavy chain portion containing the CDQSSS (SEQ ID NO: 17) lipidated peptide moiety is inserted into the periplasmic side of the inner membrane. The light chain containing the C-terminal HIS-tag is transported to the periplasmic space as a soluble protein and associates with the heavy chain portion to form Fab. Only the intact Fab, consisting of the lipidated heavy chain (Fd) and light chain, is extracted from the membrane fraction using detergent and purified by Ni-NTA affinity chromatography. Free L chain protein is removed as part of the soluble fraction before detergent extraction, but free Fd does not bind to the Ni-NTA column because it does not contain a HIS tag.
[0332] The first expression cassette for preparing Fab contains the protein-coding portion, an NlpA leader sequence (SEQ ID NO: 20), a lipidation sequence (SEQ ID NO: 17), an 11-aa linker 1 (SEQ ID NO: 18), mCherry (SEQ ID NO: 22) as a functional protein, a 28-aa linker #4 (SEQ ID NO: 6), the VH of Erbitux and the CH1 domain of a human IgG1 constant domain.
[0333] The sequence of the open reading frame of the H chain portion of Erbitux-Fab-LAND is set forth in SEQ ID NO: 23 (DNA sequence) and SEQ ID NO: 24 (amino acid sequence).
[0334] The second expression cassette for preparing Fab contains the protein-coding portion of the pelB leader sequence followed by the open reading frame for the Erbitux kappa light chain, and ends with a hexahistidine tag that allows purification by nickel-NTA affinity chromatography.
[0335] The sequences of the open reading frame of the light chain portion of Erbitux-Fab-LAND are set forth in SEQ ID NO: 26 (DNA sequence) and SEQ ID NO: 27 (amino acid sequence). The Erbitux-Fab-LAND protein was produced, purified, and functionally tested by flow cytometry as described in the general protocol above.
[0336] Methods: Flow cytometry experiments were performed using OVCAR8 cells essentially as described in Example 2 (testing the "primary Erbitux scFv LAND"). Cells were incubated with OG (octylglucoside) micelles in complete medium (containing 10% FBS). Binding of Erbitux-LAND OG micelles to cells was monitored by adding an APC anti-His tag secondary antibody to the cells and incubating them on ice for 30 minutes, instead of following the mCherry fluorescent signal (as done in Example 2). Cells were washed with PBS. Finally, cells were analyzed by flow cytometry (APC channel) using a CytoFLEX (Beckman Coulter, USA).
[0337] result: As shown in Figure 18, both Erbitux-based purified LAND formulations ("LAND with primary scFv targeting") and ("LAND with primary Fab targeting") protein micelles bound to OVCAR8 cells. In this analysis, the Fab construct outperformed the scFv construct.
[0338] These results suggest that lipidated Erbitux Fab is functional and effective in targeting, and is not inferior to lipidated Erbitux scFv.
[0339] Example 9 Primary Fab LAND (LAN with primary Fab targeting - THB-7-Fab-LAND) The first expression cassette for preparing Fab contains a protein-encoding portion, an NlpA leader sequence (SEQ ID NO:20), a lipidation sequence (SEQ ID NO:17), an 11-aa linker 1 (SEQ ID NO:18), mCherry (SEQ ID NO:22) as a functional protein, a 28-aa linker #4 (SEQ ID NO:6), the VH of THB-7, and the CH1 domain of a human IgG1 constant domain.
[0340] The sequence of the open reading frame of the H chain portion of THB-7-Fab-LAND is set forth in SEQ ID NO: 27 (DNA sequence) and SEQ ID NO: 28 (amino acid sequence).
[0341] The sequences of the open reading frame of the light chain portion of Erbitux-Fab-LAND are set forth in SEQ ID NO: 29 (DNA sequence) and SEQ ID NO: 30 (amino acid sequence). The THB-7-Fab-LAND protein was produced, purified, and functionally tested by flow cytometry as described in the general protocol above.
[0342] The second expression cassette for preparing Fab contains the protein-coding portion of the pelB leader sequence followed by the open reading frame for the Erbitux kappa light chain, and ends with a hexahistidine tag that allows purification by nickel-NTA affinity chromatography.
