Lipid particle for nucleic acid delivery and clinical application thereof
Lipid particles encapsulating nucleic acids encoding large proteins, particularly using ionizable amino lipids, address the delivery challenges of large nucleic acids, achieving high gene editing efficiency and therapeutic benefits in cancer models.
Patent Information
- Application Number
- JP2025171749
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-05-19
- Filing Date
- 2025-10-10
- Publication Date
- 2026-01-21
AI Technical Summary
Current delivery systems, including viral and non-viral methods, face challenges in efficiently transporting large nucleic acid sequences, such as mRNA and plasmids, due to their size and immune responses, limiting their application in genome editing and protein-based therapies.
Development of lipid particles, specifically cationic lipids encapsulating nucleic acid sequences encoding proteins of at least 500 amino acids, which are formulated into nanoparticles for efficient delivery and translation, using ionizable amino lipids like L8 to encapsulate Cas9 mRNA and sgRNA, enhancing gene editing efficacy.
The lipid particles achieve up to 98% gene editing in various cell lines, reduce tumor growth, and improve survival in cancer models, demonstrating effective delivery and therapeutic potential of large nucleic acids.
Smart Images

Figure 2026010063000001_ABST
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 026,785, filed May 19, 2020, the entire contents of which are incorporated herein by reference.
[0002] Sequence Listing Statement An 8,192 byte ASCII file entitled "86404SequenceListing.txt", created on May 17, 2021, which was filed concurrently with the filing of this application, is incorporated herein by reference. [Background technology]
[0003] The present invention, in some embodiments thereof, relates to lipid particles for nucleic acid delivery and their clinical applications.
[0004] Polynucleotide- or protein-based therapies are limited by the difficulty of transporting these macromolecules into the cell interior. To improve the cell penetration of these molecular therapies, several delivery systems have been developed and proposed. Examples of these systems range from cell electroporation to viral delivery and the use of lipid particles (e.g., liposomes, lipid nanoparticles), inorganic compounds (cationic polymers, nanotubes, nanoparticles), and cell-penetrating peptides (CPPs).
[0005] Genome editing is a powerful tool that can be used to induce targeted mutations, deletions, or insertions in cellular DNA sequences and facilitate recombination of predetermined gene sequences within the genome, with many therapeutic and biotechnological applications. Current genome editing reagents include, for example, meganucleases, engineered zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems.
[0006] However, delivering functional genome-editing reagents into cells can be problematic. For example, the size (160 kDa, 4300 b) of the Cas9 nuclease in the CRISPR / Cas system makes its encapsulation, cellular delivery, and translation difficult using viral and nonviral delivery systems. Most in vivo studies of gene editing have relied on adeno-associated viruses (AAVs) to deliver CRISPR / Cas components locally or to the liver. Nevertheless, the application of AAVs is limited by their small viral carrying capacity, immune responses, and current inability to target nucleic acids [e.g., Senis, E. et al. (2014). Biotechnology Journal 9, 1402-1412]. Lipid nanoparticles (LNPs) are the only clinically approved nonviral delivery system for nucleic acids. These LNPs, based on ionizable lipids, have attracted much attention in the field of RNA therapy. However, LNP formulations optimized for siRNA cannot efficiently deliver large nucleic acid sequences (e.g., mRNA, plasmids) that must be translated into functional proteins [see, e.g., Tam, YK, et al. (2016) Journal of Drug Targeting 24, 774-779; Oberli, MA et al. (2017) Nano Letters 17, 1326-1335].
[0007] Additional background art includes: Ramishetti S. et al. (2020) Adv Mater. Jan 30:e1906128, and International Publication Nos. 2016 / 189532, 2018 / 015881 and 2018 / 087753. Summary of the Invention
[0008] According to one aspect of some embodiments of the present invention, there is provided a lipid particle comprising a cationic lipid encapsulating a nucleic acid sequence, wherein the nucleic acid sequence encodes a protein of at least 500 amino acids in length, and the cationic lipid has a structure represented by Formula I: [ka] (In the formula, m is 0 or 1, A1 and A2 are each independently a saturated or unsaturated, linear, unbranched alkylene chain at least 8 carbon atoms in length; L1 is a first linking group that is an alkylene of 1 to 4 carbon atoms in length; X is -OC(=O)- or -NH-C(=O); L2 is a second linking group that is alkylene of 1 to 4 carbon atoms in length, and R1 and R2 are each independently hydrogen, alkyl, or cycloalkyl, or R1 and R2 together with the nitrogen to which they are attached form a heteroalicyclic ring; However, when X is -OC(=O)-, m is 1. Lipid particles are provided, the lipid particles having the formula:
[0009] According to one aspect of some embodiments of the present invention, there is provided a method for producing lipid particles for delivery of nucleic acid sequences, the method comprising: [ka] (In the formula, m is 0 or 1, A1 and A2 are each independently a saturated or unsaturated, linear, unbranched alkylene chain at least 8 carbon atoms in length; L1 is a first linking group that is an alkylene of 1 to 4 carbon atoms in length; X is -OC(=O)- or -NH-C(=O); L2 is a second linking group that is alkylene of 1 to 4 carbon atoms in length, and R1 and R2 are each independently hydrogen, alkyl, or cycloalkyl, or R1 and R2 together with the nitrogen to which they are attached form a heteroalicyclic ring; However, when X is -OC(=O)-, m is 1. encapsulating a nucleic acid sequence within a lipid particle comprising a cationic lipid represented by A method is provided wherein the nucleic acid sequence encodes a protein of at least 500 amino acids in length.
[0010] According to some embodiments of the present invention, the lipid particle comprises a targeting moiety.
[0011] According to some embodiments of the invention, the method includes attaching a targeting moiety to a lipid particle.
[0012] According to some embodiments of the invention, the nucleic acid sequence comprises a ribosome binding site sequence, a start codon and an in-frame stop codon.
[0013] According to some embodiments of the invention, the nucleic acid sequence is mRNA.
[0014] According to some embodiments of the invention, the protein is at least 1000 amino acids in length.
[0015] According to some embodiments of the invention, the protein is an enzyme.
[0016] According to some embodiments of the invention, the enzyme is a genome-editing endonuclease.
[0017] According to some embodiments of the present invention, the genome editing endonuclease is a CRISPR-associated endonuclease.
[0018] According to some embodiments of the invention, the CRISPR-associated endonuclease is Cas9.
[0019] According to some embodiments of the invention, the nucleic acid sequence comprises SEQ ID NO:4.
[0020] According to some embodiments of the present invention, the lipid particle further comprises a nucleic acid sequence that guides a genome editing endonuclease to a gene of interest.
[0021] According to some embodiments of the invention, the method includes encapsulating a nucleic acid sequence that guides a genome-editing endonuclease to a gene of interest in a lipid particle.
[0022] According to some embodiments of the present invention, the nucleic acid sequence that guides the genome editing endonuclease to the gene of interest is a gRNA of the CRISPR system.
[0023] According to some embodiments of the present invention, the gene of interest is selected from the group consisting of PLK1, cyclin D1, Sox11, STAT3, CCR5, HIV genes, T-Bet, NIK, CKAP5, LRG5, CA9, HPV E6 and HPV E7.
[0024] According to some embodiments of the present invention, the particles are nanoparticles having a particle size of 30-150 nm.
[0025] According to some embodiments of the present invention, there is provided a method for producing a heterologous protein of interest, comprising contacting cells with lipid particles to produce the heterologous protein of interest.
[0026] According to some embodiments of the invention, the method includes recovering the protein of interest from the cells following contacting.
[0027] According to some embodiments of the present invention, there is provided a method of creating a genetic mutation in a cell, the method comprising contacting the cell with a lipid particle to create a genetic mutation in the cell.
[0028] According to some embodiments of the invention, the method further comprises, following the contacting, administering the cells to a subject having a disease in need of treatment.
[0029] According to some embodiments of the present invention, there is provided a method for treating a disease in which exogenous expression of a protein in a subject's cells is effective, the method comprising administering to the subject a therapeutically effective amount of lipid particles to treat the disease in the subject.
[0030] According to some embodiments of the present invention, lipid particles are provided for the treatment of diseases in which exogenous expression of proteins in cells of a subject is beneficial.
[0031] According to some embodiments of the present invention, there is provided a method for treating a disease in which making a genetic mutation in a subject's cells is beneficial, the method comprising administering to the subject a therapeutically effective amount of lipid particles, thereby treating the disease in the subject.
[0032] According to some embodiments of the present invention, lipid particles are provided for the treatment of diseases in which the creation of a genetic mutation in the cells of a subject is beneficial.
