Compositions and methods for inhibiting the expression of alas1 genes

Abstract

Double-stranded ribonucleic acids that target ALAS1 genes, pharmaceutical compositions, and methods of inhibiting ALAS1 expression in cells are provided.SOLUTION: Double-stranded ribonucleic acids for inhibiting the expression of ALAS1 are provided, wherein the double-stranded ribonucleic acids comprise a sense strand and an antisense strand, wherein the antisense strand comprises a region complementary to ALAS1RNA transcripts, wherein the antisense strand comprises at least 20 contiguous nucleotides from an antisense sequence of UAAGAUGAGACACUCUUUCUGGU or UAAGAUGAGACACUCTUUCUGGU.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 61 / 887,288, filed October 4, 2013, and U.S. Provisional Patent Application No. 61 / 983,720, filed April 24, 2014, the entire contents of each of the foregoing applications being incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, the entire contents of which are incorporated by reference. The ASCII copy, created on October 2, 2014, is named A2038-7202WO_SL.txt and is 1,107,486 bytes in size.

[0003] The present invention relates to the specific inhibition of expression of the ALAS1 gene. [Background technology]

[0004] Hereditary porphyrias are a group of disorders resulting from the deficiency of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway. Deficiencies in porphyrin pathway enzymes result in insufficient heme production and in the accumulation of porphyrin precursors and porphyrins, which are toxic to tissues at high concentrations.

[0005] Among the hereditary porphyrias, acute intermittent porphyria (e.g., AIP, e.g., autosomal dominant AIP), variegate porphyria (e.g., autosomal dominant VP, e.g., autosomal dominant VP), hereditary coproporphyria (e.g., copropophyria or HCP, e.g., autosomal dominant HCP), and 5'-aminolevulinic acid (also known as δ-aminolevulinic acid or ALA) dehydratase deficiency porphyria (e.g., autosomal recessive ADP, e.g., ADP), are classified as acute hepatic porphyrias and manifest with acute, potentially life-threatening neurological attacks. Acute attacks are characterized by autonomic, limbic, and central nervous system symptoms, including severe abdominal pain, hypertension, tachycardia, constipation, motor paralysis, complete paralysis, and seizures. If not treated appropriately, they can lead to quadriplegia, respiratory failure, and death. Various factors, including cytochrome P450 inducers, diet, and hormonal changes, can induce acute attacks by increasing the activity of hepatic 5'-aminolevulinic acid synthase 1 (ALAS1), the first and rate-limiting enzyme in the heme biosynthetic pathway. In acute porphyrias, enzyme deficiencies, for example, of AIP, VP, HCP, and ADP, result in the production and accumulation of one or more substances (e.g., porphyrins and / or porphyrin precursors, such as ALA and / or PBG) in the liver, which may be neurotoxic and lead to the development of acute attacks. See, for example, Non-Patent Document 1.

[0006] The current treatment for acute porphyria attacks is intravenous administration of hemin (Panhematin®, Lundbeck or Normosang®, Orphan Europe), which provides exogenous heme for negative feedback inhibition of ALAS1, thereby reducing ALA and PBG production. Hemin is used for treatment during acute attacks and for prevention, particularly in women with acute porphyria who experience frequent attacks due to hormonal changes in the menstrual cycle. While patients generally respond well, the effect is slow, typically requiring 2–4 days or more to normalize urinary ALA and PBG concentrations toward normal levels. Because intravenous hemin is rapidly metabolized, 3–4 infusions are usually required to effectively treat or prevent an acute attack. Furthermore, repeated infusions can lead to iron overload and phlebitis, which can impair marginal venous access. Although orthotrophic liver transplantation is curative, the procedure is associated with significant morbidity and mortality, and the availability of liver donors is limited. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Balwani, M and Desnick, RJ, Blood, 120:4496-4504, 2012 Summary of the Invention [Problem to be solved by the invention]

[0008] Therefore, there is a need for alternative therapeutic approaches that are more effective, fast acting, and safe. It would be particularly advantageous if such therapeutic agents could be delivered by subcutaneous administration, as this would avoid the need for transfusions and prolonged hospital stays.

[0009] AIP, also known as porphobilinogen deaminase (PBGD) deficiency or hydroxymethylbilane synthase (HMBS) deficiency, is the most common acute hepatic porphyria. The prevalence of AIP is estimated at 5–10 per 100,000 people, with approximately 5–10% of patients being symptomatic. AIP is an autosomal dominant disorder caused by mutations in the HMBS gene, which reduces enzyme activity to half of normal levels. Previously, a mouse model of AIP with approximately 30% of wild-type HMBS activity has been generated by homologous recombination. Similar to human patients, administration of porphyrinogenic drugs such as phenobarbital increases hepatic ALAS1 activity in these mice, resulting in the accumulation of large amounts of ALA and PBG in plasma and urine. Therefore, these mice serve as an excellent model for evaluating the efficacy of novel therapeutic agents for acute hepatic porphyria. [Means for solving the problem]

[0010] The present invention describes methods and iRNA compositions for regulating the expression of the ALAS1 gene. In certain embodiments, ALAS1-specific iRNA is used to reduce or inhibit the expression of the ALAS1 gene. Such inhibition can be useful for treating disorders related to ALAS1 expression, such as porphyria.

[0011] Thus, described herein are compositions and methods for causing RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the ALAS1 gene in cells or in a subject (e.g., a mammal, such as a human subject). Also described are compositions and methods for treating diseases associated with ALAS1 gene expression, such as porphyrias, such as X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), porphyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythropoietic porphyria of infancy. In some embodiments, the disease is acute hepatic porphyria, such as ALA dehydratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disease is ALA dehydratase deficiency porphyria (ADP) or AIP.

[0012] In embodiments, the porphyria is a hepatic porphyria, such as a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.

[0013] As used herein, the terms "iRNA," "RNAi," "iRNA agent," "RNAi agent," or "iRNA molecule" refer to an agent that contains RNA, as defined herein, and mediates targeted cleavage of an RNA transcript, e.g., through the RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA described herein results in the inhibition of expression of ALAS1 in a cell or mammal.

[0014] The iRNAs included in the compositions featured herein include dsRNAs having an RNA strand (antisense strand) that is substantially complementary to at least a portion of an mRNA transcript of an ALAS1 gene (e.g., a mouse or human ALAS1 gene), e.g., a region of 30 nucleotides or less in length, generally a region of 19-24 nucleotides (also referred to herein as "ALAS1-specific iRNAs"). Alternatively, or in combination, the iRNAs include dsRNAs having an RNA strand (antisense strand) that is substantially complementary to at least a portion of an mRNA transcript of an ALAS1 gene (e.g., a human variant 1 or 2 of the ALAS1 gene), e.g., a region of 30 nucleotides or less in length, generally a region of 19-24 nucleotides (also referred to herein as "ALAS1-specific iRNAs").

[0015] In embodiments, the iRNA (e.g., dsRNA) described herein comprises an antisense strand having a region substantially complementary to a region of human ALAS1. In embodiments, the human ALAS1 has the sequence of NM_000688.4 (SEQ ID NO: 1) or NM_000688.5 (SEQ ID NO: 382). In embodiments, the human ALAS1 has the sequence of NM_199166.1.

[0016] In embodiments, the antisense sequence of the iRNA (e.g., dsRNA) targets within the region 871-895 on the ALAS1 transcript NM_000688.4 (plus or minus 5, 4, 3, 2, or 1 nucleotides in either or both directions on the 5' and / or 3' end). In embodiments, the antisense sequence targets nucleotides 871-893, 871-892, or 873-895 on the ALAS1 transcript NM_000688.4. In embodiments, the antisense sequence comprises, or consists of, a sequence that is fully complementary or substantially complementary to nucleotides 871-893, 871-892, or 873-895 on the ALAS1 transcript NM_000688.4.

[0017] In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides that differ by no more than 3, 2, or 1 nucleotide from the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the antisense strand comprises the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the sense strand comprises the sequence CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucleotides of antisense strand and / or sense strand are modified as described herein.In embodiments, dsRNA comprises (i) the antisense strand that comprises or consists of the antisense sequence of AD-60489, AD-60519 or AD-61193 and / or (ii) the sense strand that comprises or consists of the sense sequence of AD-60489, AD-60519 or AD-61193 (including one or more (for example, all) modifications of the antisense strand and / or antisense strand of AD-60489, AD-60519 or AD-61193).

[0018] In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and wherein the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides that differ from an antisense sequence listed in any one of Tables 21-40 by no more than 3 (e.g., no more than 0, 1, or no more than 2) nucleotides, or comprises an unmodified version of an antisense sequence listed in any one of Tables 21-40 (e.g., a version having the same nucleotide sequence except that some or all of the nucleotides are unmodified). In one embodiment, the antisense sequence comprises (i) at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) consecutive nucleotides that differ from the antisense sequence of AD-60489, AD-60519, or AD-61193 by no more than three (e.g., no more than zero, one, or two) nucleotides, or (ii) an unmodified version of any one of these sequences. In an embodiment, the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) consecutive nucleotides that differ from UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154) by no more than three (e.g., no more than zero, one, or two) nucleotides. In one embodiment, the antisense sequence targets positions 871-893 of NM_000688.4 (SEQ ID NO: 1). In an embodiment, the sense strand comprises the sequence CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In an embodiment, one or more nucleotides of the antisense strand and / or the sense strand are modified as described herein.

[0019] In some embodiments, the dsRNA is not a sense and / or antisense sequence listed in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20.

[0020] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides that differ from the antisense sequence of AD-60519 by no more than 3 nucleotides, no more than 2 nucleotides, or no more than 1 nucleotide. In an embodiment, one or more nucleotides are modified as described herein.

[0021] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides that differ by no more than three (e.g., no more than zero, one, or two) nucleotides from the antisense sequence of AD-60489 or a derivative of AD-60489 as described herein. In an embodiment, one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-60489 are modified as described herein. In embodiments, the derivative of AD-60489 is AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, or AD-60901. In embodiments, the derivative of AD-60489 is AD-60519. In embodiments, the derivative of AD-60489 is AD-61193.

[0022] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides that differ from a derivative of AD-58632 as described herein by no more than three (e.g., no more than zero, one, or two) nucleotides. In embodiments, one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-58632 are modified as described herein. In embodiments, the derivative of AD-58632 is AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the derivative of AD-58632 is AD-60819.

[0023] In some embodiments, the dsRNA has an IC of less than 1 nM. 50 In some embodiments, the dsRNA has an IC in the range of 0.01 to 1 nM. 50 In embodiments, the dsRNA has an IC of less than 0.05 nM. 50 In embodiments, the dsRNA has an IC of less than 0.02 nM. 50 In embodiments, the dsRNA has an IC of less than 0.01 nM. 50 In an embodiment, IC 50 is determined as described in the Examples herein.

[0024] In some embodiments, the dsRNA has a single dose ED50 of less than about 10 mg / kg. In some embodiments, the dsRNA has a single dose ED50 of less than about 5 mg / kg. In embodiments, EC50 is determined as described in the examples herein.

[0025] In some embodiments, the dsRNA exhibits improved activity compared to AD-58632. In some embodiments, the dsRNA exhibits improved activity compared to AD-60489. In some embodiments, the dsRNA exhibits improved activity compared to AD-58632 and AD-60489.

[0026] In embodiments, the dsRNA is selected from the group consisting of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519 ... 05, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the dsRNA is selected from the group consisting of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-6 and an antisense strand comprising or consisting of an antisense sequence (and / or one or more (e.g., all) modifications) selected from AD-60892, AD-60419, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.In embodiments, the dsRNA is selected from the group consisting of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, and a sense strand comprising or consisting of a sense sequence (and / or one or more (e.g., all) modifications) selected from AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.

[0027] In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand comprising, or consisting of, the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154), and / or (ii) a sense strand comprising, or consisting of, the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucleotides of the antisense strand and / or the sense strand are modified as described herein.

[0028] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-60489, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-60489 (the sense and / or antisense sequences include one or more (e.g., all) modifications of the sense strand and / or antisense strand of AD-60489).

[0029] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-60519, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-60519 (the sense and / or antisense sequences include one or more (e.g., all) modifications of the sense strand and / or antisense strand of AD-60519).

[0030] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-61193, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-61193 (the sense and / or antisense sequences include one or more (e.g., all) modifications of the sense strand and / or antisense strand of AD-61193).

[0031] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises or consists of the antisense sequence of AD-60819, and / or (ii) a sense sequence that comprises or consists of the sense sequence of AD-60819 (the sense and / or antisense sequences include one or more (e.g., all) modifications of the sense and / or antisense strand of AD-60819).

[0032] In embodiments, a dsRNA for inhibiting the expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand (or the corresponding unmodified antisense sequence) comprising or consisting of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and / or (ii) a sense strand (or the corresponding unmodified antisense sequence) comprising or consisting of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819. In embodiments, the dsRNA comprises (i) an antisense strand consisting of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and / or (ii) a sense strand consisting of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense and / or sense strand of the dsRNA differs from the corresponding antisense and / or sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 by one, two, or three nucleotides.

[0033] The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 below.

[0034] [Table 1]

[0035] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises or consists of the antisense sequence of AD-60489, AD-60519, or AD-61193 and / or (ii) a sense strand that comprises or consists of the sense sequence of AD-60489, AD-60519, or AD-61193 (including the nucleotide sequence of the sense strand and / or antisense strand of AD-60489, AD-60519, or AD-61193 and one or more (e.g., all) modifications).

[0036] In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA is AD-60489, AD-60519, AD-61193, or AD-60819. In embodiments, double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA is AD-60489, AD-60519, or AD-61193 (e.g., comprising the nucleotide sequence and / or one or more (e.g., all) modifications of AD-60489, AD-60519, or AD-61193).

[0037] In embodiments, the dsRNA comprises or consists of AD-60489 (eg, including the nucleotide sequence and / or one or more (eg, all) modifications of AD-60489).

[0038] In embodiments, the dsRNA comprises or consists of AD-60519 (eg, including the nucleotide sequence and / or one or more (eg, all) modifications of AD-60519).

[0039] In embodiments, the dsRNA comprises or consists of AD-61193 (eg, including the nucleotide sequence and / or one or more (eg, all) modifications of AD-61193).

[0040] In embodiments, the dsRNA comprises or consists of AD-60819 (eg, including the nucleotide sequence and / or one or more (eg, all) modifications of AD-60819).

[0041] In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61193, AD-60819, or another dsRNA disclosed in any one of Tables 21-40 herein) is effective to suppress liver ALAS1 mRNA levels, e.g., achieving at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% silencing (e.g., such that the ALAS1 mRNA level is reduced to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20% or less of the liver ALAS1 mRNA level in a control, e.g., an untreated individual or group of individuals, e.g., an individual or group of individuals treated with PBS alone). In embodiments, the effectiveness of the dsRNA in suppressing liver ALAS1 mRNA levels is assessed using a non-human primate model, e.g., as described in the Examples herein.

[0042] In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61193, AD-60819, or another dsRNA disclosed in any one of Tables 21-40 herein) is effective to suppress circulating ALAS1 mRNA levels, achieving, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% silencing (e.g., such that ALAS1 mRNA levels are reduced to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20% or less of control circulating ALAS1 mRNA levels, e.g., levels before treatment with the dsRNA or levels in an untreated individual or population). In embodiments, the effectiveness of the dsRNA in suppressing circulating ALAS1 mRNA levels is assessed using a non-human primate model, e.g., as described in the Examples herein. In embodiments, circulating ALAS1 mRNA levels are assessed using a circulating extracellular RNA detection (cERD) assay, e.g., as described herein or in Sehgal, A. et al., "Quantitation of tissue-specific target gene modulation using circulating RNA" (poster presented February 9, 2012, at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) or Sehgal, A. et al., "Tissue-specific gene silencing monitored in circulating RNA," RNA, 20:1-7, published online December 19, 2013.

[0043] The cERD method can be applied to any suitable biological sample.In embodiments, the circulating ALAS1 mRNA level is evaluated using a blood sample such as a serum sample.In embodiments, the circulating ALAS1 mRNA level is evaluated using a urine sample.

[0044] In some embodiments, dsRNA is a derivative of AD-60489, for example, as disclosed in any one of the tables herein.In some embodiments, dsRNA shows improved activity compared with AD-60489.In some such embodiments, dsRNA is AD-60519.

[0045] In embodiments, the dsRNA is a derivative of AD-58632, for example, as disclosed in any one of the tables herein. In embodiments, the dsRNA exhibits improved activity compared to AD-58632.

[0046] In embodiments, improved activity is indicated by a lower IC50, eg, as determined based on an in vitro assay, eg, as described in the Examples herein.

[0047] In embodiments, improved activity is shown by a lower effective dose. The effective dose may be determined based on the administration of a single dose or multiple repeated doses. In embodiments, the effective dose is determined based on the single dose ED50. In embodiments, the effective dose or the single dose ED50 is determined based on an in vivo assay. In embodiments, the in vivo assay is carried out in a non-human animal, such as a rat, a non-human primate, or a mouse.

[0048] In embodiments, an effective dose is determined based on the dose required to achieve a reduction in ALAS1 mRNA levels (e.g., liver and / or circulating ALAS1 mRNA levels), e.g., as described in the Examples herein. In embodiments, circulating mRNA is assessed using a cERD assay.

[0049] In embodiments, an effective dose is determined based on the dose required to obtain a reduction in ALA and / or PBG levels (eg, urine and / or plasma levels).

[0050] In embodiments, an effective dose is determined based on the dose required to achieve a particular therapeutic effect, such as, for example, prevention or reduction of symptoms associated with porphyria, as described herein.

[0051] In embodiments, improved activity is demonstrated by achieving higher liver dsRNA levels. In embodiments, higher liver levels are achieved after a single dose of dsRNA (e.g., a dose of 1, 2.5, 3, 5, or 10 mg / kg). In embodiments, higher liver levels are achieved after multiple doses of dsRNA (e.g., two to ten daily or weekly doses of 1, 2.5, 3, 5, or 10 mg / kg).

[0052] In one embodiment, the iRNA encompasses dsRNA having an RNA strand (antisense strand) with a region substantially complementary to a portion of ALAS1 mRNA, e.g., human ALAS1 mRNA (e.g., human ALAS1 mRNA set forth in SEQ ID NO: 1 or SEQ ID NO: 382).

[0053] In one embodiment, an iRNA that inhibits expression of the ALAS1 gene comprises at least two complementary sequences. The iRNA comprises a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand comprises a nucleotide sequence substantially complementary to at least a portion of the mRNA encoding the ALAS1 transcript, and the complementary region is 30 nucleotides or less and at least 15 nucleotides in length. Typically, the iRNA is 19-24 nucleotides in length.

[0054] In some embodiments, the iRNA is 19-21 nucleotides in length. In some embodiments, the iRNA is 19-21 nucleotides in length and is formulated in a lipid, such as a lipid nanoparticle (LNP) formulation (e.g., an LNP11 formulation).

[0055] In some embodiments, the iRNA is 21-23 nucleotides in length. In some embodiments, the iRNA is 21-23 nucleotides in length and in the form of a complex, e.g., conjugated to one or more GalNAc derivatives, e.g., as described herein.

[0056] In some embodiments, the iRNA is about 15 to about 25 nucleotides in length, and in other embodiments, the iRNA is about 25 to about 30 nucleotides in length. Upon contact with a cell expressing ALAS1, the iRNA targeting ALAS1 inhibits expression of the ALAS1 gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% or more, as assayed, such as by the methods described herein. In one embodiment, the iRNA targeting ALAS1 is formulated in a stable nucleic acid-lipid particle (SNALP).

[0057] In one embodiment, an iRNA (e.g., a dsRNA) featured herein comprises a first sequence of a dsRNA selected from the group consisting of the sense sequences in Tables 21-40, and a second sequence selected from the group consisting of the corresponding antisense sequences in Tables 21-40.

[0058] The iRNA molecules featured herein may contain naturally occurring nucleotides or may contain at least one modified nucleotide. In embodiments, the at least one modified nucleotide includes one or more of the following nucleotide modifications selected from the group consisting of locked nucleic acid (LNA), acyclic nucleotide, hexitol or hexose nucleic acid (HNA), cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, or any combination thereof. In one embodiment, the at least one modified nucleotide includes, but is not limited to, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a nucleotide having a 5'-phosphorothioate group, and a terminal nucleotide linked to a ligand, such as, for example, N-acetylgalactosamine (GalNAc) or a cholesteryl derivative. Alternatively, the modified nucleotides may be selected from the group consisting of 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, acyclic nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and nucleotides containing unnatural bases. Such modified sequences may be based, for example, on a first sequence of the iRNA selected from the group consisting of the sense sequences disclosed in Tables 21-40, and a second sequence selected from the group consisting of the corresponding antisense sequences disclosed in Tables 21-40.

[0059] In one embodiment, an iRNA described herein targets a wild-type ALAS1 RNA transcript variant, while in another embodiment, the iRNA targets a mutant transcript (e.g., an ALAS1 RNA harboring an allelic variant). For example, an iRNA featured herein can target a polymorphic variant, such as a single nucleotide polymorphism (SNP), of ALAS1. In another embodiment, the iRNA targets both wild-type and mutant ALAS1 transcripts. In yet another embodiment, the iRNA targets a specific transcript variant of ALAS1 (e.g., human ALAS1 variant 1). In yet another embodiment, the iRNA agent targets multiple transcript variants (e.g., both variant 1 and variant 2 of human ALAS1).

[0060] In one embodiment, an iRNA featured in the invention targets a non-coding region of an ALAS1 RNA transcript, such as the 5' or 3' untranslated region of the transcript.

[0061] In some embodiments, the iRNAs described herein are in the form of a complex, such as a carbohydrate complex, which may serve as a targeting moiety and / or a ligand, as described herein. In one embodiment, the complex is attached to the 3' end of the sense strand of the dsRNA. In some embodiments, the complex is attached via a linker, such as a bivalent or trivalent branched linker.

[0062] In some embodiments, the conjugate comprises one or more N-acetylgalactosamine (GalNAc) derivatives. Such conjugates are also referred to herein as GalNAc conjugates. In some embodiments, the conjugate targets the RNAi agent to specific cells, such as liver cells, e.g., hepatocytes. The GalNAc derivative can be attached via a linker, such as a bivalent or trivalent branched linker. In certain embodiments, the conjugate is [ka] is.

[0063] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker, such as the linker shown in the schematic diagram below, where X is O or S. [ka]

[0064] In some embodiments, X is O. In some embodiments, X is S.

[0065] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below. [ka]

[0066] In one embodiment, the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following: (i) Chemically synthesized, for example, by solid phase oligonucleotide synthesis; (ii) all nucleotides in the dsRNA are modified, e.g., all nucleotides are 2'-OMe or 2'-F modified, or modified with a combination of 2'-OMe and 2'-F; (iii) all nucleotides are linked via 3'-5' phosphodiester bonds; (iv) the sense strand comprises or consists of 21 nucleotides; (v) the antisense sense strand comprises or consists of 23 nucleotides; (vi) having a blunt end at the 3′ end of the sense strand; (vii) has a 3' overhang, e.g., a two-nucleotide overhang at the 3' end of the antisense strand; (viii) covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties; (ix) the 3'-end of the sense strand is conjugated to a triantennary GalNAc moiety (e.g., designated herein as L96 as defined in Table 1). In one embodiment, the 3'-end is linked to the triantennary GalNAc moiety via a phosphodiester bond; (x) has an antisense strand comprising one or more (e.g., four) phosphorothioate linkages. In one embodiment, the phosphorothioate linkages are located at the 3'-end and 5'-end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3'-end and two phosphorothioate linkages are located at the 5'-end of the antisense strand; (xi) having a sense strand comprising one or more (e.g., two) phosphorothioate linkages. In one embodiment, the one or more (e.g., two) phosphorothioate linkages are located at the 5' end of the sense strand; (xii) 21 nucleotides of the sense strand hybridize to complementary 21 nucleotides of the antisense strand; (xiii) forming 21 nucleotide base pairs and a 2-base overhang at the 3′ end of the antisense strand; (xiv) comprising or consisting of sense and antisense strands having the sequence of AD-60519; (xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the AD-60519 sense strand modifications; (xvi) having an antisense strand with 10, 12, 14, 16, 18, 19, 20, or all of the AD-60519 antisense strand modifications; or (xvii) with double-stranded sequence and all AD-60519 modifications.

[0067] In embodiments, the dsRNA is in the form of a conjugate having the following structure (also referred to herein as AD-60519 or ALN-60519) (SEQ ID NOS: 5238-5239, respectively, in order of appearance): [ka]

[0068] In one aspect, provided herein are compositions, e.g., pharmaceutical compositions, comprising one or more of the iRNAs described herein and a pharmaceutically acceptable carrier or delivery vehicle. In one embodiment, the composition is used to inhibit expression of the ALAS1 gene in an organism, typically a human subject. In one embodiment, the composition is used to treat porphyria, e.g., AIP.

[0069] In one aspect, the iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of ALAS1, wherein the dsRNA comprises a sense strand and an antisense strand of 15 to 30 base pairs in length, and the antisense strand is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1 or 382.

[0070] In a further aspect, the iRNA provided herein is a double-stranded RNAi (dsRNA) comprising a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, each strand having from about 14 to about 30 nucleotides, and wherein the double-stranded RNAi agent is Formula (III), Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' (III) (In the formula, i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' represents an oligonucleotide sequence comprising 0 to 25 nucleotides that are independently either modified or unmodified or a combination thereof, each sequence comprising at least two different modified nucleotides; each N b and N b ' represents an oligonucleotide sequence comprising 0 to 10 nucleotides, independently either modified or unmodified, or a combination thereof; each n p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications of three consecutive nucleotides; N b The modification on Y differs from the modification on N b The modifier on ' is different from the modifier on Y') It is expressed by:

[0071] In embodiments, the sense strand is conjugated to at least one ligand.

[0072] In embodiments, i is 1; j is 1; or both i and j are 1.

[0073] In embodiments, k is 1; l is 1; or k and l are both 1.

[0074] In an embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0075] In embodiments, the Y'Y'Y' motif is present at positions 11, 12, and 13 from the 5' end of the antisense strand.

[0076] In embodiments, Y' is 2'-O-methyl.

[0077] In an embodiment, the double-stranded region is 15 to 30 nucleotide pairs in length.

[0078] In an embodiment, the double-stranded region is 17 to 23 nucleotide pairs in length.

[0079] In an embodiment, the double-stranded region is 19 to 21 nucleotide pairs in length.

[0080] In an embodiment, the double-stranded region is 21 to 23 nucleotide pairs in length.