[0343] Methods: Flow cytometry experiments were performed using Z138 cells essentially as described in Example 3 (testing the "primary THB-7 scFv LAND"). Cells were incubated with OG (octylglucoside) micelles in complete medium (containing 10% FBS). Binding of THB-7-LAND OG micelles to cells was monitored by adding APC anti-His secondary antibody to the cells and incubating them on ice for 30 minutes, instead of following the mCherry fluorescent signal (as done in Example 3). Cells were washed with PBS. Finally, cells were analyzed by flow cytometry (APC channel) using a CytoFLEX (Beckman Coulter, USA).
[0344] result: As shown in Figure 19, both THB-7-based purified LAND formulations ("LAND with primary scFv targeting") and ("LAND with primary Fab targeting") protein micelles bound to Z138 cells.
[0345] The foregoing description of specific embodiments fully reveals the general nature of the present invention, and since others, applying their current knowledge, may easily modify and / or adapt such specific embodiments for various uses without undue experimentation and without departing from the general concept, such adaptations and modifications should, and are intended to, be understood within the meaning and range of equivalents of the disclosed embodiments. It should be understood that the phraseology or terminology used herein is for purposes of description and not of limitation. The means, materials, and steps for carrying out the various disclosed functions may take various alternative forms without departing from the spirit and scope of the invention, as set forth by the claims that follow.
[0346] It is the intention of the applicants that all publications, patents, and patent applications referenced herein be incorporated by reference in their entireties as if each individual publication, patent, or patent application were individually and specifically described when referenced. Furthermore, citation or identification of a reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent section headings are used, they should not be construed as necessarily limiting. Additionally, the priority documents of this application are incorporated herein by reference in their entireties.
Claims
1. A therapeutic or diagnostic agent. A lipid nanoparticle encapsulating a therapeutic or diagnostic agent. a primary antibody non-covalently bound to the lipid nanoparticle via a lipidated peptide moiety; a peptide linker, one end of which is directly bound to the primary antibody and the other end of which is bound to the lipidated peptide moiety; wherein the antibody or antibody fragment thereof is located at an end distal to the nanoparticle and binds to a target antigen on the target cell.
2. 1. A delivery system composition for delivering a therapeutic or diagnostic agent to a target cell, said delivery system comprising: a lipidated antibody comprising an antibody linked to a lipidated peptide moiety via a peptide linker, wherein the peptide linker comprises at least 40 amino acid residues; lipid nanoparticles containing the therapeutic or diagnostic agent; wherein the lipidated antibody is non-covalently bound to the lipid nanoparticle via the lipidated peptide moiety.
3. The composition of claim 1 or the delivery system of claim 2, wherein the lipidated peptide portion comprises an endomembrane lipidation signal.
4. 4. The composition or delivery system of claim 1, wherein the lipidated peptide portion of the antibody comprises the first two amino acids encoded by the E. coli NlpA gene, or the first six amino acids encoded by the E. coli NlpA gene.
5. The lipidated peptide portion of the antibody is selected from the group consisting of AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, and Dpp.
4. The composition or delivery system of any one of claims 1 to 3, comprising an inner membrane lipoprotein or a fragment thereof selected from the group consisting of: B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, DsbB, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB, and Aas.
6. 3. The composition or delivery system composition of claim 1 or 2, wherein the peptide linker comprises 40 to 400 amino acid residues.
7. The composition or delivery system composition of claim 6, wherein the peptide linker comprises 40 to 300 amino acid residues.
8. The composition or delivery system composition of any one of claims 1 to 7, wherein at least 30% of the amino acid residues of the peptide linker are glycine or serine.
9. 8. The composition or delivery system composition of claim 7, wherein the peptide linker comprises the amino acid sequence set forth in SEQ ID NO:
11.
10. 10. The composition or delivery system composition of claim 9, wherein the linker comprises the amino acid sequence set forth in SEQ ID NO:
12.
11. The delivery system composition of any one of claims 2 to 10, wherein the antibody is a primary antibody comprising an antigen recognition domain capable of binding to an antigen expressed on a target cell.
12. 12. The composition of claim 1 or the delivery system composition of claim 11, wherein the primary antibody is a humanized or human primary antibody.
13. 13. The composition of claim 1, or the delivery system composition of claim 11 or 12, wherein the primary antibody is selected from the group consisting of an anti-CD44 antibody, an anti-CD34 antibody, an anti-CD38 antibody, an anti-Ly6C antibody, an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody, an anti-CD25 antibody, an anti-CD47 antibody, an anti-CD117 antibody, an anti-CD147 antibody, an anti-EGFR antibody, and an anti-integrin β7 antibody.
