Integrating and self-inactivating viral vectors and their construction and use

Abstract

The present disclosure relates to gene delivery systems and methods for producing and using a single construct or viral vector carrying a transposon and a transposase gene that is functional in target cells but not in producer cells.

Description

[Technical Field]

[0001] Cross-reference to related art This application claims priority to U.S. Provisional Patent Application No. 63 / 595,925, filed December 20, 2022, and U.S. Provisional Patent Application No. 63 / 476,334, filed November 3, 2023, each of which is incorporated by reference in its entirety.

[0002] Incorporation by reference of sequence listing This application contains a Sequence Listing that has been submitted electronically in XML file format and is incorporated herein by reference in its entirety. The Sequence Listing of this application is labeled "123690-5003-SequenceListing.SIP," created on December 19, 2023, and is 43,800 bytes in size.

[0003] The present disclosure relates to gene delivery systems and methods for producing and using a single construct or viral vector carrying a transposon and transposase gene that function based on their cellular environment. [Background technology]

[0004] Stable and safe genomic integration of DNA encoding a sequence of interest is a prerequisite for successful and sustained gene transfer in many applications, particularly in gene therapy therapeutic areas where rapidly dividing cells are affected. Because rapid cell division can lead to the dilution of non-integrated DNA, genomic integration is necessary to achieve more sustained gene expression and resulting therapeutic effects. Furthermore, genetic diseases affecting pediatric populations, where gene transfer may provide therapeutic benefit, may require stable integration because aging and the resulting expansion of the target cell population can lead to the dilution of non-integrated DNA, resulting in a decline in the intended therapeutic effect. Currently, many genetic tools are used to integrate DNA cargo into the DNA of mammalian cells. These include, but are not limited to, retroviruses, lentiviruses, and non-viral transposon / transposase systems (e.g., Sleeping Beauty and PiggyBac transposon / transposase systems). The Sleeping Beauty system, in particular, is preferred because it appears to have an unbiased, near-random integration pattern, which appears to pose a low risk of oncogenicity. Current transposon / transposase delivery practices focus on two-component systems in which the transposon and transposase are delivered separately "in trans." The "in trans" delivery system allows for the safe integration of only the transposon, but not the transposase, when supplied in mRNA or protein form. However, this process is relatively inefficient because it requires the delivery of two separate vectors into the same cell. On the other hand, containing the transposase and transposon in a "cis" configuration on the same plasmid can result in the integration of both the transposon and transposase, potentially increasing the risk of oncogenicity due to reconstitution events driven by the transposase.

[0005] To date, transposon / transposase systems in "cis" configuration have only been delivered to target cells by non-viral approaches. For example, U.S. Patent Publication No. 2021 / 0324407 describes a gene delivery system using a single plasmid carrying a self-inactivating transposase gene and the corresponding transposon delivered to target cells by electroporation; after the initial transposition of the transposon, the transposase inactivates itself in the target cells. Chakraborty and colleagues (Chakraborty, et al., Sci. Rep. 4, 7493; DOI:10.1038 / srep07403 (2014)) describe a single plasmid construct delivered by a calcium phosphate particle-based method that combines the transposase and transgene elements to share a single poly(A) sequence, resulting in self-inactivation of the transposase after transposition due to the loss of poly(A) support for proper termination of the transposase transcript when carried with the transgene. Compared with viral approaches, these approaches currently lack the ability to efficiently deliver DNA in vivo. Therefore, there is a need to generate a single, efficient viral delivery vector that carries the complete transposon / transposase system, where the transposase is functional in target cells but not in producer cells. Summary of the Invention

[0006] In one aspect, disclosed herein is a polynucleotide comprising: (i) a transposable element comprising a pair of inverted repeats; (ii) a first nucleic acid sequence encoding a transposase; and (iii) a mammalian intron located in the first nucleic acid sequence.

[0007] In some embodiments, a first inverted repeat in the pair of inverted repeats is positioned upstream of the first nucleic acid sequence, and a second inverted repeat in the pair of inverted repeats is positioned within the first nucleic acid sequence.

[0008] In some embodiments, the second inverted repeat is located within a mammalian intron.

[0009] In some embodiments, the transposable element further comprises a cargo nucleic acid sequence flanking the pair of inverted repeats.

[0010] In some embodiments, the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

[0011] In some embodiments, the cargo nucleic acid sequence comprises a gene of interest. In some embodiments, the cargo nucleic acid sequence encodes a therapeutic agent. In some embodiments, the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or a mammalian intron. In some embodiments, the transposable element further comprises a transcriptional regulator operably linked to the cargo nucleic acid sequence.

[0012] In some embodiments, the transcriptional regulator is a promoter. In some embodiments, the transposase is a self-integrating transposase and a self-inactivating transposase. In some embodiments, the polynucleotide further comprises a pair of AAV inverted terminal repeat sequences adjacent to the transposable element and the first nucleic acid sequence.

[0013] In some embodiments, the polynucleotide is in a production cell and the intron is not spliced ​​out, thereby rendering the self-integrating transposase and the self-inactivating transposase non-functional.

[0014] In some embodiments, when the polynucleotide is in the target cell, the intron is spliced ​​out, thereby allowing the self-integrating transposase and the self-inactivating transposase to function.

[0015] In some embodiments, when the polynucleotide is in the target cell, the transposase splices the IR to favor transposition and integration of the cargo in the target region of interest.

[0016] In one aspect, disclosed herein is a polynucleotide comprising: (i) a first nucleic acid sequence comprising a nucleic acid cassette encoding a Cas nuclease; (ii) a second nucleic acid sequence comprising a nucleic acid cassette of a guide RNA (gRNA); and (iii) a mammalian intron located in the first nucleic acid sequence.

[0017] In some embodiments, the first nucleic acid sequence comprises a nucleic acid sequence of a cargo.

[0018] In some embodiments, the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

[0019] In some embodiments, the cargo nucleic acid sequence comprises a gene of interest.

[0020] In some embodiments, the cargo nucleic acid sequence encodes a therapeutic agent.

[0021] In some embodiments, the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or the mammalian intron.

[0022] In some embodiments, when the polynucleotide is in a production cell, the intron is not spliced ​​out, thereby preventing the Cas nuclease from functioning.

[0023] In some embodiments, when the polynucleotide is within the target cell, the Cas nuclease binds to the gRNA, thereby favoring gene repair and integration of the cargo by HITI (homologous sequence-free target site-specific gene knock-in technology).

[0024] In one aspect, disclosed herein is a polynucleotide comprising: (i) a nucleic acid sequence comprising a nucleic acid cassette encoding an ARCUS nuclease; and (ii) a mammalian intron located in the nucleic acid sequence.

[0025] In some embodiments, the nucleic acid sequence comprises a nucleic acid sequence of a cargo.

[0026] In some embodiments, the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

[0027] In some embodiments, the cargo nucleic acid sequence comprises a gene of interest.

[0028] In some embodiments, the cargo nucleic acid sequence encodes a therapeutic agent.

[0029] In some embodiments, the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or the mammalian intron.

[0030] In some embodiments, when the polynucleotide is in the production cell, the intron is not spliced ​​out, thereby preventing the ARCUS nuclease from functioning.

[0031] In some embodiments, when the polynucleotide is in the target cell, the ARCUS nuclease binds to the ARCUS nuclease recognition motif, thereby favoring cargo removal, ligation-assisted homologous recombination (LAHR), and gene repair by integration.

[0032] In some embodiments, the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:13.

[0033] In one aspect, disclosed herein are delivery vehicles comprising the disclosed polynucleotides.

[0034] In some embodiments, the delivery vehicle is a lipid nanoparticle (LNP), an extracellular vesicle (EV), an exosome, or a viral vector. In some embodiments, the viral vector comprises an adeno-associated virus (AAV), a recombinant adeno-associated virus (rAAV), a parvovirus, a dependovirus, an adenovirus, a lentivirus, or an SV40 virus. In some embodiments, the viral vector is an AAV. In some embodiments, the AAV comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.

[0035] In some embodiments, the polynucleotide is flanked by viral vector inverted terminal repeats (ITRs).

[0036] In another aspect, the disclosure provides a cell comprising the disclosed polynucleotide.

[0037] In another aspect, the present disclosure provides a cell comprising the disclosed delivery vehicle.

[0038] In yet another aspect, the disclosure provides genetically engineered cells comprising the disclosed polynucleotides or the disclosed delivery vehicles.

[0039] In one aspect, disclosed herein is a method of genetically modifying a cell comprising introducing into the cell a polynucleotide disclosed herein.

[0040] In one aspect, disclosed herein is a method of genetically modifying a cell comprising introducing into the cell a delivery vehicle disclosed herein.

[0041] In one aspect, disclosed herein is a method of expressing a gene of interest in a cell comprising introducing into the cell a polynucleotide disclosed herein.

[0042] In one aspect, disclosed herein is a method of expressing a gene of interest in a cell comprising introducing into the cell a delivery vehicle disclosed herein.

[0043] In some embodiments, the cells stably express the gene of interest.

[0044] In one aspect, disclosed herein are methods of treating, ameliorating, or inhibiting a disease, disorder, or condition in a subject in need thereof, the method comprising administering to the subject a disclosed polynucleotide or a disclosed delivery vehicle.

[0045] In one aspect, disclosed herein is a method of manufacturing or producing a delivery vehicle in a production cell, wherein the delivery vehicle comprises a disclosed polynucleotide.

[0046] In one aspect, disclosed herein are methods of manufacturing or producing cells that comprise a delivery vehicle that includes a polynucleotide disclosed herein.

[0047] In one aspect, disclosed herein is a method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a transposable element comprising the cargo nucleic acid sequence and a pair of inverted repeats; (ii) a first nucleic acid sequence encoding a transposase; and (iii) a mammalian intron located within the first nucleic acid sequence.

[0048] In some embodiments, the transposase is activated upon splicing of the intron.

[0049] In some embodiments, the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:13.

[0050] In some embodiments, the activating transposase splices the IR to favor the transfer and integration of the gene of interest in the target region of interest.

[0051] In one aspect, disclosed herein is a method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a first nucleic acid sequence comprising a nucleic acid cassette encoding a Cas nuclease; (ii) a second nucleic acid sequence comprising a nucleic acid cassette of a guide RNA (gRNA); and (iii) a mammalian intron located in the first nucleic acid sequence.

[0052] In some embodiments, the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:13.

[0053] In some embodiments, the Cas nuclease is activated upon splicing of the intron.

[0054] In some embodiments, activated Cas nucleases bind to gRNAs, thereby favoring gene repair and integration of the gene of interest by HITI (homologous sequence-free targeted site-specific gene knock-in technology).

[0055] In one aspect, disclosed herein is a method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a nucleic acid sequence comprising a nucleic acid cassette encoding an ARCUS nuclease; and (ii) a mammalian intron positioned in the nucleic acid sequence.

[0056] In some embodiments, the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:13.

[0057] In some embodiments, the ARCUS nuclease is activated during splicing of the intron.

[0058] In some embodiments, the activated ARCUS nuclease binds to a recognition motif for ARCUS nuclease, thereby favoring gene repair by excision, ligation-assisted homologous recombination (LAHR), and integration of the gene of interest.

[0059] In one aspect, Provided herein is a viral vector for delivering a nucleic acid into a cellular genome, comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell.

[0060] In one aspect, provided herein is a cell comprising a viral vector, the vector comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell.

[0061] In one aspect, provided herein is a method of genetically modifying a cell, comprising introducing a viral vector of the present disclosure into the cell.

[0062] In one aspect, provided herein are methods of in vitro and in vivo gene transfer using the viral vectors of the present disclosure.

[0063] In one aspect, provided herein is a method of expressing a gene of interest in a cell, comprising introducing a viral vector of the present disclosure into the cell, selecting for cells that express the gene of interest, and isolating the cells that express the gene of interest under selective pressure.

[0064] In one aspect, provided herein is a cell prepared by introducing a viral vector of the present disclosure into a cell.

[0065] In another aspect, provided herein are methods of treating, ameliorating, or inhibiting a disease, disorder, or condition using the viral vectors of the present disclosure. The disease, disorder, or condition can be, for example, cancer or a viral disease.

[0066] In another aspect, provided herein are viral vectors or cells as medicaments for treating, ameliorating, or inhibiting a disease, disorder, or condition using the viral vectors of the present disclosure. The disease, disorder, or condition can be, for example, cancer or a viral disease.

[0067] In yet another aspect, provided herein is a method for manufacturing or producing a viral vector in a producer cell, the vector comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell.

[0068] In another aspect, provided herein is a method for manufacturing or producing a viral vector in a producer cell, the vector comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell, wherein the vector comprises an intron, and the producer cell is unable to splice the intron.

[0069] In another aspect, provided herein is a method of manufacturing or producing a cell comprising a viral vector, the vector comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell.

[0070] In another aspect, Provided herein is a construct for delivering a nucleic acid into a cell genome, comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a producer cell.

[0071] In another aspect, Provided herein is a construct for delivering a nucleic acid into a cellular genome, comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; and b) a second nucleic acid encoding a transposase that functions in a target cell but not in a production cell, wherein the second nucleic acid encoding the transposase further comprises an intron that splices in mammalian cells but not in production cells.

[0072] In one aspect, a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a transposed second amino acid coding sequence; vii) a second cassette comprising a poly(A) signal; Provided herein are constructs for delivering nucleic acids into the genome of a cell, wherein the second cassette is functional in the target cell but not in the producer cell.

[0073] In one aspect, a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a transposed second amino acid coding sequence; vii) a second cassette comprising a poly(A) signal; Provided herein are constructs for delivering nucleic acids into the genome of a cell, wherein the second cassette is functional in the target cell but not in the producer cell.