[0033] Unless otherwise specified, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of embodiments of this invention, exemplary methods and / or materials are described below. In case of conflict, the present patent specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0034] Certain embodiments of the present invention are described herein, by way of example only, with reference to the accompanying drawings. It is emphasized that the matter set forth hereinafter, with particular reference to the drawings, is for purposes of illustration and for purposes of detailed description of embodiments of the present invention. Similarly, the description provided together with the drawings will make apparent to those skilled in the art how embodiments of the present invention may be practiced. [Brief explanation of the drawings]
[0035] [Figure 1-1]Figures 1A-1I show the design, construction, and activity of lipid nanoparticles encapsulating Cas9 mRNA and sgRNA, referred to herein as CRISPR LNPs or cLNPs. Figure 1A shows a schematic of cLNP formulation. It illustrates the microfluidic-based mixing of lipids to assemble cLNPs encapsulating Cas9 mRNA and sgRNA. Figure 1B shows transmission electron microscopy (TEM) images of Dlin-MC3-DMA (MC3)-based cLNPs (left) and L8-based cLNPs (right). Scale bars are 100 nm. Figure 1C shows the encapsulation efficiency measured by RiboGreen assay. Figure 1D shows the uptake of MC3-based or L8-based cLNPs by HEK293 cells. Cells were transfected with 0.1-1 μg / ml Cy5.5-labeled cLNPs and analyzed by flow cytometry. Results are presented as the geometric mean of Cy5.5 fluorescence. Figure 1E shows a GFP decay assay. GFP-expressing HEK293 (HEK / GFP) cells were transfected with MC3- or L8-based cLNPs containing Cas9 mRNA and GFP sgRNA, and the percentage of GFP-positive cells was analyzed by flow cytometry 72 hours after transfection. Figures 1F–1G show the percentage of gene editing events at the GFP and PLK1 loci (Figure 1G) in HEK / GFP cells following transfection with L8-based cLNPs containing Cas9 mRNA and GFP sgRNA (sgGFP cLNPs) or L8-based cLNPs containing PLK1 sgRNA (sgPLK1 cLNPs), as analyzed by next-generation sequencing. Figure 1H shows cell cycle analysis of HEK293 cells 48 hours after treatment with mock, sgGFP cLNPs, or sgPLK1 cLNPs (0.5 μg / ml), as determined by flow cytometry. Figure 1I shows the cell viability of HEK293 cells 96 hours after treatment with mock, sgGFP cLNP, or sgPLK1 cLNP (0.5 μg / ml), as determined by XTT assay. Results are presented as % of mock-treated cells. In Figures 1C and 1E–1H, data are presented as the mean of three or more separate experiments, and significance was assessed using one-way ANOVA with Tukey's multiple range test.In Figure 1D, data are representative of three separate experiments. [Figure 1-2] Same as above [Figure 1-3] Same as above [Figure 1-4] Same as above [Figure 2] Figures 2A-2F show in vitro genome editing of the mouse glioblastoma cell line 005 and the human ovarian cancer cell line OV8 following transfection with L8-based sgGFP cLNPs or sgPLK1 cLNPs. Figures 2A and 2D show the percentage of gene editing events at the GFP and PLK1 (Figure 1G) loci in 005 (Figure 2A) and OV8 (Figure 2D) treated with the indicated cLNPs or mock control, as analyzed by next-generation sequencing. Figures 2B and 2E show cell cycle analysis of 005 cells (Figure 2B) and OV8 cells (Figure 2E) 48 hours after treatment with the indicated cLNPs or mock control (0.5 μg / ml for 005 and 1 μg / ml for OV8), as determined by flow cytometry. Figures 2C and 2F show the cell viability of 005 cells (Figure 2C) and OV8 cells (Figure 2F) 96 hours after treatment with the indicated cLNPs or mock control (005 at 0.5 μg / ml, OV8 at 1 μg / ml), as determined by XTT assay. Results are presented as % of mock-treated cells. Data are presented as the mean of three or more separate experiments, and significance was assessed using one-way ANOVA with Tukey's multiple range test. [Figure 3-1]Figures 3A-3H show therapeutic in vivo genome editing in mice bearing 005 GBM after injection of L8-based cLNPs. Figure 3A shows a schematic diagram of intracranial injection into the mouse hippocampus. Figure 3B shows the distribution of cLNPs in tumor lesions after intracranial injection. Cy5.5-labeled cLNPs were intracranially injected into the tumor bed of 005 GBM-bearing mice. Mice were euthanized 6 hours after injection, and brain sections were analyzed by confocal microscopy. Blue: DAPI, green: 005 GFP, and yellow: Cy5.5 cLNPs. Scale bar: 50 μm. Figures 3C-3D show in vivo GFP decay in 005 GBM-bearing mice following injection of 0.05 mpk sgGFP-cLNPs into the tumor bed. Seven days after injection, single-cell suspensions were prepared from the brain and analyzed by flow cytometry for GFP reduction. Figure 3C shows a representative flow cytometry histogram. Figure 3D shows the mean fluorescence intensity + SD of three independent experiments. **P<0.005. Figure 3E is a schematic diagram of the experimental design for assessing tumor growth. 005 cells were intracranially injected into the hippocampus. Ten days after tumor inoculation, 0.05 mpk of sgGFP-cLNP, sgPLK1-cLNP, or PBS was injected into the tumor bed using an automated syringe pump at a rate of 0.3 μl / min. Tumor growth was monitored using the bioluminescence of 005-GFP-Luc cells using an IVIS-Spectrum-CT in vivo imaging system. Figures 3F-3G show tumor growth inhibition by a single dose of sgPLK-cLNP. Figure 3F shows representative bioluminescence from treated mice. Figure 3G shows tumor growth curve quantification using bioluminescence in vivo imaging. Data are presented as total flux (p / s) ± SEM. n = 15 mice per treatment group, n = 8 mice for PBS. ****p < 0.0001. One-way ANOVA was used to assess significance at day 41. Figure 3H shows Kaplan-Meier survival curves for treated mice. n = 30 mice per treatment group, n = 8 mice for PBS. ****p < 0.0001. Log-rank (Mantel-Cox) tests were used to compare curves. [Figure 3-2] Same as above [Figure 3-3] Same as above [Figure 4-1]Figures 4A-4D show therapeutic in vivo genome editing in OV8-bearing mice after injection of anti-hEGFR-targeted L8-based sgPLK1 cLNPs. Figure 4A is a schematic diagram of the experimental design. OV8-mCherry cells were intraperitoneally (ip) injected into 8-week-old athymic nu / nu mice. Ten and 17 days after tumor inoculation, 0.75 mpk of anti-hEGFR-fused sgPLK1 cLNPs or sgGFP cLNPs (T-sgPLK1 or T-sgGFP, respectively) were injected ip. Tumor growth was monitored using the mCherry fluorescence of OV8-mCherry cells using an IVIS-Spectrum-CT in vivo imaging system. Figures 4B-C show tumor growth inhibition by T-sgPLK1 cLNP treatment. Figure 3B shows representative fluorescence images of treated mice. Figure 4C shows tumor growth curve quantification. Data are presented as total flux (p / s) ± SEM, n = 10 per group, ****p < 0.0001. One-way ANOVA was used to assess significance at day 49. Figure 4D shows Kaplan-Meier survival curves for treated mice. n = 10 per treatment group. ****p < 0.0001. Log-rank (Mantel-Cox) tests were used to compare curves. [Figure 4-2] Same as above [Figure 5] Figure 5 shows an in vitro stability study of L8-based sgGFP cLNPs in HEK293 cells. HEK293 cells were treated with 0.1–1 μg / ml of cLNPs for 72 hours. Cells were stained with DAPI viability dye and analyzed by flow cytometry. Data are representative of three separate biological replicates. p = ns. Significance was assessed by one-way ANOVA with Tukey's multiple regression test. [Figure 6]Figures 6A-6C show in vitro genome editing resulting in cell death in HEK293 cells following transfection with L8-based sgPLK1 cLNP. Figure 6A shows cell cycle analysis of HEK293 cells 48 hours after treatment with mock control, sgGFP-cLNP, or sgPLK1-cLNP (0.5 μg / ml), as determined by flow cytometry. Results are representative of three separate experiments. Figure 6B shows cell viability of HEK293 cells 96 hours after treatment with mock control, sgGFP-cLNP, or sgPLK1-cLNP (0.5 μg / ml), as determined by DAPI / Annexin V assay. Results are presented as % of mock-treated cells. Data are shown as the mean of three or more separate experiments; ****p<0.0001; significance was assessed using one-way ANOVA with Tukey's multiple-range test. Figure 6C shows a representative DAPI / Annexin V diagram. Data are representative of three separate experiments. [Figure 7] Figures 7A-7B represent the % of gene editing events at the GFP (Figure 7A) locus in 005 (Figure 7A) and OV8 (Figure 7B) following transfection of L8-based sgGFP cLNPs, as analyzed by next-generation sequencing. [Figure 8-1]Figures 8A-8D show in vitro genome editing leading to G2 / M cell cycle arrest and cell death in the mouse glioblastoma cell line 005 (Figures 8A-8B) and the human ovarian cancer cell line OV8 (Figures 8C-8D) following transfection with L8-based sgGFP cLNPs. Figures 8A and 8C show cell cycle analysis of 005 and OV8 cells 48 hours after treatment with mock control, sgGFP-cLNPs, or sgPLK1-cLNPs (005 at 0.5 μg / ml, OV8 at 1 μg / ml), as determined by flow cytometry. Figures 8B and 8D show cell viability of 005 and OV8 cells, respectively, 96 hours after treatment with mock control, sgGFP-cLNPs, or sgPLK1-cLNPs (005 at 0.5 μg / ml, OV8 at 1 μg / ml), as determined by DAPI / Annexin V apoptosis analysis. Representative flow cytometry plots (left) and the mean + SD of three separate experiments (right) are shown. ***p<0.001, ****p<0.0001. [Figure 8-2] Same as above [Figure 9] Figures 9A-9C show the evaluation of liver toxicity and immunogenicity following intravenous injection of cLNPs. C57BL / 6 mice were intravenously injected with 1 mg / kg body weight of sgGFP-cLNPs. Blood liver enzyme elevations [alanine transaminase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP)] (Figure 9A) and total blood counts (Figure 9B) were assessed 24 h after injection. Immunogenicity was assessed by elevated blood levels of pro- and anti-inflammatory cytokines (interleukin-1β (IL-1β), interleukin-2 (IL-2), tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), and interleukin-10 (IL-10)) (Figure 9C). Data are representative of three separate experiments, representing biological replicates. Data are shown as interquartile range (IQR) with midline and minimum to maximum error bars (Figures 9A-9B) and mean ± sd (Figure 9C), n = 3, P = not significant. [Figure 10]Figure 10 shows the encapsulation rates of Cas9 mRNA and GFP sgRNA in MC3-, L1-, L6-, L8-, and L-10-based LNPs as measured by RiboGreen assay. [Figure 11] Figure 11 shows a GFP decay assay in HEK293 cells. GFP-expressing HEK293 cells (HEK / GFP) were transfected with increasing concentrations of MC3-, L1-, L6-, L8-, or L-10-based sgGFP cLNPs, and the % of GFP-positive cells was analyzed by flow cytometry 72 hours after transfection. [Figure 12] Figure 12 shows a GFP decay assay in tumor cell lines. 005, OV8, NAR, HCT116, or A549 cell lines were transfected with L8-based sgGFP cLNPs or a mock control, and the percentage of GFP-positive cells was analyzed by flow cytometry 72 hours after transfection. Results for each cell line are presented as a percentage of mock-treated cells. DETAILED DESCRIPTION OF THE INVENTION
[0036] The present invention, in some embodiments thereof, relates to lipid particles for nucleic acid delivery and their clinical applications.
[0037] Before describing at least one embodiment of the present invention in detail, it should be understood that the invention is not necessarily limited in its application to the details set forth in the description that follows or by the specific examples set forth in the examples. The invention is capable of other embodiments and of being practiced or carried out in various ways.