14. 13. The composition of claim 1, or the delivery system composition of claim 11 or 12, wherein the primary antibody is capable of binding to an antigen listed in Table 1 and Table 7.
15. The delivery system composition of any one of claims 2 to 10, wherein the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding to the Fc domain of the primary antibody.
16. 11. The delivery system composition of any one of claims 2 to 10, wherein the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv, dsFv and nanobody.
17. 17. The delivery system composition of claim 16, wherein the Nanobody is a monovalent or multivalent Nanobody.
18. The delivery system composition of any one of claims 1 to 10, wherein the antibody is a monoclonal antibody.
19. The composition or delivery system composition of any one of claims 1 to 18, wherein the lipidated peptide moiety is attached to the N-terminus of the antibody.
20. 20. The composition or delivery system composition of any one of claims 1 to 19, wherein the lipid nanoparticles comprise at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG lipid.
21. The ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl-N′,N′-di[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, 2-(di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propanoate (EA-P IP), di-oleyl-succinyl-serinyl-tobramycin, di-oleyl-adipyl-tobramycin, di-oleyl-suberyl-tobramycin, di-oleyl-sebacyl-tobramycin, di-oleyl-dithioglycolyl-tobramycin, monocationic lipid N-[1-(2,3-dioleoyloxy)]-N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-1,2-di-O-(1'Z,9'Z-octadecadienyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate, BGSC (bis-guanidinium-spermidine-cholesterol), BGTC (bis-guanidinium-tren-cholesterol), CDAN (N'-cholesteryloxycarbonyl 1-3,7-diazanonane-1,9-diamine), CHDTAEA (cholesteryl hemidithiodiglycolyl tris(amino(ethyl)amine), DCAT (O-(1,2-di-O-(9'Z-octadecanyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate), DC-Chol (3β[N-(N',N'-dimethylaminoethane)-carbamoyl]cobalamin) esterol), DLKD (O,O'-dilauryl N-lysyl aspartate), DMKD (O,O'-dimyristyl N-lysyl aspartate), DOG (dioleoylglycerol, DOGS (dioctadecylamidoglycylspermine), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide ornithine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine, DOSN (dioleoylsuccinylethylthioneomycin), DOSP (dioleoylsuccinylparomomycin), DOST (dioleoylsuccinyltobramycin), 1,The composition or delivery system composition of claim 20, wherein the composition or delivery system is selected from the group consisting of 2-diolcoyl-3-trimethylammoniopropane, DOTMA (N'[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride), DPPES (di-palmitoylphosphatidylethanolamide spermine), DDAB, and DODAP, or any combination thereof.
22. 22. The composition or delivery system composition of claim 21, wherein the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(di((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propanoate (EA-PIP), di-oleyl-succinyl-serinyl-tobramycin, di-oleyl-adipyl-tobramycin, di-oleyl-suberyl-tobramycin, di-oleyl-sebacyl-tobramycin, N,N-dimethyl-N',N'-di[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, and di-oleyl-dithioglycolyl-tobramycin, or any combination thereof.
23. 21. The composition or delivery system composition of claim 20, wherein the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as phosphatidylcholine (PC)), cephalin, sphingolipids and glyceroglycolipids, or combinations thereof.
24. The helper lipid may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilauroyl-L-phosphatidylethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,3-dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE), 1-palmitoyl-3-oleoyl 21. The composition or delivery system of claim 20, wherein the phosphatidyl ester is selected from the group consisting of 1,3-POPE, 1,2-dimyristoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), biotin-phosphatidylethanolamine, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), and dipalmitoylphosphatidylethanolamine (DPPE), or a combination thereof.
25. 21. The composition or delivery system composition of claim 20, wherein the PEG lipid is selected from the group consisting of DMG-PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-dimyristyloxy-propylamine; 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-distearyloxy-propylamine, or a combination thereof.
26. 26. The composition or delivery system composition of any one of claims 1 to 25, wherein the lipidated peptide moiety comprises a glycerolipid.
27. 27. The composition or delivery system composition of any one of claims 1 to 26, wherein the therapeutic agent is encapsulated within the lipid nanoparticles.
28. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a nucleic acid or polynucleotide.
29. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is exome-encoded DNA or mRNA.
30. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a non-coding RNA of the exome.