[0074] In one aspect, a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a transposed second amino acid coding sequence; vii) a second cassette comprising a poly(A) signal; Provided herein is a viral vector for delivering a nucleic acid into a cell genome, wherein a second cassette is functional in the target cell but not in the producer cell.

[0075] In one aspect, a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a transposed second amino acid coding sequence; vii) a second cassette comprising a poly(A) signal; Provided herein is a viral vector for delivering a nucleic acid into a cell genome, wherein a second cassette is functional in the target cell but not in the producer cell.

[0076] In some embodiments, the gene of interest is flanked by the inverted repeat sequence of the transposon. In certain embodiments, the nucleic acid of the transposase is disrupted in an intron. In certain embodiments, the nucleic acid of the transposase splicing is spliced ​​in the target cell and not spliced ​​in the production cell. In certain embodiments, the nucleic acid of the transposon and the transposase is flanked by the inverted terminal repeat sequence of the construct or viral vector.

[0077] These and other aspects of the viral vectors, constructs, cells, and methods will become apparent with reference to the following description. All references, patents, or applications, U.S. or foreign, that describe in more detail particular background information, procedures, methods, and / or compositions are incorporated herein by reference as if set forth in their entirety herein. In the event of any conflict, the material literally disclosed herein will control.

[0078] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0079] [Figure 1] Schematic diagram of the construct and self-integrating viral vector. ITR: AAV inverted terminal repeats required for vector assembly and packaging. IR: Sleeping Beauty inverted repeats required for cassette integration. SB: Sleeping Beauty, an enzyme involved in transposition. AI: An artificially introduced intron located within the Sleeping Beauty open reading frame and carrying the IR. [Figure 2]Schematic diagram of a viral vector in mammalian cells, where the viral vector contains a transposon and transposase that functions in mammalian cells but not in non-mammalian producer cells. 1) AAV delivers DNA to the nucleus of the target mammalian cell. 2) SB mRNA is expressed and AI is spliced, resulting in mRNA encoding intact SB. 3) The expressed SB protein carries out a transposition reaction with IR, disrupting the SB open reading frame. 4) The transposon is inserted into the genome. [Figure 3A] Schematic diagram of viral vector integration methods in non-mammalian and mammalian production hosts. Figure 3A shows that production of rAAV-BCMA-siSB-A is possible in non-mammalian (e.g., insect) cells because rAAV-BCMA-siSB-A does not lead to vector genome disruption due to the lack of splicing of intron A in the open reading frame of the Sleeping Beauty gene. [Figure 3B] Schematic diagram of viral vector integration methods in non-mammalian and mammalian production hosts. Figure 3B: Production of rAAV-BCMA-siSB-A in a mammalian production host is not possible due to disruption of the vector genome by intended splicing. [Figure 4A] Construct design. Figure 4A shows the BCMA-CAR expression cassette followed by the Sleeping Beauty transposase expression cassette disrupted by an intron (A or C variant). The BCMA-CAR expression cassette is flanked by inverted repeats of the transposon such that one of the IRs is also within an intron that disrupts the Sleeping Beauty transposase open reading frame. [Figure 4B] Construct design. Figure 4B: Shows the design of the same construct, except the coding frame of the Sleeping Beauty transposase is scrambled by including a stop codon at the beginning so that no protein is made. [Figure 5A]Plasmid constructs carrying BCMA-CAR-siSB or BCMA-CAR-siSB-scrambled were tested for correct splicing in target cells (Figure 5A). [Figure 5B] Detection of Sleeping Beauty transposase expression by Western blotting, where Sleeping Beauty transposase expression was detected only in cells transfected with the siSB intron-A construct, but not in cells transfected with the siSB intron-A scrambled control (Figure 5B). [Figure 5C] Stable integration of the BCMA-CAR (gene of interest) into the target cell genome results in stable expression of the BCMA-CAR over time (Figure 5C). [Figure 6] Lack of splicing in insect cells. The construct is not spliced ​​in insect cells, allowing for the generation of viral vectors. Two plasmids, BCMA-CAR-siSB and BCMA-CAR-siSB-scrambled, were electroporated into insect cells. Sleeping Beauty mRNA products were examined by PCR of two separate targets, as evidenced by horizontal stripes. The detected fragments indicate a lack of splicing of the mRNA produced. [Figure 7A] Production and characterization of rAAV in HEK cells. Two rAAV vectors, BCMA-CAR-siSB and BCMA-CAR-siSB-scrambled, were used to transduce HEK cells. Figure 7A: Both vectors display spliced ​​(functional transposase) and unspliced ​​(nonfunctional transposase) products of the Sleeping Beauty transposase mRNA, as examined by two separate PCR targets. [Figure 7B] Figure 7B: BCMA-CAR-siSB and BCMA-CAR-siSB scrambled control show expression of BCMA in HEK cells. [Figure 7C]Figure 7C: Detection of Sleeping Beauty transposase expression by Western blotting. Sleeping Beauty transposase expression was detected only in cells transduced with rAAV expressing the siSB intron-A construct, but not in cells transduced with rAAV expressing the siSB intron-A scrambled control. [Figure 8A] (Figure 8A) Schematic of the rAAV-siCAS mechanism when introducing a Cas target sequence only within the Cas CDS, and (Figure 8B) when introducing the same Cas target sequence upstream of the GOI cassette. [Figure 8B] (Figure 8A) Schematic of the rAAV-siCAS mechanism when introducing a Cas target sequence only within the Cas CDS, and (Figure 8B) when introducing the same Cas target sequence upstream of the GOI cassette. [Figure 8C] (Figure 8C) Figure legend. [Figure 9A] (FIG. 9A) Schematic diagram of rAAV-siARCUS mechanism when introducing the ARCUS target sequence only in the ARCUS CDS, and (FIG. 9B) when introducing the same ARCUS target sequence upstream of the GOI cassette. [Figure 9B] (FIG. 9A) Schematic diagram of rAAV-siARCUS mechanism when introducing the ARCUS target sequence only in the ARCUS CDS, and (FIG. 9B) when introducing the same ARCUS target sequence upstream of the GOI cassette. [Figure 9C] (Figure 9C) Figure legend. DETAILED DESCRIPTION OF THE INVENTION

[0080] The nucleic acid sequences of the disclosed subject matter (SEQ ID NOS: 1-14) are provided elsewhere herein in the Examples section.

[0081] The detailed description of the present invention is intended solely to familiarize those skilled in the art with the present disclosure, its principles, and its practical applications, so that they may adapt and apply the disclosure in its numerous forms as may best suit the requirements of a particular use. The present specification and its specific examples are for illustrative purposes only. Therefore, the present disclosure is not limited to the embodiments set forth in this patent application, and may be variously modified.

[0082] definition In the following description, certain specific details are set forth to provide a thorough understanding of various embodiments. However, those skilled in the art will understand that the present disclosure may be practiced without these details. In other instances, well-known structures and elements have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments. Unless the context otherwise requires, throughout the following specification and claims, terms such as "comprises" and "comprising" and variations thereof should be interpreted in an open and inclusive sense, i.e., "including, but not limited to."

[0083] Throughout this specification, references to "one embodiment," or "an embodiment," or "some embodiments," or "a particular embodiment," or "particular embodiment," or the like, mean that a particular feature, structure, element, or characteristic described in connection with the embodiment(s) is included in at least one embodiment. Thus, the appearances of phrases such as "in one embodiment," or "in an embodiment," or "some embodiments," or "a particular embodiment," or "in a particular embodiment," in various places throughout this specification and claims do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, elements, or characteristics may be combined in any suitable manner in one or more embodiments.

[0084] Also, as used in this specification and the appended claims, the singular forms "a," "the," and "the" include plural references unless the content clearly dictates otherwise.

[0085] When a range of values ​​is disclosed and the notation "at least n1..., or n2," or "between n1... and n2" is used, where n1 and n2 are numbers, unless otherwise specified, this notation is intended to include the numbers themselves and the range therebetween.

[0086] As used herein, "Functional nucleic acid" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, a nucleic acid capable of expressing a protein that can perform its function in an appropriate cell type (e.g., a target cell).

[0087] "Non-functional nucleic acid," "non-functional nucleic acid," and the like have their plain and ordinary meaning when read in light of this specification, and may include, but are not limited to, a nucleic acid capable of expressing a portion of a protein, or a complete protein that is unable to perform its function in a producing cell (e.g., an insect cell). That is, the protein is partially or completely inactive (e.g., partially or completely inhibits expression of the protein) in the producing cell (e.g., an insect cell).

[0088] "Construct" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, non-viral polynucleotide constructs such as plasmids, cosmids, or phages used to transfer genetic material to production cells.

[0089] As used herein, a "vector" is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted to result in replication of the inserted segment. Generally, a vector is capable of replication when associated with appropriate control elements. In general, the term "vector" refers to a nucleic acid molecule that can transport another nucleic acid to which it is linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules, nucleic acid molecules containing one or more free ends, nucleic acid molecules with no free ends (e.g., circular), nucleic acid molecules comprising DNA, RNA, or both, and other varieties of polynucleotides known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which viral-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retrovirus, replication-deficient retrovirus, adenovirus, replication-deficient adenovirus, and adeno-associated virus (AAV)). Viral vectors also include polynucleotides carried by viruses for transfection into host cells. Certain vectors can replicate autonomously in the host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell upon introduction into the host cell, thereby replicating along with the host genome. Furthermore, certain vectors can direct the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors." Common expression vectors useful in recombinant DNA technology are often in the form of plasmids.

[0090] "Viral vector" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, a viral polynucleotide construct, e.g., a virus, used to transfer genetic material to a target cell. Viral vectors are composed of either DNA or RNA. In some embodiments, viral vectors comprise DNA.

[0091] "Self-inactivating viral vector" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, a viral vector that, upon transduction of a target cell, results in cleavage of the viral vector genome and expression of a gene thereof, resulting in its inactivation.

[0092] "Transposon" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, a DNA sequence that can be transposed within a gene.

[0093] "Transposase" has its plain and ordinary meaning when read in light of the present specification and may include, but is not limited to, an enzyme that binds to the ends of a transposon and catalyzes the movement of the transposon to another part of the genome by a cut-and-paste mechanism or a replicative transposition mechanism.

[0094] "Target cell" refers to a mammalian cell (e.g., a human cell) that is modified by a viral vector for expression of a gene of interest. Many mammalian cell lines are known in the art, including, but not limited to, immortalized cell lines available from the American Type Culture Collection (ATCC), such as Chinese hamster ovary (CHO) cells, 293 cells, HeLa cells, baby hamster kidney (BHK) cells, mouse myeloma (SB20), monkey kidney cells (COS), and others.

[0095] "Producer cell," "production cell," "production host," and the like, refer to a non-mammalian cell (e.g., a eukaryotic cell, a non-mammalian cell, an insect cell, a bacterial cell, a plant cell, or a yeast cell) used to produce a viral vector.

[0096] "Integrating," "integrated," "integration," and the like, when read in light of this specification, have their plain and ordinary meaning and may include, but are not limited to, a segment of DNA that has become integrated into a chromosome of a producer cell or mammalian target cell after that element has been introduced (or delivered) into the cell by human manipulation. Such integrated DNA is transmitted from the original host cell or target cell to its progeny.

[0097] "Self-integrating" has its plain and ordinary meaning when read in light of this specification and may include, but is not limited to, vectors that are capable of integrating all or part of their genetic material into a host chromosome.

[0098] The term "intron" or "intron sequence" refers to a non-coding sequence within a gene that is removed by RNA splicing during the modification of precursor messenger RNA into mature messenger RNA (mRNA). Therefore, this term refers to both the DNA sequence within a gene and the corresponding sequence within the unprocessed precursor messenger RNA transcript. If the nucleic acid sequence encoding a gene contains a nucleic acid that forms a consensus splice donor / acceptor sequence with the inserted sequence, an intron may be inserted at this position. The inserted sequence is then spliced ​​out during post-transcriptional processing. Spliceosomal introns are found in eukaryotic coding genes and utilize the spliceosome for splicing (Hube F. et al., Mammalian introns: when the junk generates molecular diversity. Int J Mol Sci. 2015 Feb 20;16(3)).

[0099] In some embodiments, a "mammalian intron" refers to an intron that is spliced ​​from a sequence at a significantly higher rate in mammalian cells than in non-mammalian eukaryotic production cells. In some embodiments, a mammalian cell splices from a sequence when present in a mammalian cell at a rate at least 3 times faster than the rate at which the intron is spliced ​​from a sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, a mammalian cell splices from a sequence when present in a mammalian cell at a rate at least 10 times faster than the rate at which the intron is spliced ​​from a sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, a mammalian cell splices from a sequence when present in a mammalian cell at a rate at least 25 times faster than the rate at which the intron is spliced ​​from a sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, a mammalian cell splices from a sequence when present in a mammalian cell at a rate at least 50 times faster than the rate at which the intron is spliced ​​from a sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, the mammalian cell splices from the sequence when present in the mammalian cell at a rate at least 100 times faster than the rate at which the intron is spliced ​​from the sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, the mammalian cell splices from the sequence when present in the mammalian cell at a rate at least 500 times faster than the rate at which the intron is spliced ​​from the sequence when present in a non-mammalian eukaryotic production cell. In some embodiments, the mammalian cell splices from the sequence when present in the mammalian cell at a rate at least 1000 times faster than the rate at which the intron is spliced ​​from the sequence when present in a non-mammalian eukaryotic production cell.In some embodiments, the mammalian cell splices from the sequence when present in a mammalian cell at a rate that is at least 10 times faster, at least 100 times faster, at least 1,000 times faster, at least 10,000 times faster, at least 10^5 times faster, at least 10^6 times faster, at least 10^7 times faster, at least 10^8 times faster, or at least 10^9 times faster than the rate at which the intron is spliced ​​from the sequence when present in a non-mammalian eukaryotic production cell.