[0038] Polynucleotide- or protein-based therapies are limited by the difficulty of internalizing these macromolecules. To improve the cellular penetration of these molecular therapies, several delivery systems have been developed and proposed. These systems range from cell electroporation to viral delivery, lipid particles (e.g., liposomes, lipid nanoparticles), inorganic compounds (cationic polymers, nanotubes, nanoparticles), and cell-penetrating peptides (CPPs). However, delivering large functional proteins and the polynucleotides encoding such proteins can be problematic. For example, the Cas9 nuclease in the CRISPR / Cas system remains challenging to encapsulate, deliver, and translate into cells using viral and nonviral delivery systems due to its large size (160 kDa, 4300 b).
[0039] In carrying out the present invention, the inventors herein developed and tested highly efficient non-viral lipid nanoparticles (LNPs) for CRISPR / Cas9 gene editing, which demonstrated up to 98% gene editing in various cell lines and were able to reduce tumor growth and improve survival in two aggressive cancer mouse models.
[0040] As described here and in the Examples section that follows, the inventors have developed a novel ionizable amino lipid library using the gold standard DLin-MC3-DMA (hereafter referred to as MC3) ionizable cationic lipid or a novel ionizable amino lipid library. 7LNPs were designed to encapsulate both Cas9 mRNA and sgRNA using ionizable cationic lipids derived from the Cas9 family, specifically lipid 8 (L8), lipid 10 (L10), lipid 1 (L1), and lipid 6 (L6) (Examples 1 and 5, Figures 1A-1C). The resulting lipid nanoparticles encapsulating Cas9 mRNA and sgRNA are referred to herein as CRISPR LNPs or cLNPs. The L8-, L10-, and L1-based cLNPs induced in vitro gene disruption in transfected cells, whereas MC3- or L6-based LNPs did not (Examples 2 and 5, Figures 1D-1I, 5, and 10-12). In addition, using gRNA targeting PLK1 kinase, L8-based cLNPs induced cell death in vitro in multiple cell lines, including glioblastoma and ovarian cancer lines (Example 3, Figures 1H-1I, 2A-2F, and 6A-8D). Furthermore, L8-based cLNPs were able to induce gene disruption in vivo, leading to reduced tumor growth and improved survival in glioblastoma and ovarian cancer mouse models, suggesting their potential for therapeutic genome editing (Example 4, Figures 3A-4D and 9A-9C).
[0041] As a result, certain embodiments of the present teachings suggest the delivery of polynucleotides encoding large proteins using lipid particles containing certain cationic lipids.
[0042] Thus, according to a first aspect of the present invention there is provided a lipid particle comprising a cationic lipid of formula I as defined herein and encapsulating a nucleic acid sequence, the nucleic acid sequence encoding a protein of at least 500 amino acids in length.
[0043] According to further or alternative embodiments of the present invention, there is provided a method for producing lipid particles for delivery of a nucleic acid sequence, comprising encapsulating a nucleic acid sequence within a lipid particle comprising a cationic lipid of Formula I, as defined herein, wherein the nucleic acid sequence encodes a protein of at least 500 amino acids in length.
[0044] As used herein, "lipid particle" refers to a nano- to micro-structure that comprises lipids and is not a biological cell.
[0045] A particle can be a synthetic support, gel, or other object or material having an exterior surface that can be loaded with (e.g., encapsulated within) a nucleic acid sequence. The particle can be a polymeric or non-polymeric preparation.
[0046] Exemplary particles that can be used in certain embodiments of the present invention include, but are not limited to, polymer particles, microcapsules, liposomes, microspheres, microemulsions, nanoparticles, nanocapsules, nanospheres, nanoliposomes, nanoemulsions, and nanotubes.
[0047] Suitable particles in some embodiments of the present invention are preferably non-toxic.
[0048] In certain embodiments, the particle is a liposome. As used herein and recognized in the art, a liposome includes any synthetic (i.e., non-natural) structure composed of a lipid bilayer that contains a volume. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, and the like. Liposomes may be prepared by any known method [Monkkonen, J. et al., 1994, J. Drug Target, 2:299-308; Monkkonen, J. et al., 1993, Calcif. Tissue Int., 53:139-145; Lasic D D., Liposomes Technology Inc., Elsevier, 1993, 63-105. (chapter 3); Winterhalter M, Lasic DD, Chem Phys Lipids, 1993 September;64(1-3):35-43].
[0049] The diameter of the liposomes used is preferably in the range of 20 to 200 nm, more preferably 20 to 100 nm. Liposome size can be adjusted by extrusion, homogenization, or exposure to ultrasonic radiation. Convenient homogenizers include a microfluidic device (Microfluidics, Boston, Massachusetts, USA) or a microfluidic micromixer (Precision NanoSystems, Vancouver, British Columbia, Canada). In a typical homogenization process, liposomes are circulated through a standard emulsifying homogenizer until liposomes of the selected size are observed. Particle size distribution can be monitored using commercially available laser-beam particle size discrimination methods. Extrusion of liposomes through a small-pore polycarbonate membrane or an asymmetric ceramic membrane is an effective method for reducing liposome size to a known particle size distribution. Typically, the suspension is passed through the membrane one or more times until the desired liposome size distribution is achieved. To achieve a gradual reduction in liposome size, liposomes can be extruded through multiple membranes of successively smaller pore sizes. Liposomes can be unilamellar or multilamellar. Unilamellar liposomes may be preferred due to their greater surface area relative to lipid mass.
[0050] According to a particular embodiment, the particles are nanoparticles.
[0051] As used herein, the term "nanoparticle" refers to one or more particles intermediate in size between individual atoms and macroscopic bulk solids. Typically, nanoparticles have a characteristic particle size in the submicrometer range (e.g., the diameter of a generally spherical nanoparticle or the length of a generally elongated nanoparticle), e.g., about 1 nm to about 500 nm, about 1 nm to about 200 nm, or on the order of 10 nm (e.g., about 1 nm to about 100 nm). According to certain embodiments, the particles are nanoparticles between 30 and 150 nm in size.
[0052] The nanoparticles can be of any shape, including, but not limited to, more regular, generally spherical, hexahedral, and cubic nanoparticles, as well as elongated particle shapes such as nanowires, or irregular shapes. According to one embodiment, the nanoparticles are generally spherical.
[0053] Non-limiting examples of lipid nanoparticles and methods for their production for use in certain embodiments of the present invention are further described below and in the Examples section, as well as in, for example, Ramishetti et al. Adv Mater. 2020 Jan 30:e1906128, WO 2016 / 189532, WO 2018 / 015881, and WO 2018 / 087753, WO 2017 / 194454, and U.S. Patent Application Publication No. 20130245107, the disclosures of which are incorporated herein by reference in their entireties.
[0054] Nanoparticles can be produced by methods known in the art, for example, the methods disclosed in Jayaraman et al. Angew Chem. Jul 2012, Semple et al. Nat Biotech. 2010, Kauffman et al. Nano Lett, Oct 2015, and the methods disclosed in the Examples below.
[0055] The core of the particle may be hydrophilic or hydrophobic. The core of a lipid nanoparticle may contain some lipids and may not be entirely hydrophilic.
[0056] According to certain embodiments, the core of the particle is hydrophobic.
[0057] According to certain embodiments, the core of the particle is hydrophilic.
[0058] It should be understood that different combinations of lipids can be used to prepare the particles disclosed herein, including mixtures of more than one cationic lipid, mixtures of at least one cationic lipid and at least one anionic lipid, mixtures of at least one cationic lipid and at least one neutral lipid, and other combinations of the above.
[0059] In exemplary embodiments, the lipids of the lipid particles may be of natural or synthetic origin and are selected from, but not limited to, cationic lipids, phosphatidylethanolamines, ionizable lipids, membrane-stabilizing lipids, phospholipids, and the like, and combinations thereof, with each possibility representing a separate aspect of the present invention.
[0060] In some embodiments, the membrane-stabilizing lipid is selected from, but is not limited to, cholesterol, phospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerol), cephalin, sphingolipids (sphingomyelin and glycoglycerolipids), glycoglycerolipids, and the like, and combinations thereof, with each possibility representing a separate aspect of the present invention.
[0061] In some embodiments, the phosphatidylethanolamine is selected from, but not limited to, 1,2-dilauroyl-L-phosphatidylethanolamine (DLPE), 1,2-dileoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,3-dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE), 1-palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), biotin-phosphatidylethanolamine, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), or a combination thereof. In some embodiments, the phosphatidylethanolamine may be conjugated to a PEG-amine derivative. Each possibility represents a separate aspect of the present invention.
[0062] Additionally, according to certain embodiments, polymer-lipid based formulations may be used.
[0063] There are several polymers that can be attached to lipids. Typical polymers used as lipid-modifying agents include, but are not limited to, polyethylene glycol (PEG), polysialic acid, polylactic acid (also called polylactide), polyglycolic acid (also called polyglycotide), polylactic-polyglycolic acid (apolylactie-polyglycolicacid'), polyvinyl alcohol, polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxyethyloxazoline, polyhydroxypropyloxazoline, polyaspartamide, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinylmethylether, polyhydroxyethylacrylic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
[0064] The polymers can be used as homopolymers or as block or random copolymers.
[0065] The particles may further comprise other components. Examples of such other components include, but are not limited to, fatty alcohols, fatty acids, and / or cholesterol esters, or other pharmaceutically acceptable excipients that affect surface modification and membrane fluidity and aid in the incorporation of biologically active lipids into the lipid aggregates. Examples of sterols include cholesterol, cholesterol hemisuccinate, cholesterol sulfate, and other cholesterol derivatives. In certain embodiments of the present invention, the lipid aggregates may form micelles (typically when the aggregates are absent from a lipid matrix) or liposomes (typically when a lipid matrix is present).
[0066] According to one embodiment, the lipid phase comprises a phospholipid.
[0067] The phospholipid may be a glycerophospholipid, including, but not limited to, phosphatidylglycerol (PG) including dimyristoylphosphatidylglycerol (DMPG), phosphatidylcholine (PC) including egg yolk phosphatidylcholine and dimyristoylphosphatidylcholine (DMPC), phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM) and derivatives thereof.