31. 31. The composition or delivery system composition of claim 30, wherein the non-coding RNA of the exome is a microRNA, long non-coding RNA (lncRNA), long non-coding intergenic RNA (lincRNA), pseudogene, circular RNA (circRNA), transfer RNA (tRNA), or interfering RNA (siRNA and shRNA).
32. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a catalytically active or inactivated gene-editing nuclease.
33. 33. The composition or delivery system composition of Claim 32, wherein the catalytically active or inactivated gene-editing nuclease is selected from meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), transposases, integrases, recombinases encoded by mobile genetic elements (MGEs), Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) nucleases and their associated guide nucleic acids and targeting moieties.
34. 34. The composition or delivery system of claim 33, wherein the CRISPR-associated (Cas) nuclease is Cas9, Cas12a, Cas12b, Cas12e, Cas13, Cas13a, Cas13b, Cas14, Cas-θ, CasX, CasY, or one listed in Table 6.
35. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is an mRNA fused to a catalytically inactivated CRISPR-associated (Cas) protein or transcriptional modifier.
36. 36. The composition or delivery system composition of claim 35, wherein the mRNA fused to the transcriptional modifier is a transcriptional repressor.
37. 37. The composition or delivery system of claim 36, wherein the transcriptional repressor is a methyltransferase or a histone deacetylase.
38. 37. The composition or delivery system of claim 36, wherein the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Kruppel-associated box (KRAB), MeCP2-KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and / or SDS3.
39. 36. The composition or delivery system composition of claim 35, wherein the mRNA fused to the transcriptional modifier is a transcriptional activator.
40. 40. The composition or delivery system of claim 39, wherein the transcriptional activator is VP64, p65, and Rta, each individually, or a combination thereof (VPR), the synergistic activation mediator (SAM) activation system MS2-p65-HSF1, a DNA demethylation site, or an acetyltransferase.
41. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a base editor, a prime editor, or a mobile genetic element gene writer.
42. 42. The composition or delivery system of Claim 41, wherein the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE) comprising a catalytically inactive Cas nuclease (dCas) or a partially inactive Cas nuclease (Cas nickase or nCas), a cytidine deaminase, or an adenosine deaminase, and a guide RNA that confers target sequence specificity.
43. 43. The composition or delivery system composition of Claim 42, wherein the base editor or gene editing agent is selected from those listed in Table 2 and Table 3.
44. 42. The composition or delivery system of Claim 41, wherein the prime editor is comprised of a fusion protein consisting of a prime editing guide RNA (pegRNA) target sequence and an RNA template and a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme, wherein the pegRNA guide template and Cas9 nickase guide the reverse transcriptase to a target site and insert a new DNA strand from the RNA template into the target site.
45. 42. The composition or delivery system composition of claim 41, wherein the mobile genetic element gene writer incorporates a mobile genetic element for sequence targeting combined with a modified integrase or transposase to integrate a nucleic acid sequence into a target sequence.
46. 46. The composition or delivery system composition of Claim 45, wherein the mobile genetic element gene writer incorporates a CRISPR-Cas9 targeting element in combination with a modified piggyBac transposase to integrate a nucleic acid sequence into the target sequence.
47. 28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a protein, a ribonucleoprotein, or a drug.
48. 49. The composition or delivery system composition of any one of claims 1 to 48, wherein the target nucleic acid or gene for inhibition is one listed in Table 4.
49. 49. The composition or delivery system composition of any one of claims 1 to 48, wherein the target nucleic acid or gene for therapeutic expression is one listed in Table 5.
50. 49. The composition or delivery system composition of any one of claims 1 to 48, wherein the target nucleic acid or gene for correction or repair is one listed in Table 4, Table 5 or Table 7.
51. 49. The composition or delivery system composition of any one of claims 1 to 48, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NO: 5, 8, 24, 27, 28 or 30.
52. 52. A method of delivering a therapeutic or diagnostic agent to a subject in need thereof, comprising delivering the therapeutic or diagnostic agent to the subject by administering to the subject a composition or delivery system according to any one of claims 1 to 51.
53. 52. A method for treating a medical condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition or delivery system of any one of claims 1 to 51, wherein the agent is a therapeutic agent, thereby treating the medical condition.
54. 52. A method of diagnosing a medical condition in a subject, comprising administering to the subject an effective amount of the composition or delivery system of any one of claims 1 to 51, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.
55. 52. Use of a composition or delivery system according to any one of claims 1 to 51 for diagnosing or treating a medical condition.