[0100] explanation The present disclosure relates to gene delivery vehicles and methods for producing and using such vehicles using a single construct or viral vector carrying a transposon and transposase that functions in target cells but not in producer cells. Some embodiments include nucleic acids encoding such transposons and transposons, constructs and viral vectors comprising such nucleic acids, such constructs and viral vectors comprising introns, compositions comprising such nucleic acids, constructs and vectors, methods for producing such gene delivery vehicles, and methods for using such gene delivery vehicles. Some embodiments include the generation or production of delivery vehicles capable of DNA integration, and compositions comprising such delivery vehicles.

[0101] Provided herein are compositions and methods for generating constructs and viral vectors in which a transposon and transposase are combined in a single construct or viral vector that is functional in one environment (e.g., a target cell) but not in another (e.g., a producer cell).

[0102] In some embodiments, the compositions and methods disclosed herein enable the production of self-integrating, self-destructing transgene constructs in non-mammalian cells by inserting an exon into the coding sequence of an encoded integrase (e.g., a transposase, Cas protein, or ARCUS protein) that is removed by the splicing machinery of the target mammalian cell but is not substantially removed by the splicing machinery of the non-mammalian eukaryotic production cell (e.g., insect cells used in baculovirus expression systems). In contrast, conventional polynucleotides carrying self-integrating, self-destructing transgene constructs cannot be efficiently packaged into viral delivery vehicles (e.g., adeno-associated viruses, "AAV") assembled in eukaryotic cells (e.g., insect cells) because the intron used to destroy the integrase is removed during the production process, resulting in activation of the integrase and destruction of the polynucleotide by the integrase. Thus, the compositions and methods described herein overcome this problem, at least in part, by suppressing intron splicing during production through the use of an intron sequence that is not substantially removed in non-mammalian eukaryotic production cells, e.g., insect cells.

[0103] Delivery Vehicle The present disclosure provides a delivery vehicle for delivering polynucleotide.These delivery vehicles or systems within the scope of the present invention can be provided in any form, including but not limited to solid, semi-solid, emulsion or colloidal particles.Therefore, any of the delivery systems described herein can be provided as particulate delivery systems within the scope of the present invention, including but not limited to lipid-based systems, lipid nanoparticles (LNP), liposomes, micelles, microvesicles, extracellular vesicles, exosomes or gene guns.

[0104] Generally, the term "nanoparticle" refers to any particle having a diameter of less than 1000 nm. In certain preferred embodiments, the nanoparticles of the present invention have a maximum dimension (e.g., diameter) of 500 nm or less. In other preferred embodiments, the nanoparticles of the present invention have a maximum dimension in the range of 25 nm to 200 nm. In other preferred embodiments, the nanoparticles of the present invention have a maximum dimension of 100 nm or less. In other preferred embodiments, the nanoparticles of the present invention have a maximum dimension in the range of 35 nm to 60 nm. Of course, references herein to particle or nanoparticle may be interchangeable where appropriate. It is understood that the size of a particle will vary depending on whether it is measured before or after loading. Thus, in certain embodiments, the term "nanoparticle" may only apply to particles prior to loading. Nanoparticles encompassed by the present invention may be provided in different forms, for example, as solid nanoparticles (e.g., metal nanoparticles such as silver, gold, iron, titanium, etc.), non-metallic, lipid-based solids, polymeric nanoparticle suspensions, or combinations thereof. Metallic, dielectric, and semiconductor nanoparticles, as well as hybrid structures (e.g., core-shell nanoparticles), may also be prepared. Nanoparticles made of semiconducting materials may also be labeled with quantum dots if they are small enough (typically less than 10 nm) that quantization of electronic energy levels occurs. Such nanoscale particles are used in biomedical applications as drug carriers or imaging agents and may be adapted for similar purposes in the present invention.

[0138] Semisolid and soft nanoparticles have been produced and are within the scope of the present invention. The prototypical nanoparticle of semisolid nature is the liposome. Various types of liposomal nanoparticles are currently used clinically as delivery systems for anticancer drugs and vaccines. Nanoparticles with half hydrophilic and half hydrophobic properties, called Janus particles, are particularly effective in stabilizing emulsions. They can self-assemble at the water / oil interface and act as solid surfactants.

[0105] Self-assembled export compartments or nanoparticles bearing RNA may be constructed with polyethyleneimine (PEI) PEGylated with an Arg-Gly-Asp (RGD) peptide ligand attached to the distal end of polyethylene glycol (PEG). This system has been used, for example, to target integrin-expressing tumor neovasculature and deliver siRNA to inhibit vascular endothelial growth factor receptor-2 (VEGF-R2) expression, thereby achieving tumor angiogenesis (see, for example, Schiffelers et al., Nucleic Acids Research, 2004, Vol. 32, No. 19). Nanoplexes can be prepared by mixing equal volumes of aqueous solutions of cationic polymer and nucleic acid to achieve a net molar excess of ionic nitrogen (polymer) to phosphate (nucleic acid) ranging from 2 to 6. Electrostatic interactions between the cationic polymer and nucleic acid result in the formation of polyplexes with an average particle size distribution of approximately 100 nm, and are therefore referred to herein as nanoplexes. A gene dose of approximately 100–200 mg of CRISPR Cas is expected for delivery in Schiffelers et al.'s self-assembled nanoparticles.

[0106] Lipid particles developed by the laboratory of Qiaobing Xu at Tufts University can be used / adapted for this delivery system. Wang et al., J.Control Release, 2017 Jan 31.pii: SO 168-3659(17)30038-X.doi:10.1016 / j.jconrel.2017.01.037 [Epub ahead of print];Altmoglu et al., Biomater Sci.,4(12): 1773-80, Nov. 15, 2016;Wang et al., PNAS, 113(11):2868-73 March 15, 2016;Wang et al., PloS One, 10(11): e0141860. doi: 10.1371 / journal. pone.0141860. eCollection 2015, Nov. 3, 2015;Takeda et al., Neural Regen Res. 10(5):689-90, May 2015; Wang et al., Adv. Healthc Mater.,3(9): 1398-403, September 2014, and Wang et al., Agnew Chem Int Ed Engl., 53(11):2893-8, March 10, 2014.

[0107] U.S. Patent Publication No. 20110293703 also provides libraries of amino alcohol lipidoid compounds prepared by the methods of the invention. These amino alcohol lipidoid compounds can be prepared and / or screened using high-throughput techniques, including liquid handlers, robots, microtiter plates, computers, and the like. In certain embodiments, the amino alcohol lipidoid compounds are screened for their ability to transfect polynucleotides or other agents (e.g., proteins, peptides, small molecules) into cells.

[0108] U.S. Patent Publication No. 2013 / 0302401 relates to a class of poly(beta-amino alcohols) (PBAAs) prepared using combinatorial polymerization. The PBAAs of the present invention can be used in biotechnology and biomedical applications as coatings (e.g., film or multilayer film coatings for medical devices or implants), additives, materials, excipients, non-bifunctional agents, micropatterning agents, and cell encapsulation agents. When used as surface coatings, these PBAAs induced different levels of inflammation both in vitro and in vivo depending on their chemical structure. The large chemical diversity of this class of materials allowed for the identification of polymer coatings that inhibit macrophage activation in vitro. Furthermore, these coatings reduced inflammatory cell recruitment and fibrosis after subcutaneous implantation of carboxylic acid polystyrene microparticles. These polymers may also be used to form polyelectrolyte complex capsules for cell encapsulation. The present invention may also have many other biological applications, such as antimicrobial coatings, DNA or siRNA delivery, and stem cell tissue engineering. The teachings of U.S. Patent Publication No. 20130302401 may be applied to the CRISPR Cas system or any other system of the present invention.

[0109] In another embodiment, lipid nanoparticles (LNPs) are contemplated. Anti-transthyretin small interfering RNA has been encapsulated in lipid nanoparticles and delivered to humans (see, e.g., Coelho et al., N Engl J Med 2013;369:819-29), and such systems can be adapted and applied to the CRISPR-Cas system or any other system of the present invention. Doses of about 0.01 to about 1 mg per kg of body weight administered intravenously are contemplated. Agents to reduce the risk of infusion-related reactions, such as dexamethasone, acetaminophen, diphenhydramine or cetirizine, and ranitidine, are contemplated. Multiple doses of about 0.3 mg / kilogram every four weeks in five doses are contemplated.

[0110] Zhu et al. (US Patent Application Publication No. 20140348900) provide a process for preparing liposomes, lipid disks, and other lipid nanoparticles using a multiport manifold, in which a lipid solution stream containing an organic solvent is mixed with two or more streams of an aqueous solution (e.g., a buffer solution). In some embodiments, at least some of the lipid and aqueous solution streams do not directly oppose each other. Thus, the process does not require dilution of the organic solvent as an additional step. In some embodiments, one of the solutions may also contain an active pharmaceutical ingredient (API). The present invention provides a robust process for producing liposomes with different lipid formulations and different payloads. Particle size, morphology, and production scale can be controlled by varying the port size and number of manifold ports and by selecting the flow rates or speeds of the lipid and aqueous solutions.

[0111] LNP has been shown to be highly effective in delivering siRNA to the liver (see, for example, Tabernero et al., Cancer Discovery, April 2013, Vol. 3, No. 4, pp. 363-470), and is therefore contemplated for delivering RNA encoding CRISPR Cas to the liver. Approximately four doses of 6 mg / kg LNP every two weeks may be contemplated. Tabernero et al. demonstrated that tumor regression was observed after the first two cycles of LNP administered at 0.7 mg / kg, and by the end of six cycles, the patient achieved a partial response with complete regression of lymph node metastases and substantial shrinkage of the liver tumor. This patient achieved a complete response after 40 doses, remained in remission, and completed treatment after 26 months of administration. Two patients with RCC and extrahepatic sites of disease, including kidney, lung, and lymph nodes, who had progressed after prior therapy with a VEGF pathway inhibitor, had stable disease at all sites for approximately 8 to 12 months, and a patient with PNET and liver metastases continued in the extension study for 18 months (36 doses) with stable disease.

[0112] In some embodiments, the LNP contains a nucleic acid, and the charge ratio of the nucleic acid backbone phosphate to the cationic lipid nitrogen atom is about 1:1.5-7 or about 1:4. In some embodiments, the LNP also contains a blocking compound that is removable from the lipid composition under in vivo conditions. In some embodiments, the blocking compound is a biologically inert compound. In some embodiments, the blocking compound does not carry any charge on its surface or molecule. In some embodiments, the blocking compound is polyethylene glycol (PEG), hydroxyethyl glucose (HEG)-based polymers, polyhydroxyethyl starch (polyHES), and polypropylene. In some embodiments, the weight of PEG, HEG, polyHES, and polypropylene is about 500-10,000 Da or about 2000-5000 Da. In some embodiments, the blocking compound is PEG2000 or PEG5000.

[0113] In some embodiments, sugar-based particles, such as GalNAc, as described herein, may be used with reference to International Publication No. 2014118272 (hereby incorporated by reference) and Nair, JK et al., 2014, Journal of the American Chemical Society 136 (49), 16958-16961), and the teachings herein apply to all particles unless otherwise clearly stated, particularly with respect to delivery. This may be considered a sugar-based particle, and further details regarding other particle delivery systems and / or formulations are provided herein. Thus, GalNAc may be considered a particle in the sense of other particles described herein, such that general use and other considerations, such as the delivery of such particles, also apply to GalNAc particles. Using a solution-phase conjugation strategy, for example, a triantennary GalNAc cluster (mol. wt.) activated as a pentafluorophenyl (FP) ester was attached to a 5'-hexylamino-modified oligonucleotide (5'-HA ASO, mol. wt.: 8000 Da, Gstergaard et al., Bioconjugate Chem., 2015, 26(8), pp. 1451-1455). :2000) may be attached. Similarly, poly(acrylate) polymers have been described for in vivo nucleic acid delivery (see WO2013158141, incorporated herein by reference). In a further alternative embodiment, CRISPR nanoparticles (or protein complexes) may be premixed with natural serum proteins to improve delivery (Akinc A et al, 2010, Molecular Therapy vol. 18 no. 7, 1357-1364).

[0114] Exosomes are endogenous nanovesicles capable of transporting RNA and proteins and delivering RNA to the brain and other target organs. To reduce immunogenicity, Alvarez-Erviti et al. (2011, Nat Biotechnol 29:341) used autologous dendritic cells for exosome production. Brain targeting was achieved by engineering dendritic cells to express the exosomal membrane protein Lamp2b fused to the neuron-specific RVG peptide. Purified exosomes were loaded with exogenous RNA by electroporation. Intravenously injected RVG-targeted exosomes specifically delivered GAPDH siRNA to neurons, microglia, and oligodendrocytes in the brain, resulting in specific gene knockdown. Pre-exposure to RVG exosomes did not attenuate knockdown, and nonspecific uptake in other tissues was not observed. The therapeutic potential of exosome-mediated siRNA delivery was demonstrated by potent mRNA (60%) and protein (62%) knockdown of BACE1, a therapeutic target for Alzheimer's disease. The teachings of Alvarez-Erviti et al. can be applied and / or adapted to generate and / or deliver the CRISPR-Cas system molecules described herein.