[0068] The lipid particles disclosed herein comprise cationic lipids (monocationic or polycationic lipids). Cationic lipids typically contain a lipophilic moiety, such as a sterol or glycerol backbone, with two acyl or two alkyl, or one acyl and one alkyl chain providing the hydrophobic region of the amphiphilic molecule, resulting in an overall positive charge. According to certain embodiments, the particles comprise cationic lipids other than those of Formula I, as defined herein. Non-limiting examples of cationic lipids that may be used with certain embodiments of the invention include 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxy-3-(trimethylamino)propane (DOTAP), N-[-1-(2,3-ditetradecyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N-[1-(2,3-diole ... These include ceramide carbamoyl spermine (CCS), D-Lin-MC3-DMA (Cas number 1224606-06-7), dimethyl-dioctadecylammonium (DDAB), N-[2-[[2,5-bis[3-aminopropyl)amino]-1-oxopentyl]amino]ethyl]N,N-dimethyl-2,3-bis(1-oxo-9-octadecenyl)oxy];-dimethylpropanammonium (DOSPA), ceramide carbamoyl spermine (CCS), D-Lin-MC3-DMA (Cas number 1224606-06-7).
[0069] According to another particular embodiment, the particles contain no other cationic lipids than those of formula I as defined herein.
[0070] Cationic lipids can be used alone or in combination with cholesterol, neutral phospholipids, or other known lipid assembly components. In addition, cationic lipids can be part of derivatized phospholipids, such as the neutral lipid dioleylphosphatidylethanolamine (DOPE) derivatized with polylysine to form cationic lipopolymers.
[0071] According to certain embodiments, the polymer used to make the particles is biocompatible and biodegradable, such as poly(DL-lactide-co-glycolide) polymer (PLGA). However, additional polymers that can be used to make the particles include, but are not limited to, PLA (polylactic acid) and its copolymers, polyanhydrides, polyalkyl-cyanoacrylates (such as polyisobutylcyanoacrylate), polyethylene glycol, polyethylene oxide and its derivatives, chitosan, albumin, gelatin, and the like.
[0072] The particles of the invention may be modified (e.g., by PEGylation) to decrease their clearance, extend their clearance time frame, and increase their circulatory half-life to allow antibody binding. The PEG incorporated into the particles may be characterized by various combinations of chemical composition and / or molecular weight depending on the application and purpose.
[0073] According to some embodiments, the particles comprise one or more PEG derivatives. According to certain embodiments, PEG or PEG derivatives may be attached as lipids. Non-limiting examples of PEG derivatives include PEG-DMG 3-N-(-methoxypoly(ethylene glycol) 2000) carbamoyl-l,2-dimyricylglycerol, PEG-cDMA 3-N-(-methoxypoly(ethylene glycol) 2000) carbamoyl-l,2-dimyristyloxy-propylamine, PEG-cDSA, 3-N-(-methoxypoly(ethylene glycol) 2000) carbamoyl-l,2-distearyloxy-propylamine, DSPE-PEG, PEG-maleimide, DSPE-PEG-maleimide, or combinations thereof.
[0074] According to some embodiments, the lipid phase may comprise about 30-60% (mol) cationic lipid, for example, the cationic lipid may comprise about 40-50% (mol) of the lipid phase.
[0075] In some embodiments, the lipid phase may comprise about 20-70% (mol) of a membrane-stabilizing lipid. For example, about 40-60% of the lipid phase may be membrane-stabilizing lipid. In some embodiments, multiple membrane-stabilizing lipids may be used in the lipid phase. For example, the membrane-stabilizing lipid may comprise cholesterol (about 30-50% (mol) of the lipid phase) and about 5-15% (mol) of a phospholipid (e.g., DSPC, etc.) of the lipid phase.
[0076] According to some embodiments, the lipid phase may comprise about 0.01-3% (mol) of PEG-maleimide (optionally lipid-bound). For example, the PEG-maleimide may comprise about 0.05-0.6% of the lipid mixture.
[0077] According to some embodiments, the additional (lipid-bound) PEG-derivative may comprise about 0.5-10% of the lipid phase composition.
[0078] According to exemplary embodiments, the particles may comprise various mole / mol ratios of cationic lipids (e.g., cationic lipids of Formula I as defined herein), cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG derivatives (e.g., DMG-PEG), and lipid-linked PEG-maleimide (e.g., DSPE-PEG-maleimide). For example, the lipid phase may comprise cationic lipids (e.g., cationic lipids of Formula I as defined herein) / DSPC / Chol / DMG-PEG / DSPE-PEG-maleimide (mol / mol: 50:10.5:38:1.4:0.1).
[0079] According to this embodiment, the particles comprise one or more cationic lipids, which are collectively represented by Formula I below:
[0080] [ka]
[0081] (In the formula, m is 0 or 1, A1 and A2 are each independently a saturated or unsaturated, linear, unbranched alkylene chain at least 8 carbon atoms in length; L1 is a first linking group that is an alkylene of 1 to 4 carbon atoms in length; X is -OC(=O)- or -NH-C(=O); L2 is a second linking group that is alkylene of 1 to 4 carbon atoms in length, and R1 and R2 are each independently hydrogen, alkyl, or cycloalkyl, or R1 and R2 together with the nitrogen to which they are attached form a heteroalicyclic ring; However, when X is -OC(=O)-, m is 1.
[0082] In some embodiments of any of Formula I, X is -OC(=O)- and the cationic lipid is represented by Formula Ia:
[0083] [ka]
[0084] (wherein A1, A2, L1, L2, R1, and R2 are defined as in formula I).
[0085] In some embodiments of Formula Ia, L1 is unsubstituted alkylene.
[0086] In some embodiments of Formula Ia, L1 is alkylene 2 carbon atoms in length.
[0087] In some embodiments of Formula Ia, L1 is an unsubstituted alkylene of 2 carbon atoms in length.
[0088] In some embodiments of any of Formula I, X is -NH-C(=O)-, m is 0, and the cationic lipid is represented by Formula Ib.
[0089] [ka]
[0090] (wherein A1, A2, L2, R1, and R2 are defined as in formula I).
[0091] In some embodiments of any of Formula I, Ia, or Ib, L2 is an alkylene chain 3 carbon atoms in length.
[0092] In some embodiments of any of Formula I, Ia, or Ib, L2 is an unsubstituted alkylene chain.
[0093] In some embodiments of any of Formula I, Ia, or Ib, L2 is an alkylene chain 3 carbon atoms in length and is unsubstituted.
[0094] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of R1 and R2 is alkyl, preferably a short alkyl having a length of 1 to 4 carbon atoms, more preferably methyl.
[0095] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of R1 and R2 is methyl.
[0096] In some embodiments of any of Formula I, Ia, or Ib, each of R1 and R2 is alkyl, and in some embodiments, each of R1 and R2 is methyl.
[0097] In some embodiments of any of Formulas I and Ia, R1 and R2 together form a heteroalicyclic ring.
[0098] The heteroalicyclic ring is preferably a five-, six-, or seven-membered ring, preferably a six-membered ring. The heteroalicyclic ring may contain an additional heteroatom other than the nitrogen to which R and R are attached. In an exemplary embodiment, the additional heteroatom is another nitrogen atom. In an exemplary embodiment, R, R, and N together form a piperazine. -N(R)(R) may alternatively form another heteroalicyclic ring, as exemplified below in the definition of "heteroalicyclic ring."
[0099] In some of the embodiments of any of Formula Ib, each of R1 and R2 is alkyl, and in some embodiments, each of R1 and R2 is methyl.
[0100] In some embodiments of any of Formula I, Ia, or Ib, A1 and A2 can be the same or different, and preferably are the same.
[0101] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an unsaturated alkylene chain.
[0102] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an alkylene chain from 8 to 40, or from 8 to 30, or from 10 to 30, or from 12 to 30, or from 14 to 30 carbon atoms in length.
[0103] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an unsubstituted alkylene chain.
[0104] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an unsubstituted unsaturated alkylene chain.
[0105] In some embodiments of any of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an unsubstituted unsaturated alkylene chain having a length of from 8 to 40, or from 8 to 30, or from 10 to 30, or from 12 to 30, or from 14 to 30 carbon atoms.
[0106] Each of A1 and A2 independently may be a hydrocarbon residue of a fatty acid, which may also be referred to as a fatty acid-derived hydrocarbon, i.e., a hydrocarbon moiety attached to a carboxylic acid in a fatty acid, optionally having an additional methylene group (instead of the carboxylic acid group).
[0107] The fatty acid may be a saturated or unsaturated fatty acid, preferably an unsaturated fatty acid.
[0108] Exemplary fatty acids in the context of these embodiments include, but are not limited to, saturated or unsaturated fatty acids having more than 10 carbon atoms, preferably 12 to 24 carbon atoms, including, but not limited to, myristic acid, lauric acid, palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, and the like.
[0109] When the alkylene chain is unsaturated, it always contains one, two, three or more unsaturated bonds therein, each independently in the cis or trans configuration.
[0110] In exemplary embodiments of Formula I, Ia, or Ib, at least one, preferably both, of A1 and A2 is an unsaturated alkylene having two or more unsaturated bonds, and in some of these exemplary embodiments, each unsaturated bond is in a cis configuration.
[0111] In exemplary embodiments of Formula I, Ia, or Ib, at least one, and preferably both, of A1 and A2 is a residue of linoleic acid, ie, (9Z,12Z)-octadeca-9,12-dienyl.
[0112] An exemplary cationic lipid of Formula Ib is presented herein as Lipid 1.
[0113] An exemplary cationic lipid of Formula Ia, in which R1 and R2 are each methyl, is presented herein as lipid 8.
[0114] An exemplary cationic lipid of Formula Ia, in which R1 and R2 together form a heteroalicyclic ring, is presented herein as lipid 10.
[0115] According to any of the embodiments described herein, any cationic lipid substance of the present invention may be in the form of a salt thereof, e.g., a pharmaceutically acceptable salt.
[0116] As used herein, the phrase "pharmaceutically acceptable salt" refers to a charged species of a parent compound (herein, a cationic lipid described herein, e.g., a cationic lipid of Formula I) and its counterion, and is typically used to alter the solubility characteristics of the parent compound, reduce significant irritation caused by the parent compound in an organism, and / or improve stability, without abrogating the compound's biological activity and properties. Alternatively, pharmaceutically acceptable salts of the compounds described herein can be formed during the synthesis of the compounds, for example, by isolating the compound from a reaction mixture or recrystallizing the compound.
[0117] In some circumstances of the present embodiments, the pharmaceutically acceptable salts of the compounds described herein may optionally be acid addition salts, which comprise at least one basic group (e.g., an amine or amine-containing group) of the compound in positively charged form (e.g., a form in which the basic group is protonated) in combination with at least one counterion derived from a selected base to form a pharmaceutically acceptable salt.