[0081] In embodiments, the modification on the nucleotide is selected from the group consisting of locked nucleic acid (LNA), acyclic nucleotide, hexitol or hexose nucleic acid (HNA), cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and any combination thereof.

[0082] In embodiments, the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.

[0083] In embodiments, the modification on the nucleotide is 2'-O-methyl, 2'-fluoro, or both.

[0084] In an embodiment, the ligand comprises a carbohydrate.

[0085] In embodiments, the ligand is attached via a linker.

[0086] In embodiments, the linker is a bivalent or trivalent branched linker.

[0087] In embodiments, the ligand is [ka] is.

[0088] In embodiments, the ligand and linker are Formula XXIV, [ka] As shown in the figure.

[0089] In embodiments, the ligand is attached to the 3' end of the sense strand.

[0090] In embodiments, the dsRNA consists of or comprises a nucleotide sequence selected from the group of sequences provided in Tables 21-40.

[0091] In a further aspect, the iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript, and wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in any one of Tables 21-40. In embodiments, the nucleotides in the antisense strand have fewer modifications, more modifications, or different modifications compared to the antisense sequences listed in any one of Tables 21-40.

[0092] In embodiments, the sense and antisense sequences are duplexes as disclosed herein that suppress ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, as assessed, for example, using the assays disclosed in the Examples provided herein.

[0093] In embodiments, ALAS1 mRNA expression is assessed based on ALAS1 mRNA levels in the liver, e.g., assessed using a liver biopsy sample. In embodiments, ALAS1 mRNA expression is assessed based on ALAS1 mRNA levels in a biological fluid, such as blood, serum, plasma, cerebrospinal fluid, or urine. In embodiments, ALAS1 mRNA expression is assessed using a circulating extracellular RNA detection (cERD) assay, such as the cERD assay described herein or in Sehgal, A. et al., "Quantitation of tissue-specific target gene modulation using circulating RNA" (poster presented at the Keystone Gene Silencing by small RNAs Symposium (Vancouver, February 7-12, 2012) on February 9, 2012), or Sehgal, A. et al., "Tissue-specific gene silencing monitored in circulating RNA," RNA, 20:1-7, published online on December 19, 2013.

[0094] In some embodiments, the dsRNA comprises at least one modified nucleotide.

[0095] In some embodiments, the at least one modified nucleotide is selected from the group consisting of a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0096] In some embodiments, the modified nucleotide is selected from the group consisting of 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, acyclic nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and non-natural base-containing nucleotides.

[0097] In some embodiments, the region of complementarity is at least 17 nucleotides in length.

[0098] In some embodiments, the region of complementarity is 19-21 nucleotides in length.

[0099] In some embodiments, the region of complementarity is 19 nucleotides in length.

[0100] In some embodiments, each strand is 30 nucleotides or less in length.

[0101] In some embodiments, at least one strand comprises a 3' overhang of at least one nucleotide. In embodiments, the antisense strand comprises a 3' overhang of at least one nucleotide.

[0102] In some embodiments, at least one strand comprises a 3' overhang of at least two nucleotides. In embodiments, the antisense strand comprises a 3' overhang of at least two nucleotides. In embodiments, the antisense strand comprises a 3' overhang of two nucleotides.

[0103] In some embodiments, the dsRNA described herein further comprises a ligand.

[0104] In some embodiments, the ligand is a GalNAc ligand.

[0105] In some embodiments, the ligand targets the dsRNA to hepatocytes.

[0106] In some embodiments, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0107] In some embodiments, the region of complementarity consists of an antisense sequence selected from the antisense sequences listed in Tables 21-40, or a corresponding antisense sequence in which some or all of the nucleotides are unmodified. In embodiments, the region of complementarity consists of the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In some embodiments, the region of complementarity consists of the antisense sequence of double-stranded AD-60489. In some embodiments, the region of complementarity consists of the antisense sequence of double-stranded AD-60519.

[0108] In embodiments, the complementary region consists of an antisense sequence selected from the duplexes disclosed herein that inhibits ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90% as assessed using the assays disclosed in the Examples provided herein.

[0109] In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 21-40 and an antisense strand consisting of an antisense sequence selected from Tables 21-40. In embodiments, the dsRNA comprises a pair of corresponding sense and antisense sequences selected from the duplexes disclosed in Tables 21-40.

[0110] In one aspect, the present invention provides cells containing at least one of the iRNAs (e.g., dsRNA) featured herein. The cells are generally mammalian cells, such as human cells. In some embodiments, the cells are erythroid cells. In other embodiments, the cells are liver cells (e.g., hepatocytes).

[0111] In one aspect, provided herein is a pharmaceutical composition for inhibiting expression of the ALAS1 gene, the composition comprising an iRNA (e.g., a dsRNA) described herein.

[0112] In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is administered in an unbuffered solution. In embodiments, the unbuffered solution is saline or water, such as water for injection.

[0113] In an embodiment, the pharmaceutical composition comprises AD-60519 and water for injection. In an embodiment, the composition comprises AD-60519 at about 100-300 mg / mL, e.g., 200 mg / mL. In an embodiment, the composition has a pH of 6.0-7.5, e.g., about 7.0. In an embodiment, the composition is for subcutaneous injection. In an embodiment, the pharmaceutical composition is packaged in a container (e.g., a glass vial, e.g., a 2 mL glass vial) with a volume of about 0.3-1 mL, e.g., 0.55 mL. In an embodiment, the pharmaceutical composition is ALN-AS1 as described in the Examples herein.

[0114] In an embodiment of the pharmaceutical composition described herein, iRNA (e.g., dsRNA) is administered in a non-buffered solution. In an embodiment, the buffered solution comprises acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In an embodiment, the buffered solution is phosphate-buffered saline (PBS).

[0115] In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is targeted to hepatocytes.

[0116] In embodiments of the pharmaceutical compositions described herein, the compositions are administered intravenously.

[0117] In embodiments of the pharmaceutical compositions described herein, the compositions are administered subcutaneously.

[0118] In embodiments, the pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand) that targets the iRNA (e.g., dsRNA) to hepatocytes.

[0119] In embodiments, the pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein comprising a ligand (e.g., a GalNAc ligand), and the pharmaceutical composition is administered subcutaneously. In embodiments, the ligand targets the iRNA (e.g., dsRNA) to hepatocytes.

[0120] In certain embodiments, the pharmaceutical composition, for example, the composition described herein, comprises a lipid formulation.In some embodiments, the RNAi agent is in an LNP formulation, for example, an MC3 formulation.In some embodiments, the LNP formulation targets the RNAi agent to specific cells, for example, liver cells, such as hepatocytes.In some embodiments, the lipid formulation is an LNP11 formulation.In some embodiments, the composition is administered intravenously.

[0121] In another embodiment, the pharmaceutical composition is formulated for administration according to a dosing regimen described herein, e.g., not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week, etc. In another embodiment, administration of the pharmaceutical composition can continue for, e.g., 1, 2, 3, or 6 months or more, or for one year or more.

[0122] In another embodiment, a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting ALAS1, is administered in conjunction with a non-iRNA therapeutic agent, such as an agent known to treat porphyria (e.g., AIP) or a symptom of porphyria (e.g., pain). In another embodiment, a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting AIP, is administered in conjunction with a non-iRNA therapeutic regimen, such as hemin or glucose, e.g., a glucose infusion (e.g., IV glucose). For example, an iRNA featured in the invention can be administered before, after, or simultaneously with glucose, dextrose, or similar therapeutic agents that help restore energy balance (e.g., total parenteral nutrition). An iRNA featured in the invention can also be administered before, after, or simultaneously with the administration of a heme product (e.g., hemin, heme arginate, or heme albumin), optionally in combination with glucose (e.g., IV glucose).

[0123] Typically, glucose administered for the treatment of porphyria is administered intravenously (IV). Intravenous administration of glucose is referred to herein as "IV glucose." However, alternative embodiments in which glucose is administered by other means are also encompassed.

[0124] In one embodiment, an ALAS1 iRNA is administered to a patient, followed by a non-iRNA agent or treatment regimen (e.g., glucose and / or heme products) (or vice versa). In another embodiment, the ALAS1 iRNA and the non-iRNA therapeutic agent or treatment regimen are administered simultaneously.

[0125] In one aspect, provided herein is a method for inhibiting ALAS1 expression in a cell, comprising: (a) introducing into the cell an iRNA (e.g., dsRNA) described herein; and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of mRNA transcripts of the ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell.

[0126] In one aspect, provided herein is a method of reducing or inhibiting expression of the ALAS1 gene in a cell (e.g., an erythroid cell or a liver cell, e.g., a hepatocyte). The method comprises: (a) introducing into a cell double-stranded ribonucleic acid (dsRNA) comprising at least two sequences complementary to each other; (b) maintaining the cells of step (a) for a time sufficient to obtain degradation of mRNA transcripts of the ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cells; wherein the dsRNA comprises a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a complementary region that is substantially complementary to at least a portion of an mRNA encoding ALAS1, the complementary region being 30 nucleotides or less, i.e., 15 to 30 nucleotides in length, generally 19 to 24 nucleotides in length, and the dsRNA, upon contact with a cell expressing ALAS1, inhibits expression of the ALAS1 gene by at least 10%, e.g., at least 20%, at least 30%, at least 40% or more.

[0127] In embodiments of the foregoing methods of inhibiting ALAS1 expression in cells, the cells are treated in vitro, in vitro, or in vivo. In embodiments, the cells are hepatocytes.

[0128] In embodiments, the cell is present in a subject in need of treatment, prevention and / or management of a disease associated with ALAS1 expression.

[0129] In embodiments, the disease is porphyria. In embodiments, the porphyria is acute intermittent porphyria or ALA dehydratase deficiency porphyria.

[0130] In embodiments, the porphyria is a hepatic porphyria, such as a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.

[0131] In embodiments, the expression of ALAS1 is inhibited by at least 30%.

[0132] In embodiments, the iRNA (e.g., dsRNA) has an IC in the range of 0.01 to 1 nM. 50 It has.

[0133] In certain embodiments, the cell (eg, a hepatocyte) is a mammalian cell (eg, a human, non-human primate, or rodent cell).

[0134] In one embodiment, the cells are treated in vitro, in vitro, or in vivo (e.g., the cells are present in a subject (e.g., a patient in need of treatment, prevention, and / or management of a disorder associated with ALAS1 expression).

[0135] In one embodiment, the subject is a mammal (e.g., a human) at risk for or diagnosed with a porphyria, such as X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythropoietic porphyria of infancy. In some embodiments, the disease is an acute hepatic porphyria, such as ALA dehydratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disease is ALA deyhdratase deficiency porphyria (ADP) or AIP.

[0136] In embodiments, the porphyria is a hepatic porphyria, such as a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.

[0137] In one embodiment, the introduced dsRNA reduces or inhibits expression of the ALAS1 gene in the cell.

[0138] In one embodiment, the introduced dsRNA reduces or inhibits expression of the ALAS1 gene or the levels of one or more porphyrins or porphyrin precursors (e.g., δ-aminolevulinic acid (ALA), porphobilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphyrinogen IX, and protoporphyrin IX) or porphyrin products or metabolites by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to a reference (e.g., untreated cells or cells treated with a non-targeting control dsRNA). Without being bound by theory, ALAS1 is the first enzyme in the porphyrin pathway. Therefore, reducing expression of the ALAS1 gene is likely to reduce the levels of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites.

[0139] In another aspect, the invention provides methods for treating, preventing, or managing a pathological process associated with ALAS1 expression (e.g., a pathological process associated with porphyrins, porphyrin precursors, such as porphyrias, or associated with porphyrin pathway defects). In one embodiment, the method comprises administering to a subject, e.g., a patient in need of such treatment, prevention, or management, an effective amount (e.g., a therapeutically or prophylactically effective amount) of one or more iRNAs featured herein.

[0140] In one aspect, provided herein is a method for treating and / or preventing a disease associated with ALAS1 expression, comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., dsRNA) described herein or a therapeutically effective amount of a composition comprising an iRNA (e.g., dsRNA) described herein.

[0141] In one aspect, provided herein is a method for treating and / or preventing porphyria, comprising administering to a subject in need of such treatment double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand, each 15 to 30 base pairs in length, wherein the antisense strand is complementary to at least 15 consecutive nucleotides of SEQ ID NO:1 or SEQ ID NO:382.

[0142] In one embodiment, the subject (e.g., patient) has porphyria. In another embodiment, the subject (e.g., patient) is at risk for developing porphyria. In some embodiments, administration of an iRNA targeting ALAS1 alleviates or reduces the severity of at least one symptom of an ALAS1-associated disease in the patient.

[0143] In one embodiment, the subject is a mammal (e.g., a human) at risk for or diagnosed with a disorder associated with ALAS1 expression, such as a porphyria, e.g., X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In further embodiments, the porphyria is an acute hepatic porphyria, such as ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In some such embodiments, the disease is ALA deyhdratase deficiency porphyria (ADP) or AIP.

[0144] In embodiments, the subject has or is at risk of developing porphyria. In embodiments, the porphyria is a hepatic porphyria, such as a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.

[0145] In embodiments, porphyria, porphyric symptoms, prodromal symptoms, or porphyric attacks are induced by exposure to an exacerbating factor described herein. In some embodiments, the exacerbating factor is a chemical exposure. In some embodiments, the exacerbating factor is a drug, e.g., a prescription or over-the-counter drug. In some embodiments, the exacerbating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, such as the luteal phase.

[0146] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered after an acute attack of porphyria.

[0147] In embodiments, the iRNA (e.g., dsRNA) or a composition comprising the iRNA is administered during an acute attack of porphyria.

[0148] In embodiments, the iRNA (e.g., dsRNA) or a composition comprising the iRNA is administered prophylactically to prevent acute attacks of porphyria.

[0149] In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation.

[0150] In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate.

[0151] In embodiments, the iRNA (e.g., dsRNA) is administered at a dose of 0.05 to 50 mg / kg.

[0152] In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 0.01 mg / kg to 5 mg / kg of the subject's body weight.

[0153] In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and administered at a dose of 0.05-5 mg / kg.

[0154] In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 0.5 to 50 mg / kg. In certain embodiments, the iRNA in the GalNAc conjugate is administered at a dose of less than 10 mg / kg (e.g., 5 mg / kg or less), e.g., once weekly; e.g., a dose of 1 mg / kg or less, 2.5 mg / kg or less, or 5 mg / kg or less once weekly. In one embodiment, the iRNA in the GalNAc conjugate is administered at a dose of about 2.5 mg / kg or less, e.g., once weekly. In one embodiment, the iRNA in the GalNAc conjugate is administered subcutaneously.

[0155] In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered subcutaneously at a dose of 0-5 mg / kg, e.g., 0-2.5 mg / kg or 1-2.5 mg / kg. In embodiments, the iRNA is administered weekly. In embodiments, the iRNA is administered as a composition comprising the iRNA and water for injection. In embodiments, the iRNA is AD-60519. In embodiments, the composition comprises the iRNA, e.g., AD-60519, at a concentration of about 200 mg / mL.

[0156] In embodiments, the method reduces porphyrin or porphyrin precursor levels in the subject.

[0157] In embodiments, levels are reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In one embodiment, levels are reduced by at least 30%.

[0158] In embodiments, the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG).

[0159] In embodiments, the iRNA (e.g., dsRNA) has an IC in the range of 0.01 to 1 nM. 50 It has.

[0160] In embodiments, the methods described herein include: (i) ameliorating symptoms associated with ALAS1-related disorders (e.g., porphyria); (ii) inhibiting ALAS1 expression in a subject (e.g., as assessed using a cERD assay); (iii) reducing porphyrin precursor (e.g., ALA or PBG) or porphyrin levels in a subject; (iv) reducing the frequency of acute attacks of symptoms associated with porphyria in a subject; or (v) reducing the incidence of acute attacks of symptoms associated with porphyria in a subject when the subject is exposed to an exacerbating factor (e.g., the premenstrual or luteal phase);

[0161] In embodiments, the method ameliorates pain and / or progressive neuropathy.

[0162] In embodiments, the iRNA (e.g., dsRNA) or a composition comprising the iRNA is administered according to a dosing regimen.

[0163] In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered before or during an acute attack of porphyria. In some embodiments, the iRNA is administered before an acute attack of porphyria.

[0164] In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during the prodromal period, which in embodiments is characterized by abdominal pain, nausea, psychological symptoms (e.g., anxiety), restlessness, and / or insomnia.

[0165] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a particular phase of the menstrual cycle, such as the luteal phase.

[0166] In embodiments, the method ameliorates or prevents porphyria periodic attacks, e.g., by reducing the severity, duration, or frequency of attacks. In embodiments, the periodic attacks are associated with an exacerbating factor. In embodiments, the exacerbating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, such as the luteal phase.

[0167] In embodiments, the subject has elevated ALA and / or PBG levels. In embodiments, ALA and / or PBG levels are elevated in plasma or urine from the subject. In embodiments, the subject has or is at risk of developing a porphyria, e.g., hepatic porphyria. In embodiments, the subject is asymptomatic. In embodiments, the subject carries a genetic alteration (e.g., a genetic mutation) associated with a porphyria described herein. In embodiments, the subject has or is at risk of developing a porphyria and suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In embodiments, the subject is not suffering from an acute attack but suffers from pain (e.g., chronic pain, such as long-term neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.

[0168] In embodiments, the subject (a) has elevated ALA and / or PBG levels, and (b) suffers from pain (e.g., chronic pain, such as long-term neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.

[0169] In embodiments, the subject has elevated plasma and / or urinary levels of ALA and / or PBG. In embodiments, the elevated levels of ALA and / or PBG are accompanied by other symptoms, such as pain (e.g., chronic pain, e.g., long-term neuropathic pain) or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the subject is asymptomatic. In embodiments, the subject has a genetic mutation associated with porphyria, such as a mutation described herein.

[0170] In an embodiment, the subject has elevated levels (e.g., plasma or urine levels) of porphyrin precursors such as ALA and / or PBG, for example, levels above or equal to the reference value. In an embodiment, the levels are above the reference value. In an embodiment, the reference value is 2 standard deviations above the mean level in healthy samples. In an embodiment, the reference value is the upper reference limit.

[0171] In embodiments, the subject has plasma and / or urinary levels of ALA and / or PBG that are greater than two, three, four, or five times the upper reference limit, or even higher. As used herein, "upper reference limit" refers to a level that is the upper limit of the 95% confidence interval of a reference sample, e.g., a sample from a normal (e.g., wild-type) or healthy individual, e.g., an individual who does not carry a genetic mutation associated with porphyria and / or an individual who is not affected by porphyria. In embodiments, the subject has urinary ALA and / or PBG levels that are greater than two to four times the upper reference limit. In embodiments, the subject has urinary ALA and / or PBG levels that are greater than four times the upper reference limit.

[0172] In embodiments, the baseline plasma PBG level is 0.12 μmol / L. In embodiments, the subject is a human and has a plasma PBG level of greater than or equal to 0.12 μmol / L, 0.24 μmol / L, 0.36 μmol / L, 0.48 μmol / L, or 0.60 μmol / L. In embodiments, the subject is a human and has a plasma PBG level of greater than or equal to 0.48 μmol / L.

[0173] In embodiments, the reference value for urinary PBG is 1.2 mmol / mol creatinine. In embodiments, the subject is a human and has a urinary PBG level of greater than or equal to 1.2 mmol / mol creatinine, 2.4 mmol / mol creatinine, 3.6 mmol / mol creatinine, 4.8 mmol / mol creatinine, or 6.0 mmol / mol creatinine. In embodiments, the subject is a human and has a plasma PBG level of greater than or equal to 4.8 mmol / mol.

[0174] In embodiments, the reference value for plasma ALA is 0.12 μmol / L. In embodiments, the subject is a human and has a plasma ALA level of greater than or equal to 0.12 μmol / L, 0.24 μmol / L, 0.36 μmol / L, 0.48 μmol / L, or 0.60 μmol / L. In embodiments, the subject is a human and has a plasma ALA level of greater than or equal to 0.48 μmol / L.

[0175] In embodiments, the reference level for urinary ALA is 3.1 mmol / mol creatinine. In embodiments, the subject is a human and has a urinary ALA level greater than or equal to 3.1 mmol / mol creatinine, 6.2 mmol / mol creatinine, 9.3 mmol / mol creatinine, 12.4 mmol / mol creatinine, or 15.5 mmol / mol creatinine.

[0176] In embodiments, the method reduces one or more signs or symptoms of porphyria. In embodiments, the subject has elevated ALA and / or PBG levels. In embodiments, the method reduces pain (e.g., chronic pain, e.g., chronic neuropathic pain) and / or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the pain is neuropathic pain (e.g., pain associated with the progressive neuropathy of acute porphyria). Pain reduction includes, for example, pain prevention, delay in pain onset, reduction in frequency of pain onset, and / or reduction in pain severity. In embodiments, pain reduction is assessed based on the subject's use of analgesics.

[0177] In embodiments, the method ameliorates or prevents acute attacks of porphyria, for example, by reducing the severity, duration, or frequency of attacks.

[0178] In embodiments, the method reduces or prevents nerve damage.

[0179] In embodiments, the method prevents deterioration (e.g., prevents the development of abnormalities) or results in an improvement in a clinical measure, such as, for example, a clinical measure of muscle, and / or a clinical measure of nerve function, such as, for example, EMG and / or nerve conduction velocity.

[0180] In embodiments, the method reduces heme utilization by the subject.

[0181] In embodiments, the method reduces the use of pain medication by the subject.

[0182] In an embodiment, the method reduces hospitalizations.

[0183] In embodiments, the method is effective to reduce ALA and / or PBG levels (e.g., plasma or urinary ALA and / or PBG levels). In embodiments, the method is effective to produce a predetermined reduction in elevated ALA and / or PBG levels.

[0184] In embodiments, the predetermined decrease is to a value below the reference value. In some embodiments, the reference value is the upper reference limit. In some embodiments, the reference value is a value two standard deviations above the mean level of the standard sample.

[0185] In embodiments, the method is effective in reducing ALA and / or PBG levels in a subject to less than two times the upper normal limit. In embodiments, the method is effective in reducing ALA levels to less than two times the upper normal limit. In embodiments, the method is effective in reducing PBG levels to less than two times the upper normal limit.

[0186] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered in a single dose or multiple doses, e.g., according to a dosing regimen.

[0187] In embodiments, an iRNA (e.g., dsRNA) or a composition comprising an iRNA is administered prophylactically to a subject at risk of developing porphyria. In embodiments, an iRNA (e.g., dsRNA) or a composition comprising an iRNA is administered prophylactically at the beginning of puberty. In embodiments, the subject carries a genetic mutation associated with porphyria and / or has elevated ALA and / or PBG levels (e.g., elevated plasma or urinary ALA and / or PBG levels). In embodiments, the mutation predisposes the individual to acute attacks (e.g., upon exposure to an exacerbating factor, such as a drug, diet, or other exacerbating factor, e.g., those disclosed herein). In embodiments, the mutation is associated with elevated levels of porphyrin or porphyrin precursors (e.g., ALA and / or PBG). In embodiments, the mutation is associated with chronic pain (e.g., chronic neuropathic pain) and / or neuropathy (e.g., progressive neuropathy).

[0188] In embodiments, the mutation is a mutation in the ALAS1 gene. In embodiments, the mutation is a mutation in the ALAS1 gene promoter or a mutation in an upstream or downstream region of the ALAS1 gene. In embodiments, the mutation is a mutation in a transcription factor or other gene that interacts with ALAS1. In embodiments, the mutation is a mutation in a gene encoding an enzyme in the heme biosynthetic pathway.

[0189] In embodiments, the iRNA (e.g., dsRNA or a conjugate thereof) or a composition comprising the iRNA is administered subcutaneously. In embodiments, the iRNA is in the form of a GalNAc conjugate. In embodiments, the iRNA (e.g., dsRNA) is administered at a dose of 0.5 to 50 mg / kg. In certain embodiments, the iRNA is administered at a dose of less than 10 mg / kg (e.g., 5 mg / kg or less) once a week, e.g., at a dose of 1 mg / kg or less, 2.5 mg / kg or less, or 5 mg / kg or less, e.g., once a week. In one embodiment, the iRNA is administered at a dose of about 2.5 mg / kg or less, e.g., once a week.

[0190] In embodiments, the subject to be treated is asymptomatic and has elevated ALA and / or PBG levels. In embodiments, the subject has porphyria, such as AIP. In embodiments, the patient suffers from recurrent porphyric attacks.

[0191] In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of less than 5 mg / kg, such as, for example, 0.1, 0.35, 1.0, or 2.5 mg / kg. In embodiments, the iRNA (e.g., AD-60519) is administered in repeated doses, such as, for example, weekly doses.

[0192] In one embodiment, the subject is asymptomatic and has elevated ALA and / or PBG levels, and an iRNA (e.g., AD-60519) is administered in a single dose, e.g., 0.1, 0.35, 1.0, or 2.5 mg / kg; or in repeated weekly doses, e.g., of 1 and 2.5 mg / kg, over several weeks (e.g., 4 weeks).

[0193] In one embodiment, the subject has AIP, e.g., an AIP patient, and is administered an iRNA (e.g., AD-60519) at a dose of 1-2.5 mg / kg weekly.

[0194] In embodiments, a treatment regimen is used in which the iRNA is administered more frequently initially, followed by less frequent administration. In embodiments, the iRNA is initially administered once daily for several days (e.g., 2-14 days, such as 2, 3, 4, 5, 6, or 7 days). In embodiments, the iRNA is subsequently administered once weekly. In embodiments, the iRNA is subsequently administered once every other week. In embodiments, the iRNA is subsequently administered at a frequency effective to reduce one or more of the porphyria signs or symptoms.

[0195] In one aspect, provided herein is a method of treating a subject with elevated ALA and / or PBG levels, the method comprising administering to the subject double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand 15 to 30 base pairs in length, wherein the antisense strand is complementary to at least 15 consecutive nucleotides of SEQ ID NO:1 or SEQ ID NO:382.

[0196] In one aspect, provided herein is a method of treating a subject with elevated ALA and / or PBG levels, the method comprising administering to the subject a therapeutically effective amount of dsRNA or a composition comprising dsRNA, as described herein.

[0197] In some embodiments, the methods described herein are effective in reducing ALA and / or PBG levels, hi some embodiments, the ALA and / or PBG levels are reduced to below or at a reference level, e.g., an upper reference limit.

[0198] In embodiments, the subject to be treated is asymptomatic and has elevated ALA and / or PBG levels. In embodiments, the subject has a porphyria, e.g., AIP.