[0115] In some embodiments, the delivery vehicle is a virus-like particle (VLP). As used herein, the term "virus-like particle" (VLP) refers to a structure that resembles a virus in at least one attribute, but has not demonstrated infectious properties. A VLP may be a non-replicating, non-infectious viral shell that contains a viral capsid but lacks all or part of the viral genome, particularly the replication components of the viral genome. VLPs are generally composed of one or more viral proteins, such as, but not limited to, proteins referred to as capsid, coat, shell, surface, and structural proteins (e.g., VP1, VP2). VLPs may also resemble the structure of bacteriophages, being non-replicating, non-infectious, and lacking at least the gene(s) encoding the bacteriophage replication machinery and the gene(s) encoding proteins involved in viral attachment or entry into a host.

[0116] vector Vectors useful in the present disclosure are suitable for replication, and optionally integration, in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulating the expression of the desired nucleic acid sequence.

[0117] The vector of the present disclosure can also be used for nucleic acid immunization and gene therapy by using standard gene delivery protocol.The method of gene delivery is known in the art.For example, it is described in U.S. Patent No. 5,399,346, 5,580,859, 5,589,466, and they are incorporated herein by reference in their entirety.In another embodiment, the present disclosure provides a gene therapy vector.

[0118] In some embodiments, the isolated nucleic acid of interest can be cloned into many types of vectors. For example, the nucleic acid can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0119] In some embodiments, the vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. Generally, a suitable vector contains a functional replication origin in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (see, for example, WO 01 / 96584, WO 01 / 29058, and U.S. Patent No. 6,326,193).

[0120] Many virus-based systems have been developed for gene transfer into mammalian cells (e.g., BHK, VERO, HT1080, 293, RD, COS-7, or CHO cells). For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of interest either in vivo or ex vivo.

[0121] In some embodiments, the viral vector can be any vector, including but not limited to, adeno-associated virus (AAV), recombinant adeno-associated virus (rAAV), parvovirus, dependovirus, adenovirus, lentivirus, SV40 virus, or a combination thereof. In some embodiments, the viral vector is linear.

[0122] In some embodiments, vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer, because they allow the stable integration of transgenes over a long period of time and their proliferation in daughter cells.Lentivirus vectors have an additional advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells such as hepatocytes.They also have the additional advantage of being less immunogenic.

[0123] In some embodiments, the viral vector is an AAV vector, or any variant and serotype thereof, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and / or AAV9. In some embodiments, the AAV is AAV2, AAV5, AAV8, and / or AAV9. The viral vector can include a reporter, such as a fluorescent reporter or a chemiluminescent reporter, for example, green fluorescent protein (GFP) and luciferase, respectively.

[0124] AAV vectors provide a powerful gene delivery tool for the treatment of various disorders. AAV vectors have many characteristics that make them ideally suited for gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Gene therapy compositions can include viral vectors, including adenovirus-associated vectors (AAV), as well as their variants and serotypes, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and / or AAV9. The expression of a specific gene contained in an AAV vector can be specifically targeted to one or more types of cells by selecting the appropriate combination of AAV serotype, promoter, and delivery method.

[0125] In one embodiment, the gene of interest is contained within an AAV vector. More than 30 natural serotypes of AAV are available. Many natural variants of AAV capsids exist, allowing the identification and use of AAVs with properties particularly suited to skeletal muscle. AAV viruses can be engineered using conventional molecular biology techniques, allowing these particles to be optimized for cell-specific delivery of myotubularin nucleic acid sequences, minimizing immunogenicity, adjusting stability and particle lifespan, efficient degradation, precise delivery to the nucleus, etc.

[0126] In some embodiments, the transposase includes, but is not limited to, Sleeping Beauty (e.g., Sleeping Beauty 10, 11, 100X), Piggyback, Piggy bat, Mu (e.g., MuA), TcBuster, Mos1, Tol1, Tol2, Frog Prince, spinON, HimarI, Passport, Minos, hAT, Hsmar1, Harbinger, Harbinger3-DR, Acids, PIF, Tn3, Tn5, Tn10, Tn552, Tn903, Ty1, Tc1, IS5, IS911, Hor, and derivatives and analogs thereof. Also included are combinations of transposases. As used herein, a transposon is one that is readily recognized and available by those skilled in the art. In some embodiments, the transposon corresponds to its respective transposase, for example, a Sleeping Beauty transposon or a PiggyBac transposon. In some embodiments, the constructs and viral vectors comprise a promoter.

[0127] Some embodiments provided herein relate to single-component constructs and viral vectors for delivery of nucleic acids to a target cell genome, a) a first nucleic acid encoding a transposon containing a gene of interest; and b) a second nucleic acid encoding a transposase that functions in target cells but not in producer cells.

[0128] In some embodiments, methods of virus production are described that utilize non-mammalian (e.g., vertebrate) production hosts (e.g., producer cells) to produce viral particles. The subject constructs described herein can be delivered to producer cells by standard transduction methods known to those skilled in the art using viruses compatible with the producer cells, e.g., baculovirus. Differences between spliceosome and splice site recognition between species, target cells (i.e., mammalian cells) and producer cells (i.e., non-mammalian cells, e.g., insect cells such as Trichoplusia ni (Tn5) or Sf9)) are exploited herein to enable vector production without premature transposase activity in the producer cells. Premature transposase activity in the producer cells leads to destruction of the vector genome before it can be packaged into viral particles.

[0129] In some embodiments, both ends of the transposon are flanked by inverted repeat transposable elements that are specifically recognized by the transposase. In some embodiments, the inverted terminal repeats flank the gene of interest, a portion of the transposase on the lagging strand, and a portion of the intron. All four fragments (the gene of interest, the inverted terminal repeats on either end of the gene of interest, a portion of the transposase on the lagging strand, and a portion of the intron) constitute the transposon region (see Figure 1 for clarity). In some embodiments, the transposon / transposase system of the construct and viral vector is flanked by transposon inverted repeats (IRs) along with the transposase, and the entire cassette is flanked by AAV inverted terminal repeats (ITRs) (Figure 1). In some embodiments, a viral vector is used to deliver a gene of interest to a target cell, and the viral vector comprises: a) a first nucleic acid encoding a transposon containing the gene of interest; and b) a second nucleic acid encoding a transposase that functions in target cells but not in producer cells. This viral vector is designed to integrate into the genome of a target mammalian cell, referred to herein as a "target cell," and express its intended cargo (e.g., a gene of interest) while simultaneously partially or completely inactivating or disrupting the transposase open reading frame, thereby partially or completely inhibiting production of the transposase protein (Figure 2). This inactivation or disruption of the transposase is a designed safety feature of the vector, as it provides for self-limiting of the transposase once transposed.

[0130] In some embodiments, the cargo is one or more therapeutic agents, including those described herein. In some embodiments, exemplary polypeptides, nucleic acids, or other therapeutic agents include those useful in treating Duchenne muscular dystrophy, limb-girdle myopathies, and spinal muscular atrophies, as well as other muscle-related disorders. Exemplary muscle-related disorders include acid maltase deficiency (AMD), amyotrophic lateral sclerosis (ALS), Andersen-Tauil syndrome, Becker muscular dystrophy (BMD), myotonia congenita (Becker disease), Bethlem myopathy, spinal-bulbar muscular atrophy (SPMA), carnitine deficiency, carnitine palmitoyltransferase deficiency (CPT deficiency), central core myopathy (CCD), centronuclear myopathy, Charcot-Marie-Tooth disease (CMT), and congenital muscle-related disorders. Congenital myasthenic syndrome (CMD), congenital myosthenic syndrome (CMS), congenital myotonic dystrophy, Kori's disease (debranching enzyme deficiency), debranching enzyme deficiency, Dejerine-Sottas disease (DSD), dermatomyositis (DM), distal muscular dystrophy (DD), Duchenne muscular dystrophy (DMD), myotonic dystrophy, Emery-Dreifuss muscular dystrophy (EDMD), endocrine myopathy, Eulenberg's disease (congenital paramyotonia), Facioscapulohumeral muscular dystrophy (FSH or FSHD), Finnish (tibial) distal myopathy, Forbes disease (debranching enzyme deficiency), Friedreich's ataxia (FA), Fukuyama congenital muscular dystrophy, glycogen storage disease type 10, glycogen storage disease type 11, glycogen storage disease type 2, glycogen storage disease type 3, glycogen storage disease type 5, glycogen storage disease type 7, glycogen storage disease type 9, Gowers-Laing distal myopathy, Hauptmann-Thannhauser muscular dystrophy (Emery-Dreifuss muscular dystrophy), hereditary inclusion body myositis , hereditary motor and sensory neuropathy (Charcot-Marie-Tooth disease), hyperthyroid myopathy, hypothyroid myopathy, inclusion body myositis (IBM), hereditary myopathy, integrin-deficient congenital muscular dystrophy, Kennedy disease (spinal-bulbar muscular atrophy), Kugelberg-Welander disease (spinal muscular atrophy), lactate dehydrogenase deficiency, Lambert-Eaton myasthenic syndrome (LEMS), limb-girdle muscular dystrophy (LGMD), Lou Gehrig's disease (amyotrophic lateral sclerosis),Glycogen storage disease type 5 (phosphorylase deficiency), merosin-deficient congenital muscular dystrophy, muscle metabolic disorders, mitochondrial myopathy, Miyoshi distal myopathy, motor neuron disease, muscle-oculencephalopathy, myasthenia gravis (MG), myoadenylate deaminase deficiency, myofibrillar myopathy, myophosphorylase deficiency, myotonia congenita (MC), myotonic muscular dystrophy (MMD), myotubular myopathy (MTM or MM), nemaline myopathy, Nomura-type distal myopathy, oculopharyngeal muscular dystrophy (OPMD), congenital paramyotonia, Pearson syndrome, periodic paralysis, gastrocnemius muscle atrophy (Charcot-Marie-Tooth disease), phosphofructokinase deficiency, phosphoglycerin kinase These include, but are not limited to, maltase deficiency, phosphoglycerate mutase deficiency, phosphorylase deficiency, polymyositis (PM), Pompe disease (acid maltase deficiency), progressive external ophthalmoplegia (PEO), rod body myopathy (nemaline myopathy), spinal muscular atrophy (SMA), spinal-bulbar muscular atrophy (SBMA), Steinert disease (myotonic muscular dystrophy), Tarui disease (phosphofructokinase deficiency), Thomsen disease (myotonia congenita), Ullrich congenital muscular dystrophy, Walker-Warburg syndrome (congenital muscular dystrophy), Welander distal myopathy, Werdnig-Hoffmann disease (spinal muscular atrophy), and ZASP-related myopathy.

[0131] In some embodiments, exemplary polypeptides include neuroprotective polypeptides and anti-angiogenic polypeptides. Suitable polypeptides include, but are not limited to, glial cell line-derived neurotrophic factor (GDNF), fibroblast growth factor 2 (FGF-2), nurturin, ciliary neurotrophic factor (CNTF), nerve growth factor (NGF, e.g., nerve growth factor beta), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), neurotrophin-6 (NT-6), epidermal growth factor (EGF), pigment epithelium-derived factor (PEDF), Wnt polypeptides, soluble Flt-1, angiostatin, endostatin, VEGF, anti-VEGF antibodies, soluble VEGFR, factor VIII (FVIII), factor IX (FIX), and members of the hedgehog family (such as Sonic hedgehog, Indiana hedgehog, and desert hedgehog).

[0132] In some embodiments, useful therapeutic products encoded by heterologous nucleic acid sequences include hormones, and growth and differentiation factors, including insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone-releasing factor (GRF), follicle-stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony-stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factor I and II (IGF-I and IGF-II). , any one of the transforming growth factor alpha superfamily (including TGFα, activin, inhibin, or any of the bone morphogenetic proteins (BMP) BMP1-15), any one of the heregulin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neurturin, agrin, any one of the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.

[0133] In some embodiments, useful heterologous nucleic acid sequence products include proteins that regulate the immune system, including, but not limited to, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-25 (including IL-2, IL-4, IL-12, and IL-18), monocyte chemotactic proteins, leukemia inhibitory factor, granulocyte-macrophage colony-stimulating factor, Fas ligand, tumor necrosis factor alpha and beta, interferons (alpha, beta, and gamma), stem cell factor, and flk-2 / flt3 ligand. Gene products produced by the immune system are also useful in the present invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T cell receptors, chimeric T cell receptors, single-chain T cell receptors, class I and class II MHC molecules, and engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins such as membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2, and CD59.

[0134] In some embodiments, useful heterologous nucleic acid sequence products include any one of receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. Useful heterologous nucleic acid sequences also include receptors for cholesterol regulation and / or lipid regulation, including low-density lipoprotein (LDL) receptors, high-density lipoprotein (HDL) receptors, very-low-density lipoprotein (VLDL) receptors, and scavenger receptors. The present invention also encompasses the use of gene products such as members of the steroid hormone receptor superfamily, including glucocorticoid and estrogen receptors, vitamin D receptors, and other nuclear receptors. Additionally, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP-2, myb, MyoD, and myogenin, ETS box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4 C / EBP, SP1, CCAAT box binding proteins, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS binding proteins, STATs, GATA box binding proteins such as GATA-3, and the forkhead family of winged-helix proteins.