[0118] Thus, the base addition salts of the compounds described herein may be complexes formed with one or more acidic groups of the compound and an equivalent amount of one or more bases.
[0119] Depending on the stoichiometric ratio of charged groups in the compound to counterions in the salt, acid addition salts can be either mono- or poly-addition salts.
[0120] The phrase "mono-addition salt," as used herein, refers to an addition salt in which the stoichiometric ratio of counterion to the charged form of the present compound is 1:1, and which contains one molar equivalent of counterion per one molar equivalent of the present compound.
[0121] The phrase "polyaddition salt," as used herein, refers to an addition salt in which the stoichiometric ratio of counterion to charged form of compound is greater than 1:1, e.g., 2:1, 3:1, 4:1, etc., and which includes two or more molar equivalents of counterion per molar equivalent of compound.
[0122] Examples of pharmaceutically acceptable salts include, but are not limited to, ammonium cations and acid addition salts thereof.
[0123] Acid addition salts may include, but are not limited to, various organic and inorganic acids such as hydrochloric acid to provide hydrochloric acid addition salts, hydrobromic acid to provide hydrobromide acid addition salts, acetic acid to provide acetic acid addition salts, ascorbic acid to provide ascorbic acid addition salts, benzenesulfonic acid to provide besylate addition salts, camphorsulfonic acid to provide camphorsulfonic acid addition salts, citric acid to provide citrate addition salts, maleic acid to provide maleic acid addition salts, malic acid to provide malic acid addition salts, methanesulfonic acid to provide methanesulfonic acid (mesylate) addition salts, naphthalenesulfonic acid to provide naphthalenesulfonic acid addition salts, oxalic acid to provide oxalic acid addition salts, phosphoric acid to provide phosphoric acid addition salts, toluenesulfonic acid to provide p-toluenesulfonic acid addition salts, succinic acid to provide succinic acid addition salts, sulfuric acid to provide sulfuric acid addition salts, tartaric acid to provide tartaric acid addition salts, and trifluoroacetic acid to provide trifluoroacetic acid addition salts. Each of these acid addition salts may be either a mono- or poly-addition salt, as defined herein.
[0124] Embodiments of the present invention further include any and all enantiomers, diastereomers, prodrugs, solvates, hydrates, and / or pharmaceutically acceptable salts of the compounds described herein (e.g., the cationic lipids of Formula I described herein).
[0125] The term "enantiomer," as used herein, refers to a stereoisomer of a compound that can be superimposed on its corresponding structure only by complete inversion / reflection (mirror image) of each other. Enantiomers are said to be "chiral" because they are described as being like right and left hands. Enantiomers have the same chemical and physical properties except when present in an environment that is chiral to itself (e.g., any biological system). In embodiments of the present invention, a compound may have one or more chiral centers, each of which may be in the R or S configuration, or any combination. Compounds according to some embodiments of the present invention may have any chiral center that exhibits the R or S configuration.
[0126] The term "diastereomers," as used herein, refers to stereoisomers that are not enantiomers of one another. Two or more stereoisomers of a compound exhibit diastereomeric properties when they have different configurations at one or more, but not all, of their equivalent (related) stereocenters and are not mirror images of one another. When two diastereoisomers differ from each other at only one stereocenter, they are epimers. Each stereocenter (chiral center) results in two different configurations, and therefore two different stereoisomers. In the context of the present invention, embodiments of the present invention encompass compounds with multiple chiral centers, occurring in any combination of configurations, i.e., any diastereomers.
[0127] The term "prodrug" refers to an agent that is converted into an active compound (the active parent drug) in vivo. Prodrugs are typically useful for facilitating administration of the parent drug. They may be bioavailable, for example, by oral administration, whereas the parent drug is not. Prodrugs may also have improved solubility compared to the parent drug in pharmaceutical compositions. Prodrugs are also often used to achieve sustained release of the active compound in vivo. Examples of prodrugs include, but are not limited to, compounds of the invention bearing one or more carboxylic acid moieties that are administered as esters ("prodrugs"). Such prodrugs are hydrolyzed in vivo to yield the free compound (the parent drug). The selected ester can affect both the solubility properties and the rate of hydrolysis of the prodrug.
[0128] The term "solvate" refers to a complex of variable stoichiometry (e.g., di-, tri-, tetra-, penta-, hexa-, etc.) formed by a solute (a compound described herein) and a solvent, where the solvent does not interfere with the biological activity of the solute. Suitable solvents include, for example, ethanol, acetic acid, etc.
[0129] The term "hydrate" refers to a solvate as described above wherein the solvent is water.
[0130] Throughout this application, the phrase "linking moiety" or "linking group" refers to a group that joins two or more moieties or groups in a compound. Linking moieties are typically derived from difunctional or trifunctional compounds and can be considered biradical or triradical moieties that are connected to two or three other moieties by two or three atoms, respectively.
[0131] Exemplary linking moieties include hydrocarbon moieties or chains, optionally interrupted by one or more heteroatoms as defined herein, and / or chemical groups defined below as linking groups.
[0132] When a chemical group is referred to herein as a "terminal group," it is understood to be a substituent that is attached to another group by one atom contained therein.
[0133] Throughout this application, the term "hydrocarbon" collectively refers to chemical groups composed primarily of carbon and hydrogen atoms. Hydrocarbons may include alkyl, alkene, alkyne, aryl, and / or cycloalkyl, each substituted or unsubstituted, and may contain one or more heteroatoms. The number of carbon atoms may range from 2 to 20, preferably in a lower range, such as 1 to 10, or 1 to 6, or 1 to 4. The hydrocarbon may be a linking group or a terminal group.
[0134] The term "amine," as used herein, refers to the groups --NR'R" and --NR'--, where R' and R" are independently hydrogen, alkyl, cycloalkyl, or aryl, as these terms are defined herein.
[0135] Thus, the amine group can be a primary amine where R' and R" are both hydrogen, a secondary amine where R' is hydrogen and R" is alkyl, cycloalkyl, or aryl, or a tertiary amine where each of R' and R is independently alkyl, cycloalkyl, or aryl.
[0136] Alternatively, R' and R" can each independently be hydroxyalkyl, trihaloalkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, heteroalicyclic, amine, halide, sulfonate, sulfoxide, phosphonate, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, cyano, nitro, azo, sulfonamide, carbonyl, C-carboxylate, O-carboxylate, N-thiocarbamate, O-thiocarbamate, urea, thiourea, N-carbamate, O-carbamate, C-amide, N-amide, guanyl, guanidine, and hydrazine.
[0137] Further alternatively, R′ and R″ together form a nitrogen-containing heteroalicyclic ring.
[0138] The amine groups described herein may be in the protonated form or the ammonium form as described herein.
[0139] The term "alkyl" refers to saturated aliphatic hydrocarbons, including straight-chain and branched-chain groups. Preferably, alkyl groups have 1 to 30, or 1 to 20, carbon atoms. When a numerical range is mentioned herein, such as "1 to 20," this range means that the substituent, in this case the alkyl group, can contain 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to 20 carbon atoms. Alkyl groups can be substituted or unsubstituted.
[0140] An alkyl group may be a terminal group, as defined above, in which case it is attached to a single adjacent atom, or it may be a linking group, as defined above, in which case it is attached to two or more moieties through at least two carbons in the chain. When alkyl is a linking group, it is also referred to herein as an "alkylene" or "alkylene chain."
[0141] As used herein, an "alkene" or "alkyne" is an alkyl, as defined herein, that contains at least one double or triple bond, respectively.
[0142] The term "cycloalkyl" refers to an all-carbon monocyclic or fused ring group (i.e., rings which share adjacent pairs of carbon atoms) in which one or more of the rings does not have a completely conjugated pi-electron system. Examples include, but are not limited to, cyclohexane, adamantane, norbornyl, isobornyl, and the like. Cycloalkyl groups can be substituted or unsubstituted.
[0143] A cycloalkyl group may be a terminal group, as defined above, in which case it is attached to one adjacent atom, or it may be a linking group, as defined above, in which case it is attached to two or more moieties at two or more positions.
[0144] The term "heteroalicyclic group" refers to a monocyclic or fused ring group having one or more atoms, such as nitrogen, oxygen, and sulfur, in the ring(s). The ring may also have one or more double bonds. However, the ring does not have a completely conjugated π-electron system. Representative examples are piperidine, piperazine, tetrahydrofuran, tetrahydropyran, morpholino, oxalidine, etc.
[0145] Heteroalicyclic groups can be substituted or unsubstituted. Heteroalicyclic groups can be terminal groups, as defined above, in which case they are attached to a single adjacent atom, or linking groups, as defined above, in which case they are attached to two or more moieties at two or more positions.
[0146] The term "aryl" refers to an all-carbon monocyclic or fused-ring polycyclic group (i.e., rings which share adjacent pairs of carbon atoms) having a completely conjugated π-electron system. Aryl groups can be substituted or unsubstituted. An aryl group can be a terminal group, as defined above, in which case it is bonded to a single adjacent atom, or a linking group, as defined above, in which case it is bonded to two or more moieties at two or more positions.
[0147] The term "heteroaryl" refers to a monocyclic or fused ring group (i.e., rings that share adjacent pairs of carbon atoms) containing one or more atoms in the ring(s) and a completely conjugated π-electron system. Examples of heteroaryl groups include, but are not limited to, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine, pyrimidine, quinoline, isoquinoline, and purine. A heteroaryl group may be a terminal group, as defined above, in which case it is bonded to an adjacent atom, or a linking group, as defined above, in which case it is bonded to two or more moieties at two or more positions. Representative examples are pyridine, pyrrole, oxazole, indole, purine, and the like.
[0148] Any amine groups described herein are shown in their free base form, but are also meant to encompass their ionized form at physiological pH and / or their salt forms, e.g., the pharmaceutically acceptable salt forms described herein.
[0149] Alkyl, cycloalkyl, aryl, alkaryl, heteroaryl, heteroalicyclic, acyl, and any other moiety described herein, when substituted, always contain one or more substituents, which may each independently be, but are not limited to, hydroxy, alkoxy, thiohydroxy, thioalkoxy, aryloxy, thioaryloxy, alkaryl, alkenyl, alkynyl, sulfonate, sulfoxide, thiosulfate, sulfate, sulfite, thiosulfite, phosphonate, cyano, nitro, azo, sulfonamido, carbonyl, thiocarbonyl, C-carboxylate, O-carboxylate, N-thiocarbamate, O-thiocarbamate, oxo, thiooxo, oxime, acyl, acyl halide, azo, azide, urea, thiourea, N-carbamate, O-carbamate, C-amido, N-amido, guanyl, guanidyl, hydrazine, and hydrazide, as these terms are defined herein.