[0199] In embodiments, the iRNA is administered at a dose of less than 5 mg / kg, e.g., 0.1, 0.35, 1.0, or 2.5 mg / kg. In embodiments, the iRNA is administered in repeated doses, e.g., weekly doses.

[0200] In another aspect, the invention provides a method for reducing porphyrin or porphyrin precursor levels in a cell (e.g., an erythroid cell or a liver cell, e.g., a hepatocyte). In one embodiment, the cell is treated in vitro, in vitro, or in vivo (e.g., the cell is present in a subject (e.g., a patient in need of treatment, prevention, and / or management of a disorder associated with ALAS1 expression). The method comprises contacting the cell with an effective amount of one or more iRNAs that target ALAS1, e.g., one or more of the iRNAs disclosed herein, thereby reducing porphyrin or porphyrin precursor levels in the cell compared to pre-contact levels; or reducing porphyrin or porphyrin precursor levels in other cells, tissues, or bodily fluids in the subject in which the cell is located. Such methods can be used to treat (e.g., ameliorate the severity of) a disorder associated with ALAS1 expression, such as a porphyria, e.g., AIP or ALA dehydratase deficiency porphyria.

[0201] In one embodiment, the contacting step is performed in vitro, in vitro, or in vivo. For example, the cell can be present in a subject, such as a mammal (e.g., a human) at risk for or diagnosed with porphyria. In one embodiment, the porphyria is acute hepatic porphyria. In an embodiment, the porphyria is a hepatic porphyria, such as a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA dehydratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In an embodiment, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In an embodiment, the porphyria is a dual porphyria.

[0202] In one aspect, provided herein is a method of reducing porphyrin or porphyrin precursor (e.g., ALA or PBG) levels in a cell, comprising contacting the cell with an iRNA (e.g., dsRNA) described herein in an amount effective to reduce porphyrin or porphyrin precursor levels in the cell.

[0203] In some embodiments, the cells are hepatocytes. In some embodiments, the porphyrin or porphyrin precursor is δ-aminolevulinic acid (ALA), porphobilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphyrinogen IX, or protoporphyrin IX. In some embodiments, the porphyrin precursor is ALA or PBG.

[0204] In one embodiment, the cell is an erythroid cell. In a further embodiment, the cell is a liver cell (e.g., a hepatocyte).

[0205] In one aspect, provided herein is a vector encoding at least one iRNA (e.g., adsRNA) strand, as described herein.

[0206] In one aspect, provided herein is a vector encoding at least one dsRNA strand, wherein the dsRNA comprises a region of complementarity to at least a portion of an mRNA encoding ALAS1, wherein the dsRNA is 30 base pairs or less in length, and wherein the dsRNA targets the mRNA for cleavage.

[0207] In embodiments, the region of complementarity is at least 15 nucleotides in length.

[0208] In one embodiment, the complementary region is at least 19-21 nucleotides in length. In one aspect, the present invention provides a vector for inhibiting expression of the ALAS1 gene in a cell. In one embodiment, the vector comprises an iRNA described herein. In one embodiment, the vector comprises at least one regulatory sequence operably linked to a nucleotide sequence encoding at least one strand of an iRNA described herein. In one embodiment, the vector comprises at least one ALAS1 iRNA strand.

[0209] In one aspect, provided herein is a cell comprising a vector described herein. In one aspect, provided herein is a cell containing a vector that inhibits ALAS1 gene expression in a cell. The vector comprises a regulatory sequence operably linked to a nucleotide sequence encoding at least one strand of one of the iRNAs described herein. In one embodiment, the cell is a liver cell (e.g., a hepatocyte). In another embodiment, the cell is an erythroid cell.

[0210] In another aspect, a method of assaying circulating extracellular ALAS1 mRNA levels in a subject is provided, the method comprising detecting (e.g., measuring) ALAS1 mRNA levels in a biological fluid sample (e.g., a blood sample (e.g., a serum or plasma sample), a cerebrospinal fluid sample, or urine) from the subject, wherein the biological fluid sample comprises ALAS1 mRNA, thereby assaying circulating extracellular ALAS1 mRNA levels in the subject.

[0211] In another aspect, a method for assaying circulating extracellular ALAS1 mRNA levels in a subject is provided, the method comprising the steps of: (i) providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., a blood or plasma sample) from the subject, the RNA comprising ALAS1 mRNA; (ii) obtaining ALAS1 cDNA from the ALAS1 mRNA; (iii) contacting the ALAS1 cDNA with nucleic acid (e.g., a probe and / or primer) complementary to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mixture; and (iv) detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mixture, thereby assaying circulating extracellular ALAS1 mRNA levels in the subject, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level.

[0212] In embodiments, the biological fluid sample is a blood sample. In embodiments, the biological fluid sample is a serum sample. In embodiments, the biological fluid sample is a urine sample.

[0213] In an embodiment, the method comprises PCR, qPCR or 5'-RACE.

[0214] In an embodiment, the nucleic acid is a probe or a primer.

[0215] In embodiments, the nucleic acid comprises a detectable moiety and the ALAS1 mRNA level is determined by detecting the amount of the detectable moiety.

[0216] In embodiments, the methods further comprise obtaining a biological fluid sample from the subject. In embodiments, the biological fluid sample is isolated from tissue and contains exosomes. In embodiments of these methods, the effectiveness of the porphyria treatment is assessed based on a comparison of circulating extracellular ALAS1 mRNA levels in the subject compared to a reference level.

[0217] In embodiments, a decrease in circulating extracellular ALAS1 mRNA levels in the subject in response to porphyria treatment compared to the baseline level indicates that the porphyria treatment is effective. In embodiments, the baseline level is the circulating extracellular ALAS1 mRNA level in the subject prior to porphyria treatment.

[0218] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0219] Details of various embodiments of the invention are set forth in the description that follows. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]

[0220] [Figure 1] FIG. 1 depicts the heme biosynthetic pathway. [Figure 2A] Figures 2A and 2B show a table summarizing specific porphyrias that have been associated with genetic errors in heme metabolism. [Figure 2B] Figures 2A and 2B show a table summarizing specific porphyrias that have been associated with genetic errors in heme metabolism. [Figure 3A]Figures 3A and 3B depict the human ALAS1 mRNA sequence transcript (Reference sequence NM_000688.4 (GI:40316942, archived November 19, 2011), SEQ ID NO: 1). [Figure 3B] Figures 3A and 3B depict the human ALAS1 mRNA sequence transcript (Reference sequence NM_000688.4 (GI:40316942, archived November 19, 2011), SEQ ID NO: 1). [Figure 4A] Figures 4A and 4B depict the human ALAS1 mRNA sequence transcript (Reference sequence NM_000688.5 (GI:362999011, archived April 1, 2012), SEQ ID NO: 382). [Figure 4B] Figures 4A and 4B depict the human ALAS1 mRNA sequence transcript (Reference sequence NM_000688.5 (GI:362999011, archived April 1, 2012), SEQ ID NO: 382). [Figure 5] Figure 5 shows the dose response of siRNA AD-53558 in suppressing mouse ALAS1 (mALAS1) mRNA compared to a PBS control. Results for the luciferase (LUC) AD-1955 control are also shown. [Figure 6] 6 shows the dose response of siRNA AD-53558 in suppressing ALAS1 mRNA in rats compared to a PBS control. Results of the luciferase (LUC) AD-1955 control are also shown. [Figure 7] FIG. 7 shows the durability of mouse ALAS1 (mALAS1) mRNA suppression by siRNA AD-53558 compared to the PBS control. [Figure 8] FIG. 8 shows the mean±standard deviation of plasma ALA levels (in μM) at baseline and after phenobarbital treatment in the experimental (ALAS1 siRNA) and control (LUC siRNA) groups. [Figure 9] FIG. 9 shows individual animal plasma ALA levels (in μM) at baseline and after phenobarbital treatment in ALAS1 siRNA and control (LUC siRNA) treated animals. [Figure 10] FIG. 10 shows the mean±standard deviation of plasma ALA levels (in μM) at baseline and after phenobarbital treatment in ALAS1 siRNA and control (LUC siRNA) treated animals. [Figure 11] FIG. 11 shows individual animal plasma PBG levels (in μM) at baseline and after phenobarbital treatment in ALAS1 siRNA and control (LUC siRNA) treated animals. [Figure 12] FIG. 12 shows relative hepatic mALAS1 mRNA levels at baseline and after phenobarbital treatment in selected representative experimental (ALAS1 siRNA) and control (PBS) animals. [Figure 13] FIG. 13 shows the effect of three GalNAc-conjugated mALAS1 siRNAs (compared to the PBS control) on mALAS1 expression in mouse liver tissue. [Figure 14] FIG. 14 shows plasma ALA and PBG levels over time after phenobarbital administration and ALAS1 siRNA or control LUC siRNA treatment. [Figure 15] FIG. 15 shows the effect of GalNAc-conjugated ALAS1 siRNA on plasma ALA and plasma PBG levels in a mouse AIP phenobarbital-induced model. [Figure 16] 1 shows the dose-dependent effect of ALAS1 siRNA on plasma ALA and PBG levels in a mouse phenobarbital-induced AIP model. In animals administered ALAS1 siRNA, the administered siRNA dose (0.05 mg / kg, 0.1 mg / kg, 0.5 mg / kg, or 1.0 mg / kg) is shown on the horizontal axis. [Figure 17]The upper panel shows the experimental design used to test ALA and PBG suppression by ALAS1 siRNA. The lower panel shows plasma ALA and PBG levels at baseline, in the control (Luc) condition, and at weeks 0, 2, and 4 following treatment with ALAS1 siRNA. [Figure 18] The experimental design (top) and results regarding plasma ALA (μmol / L) levels (middle) and plasma PBG (μmol / L) levels (bottom) used to compare the therapeutic effects of ALAS1 siRNA or hemin in an AIP animal model are shown. [Figure 19] Relative mRNA levels (ALAS1 / GAPDH) are shown in animals treated with 30 mg / kg, 10 mg / kg, or 3 mg / kg AD-58632 compared to animals treated with a PBS control. [Figure 20] 1 shows the experimental design used to investigate the dose-response effect of AD-58632 ALAS1 GalNAc conjugate in a rat AIP model. [Figure 21] Relative levels of hepatic PBGD mRNA (upper graph) and hepatic ALAS1 mRNA (lower graph) in a rat AIP model are shown. Animal groups received one of four treatments: (1) phenobarbital (PB) treatment only, (2) phenobarbital and porphobilinogen deaminase (PBGD) siRNA treatment, (3) phenobarbital, PBGD siRNA, and 30 mg / kg of ALAS1 siRNA, or (4) phenobarbital, PBGD siRNA, and 10 mg / kg of ALAS1 siRNA. [Figure 22]Urinary PBG (upper panel) and ALA (lower panel) levels compared with creatinine levels in a rat AIP model. Animal groups received one of four treatments: (1) phenobarbital (PB) treatment only, (2) phenobarbital and porphobilinogen deaminase (PBGD) siRNA treatment, (3) phenobarbital, PBGD siRNA, and 30 mg / kg ALAS1 siRNA, or (4) phenobarbital, PBGD siRNA, and 10 mg / kg ALAS1 siRNA. [Figure 23] Figure 1 shows the suppression of ALAS-1 mRNA by AD-58632 compared to PBS control in groups of rats receiving five daily doses of 6 mg / kg, 2 mg / kg, or 1 mg / kg siRNA versus a single bolus dose of 30 mg / kg, 10 mg / kg, or 5 mg / kg siRNA. [Figure 24] 1 shows the suppression of ALAS-1 mRNA by AD-58632 compared to PBS control in groups of rats receiving four weekly doses of 10 mg / kg, 5 mg / kg, or 2.5 mg / kg siRNA. [Figure 25] 1 shows the suppression of ALAS-1 mRNA by AD-58632 and by five 19 / 19-mer duplexes. [Figure 26] The results of an evaluation of the effect of chain length and overhangs on the two best 19-mers are shown. [Figure 27] 1 is a graph showing the levels of ALAS1 mRNA in the liver (left bar) and serum (right bar) for each treatment group in the NHP study described in Example 34. [Figure 28] 1 shows the suppression of ALAS-1 mRNA in rats receiving 3 mg / kg or 10 mg / kg of AD-58632 or AD-60489 compared to the PBS control. [Figure 29] 1 shows the experimental design used to investigate the efficacy of ALAS1 siRNAs AD-58632 and AD-60489 in suppressing liver mRNA in non-human primates. [Figure 30]1 shows dose-dependent suppression of liver mRNA in non-human primates following treatment with 1.25 mg / kg, 2.5 mg / kg, or 5 mg / kg of AD-58632 or AD-60489. [Figure 31] 1 shows a comparison of mRNA suppression results obtained from liver biopsies and from cERD assays in a non-human primate study. [Figure 32] 1 shows the time course of mRNA suppression assessed using the cERD assay in a non-human primate study. The horizontal axis indicates time according to study day. [Figure 33] 1 shows suppression of ALAS1 mRNA in rats that received PBS or a single 5 mg / kg dose of one of the indicated siRNA duplexes. [Figure 34] Shown are liver concentrations of siRNA in rats administered a single 5 mg / kg dose of the indicated siRNA. [Figure 35] (Top) The experimental design used to investigate the therapeutic effects of AD-60925 and AD-60926 is shown. (Bottom) The relative levels of rat ALAS1 / GAPDH mRNA are shown in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF11-PBGD, PB, and 3 mg / kg AD-60925, or (4) AF11-PBGD, PB, and AD-60926. [Figure 36] Relative levels of urinary PBG (top) and urinary ALA (bottom) are shown in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg / kg AD-60925, or (4) AF11-PBGD, PB, and AD-60926. [Figure 37] Relative levels of urinary PBG (top) and urinary ALA (bottom) over time are shown in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg / kg AD-60925, or (4) AF11-PBGD, PB, and AD-60926. Arrows indicate the time points at which PB was administered. [Figure 38] Shown are the relative levels of rat ALAS1 (rALAS1) mRNA in rats administered four 2.5 mg / kg doses of PBS or one of the indicated siRNAs. [Figure 39] Shown are the relative levels of rat ALAS1 (rALAS1) mRNA in rats administered a single 2.5 mg / kg dose of PBS or one of the indicated siRNAs. [Figure 40] (Top) Relative levels of rat ALAS1 (rALAS1) mRNA in rats administered a single 3 mg / kg dose of PBS or one of the indicated siRNAs. (Bottom) siRNA concentrations in the liver. [Figure 41] (Top) Suppression of rat ALAS1 (rALAS1) mRNA by AD-60489, AD-60519, and AD-60901. (Bottom) siRNA concentration in the liver. [Figure 42] Shown are the relative levels of rat ALAS1 (rALAS1) mRNA in rats treated with PBS or a single 2.5 mg / kg dose of one of the indicated siRNAs. [Figure 43] Shown are relative levels of rat ALAS1 (rALAS1) mRNA in rats treated twice weekly for 2 weeks with PBS or a 2.5 mg / kg dose of one of the indicated siRNAs. [Figure 44] (Top) Schematic of the experimental design used to investigate the therapeutic effect of multiple biweekly administrations of AD-60519. (Bottom) Graphs depicting the suppression of urinary PBG and urinary ALA in rats treated with (i) PBGD siRNA and six doses of PBS, (ii) PBGD siRNA, PB, and six doses of PBS, (iii) PBGD siRNA, PB, and six doses of 2.5 mg / kg AD-60519, or (iv) PBGD siRNA, PB, and six doses of 5 mg / kg AD-60519. [Figure 45]Graphs depicting the suppression of serum PBG (upper graph) and serum ALA (lower graph) in a mouse AIP model treated with (i) PBGD siRNA and six doses of PBS (baseline), (ii) PBGD siRNA, PB, and six doses of PBS (saline), (iii) PBGD siRNA, PB, and six doses of 2.5 mg / kg AD-60519, or (iv) PBGD siRNA, PB, and six doses of 5 mg / kg AD-60519. [Figure 46] (Top) A schematic diagram of the experimental design used to examine the therapeutic effect of multiple weekly administrations of AD-60519 is shown. (Bottom) A graph depicting the relative levels of rat ALAS1 mRNA (rALAS1 / GAPDH) in rats treated with (i) PBGD siRNA and four doses of PBS, (ii) PBGD siRNA, PB, and four doses of PBS, (iii) PBGD siRNA, PB, and four doses of 3 mg / kg AD-60519, (iv) PBGD siRNA, PB, and four doses of 1 mg / kg AD-60519, or (v) PBGD siRNA, PB, and four doses of 0.3 mg / kg AD-60519 is shown. [Figure 47] Graphs depicting urinary PBG (upper graph) and urinary ALA (lower graph) levels in rats treated with (i) PBGD siRNA and four doses of PBS, (ii) PBGD siRNA, PB, and four doses of PBS, (iii) PBGD siRNA, PB, and four doses of 3 mg / kg AD-60519, (iv) PBGD siRNA, PB, and four doses of 1 mg / kg AD-60519, or (v) PBGD siRNA, PB, and four doses of 0.3 mg / kg AD-60519 are shown. [Figure 48] FIG. 1 is a schematic diagram showing the design of a non-human primate study in which the effect of ALAS1 siRNA GalNAc conjugates on suppressing hepatic and circulating ALAS1 mRNA is examined. [Figure 49]1 is a graph showing hepatic mRNA suppression in non-human primates (NHPs) following treatment with ALAS1 siRNA GalNAc complexes. [Figure 50] 48 is a graph showing normalized serum levels of ALAS1 mRNA in non-human primates (NHPs) at various time points during the course of a study in which the effect of treatment with ALAS1 siRNA GalNAc conjugates was examined. The days on the horizontal axis correspond to the days in the schematic diagram in FIG. [Figure 51] Normalized ALAS1 mRNA levels are shown (shown as a percentage of pre-dose levels) assessed in a rat single-dose study using urinary cERD to monitor ALAS1 repression. [Figure 52] FIG. 1 is a schematic diagram showing the design of a non-human primate study in which the effects of multiple and single doses of AD-60519 on suppressing hepatic and circulating ALAS1 mRNA are examined. [Figure 53] 1 is a bar graph showing mean relative liver ALAS1 mRNA levels (% of PBS control) on study day 24 (multiple dose group) or study day 4 (single dose group). [Figure 54] 1 is a graph showing normalized serum ALAS1 mRNA levels (shown as a percentage of pre-dose levels) assessed using cERD for the multiple-dose group (top graph, showing results up to day 24) and the single-dose group (bottom graph, showing results up to day 22). [Figure 55] Graphs showing liver mRNA, serum mRNA, and urinary mRNA levels on study day 4 (single-dose group) or study day 24 (multiple-dose group). Individual animal data and mean values ​​for each group are shown. [Figure 56] 1 is a graph showing normalized serum ALAS1 mRNA levels (expressed as a percentage of pre-dose levels) after 8 weeks for the multiple-dose group, as assessed using cERD. Each graphical data point represents the group mean residual ALAS1 mRNA ± group standard deviation for triplicate animal samples. [Figure 57]57 is a schematic diagram of the structure of ALN-60519 (also referred to herein as AD-60519). Figure 57 discloses SEQ ID NOs: 5238-5239, respectively, in order of appearance. [Figure 58] ALAS1 mRNA levels were assessed in matched serum or urine samples obtained from either AIP patients or healthy volunteers (NHVs). ALAS1 mRNA levels in serum or urine were measured using the cERD method. A second set of serum and urine samples was collected in AIP patients A and B to assess the temporal variation of ALAS1 mRNA. DETAILED DESCRIPTION OF THE INVENTION

[0221] iRNAs induce sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Described herein are iRNAs and methods for using them to inhibit expression of the ALAS1 gene in cells or mammals, wherein the iRNA targets the ALAS1 gene. Also provided are compositions and methods for treating disorders associated with ALAS1 expression, such as porphyrias (e.g., ALA dehydratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria, congenital erythropoietic porphyria, porphyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), X-linked sideroblastic anemia (XLSA), and transient erythropoietic porphyria of infancy.

[0222] Porphyrias can be inherited or acquired disorders caused by the reduced or increased activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway (see Figure 1). Porphyrins are the primary heme precursors. Porphyrins and porphyrin precursors include δ-aminolevulinic acid (ALA), porphobilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphyrinogen IX, and protoporphyrin IX. Heme is an essential part of hemoglobin, myoglobin, catalase, peroxidase, and cytochromes, including respiratory and P450 hepatic cytochromes. Heme is synthesized in most or all human cells. Approximately 85% of heme is produced in erythroid cells, primarily for hemoglobin. Most of the remaining heme is produced in the liver, 80% of which is used for cytochrome synthesis. Deficiencies in certain enzymes in the porphyrin pathway result in insufficient heme production and also in the accumulation of porphyrins, precursors, and / or porphyrins, which, at high concentrations, can be toxic to cell or organ function.

[0223] Porphyrias may manifest by neurological complications ("acute"), skin problems ("cutaneous"), or both. Porphyrias may be classified by the primary site of overproduction and accumulation of porphyrins or their precursors. In hepatic porphyrias, porphyrins and porphyrin precursors are overproduced predominantly in the liver, whereas in erythropoietic porphyrias, porphyrins are overproduced in erythroid cells within the bones. Acute or hepatic porphyrias result in nervous system dysfunction and neurological manifestations, which can affect both the central and limbic nervous systems, resulting in symptoms such as pain (e.g., abdominal pain and / or chronic neuropathic pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, convulsions, psychiatric disturbances (e.g., hallucinations, depression, anxiety, paranoia), cardiac arrhythmias, tachycardia, constipation, and diarrhea. Cutaneous or erythroid porphyrias primarily affect the skin, causing symptoms such as photosensitivity, which can be painful, blisters, necrosis, itching, swelling, and increased hair growth in areas such as the forehead. Subsequent infection of the skin lesions can lead to bone and tissue loss, as well as scarring, disfigurement, and defects of digits (e.g., fingers, toes). Most porphyrias are caused by mutations encoding enzymes in the heme biosynthetic pathway. An overview of porphyrias associated with genetic errors in heme metabolism is provided in Figure 2.

[0224] Not all porphyrias are genetic. For example, patients with liver disease may develop porphyria as a result of liver failure, and a transient form of erythroporphria in infancy (transient erythroporphyria of infancy) has been described (see Crawford, RI et al., J Am Acad Dermatol. 1995 Aug;33(2 Pt 2):333-6). Patients with PCT may have deficiency of uroporphyrinogen decarboxylase (URO-D) activity due to the formation of an ORO-D enzyme that is less active than the normal enzyme (see Phillips et al., Blood, 98:3179-3185, 2001).

[0225] Acute intermittent porphyria (AIP), also known as porphobilinogen (PBG) deaminase deficiency or hydroxymethylbilane synthase (HMBS) deficiency, is the most common type of acute hepatic porphyria. Other acute hepatic porphyrias include hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA dehydratase deficiency porphyria (ADP). Acute hepatic porphyrias are described, for example, in Balwani, M., and Desnick, R.J., Blood, 120:4496-4504, 2012.

[0226] AIP is typically an autosomal dominant disorder characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilane synthase (HMB synthase or HMBS). PBG deaminase is the third enzyme in the heme biosynthetic pathway (see Figure 1) and catalyzes the head-to-tail condensation of porphobilinogen molecules into the linear tetrapyrrole hydroxymethylbilane (HMB). Alternatively spliced ​​transcript variants encoding different isoforms of PBG deaminase have been described. Mutations in the PBG deaminase gene have been associated with AIP. Such mutations can result in reduced PBG deaminase levels and / or reduced PBG deaminase activity (affected individuals typically have approximately a 50% reduction in PBG deaminase activity).

[0227] There are at least two distinct models for the pathophysiology of AIP and other acute hepatic porphyrias (see, e.g., Lin CS-Y et al., Clinical Neurophysiology, 2011;122:2336-44). According to one model, reduced heme production due to PBG deaminase deficiency leads to energy failure and axonal degeneration. According to another, currently more favored, model, deposition of porphyrin precursors (e.g., ALA and PBG) leads to neurotoxicity.

[0228] AIP has been found to have a prevalence as high as 1 in 10,000 in certain populations (e.g., northern Sweden; see Floderus Y et al., Clin Genet. 2002;62:288-97). The prevalence in the general population of the United States and Europe, excluding the United Kingdom, is estimated to be between 1 in 10,000 and 1 in 20,000. Clinical disease manifests in only approximately 10–15% of individuals carrying a mutation known to be associated with AIP. However, penetrance is as high as 40% in individuals with certain mutations (e.g., the W198X mutation). AIP is typically latent before puberty. Symptoms are more common in females than in males. The prevalence of the disease is likely underestimated due to its incomplete penetrance and long latency period. It is estimated that approximately 2,000 individuals in the United States have experienced at least one attack. There are an estimated 150 active recurrent cases in France, Sweden, the UK, and Poland; most of these patients are young women, with a median age of 30. See, e.g., Elder et al., J Inherit Metab Dis., published online November 1, 2012.

[0229] AIP affects, for example, the visceral, limbic, autonomic, and central nervous systems. AIP symptoms vary and may include gastrointestinal symptoms (e.g., severe, poorly localized abdominal pain, nausea / vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention / incontinence, or dark urine, e.g., dark red urine), neurological symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting cranial nerves and / or resulting in weakness in the arms or legs), convulsions, neuropathic pain (e.g., pain associated with progressive neuropathy, such as chronic neuropathic pain), neuropsychiatric symptoms (e.g., confusion, anxiety, agitation, hallucinations, hysteria, delirium, blunted affect, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system disorders (e.g., cardiovascular symptoms such as tachycardia, hypertension, and / or arrhythmias, and changes in circulating catecholamine levels, sweating, restlessness, and / or tremors). Symptoms include: increased blood pressure, dehydration, and electrolyte abnormalities. The most common symptoms are abdominal pain and tachycardia. Neurological manifestations include motor and autonomic neuropathy, and seizures. Patients frequently have chronic neuropathic pain and develop progressive neuropathy. Patients with recurrent attacks often have prodromal symptoms. Permanent paralysis may occur after severe attacks. Recovery from severe attacks that are not promptly treated may take weeks or months. Sudden attacks can be fatal, for example, due to respiratory muscle paralysis or cardiovascular damage from electrolyte imbalance (see, e.g., Thunell, S., Hydroxymethylbilane Synthase Deficiency, 2004, pp. 111-114, the entire contents of which are incorporated by reference). Synthase Deficiency) September 27, 2005 [Updated September 1, 2011]. In: Pagon RA, Bird TD, Dolan CR, et al., editors. GeneReviews® [Internet]. Seattle, WA: University of Washington, Seattle; 1993— (hereafter see Thunell (1993)). Before hemin therapy became available, up to 20% of patients with AIP died from their disease.