[0135] In some embodiments, useful heterologous nucleic acid sequence products include carbamoyl synthetase I, ornithine transcarbamylase, argininosuccinate synthetase, argininosuccinate lyase, arginase, fumaryl acetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, cystatin β-synthase, branched-chain keto acid decarboxylase, albumin, isovaleryl-CoA dehydrogenase, propionyl-CoA carboxylase, methylmalonyl-CoA mutase, glutaryl-CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H protein, T protein, cystic fibrosis transmembrane conductance regulator (CFTR) sequence, and dystrophin cDNA sequence. Still other useful gene products include enzymes useful in enzyme replacement therapy, which are useful for a variety of conditions resulting from a lack of enzyme activity. For example, mannose-6-phosphate-containing enzymes may be used in therapy for lysosomal storage diseases (e.g., suitable genes include those encoding β-glucuronidase (GUSB)).

[0136] In some embodiments, useful heterologous nucleic acid sequence products include those used to treat hemophilia, including hemophilia B (including factor IX) and hemophilia A (including factor VIII and its variants, such as heterodimers and B-deleted domain light and heavy chains; see U.S. Patent Nos. 6,200,560 and 6,221,349). The factor VIII gene encodes 2351 amino acids, and the protein has six domains designated, from the amino to the carboxy terminus, as A1-A2-B-A3-C1-C2 (Wood et al., (1984) Nature, 312:330; Vehar et al., (1984) Nature, 312:337; and Toole et al., (1984) Nature, 342:337). Human factor VIII is processed intracellularly to yield a heterodimer containing primarily a heavy chain containing the A1, A2, and B domains, and a light chain containing the A3, C1, and C2 domains. Both the single-chain polypeptide and the heterodimer circulate in plasma as inactive precursors until activated by thrombin cleavage between the A2 and B domains, releasing the B domain and resulting in a heavy chain consisting of the A1 and A2 domains. The B domain is deleted in the activated procoagulant form of the protein. Furthermore, in the native protein, the two polypeptide chains ("a" and "b") adjacent to the B domain are bound to divalent calcium cations.

[0137] In some embodiments, useful gene products include non-natural polypeptides, such as chimeric or hybrid polypeptides with non-natural amino acid sequences containing insertions, deletions, or amino acid substitutions. For example, single-chain engineered immunoglobulins may be useful for certain immunodeficiency patients. Other types of non-natural gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, used to reduce overexpression of targets.

[0138] In some embodiments, the present invention provides the method for treating stem cell disorder, for example, the disorder of bone marrow stem cell or adult tissue stem cell (that is, somatic stem cell).In some embodiments, adult stem cell can comprise organoid stem cell (that is, stem cell that originates from any target organ or organ system in the body). Examples of bodily organs include, but are not limited to, skin, hair, nails, sensory receptors, sweat glands, sebaceous glands, bones, muscles, brain, spinal cord, nerves, pituitary gland, pineal gland, hypothalamus, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas (pancreatic islet tissue), heart, blood vessels, lymph nodes, lymphatic vessels, thymus, spleen, tonsils, nose, pharynx, larynx, trachea, bronchi, lungs, mouth, pharynx, esophagus, stomach, small intestine, large intestine, rectum, anal canal, teeth, salivary glands, tongue, liver, gallbladder, pancreas, appendix, kidneys, ureters, bladder, urethra, testicles, vas deferens, urethra, prostate, penis, scrotum, ovaries, uterus, fallopian tubes, vagina, vulva, and mammary glands (breasts). Body organ system includes but is not limited to integumentary system, skeletal system, muscular system, nervous system, endocrine system, cardiovascular system, lymphatic system, respiratory system, digestive system, urinary system and reproductive system.In some embodiments, the disorder for treatment is the disorder in any one or more organoid stem cells (that is, stem cells that originate from any organ or organ system in the body).

[0139] The delivery particles described herein may be used and may further comprise a number of different cargo molecules for delivery. Exemplary cargo molecules may include, but are not limited to, nucleic acids, polynucleotides, proteins, polypeptides, polynucleotide / polypeptide complexes, small molecules, sugars, or combinations thereof. Cargoes that can be delivered according to the systems and methods described herein include, but are not necessarily limited to, bioactive agents, including, but not limited to, therapeutic agents, imaging agents, and monitoring agents. Cargoes may be exogenous or endogenous materials.

[0140] Bioactive agents include any molecule that induces an effect in a cell. Bioactive agents may be proteins, nucleic acids, small molecules, carbohydrates, and lipids. When the cargo is or includes a nucleic acid, the nucleic acid may be a separate entity from the DNA-based carrier. In these embodiments, the DNA-based carrier is not itself the cargo. In other embodiments, the DNA-based carrier may itself include a nucleic acid cargo. Therapeutic agents include chemotherapeutic agents, anti-carcinogenic agents, anti-angiogenic agents, tumor suppressors, antibacterial agents, enzyme replacement therapy, gene expression regulators, and expression constructs containing nucleic acids encoding therapeutic proteins or nucleic acids. Therapeutic agents may be peptides, proteins (including enzymes, antibodies, and peptide hormones), cytoskeletal ligands, nucleic acids, small molecules, non-peptide hormones, etc. To increase affinity for the nucleus, the agent may be conjugated to a nuclear localization sequence. Nucleic acids that can be delivered by the methods of the present invention include synthetic and natural nucleic acid materials, including DNA, RNA, transposon DNA, antisense nucleic acids, dsRNA, siRNA, transcribed RNA, messenger RNA, ribosomal RNA, small nucleolar RNA, microRNA, ribozymes, plasmids, expression constructs, and the like.

[0141] In some embodiments, the cargo comprises one or more nucleic acid molecules selected from DNA, mRNA, tRNA, rRNA, siRNA, microRNA, regulatory RNA, and non-coding and coding RNA.

[0142] However, to produce the disclosed viral vectors, a production system is required in which the self-inactivating feature of the viral vector is silent in producer cells. That is, the transposase is not functional in producer cells. Otherwise, the transposase would self-destruct during the production process in producer cells. In one embodiment, the present disclosure describes the use of a production system for a transposon / transposase system combined with a differentially spliced ​​intron (i.e., spliced ​​and functional in mammalian target cells, but not spliced ​​and non-functional in non-mammalian producer cells) for viral vectors, such as AAV and other viruses. The viral vector contains a transposase that functions in target cells but not in producer cells, and the intron is not spliced. The lack of splicing in producer cells does not allow transposase expression in the producer cells, and therefore, transposase expression does not occur, resulting in proper generation of the viral vector (Figures 3A-3B).

[0143] In some embodiments, the transposase is a Tn transposase (e.g., Tn3, Tn5, Tn7, Tn10, Tn552, Tn903), a transposase fused to protein A, protein G (e.g., pAG-Tn5), MuA transposase, Vibhar transposase (e.g., from Vibio harveyi), Ac-Ds, Ascot-1, Bs1, Cin4, Copia, En / Spm, F element, hobo The tagging sequence includes Hsmar1, Hsmar2, IN(HIV), IS1, IS2, IS3, IS4, IS5, IS6, IS10, IS21, IS30, IS50, IS51, IS150, IS256, IS407, IS427, IS630, IS903, IS911, IS982, IS1031, ISL2, L1, Mariner, P element, Tam3, Tc1, Tc3, Tel, THE-1, Tn / O, TnA, Tn3, Tn5, Tn7, Tn10, Tn552, Tn903, Tol1, Tol2, TnlO, Tyl, prokaryotic transposase, or any transposase related to and / or derived from those listed above. In some embodiments, the tagging sequence includes a fusion of Protein A, Protein G, and Tn5 transposase (pAG-Tn5).

[0144] In some embodiments, the constructs and viral vectors include a first nucleic acid encoding a transposon containing a gene of interest (GOI), the transposon also including, but not limited to, a promoter, a drug selection gene, or other components. In some embodiments, the GOI is flanked by inverted terminal repeats.

[0145] With reference to the Examples and Figures, in some embodiments, constructs and viral vectors include a) a first cassette comprising, for example, in order, an inverted repeat of a transposon, or alternatively, consisting essentially of, a CMV enhancer plus promoter, an intron (e.g., a chimeric intron), a coding sequence of a gene of interest, and a poly(A) signal (e.g., a bGH poly(A) signal); and b) downstream of the first cassette, for example, on the lagging strand and in a reverse orientation, comprising, for example, in order, a promoter (e.g., an SV40 promoter), a first intron (e.g., an SV40 intron), a first portion of a first amino acid coding sequence of a transposase (preferably, the coding sequence of the first 92 amino acids (from the N-terminus) of SB100X), a first portion of a second intron (e.g., a mammalian intron, a human intron, TP53, or GH), a transposase-specific inverted repeat (e.g., a right-specific inverted repeat in a reverse orientation with respect to the orientation of the cassette, a right-Sleeping Amino Acid Sequence Signal (RMS) in a reverse orientation). a second cassette comprising, or consisting essentially of, a first amino acid coding sequence of a transposase (e.g., a nucleotide sequence encoding the remaining amino acid sequence of the first amino acid coding sequence of a transposase, e.g., the 249 amino acid coding sequence of SB100X), a second cassette comprising, or consisting essentially of, a second intron (e.g., a human intron, TP53, or GH), a second portion of a first amino acid coding sequence of a transposase (e.g., the remaining amino acid coding sequence of the first amino acid coding sequence of a transposase, e.g., the 249 amino acid coding sequence of SB100X), and a poly(A) signal (e.g., an SV40 poly(A) signal).

[0146] In some embodiments, the first and second cassettes are flanked by viral (eg, AAV) inverted terminal repeat sequences.

[0147] In some embodiments, the coding sequence of a transposase (e.g., SB100X) is interrupted by an intron (e.g., a mammalian intron, or a human intron, in which a right-handed transposase (e.g., SB100X) inverted repeat is located). In some embodiments, the mammalian intron allows expression of the transposase in target cells (e.g., human cells), but not in producer cells (e.g., insect cells).

[0148] In some embodiments, the mammalian intron is recognized by a mammalian spliceosome but not by a non-mammalian spliceosome.

[0149] In some embodiments, the mammalian intron is removed during RNA processing in the target cell, thereby restoring the transposase (e.g., SB100X) coding sequence / reading frame and allowing translation of the transposase (e.g., SB100X transposase) in the target cell. Preferably, the mammalian intron is not removed during RNA processing in the producer cell, thereby interrupting the transposase coding sequence by the mammalian intron in the producer cell (e.g., insect cell) and prematurely terminating translation of the transposase in the producer cell. In some embodiments, the mammalian intron includes one or more stop codons (e.g., stop codons positioned early in the intron sequence). In some embodiments, the transposase (e.g., SB100X) is not expressed in the producer cell (e.g., insect cell). In some embodiments, transposon transposition does not occur in the producer cell, and the viral genome remains intact and is packaged into viral particles. In some embodiments, the transposase gene (e.g., the SB100X gene) contains a mammalian intron that allows the right transposase (e.g., SB) inverted repeat to be introduced into the transposase gene (e.g., the SB100X gene) without blocking expression of the transposase (e.g., the SB100X gene), and this intron is spliced ​​out during RNA processing in the target cell. In some embodiments, the right transposase (e.g., SB) inverted repeat is positioned within the coding sequence of the transposase (e.g., SB100X), thereby ensuring its inactivation upon expression of the initial episomal transposase (e.g., SB100X) and subsequent transposition of the transposon. In some embodiments, the promoter (e.g., SV40) and / or intron (e.g., SV40) and / or the first transposase codon (e.g., the first 92 SB100X codons) are not integrated into the producer cell genome. In some embodiments, the open reading frame of a transposase (e.g., SB100X) is disabled.

[0150] Introduction or delivery of the construct into production cells (e.g., insect cells) can be by any means known to those of skill in the art, including, but not limited to, baculoviral transduction, electroporation, non-viral delivery, hi some embodiments, target cells and / or production cells are transfected / nucleofected by lipofectamine / epifectamine transfection or nucleofection.

[0151] In some embodiments, the self-integrating transposase and the self-inactivating transposase (e.g., siSB) are integrated into the target cell genome. In other embodiments, the construct and viral vector contain a mammalian intron (e.g., a TP53 intron). In some embodiments, the mammalian intron is not recognized by the producer cell (e.g., an insect cell). In still other embodiments, the viral vector is produced in the producer cell (e.g., an insect cell) without expression of the transposase protein (e.g., SB100X).

[0152] In some embodiments described herein, the constructs and viral vectors comprise a first nucleic acid encoding a transposon comprising a gene of interest (GOI), wherein the GOI is selected from the group consisting of CAR, CD19, BCMA, CD20, HER-2, CEA, CD7, CD22, CD33, CD44v6, CD123, CD135, CD38, CD138, CD269, CD319, ROR1, ROR2, GD2, EGFR and variants thereof, EpCAM, GPRC5D, PSMA, WT1, PSCA, ERBB2, CD133, L1CAM, the extracellular domain of MUC16 (MUC-CD), mesothelin, CEA, CD24, carboxy-anhydrase-IX (CAIX), Slamf7, FLT3, Siglec-6, a n These include, but are not limited to, b3 integrin, FAP, CD5, NY-ESO-1, MAGEA3 and MAGEA4.