[0150] The terms "halide" and "halo" refer to fluorine, chlorine, bromine, or iodine.
[0151] The term "haloalkyl" refers to an alkyl group, as defined above, substituted with one or more halide groups.
[0152] The term "sulfite" refers to an -OS(=O)2-OR' terminal group, as defined herein above, or an -OS(=O)2-O- linking group, as defined herein above, where R' is as defined herein above.
[0153] The term "thiosulfate" refers to an -OS(=S)(=O)-OR' terminal group or an -OS(=S)(=O)-O- linking group, both of which phrases are defined herein above, where R' is defined herein above.
[0154] The term "sulfite" refers to a linking group that is an -OS(=O)-O-R' terminal group or an -OS(=O)-O- group, where these phrases are as defined hereinabove, and where R' is as defined hereinabove.
[0155] The term "thiosulfite" refers to a linking group that is an -OS(=S)-O-R' terminal group or an -OS(=S)-O- group, where these phrases are as defined hereinabove, and where R' is as defined hereinabove.
[0156] The term "sulfinate" refers to a linking group that is an -S(=O)-OR' terminal group or an -S(=O)-O- group, where these phrases are as defined hereinabove, and where R' is as defined hereinabove.
[0157] The term "sulfoxide" or "sulfinyl" refers to an -S(=O)R' terminal group or an -S(=O)- linking group, where R' is as defined hereinabove.
[0158] The term "sulfonate" refers to an -S(=O)2-R' terminal group or an -S(=O)2- linking group, as these phrases are defined herein above, where R' is as defined herein.
[0159] The term "S-sulfonamido" refers to an -S(=O)2-NR'R" terminal group or an -S(=O)2-NR'- linking group, where these phrases are as defined herein above and R' and R" are as defined herein.
[0160] The term "N-sulfonamido" refers to an R'S(=O)2-NR"- terminal group or an -S(=O)2-NR'- linking group, where these phrases are as defined herein above, and where R' and R" are as defined herein.
[0161] The term "disulfide" refers to an --S--SR' terminal group or an --SS-- linking group, these phrases being as defined herein above, where R' is as defined herein.
[0162] The term "phosphonate" refers to a -P(=O)(OR')(OR") terminal group or a -P(=O)(OR')(O)- linking group, as these terms are defined herein above, where R' and R" are as defined herein.
[0163] The term "thiophosphonate" refers to a -P(=S)(OR')(OR") terminal group or a -P(=S)(OR')(O)- linking group, as these terms are defined herein above, where R' and R" are as defined herein.
[0164] The term "phosphinyl" refers to a -PR'R" terminal group or a -PR'- linking group, where these phrases are as defined herein above and R' and R" are as defined herein.
[0165] The term "phosphine oxide" refers to a -P(=O)(R')(R") terminal group or a -P(=O)(R')- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0166] The term "phosphine sulfide" refers to a -P(=S)(R')(R") terminal group or a -P(=S)(R')- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0167] The term "phosphite" refers to an -O-PR'(=O)(OR") terminal group or an -O-PH(=O)(O)- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0168] The term "carbonyl" or "carbonate," as used herein, refers to a -C(=O)-R' terminal group or a -C(=O)- linking group, as these phrases are defined herein above, where R' is as defined herein.
[0169] The term "thiocarbonyl," as used herein, refers to a -C(=S)-R' terminal group or a -C(=S)- linking group, where these phrases are as defined herein above, and where R' is as defined herein.
[0170] The term "oxo," as used herein, represents the (=O) group, where the oxygen atom is connected to an atom (eg, a carbon atom) with a double bond at the indicated position.
[0171] The term "thioxo," as used herein, represents the (=S) group, where the sulfur atom is connected to an atom (eg, a carbon atom) with a double bond at the indicated position.
[0172] The term "oxime" refers to an =N-OH terminal group or an =NO- linking group, as these phrases are defined herein above.
[0173] The term "hydroxy" refers to the group --OH.
[0174] The term "alkoxy" refers to both an --O-alkyl and an --O-cycloalkyl group, as defined herein.
[0175] The term "aryloxy" refers to both an --O-aryl and an --O-heteroaryl group, as defined in this Application.
[0176] The term "thiohydroxy" refers to the group --SH.
[0177] The term "thioalkoxy" refers to both an --S-alkyl group and an --S-cycloalkyl group, as defined herein.
[0178] The term "thioaryloxy" refers to both an --S-aryl and an --S-heteroaryl group, as defined in this Application.
[0179] The term "hydroxyalkyl," also referred to herein as "alcohol," refers to an alkyl, as defined herein, substituted with a hydroxyl group.
[0180] The term "cyano" refers to the group --C.ident.N.
[0181] The term "isocyanate" refers to the group --N.dbd.C.dbd.O.
[0182] The term "isothiocyanate" refers to the group --N.dbd.C.dbd.S.
[0183] The term "nitro" refers to the group --NO.sub.2.
[0184] The term "acyl halide" refers to the group --(C.dbd.O)R'''' where R'''' is a halide as defined hereinabove.
[0185] The terms "azo" or "diazo" refer to an -N=NR' terminal group or an -N=N- linking group, where these phrases are as defined hereinabove, and where R' is as defined hereinabove.
[0186] The term "peroxo" refers to an -O-OR' terminal group or an -OO- linking group, both of which phrases are as defined hereinabove, where R' is as defined hereinabove.
[0187] The term "carboxylate" as used herein includes C-carboxylates and O-carboxylates.
[0188] The term "C-carboxylate" refers to a -C(=O)-OR' terminal group or a -C(=O)-O- linking group, both of which phrases are defined herein above, where R' is as defined herein.
[0189] The term "O-carboxylate" refers to an -OC(=O)R' terminal group or an -OC(=O)- linking group, as these phrases are defined herein above, where R' is as defined herein.
[0190] Carboxylate may be linear or cyclic. In the cyclic case, R' and a carbon atom are linked together to form a ring in the C-carboxylate, and this group is also called a lactone. Alternatively, R' and O are linked together to form a ring in the O-carboxylate. Cyclic carboxylates can function as linking groups, for example, when an atom in the formed ring is linked to another group.
[0191] The term "thiocarboxylate" as used herein includes C-thiocarboxylates and O-thiocarboxylates.
[0192] The term "C-thiocarboxylate" refers to a -C(=S)-OR' terminal group or a -C(=S)-O- linking group, as these phrases are defined herein above, where R' is as defined herein.
[0193] The term "O-thiocarboxylate" refers to an -OC(=S)R' terminal group or an -OC(=S)- linking group, as these phrases are defined herein above, where R' is as defined herein.
[0194] Thiocarboxylates may be linear or cyclic. In the cyclic case, R' and a carbon atom are linked together to form a ring in the C-thiocarboxylate, and the group is also referred to as a thiolactone. Alternatively, R' and O are linked together to form a ring in the O-thiocarboxylate. Cyclic thiocarboxylates can function as linking groups, for example, when an atom in the formed ring is linked to another group.
[0195] The term "carbamate" as used herein includes N-carbamates and O-carbamates.
[0196] The term "N-carbamate" refers to an R"OC(=O)-NR'- terminal group or an -OC(=O)-NR'- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0197] The term "O-carbamate" refers to an -OC(=O)-NR'R" terminal group or an -OC(=O)-NR'- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0198] Carbamates may be linear or cyclic. When cyclic, R' and a carbon atom are linked together to form a ring in an O-carbamate. Alternatively, R' and O are linked together to form a ring in an N-carbamate. Cyclic carbamates can function as linking groups, for example, when an atom in the formed ring is linked to another group.
[0199] The term "carbamate" as used herein includes N-carbamates and O-carbamates.
[0200] The term "thiocarbamate" as used herein includes N-thiocarbamates and O-thiocarbamates.
[0201] The term "O-thiocarbamate" refers to an -OC(=S)-NR'R" terminal group or an -OC(=S)-NR'- linking group, where these phrases are as defined herein above and R' and R" are as defined herein.
[0202] The term "N-thiocarbamate" refers to an R"OC(=S)NR'- terminal group or an -OC(=S)NR'- linking group, as these terms are defined herein above, where R' and R" are as defined herein.
[0203] The thiocarbamates may be linear or cyclic, as described herein for carbamates.
[0204] The term "dithiocarbamate" as used herein includes S-dithiocarbamates and N-dithiocarbamates.
[0205] The term "S-dithiocarbamate" refers to an -SC(=S)-NR'R" terminal group or an -SC(=S)NR'- linking group, where these phrases are as defined herein above and R' and R" are as defined herein.
[0206] The term "N-dithiocarbamate" refers to an R"SC(=S)NR'- terminal group or an -SC(=S)NR'- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0207] The term "urea," also referred to herein as "ureido," refers to an -NR'C(=O)-NR"R'" terminal group or an -NR'C(=O)-NR"- linking group, as these phrases are defined herein above, where R' and R" are as defined herein and R'" is as defined herein for R' and R".
[0208] The term "thiourea," also referred to herein as "thioureido," refers to an -NR'-C(=S)-NR"R'" terminal group or an -NR'-C(=S)-NR"- linking group, where R', R" and R'" are as defined herein.
[0209] The term "amide" as used herein includes C-amide and N-amide.
[0210] The term "C-amido" refers to a -C(=O)-NR'R" terminal group or a -C(=O)-NR'- linking group, where these phrases are as defined herein above, and where R' and R" are as defined herein.
[0211] The term "N-amido" refers to an R'C(=O)-NR"- terminal group or an R'C(=O)-N- linking group, as these phrases are defined herein above, where R' and R" are as defined herein.
[0212] The amide may be linear or cyclic. In the cyclic case, R' and the carbon atom are linked together to form a ring in the form of a C-amide, and this group is also called a lactam. The cyclic amide can function as a linking group, for example, when the atom in the formed ring is linked to another group.
[0213] The term "guanyl" refers to the R'R"NC(=N)-terminus or -R'NC(=N)- linking group defined above, where R' and R" are as defined herein.
[0214] The term "guanidine" refers to the R'NC(=N)-NR"R'" terminal group or the -R'NC(=N)-NR"- linking group as defined above, where R', R" and R'" are as defined herein.