[0230] Individuals who carry the AIP gene are at increased risk of hepatocellular carcinoma. The risk of hepatocellular carcinoma is particularly severe in individuals with recurrent seizures, with risk exceeding 100 times that of the general population after age 50.

[0231] Acute porphyria attacks can be triggered by endogenous or exogenous factors, such as increased demand for hepatic P450 enzymes and / or induction of hepatic ALAS1 activity. Increased demand for hepatic P450 enzymes leads to a decrease in hepatic free heme, which in turn induces hepatic synthesis of ALAS1.

[0232] Exacerbating factors include fasting (or other forms of reduced or inadequate caloric intake, such as those resulting from crash dieting or long-distance athletic competition), metabolic stress (e.g., infection, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), smoking, lipid-soluble exogenous chemicals (including, for example, cigarette smoke, certain prescription drugs, organic solvents, biocides, and chemicals present in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may also experience exacerbations during the premenstrual period), synthetic estrogens, progesterone, fertility drugs, and hormone replacement therapy). See, e.g., Thunell (1993).

[0233] Over 1000 medications are contraindicated in acute hepatic porphyrias (e.g., AIP, HCP, ADP, and VP), including, for example, alcohol, barbiturates, carbamazepine, carisoprodol, clonazepam (high doses), danazol, diclofenac and possibly other NSAIDs, ergot, estrogens, ethclorvynol, glutethimide, griseofulvin, mephenytoin, meprobamate (also mebutamate and tybutamate), methyprylon, metoclopramide, phenytoin, primidone, progesterone and synthetic progestins, pyrazinamide, pyrazolones (aminopyrine and antipyrine), rifampin, succinimides (ethosuximide and methosuximide), sulfonamide antibiotics, and valproic acid.

[0234] Objective signs of AIP include discoloration of the urine during acute attacks (the urine may appear red or reddish-brown) and increased urinary concentrations of PBG and ALA during acute attacks. Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in over 98% of affected individuals. Thunell (1993).

[0235] Diagnosis of porphyria may involve evaluation of family history, assessment of porphyrin precursor levels in urine, blood, or stool, and / or enzyme activity and DNA mutation analysis. Differential diagnosis of porphyria may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in urine, feces, and / or plasma during an attack (e.g., by chromatography and fluorometry). The diagnosis of AIP can be confirmed by establishing that erythrocyte PBG deaminase activity is 50% or less of normal levels. DNA testing for mutations may be performed in patients and at-risk relatives. The diagnosis of AIP is typically confirmed by DNA testing to identify specific causative gene mutations (e.g., HMBS mutations).

[0236] Current management of acute attacks of AIP involves hospitalization, symptom monitoring, and removal of unsafe medications. Treatment of acute attacks typically requires hospitalization to manage and treat acute symptoms, including abdominal pain, cramps, dehydration / hyponatremia, nausea / vomiting, tachycardia / hypertension, and urinary retention / intestinal obstruction. For example, abdominal pain may be treated with narcotic analgesics; cramps may be treated with seizure prophylaxis and possibly medications (although many anticonvulsant medications are contraindicated); nausea / vomiting may be treated with, for example, phenothiazines; and tachycardia / hypertension may be treated with, for example, beta-blockers. Treatment includes withdrawal of unsafe medications and monitoring of respiratory function, muscle strength, and neurological status. Mild attacks (e.g., those without paresis or hyponatremia) may be treated with at least 300 g of intravenous 10% glucose per day, although increasingly, hemin is being administered immediately. Severe attacks are typically treated with intravenous hemin (3-4 mg / kg daily for 4-14 days) as soon as possible, followed by IV glucose while waiting for the IV hemin to take effect. Typically, attacks are treated with IV hemin for 4 days, followed by IV glucose while waiting for the IV hemin to be administered. Within 3-4 days following the initiation of hemin administration, there is usually a concomitant clinical improvement with a decrease in ALA and PBG levels.

[0237] Hemin (Panhematin® or Injectable Hemin, formerly known as Hematin) is the only heme product approved for use in the United States and the first drug approved under the Orphan Drug Act. Panhematin® is hemin derived from processed red blood cells (PRBCs), a protoporphyrin IX containing a ferric ion (heme B) with a chloride ligand. Heme acts to limit hepatic and / or bone marrow synthesis of porphyrins. The exact mechanism by which hemin produces symptomatic improvement in patients with acute episodes of hepatic porphyria remains unclear; however, its effect is thought to be due to (feedback) inhibition of delta-aminolevulinic acid (ALA) synthase, the rate-limiting enzyme in the porphyrin / heme biosynthetic pathway. See Panhematin® product label, October 2010, Lundbeck, Inc. Inhibition of ALA synthase should result in reduced production of ALA and PBG, as well as porphyrins and porphyrin intermediates.

[0238] Disadvantages of heme products (e.g., hemin) include delayed effects on clinical symptoms and failure to prevent recurrence of attacks. Adverse reactions associated with heme (e.g., hemin) administration include phlebitis (e.g., thrombophlebitis), venous access failure, anticoagulation (or coagulopathy), thrombocytopenia, renal failure, or iron overload, which may occur, particularly in patients who require multiple courses of hemin treatment for recurrent attacks. To prevent phlebitis, patients with recurrent attacks require an indwelling venous catheter for access. At high doses, renal damage may occur. Rarely reported side effects include fever, pain, fatigue, hemolysis, anaphylaxis, and circulatory collapse. See Anderson, K.E., Approaches to Treatment and Prevention of Human Porphyrias, in The Porphyrin Handbook: Medical Aspects of Porphyrins, edited by Karl M. Kadish, Kevin M. Smith, and Roger Guilard (2003) (hereafter Anderson).

[0239] Heme is difficult to prepare in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or higher. Anderson. Panhematin is a lyophilized hemin preparation. When lyophilized hemin is solubilized for intravenous administration, degradation products are rapidly formed; these degradation products cause transient anticoagulant effects at the infusion site and phlebitis. Anderson. Heme albumin and heme alginate (Normosang, the European version of hemin) are more stable and potentially less likely to cause thrombophlebitis. However, heme alginate is not approved for use in the United States. Panhemin can be stabilized for infusion by solubilizing it in 30% human albumin rather than sterile water; however, albumin has an intravascular volume-expanding effect and is isolated from human blood, increasing treatment costs and pathogen risk. See, e.g., Anderson, supra.

[0240] Successful treatment of acute attacks does not prevent or delay relapse. There is a question as to whether hemin itself can cause recurrent attacks due to heme oxygenase induction. Nevertheless, in some areas (particularly France), young women with multiple recurrent attacks are treated with weekly doses of hemin in an attempt to achieve prevention.

[0241] Limited experience with liver transplantation suggests that, if successful, it is an effective treatment for AIP. Approximately 12 transplants have been performed in human patients in Europe, with curative or variable efficacy. Liver transplantation can restore normal excretion of ALA and PBG and prevent acute attacks. See, e.g., Dar, FS et al., Hepatobiliary Pancreat. Dis. Int., 9(1):93-96 (2010). Furthermore, when a liver from an AIP patient is transplanted into another patient (a "domino transplant"), the transplanted patient may develop AIP.

[0242] Long-term clinical effects of acute porphyrias include chronic neuropathic pain, which can result from progressive neuropathy due to neurotoxic effects, such as elevated porphyrin precursors (e.g., ALA and / or PBG). Neurotoxic effects can be associated with, for example, altered GABA signaling and / or the generation of toxic heme intermediates, such as iron-mediated oxidation and reactive oxygen species (ROS) production. Patients may also suffer from neuropathic pain prior to or during acute attacks. Elderly patients may also experience increased neuropathic pain with age, for which various anesthetics are typically prescribed. Electromyographic abnormalities and reduced conduction times have been demonstrated in patients with acute hepatic porphyria. Notably, untreated, uninduced mice with AIP (PBG deaminase deficiency) have been shown to develop progressive motor neuropathy, which leads to progressive quadriceps axon degeneration and loss, likely due to constitutively elevated levels of porphyrin precursors (ALA and PBG), porphyrin and / or heme deficiency (Lindberg et al., J. Clin. Invest., 103(8):1127-1134, 1999). In patients with acute porphyrias (e.g., ADP, AIP, HCP, or VP), porphyrin precursor (ALA and PBG) levels are often elevated in asymptomatic patients and in symptomatic patients between attacks. Therefore, reducing porphyrin precursors and restoring normal heme biosynthesis by reducing ALAS1 expression and / or activity levels is expected to prevent and / or minimize the onset of chronic and progressive neurological disorders. Treatment, e.g., chronic treatment (e.g., periodic treatment with an iRNA described herein, e.g., treatment according to a dosing regimen described herein, e.g., weekly or biweekly treatment), can continuously reduce ALAS1 expression in acute porphyria patients with elevated levels of porphyrin precursors, porphyrins, porphyrin products, or their metabolites. Such treatment may be provided as needed to prevent or reduce the frequency or severity of symptoms (e.g., pain and / or neuropathy) in an individual patient and / or reduce porphyrin precursor, porphyrin, porphyrin product, or metabolite levels.

[0243] There is a need to identify novel therapeutic agents that can be used to treat porphyrias. As discussed above, existing therapeutic agents, such as heme products (e.g., hemin), have numerous drawbacks. For example, hemin's effects on clinical symptoms are delayed, expensive, and can have side effects (e.g., thrombophlebitis, anticoagulation, thrombocytopenia, iron overload, renal failure). Novel therapeutic agents as described herein may address these drawbacks and unmet patient needs by acting more rapidly, not inducing phlebitis, offering the convenience of subcutaneous administration, successfully preventing recurrent attacks, preventing or ameliorating pain (e.g., chronic neuropathic pain) and / or progressive neuropathy, and / or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular carcinoma).

[0244] Patients with AIA include those suffering from recurrent attacks and those suffering from acute sporadic attacks. Among patients with recurrent attacks, approximately 5–10% have recurrent intermittent attacks (2–3 attacks per year) or recurrent attacks (>4 attacks per year). These patients are likely to be considered for liver transplantation or receive prophylactic heme (e.g., hemin) infusions. Patients with recurrent attacks are likely to experience a decline in quality of life due to prolonged hospitalization, opiate addiction, and / or venous network toxicity. Long-term heme administration can induce heme oxygenase (HO-1). Therefore, weaning patients from heme can be difficult, and some patients require more frequent treatment. Therefore, some clinicians limit heme use to the most severe attacks. Therefore, there is an unmet need for convenient, effective preventive and therapeutic methods that are better tolerated.

[0245] For patients suffering from an acute attack, clinical guidelines recommend administering heme as soon as possible. However, given the challenges of diagnosis and the lack of readily available medication, administration may be delayed. The slow onset of effect of heme (e.g., hemin) and its poor tolerance delay the time to improvement. Even after heme administration, persistence of severe abdominal pain may require the patient to receive opiates for several days.

[0246] Delayed heme administration or continued exposure to exacerbating factors can lead to more severe complications, including motor neuropathy and associated symptoms (e.g., weakness, paresis). Respiratory failure and paralysis can occur in severe cases. Recovery from neurological symptoms can take much longer to resolve. Therefore, there is a need for treatments with a more rapid onset of action and better tolerance in the context of acute attacks.

[0247] The pharmacological validation of ALAS1 as a target for mRNA silencing is supported by at least the following findings: ALAS1 mRNA is strongly upregulated during seizures; panhematin downregulates ALAS-1; and addition of heme to hepatocytes in culture results in a decrease in ALAS-1 mRNA. Several findings also suggest that suppression of ALAS1 mRNA may be achieved by targeting the liver. For example, liver transplantation is curative; liver-derived metabolites have been shown to drive seizures (e.g., Dar et al. Hepatobiliary Pancreat Dis Int. 9:93-6 (2010); Dowman et al. Ann Intern Med 154:571-2 (2011); and Wu et al. Genes Dev 23:2201-2209 (2009). Thus, using an iRNA composition, for example, to reduce ALAS1 expression in the liver, can be used to treat porphyria. In certain embodiments, an iRNA composition can be used for prophylaxis and acute treatment of porphyria. For example, an iRNA composition can be used prophylactically in the setting of recurrent attacks to induce long-term or chronic suppression of ALAS1 expression (resulting in long-term or chronic suppression of ALA / PBG), thereby blunting the recurrent ALAS1 upregulation that drives attacks. Such prophylactic treatment can reduce the number and severity of attacks. In the setting of acute attacks, administration of an iRNA composition can treat the acute attack, for example, by reducing ALA / PBG levels.

[0248] The present disclosure provides methods and iRNA compositions for regulating the expression of the ALAS1 gene. In certain embodiments, ALAS1-specific iRNA is used to reduce or inhibit ALAS1 expression, resulting in reduced expression of the ALAS1 gene. Reduced expression of the ALAS1 gene may reduce the levels of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites. Reduced expression of the ALAS1 gene and the associated reduction in the levels of one or more porphyrin precursors and / or porphyrins may be useful for treating disorders associated with ALAS1 expression, such as porphyria.

[0249] The iRNA of the compositions featured herein comprises an RNA strand (antisense strand) having a region of 30 nucleotides or less, i.e., 15 to 30 nucleotides in length, generally 19 to 24 nucleotides in length, that is substantially complementary to at least a portion of the mRNA transcript of the ALAS1 gene (also referred to herein as "ALAS1-specific iRNA"). Use of such iRNAs enables targeted degradation of the mRNA of genes implicated in pathologies associated with ALAS1 expression in mammals, such as porphyrias, e.g., ALA dehydratase deficiency porphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria. Very low doses of ALAS1-specific iRNA can specifically and efficiently mediate RNAi, resulting in significant inhibition of ALAS1 gene expression. iRNAs targeting ALAS1 can specifically and efficiently mediate RNAi, resulting in significant inhibition of ALAS1 gene expression, for example, in cell-based assays. Thus, these iRNAs and other methods and compositions are useful for treating pathological processes associated with ALAS1 expression, such as porphyrias (e.g., X-linked sideroblastic anemia (XLSA), ALA dehydratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, porphyria cutanea tarda (prophyria cutanea tarda), hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythropoietic porphyria of infancy).

[0250] The following description discloses how to make and use iRNA-containing compositions for inhibiting expression of the ALAS1 gene, as well as compositions and methods for treating diseases and disorders caused by or regulated by expression of this gene. Pharmaceutical composition embodiments featured in the present invention include an iRNA having an antisense strand comprising a region of 30 nucleotides or less, typically 19-24 nucleotides in length, together with a pharmaceutically acceptable carrier, which region is substantially complementary to at least a portion of an RNA transcript of the ALAS1 gene. Composition embodiments featured in the present invention also include an iRNA having an antisense strand that is 30 nucleotides or less, typically 19-24 nucleotides in length, and has a complementary region that is substantially complementary to at least a portion of an RNA transcript of the ALAS1 gene.

[0251] Thus, in some aspects, the present invention features pharmaceutical compositions containing ALAS1 iRNA and a pharmaceutically acceptable carrier, methods for inhibiting expression of the ALAS1 gene using the compositions, and methods for treating disorders associated with ALAS1 expression using the pharmaceutical compositions.

[0252] I. Definition For convenience, the meanings of certain terms and phrases used in the specification, examples, and appended claims are provided below. In the event of an apparent conflict between usage in other parts of this specification and its definition provided in this section, the definition in this section shall control.

[0253] "G", "C", "A", "T" and "U" generally refer to nucleotides containing guanine, cytosine, adenine, thymidine and uracil as bases, respectively.However, it is understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides or alternative replacement moieties, as will be further detailed below.Those skilled in the art are well aware that guanine, cytosine, adenine and uracil can be replaced by other moieties without substantially changing the base pairing properties of oligonucleotides comprising nucleotides with such replacement moieties.As a non-limiting example, a nucleotide comprising inosine as its base can base pair with a nucleotide containing adenine, cytosine or uracil.Therefore, a nucleotide containing uracil, guanine or adenine can be replaced with a nucleotide containing inosine, for example, in the nucleotide sequence of the dsRNA of the present invention. In another example, adenine and cytosine can be substituted with guanine and uracil, respectively, anywhere in the oligonucleotide to form a GU wobble base pair with the target mRNA. Sequences containing such substituted moieties are suitable for the compositions and methods featured herein.

[0254] As used herein, "ALAS1" (also known as ALAS-1; delta-aminolevulinic acid synthase 1; delta-ALA synthase 1; 5'-aminolevulinic acid synthase 1; ALAS-H; ALASH; ALAS-N; ALAS3; EC 2.3.1.37; nonspecific mitochondrial 5-aminolevulinic acid synthase; ALAS; MIG4; OTTHUMP00000212619; OTTHUMP00000212620; OTTHUMP00000212621; OTTHUMP00000212622; translocation-inducing protein 4; EC 2.3.1) refers to a nuclear-encoded mitochondrial enzyme that is the first enzyme in the mammalian heme biosynthetic pathway and is typically the rate-limiting enzyme. ALAS1 catalyzes the condensation of glycine with succinyl-CoA to produce delta-aminolevulinic acid (ALA). The human ALAS1 gene is ubiquitously expressed, found on chromosome 3p21.1, and typically encodes a sequence of 640 amino acids. In contrast, the ALAS-2 gene, which encodes an isoenzyme, is expressed exclusively in erythrocytes, found on chromosome Xp11.21 (chromoxome), and typically encodes a sequence of 550 amino acids. As used herein, "ALAS1 protein" refers to any protein variant of ALAS1 from any species (e.g., human, mouse, non-human primate), as well as any mutant or fragment thereof that retains ALAS1 activity. Similarly, "ALAS1 transcript" refers to any transcript variant of ALAS1 from any species (e.g., human, mouse, non-human primate). The sequence of the human ALAS1 mRNA transcript is available at NM_000688.4 (Figures 3A and 3B; SEQ ID NO: 1). The sequence of another human ALAS1 mRNA transcript is available at NM_000688.5 (Figures 4A and 4B; SEQ ID NO: 382). The levels of the encoded mature ALAS1 protein are regulated by heme; high levels of heme downregulate the mature enzyme in mitochondria, whereas low levels of heme upregulate it. Multiple alternatively spliced ​​variants encoding the same protein have been identified.

[0255] As used herein, the terms "iRNA," "RNAi," "iRNA agent," or "RNAi agent" refer to an agent that contains an RNA, as defined herein, and mediates targeted cleavage of an RNA transcript, e.g., through the RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA described herein results in inhibition of ALAS1 expression. Inhibition of ALAS1 expression may be assessed based on a decrease in ALAS1 mRNA levels or a decrease in ALAS1 protein levels. As used herein, a "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the ALAS1 gene, including the mRNA, which is the RNA processing product of the primary transcript. The target portion of the sequence is at least sufficiently long to serve as a substrate for iRNA-directed cleavage at or near that portion. For example, a target sequence is generally 9-36 nucleotides in length, e.g., 15-30 nucleotides in length, including all subranges therebetween. By way of non-limiting example, the target sequence may be 15 to 30 nucleotides, 15 to 26 nucleotides, 15 to 23 nucleotides, 15 to 22 nucleotides, 15 to 21 nucleotides, 15 to 20 nucleotides, 15 to 19 nucleotides, 15 to 18 nucleotides, 15 to 17 nucleotides, 18 to 30 nucleotides, 18 to 26 nucleotides, 18 to 23 nucleotides, 18 to 22 nucleotides, 18 to 21 nucleotides, 18 to 20 nucleotides, 19 to 30 nucleotides, 19 to 26 nucleotides, The amino acid sequence may be 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.

[0256] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides described by a sequence referenced using standard nucleotide nomenclature.

[0257] As used herein, unless otherwise specified, the term "complementary," when used to describe a first nucleotide sequence in the context of a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize to an oligonucleotide or polynucleotide comprising the second nucleotide sequence under specified conditions to form a double-stranded structure, as would be understood by one of skill in the art. Such conditions may be stringent conditions, which may include, for example, 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, at 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in an organism, may also be applied. One of skill in the art can determine the optimal set of conditions for testing the complementarity of two sequences depending on the end use of the hybridized nucleotides.

[0258] For example, a complementary sequence in an iRNA, such as a dsRNA described herein, includes base pairing between an oligonucleotide or polynucleotide comprising a first nucleotide sequence and an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as "fully complementary" to each other. However, when a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences may be fully complementary, or they may form one or more, but generally no more than 5, 4, 3, or 2 mismatched base pairs upon hybridization of a duplex of up to 30 base pairs, while retaining the ability to hybridize under conditions most appropriate for their ultimate use, such as inhibiting gene expression through the RISC pathway. However, if two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs shall not be considered mismatches in determining complementarity. For example, if a dsRNA comprises one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, and the longer oligonucleotide comprises a 21 nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, it may still be referred to as "fully complementary" for purposes described herein.

[0259] "Complementary" sequences, as used herein, may also include or be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from unnatural and modified nucleotides, such as, but not limited to, G:U wobble base pairs or Hoogsteen base pairs, so long as the above requirements regarding their hybridization ability are met.

[0260] The terms "complementary," "fully complementary," and "substantially complementary" may be used herein to refer to matching bases between the sense and antisense strands of a dsRNA or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.

[0261] As used herein, a polynucleotide that is "substantially complementary to at least a portion" of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous portion of a target mRNA (e.g., an mRNA encoding an ALAS1 protein). For example, a polynucleotide is complementary to at least a portion of an ALAS1 mRNA if its sequence is substantially complementary to a non-interrupted portion of the mRNA encoding ALAS1. For example, a polynucleotide is complementary to at least a portion of an ALAS1 mRNA if its sequence is substantially complementary to a non-interrupted portion of the mRNA encoding ALAS1.

[0262] The term "double-stranded RNA" or "dsRNA," as used herein, refers to an iRNA, including an RNA molecule or molecular complex, having a hybridized double-stranded region comprising two antiparallel and substantially complementary nucleic acid strands, said to have "sense" and "antisense" orientations with respect to the target RNA. The double-stranded region can be of any length that allows for specific degradation of the desired target RNA, for example, via the RISC pathway, but typically ranges in length from 9 to 36 base pairs, e.g., 15 to 30 base pairs in length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length within this range, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36, as well as 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-30 base pairs, 18-40 base pairs, 18-42 base pairs, 18-43 base pairs, 18-44 base pairs, 18-45 base pairs, 18-46 base pairs, 18-47 base pairs, 18-48 base pairs, 18-50 base pairs, 18-51 base pairs, 18-52 base pairs, 18-53 base pairs, 18-54 base pairs, 18-55 base pairs, 18-56 base pairs, 18-57 base pairs, 18-58 base pairs, 18-59 base pairs, 19-60 base pairs, 19-61 base pairs, 19-62 base pairs, 19-63 base pairs, 19-64 base pairs, 19-65 base pairs, 20-66 base pairs, 20-67 base pairs, 20-68 base pairs, 20-69 base pairs The length may be any subrange therebetween, including, but not limited to, 8-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNA generated in cells by processing with Dicer and similar enzymes is generally in the 19-22 base pair range. One strand of the double-stranded region of the dsDNA comprises a sequence that is substantially complementary to a region of the target RNA. The two strands that form the duplex structure can be derived from a single RNA molecule with at least one self-complementary region, or can be generated from two or more separate RNA molecules.When the double-stranded region is generated from two strands of a single molecule, the molecule can have a double-stranded region separated by a single strand of nucleotides (referred to herein as "hairpin loop") between the 3'-end of one strand that forms the double-stranded structure and the 5'-end of each other strand.The hairpin loop can comprise at least one unpaired nucleotide; in some embodiments, the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.When the two substantially complementary strands of dsRNA are formed by another RNA molecule, these molecules can be, but do not necessarily have to be, covalently linked.When the two strands are covalently linked by means other than a hairpin loop, the linking structure is referred to as a "linker".The term "siRNA" is also used herein to refer to the above-mentioned dsRNA.

[0263] In another embodiment, an iRNA agent may be a "single-stranded siRNA" introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and chemically modified. The design and testing of single-stranded siRNAs is described in U.S. Pat. No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the contents of each of which are incorporated herein by reference in their entirety. Any of the antisense nucleotide sequences described herein (e.g., the sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20 or Tables 21-40) may be used as single-stranded siRNAs as described herein, or may be chemically modified and used by the methods described in Lima et al. (2012) Cell 150:883-894.

[0264] In another embodiment, the RNA agent is a "single-stranded antisense RNA molecule." Single-stranded antisense RNA molecules are complementary to a sequence within a target mRNA. Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by base-pairing with the mRNA and physically interfering with the translation machinery. See Dias, N. et al. (2002) Mol Cancer Ther 1:347-355. Alternatively, single-stranded antisense molecules inhibit target mRNA by hybridizing to the target (hydridizing) and cleaving the target through an RNase H cleavage event. Single-stranded antisense RNA molecules can be about 10 to about 30 nucleotides in length and have a sequence complementary to the target sequence. For example, a single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, such as, for example, the sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20 or Tables 21-40.

[0265] Those skilled in the art will recognize that the terms "RNA molecule" or "ribonucleic acid molecule" encompass not only naturally expressed or found RNA molecules, but also RNA analogs and derivatives comprising one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. Strictly speaking, a "ribonucleoside" comprises a nucleoside base and a ribose sugar, and a "ribonucleotide" is a ribonucleoside with one, two, or three phosphate moieties. However, the terms "ribonucleoside" and "ribonucleotide" can be considered equivalent as used herein. RNA can be modified in the nucleobase structure, the ribose structure, or the ribose-phosphate backbone structure, for example, as described herein below. However, molecules comprising ribonucleoside analogs or derivatives must retain the ability to form double strands. As non-limiting examples, the RNA molecule may also include at least one modified ribonucleoside, including, but not limited to, a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino modified nucleoside, a 2'-alkyl modified nucleoside, a morpholino nucleoside, a phosphoramidate or non-natural base-containing nucleoside, or any combination thereof. Alternatively, the RNA molecule can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more modified ribonucleosides up to the entire length of the dsRNA molecule. The modification need not be the same for each such multiple modified ribonucleoside in the RNA molecule.In one embodiment, a modified RNA contemplated for use in the methods and compositions described herein is a peptide nucleic acid (PNA), which has the ability to form the necessary double-stranded structure to enable or mediate the specific degradation of a target RNA, for example, through the RISC pathway.