[0153] In some embodiments, the constructs and viral vectors comprise a first nucleic acid encoding a transposon comprising a gene of interest (GOI), wherein the GOI is selected from the group consisting of factor IX (F9), factor VIII (F8), alanine:glyoxylate aminotransferase (AGXT), alpha-L-iduronidase (IDUA), ornithine transcarbamylase (OTC), lysosomal acid lipase (LIPA), argininosuccinate synthase (ArgS), factor VIII (F9), factor VIII (F8), alanine:glyoxylate aminotransferase (AGXT), factor VIII (F8 ... ase 1 (ASS1), argininosuccinate lyase (ASL), galactosidase alpha (GLA), cathepsin A (CTSA), arylsulfatase B (ARSB), glucosylceramidase beta 1 (GBA), iduronate 2-sulfatase (IDS), cystathionine beta synthase (CBS), acyl-CoA synthetase family member 3 (ACSF3), methylmalonyl-CoA mutase (MMUT), protease Propionyl-CoA carboxylase subunit alpha (PCCA), propionyl-CoA carboxylase subunit beta (PCCB), glucose-6-phosphatase catalytic subunit 1 (G6PC), branched-chain ketoacid dehydrogenase E1 subunit alpha (BCKDHA), phenylalanine hydroxylase (PAH), UDP-glucuronosyltransferase family 1 member A1 (UGT1A1), N-sulfoglucosamine sulfohydrolase (SGSH), galactosamine (N-acetyl)-6-sulfatase (GALNS), prosaposin (PSAP), hexosaminidase subunit alpha (HEXA), mucolipin TRP cation channel 1 (MCOLN1), sphingomyelin phosphodiesterase 1 (SMPD1), galactosylceramidase (GALC), galactosidase beta 1 (GLB1),4-alpha-glucan branching enzyme 1 (GBE1), N-acetyl-alpha-glucosaminidase (NAGLU), hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha (HADHA), ATP-binding cassette subfamily D member 1 (ABCD1), interleukin-12 receptor subunit beta 1 (IL12RB1), acyl-CoA dehydrogenase very long chain (ACADVL), heparan-alpha-glucosaminide N-acetyltransferase (HGS) NAT), hexosaminidase subunit beta (HEXB), serpin family A member 1 (SERPINA1), survival motor neuron 1 (SMN1), cystinosin, lysosomal cystine transporter (CTNS), and the first nucleic acid is flanked by transposon inverted repeats. The vector also contains a second nucleic acid encoding a nonfunctional transposase that is activated in target cells but not in producer cells, including, but not limited to, Sleeping Beauty 10, 11, 100X, PiggyBac, Piggy bat, Mu, TcBuster, Mos1, Tol1, Tol2, Frog Prince, spinON, HimarI, Passport, Minos, hAT, Hsmar1, Harbinger, Harbinger3-DR, Acid, and PIF. In some embodiments, the constructs and viral vectors are flanked by inverted terminal repeats of a virus used for delivery to mammalian cells.

[0154] In some embodiments, the constructs and viral vectors comprise a promoter region, where the promoter includes, but is not limited to, EF1a, CMV, SV 40, and the sequence comprises a nucleic acid sequence comprising at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO:8, SEQ ID NO:10.

[0155] In some embodiments, the constructs and viral vectors comprise a polyadenylation signal, where the polyA comprises synthetic polA, bgH, SV40 polyA, and the sequence comprises, but is not limited to, a nucleic acid sequence comprising at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 14. In some embodiments, the polyA signal comprises in combination with other elements of the constructs and viral vectors.

[0156] In some embodiments, the constructs and viral vectors further comprise a sequence encoding a suicide gene, hi some embodiments, the suicide gene is thymidine kinase, oxidoreductase, cytosine deaminase, thymidine kinase thymidylate kinase (Tdk::Tmk), or deoxycytidine kinase.

[0157] In some embodiments, the constructs and viral vectors comprise a drug selection gene. In some embodiments, the drug selection gene encodes dihydrofolate reductase (DHFR), DHFR double mutant (DHFRdm), hygromycin B phosphotransferase (hph), aminoglycoside phosphotransferase, beta-lactase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), thymidine kinase (TK), lacz (encoding beta-galactosidase), bleomycin resistance, metallothionein, or xanthine guanine phosphoribosyltransferase (XGPRT). In some embodiments, the drug for selection is methotrexate.

[0158] In some embodiments, the constructs and viral vectors comprise a transposase sequence, wherein the transposase is Sleeping Beauty 100x containing an intron, and the sequence comprises a nucleic acid sequence comprising at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO:7.

[0159] In some embodiments, the constructs and viral vectors include an intron, where the intron is selected from TP53 intron 1, TP53 intron 2, a chimeric intron, a β-globin / IgG chimeric intron, an EF1a intron, a CMV intron, or an SV40 intron. In some embodiments, the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 5, 6, or 13. In some embodiments, the intron is positioned within the open reading frame of the transposase set forth in SEQ ID NO: 7. In some embodiments, the intron is selected to be functional in target cells but not functional in producer cells used for virus production. In some embodiments, the intron is included in combination with other elements of the construct or viral vector. In some embodiments, the intron is positioned anywhere within the transposase.

[0160] In some embodiments, target cells include, but are not limited to, human cells, primary cells such as T cells, human T cells, or stem cells, preferably human stem cells.

[0161] In some embodiments, the viral vector is generated (e.g., produced) in a producer cell, which may include, but is not limited to, insect cells, SF9, SF+, yeast cells, Saccharomyces, Pichia pastoris, prokaryotic cells, Lactococcus lactis, Escherichia coli, etc.

[0162] In certain embodiments, the construct and viral vector comprise a chimeric antigen receptor (CAR). In some embodiments, the viral vector expresses a chimeric antigen receptor. CAR refers to a chimeric synthetic receptor that is expressed on target cells and engineered to bind to a specific antigen. CARs are known to those skilled in the art and include CARs CD19, BCMA, CD20, HER-2, CEA, CD7, CD22, CD33, CD44v6, CD123, CD135, CD38, CD138, CD269, CD319, ROR1, ROR2, GD2, EGFR and its variants, EpCAM, GPRC5D, PSMA, WT1, PSCA, ERBB2, CD133, L1 CAM, the extracellular domain of MUC16 (MUC-CD), mesothelin, CEA, CD24, carboxyanhydrase-IX (CAIX), Slamf7, FLT3, Siglec-6, a n These include, but are not limited to, b3 integrin, FAP, CD5, NY-ESO-1, MAGEA3, and MAGEA4.

[0163] In certain embodiments, the constructs and viral vectors comprise a gene of interest that encodes a therapeutic protein, hi some embodiments, the viral vector expresses the therapeutic protein in vitro or in vivo. Therapeutic proteins are known to those skilled in the art and include Factor IX (F9), Factor VIII (F8), alanine:glyoxylate aminotransferase (AGXT), alpha-L-iduronidase (IDUA), ornithine transcarbamylase (OTC), lysosomal acid lipase (LIPA), argininosuccinate synthase 1 (ASS1), argininosuccinate lyase (ASL), galactosidase alpha (GLA), cathepsin A (CTSA), arylsulfatase B (ARSB), glucosylceramidase beta 1 (GBA), iduronate 2-sulfatase (IDS), cystathionine beta synthase (CBS), acyl-CoA synthetase family member 3 (ACSF3), methylmalonyl-CoA mutase (MMUT), propionyl-CoA carboxylase subunit α (α-CoA α). pha (PCCA), propionyl-CoA carboxylase subunit beta (PCCB), glucose-6-phosphatase catalytic subunit 1 (G6PC), branched-chain ketoacid dehydrogenase E1 subunit alpha (BCKDHA), phenylalanine hydroxylase (PAH), UDP-glucuronosyltransferase family 1 member A1 (UGT1A1), N-sulfoglucosamine sulfohydrolase (SGSH), galactosamine (N-acetyl)-6-sulfatase (GALNS), prosaposin (PSAP), hexosaminidase subunit alpha (HEXA), mucolipin TRP cation channel 1 (MCOLN1), sphingomyelin phosphodiesterase 1 (SMPD1), galactosylceramidase (GALC), galactosidase beta 1 (GLB1),These include, but are not limited to, 4-alpha-glucan branching enzyme 1 (GBE1), N-acetyl-alpha-glucosaminidase (NAGLU), hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha (HADHA), ATP-binding cassette subfamily D member 1 (ABCD1), interleukin-12 receptor subunit beta 1 (IL12RB1), acyl-CoA dehydrogenase very long chain (ACADVL), heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), hexosaminidase subunit beta (HEXB), serpin family A member 1 (SERPINA1), survival motor neuron 1 (SMN1), cystinosin, and lysosomal cystine transporter (CTNS).

[0164] In some embodiments, the disclosed delivery vehicles are useful in conjunction with CRISPR / Cas systems for gene editing. Generally, CRISPR-Cas or CRISPR system as used herein and in documents such as WO 2014 / 093622 (PCT / US2013 / 074667) collectively refers to the transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr-mate sequences (including "direct repeats" and tracrRNA-processed partial direct repeats in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), or "RNAs" as that term is used herein (e.g., sequences encoding Cas9, e.g., CRISPR RNA and trans-activating (tracr) RNA or single guide RNA (sgRNA) (chimeric RNA) to guide Cas), or other sequences and transcripts from the CRISPR locus. In general, CRISPR systems are characterized by elements that promote the formation of a CRISPR complex at the site of the target sequence (also called a protospacer in the context of endogenous CRISPR systems). See, e.g., Shmakov et al. (2015) "Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems," Molecular Cell, DOI: dx.doi.org / 10.1016 / j.molcel.2015.10.008.

[0165] In some embodiments, ARCUS nuclease is considered as the delivery vehicle of the disclosed gene editing.ARCUS nuclease (Precision BioSciences) is based on the naturally occurring genome editing enzyme I-CreI, which evolved in the algae Chlamydomonas reinhardtii, and is a homing endonuclease that performs highly specific cleavage and DNA insertion in cellular DNA.Nuclease can inactivate itself after gene editing, thereby minimizing potential off-targeting.

[0166] In certain embodiments, viral vectors can be used to engineer target cells to stably express the GOI.

[0167] In some embodiments, viral vectors are used to express a GOI in animals or humans for therapeutic purposes.

[0168] In some embodiments, the disclosed compositions (e.g., viral vectors) and methods are useful as therapeutic interventions to ameliorate signs or symptoms of a disease or pathological condition, such as those of cancer. Treatment may also induce remission or cure of conditions such as cancer, particularly central nervous system (CNS) cancers or tumors. In certain examples, treatment includes preventing disease by inhibiting the full development of the disease, such as preventing the development of tumor metastasis. Disease prevention does not require the complete absence of dysplasia or cancer; for example, a reduction of at least about 50% may be sufficient.

[0169] The various alternatives described herein are not intended to be limiting. Other alternatives can be utilized without departing from the scope of the present disclosure as described herein. Thus, one of ordinary skill in the art will readily appreciate that the aspects of the present disclosure, generally as described herein, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are expressly contemplated herein. As non-limiting examples, various arrangements and combinations of transposons, transposases, introns, GOIs, polyA, promoters, and other genetic elements are contemplated herein. [Example]

[0170] 1. [Example 1] Vector integration and expression To demonstrate correct integration and expression of the vector, two constructs were generated: (i) one carrying the BCMA-CAR cassette and an additional cassette encoding a functional Sleeping Beauty transposase (this construct is also known as BCMA-siSB), and (ii) a control plasmid (BCMA-siSB-scrambled) that was identical to plasmid (i) except for two nucleotides in the SB coding sequence that abolished SB expression. Both constructs contained two separate cassettes. The first cassette (identical in both constructs i and ii) contains the following elements in sequential order: a. Left SB-specific inverted repeat b. CMV enhancer + promoter c. Chimeric intron d. BCMA coding sequence e. bGH poly(A) signal

[0171] The second cassette of construct (i) is downstream of the first cassette but on the lagging strand, and is therefore in the reverse orientation, and contains the following elements in consecutive order (5' to 3'): f. SV40 promoter g. SV40 intron h. Coding sequence for the first 92 amino acids (from the N-terminus) of SB100X i. First part of a human intron (TP53, or GH) j. Right SB-specific inverted repeat (reverse orientation relative to the cassette orientation) k. Second part of human intron (TP53, or GH) l. The remaining coding sequence for 249 amino acids of SB100X m. SV40 poly(A) signal The sequence of the second cassette in plasmid (ii) is identical to that of the second cassette on plasmid (i), except for two nucleobase changes. These two base changes changed the tyrosine codon at position 56 and the serine codon at position 58 of the amino acid sequence to stop codons. These premature stop codons terminate translation of SB100X and do not produce any (functional) transposase, and therefore may be referred to as a scrambled control.

[0172] These two cassettes are further flanked by inverted terminal repeats of the virus, in this case AAV, thus encompassing the entire two cassettes in the AAV genome. Figure 1 and Figures 4A-4B provide a schematic diagram of the custom AAV genome and all previously summarized elements, in order. As can be deduced from the summary of elements and as shown in Figure 1, the SB100X gene has its coding sequence interrupted by a mammalian (e.g., human) intron, into which a right-handed SB inverted repeat is located. The sequence between the two SB inverted repeats (within the SB100X gene, the start of the first cassette on the left and the intron on the right) constitutes a transposable element (Figure 1). The mammalian intron allows SB100X expression in mammalian cells, as opposed to insect cells, because this intron is recognized by the mammalian spliceosome but not the insect spliceosome. Removal of this intron during RNA processing restores the SB100X coding sequence / reading frame in mammalian cells, which can then be translated into the SB100X transposase (Figure 2). Without intron removal, the coding sequence is interrupted by the intron, and translation terminates prematurely due to the presence of a premature stop codon in the intron sequence. Therefore, SB100X is not expressed in insect cells, and therefore, transposon transposition does not occur, leaving the AAV genome intact for packaging into viral particles. Because mammalian cells allow expression of the SB100X transposase, these cells cannot be used as production hosts because the AAV genome is disrupted by the transposition event upon SB100X expression (Figures 3A-3B). Therefore, the presence of a mammalian intron in the SB100Xx gene allowed the introduction of an appropriate SB inverted repeat sequence within the SB100X gene without blocking SB100X expression, because this intron is spliced ​​out during RNA processing. The positioning of the right SB inverted repeat sequence in the SB100X coding sequence ensures its inactivation upon initial episomal SB100X expression and subsequent transposon transposition.This is because the SV40 promoter (and SV40 intron) and the first 92 SB100X codons are not integrated into the host genome, thus invalidating the SB100X open reading frame (Figure 2).