[0215] The term "hydrazine" refers to an -NR'-NR"R'" terminal group or an -NR'-NR"- linking group, where these phrases are as defined herein above, and where R', R", and R'" are as defined herein.
[0216] As used herein, the term "hydrazide" refers to a -C(=O)-NR'-NR"R'" terminal group or a -C(=O)-NR'-NR"- linking group, where these phrases are as defined herein above and where R', R" and R'" are as defined herein.
[0217] As used herein, the term "thiohydrazide" refers to a -C(=S)-NR'-NR"R'" terminal group or a -C(=S)-NR'-NR"- linking group, where these terms are as defined herein above and where R', R" and R'" are as defined herein.
[0218] As used herein, the term "acyl" refers to the group --C(.dbd.O)--R, where R is as defined herein.
[0219] As used herein, the term "acyl" refers to the group --C(.dbd.O)--R, where R is a substituted or unsubstituted alkyl, cycloalkyl, aryl, alkaryl, hydrocarbon chain, or hydrogen.
[0220] According to certain embodiments, the particles comprise a detectable moiety.
[0221] According to certain embodiments, the method includes binding a detectable moiety to a particle.
[0222] Examples of detectable moieties that can be used in the present invention include radioisotopes, phosphorescent chemicals, chemiluminescent chemicals, fluorescent chemicals, enzymes, fluorescent polypeptides, and radioisotopes (
[0125] Examples of detectable moieties include, but are not limited to, iodine. The detectable moiety can be a member of a binding pair that can be distinguished through interaction with the other member of the binding pair, or a label that can be directly visualized. In one example, the label is a fluorescent protein or an enzyme that produces a colorimetric reaction.
[0223] Examples of suitable fluorescent dyes include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FITC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas Red, PE-Cy5, and the like. Guidelines for selecting fluorescent dyes and binding them to various molecules are provided in Richard P. Haugland, "Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992-1994," 5th ed., Molecular Probes, Inc. (1994), U.S. Patent No. 6,037,137 to Oncoimmunin Inc., Hermanson, "Bioconjugate Techniques," Academic Press New York, NY (1995), Kay M. et al., 1995. Biochemistry 34:293, Stubbs et al., 1996. Biochemistry 35:937, Gakamsky D. et al., "Evaluating Receptor Stoichiometry by Fluorescence Resonance Energy Transfer," in "Receptors: A Practical Approach," 2nd ed., Stanford C. and Horton R. (eds.), Oxford University Press, UK. (2001), and U.S. Patent No. 6,350,466 to Targesome, Inc. Fluorescence detection methods that can be used to detect antibodies when conjugated to a fluorescently detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in situ hybridization (FISH), and fluorescence resonance energy transfer (FRET).
[0224] Further examples of detectable moieties include molecules detectable by positron emission tomography (PET) or magnetic resonance imaging (MRI), which are well known to those skilled in the art.
[0225] According to certain embodiments, the particles comprise a targeting moiety.
[0226] According to certain embodiments, the method includes binding a targeting moiety to a particle.
[0227] As used herein, the term "targeting moiety" refers to a functional group that functions to target or direct the particles described herein or compositions comprising same to a particular cell type (e.g., cancer cells). Such targeting moieties include, but are not limited to, antibodies, cell surface receptors, ligands, hormones, lipids, sugars, and dextrans.
[0228] According to certain embodiments, the targeting moiety is an antibody.
[0229] Methods for attaching detectable or target moieties to particles are known in the art and are described in the Examples section below and further disclosed, for example, in WO 2018 / 015881, U.S. Pat. Nos. 5,171,578, 5,204,096, and 5,258,499, the contents of which are incorporated herein by reference in their entireties.
[0230] The lipid particles disclosed herein encapsulate a nucleic acid sequence that encodes a protein.
[0231] Encapsulation of nucleic acid sequences into particles can be carried out simultaneously with or subsequent to particle assembly and is described by known methods, such as those described in the Examples section below, or as disclosed, for example, in Ramishetti et al. Adv Mater. 2020 Jan 30:e1906128, WO 2018 / 015881, WO 2018 / 087753, WO 2017 / 194454, and U.S. Patent Application Publication No. 2013 / 0245107, the contents of which are incorporated herein by reference in their entirety.
[0232] Any suitable particle:nucleic acid sequence ratio is contemplated in some embodiments of the present invention. According to particular embodiments, the particle:nucleic acid sequence ratio (w / w) may be from about 1:1 to about 50:1, from about 2:1 to about 30:1, from about 5:1 to about 100:1, from about 10:1 to about 40:1, or from about 15:1 to about 25:1. According to particular embodiments, the particle:nucleic acid sequence ratio (w / w) is 10:1.
[0233] As used herein, the term "nucleic acid sequence" or "polynucleotide" refers to a single-stranded or double-stranded nucleic acid sequence isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a DNA sequence, a genomic polynucleotide sequence, and / or a composite polynucleotide sequence (e.g., a combination of the above). According to certain embodiments, the nucleic acid sequence is a messenger RNA (mRNA) sequence.
[0234] To express an exogenous protein in a mammalian cell, the nucleic acid sequence encoding the protein typically includes regulatory sequences suitable for mammalian cell expression.
[0235] Thus, for example, when transcription of a nucleic acid sequence is desired, the nucleic acid sequence is preferably ligated to a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence constitutively or inducibly within the cell. The nucleic acid construct may also include additional sequences (e.g., shuttle vectors) that make it suitable for replication and integration in prokaryotes, eukaryotes, or preferably both. In addition, a typical construct may include transcription and translation initiation sequences, transcription and translation termination sequences, and a polyadenylation signal. For example, such a construct typically has a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or portion thereof.
[0236] Alternatively, or in addition, the nucleic acid sequence may include regulatory sequences such as ribosome binding site sequences, initiation codons and in-frame stop codons, so that the nucleic acid sequence is required for translation.
[0237] Additionally, the nucleic acid sequence may include a nucleic acid sequence encoding a selection marker, a reporter protein, an internal ribosome entry site (IRES), and the like.
[0238] Constructs useful in the methods of some embodiments of the present invention may be constructed using recombinant techniques well known to those skilled in the art.
[0239] The nucleic acid sequence may contain modifications, for example, to increase RNA stability and minimize immunogenicity, including 5-methoxyuridine, pseudouridine, 5-methylcytidine, N6-methyladenosine, 2'-O-methyl, 2'-O-methyl 3' phosphorothioate, 2'-O-methyl 3' phosphonoacetate, and locked nucleic acids (LNA).
[0240] The protein encoded by the nucleic acid sequence is at least 500 amino acids in length.
[0241] According to specific embodiments, the protein is at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300 amino acids in length, each possibility representing a separate embodiment of the present invention.
[0242] According to a particular embodiment, the protein is at least 1000 amino acids in length.
[0243] The protein may be a single unit protein or a multi-unit protein.
[0244] The protein may be a naturally occurring protein, a synthetic (ie, artificial), a fusion protein, or a chimeric protein.
[0245] Non-limiting examples of proteins include enzymes, transcription factors, regulatory proteins, conserved proteins, structural proteins, antibodies, transcription factors, hormones, growth factors, housekeeping proteins and inducible proteins.
[0246] According to certain embodiments, the protein is not an antibody.
[0247] According to certain embodiments, the protein is an enzyme, non-limiting examples of which include nucleases, proteases, kinases, helicases, integrases, transferases, reductases, hydrolases, lyases, and isomerases.
[0248] According to certain embodiments, the protein is a genome-editing endonuclease.
[0249] Genome editing using engineered endonucleases refers to a reverse genetic method that uses artificially modified nucleases to cleave at desired locations in the genome, resulting in specific double-strand breaks, which are then repaired by cell-intrinsic processes such as homologous sequence-dependent repair (HDR) and non-homologous end joining (NHEJF). While NHEJF directly joins the DNA ends at the double-strand break, HDR utilizes a homologous donor sequence as a template to regenerate the missing DNA sequence at the break. To introduce specific nucleotide modifications into genomic DNA, HDR requires the presence of a donor DNA repair template containing the desired sequence.
[0250] Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes target only a few base pairs in DNA, and these sequences are often found at numerous locations throughout the genome, resulting in multiple cuts that are not limited to the desired location. To overcome this challenge and create site-specific single- or double-stranded cuts, several different classes of nucleases have been discovered and bioengineered. These nucleases include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems.
[0251] Meganucleases: Meganucleases are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that affect catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases differ significantly from each other in terms of conserved structural elements and, as a result, DNA recognition sequence specificity and catalytic activity. Meganucleases are generally found in microbial species and have the unique property of having very long recognition sequences (>14 bp), which allows for highly specific cleavage at the desired site.
[0252] This can be used to create site-specific double-strand breaks in genome editing.Those skilled in the art can use these natural meganucleases, but the number of such natural meganucleases is limited.To overcome this problem, mutation introduction and high-throughput screening methods have been used to create variant meganucleases that recognize unique sequences.For example, various meganucleases have been fused to create hybrid enzymes that recognize new sequences.
[0253] Alternatively, the amino acids of meganucleases that interact with DNA can be modified to design sequence-specific meganucleases (see, for example, U.S. Patent No. 8,021,867). Meganucleases can be designed using methods described, for example, in Certo, MT et al. Nature Methods (2012) 9:073-975, U.S. Patent Nos. 8,304,222, 8,021,867, 8,119,381, 8,124,369, 8,129,134, 8,133,697, 8,143,015, 8,143,016, 8,148,098, or 8,163,514. Alternatively, meganucleases with site-specific cleavage properties can be obtained using commercially available technologies, such as Precision Biosciences' Directed Nuclease Editor™ genome editing technology.
[0254] ZFNs and TALENs: Two different types of engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven effective in creating targeted double-strand breaks ( Christian et al., 2010 , Kim et al., 1996 , Li et al., 2011 , Mahfouz et al., 2011 , Miller et al., 2010 ).