[0266] In one aspect, the modified ribonucleoside comprises a deoxyribonucleoside. In such cases, the iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang or one or more deoxynucleosides within the double-stranded portion of the dsRNA. In certain embodiments, the RNA molecule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or more (but not 100%) deoxyribonucleosides, e.g., within one or both strands. In other embodiments, the term "iRNA" does not encompass double-stranded DNA molecules (e.g., naturally occurring double-stranded DNA molecules or 100% deoxynucleoside-containing DNA molecules). In one embodiment, an RNA interference agent comprises a single-stranded RNA that interacts with a target RNA sequence and induces cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is degraded into siRNAs by a type III endonuclease known as Dicer (Sharp et al., Genes Dev., 2001, 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into short interfering RNAs of 19-23 base pairs with characteristic two-base 3' overhangs (Bernstein et al., 2001, Nature, 409:363). The siRNA is then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen et al., 2001, Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within RISC cleave the target, inducing silencing (Elbashir et al., 2001, Genes Dev. 15:188).Thus, in one aspect, the present invention relates to single-stranded RNAs that promote RISC complex formation, resulting in target gene silencing.

[0267] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of an iRNA, such as a dsRNA. For example, a nucleotide overhang exists when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, or at least five or more nucleotides. A nucleotide overhang can comprise or consist of nucleotide / nucleoside analogs, including deoxyribonucleotides / nucleosides. An overhang can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhanging nucleotide can be present on the 5'-end, the 3'-end, or both ends of either the antisense or sense strand of a dsRNA.

[0268] In one embodiment, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3'-end and / or 5'-end. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3'-end and / or 5'-end. In another embodiment, one or more nucleotides in the overhang are substituted with a thiophosphate nucleoside.

[0269] The term "blunt-ended" or "blunt-ended" used herein in relation to dsRNA means that there is no unpaired nucleotide or nucleotide analogue at a given end of dsRNA, i.e., there is no nucleotide overhang.One or both ends of dsRNA can be blunt-ended.When both ends of dsRNA are blunt-ended, the dsRNA is said to be blunt-ended.For clarity, "blunt-ended" dsRNA is a dsRNA with both ends blunted, i.e., there is no nucleotide overhang at either end of the molecule.In most cases, such molecules are double-stranded throughout their entire length.

[0270] The term "antisense strand" or "guide strand" refers to an iRNA strand, such as a dsRNA, that includes a region that is substantially complementary to a target sequence. As used herein, the term "region complementary" refers to a region on the antisense strand that is substantially complementary to a sequence, such as a target sequence as defined herein. If the complementary region is not completely complementary to the target sequence, mismatches may exist in the internal or terminal regions of the molecule. Generally, mismatches are most tolerated in the terminal regions, such as within 5, 4, 3, or 2 nucleotides of the 5' and / or 3' end.

[0271] The terms "sense strand" or "passenger strand," as used herein, refer to an iRNA strand that includes a region that is substantially complementary to a region of the antisense strand, as defined herein.

[0272] As used herein, in one embodiment, the term "SNALP" refers to a stable nucleic acid-lipid particle. SNALP refers to a lipid vesicle with a reducing aqueous interior containing a nucleic acid, such as an iRNA, or a plasmid from which the iRNA is transcribed. SNALPs are described, for example, in U.S. Patent Application Publication No. 20060240093, U.S. Patent Application Publication No. 20070135372, and International Publication No. 2009082817. These applications are incorporated by reference in their entireties.

[0273] "Introducing into a cell," in reference to iRNA, means facilitating or causing uptake or absorption into the cell, as understood by those skilled in the art. Absorption or uptake of iRNA can occur through unassisted diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; iRNA can also be "introduced into a cell" when the cell is part of a living organism. In such cases, introduction into a cell includes delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be via β-glucan delivery systems, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Patent Publication No. 2005 / 0281781, the entire contents of which are incorporated herein by reference. In vitro introduction into cells includes methods known in the art, such as electroporation and lipofection. Additional approaches are described herein below or known in the art.

[0274] As used herein, the term "modulate expression of" refers to at least partial "inhibition" or partial "activation" of ALAS1 gene expression in cells treated with an iRNA composition described herein compared to expression in control cells. Control cells include untreated cells or cells treated with a non-targeting control iRNA.

[0275] As used herein, the terms "activate," "enhance," "upregulate expression," "increase expression," and the like, insofar as they refer to the ALAS1 gene, refer to at least partial activation of ALAS1 gene expression, manifested by an increase in the amount of ALAS1 mRNA, which may be isolated from or detected in a first cell or group of cells in which the ALAS1 gene is transcribed, and which first cell or group of cells has been treated to increase expression of the ALAS1 gene compared to a second cell or group of cells (control cells) that is substantially identical to the first cell or group of cells but has not been so treated.

[0276] In one embodiment, expression of the ALAS1 gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA described herein. In some embodiments, expression of the ALAS1 gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured herein. In some embodiments, expression of the ALAS1 gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA described herein. In some embodiments, ALAS1 gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold or more in cells treated with an iRNA described herein compared to expression in untreated cells. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006, Proc. Natl. Acad. Sci. USA, 103:17337-42, and U.S. Patent Nos. 20070111963 and 2005226848, each of which is incorporated herein by reference.

[0277] The terms "silence," "inhibit expression," "downregulate expression," "suppress expression," and the like, insofar as they refer to the ALAS1 gene, refer to at least partial suppression of expression of the ALAS1 gene, e.g., by assessment based on ALAS1 mRNA expression, ALAS1 protein expression, or another parameter functionally linked to ALAS1 gene expression (e.g., ALA or PBG concentrations in plasma or urine). For example, inhibition of ALAS1 expression may be manifested by a decrease in the amount of ALAS1 mRNA, which may be isolated from or detected in a first cell or group of cells in which the ALAS1 gene is transcribed and which has been treated such that ALAS1 gene expression is inhibited compared to a control. The control may also be a second cell or group of cells (control cells) that is substantially identical to the first cell or group of cells but has not been so treated. The degree of inhibition is usually measured using a method such as, for example,

number

[0278] Alternatively, the degree of inhibition may be expressed in terms of a reduction in a parameter functionally linked to ALAS1 gene expression, such as the amount of protein encoded by the ALAS1 gene or the level of one or more porphyrins. The reduction in a parameter functionally linked to ALAS1 gene expression may also be expressed as a percentage of the control level. In principle, ALAS1 gene silencing may be determined by any suitable assay in any cell that expresses ALAS1, either constitutively or by genome engineering. However, if a reference is needed to determine whether a given iRNA inhibits ALAS1 gene expression to a particular extent and is therefore encompassed by the present invention, the assays provided in the Examples below may serve as such a reference.

[0279] For example, in some cases, expression of the ALAS1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA featured herein. In some embodiments, expression of the ALAS1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA featured herein. In some embodiments, expression of the ALAS1 gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA described herein.

[0280] As used herein, in the context of ALAS1 expression, the terms "treat," "treating," "treatment," and the like refer to the alleviation or alleviation of a pathological process associated with ALAS1 expression (e.g., a pathological process associated with a porphyrin or porphyrin pathway defect, such as a porphyria). In the context of the present invention, insofar as it relates to any of the other medical conditions listed below (other than a pathological process associated with ALAS1 expression), the terms "treat," "treatment," and the like refer to preventing, alleviating, or alleviating at least one symptom associated with such medical condition, or slowing or reversing the progression or expected progression of such condition. For example, the methods featured herein, when used to treat porphyria, may serve to alleviate or prevent one or more symptoms associated with porphyria (e.g., pain), reduce the severity or frequency of attacks associated with porphyria, reduce the likelihood of an attack of one or more symptoms associated with porphyria upon exposure to an aggravating condition, shorten the duration of attacks associated with porphyria, and / or reduce the risk of developing a condition associated with porphyria (e.g., hepatocellular carcinoma or a neurological disorder (e.g., a progressive neurological disorder)). Thus, unless the context clearly dictates otherwise, the terms "treat," "treatment," and the like are intended to encompass prophylactic methods, e.g., prevention of an ALAS1 expression-associated disorder and / or symptoms of the disorder.

[0281] "Reduce," in the context of a disease marker or symptom, means a statistically or clinically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, typically to a level generally accepted as being within the normal range for individuals without such disease.

[0282] As used herein, the phrases "therapeutically effective amount" and "prophylactically effective amount" refer to an amount that provides a therapeutic effect in the treatment, prevention, or management of a pathological process associated with ALAS1 expression. The particular therapeutically effective amount can be readily determined by an ordinary practitioner and may vary depending on factors known in the art, such as the type of pathological process, the patient's medical history and age, the stage of the pathological process, and the administration of other drugs.

[0283] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier. As used herein, a "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to an amount of an iRNA effective to produce an intended pharmacological, therapeutic, or prophylactic result. For example, in a method for treating a disease associated with ALAS1 expression (e.g., a method for treating porphyria), an effective amount can include an amount effective to reduce one or more symptoms associated with porphyria, reduce the frequency of attacks, reduce the likelihood of one or more symptoms associated with porphyria occurring upon exposure to an exacerbating factor, or reduce the risk of developing a condition associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular carcinoma). For example, if a given clinical treatment is considered effective if there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, then a therapeutically effective amount of a therapeutic agent for that disease or disorder is the amount necessary to produce at least a 10% reduction in the parameter. For example, a therapeutically effective amount of an iRNA targeting ALAS1 may reduce ALAS1 protein levels by any measurable amount, such as, for example, by at least 10%, 20%, 30%, 40%, or 50%.

[0284] The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, inert diluents such as pharmaceutically acceptable excipients, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while cornstarch and alginic acid are suitable disintegrants. Binders include starch and gelatin, while lubricants, if present, are generally magnesium stearate, stearic acid, or talc. If necessary, tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The active ingredients contained in the formulation are described in more detail herein below.

[0285] When referring to a numerical value or numerical range, the term "about" means that the referenced numerical value or numerical range is approximate within experimental variation (or within statistical experimental error), and thus the numerical value or numerical range may vary, for example, by 1% to 15% from the stated number or numerical range.

[0286] II. iRNA Agents Described herein are iRNA agents that inhibit expression of the ALAS1 gene. In one embodiment, the iRNA agent comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting ALAS1 gene expression in a cell or subject (e.g., in a mammal such as a human with porphyria), where the dsRNA comprises an antisense strand having a region of complementarity complementary to at least a portion of an mRNA formed upon expression of the ALAS1 gene, the region of complementarity being 30 nucleotides or less in length, generally 19-24 nucleotides in length, and where the dsRNA, upon contact with a cell expressing the ALAS1 gene, inhibits expression of the ALAS1 gene by at least 10%, as assayed, for example, by PCR or branched DNA (bDNA)-based methods or by protein-based methods such as Western blot. In one embodiment, the iRNA agent activates expression of the ALAS1 gene in the cell or mammal. Expression of the ALAS1 gene in cell cultures such as COS cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cells, or in biological samples from subjects can be assayed by measuring ALAS1 mRNA levels, such as by bDNA or TaqMan assays, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western blotting or flow cytometry techniques.

[0287] dsRNA contains two RNA strands that are sufficiently complementary to hybridize to form a double-stranded structure under the conditions in which the dsRNA is used. One strand of the dsRNA (the antisense strand) contains a region of complementarity that is substantially complementary to the target sequence, generally perfectly complementary. The target sequence can be derived from the sequence of mRNA formed during expression of the ALAS1 gene. The other strand (the sense strand) contains a region complementary to the antisense strand such that, when combined under appropriate conditions, the two strands hybridize to form a double-stranded structure. Typically, the double-stranded structure is 15-30, more commonly 18-25, even more commonly 19-24, and most commonly 19-21 base pairs in length. Similarly, the region of complementarity to the target sequence is 15-30, more commonly 18-25, even more commonly 19-24, and most commonly 19-21 nucleotides in length. In some embodiments, the dsRNA is 15-20 nucleotides in length, and in other embodiments, the dsRNA is 25-30 nucleotides in length. As those skilled in the art will recognize, the target region of an RNA targeted for cleavage is most often a portion of a larger RNA molecule, which is often an mRNA molecule. Where applicable, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to serve as a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway). dsRNAs with duplexes as short as 9 base pairs can, in some circumstances, mediate RNAi-directed RNA cleavage. In most cases, the target is at least 15 nucleotides in length, e.g., 15-30 nucleotides in length.

[0288] Those skilled in the art will also recognize that the double-stranded region is the primary functional portion of a dsRNA, e.g., a 9-36 base pair double-stranded region, e.g., 15-30 base pairs. Thus, in one embodiment, an RNA molecule or RNA molecule complex having a double-stranded region of more than 30 base pairs is a dsRNA, as long as it is processed into a functional duplex, e.g., 15-30 base pairs, that targets a desired RNA for cleavage. Thus, in one embodiment, a miRNA, in turn, is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting ALAS1 expression is not generated in a target cell by cleavage of a larger dsRNA.

[0289] The dsRNA described herein may further comprise one or more single-stranded nucleotide overhangs.The dsRNA can be synthesized by standard methods known in the art, for example, by using an automated DNA synthesizer, such as that commercially available from Biosearch, Applied Biosystems, Inc., as will be further discussed below.In one embodiment, the ALAS1 gene is the human ALAS1 gene.In another embodiment, the ALAS1 gene is the mouse or rat ALAS1 gene.

[0290] In certain embodiments, the first sequence is the sense strand of a dsRNA comprising a sense sequence disclosed herein, e.g., in Tables 21-40, and the second sequence is the antisense strand of a dsRNA comprising an antisense sequence disclosed herein, e.g., in Tables 21-40.

[0291] In certain embodiments, the first sequence is the sense strand of a dsRNA, including a sense sequence from Table 2 or Table 3, and the second sequence is the antisense strand of a dsRNA, including an antisense sequence from Table 2 or Table 3. In embodiments, the first sequence is the sense strand of a dsRNA, including a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15, and the second sequence is the antisense strand of a dsRNA, including an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15. In embodiments, the first sequence is the sense strand of a dsRNA, including a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20, and the second sequence is the antisense strand of a dsRNA, including an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18, or 20.

[0292] In one embodiment, the dsRNA can comprise at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40, and the antisense strand corresponding to the sense strand is selected from the antisense sequences provided herein, e.g., in Tables 21-40.

[0293] In one embodiment, the dsRNA can comprise at least sense and antisense nucleotide sequences, wherein the sense strand is selected from the group of sequences provided in Tables 2 and 3 and corresponds to the antisense strand of the sense strand selected from Tables 2 and 3. In a further embodiment, the dsRNA can comprise at least sense and antisense nucleotide sequences, wherein the sense strand is selected from the group of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15 and corresponds to the antisense strand of the sense strand selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15. In a further embodiment, the dsRNA can comprise at least sense and antisense nucleotide sequences, wherein the sense strand is selected from the group of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20 and corresponds to the antisense strand of the sense strand selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20.

[0294] In embodiments, the iRNA may be any of the following: AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519 ... 05, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the iRNA is selected from the group consisting of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, The antisense strand comprises or consists of an antisense sequence (including one or more (e.g., all modifications)) selected from the antisense sequences of AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.In embodiments, the iRNA is selected from the group consisting of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD and a sense strand comprising or consisting of a sense sequence (and / or one or more (e.g., all) modifications) selected from AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.

[0295] In embodiments, the iRNA comprises (i) an antisense strand comprising, or consisting of, the sequence UAAGAUGAGACACUCUUUCUGGU or UAAGAUGAGACACUCTUUCUGGU, and / or (ii) a sense strand comprising, or consisting of, the sequence CAGAAAGAGUGUCUCAUCUUA. In embodiments, one or more nucleotides of the antisense strand and / or the sense strand are modified as described herein.

[0296] In embodiments, the iRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-60489, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-60489 (and / or one or more (e.g., all) modifications of the sense strand and / or antisense strand of AD-60489).

[0297] In embodiments, the iRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-60519, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-60519 (and / or one or more (e.g., all) modifications of the sense and / or antisense strand of AD-60489).

[0298] In embodiments, the iRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-61193, and / or (ii) a sense strand comprising or consisting of the sense sequence of AD-61193 (and / or one or more (e.g., all) modifications of the sense and / or antisense strand of AD-60489).

[0299] In embodiments, the iRNA comprises (i) an antisense strand comprising or consisting of the antisense sequence of AD-60819, and / or (ii) a sense sequence comprising or consisting of the sense sequence of AD-60819 (and / or one or more (e.g., all) modifications of the sense and / or antisense strand of AD-60489).

[0300] In embodiments, an iRNA for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand (or the corresponding unmodified antisense sequence) comprising or consisting of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and / or (ii) a sense strand (or the corresponding unmodified antisense sequence) comprising or consisting of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819. In embodiments, the iRNA comprises (i) an antisense strand consisting of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and / or (ii) a sense strand consisting of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense and / or sense strand of the dsRNA differs from the corresponding antisense and / or sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 by one, two, or three nucleotides.

[0301] The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 disclosed herein.

[0302] In one embodiment, the iRNA is ALN-60519. ALN-60519 is a chemically synthesized double-stranded oligonucleotide covalently linked to a ligand containing three N-acetylgalactosamine (GalNAc) residues (shown in Figure 57). In one embodiment, all nucleotides of ALN-60519 are 2'-OMe or 2'-F modified and linked via a 3'-5' phosphodiester bond, thus forming the sugar-phosphate backbone of the oligonucleotide. The sense and antisense strands of ALN-60519 contain 21 and 23 nucleotides, respectively. The 3' end of the sense strand of ALN-60519 is conjugated to a triantennary GalNAc moiety (designated L96) via a phosphodiester bond. The antisense strand contains four phosphorothioate linkages, two at the 3' end and two at the 5' end. The sense strand of ALN-60519 contains two phosphorothioate linkages at the 5' end. 21 nucleotides of the sense strand of ALN-60519 hybridize with the complementary 21 nucleotides of the antisense strand, thus forming a 21-nucleotide base pair and a two-base overhang at the 3' end of the antisense strand. The two single strands of the sense and antisense strands of ALN-60519 can be synthesized by conventional solid-phase oligonucleotide synthesis using standard phosphoramidite chemistry, in which the 5'-hydroxyl group is protected as a dimethoxytriphenylmethyl (DMT) ether. Each strand can be constructed from the 3' end to the 5' end by sequential addition of protected nucleoside phosphoramidites.

[0303] In these embodiments, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to an mRNA sequence produced by expression of the ALAS1 gene. Thus, the dsRNA comprises two oligonucleotides, the first of which is described herein as the sense strand and the second of which is described as the antisense strand that corresponds to the sense strand. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

[0304] Those skilled in the art are well aware that dsRNAs having a duplex structure of 20-23 base pairs, particularly 21 base pairs, have been advocated as being particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can be similarly effective. In the above-described embodiment, due to the nature of the oligonucleotide sequences provided in the tables herein, the dsRNAs described herein can contain at least one strand that is at least 21 nucleotides long. It can be reasonably expected that shorter duplexes having one of the sequences described herein, with only a few nucleotides missing from one or both ends, may be similarly effective compared to the dsRNAs described above. Thus, dsRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one of the sequences described herein and having an ability to inhibit expression of the ALAS1 gene that differs by no more than 5, 10, 15, 20, 25, or 30% from a dsRNA comprising the full-length sequence are contemplated by the present invention.

[0305] Additionally, the RNAs provided in the Tables herein identify regions of the ALAS1 transcript that are highly susceptible to RISC-mediated cleavage. Accordingly, the present invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within a specific region of an RNA transcript if it promotes cleavage of the transcript anywhere within that region. Such iRNAs generally comprise at least 15 contiguous nucleotides from one of the sequences provided herein in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, 20, and Tables 21-40, linked to additional nucleotide sequences from regions flanking the selected sequence in the ALAS1 gene.

[0306] Target sequences are generally 15-30 nucleotides in length, although there is wide variability in the suitability of specific sequences within this range to induce cleavage of any given target RNA. While the various software packages and guidelines presented herein provide guidance for identifying optimal target sequences for any given gene target, an empirical approach can also be taken in which a "window" or "mask" of a given size (21 nucleotides, as a non-limiting example) is placed, either physically or figuratively (e.g., by computer simulation), around the target RNA sequence to identify sequences within a size range that may serve as target sequences. By successively shifting the sequence "window" one nucleotide upstream or downstream of the initial target sequence position, subsequent potential target sequences can be identified until a complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis of the identified sequences and testing (using assays described herein or known in the art) to identify optimally functioning sequences, can identify RNA sequences that mediate the best inhibition of target gene expression when targeted with an iRNA agent. Thus, for example, while the sequences identified in the tables herein represent effective target sequences, it is contemplated that further optimization of inhibitory efficiency may be achieved by successively "window walking" one nucleotide upstream or downstream of a given sequence to identify sequences with equivalent or better inhibitory properties.

[0307] It is also contemplated that further optimization of any sequence, for example, identified in the table herein, can be achieved by systematically adding or removing nucleotides to create longer or shorter sequences, and then testing these and the created sequences by walking through windows of a size longer or shorter than that of the target RNA from that position.Again, combining this approach of creating new target candidates with testing the effectiveness of iRNAs based on these target sequences in inhibition assays known in the art or described herein can lead to further improvements in inhibition efficiency.Furthermore, such optimized sequences can be adjusted by, for example, introducing modified nucleotides described herein or known in the art, adding or modifying overhangs, or other modifications known in the art and / or discussed herein, to further optimize the molecule as an expression inhibitor (e.g., increasing serum stability or circulating half-life, increasing thermostability, enhancing transmembrane delivery, targeting specific locations or cell types, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.).

[0308] The iRNAs described herein may contain one or more mismatches with the target sequence. In one embodiment, the iRNAs described herein contain three or fewer mismatches. If the antisense strand of an iRNA contains mismatches with the target sequence, the extent of the mismatch is preferably not located in the center of the complementary region. If the antisense strand of an iRNA contains mismatches with the target sequence, the mismatch is preferably limited to within the last five nucleotides from either the 5' or 3' end of the complementary region. For example, in a 23-nucleotide iRNA agent RNA strand complementary to a region of the ALAS1 gene, the RNA strand generally does not contain any mismatches within the central 13 nucleotides. Using methods described herein or known in the art, it can be determined whether an iRNA containing mismatches with the target sequence is effective in inhibiting expression of the ALAS1 gene. Examining the effectiveness of an iRNA with mismatches in inhibiting expression of the ALAS1 gene is important, especially when a particular complementary region of the ALAS1 gene is known to have polymorphic sequence variation within the population.

[0309] In one embodiment, at least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4 nucleotides, generally 1 or 2 nucleotides. dsRNAs with at least one nucleotide overhang have surprisingly superior inhibitory properties compared to their blunt-ended counterparts. In yet another embodiment, the RNA of an iRNA, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial properties. Nucleic acids featured in the present invention may be synthesized and / or modified by methods established in the art, such as those described in "Current Protocols in Nucleic Acid Chemistry," edited by Beaucage, SL et al., John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications include, for example, (a) terminal modifications, such as 5'-end modifications (phosphorylation, conjugated linkage, inverted linkage) and 3'-end modifications (conjugated linkage, DNA nucleotide, inverted linkage, etc.); (b) base modifications, such as substitution with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, base removal (abasic nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' or 4' position, or with acyclic sugars) or sugar substitutions; and (d) backbone modifications, including modification or replacement of phosphodiester linkages. Specific examples of RNA compounds useful in the present invention include, but are not limited to, RNAs containing modified backbones or RNAs that do not contain natural internucleoside linkages. RNAs with modified backbones particularly include those that do not have a phosphorus atom in the backbone. For purposes herein, and as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone are also considered to be oligonucleosides. In certain embodiments, a modified RNA has a phosphorus atom in its internucleoside backbone.

[0310] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and boranophosphates with reversed polarity, in which adjacent nucleoside unit pairs are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.Various salts, mixed salts, and free acid forms are also included.

[0311] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; and 5,286,717, each of which is incorporated herein by reference. ;U.S. Patent Nos. 5,321,131; U.S. Patent No. 5,399,676; U.S. Patent No. 5,405,939; U.S. Patent No. 5,453,496; U.S. Patent No. 5,455,233; U.S. Patent No. 5,466,677; U.S. Patent No. 5,476,925; U.S. Patent No. 5,519,126; U.S. Patent No. 5,536,821; U.S. Patent No. 5,541,316; U.S. Patent No. 5,550,111; U.S. Patent No. 5,563,253; U.S. Patent No. 5,571,79 No. 9; U.S. Patent No. 5,587,361; U.S. Patent No. 5,625,050; U.S. Patent No. 6,028,188; U.S. Patent No. 6,124,445; U.S. Patent No. 6,160,109; U.S. Patent No. 6,169,170; U.S. Patent No. 6,172,209; U.S. Patent No. 6,239,265; U.S. Patent No. 6,277,603; U.S. Patent No. 6,326,199; U.S. Patent No. 6,346,614; U.S. Patent No. 6,444,423; U.S. Patent No. 6,5 Nos. 31,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and RE39464.

[0312] Modified RNA backbones that do not contain phosphorus atoms have backbones formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages. These include morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, those with amide backbones, and others with mixed N, O, S, and CH2 components.

[0313] Representative United States patents that teach the preparation of the above oligonucleosides include U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; and 5,470,967, each of which is incorporated herein by reference. ; U.S. Patent No. 5,489,677; U.S. Patent No. 5,541,307; U.S. Patent No. 5,561,225; U.S. Patent No. 5,596,086; U.S. Patent No. 5,602,240; U.S. Patent No. 5,608,046; U.S. Patent No. 5,610,289; U.S. Patent No. 5,618,704; U.S. Patent No. 5,623,070; U.S. Patent No. 5,663,312; U.S. Patent No. 5,633,360; U.S. Patent No. 5,677,437; and U.S. Patent No. 5,677,439.

[0314] In other RNA mimics suitable or contemplated for use in iRNA, both the sugar and internucleoside linkages, the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are linked directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is incorporated herein by reference. Further teaching of PNA compounds is found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0315] Some embodiments featured herein include RNAs with phosphorothioate backbones, and oligonucleosides with heteroatom backbones that are, in particular, -CH-NH-CH-, -CH-N(CH)-O-CH- (known as methylene(methylimino) or MMI backbones), -CH-ON(CH)-CH-, -CH-N(CH)-N(CH)-CH-, and -N(CH)-CH-CH- (natural phosphodiester backbones are represented as -OPO-CH-) of the aforementioned U.S. Patent No. 5,489,677, and with amide backbones of the aforementioned U.S. Patent No. 5,602,240. In some embodiments, RNAs featured herein have morpholino backbone structures of the aforementioned U.S. Patent No. 5,034,506.