[0173] The self-inactivating SB technology was constructed and tested with two different human introns, A (TP53 intron) and intron C (hGH intron) (Figures 4A-4B).

[0174] 2. [Example 2] Verification of construct efficacy To verify the correct functionality of the constructs in mammalian cells (i.e., target cells) and insect cells (i.e., AAV-producing cells), the disclosed constructs were tested in HEK293t cell lines (mammalian cells) and SF9 cells (insect cells). As previously described, the artificial intron placed in the SB100X coding sequence is of mammalian origin. We assumed that correct splicing of the SB100X transcript and subsequent transposase production would occur in mammalian cells, that no splicing event would occur in insect cells, and that SB100X protein would therefore not be found in SF9 insect cells. The siSB constructs were introduced into HEK293t and SF9 cells by either lipofectamine / epifectamine transfection or nucleofection. Cells were allowed to recover and grow for 48–72 h after transfection / nucleofection before collecting samples for detection of SB100X transcripts and SB100X protein. Multiple RT-PCR reactions were performed to determine the presence of SB100X transcripts and splice variants (spliced ​​or unspliced). Western blot analysis was performed on the samples to determine SB100X protein expression. Boundary RT-PCR reactions were performed with either both primers flanking the artificial intron or one primer flanking the intron. Thus, these boundary PCRs produce a large amplified product if the transcript is unspliced ​​and a smaller amplified product if the transcript is spliced. Boundary RT-PCR with flanking primers demonstrates correct splicing of intron A (SEQ ID NO: 5A) and two splice variants of intron C (SEQ ID NO: 6) in mammalian cells for both the siSB and siSB-scrambled transposase constructs, as seen in the left panel of Figure 5A. (The less prominent, smaller bands represent the correctly spliced ​​transcript.) The PCR-amplified splice variants were also sent for Sanger sequencing, which verified that the lower band was indeed the correctly spliced ​​product.The right panel of Figure 5A shows the results of another boundary PCR using primers flanking the intron and conditions that allow amplification of only correctly spliced ​​products. Figure 5B shows the expression of the Sleeping Beauty transposase protein in mammalian HEK293 cells only in cells transfected with BCMA-siSB containing intron A but not intron C. In contrast, HEK293t cells transfected with BCMA-siSB-scrambled do not express the SB transposase protein. Finally, we tested the ability of constructs carrying self-integrating and self-inactivating transposases (siSBs) to integrate into the host (target cell) genome. This was done by maintaining dividing initially transfected cells in culture for an extended period of time and analyzing BCMA-CAR expression at multiple time points to determine whether expression was sustained, compared to the siSB-scrambled construct, which should not exhibit sustained BCMA-CAR expression. Figure 5C shows that only the construct carrying BCMA-siSB-intron A can effectively mediate transposon integration, resulting in long-term persistence of BCMA-CAR expression in mammalian cells, while the BCMA-siSB scramble does not exhibit this persistence in expression due to the lack of functional transposase expression (as demonstrated by Western blot analysis). Both the correct and scrambled constructs, carrying intron C, did not exhibit persistence of BCMA expression, indicating that an integration event did not occur in the host genome. This supports the Western blot data as well as the RT-PCR data, which showed minimal production of correctly spliced ​​product compared to other splice variants (which would not be able to produce functional SB protein due to the premature stop codon introduced by the partially spliced ​​artificial intron).To ensure that AAV siSB vectors could be produced in insect cell lines without destroying the vector due to inappropriate expression of SB100X, a test was performed to determine whether both introns were spliced ​​(i.e., functional) in vector-producing cells, i.e., insect cells (Figure 6). To test this, a construct carrying intron A was introduced into insect cells using the Amaxa Cell Line Nucleofector Kit® and a Lonza 2D Nucleofector. Nucleofected cells were then examined for the presence of spliced ​​or unspliced ​​transcripts using RT-PCR. The data showed the presence of only unspliced ​​SB100X transcripts (Figure 6), suggesting that the mammalian intron was not recognized by the insect cells. Thus, such a process prevented the expression of the transposase protein and subsequent destruction of the vector genome in the producer cells, thereby enabling the production of AAV vectors.

[0175] 3. Example 3: The disclosed constructs or viral vectors carrying transposons and transposase genes function in target cells Batches of rAAV virus (approximately e12 gc / ml) encoding either BCMA CAR-siSB-A or BCMA CAR-siSB-Scrambled-A were procured from a commercial supplier (Virovek). As a quality control, the size of the virus was determined and found to be as expected, i.e., 4.7 kb. To determine the functionality of the rAAV, the rAAV was tested in HEK293t cells, determining SB transposase mRNA splicing using the RT-PCR approach described above and SB transposase protein expression by Western blotting. To accomplish this, one day before transduction, approximately 75,000 HEK293t cells were seeded into each well of a 24-well plate containing DMEM medium containing serum (10% FBS). The following day, the medium was completely removed from the wells, and the cells were washed once with DPBS to remove residual serum. rAAV transduction was performed in transduction medium (DMEM medium containing 0.5% FBS) at different multiplicities of infection (MOI) of EE3, E4, and E55. 24 hours after transduction, the medium was replaced with fresh serum-containing DMEM medium (10% FBS). Two days after transduction, cells were harvested to determine SB transposase mRNA splicing, SB transposase protein production, and BCMA CAR expression / stable integration.

[0176] a. To determine splicing of the SB transposase mRNA, boundary RT-PCR was performed for detection of the SB100X transcript, as described above in Example 1. Boundary PCR amplifies a larger product when SB100X is unspliced ​​(thus retaining the artificial intron) and a smaller product when the transcript is spliced ​​(when the artificial intron is removed and the SB100X reading frame is restored). Figure 7A indeed shows the presence of both unspliced ​​and spliced ​​SB100X transcripts. Because transcription is a continuous process, it was expected that both forms would be found in rAAV-transfected cells.

[0177] b. To determine BCMA CAR expression by flow cytometry, HEK293t cells transduced with either BCMA CAR-siSB-A or BCMA CAR-siSB-Scrambled-A were stained with BCMA CAR detection reagent (CD269 protein, His and Fc tags, PE conjugated) and analyzed by flow cytometry on a BD LSRFortessa instrument. A dose-dependent correlation between the MOI of the rAAV used for transduction and BCMA CAR expression was observed. As shown in Figure 7B, a maximum of 79% of the cell population expressed BCMA CAR at an MOI of E5. As a comparative control, HEK293t cells were transduced with a lentiviral vector encoding BCMA-CAR.

[0178] c. To determine the expression of BCMA CAR, HEK293t cells transduced with either BCMA CAR-siSB-A or BCMA CAR-siSB-Scrambled-A were lysed using RIPA buffer containing protease inhibitors and centrifuged at 10,000 g for 10 minutes at 4°C. After centrifugation, the supernatant was collected and the total protein concentration was estimated using a Micro BCA Protein Assay Kit (ThermoFisher). Approximately 5 μg of cell lysate was subjected to SDS-PAGE by loading the lysate into a well of Bolt 4-12%, Bis-Tris, 1.0 mm, Mini Protein Gels (ThermoFisher). The gel was then subjected to Western blotting to transfer proteins from the gel onto a PVDF membrane, which was then blocked and incubated with primary antibodies (goat anti-SB antibody and mouse alpha tubulin), followed by secondary antibodies (donkey anti-goat antibody conjugated to IRDye 800CW and donkey anti-mouse antibody conjugated to IRDye 680RD). Finally, the signal was detected using an Odyssey instrument. As shown in Figure 7C, Sleeping Beauty transposase expression was observed only in HEK cells transduced with rAAV encoding BCMA-CAR-siSB, but not in HEK cells transduced with BCMA-CAR-siSB-scrambled, confirming the splicing data shown in Figure 7A and resulting in the production of functional protein.

[0179] 4. Example 4: The disclosed constructs or viral vectors carrying various gene editing tools function in target cells A batch of rAAV virus (approximately e12 gc / ml) encoding either BCMA CAR-siSB-A or BCMA CAR-siSB was prepared. Similar to siSB, any other genome editing tool, such as other transposases, integrases, recombinases, or nucleases, can be used in a similar manner. A viral or non-viral delivery vehicle delivers a single fragment of DNA containing not only the GOI or DNA element that needs to be introduced into the host cell's DNA, but also an enzyme capable of integrating this fragment of DNA into the host cell's genome, thereby self-inactivating it. This can be achieved by incorporating the DNA recognition motifs of these enzymes into an artificial intron and placing this artificial intron within the enzyme's own coding sequence (CDS). For integrases such as lambda integrase, simply replace siSB with self-inactivating lambda integrase (siLambda), which therefore contains an ATT site (lambda integrase recognition motif) within the artificial intron located within its own coding sequence. Another ATT site is placed upstream of the GOI cassette, and the left IR is placed in the siSB machinery (S. Harsha Vijaya Chandra et al., Nucleic Acids Research, Volume 44, Issue 6, 7 April 2016).

[0180] In nucleases, including but not limited to CRISPR / Cas9 (or any other targeted nuclease capable of generating a blunt double-strand break), a recognition motif is incorporated into an artificial intron (in this case, a PAM sequence and a spacer sequence). The Cas protein is then first produced during splicing of the intron from its own transcript. Upon binding to the sgRNA, the Cas ribonucleoprotein (RNP) recognizes not only the spacer sequence in the host's genome, but also the identical spacer sequence within the artificial intron within its own coding sequence. Upon generating a double-strand break (DSB) in the host DNA, the Cas ribonucleoprotein (RNP) also cleaves the template DNA on which the nuclease's own coding sequence resides, thereby destroying the coding sequence in the process. This DSB in the host genome can then be repaired by HITI (homologous target-site-specific gene knock-in technology), where a fragment of linearized DNA can be integrated (SK TsuneLNG, et al, Nature 540, 144-149(2016)). Figure 8A provides a mechanism for introducing the recognition motif only into the CAS coding sequence (CDS), while Figure 8B provides a mechanism for introducing the recognition motif immediately upstream of the GOI cassette.

[0181] When using a nuclease that generates staggered double-strand breaks, such as ARCUS nuclease, an ARCUS recognition motif would again be incorporated within the coding sequence of ARCUS itself, within an artificial intron. This recognition motif would also be identical to the recognition motif designed to target it in the host cell's genome and therefore within its own CDS in the DNA template introduced into the cell to integrate the specific DNA element, thereby creating staggered double-strand breaks in both the host's genome and the ARCUS nuclease. If short homology (60-80 bp) arms directly adjacent to the staggered DNA ends of the DNA template are incorporated, the double-strand break in the host's genome can be repaired by ligation-assisted homologous recombination (LAHR) (Zhao Z, et al. Nucleic Acids Res. 2022 Jun 24;50(11):e62). Figure 9A provides a schematic diagram of the mechanism for introducing the recognition motif only into the ARCUS CDS, while Figure 9B provides a schematic diagram for introducing the same recognition motif immediately upstream of the GOI cassette.

[0182] In certain embodiments, viral vectors are used to engineer target cells to stably express a GOI for large-scale protein production by transducing the host cells with a TIE-AAV vector containing a nucleic acid sequence encoding the protein of interest.

[0183] In certain embodiments, the constructs and viral vectors comprise a protein of interest, including, but not limited to, a cytokine, interferon, antibody, monoclonal antibody, single-chain variable fragment (scFv), nanobody, monobody, insulin, erythropoietin, hormone, food processing enzyme (e.g., amylase, cellulase), detergent enzyme (e.g., protease), therapeutic vaccine, clotting factor, growth factor for cell culture, enzyme for biofuel production, and anticoagulant (e.g., tissue plasminogen activator).

[0184] [Cited References and Alternative Embodiments] All references cited herein are incorporated by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0185] As will be apparent to those skilled in the art, many modifications and variations of the present disclosure can be made without departing from its spirit and scope. The specific embodiments described herein are provided by way of example only. The embodiments were chosen and described to best explain the principles of the present disclosure and its practical application, so that those skilled in the art can best utilize the present disclosure and various embodiments, with various modifications suited to the particular applications contemplated. The present disclosure should be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. [Sequence List Free Text]

[0186] Disclosed Nucleic Acid Sequences BCMA-CAR-siSB-A; SEQ ID NO: 1 BCMA-CAR-siSB-C; SEQ ID NO: 2 BCMA-CAR-siSB scrambled A; SEQ ID NO: 3 BCMA-CAR-siSB-scrambled C; SEQ ID NO: 4 Intron A, SEQ ID NO: 5 GTAAGCAAGCAGGACAAGAAGCGGTGGAGGAGACCAAGGGTGCAGTTATGCCTCAGATTCACTTTTATCACCTTTCCTTGCCTCTTTCCTAG Intron C, SEQ ID NO: 6 Gtaagcgcccctaaaatccctttggcacaatgtgtcctgaggggagaggcagcgacctgtagatgggacgggggcactaaccctcagggtttggggttctgaatgtgagtatcgccatgtaagcccagtatttggccaatctcagaaagctcctggctccctggaggatggagagagaaaaacaaacagctcctggagcagggagatgctggcctcttgctctccggctccctctgttgccctctggtttctccccag siSB-A, SEQ ID NO: 7 CMV promoter, SEQ ID NO: 8 gcattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtccgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacaccaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccccgccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagaggtcgtttagtgaaccgtcagatcactagtagctttattgcggtagtttatcacagttaaattgctaacgcagtcagtgctcgactgatcacaggtaagtatcaaggttacaagacaggtttaaggaggccaatagaaactgggcttgtcgagacagagaagattcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag BCMA-CAR, SEQ ID NO: 9 SV40 promoter, SEQ ID NO: 10 TAGAAGTAAAGGCAACATCCACTGAGGAGCAGTTCTTTGATTTGCACCACCACCGGATCCGGGACCTGAAATAAAAGACAAAAAGACTAAACTTACTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATA GCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCGATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCA Sleeping Beauty 100x: SEQ ID NO: 11 Scrambled Sleeping Beauty 100x, SEQ ID NO: 12 TP53 intron 2:, SEQ ID NO: 13 GTGAGCAGCTGGGGCTGGAGAGACGACAGGGCTGGTTGCCCAGGGTCCCCAGGCCTCTGATTCCTCACTGATTGCTCTTAAGCAAGCAGGACAAGAAGCGGTGGAGGAGACCAAGGGTGCAGTTATGCCTCAGATTCACTTTTATCACCTTTCCTTGCCTCTTTCCTAG SV40 poly(A) signal: SEQ ID NO: 14 GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT

Claims

1. A polynucleotide comprising: (i) a transposable element comprising a pair of inverted repeat sequences; (ii) a first nucleic acid sequence encoding a transposase; and (iii) a mammalian intron located in the first nucleic acid sequence.