[0316] Modified RNAs can also contain one or more substituted sugar moieties. For example, iRNAs, such as dsRNAs provided herein, can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl, or C2-C 10 It may be an alkenyl or alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In another embodiment, the dsRNA includes one of the following at the 2' position: C1 to C 10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intervening agent, group that improves the pharmacokinetic properties of iRNA, or group that improves the pharmacodynamic properties of iRNA, and other substituents with similar properties. In some embodiments, the modification comprises 2'-methoxyethoxy (2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta 78:486-504, 1995), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminooxyethoxy, or O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described herein below in the Examples, and the 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), or 2'-O-CH2-O-CH2-N(CH2)2, as also described herein below in the Examples.

[0317] In other embodiments, an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides). In certain embodiments, the sense strand or the antisense strand, or both the sense and antisense strands, contain fewer than five acyclic nucleotides per strand (e.g., 4, 3, 2, or 1 acyclic nucleotide per strand). The one or more acyclic nucleotides are found, for example, in the double-stranded region of the sense or antisense strand, or both strands, of the iRNA agent; at the 5' end, the 3' end, or both the 5' and 3' ends of the sense or antisense strand, or both strands. In one embodiment, the one or more acyclic nucleotides are present in positions 1-8 of the sense or antisense strand, or both. In one embodiment, the one or more acyclic nucleotides are found in positions 4-10 (e.g., positions 6-8) from the 5' end of the antisense strand. In another embodiment, the one or more acyclic nucleotides are found in one or both of the 3' overhangs of the iRNA agent.

[0318] The term "acyclic nucleotide" or "acyclic nucleoside," as used herein, refers to any nucleotide or nucleoside having an acyclic sugar, such as, for example, an acyclic ribose. Representative acyclic nucleotides or nucleosides include, for example, nucleobases, such as natural or modified nucleobases (e.g., nucleobases as described herein). In certain embodiments, the bond between any of the ribose carbons (C1, C2, C3, C4, or C5), independently or in combination, is absent from a nucleotide. In one embodiment, the bond between the C2-C3 carbons of the ribose ring is absent, such as, for example, an acyclic 2'-3'-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4, or C4-C5 is absent (e.g., a 1'-2', 3'-4', or 4'-5'-seco-nucleotide monomer). Representative acyclic nucleotides are disclosed in U.S. Pat. No. 8,314,227, which is incorporated herein by reference in its entirety. For example, acyclic nucleotides include any of monomers D through J in Figures 1-2 of U.S. Pat. No. 8,314,227. In one embodiment, acyclic nucleotides include the following monomers: [ka] (wherein the base is, for example, a nucleobase, such as a natural or modified nucleobase (e.g., a nucleobase as described herein)).

[0319] In certain embodiments, acyclic nucleotides can be modified or derivatized, for example, by conjugating the acyclic nucleotide to another moiety such as a ligand (e.g., GalNAc, cholesterol ligand), alkyl, polyamine, sugar, polypeptide, among others.

[0320] In other embodiments, the iRNA agent includes one or more acyclic nucleotides and one or more LNAs (e.g., LNAs as described herein). For example, the one or more acyclic nucleotides and / or one or more LNAs can be present in the sense strand, the antisense strand, or both. The number of acyclic nucleotides in one strand can be the same or different from the number of LNAs in the opposite strand. In certain embodiments, the sense strand and / or antisense strand comprise fewer than five LNAs (e.g., four, three, two, or one LNA) located in the double-stranded region or 3' overhang. In other embodiments, one or two LNAs are located in the double-stranded region or 3' overhang of the sense strand. Alternatively, or in combination, the sense strand and / or antisense strand comprise fewer than five acyclic nucleotides (e.g., four, three, two, or one acyclic nucleotide) in the double-stranded region or 3' overhang. In one embodiment, the sense strand of an iRNA agent comprises one or two LNAs in the 3' overhang of the sense strand of the iRNA agent and one or two acyclic nucleotides in the double-stranded region of the antisense strand (e.g., positions 4-10 (e.g., positions 6-8) from the 5' end of the antisense strand).

[0321] In other embodiments, the incorporation of one or more acyclic nucleotides in an iRNA agent (alone or in addition to one or more LNAs) results in one or more (or all) of the following: (i) reduced off-target effects; (ii) reduced passenger strand participation during RNAi; (iii) increased specificity of the guide strand for its target mRNA; (iv) reduced microRNA off-target effects; (v) increased stability; or (vi) increased resistance to degradation of the iRNA molecule.

[0322] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, specifically at the 3' position of the sugar on the 3'-terminal nucleotide, or in 2'-5'-linked dsRNA, and at the 5' position of the 5'-terminal nucleotide. An iRNA can also have a sugar mimic, such as a cyclobutyl moiety, in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of the above modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; and 5,519,134, each of which is incorporated herein by reference and certain of which are commonly owned with the present application. Nos. 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920.

[0323] iRNAs may also contain nucleobase (often simply referred to in the art as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil (pseudouracil); 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine (5-hydroxymethylcytosine); xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil (pseudouracil); 4-thiouracil (pseudouracil); 4-thiouracil (pseudouracil); 4-thiouracil (pseudouracil); 4- Other synthetic and natural nucleobases include uracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo, specifically 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-daazaadenine; and 3-deazaguanine and 3-deazaadenine.Further examples of nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in "Modified Nucleosides in Biochemistry, Biotechnology and Medicine", edited by Herdevijn, P., Wiley-VCH, 2008, those disclosed in "The Concise Encyclopedia of Polymer Science and Engineering", pp. 858-859, edited by Kroschwitz, JL, John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, Vol. 30, p. 613, and those disclosed by Sanghvi, Y. Examples of suitable nucleobases include those disclosed by S., Chapter 15, "dsRNA Research and Applications," pp. 289-302, edited by Crooke, ST, and Lebleu, B., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, Crooke, ST, and Lebleu, B., eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), making them exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0324] Representative U.S. patents that teach the preparation of the above-mentioned specific modified nucleobases as well as other modified nucleobases include U.S. Pat. No. 3,687,808, as noted above, and the following U.S. Pat. Nos.: 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594 ,121, 5,596,091; U.S. Patent Nos. 5,614,617; 5,681,941; U.S. Patent No. 6,015,886; U.S. Patent No. 6,147,200; U.S. Patent No. 6,166,197; U.S. Patent No. 6,222,025; U.S. Patent No. 6,235,887; U.S. Patent No. 6,380,368; U.S. Patent No. 6,528,640; U.S. Patent No. 6,639,062; U.S. Patent No. 6,617,438; U.S. Patent No. 7,045,610; U.S. Patent No. 7,427,672; and U.S. Patent No. 7,495,088, and U.S. Patent No. 5,750,692, which is also incorporated herein by reference.

[0325] The RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNAs) (also referred to herein as "locked nucleotides"). In one embodiment, a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an additional bridge bond, e.g., between the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of locked nucleic acids to siRNA has been shown to increase the stability of siRNA in serum, increase thermal stability, and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0326] Representative US patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patent No. 6,268,490; U.S. Patent No. 6,670,461; U.S. Patent No. 6,794,499; U.S. Patent No. 6,998,484; U.S. Patent No. 7,053,207; U.S. Patent No. 7,084,125; U.S. Patent No. 7,399,845; and U.S. Patent No. 8,314,227, each of which is incorporated herein by reference in its entirety.Representative LNAs include, but are not limited to, 2',4'-C methylene bicyclonucleotides (see, for example, WO 00 / 66604 and WO 99 / 14226 to Wengel et al.).

[0327] In other embodiments, an iRNA agent includes one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. G-clamp nucleotides are modified cytosine analogs, the modification conferring hydrogen-bonding capabilities to both the Watson-Crick and Hoogsteen faces of complementary guanines within a duplex; see, e.g., Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially increased helical thermal stability and mismatch discrimination when hybridized to a complementary oligonucleotide. Incorporation of such nucleotides into an iRNA molecule can result in increased affinity and specificity for a nucleic acid target, complementary sequence, or template strand.

[0328] Potential stabilizing modifications to the ends of RNA molecules include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, and inverted base dT (idT). Disclosure of this modification is found in WO 2011 / 005861.

[0329] iRNA motifs In one embodiment, the sense strand sequence is: Formula (I), 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' (I) (In the formula, i and j are each independently 0 or 1; p and q are each independently 0 to 6; each N a independently represent oligonucleotide sequences comprising 0 to 25 modified nucleotides, each sequence comprising at least two different modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each N p and N q independently represent overhanging nucleotides; Nb and Y do not have the same modification; XXX, YYY and ZZZ may be represented by (wherein XXX, YYY and ZZZ each independently represent one motif of three identical modifications of three consecutive nucleotides). Preferably, YYY are all 2'-F modified nucleotides.

[0330] In one embodiment, N a and / or N b comprises an alternating pattern of modifications.

[0331] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, if the RNAi agent has a double-stranded region 17-23 nucleotides in length, the YYY motif can occur at or near the cleavage site of the sense strand (e.g., at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13, counting from the first nucleotide at the 5' end, or optionally, counting from the first paired nucleotide at the 5' end within the double-stranded region).

[0332] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand is formula, 5'n p -N a -YYY-N b -ZZZ-N a-n q 3'(Ib); 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id) It can be represented by:

[0333] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0334] When the sense strand is represented by formula (Ic), N b represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0335] When the sense strand is represented by formula (Id), N b represents an oligonucleotide sequence comprising, independently, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6. Each N a can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0336] Each of X, Y, and Z may be the same as or different from one another.

[0337] In another embodiment, i is 0 and j is 0, and the sense strand is formula, 5'N p -N a -YYY-N a -N q 3' (Ia) It may be represented by:

[0338] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0339] In one embodiment, the sequence of the antisense strand of the RNAi is: Formula (II), 5'n q '-N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3' (II) (In the formula, k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each N a ' independently represent oligonucleotide sequences comprising 0 to 25 modified nucleotides, each sequence comprising at least two different modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each N p ' and N q ' independently represents an overhanging nucleotide; N b' and Y' do not have the same modification; X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications of three consecutive nucleotides. It may be represented by:

[0340] In one embodiment, N a ' and / or N b ' comprises an alternating pattern of modifications.

[0341] Y'Y'Y' motif occurs at or near the cleavage site of antisense strand.For example, when RNAi agent has a double-stranded region of 17-23 nucleotides in length, Y'Y'Y' motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14, or 13, 14, 15 of antisense strand, counting from the first nucleotide of 5'-end, or optionally counting from the first paired nucleotide of 5'-end in double-stranded region.Preferably, Y'Y'Y' motif occurs at positions 11, 12, 13.

[0342] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0343] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1; or both k and l are 1.

[0344] Therefore, the antisense strand formula, 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p '3'(IIb); 5'n q '-N a '-Y'Y'Y'-N b '-X'X'X'-n p '3' (IIc); or 5'n q '-Na '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p '3' (IId) It can be represented by:

[0345] When the antisense strand is represented by formula (IIb), N b ' represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' represents an oligonucleotide sequence, independently comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0346] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' represents an oligonucleotide sequence, independently comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0347] When the antisense strand is represented by formula (IId), N b Each N' represents an oligonucleotide sequence, independently comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6.

[0348] In another embodiment, k is 0 and l is 0, and the antisense strand is formula, 5'n p '-N a '-Y'Y'Y'-N a '-n q '3' (Ia) It may be represented by:

[0349] When the antisense strand is represented by formula (IIa), each N a ' represents an oligonucleotide sequence comprising, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0350] Each of X', Y', and Z' may be the same as or different from one another.

[0351] Each nucleotide of sense strand and antisense strand can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of sense strand and antisense strand can be independently modified with 2'-O-methyl or 2'-fluoro.Each X, Y, Z, X', Y' and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification.

[0352] In one embodiment, when the double-stranded region is 21nt, the sense strand of the RNAi agent may contain a YYY motif that occurs at positions 9, 10, and 11 of the strand, counting from the first nucleotide at the 5' end, or optionally counting from the first paired nucleotide at the 5' end within the double-stranded region; Y represents a 2'-F modification. The sense strand may further contain a XXX motif or a ZZZ motif as a wing-like modification at the opposite end of the double-stranded region. XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0353] In one embodiment, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, or 13 of the strand, counting from the first nucleotide at the 5' end, or optionally from the first paired nucleotide at the 5' end in the double-stranded region; Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or a Z'Z'Z' motif as a winged modification at the opposite end of the double-stranded region; and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0354] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (ID) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc), and (IId), respectively.

[0355] Thus, the RNAi agents used in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi duplex may be Formula (III), Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' (III) (In the formula, i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each Na and N a ' independently represent oligonucleotide sequences comprising 0 to 25 modified nucleotides, each sequence comprising at least two different modified nucleotides; each N b and N b ' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; Each n, each of which may or may not be present p ',n p , n q ', and n q independently represent overhanging nucleotides; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications of three consecutive nucleotides. It is expressed by:

[0356] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 1 and j is 0; or i and j are both 0. Or i and j are both 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or k and l are both 0. Or k and l are both 1.

[0357] Exemplary combinations of sense and antisense strands that form RNAi duplexes include the following formulas: 5'n p -N a -YYY-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a -nq 3' 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5' (IIIb) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (IIId)

[0358] When the RNAi agent is represented as formula (IIIa), each N a represents an oligonucleotide sequence comprising, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0359] When the RNAi agent is represented as formula (IIIb), each N b represents an oligonucleotide sequence comprising, independently, 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a represents an oligonucleotide sequence comprising, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0360] When the RNAi agent is represented as formula (IIIc), each N b , N b Each N' independently represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a represents an oligonucleotide sequence comprising, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0361] When the RNAi agent is represented as formula (IIId), each N b , N b Each N' independently represents an oligonucleotide sequence comprising 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a N' independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b andN b ' independently comprise an alternating pattern of modifications.

[0362] Each of X, Y, and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same as or different from one another.

[0363] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may be base-paired with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides are base-paired with a corresponding Y' nucleotide; or all three Y nucleotides are base-paired with a corresponding Y' nucleotide.

[0364] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may be base-paired with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides are base-paired with a corresponding Z' nucleotide; or all three Z nucleotides are base-paired with a corresponding Z' nucleotide.

[0365] When the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides may base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides base pair with a corresponding X' nucleotide; or all three X nucleotides base pair with a corresponding X' nucleotide.

[0366] In one embodiment, the modification on a Y nucleotide is different from the modification on a Y' nucleotide, the modification on a Z nucleotide is different from the modification on a Z' nucleotide, and / or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0367] In one embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modifications were 2'-O-methyl or 2'-fluoro, and N p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to the adjacent nucleotide by a phosphorothioate bond. a The modifications were 2'-O-methyl or 2'-fluoro, and n p '>0 and at least one n pIn yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is conjugated to one or more GalNAc derivatives that are linked to adjacent nucleotides by phosphorothioate bonds, and the sense strand is attached through a bivalent or trivalent branched linker. a The modifications were 2'-O-methyl or 2'-fluoro, and n p '>0 and at least one n p ' are linked to adjacent nucleotides by phosphorothioate bonds, the sense strand comprising at least one phosphorothioate bond, the sense strand being conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0368] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modifications were 2'-O-methyl or 2'-fluoro, and n p '>0 and at least one n p ' are linked to adjacent nucleotides by phosphorothioate bonds, the sense strand comprising at least one phosphorothioate bond, the sense strand being conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0369] In one embodiment, the RNAi agent is a multimer that contains at least two double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and the double strands are connected by a linker.The linker can be cleavable or non-cleavable.Optionally, the multimer further comprises a ligand.Each of the double strands can target the same gene or two different genes; or each of the double strands can target the same gene at two different target sites.

[0370] In one embodiment, the RNAi agent is a multimer containing 3, 4, 5, 6 or more double strands represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), and the double strands are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the double strands can target the same gene or two different genes; or each of the double strands can target the same gene at two different target sites.

[0371] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at either or both of the 5' end, the 3' end, and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target the same gene at two different target sites.

[0372] iRNA complex The iRNA agent disclosed herein can be in the form of a complex.The complex can be attached to any suitable position in iRNA molecule, for example, at the 3'-end or 5'-end of sense or antisense strand.The complex can optionally be attached via a linker.

[0373] In some embodiments, an iRNA agent described herein may be chemically linked to one or more ligands, moieties, or conjugates that confer functionality, for example, by affecting (e.g., promoting) activity, cellular distribution, or cellular uptake. Such moieties include cholesterol moieties (Letsinger et al., Proceedings of the National Academy of Sciences of the United States of America, 1989, 86:6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl-S-tritylthiol (Manoharan et al., Bioorganic & Medicinal Chemistry Letters, 1994, 4:1053-1060), and the like. N et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765-2770; thiocholesterol (Oberhauser et al., Nucl. Acids Research, 1993, 3:2765-2770); Res., 1992, 20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Letters, 1993, 75:49-54). Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., Journal of Pharmacology Experimental Examples of lipid moieties include, but are not limited to, lipid moieties such as those described in J. Pharmacol. Exp. Ther., 1996, 277:923-937.

[0374] In one embodiment, a ligand alters the distribution, targeting, or lifespan of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides improved affinity for a selected target, such as a molecule, a cell, or cell type (e.g., a liver cell, such as a hepatocyte), a compartment, such as a subcellular or organ compartment, a tissue, or organ, or region of the body, e.g., compared to a species in the absence of such a ligand. Typical ligands do not participate in double-strand pairing in duplexed nucleic acids.

[0375] Ligands can include natural substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines are polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, polyamine quaternary salts, or alpha helical peptides.

[0376] The ligand can also include a targeting group such as a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody that binds to a specific cell type such as a kidney cell. The targeting group can be thyroid stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetylglucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, biotin, or an RGD peptide or RGD peptidomimetic.

[0377] In some embodiments, the ligand is a GalNAc ligand comprising one or more N-acetylgalactosamine (GalNAc) derivatives. Additional conjugate descriptions of GalNAc ligands are provided in the section entitled Carbohydrate Conjugates.

[0378] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithophosphate, and the like. Examples of suitable cleavage inhibitors include acetylcholinesterases (e.g., acetylcholinesterase ...

[0379] Ligands can be proteins, such as glycoproteins; peptides, such as molecules with specific affinity for co-ligands; or antibodies, such as antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include lipids, lectins, carbohydrates, vitamins, cofactors, and non-peptide species, such as multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharides, p38 MAP kinase activators, or NF-κB activators.

[0380] The ligand can be a substance, such as a drug, that can increase uptake of an iRNA agent into a cell, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments, e.g., by disrupting the cell's cytoskeleton. The drug can be, e.g., taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0381] In some embodiments, the ligand attached to the iRNA described herein functions as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides comprising several phosphorothioate linkages are also known to bind to serum proteins. Therefore, short oligonucleotides, such as, for example, about 5-, 10-, 15-, or 20-base oligonucleotides comprising multiple phosphorothioate linkages in the backbone, are also suitable as ligands (e.g., as PK-modulating ligands) for the present invention. In addition, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.

[0382] Ligand-conjugated oligonucleotides of the invention may be synthesized by using an oligonucleotide bearing a pendant reactive functional group, such as one derived from the addition of a binding molecule onto an oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with a commercially available ligand, a synthesized ligand having any of a variety of protecting groups, or a ligand having a binding moiety attached thereto.

[0383] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely produced through well-known solid-phase synthesis techniques. Equipment for such synthesis is sold by several suppliers, including Applied Biosystems (Foster City, Calif.). Additionally or alternatively, any other means for such synthesis known in the art may be used. It is also known to use similar techniques to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.

[0384] In the ligand-conjugated oligonucleotides and sequence-specific linked nucleosides bearing ligand molecules of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors already bearing a linking moiety, ligand-nucleotide or nucleoside conjugate precursors already bearing a linking moiety, or building blocks bearing non-nucleoside ligands.

[0385] When using a nucleotide conjugate precursor that already has a binding moiety, synthesis of the sequence-specific linked nucleoside is typically completed, and then a ligand molecule is reacted with the binding moiety to produce the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the invention are synthesized by automated synthesizers using phosphoramidites derived from ligand-nucleoside conjugates, in addition to standard and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0386] lipid complex In one embodiment, the ligand is a lipid or lipid-based molecule.This lipid or lipid-based molecule can typically bind to serum proteins such as human serum albumin (HSA).The HSA-binding ligand allows the distribution of the complex to target tissues, such as non-renal target tissues of the body.For example, the target tissue can be the liver, including the parenchymal cells of the liver.Other molecules that can bind to HSA can also be used as ligands.For example, neproxin or aspirin can be used.The lipid or lipid-based ligand can (a) increase the degradation resistance of the complex, (b) increase the targeting or transport into target cells or cell membranes, and / or (c) be used to regulate the binding of serum proteins, such as HSA.

[0387] For example, lipid-based ligands can be used to regulate (for example, inhibit) the binding of complex to target tissue.For example, the lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidney, and therefore less likely to be removed from the body.The lipid or lipid-based ligand that binds weaker to HSA can be used to target complex to the kidney.

[0388] In one embodiment, the lipid-based ligand binds to HSA. For example, the ligand may bind to HSA with sufficient affinity to enhance distribution of the conjugate to non-renal tissues. However, the affinity is typically not so strong that HSA ligand binding cannot be reversed.

[0389] In another embodiment, the lipid-based ligand binds weakly or not at all to HSA, improving distribution of the conjugate to the kidney. Other moieties that target kidney cells may also be used in place of or in addition to the lipid-based ligand.

[0390] In another embodiment, the ligand is a moiety, such as a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., malignant or non-malignant types, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients that are taken up by cancer cells. Also included are HSA and low-density lipoprotein (LDL).

[0391] Cell-penetrating agents In another aspect, the ligand is a cell-penetrating agent, such as a helical cell-penetrating agent. In one embodiment, the agent is amphipathic. An exemplary cell-penetrating agent is a peptide, such as tat or antennopedia. When the cell-penetrating agent is a peptide, it can be modified, including peptidylmimetic, invertomer, non-peptide or pseudo-peptide bond, and the use of D-amino acids. The helical agent is typically an α-helical agent, and can have a lipophilic and lipophobic phase.

[0392] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules that can fold into defined three-dimensional structures similar to natural peptides. The addition of peptides and peptidomimetics to iRNA agents can affect the pharmacokinetic distribution of iRNAs, such as by facilitating cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0393] The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 3367). An RFGF analog containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 3368)) can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, capable of transporting numerous polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3369)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 3370)) have been shown to function as delivery peptides. Peptides or peptidomimetics can be encoded by random sequences of DNA, such as peptides identified from phage-display libraries or one-bead-one-compound (OBOC) combinatorial libraries (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to the dsRNA agent via an incorporated monomer unit is a cell-targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or an RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can have structural modifications to increase stability or induce conformational properties. Any of the structural modifications described below can be used.

[0394] The RGD peptide used in the compositions and methods of the present invention can be linear or cyclic, and can be modified, for example, by glycosylation or methylation, to facilitate targeting to specific tissues.RGD-containing peptides and peptidomimetics include D-amino acids and synthetic RGD mimics.In addition to RGD, other moieties that target integrin ligands can be used.Preferred complexes of this ligand target PECAM-1 or VEGF.

[0395] RGD peptide moieties can be used to target specific cell types, such as tumor cells, e.g., endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate targeting of dsRNA agents to tumors in a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, RGD peptides facilitate targeting of iRNA agents to the kidney. RGD peptides can be linear or cyclic and can be modified, e.g., by glycosylation or methylation, to facilitate targeting of specific tissues. For example, glycosylated RGD peptides can be used to target α V iRNA agents can be delivered to tumor cells that express s3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

[0396] A "cell-penetrating peptide" can penetrate cells, such as microbial cells, e.g., bacterial or fungal cells, or mammalian cells, e.g., human cells. Microbial cell-penetrating peptides can be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins, or bactenecins), or peptides containing only one or two key amino acids (e.g., PR-39 or indolicidin). Cell-penetrating peptides can also contain nuclear localization signals (NLSs). For example, cell-penetrating peptides can be bisected amphipathic peptides, such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res., 31, 2717-2724, 2003).

[0397] Carbohydrate complex In some embodiments of the compositions and methods of the present invention, the iRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated iRNAs are advantageous for in vivo delivery of nucleic acids and compositions suitable for in vivo therapeutic applications, as described herein. As used herein, "carbohydrate" refers to a compound that is either a carbohydrate itself, composed of one or more monosaccharide units (which may be linear, branched, or cyclic) having at least six carbon atoms, with an oxygen, nitrogen, or sulfur atom attached to each carbon atom; or a compound having as its part a carbohydrate moiety composed of one or more monosaccharide units (which may be linear, branched, or cyclic), each having at least six carbon atoms, with an oxygen, nitrogen, or sulfur atom attached to each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Particular monosaccharides include sugars of C5 and above (e.g., C5, C6, C7, or C8); di- and trisaccharides include sugars with two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0398] In one embodiment, the carbohydrate conjugate comprises a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine (GalNAc). GalNAc conjugates are described, for example, in U.S. Patent No. 8,106,022, the entire contents of which are incorporated herein by reference. In some embodiments, GalNAc conjugates act as ligands that target iRNAs to specific cells. In some embodiments, GalNAc conjugates target iRNAs to hepatocytes, for example, by acting as a ligand for the asialoglycoprotein receptor of hepatocytes (e.g., hepatocytes).

[0399] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments, the GalNAc conjugate is conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3' end of the sense strand) by a linker, e.g., a linker described herein.

[0400] In some embodiments, the GalNAc conjugate is [ka] is.

[0401] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the schematic diagram below, for example, where X is O or S. [ka]

[0402] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below. [ka]

[0403] In some embodiments, the carbohydrate complexes used in the compositions and methods of the present invention are [ka] [ka] [ka] [ka] [ka] is selected from the group consisting of:

[0404] Other exemplary carbohydrate complexes for use in the embodiments described herein include: [ka] (In the formula, One of X or Y is an oligonucleotide and the other is hydrogen. These include, but are not limited to:

[0405] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and / or a cell-penetrating peptide.

[0406] In one embodiment, the iRNA of the present invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrates conjugated to linkers in the compositions and methods of the present invention include: [ka] [ka] [ka] (In the formula, One of X or Y is an oligonucleotide and the other is hydrogen. These include, but are not limited to:

[0407] Linker In some embodiments, the conjugates or ligands described herein may be attached to the iRNA oligonucleotide by various linkers, which may be cleavable or non-cleavable.

[0408] The term "linker" or "linking group" means an organic moiety that joins two parts of a compound, e.g., covalently bonds the two parts of a compound. A linker is typically a direct bond; or an atom such as oxygen or sulfur; a unit such as NR, C(O), C(O)NH, SO, SO, SONH; or a unit such as substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkynyl, Heterarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclyl and alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteraryl, etc., but are not limited to alkylalkynyl, alkylaryl, alkenylaryl, alkynylheteroaryl, alkylhetereroaryl, etc., comprising a chain of atoms, wherein one or more methylenes can be interrupted or terminated by O, S, S(O), SO, N(R), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic, where R is hydrogen, acyl, aliphatic, or substituted aliphatic.In one embodiment, the linker is about 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7 to 17, 8 to 17, 6 to 16, 7 to 16, or 8 to 16 atoms.

[0409] In one embodiment, the dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formulas (XXXI) to (XXXIV). [ka] During the ceremony, q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C independently represent each occurrence from 0 to 20, and the repeat units may be identical or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C is, each independently for each occurrence, absent, CO, NH, O, S, OC(O), NHC(O), CH, CHNH, or CHO; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C is independently for each occurrence absent, alkylene, or substituted alkylene, and one or more methylenes are selected from O, S, S(O), SO, N(R N), C(R')=C(R''), C≡C or C(O); R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C are independently for each occurrence absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] or heterocyclyl; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represents a ligand; i.e., independently for each occurrence, a monosaccharide (e.g., GalNAc), a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, or a polysaccharide; R a is H or an amino acid side chain. Trivalent conjugated GalNAc derivatives are Formula (XXXV), [ka] (In the formula, L 5A , L 5B and L 5C It is particularly useful for use with RNAi agents to inhibit the expression of target genes such as ribonucleotides (wherein represents a monosaccharide, such as a GalNAc derivative).

[0410] Examples of suitable divalent and trivalent branched linker groups for conjugation to GalNAc derivatives include, but are not limited to, the structures listed above as Formulas II, VII, XI, X, and XIII.

[0411] A cleavable tether is one that is sufficiently stable outside a cell but is cleaved upon entry into a target cell to release the two moieties tethered by the linker. In preferred embodiments, the cleavable tether cleaves at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold or more, or at least about 100-fold more rapidly in the target cell, or under first standard conditions (which may, e.g., be selected to mimic or represent intracellular conditions), than in the subject's blood, or under second standard conditions (which may, e.g., be selected to mimic or represent conditions found in blood or serum).

[0412] Cleavable linking groups are susceptible to cleavage agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleavage agents are more common in cells than in serum or blood, or are found at higher levels or activity. Examples of such degradable agents include oxidizing or reducing enzymes or reducing agents such as mercaptans present in cells, which can degrade redox-cleavable linking groups by reduction, and are selective for specific substrates or do not have substrate specificity; esterases; agents that can create an acidic environment, such as endosomes or those that produce a pH of 5 or less; enzymes that can hydrolyze or degrade acid-cleavable linking groups by acting as general acids, peptidases (which can be substrate specific), and phosphatases.

[0413] Cleavable linking groups, such as disulfide bonds, can be highly sensitive to pH. While the pH of human serum is 7.4, the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of about 5.0. Some linkers have cleavable linking groups that are cleaved at a preferred pH, thereby releasing the cationic lipid from the ligand in the cell or to a desired compartment of the cell.

[0414] Linker can contain cleavable linking group that can be cleaved by specific enzyme.The type of cleavable linking group incorporated into linker can depend on the cell to be targeted.For example, the ligand for targeting liver can be linked to cationic lipid through a linker that contains ester group.Hepatocytes are rich in esterase, therefore linker is more efficiently cleaved in hepatocytes than in cell types that are not rich in esterase.Other cell types that are rich in esterase include lung, renal cortex and testicular cells.

[0415] Linkers containing peptide bonds may be used in targeting peptidase-rich cell types such as hepatocytes and synoviocytes.

[0416] In general, the suitability of a candidate cleavable linker can be evaluated by testing the ability of a degradable agent (condition) to cleave the candidate linker. It may also be desirable to test candidate cleavable linkers for their ability to resist cleavage in blood or upon contact with other non-target tissues. Thus, the relative susceptibility to cleavage between first and second conditions can be determined, with the first condition selected to indicate cleavage in target cells and the second condition selected to indicate cleavage in other tissues or biological fluids, such as blood or serum. Evaluation can be performed in a cell-free system, in cells, in cell culture, in organ or tissue culture, or in a whole animal. It may be useful to perform initial evaluations in cell-free or culture conditions and confirm with further evaluations in a whole animal. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times more rapidly in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0417] Redox-cleavable linking groups In one embodiment, the cleavable linker is a redox-cleavable linker that cleaves upon reduction or oxidation. One example of a reductively cleavable linker is a disulfide linker (-SS-). To determine whether a candidate cleavable linker is a suitable "reductively cleavable linker," or suitable for use with, for example, a particular iRNA moiety and a particular targeting agent, one can rely on the methods described herein. For example, candidates can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rate observed in cells, such as target cells. Candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, the candidate compound is cleaved at a maximum of about 10% in blood. In another embodiment, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times more rapidly in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of a candidate compound may be determined using standard enzyme kinetic assays under conditions selected to mimic intracellular media compared to conditions selected to mimic extracellular media.

[0418] Phosphate-Based Cleavable Tethers In another embodiment, the cleavable linker comprises a phosphate-based cleavable linker. The phosphate-based cleavable linker can be cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that cleaves a phosphate group in a cell is an enzyme such as a phosphatase in the cell. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, -OP(S)(Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.

[0419] Acid-cleavable linking group In another embodiment, the cleavable linker comprises an acid-cleavable linker. An acid-cleavable linker is a linker that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linker is cleaved in an acidic environment of about pH 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or less) or by an agent such as an enzyme that can act as a general acid. Within cells, certain low-pH organelles, such as endosomes and lysosomes, may provide a cleavage environment for the acid-cleavable linker. Examples of acid-cleavable linkers include, but are not limited to, hydrazones, esters, and amino acid esters. Acid-cleavable groups may have the general formula -C=NN-, C(O)O, or -OC(O). Preferred embodiments include, when a carbon is attached to the oxygen of the ester (alkoxy group), an aryl group; a substituted alkyl group; or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates may be evaluated using methods similar to those described above.

[0420] Ester-Based Cleavable Linkers In another embodiment, the cleavable linker comprises an ester-based cleavable linker. Ester-based cleavable linkers are cleaved in cells by enzymes such as esterases and amidases. Examples of ester-based cleavable linkers include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable linkers have the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.

[0421] Peptide-Based Cleavable Tethers In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linker. Peptide-based cleavable linkers are cleaved in cells by enzymes such as peptidases and proteases. Peptide-based cleavable linkers are peptide bonds formed between amino acids to give rise to oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include amide groups (—C(O)NH—). Amide groups can be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to give rise to peptides and proteins. Peptide-based cleavable groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give rise to peptides and proteins, but do not include the entire amide functionality. Peptide-based cleavable linkers have the general formula —NHCHRAC(O)NHCHRBC(O)—, where R and R are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.

[0422] Representative United States patents that teach the preparation of RNA complexes include U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,591,584; and 5,109,110, the contents of each of which are incorporated herein by reference in their entirety. No. 24; U.S. Patent No. 5,118,802; U.S. Patent No. 5,138,045; U.S. Patent No. 5,414,077; U.S. Patent No. 5,486,603; U.S. Patent No. 5,512,439; U.S. Patent No. 5,578,718; U.S. Patent No. 5,608,046; U.S. Patent No. 4,587,044; U.S. Patent No. 4,605,735; U.S. Patent No. 4,667,025; U.S. Patent No. 4,762,779; U.S. Patent No. 4,789,737; U.S. Patent No. 4,824,941 Specification; U.S. Patent No. 4,835,263; U.S. Patent No. 4,876,335; U.S. Patent No. 4,904,582; U.S. Patent No. 4,958,013; U.S. Patent No. 5,082,830; U.S. Patent No. 5,112,963; U.S. Patent No. 5,214,136; U.S. Patent No. 5,082,830; U.S. Patent No. 5,112,963; U.S. Patent No. 5,214,136; U.S. Patent No. 5,245,022; U.S. Patent No. 5,254,469; U.S. Patent No. 5,258,506 Documents; U.S. Patent No. 5,262,536; U.S. Patent No. 5,272,250; U.S. Patent No. 5,292,873; U.S. Patent No. 5,317,098; U.S. Patent Nos. 5,371,241, 5,391,723; U.S. Patent Nos. 5,416,203, 5,451,463; U.S. Patent No. 5,510,475; U.S. Patent No. 5,512,667; U.S. Patent No. 5,514,785; U.S. Patent No. 5,565,552; U.S. Patent No. 5,567,810; U.S. Patent No. 5,574,142;Examples of such patents include, but are not limited to, U.S. Patent Nos. 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022.

[0423] Not all positions in a given compound need be uniformly modified; in fact, more than one of the foregoing modifications may be incorporated in a single compound, or even in a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0424] "Chimeric" iRNA compounds or "chimeras," in the context of the present invention, are iRNA compounds, e.g., dsRNA, that contain two or more chemically distinct regions, each composed of at least one monomer unit, i.e., nucleotides in the case of dsRNA compounds. These iRNAs typically contain at least one region in which the RNA has been modified to confer on the iRNA increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. Additional regions of the iRNA may serve as substrates for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H therefore results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. As a result, comparable results are often obtained with shorter iRNAs when chimeric dsRNAs are used compared to phosphorothioate deoxydsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0425] In some cases, the RNA of an iRNA may be modified with a non-ligand group. Several non-ligand molecules have been conjugated to iRNA to enhance iRNA activity, cellular distribution, or intracellular uptake; procedures for performing such conjugation are available in the scientific literature. Such non-ligand moieties include lipid moieties such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, Vol. 365, No. 1, pp. 54-61; Letsinger et al., Proceedings of the National Academy of Sciences, 1989, Vol. 86, p. 6553), cholic acid (Manoharan et al., Bioorganic Medical Chemistry, 2007, Vol. 86, p. 6553), and thiamin monophosphate (Thiamin Monophosphate). Bioorg. Med. Chem. Let., 1994, 4, 1053), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765), thiocholesterol (Oberhauser et al., Nucl. Acids Research, 1994, 4, 1053), Res., 1992, 20, 533), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 1001).49), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 14, 969). Lett., 1995, 36:3651), palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative U.S. patents teaching the preparation of such RNA conjugates are listed above. A typical conjugation protocol involves the synthesis of RNA bearing amino linkers at one or more positions in the sequence. The amino groups are then reacted with the molecule to be conjugated using an appropriate coupling or activating reagent. The conjugation reaction may be carried out in solution phase while the RNA is still bound to the solid support, or following RNA cleavage. Purification of the RNA conjugate by HPLC typically yields a pure conjugate.

[0426] iRNA delivery Delivery of iRNA to a subject in need thereof can be achieved in several different ways. In vivo delivery can be achieved directly by administering a composition comprising iRNA, such as dsRNA, to a subject. Alternatively, delivery can be achieved indirectly by administering one or more vectors that encode and induce expression of iRNA. These alternatives are discussed below.

[0427] direct delivery Generally, any method for delivering nucleic acid molecules can be adapted for use with iRNA (see, e.g., Akhtar S. and Julian RL., 1992, Trends Cell. Biol., Vol. 2, No. 5, pp. 139-144, and International Publication No. WO 94 / 02595, the entire contents of which are incorporated herein by reference). However, there are three important factors to consider for successful in vivo delivery of iRNA molecules: (a) the biological stability of the delivered molecule, (2) prevention of nonspecific effects, and (3) accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, such as direct injection or implantation into tissues (such as, but not limited to, tumors), or by administering the preparation locally. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure of systemic tissues that might otherwise be harmed by or degrade the agent, and allows for the administration of lower total doses of iRNA molecules. Several studies have demonstrated successful gene product knockdown when iRNA is administered locally. For example, intraocular delivery of VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ, et al., 2004, Retina 24, pp. 132-138) and by subretinal injection in mice (Reich, SJ, et al., 2003, Mol. Vis. 9, pp. 210-216) both prevented neovascularization in experimental models of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA in mice could reduce tumor volume (Pille, J. et al., 2005, Mol. Ther., 11, pp. 267-274) and extend the survival time of tumor-bearing mice (Kim, WJ. et al., 2006, Mol. Ther., 14, pp. 343-350; Li, S. et al., 2007, Mol. Ther., 15, pp. 515-523).RNA interference can be delivered to the CNS by direct injection (Dorn, G. et al., 2004, Nucleic Acids 32:e49; Tan, P.H. et al., 2005, Gene Ther. 12:59-66; Makimura, H. et al., 2002, BMC Neurosci. 3:18; Shishkina, G.T. et al., 2004, Neuroscience 129:521-528; Thakker, E.R. et al., 2004, Proceedings of the National Academy of Sciences 101:17270-17275; Akaneya, Y. et al., 2005, Journal of Neuroscience 101:17270-17275). Successful local delivery has been demonstrated to the lungs via intranasal administration (Howard, K. A. et al., 2006, Mol. Ther., 14, 476-484; Zhang, X. et al., 2004, J. Biol. Chem., 279, 10677-10684; Bitko, V. et al., 2005, Nat. Med., 11, 50-55). To administer iRNA systemically to treat disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent rapid degradation of dsRNA by endogenous endo- and exo-nucleases.

[0428] Modification of RNA or pharmaceutical carrier can also allow iRNA composition to target tissue, avoiding undesirable non-specific effects.iRNA molecule can be modified by chemical conjugation with other groups, such as lipid or carbohydrate groups as described herein.This conjugate can be used to target iRNA to specific cells, such as liver cells, for example, hepatocytes.For example, GalNAc conjugate or lipid (for example, LNP) formulation can be used to target iRNA to specific cells, such as liver cells, for example, hepatocytes.

[0429] Lipophilic groups such as cholesterol improve cellular uptake and prevent degradation. For example, systemic injection of iRNA against ApoB conjugated to a lipophilic cholesterol moiety into mice resulted in apoB mRNA knockdown in both the liver and jejunum (Soutschek, J. et al., 2004, Nature 432, pp. 173-178). Conjugation of iRNA to an aptamer has been shown to suppress tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J. et al., 2006, Nature Biotechnol. 24, pp. 1005-1015). In alternative embodiments, iRNA can be delivered using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of iRNA molecules (which are negatively charged) and also enhance their interaction with the negatively charged cell membrane, allowing for efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can be conjugated to iRNA or induced to form vesicles or micelles that encase iRNA (see, for example, Kim SH. et al., 2008, Journal of Controlled Release, Vol. 129, No. 2, pp. 107-116). The formation of vesicles or micelles further prevents degradation of iRNA upon systemic administration. Methods for making and administering cationic iRNA complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen, D.R. et al., 2003, J. Mol. Biol. 327:761-766; Verma, U.N. et al., 2003, Clin. Cancer Res. 9:1291-1300; Arnold, A.S. et al., 2007, J. Hypertens. 25:197-205, the contents of which are incorporated herein by reference in their entireties).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, D.R. et al., 2003, supra; Verma, U.N. et al., 2003, supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T.S. et al., 2006, Nature 441, pp. 111-114), cardiolipin (Chien, P.Y. et al., 2005, Cancer Gene Ther. 12, pp. 321-328; Pal, A. et al., 2005, International Journal of Oncology 10, pp. 111-114), and ribozymes (Chien, P.Y. et al., 2005, Cancer Gene Ther. 12, pp. 321-328). J. Oncol. 26, pp. 1087-1091), polyethyleneimine (Bonnet ME et al., 2008, Pharmaceutical Research (Pharm. Res.), August 16, advance online publication; Aigner A., ​​2006, J. Biomed. Biotechnol., pp. 71659), Arg-Gly-Asp (RGD) peptide (Liu S., 2006, Mol. Pharm. 3, pp. 472-487), and polyamidoamine (Tomalia DA et al., 2007, Biochemical Society Biochem. Soc. Trans. 35, pp. 61-67; Yoo, H. et al., 1999, Pharm. Res. 16, pp. 1799-1804. In some embodiments, for systemic administration, iRNA is complexed with cyclodextrin. Methods and pharmaceutical compositions for administering iRNA and cyclodextrin are described in U.S. Pat. No. 7,427,605, the entire contents of which are incorporated herein by reference.

[0430] iRNA-encoding vector In another embodiment, ALAS1 gene-targeting iRNAs can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A. et al., TIG., 1996, vol. 12, pp. 5-10; Skillern, A. et al., PCT Publication No. WO 00 / 22113; Conrad, PCT Publication No. WO 00 / 22114; and Conrad, U.S. Patent No. 6,054,299). Expression can be transient (hours to weeks) or persistent (weeks to months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrating or non-integrating vectors. The transgene can also be constructed to allow it to be inherited as an extrachromosomal plasmid (Gassmann et al., Proceedings of the National Academy of Sciences, 1995, 92:1292).

[0431] Each iRNA strand or strands can be transcribed from the promoter on the expression vector.When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be simultaneously introduced into target cells (for example, by transfection or infection).Alternatively, each of the promoters can be transcribed from the individual strands of dsRNA by the promoters located on the same expression plasmid.In one embodiment, dsRNA is expressed as an inverted repeat that is connected by a linker polynucleotide sequence, so that dsRNA has a stem-loop structure.

[0432] iRNA expression vectors are typically DNA plasmids or viral vectors. Recombinant constructs for expressing iRNAs described herein can be produced using expression vectors compatible with eukaryotic cells, such as vertebrate cells. Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors contain convenient restriction enzyme recognition sites for inserting desired nucleic acid fragments. Delivery of iRNA-expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from the patient and then reintroduced into the patient, or by any other means that allows introduction into desired target cells.

[0433] iRNA expression plasmids can be transfected into target cells as complexes with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdown, targeting different regions of a target RNA over a period of one week or more, are also contemplated by the present invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be indicated by a reporter, such as a fluorescent marker like green fluorescent protein (GFP). Stable transfection of cells in vitro can be ensured using markers that confer resistance to specific environmental factors (e.g., antibiotics and drugs) on transfected cells, such as hygromycin B resistance.

[0434] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, and the like; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) poxvirus vectors, such as orthopox, e.g., vaccinia virus vectors, or avipox, e.g., canarypox or fowlpox; and (j) helper-dependent or gutless adenoviruses. Replication-defective viruses may also be advantageous. Different vectors may or may not integrate into the cellular genome. The constructs may optionally contain viral sequences for transfection. Alternatively, the constructs may be incorporated into vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant expression of iRNA generally require regulatory elements, such as promoters, enhancers, etc., to ensure iRNA expression in target cells. Other contemplated aspects of vectors and constructs are described in more detail below.

[0435] Vectors useful for delivering iRNA contain sufficient regulatory elements (promoters, enhancers, etc.) for expression of the iRNA in the desired target cells or tissues. Regulatory elements can be selected to provide for either constitutive or regulated / inducible expression.

[0436] iRNA expression can be precisely regulated using inducible regulatory sequences that are sensitive to specific physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB Journal, 8:20-24). Suitable inducible expression systems for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art can select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.

[0437] In certain embodiments, viral vectors containing nucleic acid sequences encoding iRNAs may be used. For example, retroviral vectors may be used (see Miller et al., Meth. Enzymol. 217:581-599, 1993). These retroviral vectors contain the components necessary for correct packaging of the viral genome and integration into host cell DNA. The nucleic acid sequences encoding the iRNAs are cloned into one or more vectors, facilitating delivery of the nucleic acid to a patient. More details regarding retroviral vectors can be found in Boesen et al., Biotherapy 6:291-302, 1994, which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells, for example, to generate stem cells that are more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are Clowes et al., J. Clin. Invest., 93:644-651 (1994); Kiem et al., Blood, 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy, 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel., 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, HIV-based vectors described in U.S. Pat. No. 6,143,520; U.S. Pat. No. 5,665,557; and U.S. Pat. No. 5,981,276, which are incorporated herein by reference.

[0438] Adenoviruses are also being considered for use in delivering iRNA. Adenoviruses are particularly attractive vehicles for delivering genes to, for example, respiratory epithelia. Adenoviruses naturally infect respiratory epithelia, causing a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development, Vol. 3, pp. 499-503, 1993, present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy, 5:3-10, 1994, demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science, Vol. 252, pp. 431-434 (1991); Rosenfeld et al., Cell, Vol. 68, pp. 143-155 (1992); Mastrangeli et al., J. Clin. Invest., Vol. 91, pp. 225-234 (1993); WO 94 / 12649; and Wang et al., Gene Therapy, Vol. 2, pp. 775-783 (1995). Suitable AV vectors for expressing the iRNAs featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors to target cells are described in Xia H et al., 2002, Nature Biotechnology, 20, pp. 1006-1010.

[0439] The use of adeno-associated virus (AAV) vectors is also contemplated (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300, 1993; U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector, e.g., with either the U6 or H1 RNA promoter, or the cytomegalovirus (CMV) promoter. AAV vectors suitable for expressing the dsRNA featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering vectors to target cells are described in Samulski R et al., 1987, J. Virol., 61, pp. 3096-3101; Fisher KJ et al., 1996, J. Virol., 70, pp. 520-532; Samulski R et al., 1989, J. Virol., 1999, The Journal of Virology, 2000, pp. 111-114, the disclosures of which are incorporated herein by reference in their entirety. J. Virol., vol. 63, pp. 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; WO 94 / 13788; and WO 93 / 24641.

[0440] Another exemplary viral vector is a vaccinia virus, eg, an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, a poxvirus, eg, an avipox, such as fowlpox or canarypox.

[0441] The tropism of viral vectors can be modified, if desired, by pseudotyping the vector with envelope proteins or other surface antigens from other viruses or by substituting capsid proteins from different viruses. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to target different cells by expressing different capsid protein serotypes; see, for example, Rabinowitz JE et al., 2002, J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

[0442] The vector pharmaceutical preparation can include the vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

[0443] III. iRNA-Containing Pharmaceutical Compositions In one embodiment, the present invention provides a pharmaceutical composition containing an iRNA described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition contains an iRNA useful for treating a disease or disorder associated with the expression or activity of the ALAS1 gene (e.g., a disease involving the porphyrin pathway). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, the composition can be formulated for systemic administration via parenteral delivery, such as intravenous (IV) delivery. In some embodiments, the compositions provided herein (e.g., LNP formulations) are formulated for intravenous delivery. In some embodiments, the compositions provided herein (e.g., compositions comprising GalNAc conjugates) are formulated for subcutaneous delivery.

[0444] The pharmaceutical compositions provided herein are administered at a dose sufficient to inhibit expression of the ALAS1 gene. Generally, suitable doses of iRNA range from 0.01 to 200.0 milligrams per kilogram of recipient body weight per day, generally from 1 to 50 mg per kilogram of body weight per day. For example, dsRNA may be administered at 0.05 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, or 50 mg / kg per single dose. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more subdoses at appropriate intervals throughout the day, or even via continuous infusion or delivery via a controlled-release formulation. In such cases, the amount of iRNA contained in each subdose must be correspondingly smaller to achieve the total daily dose. The dosage unit can also be formulated for delivery over several days, for example, by using conventional sustained release formulations that provide sustained release of iRNA over several days.Sustained release formulations are well known in the art and are particularly useful for delivering active substances to specific sites, which can be used with the active substances of the present invention.In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0445] The effect of a single dose on ALAS1 levels can be prolonged, such that subsequent doses are administered no more than 3, 4, or 5 days apart, or no more than 1, 2, 3, or 4 weeks apart.

[0446] Those skilled in the art will understand that certain factors, including but not limited to, the severity of the disease or disorder, previous treatments, the subject's overall health and / or age, and other diseases present, may influence the dosage and timing required to effectively treat a subject. Moreover, treatment of a subject with a therapeutically effective amount of a composition may include a single treatment or a series of treatments. The effective dosage and in vivo half-life of the individual iRNAs encompassed by the present invention may be estimated using conventional procedures or based on in vivo studies using appropriate animal models, as described elsewhere herein.

[0447] Advances in mouse genetics have produced several mouse models for studying various human diseases (e.g., porphyrin-related or porphyrin pathway defects, such as porphyrias), including pathological processes associated with ALAS1 expression. Such models can be used for in vivo testing of iRNAs and to determine therapeutically effective doses and / or effective dosing regimens.

[0448] A suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS1. Mice with knock-in mutations (e.g., mutations associated with acute hepatic porphyria in humans) can be used to determine therapeutically effective doses and / or durations of administration. The present invention also includes pharmaceutical compositions and formulations containing the iRNA compounds featured herein. The pharmaceutical compositions of the present invention may be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be topical (e.g., via a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including nebulizers; intratracheal, intranasal, transepidermal, and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal administration, e.g., via an implanted device; or intracranial administration, e.g., intracerebral, intrathecal, or intraventricular.

[0449] The iRNA can be delivered in a manner that targets a specific tissue, such as an erythropoiesis-producing tissue. For example, the iRNA can be delivered to the bone marrow, liver (e.g., liver parenchymal cells), lymph nodes, spleen, lung (e.g., lung pleura), or spinal cord. In one embodiment, the iRNA is delivered to the bone marrow.

[0450] Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful. Suitable topical formulations include those in which the iRNA featured in the present invention is in admixture with a topical delivery agent, such as a lipid, liposome, fatty acid, fatty acid ester, steroid, chelating agent, or surfactant. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearolyphosphatidylcholine), anionic (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNA featured in the present invention may be encapsulated in or complexed with liposomes, particularly cationic liposomes. Alternatively, the iRNA may be complexed with lipids, particularly cationic lipids. Suitable fatty acids and esters include arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C 1~20 Topical formulations include, but are not limited to, alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0451] Liposomal formulation Besides microemulsions, which have been studied and used for drug formulation, there are many other organized surfactant structures. These include monolayers, micelles, bilayers, and vesicles. Vesicles such as liposomes have attracted considerable attention from the perspective of drug delivery due to their specificity and the duration of action they offer. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayer group.

[0452] Liposomes are unilamellar or multilamellar vesicles with a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes cannot fuse efficiently with the cell wall, but are taken up by macrophages in vivo.

[0453] To cross intact mammalian skin, lipid vesicles must pass through a series of pores, each less than 50 nm in diameter, under the influence of an appropriate transdermal gradient. It is therefore desirable to use liposomes that are highly deformable and can pass through such pores.