2. 2. The polynucleotide of claim 1, wherein a first inverted repeat sequence in the pair of inverted repeat sequences is located upstream of the first nucleic acid sequence and a second inverted repeat sequence in the pair of inverted repeat sequences is located within the first nucleic acid sequence.

3. The method of claim 2 , wherein the second inverted repeat sequence is located within the mammalian intron.

4. The polynucleotide of any one of claims 1 to 4, wherein the transposable element further comprises a cargo nucleic acid sequence flanking the pair of inverted repeats.

5. 5. The polynucleotide of claim 4, wherein the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

6. The polynucleotide of claim 4 or 5, wherein the cargo nucleic acid sequence comprises a gene of interest.

7. The polynucleotide of any one of claims 4 to 6, wherein the cargo nucleic acid sequence encodes a therapeutic agent.

8. The polynucleotide of any one of claims 4 to 7, wherein the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or the mammalian intron.

9. The polynucleotide of any one of claims 4 to 8, wherein the transposable element further comprises a transcriptional regulator operably linked to the cargo nucleic acid sequence.

10. The polynucleotide of claim 9, wherein the transcriptional regulatory element is a promoter.

11. The polynucleotide of any one of claims 1 to 10, wherein the transposase is a self-integrating transposase and a self-inactivating transposase.

12. 12. The polynucleotide of any one of claims 1 to 11, wherein the polynucleotide further comprises a pair of AAV inverted terminal repeat sequences flanking the transposable element and the first nucleic acid sequence.

13. The polynucleotide of any one of claims 1 to 12, wherein the intron is not spliced ​​when the polynucleotide is in a producing cell, thereby causing the self-integrating transposase and the self-inactivating transposase to not function.

14. The polynucleotide of any one of claims 1 to 13, wherein the intron is spliced ​​when the polynucleotide is in a target cell, thereby rendering the self-integrating transposase and the self-inactivating transposase functional.

15. 15. The polynucleotide of any one of claims 1 to 14, wherein when the polynucleotide is in a target cell, the transposase splices the IR to favor transposition and integration of the cargo in the target region of interest.

16. 1. A polynucleotide comprising: (i) a first nucleic acid sequence comprising a nucleic acid cassette encoding a Cas nuclease; (ii) a second nucleic acid sequence comprising a nucleic acid cassette of a guide RNA (gRNA); and (iii) a mammalian intron located in the first nucleic acid sequence.

17. 17. The polynucleotide of claim 16, wherein the first nucleic acid sequence comprises a cargo nucleic acid sequence.

18. 18. The polynucleotide of claim 17, wherein the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

19. 19. The polynucleotide of claim 17 or 18, wherein the cargo nucleic acid sequence comprises a gene of interest.

20. The polynucleotide of any one of claims 17 to 19, wherein the cargo nucleic acid sequence encodes a therapeutic agent.

21. 21. The polynucleotide of any one of claims 17 to 20, wherein the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or the mammalian intron.

22. 22. The polynucleotide of any one of claims 16 to 21, wherein the intron is not spliced ​​when the polynucleotide is in a production cell, thereby preventing the Cas nuclease from functioning.

23. 23. The polynucleotide of any one of claims 16 to 22, wherein when the polynucleotide is in a target cell, the Cas nuclease binds to the gRNA, thereby favoring gene repair by HITI (homologous site-specific gene knock-in technology) and integration of the cargo.

24. A polynucleotide comprising: (i) a nucleic acid sequence comprising a nucleic acid cassette encoding an ARCUS nuclease; and (ii) a mammalian intron located in said nucleic acid sequence.

25. 25. The polynucleotide of claim 24, wherein the nucleic acid sequence comprises a cargo nucleic acid sequence.

26. 26. The polynucleotide of claim 25, wherein the cargo nucleic acid sequence encodes an mRNA, a tRNA, an rRNA, an siRNA, a microRNA, a regulatory RNA, or a non-coding and coding RNA.

27. 27. The polynucleotide of claim 25 or 26, wherein the cargo nucleic acid sequence comprises a gene of interest.

28. The polynucleotide of any one of claims 25 to 27, wherein the cargo nucleic acid sequence encodes a therapeutic agent.

29. 29. The polynucleotide of any one of claims 25 to 28, wherein the cargo nucleic acid sequence does not overlap with the first nucleic acid sequence or the mammalian intron.

30. 30. The polynucleotide of any one of claims 24 to 29, wherein the intron is not spliced ​​when the polynucleotide is in a producing cell, thereby preventing the ARCUS nuclease from functioning.

31. 31. The polynucleotide of any one of claims 24 to 30, wherein when the polynucleotide is in a target cell, the ARCUS nuclease binds to an ARCUS nuclease recognition motif, thereby favoring removal of the cargo, ligation-assisted homologous recombination (LAHR), and gene repair by integration.

32. 32. The polynucleotide of any one of claims 1 to 31, wherein the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:

13.

33. A delivery vehicle comprising the polynucleotide of any one of claims 1 to 32.

34. The delivery vehicle of any one of claims 1 to 33, wherein the delivery vehicle is a lipid nanoparticle (LNP), an extracellular vesicle (EV), an exosome, or a viral vector.

35. 35. The delivery vehicle of any one of claims 1 to 34, wherein the viral vector comprises an adeno-associated virus (AAV), a recombinant adeno-associated virus (rAAV), a parvovirus, a dependovirus, an adenovirus, a lentivirus, or an SV40 virus.

36. The delivery vehicle of any one of claims 1 to 35, wherein the viral vector is AAV.

37. 37. The delivery vehicle of any one of claims 1 to 36, wherein the AAV comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9.

38. 38. The delivery vehicle of any one of claims 1 to 37, wherein the polynucleotide is flanked by viral vector inverted terminal repeats (ITRs).

39. A cell comprising the polynucleotide of any one of claims 1 to 32.

40. A cell comprising a delivery vehicle according to any one of claims 33 to 38.

41. A genetically engineered cell comprising a polynucleotide according to any one of claims 1 to 32 or a delivery vehicle according to any one of claims 33 to 38.

42. A method for genetically modifying a cell, comprising introducing into said cell a polynucleotide according to any one of claims 1 to 32.

43. A method of genetically modifying a cell, comprising introducing into said cell a delivery vehicle according to any one of claims 33 to 38.

44. A method for expressing a gene of interest in a cell, comprising introducing into said cell a polynucleotide according to any one of claims 1 to 32.

45. A method for expressing a gene of interest in a cell, the method comprising introducing into said cell a delivery vehicle according to any one of claims 33 to 38.

46. 46. ​​The method of claim 44 or claim 45, wherein the cells stably express the gene of interest.

47. 39. A method of treating, ameliorating, or inhibiting a disease, disorder, or condition in a subject in need thereof, comprising administering to the subject the polynucleotide of any one of claims 1-32 or the delivery vehicle of any one of claims 33-38.

48. 33. A method of manufacturing or producing a delivery vehicle in a production cell, wherein said delivery vehicle comprises a polynucleotide according to any one of claims 1 to 32.

49. A method of manufacturing or producing a cell comprising a delivery vehicle comprising the polynucleotide of any one of claims 1 to 32.

50. A method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a transposable element comprising the cargo nucleic acid sequence and a pair of inverted repeat sequences; (ii) a first nucleic acid sequence encoding a transposase; and (iii) a mammalian intron located within the first nucleic acid sequence.

51. 51. The method of claim 50, wherein the transposase is activated during the splicing of the intron.

52. 52. The method of claim 51 , wherein the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:

13.

53. 53. The method of any one of claims 50 to 52, wherein the activating transposase splices the IR to favor the transposition and integration of the gene of interest in the target region of interest.

54. 1. A method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a first nucleic acid sequence comprising a nucleic acid cassette encoding a Cas nuclease; (ii) a second nucleic acid sequence comprising a nucleic acid cassette of a guide RNA (gRNA); and (iii) a mammalian intron located in the first nucleic acid sequence.

55. 55. The method of claim 54, wherein the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:

13.

56. 56. The method of any one of claims 54 to 55, wherein the Cas nuclease is activated upon splicing of the intron.

57. 57. The method of Claim 56, wherein the activated Cas nuclease binds to the gRNA, thereby favoring gene repair by HITI (homologous site-specific gene knock-in technology) and integration of the gene of interest.

58. A method for integrating a cargo nucleic acid sequence into the genome of a mammalian cell, the method comprising introducing into the mammalian cell a polynucleotide comprising: (i) a nucleic acid sequence comprising a nucleic acid cassette encoding an ARCUS nuclease; and (ii) a mammalian intron positioned in the nucleic acid sequence.

59. 59. The method of claim 58, wherein the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:

13.

60. 60. The method of any one of claims 58 to 59, wherein the ARCUS nuclease is activated during splicing of the intron.

61. 61. The method of claim 60, wherein the activated ARCUS nuclease binds to a recognition motif for ARCUS nuclease, thereby favoring gene repair by excision, ligation-assisted homologous recombination (LAHR), and integration of the gene of interest.

62. 1. A construct for delivering a nucleic acid into a cellular genome, comprising: a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a second amino acid coding sequence of said transposition; and vii) a second cassette comprising a poly(A) signal; A construct wherein the second cassette is functional in target cells but not in producer cells.

63. 1. A delivery vehicle for delivering a nucleic acid into a cellular genome, comprising: a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a second amino acid coding sequence of said transposition; and vi) a second cassette comprising a poly(A) signal; A delivery vehicle wherein said second cassette is functional in target cells but not in producer cells.

64. 1. A viral vector for delivery of a nucleic acid into a cellular genome, comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; b) a second nucleic acid encoding a transposase that functions in the target cells but not in the producer cells.

65. 65. The viral vector of claim 64, wherein the second nucleic acid encodes a transposase coding region interrupted by an intron that is spliced ​​in target cells and not spliced ​​in producer cells.

66. 66. The viral vector of claim 65, wherein the intron comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:

13.

67. A cell comprising the viral vector of any one of claims 64 to 66.

68. A method for genetically modifying a cell, comprising introducing the viral vector of any one of claims 64 to 66 into the cell.

69. A method for gene transfer using the viral vector according to any one of claims 64 to 66.

70. A method for expressing a gene of interest in a cell, the method comprising introducing the viral vector of any one of claims 64 to 66 into the cell.

71. 71. The method of claim 70, wherein the cells stably express the gene of interest.

72. 67. An engineered cell comprising the viral vector of any one of claims 64 to 66.

73. 67. A method of treating, ameliorating, or inhibiting a disease, disorder, or condition using the viral vector of any one of claims 64 to 66.

74. 1. A method for producing or generating a viral vector in a producer cell, the vector comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; b) a second nucleic acid encoding a transposase that functions in the target cell but not in the production cell.

75. 75. The method of claim 74, wherein the vector comprises an intron and the production cell is unable to splice the intron.

76. 1. A method for producing or generating a cell containing a viral vector, the method comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; b) a second nucleic acid encoding a transposase that functions in the target cell but not in the production cell.

77. 1. A construct for delivery of a nucleic acid into a cell genome, comprising: a) a first nucleic acid encoding a transposon comprising a gene of interest; b) a second nucleic acid encoding a transposase that functions in the target cell but not in the producer cell.

78. 78. The construct of claim 77, wherein the second nucleic acid encoding a transposase further comprises an intron that splices in a target cell but not in a producer cell.

79. 1. A construct for delivery of a nucleic acid into a cell genome, comprising: a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a second amino acid coding sequence of said transposition; and vii) a second cassette comprising a poly(A) signal; A construct wherein the second cassette is functional in target cells but not in producer cells.

80. 1. A viral vector for delivery of a nucleic acid into a cellular genome, comprising: a) a first cassette, i) an inverted repeat sequence of a transposon; ii) an enhancer; and iii) a promoter; and iv) an intron; and v) a target antigen coding sequence; and vi) a first cassette comprising a poly(A) signal; b) a second cassette, i) a promoter; and ii) a first intron; and iii) a first amino acid coding sequence of a transposase; and iii) a first portion of a second intron; and iv) a transposase-specific inverted repeat sequence; and v) a second portion of the second intron; and vi) a second amino acid coding sequence of said transposition; and vii) a second cassette comprising a poly(A) signal; A viral vector, wherein the second cassette functions in target cells but not in producer cells.

Images