[0454] Additional advantages of liposomes include the following: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water- and lipid-soluble drugs; and liposomes can protect drugs encapsulated in their internal compartments from metabolism and degradation (Rosoff, Pharmaceutical Dosage Forms, edited by Lieberman, Rieger, and Banker, 1988, Vol. 1, p. 245, Marcel Dekker, Inc., New York, NY). Important considerations in the preparation of liposomal formulations are the lipid surface charge, vesicle size, and aqueous volume of the liposomes.

[0455] Liposomes are useful for the transfer and delivery of active ingredients to the site of action.Because liposome membrane is structurally similar to biological membrane, when liposome is applied to tissue, liposome begins to integrate with cell membrane, and as liposome and cell fusion proceeds, liposome contents are released into cells, where active agents can act.

[0456] Liposomal formulations have been the focus of extensive research as a delivery mode for many drugs. Evidence is emerging that liposomes offer several advantages over other formulations for topical administration. These advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of both hydrophilic and hydrophobic drugs intradermally.

[0457] Several reports have detailed the ability of liposomes to deliver active substances, including high molecular weight DNA, into the skin. Compounds, including painkillers, antibodies, hormones, and high molecular weight DNA, have been administered to the skin. The majority of applications have resulted in targeting the upper layers of the epidermis.

[0458] Liposomes are divided into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable complexes. The positively charged DNA / liposome complexes bind to the negatively charged cell surface and are internalized inside endosomes. The acidic pH within the endosome causes the liposomes to rupture, releasing their contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun. 1987, 147, 980-985).

[0459] pH-sensitive or negatively charged liposomes do not complex with DNA but rather encapsulate it. Because both DNA and lipids have similar charges, repulsion rather than complexation occurs. Nevertheless, some DNA is encapsulated within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19:269-274).

[0460] One major type of liposome composition contains phospholipids in addition to naturally occurring phosphatidylcholine. For example, neutral liposome compositions can be made from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally made from dimyristoylphosphatidylglycerol, while anionic fusogenic liposomes are primarily formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is made from phosphatidylcholine (PC), such as soybean PC and egg PC. Another type is made from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0461] Several studies have evaluated topical delivery of liposomal formulations to the skin. Application of interferon-containing liposomes to guinea pig skin resulted in a reduction in cutaneous herpes sores, whereas other means of interferon delivery (e.g., as a solution or emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, vol. 2, pp. 405-410). An additional study tested the effectiveness of administering interferon as part of a liposomal formulation compared with administering interferon using an aqueous system and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, vol. 18, pp. 259-265).

[0462] Nonionic liposomal systems, particularly those containing nonionic surfactants and cholesterol, have been studied to determine their efficacy in delivering drugs to the skin. Nonionic liposomal formulations containing Novasome™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine A into the dermis of mouse skin. The results suggested that such nonionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., STP Pharma. Sci., 1994, Vol. 4, No. 6, p. 466).

[0463] Liposomes also include "sterically stabilized" liposomes, which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into the liposome, result in improved circulation life compared to liposomes lacking such specialized lipids. An example of a sterically stabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome is (A) monosialoganglioside G M1 or (B) derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Without wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the improved circulation half-life of these sterically stabilized liposomes is due to reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223:42; Wu et al., Cancer Research, 1993, 53:3765).

[0464] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al., Ann. NY Acad. Sci., 1987, 507, 64, describe monosialoganglioside G M1 reported the ability of galactocerebroside sulfate and phosphatidylinositol to improve the blood half-life of liposomes. These findings were elaborated by Gabizon et al., Proceedings of the National Academy of Sciences, Vol. 85, p. 6949, 1988. U.S. Pat. No. 4,837,028 and WO 88 / 04924, both to Allen et al., report the ability of (1) sphingomyelin and (2) ganglioside G M1or galactocerebroside sulfate. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al.).

[0465] Numerous liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods for their preparation, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) describe a nonionic detergent containing a PEG moiety, 2C 1215Gdescribed liposomes comprising PEG or PEG-stearate. Illum et al., FEBS Lett., 1984, vol. 167, p. 79, noted that hydrophilic coating of polystyrene particles with polymeric glycols resulted in significantly improved blood half-lives. Synthetic phospholipids modified by the addition of carboxylic acid groups of polyalkylene glycols (e.g., PEG) were described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, vol. 268, p. 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significantly increased blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, vol. 1029, p. 91) extended these observations to other PEG-derivatized phospholipids, such as DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes bearing covalently bound PEG moieties on their exterior surfaces are described in EP 0 445 131 B1 and WO 90 / 04384 to Fisher. Liposomal compositions containing 1-20 mole percent PEG-derivatized PE, and methods for their use, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and EP 0 496 813 B1). Liposomes comprising several other lipid-polymer complexes are disclosed in WO 91 / 05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.), and WO 94 / 20073 (Zalipsky et al.).Liposomes comprising PEG-modified ceramide lipids are described in WO 96 / 10391 (Choi et al.). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes whose surfaces can be further derivatized with functional moieties.

[0466] Some liposomes comprising nucleic acids are known in the art. International Publication No. 96 / 40062 to Thierry et al. discloses a method for encapsulating high molecular weight nucleic acids in liposomes. U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bound liposomes and asserts that the contents of such liposomes may include dsRNA. U.S. Patent No. 5,665,710 to Rahman et al. describes a specific method for encapsulating oligodeoxynucleotides in liposomes. International Publication No. 97 / 04787 to Love et al. discloses liposomes comprising raf gene-targeting dsRNA.

[0467] Transfersomes are yet another type of liposome, highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets that are so highly deformable that they can easily penetrate pores smaller than droplets. Transfersomes can adapt to the environment in which they are used; for example, they self-optimize (adapt to the shape of skin pores), self-repair, often reach their targets without fragmentation, and are often self-loading. To create transfersomes, a surface edge activator, usually a surfactant, can be added to a standard liposome composition. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0468] Surfactants have a wide range of applications in formulations such as emulsions (including microemulsions) and liposomes. The most common method of classifying and ranking the properties of the many different surfactant types, both natural and synthetic, is by use of the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of classifying the different surfactants used in formulations (Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0469] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants have a wide range of applications in pharmaceutical and cosmetic products and can be used over a wide pH range. Their HLB values ​​generally range from 2 to approximately 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

[0470] If surfactant molecule carries negative charge when dissolved or dispersed in water, surfactant is classified as anionic.Anionic surfactants include carboxylates such as soap, acyl lactylate, acyl amide of amino acid, sulfate esters such as alkyl sulfate and ethoxylated alkyl sulfate, sulfonates such as alkyl benzene sulfonate, acyl isethionate, acyl taurate and acyl sulfosuccinate, and acyl phosphate.The most important members of anionic surfactant class are alkyl sulfate and soap.

[0471] If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used members of this class.

[0472] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phospholipids.

[0473] The use of surfactants in pharmaceuticals, formulations, and emulsions has been reviewed (Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0474] nucleic acid lipid particles In one embodiment, the ALAS1 dsRNA featured in the present invention is fully encapsulated in a lipid formulation to form, for example, SPLP, pSPLP, SNALP, or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to stable nucleic acid-lipid particles, including SPLPs. As used herein, the term "SPLP" refers to nucleic acid-lipid particles comprising plasmid DNA encapsulated within lipid vesicles. SNALP and SPLP typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALP and SPLP exhibit long circulatory life following intravenous (iv) injection and accumulate at distal sites (e.g., sites physically distant from the site of administration), making them extremely useful for systemic applications. SPLPs include "pSPLPs" containing encapsulated condensing agent-nucleic acid complexes, as described in WO 00 / 03683. The particles of the present invention typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially non-toxic. Additionally, when present in the nucleic acid-lipid particles of the present invention, the nucleic acid is resistant to nuclease degradation in aqueous solution. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and WO 96 / 40964.

[0475] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to dsRNA ratio) ranges from about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0476] Cationic lipids include, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLenDMA), and 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLenDMA). 1,2-Dilinoleyl-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP).Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanedio(propanedio) (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), or or its analogs, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or mixtures thereof. The cationic lipid may comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0477] In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles.The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed October 23, 2008, which is incorporated herein by reference.

[0478] In one embodiment, the lipid-siRNA particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane:10% DSPC:40% cholesterol:10% PEG-C-DOMG (molar percentages), with a particle size of 63.0±20 nm and an siRNA / lipid ratio of 0.027.

[0479] Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine-4-(N-maleiminomethyl)-2-(4-methyl-2-propanol), and dioleoyl-phosphatidylethanolamine-4-(N-maleiminomethyl)-2-(4-methyl-2-propanol). The lipid may be an anionic or neutral lipid, including, but not limited to, 16-O-monomethyl-2-cyclohexane-1-carboxylic acid (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), cholesterol, or mixtures thereof. When cholesterol is included, the non-cationic lipid may be about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid present in the particle.

[0480] The conjugated lipid that inhibits particle aggregation may be, for example, without limitation, a polyethylene glycol (PEG)-lipid, including PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C]8). The conjugated lipid that inhibits particle aggregation may be 0 mol% to about 20 mol% or about 2 mol% of the total lipid present in the particles.

[0481] In some embodiments, the nucleic acid-lipid particles further comprise cholesterol, for example, from about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0482] In some embodiments, the iRNA is formulated in a lipid nanoparticle (LNP).

[0483] LNP01 In one embodiment, lipid-dsRNA nanoparticles (e.g., LNP01 particles) can be prepared using lipidoid ND98·4HCl (MW1487) (see U.S. Patent Application No. 12 / 056,230, filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-ceramide C16 (Avanti Polar Lipids). Stock solutions of each can be prepared in ethanol as follows: 133 mg / ml ND98; 25 mg / ml cholesterol; 100 mg / ml PEG-ceramide C16. The ND98, cholesterol, and PEG-ceramide C16 stock solutions can then be combined in a molar ratio of, for example, 42:48:10. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate at pH 5) to achieve a final ethanol concentration of approximately 35-45% and a final sodium acetate concentration of approximately 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously when mixed.Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (for example, 100 nm cutoff) using a thermobarrel extruder, such as Lipex extruder (Northern Lipids, Inc.).In some cases, the extrusion step can be omitted.Ethanol removal and simultaneous buffer exchange can be achieved, for example, by dialysis or tangential flow filtration.Buffer exchange can be with phosphate buffered saline (PBS) at about pH 7, for example, about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4. [ka]

[0484] LNP01 formulations are described, for example, in WO 2008 / 042973, which is incorporated herein by reference.

[0485] Additional exemplary lipid dsRNA formulations are provided in the table below.

[0486] [Table 2]

[0487] [Table 3]

[0488] [Table 4]

[0489] Formulations comprising SNALP (1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) are described in WO 2009 / 127060, filed April 15, 2009, which is incorporated herein by reference.

[0490] XTC-containing formulations are described, for example, in U.S. Provisional Patent Application No. 61 / 148,366, filed January 29, 2009; U.S. Provisional Patent Application No. 61 / 156,851, filed March 2, 2009; U.S. Provisional Patent Application No. 61 / 228,373, filed July 24, 2009; U.S. Provisional Patent Application No. 61 / 239,686, filed September 3, 2009; and International Application No. PCT / US2010 / 022614, filed January 29, 2010, which are incorporated herein by reference.

[0491] MC3-containing formulations are described, for example, in U.S. Provisional Patent Application No. 61 / 244,834, filed September 22, 2009; U.S. Provisional Patent Application No. 61 / 185,800, filed June 10, 2009; and International Application No. PCT / US10 / 28224, filed June 10, 2010, which are incorporated herein by reference.

[0492] ALNY-100-containing formulations are described, for example, in International Application PCT / US09 / 63933, filed November 10, 2009, which is incorporated herein by reference.

[0493] C12-200-containing formulations are described in U.S. Provisional Patent Application No. 61 / 175,770, filed May 5, 2009, and International Application No. PCT / US10 / 33777, filed May 5, 2010, which are incorporated herein by reference.

[0494] Synthesis of cationic lipids Any of the compounds, such as the cationic lipids used in the nucleic acid-lipid particles featured in the present invention, can be prepared by known organic synthesis techniques, including those methods described in more detail in the Examples. Unless otherwise indicated, all substituents are as defined below.

[0495] "Alkyl" means a straight-chain or branched, acyclic or cyclic, saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms. Representative saturated straight-chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

[0496] Alkenyl refers to the alkyl as defined above, containing at least one double bond between adjacent carbon atoms.Alkenyl includes both cis and trans isomers.Representative straight-chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, etc.

[0497] "Alkynyl" means any alkyl or alkenyl as defined above further containing at least one triple bond between adjacent carbons. Representative straight-chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.

[0498] "Acyl" means any alkyl, alkenyl, or alkynyl, as defined below, where the carbon at the point of attachment is replaced by an oxo group. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.

[0499] "Heterocycle" means a saturated, unsaturated, or aromatic 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocycle containing one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, including bicycles in which any of the heterocycles below are fused to a benzene ring; the nitrogen and sulfur heteroatoms may or may not be oxidized, and the nitrogen heteroatom may or may not be quaternized. The heterocycle may be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls, as defined below. Examples of heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperidinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

[0500] The terms "optionally substituted alkyl," "optionally substituted alkenyl," "optionally substituted alkynyl," "optionally substituted acyl," and "optionally substituted heterocycle" mean that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (=O), two hydrogen atoms are replaced. In this regard, the substituents include oxo, halogen, heterocycle, -CN, -OR. x , -NR x R y , -NR x C(=O)R y , -NR x SO2R y , -C(=O)R x , -C(=O)OR x , -C(=O)NR x R y , -SO n R x , and -SO n NR x R y n is 0, 1 or 2; R x and R y are the same or different and independently represent hydrogen, alkyl, or heterocycle, and each of said alkyl and heterocycle substituents may be selected from one or more of oxo, halogen, —OH, —CN, alkyl, —OR x , heterocycle, -NR x R y , -NR x C(=O)R y , -NR x SO2R y , -C(=O)R x , -C(=O)OR x , -C(=O)NR x R y , -SO n R x , and -SO n NR x R y It may be further substituted by:

[0501] "Halogen" means fluoro, chloro, bromo, and iodo.

[0502] In some embodiments, the methods featured in this invention may require the use of protecting groups. Protecting group procedures are well known to those skilled in the art (see, for example, "Protective Groups in Organic Synthesis," Green, TW et al., Wiley-Interscience, New York, NY, 1999). Briefly, in the context of this invention, a protecting group is any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during a specific reaction and then removed to expose the original functional group. In some embodiments, an "alcohol protecting group" is used. An "alcohol protecting group" is any group that reduces or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using tech...

Claims

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, the dsRNA comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO: 1), and the antisense strand comprising at least 20 consecutive nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).

2. 1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO: 1), and wherein the antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21-40, or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21-40 (SEQ ID NOs: 4172-5237).

3. The dsRNA of claim 2, wherein the dsRNA comprises at least one modified nucleotide.

4. The dsRNA according to any one of claims 1 to 3, wherein the length of the double-stranded region is 17 to 23 nucleotide pairs.

5. The dsRNA of any one of claims 1 to 4, wherein at least one strand comprises a 3' overhang of at least two nucleotides.

6. The dsRNA of any one of claims 1 to 5, wherein each strand is 26 nucleotides or less in length.

7. 4. The dsRNA of claim 3, wherein the at least one modified nucleotide is selected from 2'-O-methyl, 2'-fluoro modified nucleotides, and optionally one or more 5'-phosphorothioate groups, or any combination thereof.

8. 8. The dsRNA of any one of claims 1 to 7, further comprising a ligand, optionally wherein the ligand is conjugated to the 3' end of the dsRNA sense strand.

9. 9. The dsRNA of claim 8, wherein the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.

10. The ligand is 【Chemistry 1】 The dsRNA of claim 9, wherein

11. The dsRNA of any one of claims 8 to 10, wherein the ligand is attached via a bivalent or trivalent branched linker.

12. The ligand and linker are represented by Formula XXIV: 【Chemistry 2】 The dsRNA of claim 11, wherein the dsRNA is as shown in

13. The dsRNA is 【Transformation 3】 9. The dsRNA of claim 8, wherein the dsRNA is conjugated to the ligand L96 via a linker, as shown in

14. The dsRNA of any one of claims 8 to 13, wherein the ligand targets the dsRNA to hepatocytes.

15. The dsRNA according to any one of claims 1 to 14, wherein the dsRNA comprises a sense strand consisting of a sense sequence selected from the sense sequences listed in Tables 21 to 40, and an antisense strand consisting of an antisense sequence selected from the antisense sequences listed in Tables 21 to 40.

16. the dsRNA has an IC of less than 1 nM, less than 0.05 nM, less than 0.02 nM, or less than 0.01 nM ５０ The dsRNA according to any one of claims 1 to 15, having the following structure:

17. 17. The dsRNA of any one of claims 1 to 16, wherein the dsRNA has a single dose ED50 of less than about 10 mg / kg or less than about 5 mg / kg.

18. 18. The dsRNA of any one of claims 1-17, wherein the dsRNA exhibits improved activity compared to AD-58632 or AD-60489, optionally wherein the dsRNA is selected from a dsRNA listed in Tables 21-40.

19. 19. The dsRNA of any one of claims 1 to 18, wherein the sense strand comprises or consists of the sequence CAGAAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).

20. 3. The dsRNA of claim 1 or 2, (i) the antisense strand comprises an antisense sequence of AD-60519, and the antisense sequence comprises all modified nucleotides of AD-60519; (ii) the antisense strand consists of the antisense sequence of AD-60519, and the antisense sequence comprises all modified nucleotides of AD-60519; (iii) the sense strand comprises the sense sequence of AD-60519, and the sense sequence comprises all modified nucleotides of AD-60519; (iv) the sense strand consists of the sense sequence of AD-60519, and the sense sequence comprises all modified nucleotides of AD-60519; (v) the sense strand comprises the sense sequence of AD-60519 and the antisense strand comprises the antisense sequence of AD-60519, and the sense and antisense sequences comprise all modified nucleotides of AD-60519; or (vi) A dsRNA, wherein the sense strand consists of the sense sequence of AD-60519 and the antisense strand consists of the antisense sequence of AD-60519, and the sense and antisense sequences comprise all modified nucleotides of AD-60519.

21. 3. The dsRNA of claim 1 or 2, (i) the antisense strand comprises the antisense sequence of AD-60489, and / or the sense strand comprises the sense sequence of AD-60489, and the antisense and / or sense sequences comprise all modified nucleotides of AD-60489; or (ii) a dsRNA, wherein the antisense strand consists of the antisense sequence of AD-60489 and / or the sense strand consists of the sense sequence of AD-60489, and the antisense and / or sense sequences comprise all modified nucleotides of AD-60489.

22. 3. The dsRNA of claim 1 or 2, (i) the antisense strand comprises the antisense sequence of AD-61193, and / or the sense strand comprises the sense sequence of AD-61193, and the antisense and / or sense sequences comprise all modified nucleotides of AD-61193; or (ii) A dsRNA, wherein the antisense strand consists of the antisense sequence of AD-61193 and / or the sense strand consists of the sense sequence of AD-61193, and the antisense and / or sense sequences comprise all modified nucleotides of AD-61193.

23. 3. The dsRNA of claim 2, (i) the antisense strand comprises the antisense sequence of AD-60819, and / or the sense strand comprises the sense sequence of AD-60819, and the antisense and / or sense sequences comprise all modified nucleotides of AD-60819; or (ii) a dsRNA, wherein the antisense strand consists of the antisense sequence of AD-60819 and / or the sense strand consists of the sense sequence of AD-60819, and the antisense and / or sense sequences comprise all modified nucleotides of AD-60819.

24. A vector encoding at least one dsRNA strand according to any one of claims 1 to 23.

25. A cell comprising the dsRNA of any one of claims 1 to 23 or the vector of claim 24.

26. A pharmaceutical composition for inhibiting the expression of the ALAS1 gene, comprising the dsRNA of any one of claims 1 to 23.

27. 27. The pharmaceutical composition of claim 26, wherein the dsRNA is administered in unbuffered saline or aqueous solution.

28. 28. The pharmaceutical composition of claim 26 or 27, wherein the composition is suitable for subcutaneous administration.

29. (a) introducing the dsRNA according to any one of claims 1 to 23 into a cell; (b) maintaining the cells of step (a) for a time sufficient to obtain degradation of mRNA transcripts of the ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cells; 1. A method of inhibiting ALAS1 expression in a cell, comprising:

30. 24. A method of reducing the level of a porphyrin or porphyrin precursor in a cell (e.g., a hepatocyte), comprising contacting the cell with the dsRNA of any one of claims 1-23 in an amount effective to reduce the level of the porphyrin or porphyrin precursor (e.g., ALA or PBG) in the cell.

31. (i) a dsRNA according to any one of claims 1 to 23, or (ii) The composition according to any one of claims 26 to 28. to a subject in need of such treatment, thereby treating the porphyria.

32. 32. The method of claim 31, wherein the subject is at risk of developing or diagnosed with porphyria.

33. 33. The method of claim 31 or 32, wherein the porphyria is acute intermittent porphyria or ALA dehydratase deficiency porphyria.

34. 34. The method of any one of claims 31-33, wherein (i) the dsRNA or composition comprising dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA or composition comprising dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA or composition comprising dsRNA is administered prophylactically to prevent an acute attack of porphyria.

35. 35. The method of any one of claims 31 to 34, wherein the dsRNA is administered at a dose of 0.05 to 50 mg / kg of the subject's body weight, such as, for example, at a dose of 0.01 mg / kg to 5 mg / kg of the subject's body weight.

36. 36. The method according to any one of claims 31 to 35, wherein the method comprises: (i) reducing porphyrin or porphyrin precursor (e.g., δ-aminolevulinic acid (ALA) or porphobilinogen (PBG)) levels in the subject, optionally reducing the levels by at least 30%; and / or (ii) inhibiting ALAS1 expression in said subject.

37. 37. The method of any one of claims 31-36, wherein the method (i) ameliorates symptoms associated with an ALAS1-related disorder (e.g., porphyria); (ii) reduces the frequency of acute attacks of symptoms associated with porphyria in the subject; and / or (iii) reduces the incidence of acute attacks of symptoms associated with porphyria in the subject when the subject is exposed to an exacerbating factor, such as, for example, the premenstrual period.

38. 38. The method of claim 31, wherein the dsRNA or composition comprising the dsRNA is administered according to a dosing regimen, such as weekly, biweekly, or monthly.

39. 39. The method of any one of claims 31 to 38, wherein the dsRNA is administered before an acute attack of porphyria, such as, for example, during the prodromal period.

40. 40. The method of any one of claims 31-39, wherein the subject has elevated levels (e.g., plasma or urine levels) of ALA and / or PBG, and optionally the subject suffers from chronic pain.

41. The method of any one of claims 31 to 40, wherein elevated ALA and / or PBG levels are reduced.

42. 42. The method of any one of claims 31 to 41, wherein the method reduces or prevents pain, neuropathy, and / or nerve damage.

43. 43. The method of any one of claims 31 to 42, wherein the method prevents an acute attack of porphyria.

44. The method of any one of claims 31 to 43, wherein the dsRNA or the composition comprising the dsRNA is administered repeatedly.

45. (i) a dsRNA according to any one of claims 1 to 23, or (ii) The composition according to any one of claims 26 to 28. to a subject in need of such treatment, wherein optionally said method is effective in lowering ALA and / or PBG levels.

46. 24. A method of treating a subject having elevated ALA and / or PBG levels, comprising administering 1 mg / kg, 2.5 mg / kg, or 5 mg / kg of the dsRNA of any one of claims 1 to 23 once a week for at least 10 weeks, thereby reducing ALA and / or PBG levels in the subject.

47. 24. A method of treating a human patient with AIP suffering from multiple recurrent attacks, comprising administering the dsRNA of any one of claims 1 to 23 at a dose of 2.5 mg / kg for at least 6 months, thereby treating the patient, and optionally the method further comprising: (i) reducing the frequency of seizures; (ii) reducing hematin use; (iii) reduce hospitalizations, and / or (iv) A method for improving quality of life.

48. 1. A method of assaying the level of circulating extracellular ALAS1 mRNA in a subject, comprising: detecting (e.g., measuring) the level of ALAS1 mRNA in a biological fluid sample (e.g., a blood sample, a plasma sample, a serum sample, or a urine sample) from the subject, the level comprising ALAS1 mRNA; thereby assaying circulating extracellular ALAS1 mRNA levels in said subject.

49. 1. A method of assaying the level of circulating extracellular ALAS1 mRNA in a subject, comprising: (i) providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., a blood sample, a plasma sample, a serum sample, or a urine sample) from the subject, the RNA comprising ALAS1 mRNA; (ii) obtaining ALAS1 cDNA from the ALAS1 mRNA; (iii) contacting the ALAS1 cDNA with a nucleic acid (e.g., a probe and / or a primer) complementary to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mixture; (iv) detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mixture, wherein the level of ALAS1 cDNA is indicative of the level of ALAS1 mRNA; thereby assaying circulating extracellular ALAS1 mRNA levels in said subject, Optionally, (a) the method comprises PCR, qPCR or 5'-RACE; (b) the nucleic acid is a probe or primer, and / or (c) the nucleic acid comprises a detectable moiety, and the ALAS1 mRNA level is determined by detecting the amount of the detectable moiety.

50. 50. The method of claim 49, wherein the effectiveness of the porphyria treatment is assessed based on a comparison of the circulating extracellular ALASl mRNA level in the subject to a reference value.

51. 50. The method of claim 49, wherein a decrease in the circulating extracellular ALASl mRNA level in the subject compared to the baseline in response to the porphyria treatment indicates that the porphyria treatment is efficacious.

52. 52. The method of any one of claims 49 to 51, further comprising obtaining a biological fluid sample from a subject, optionally wherein said biological fluid sample is separated from tissue, and wherein said biological fluid sample contains exosomes.

53. 21. A composition comprising the dsRNA of claim 20 and water for injection.

54. 54. The composition of claim 53, comprising about 200 mg / mL of the dsRNA of claim 20.

55. 55. The composition of claim 53 or 54, having a pH of from 6.0 to 7.5, for example about 7.

0.

56. 56. The composition of any one of claims 53 to 55, formulated for subcutaneous injection.

57. 57. A method of treating a subject having porphyria (e.g., AIP) or high levels of ALA and / or PBG, comprising subcutaneously administering to the subject a composition of any one of claims 53-56.

58. 58. The method of claim 57, wherein the composition is administered at a dose of 0-5 mg / kg, such as, for example, a dose of 2.5 mg / kg or less or a dose of 1-2.5 mg / kg.

59. 59. The method of claim 58, wherein the composition is administered weekly.

Images