[0255] Essentially, ZFN and TALEN restriction endonuclease technologies utilize a nonspecific DNA-cleaving enzyme linked to a specific DNA-binding domain (a series of zinc finger domains or TALE repeat sequences, respectively). Typically, a restriction enzyme is selected in which the DNA recognition site and cleavage site are separated from each other. By separating the cleavage site and then linking it to the DNA-binding domain, an endonuclease with extremely high specificity for the desired sequence is obtained. An exemplary restriction enzyme with such properties is Fokl. Furthermore, Fokl has the advantage that it must form a dimer to have nuclease activity, meaning that each nuclease partner recognizes a unique DNA sequence, significantly increasing specificity. To enhance this effect, Fokl nucleases have been engineered to function only as heterodimers, enhancing catalytic activity. A heterodimeric functional nuclease avoids the possibility of undesired homodimer activity, thereby enhancing the specificity of double-strand cleavage.
[0256] Therefore, for example, to target a specific site, ZFN and TALEN are constructed as a nuclease pair, each of which is designed to bind to the adjacent sequence of the target site.When the nuclease binds to the target site during transient expression in cells, the FokI domain forms a heterodimer, resulting in double-strand breaks.The repair of these double-strand breaks by non-homologous end joining (NHEJ) pathway often results in small deletions or small sequence insertions.Since each repair performed by NHEJ is unique, the use of a single nuclease pair can generate a series of alleles with various different deletions at the target site.
[0257] Deletions are typically of any length, ranging from a few base pairs to several hundred base pairs; however, larger deletions have been successfully created in cell culture by simultaneously using two pairs of nucleases (Carlson et al., 2012; Lee et al., 2010). Furthermore, when a DNA fragment with homology to the target region is introduced along with the nuclease pair, the double-strand break can be repaired by homology-dependent repair, resulting in specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).
[0258] Although the nuclease moieties of ZFNs and TALENs share similar properties, these modified nucleases differ in their DNA recognition peptides. ZFNs utilize Cys2-His2 zinc fingers, while TALENs utilize TALEs. Both of these DNA recognition peptide domains share the characteristic that they are naturally found in combination with proteins. Cys2-His2 zinc fingers are typically repeated at 3 bp intervals and have been found in a variety of combinations with various proteins that interact with nucleic acids. TALEs, on the other hand, are found in repeats with a one-to-one recognition ratio between amino acids and recognized nucleotide pairs. Because both zinc fingers and TALEs occur in a repeat pattern, various combinations can be tested to create diverse sequence specificities. Approaches for generating site-specific zinc finger endonucleases include, among others, modular assembly (sequentially linking zinc fingers associated with triplet sequences to cover the desired sequence), OPEN (low stringency selection of peptide domains and triplet nucleotides, followed by high stringency selection of peptide combinations and the final target in a bacterial system), and one-hybrid screening of bacterial zinc finger libraries. ZFNs can be engineered or commercially available, for example, from Sangamo Biosciences™ (Richmond, Calif.).
[0259] The method of designing and obtaining TALEN is described, for example, in Reyon et al. Nature Biotechnology 2012 May, 30(5):460-5, Miller et al. Nat Biotechnol. (2011) 29:143-148, Cermak et al. Nucleic Acids Research (2011) 39(12):e82 and Zhang et al. Nature Biotechnology (2011) 29(2):149-53. A web-based program called Mojo Hand has recently been developed by Mayo Clinic to design TAL constructs and TALEN constructs for genome editing (accessible at www.talendesign.org). TALEN can be designed or commercially obtained, for example, from Sangamo Biosciences (Richmond, California).
[0260] CRISPR-Cas system (also referred to herein as "CRISPR"): Many bacteria and archaea contain an endogenous RNA-based adaptive immune system that can degrade the nucleic acids of invading phages and plasmids. The system consists of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce the RNA component and CRISPR-associated (Cas) genes that encode the protein component. CRISPR RNA (crRNA) contains short stretches of homology to specific viral and plasmid DNA and acts as a guide to direct Cas nucleases to degrade the corresponding pathogen's complementary nucleic acid. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes have shown that three components, the Cas nuclease, the crRNA containing 20 base pairs of homology to the target sequence, and the trans-activating crRNA (tracrRNA), form an RNA / protein complex that, when combined, is sufficient for sequence-specific nuclease activity (Jinek et al. Science (2012) 337:816-821).
[0261] Furthermore, it has been demonstrated that synthetic chimeric single guide RNAs (sgRNAs) composed of a fusion between crRNA and tracrRNA can direct Cas to cleave target DNA complementary to the crRNA in vitro, and transient expression of Cas in conjunction with synthetic gRNAs can produce targeted double-strand breaks in various species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a,b; Jinek et al., 2013; Mali et al., 2013).
[0262] The CRISPR / Cas system for genome editing contains two distinct components: a gRNA and an endonuclease (e.g., Cas).
[0263] Non-limiting examples of CRISPR nucleases include Cas9, Cas12a, Cas12b, Cas12e, Cas13a, Cas13b, Cas14, CasX and CasY. Thus, according to certain embodiments, the genome editing endonuclease is a CRISPR-associated endonuclease, such as Cas9, Cas12a, Cas12b, Cas12e, Cas13a, Cas13b, Cas14, CasX or CasY endonuclease.
[0264] According to certain embodiments, the genome editing endonuclease is Cas9.
[0265] The Cas9 nuclease has two functional domains, RuvC and HNH, each of which cleaves a different DNA strand, and when both domains are active, Cas9 creates a double-strand break in genomic DNA.
[0266] RuvC - or HNH -Modified Cas9 enzymes containing a single inactive catalytic domain (either of the above) are called "nickases." Cas9 nickases with only one active nuclease domain cleave only one strand of the target DNA, generating a single-strand break or "nick." Single-strand breaks or nicks are typically rapidly repaired by the HDR pathway, which uses the intact complementary DNA strand as a template. However, nicks on two adjacent, opposing strands introduced by Cas9 nickases are treated as double-strand breaks and are often referred to as "double-nick" CRISPR systems. Double nicks can be repaired by either NHEJ or HDR, depending on the desired effect on the target gene. Therefore, when specificity and reduced off-target effects are critical, designing two gRNAs whose target sequences are located in close proximity and on opposite strands of genomic DNA and then using Cas9 nickases to generate double nicks reduces off-target effects. However, nicks generated by only one gRNA alone do not result in changes to genomic DNA.
[0267] According to a particular embodiment, the Cas9 is Streptococcus pyogenes Cas9.
[0268] According to certain embodiments, the nucleic acid sequence encoding Cas9 comprises chemical modifications such as 5-methoxyuridine and CleanCap.
[0269] Nucleic acid sequences encoding Cas9 are commercially available, for example, from Trilink Biotenologies Inc.
[0270] Non-limiting examples of nucleic acid sequences encoding Cas9 that can be used in this disclosure include SEQ ID NO:4.
[0271] The sgRNA encodes a target homologous sequence (crRNA) combined with an endogenous bacterial RNA (tracrRNA) that links the crRNA to the Cas nuclease as a single chimeric transcript. The sgRNA / Cas complex is recruited to the target sequence through base pairing between the gRNA sequence and complementary genomic DNA. For Cas to successfully bind, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. Binding of the sgRNA / Cas complex localizes Cas to the genomic target sequence, allowing it to cleave both strands of DNA and create a double-stranded break. Similar to ZFNs and TALENs, the double-stranded break generated by CRISPR / Cas can undergo homologous recombination or NHEJ and is susceptible to specific sequence modifications during DNA repair.
[0272] A major advantage of CRISPR / Cas is that the system combines high efficiency with the ability to easily generate synthetic sgRNAs. This advantage results in a system that can be easily modified to target modifications at different genomic sites and / or to target different modifications at the same site. Furthermore, protocols have been established that allow for simultaneous targeting of multiple genes. Most cells carrying mutations have biallelic mutations in the targeted genes.
[0273] However, apparent flexibility in base-pairing interactions between the sgRNA sequence and the genomic DNA target sequence allows Cas to cleave even imperfect matches to the target sequence.
[0274] There are many publicly available tools to help select and / or design target sequences, as well as bioinformatically determined lists of unique gRNAs for various genes in various species, such as Target Finder from the Feng Zhang lab, Target Finder (E-CRISP) from the Michael Boutros lab, RGEN Tools:Cas-OFFinder, CasFinder: A Flexible Algorithm for Identifying Specific Cas9 Targets in Genomes, and CRISPR Optimal Target Finder.
[0275] As described above in this application, to use some genome editing systems (e.g., CRISPR / Cas systems), both a genome editing endonuclease (e.g., Cas9) and a nucleic acid sequence (e.g., gRNA) that guides the genome editing endonuclease to a gene of interest must be expressed in the target cell. Thus, according to certain embodiments, the lipid particle further encapsulates a nucleic acid sequence (e.g., sgRNA in a CRISPR system) that guides the genome editing endonuclease to a gene of interest.
[0276] According to certain embodiments, the method includes encapsulating a nucleic acid sequence (e.g., an sgRNA in a CRISPR system) that directs a genome-editing endonuclease to a gene of interest in a lipid particle.
[0277] Non-limiting examples of genes of interest include survival genes (e.g., KRAS, BCL-2 family genes, BRAF, KPNB1, PCNA, KIF11, NIK, TOP2A), pro-inflammatory genes (e.g., IL-1, TNFα, IFNγ, IL-12, IL-18, granulocyte-macrophage colony-stimulating factor), anti-inflammatory genes (e.g., IL4, IL-10, IL-13, IFNα, TGFβ), cell cycle inhibitor genes (e.g., p53, serotonin receptor agonists), and cytotoxic genes (e.g., cytotoxic genes). These include housekeeping genes, transcription factors (e.g., Sox11, STAT1, STAT3, NFκB, FoxP3, T-bet, RORγT), genes involved in the spread or replication of infectious viruses (e.g., HIV, HPV E6, HPV E7, e.g., CCR5, ACE2), and genes encoding membrane-bound receptors (e.g., tenascin-C, CD147, LGR5, CA9, TCR).
[0278] According to certain embodiments, the gene of interest is selected from the group consisting of PLK1, cyclin D1, Sox11, STAT3, CCR5, HIV genes (e.g., gag, pol, env, tat, rev, nef, vpr, vif, vpu), T-Bet, NIK, CKAP5, LRG5, CA9, HPV E6, HPV E7, TOP2A, and CDC20.
[0279] According to particular embodiments, the gene of interest is selected from the group consisting of PLK1, cyclin D1, Sox11, STAT3, CCR5, HIV and T-Bet.
[0280] According to a particular embodiment, the gene of interest is PLK1.
[0281] Thus, according to certain embodiments, the gRNA sequence targeting PLK1 comprises SEQ ID NO: 2 or 3.
[0282] Both cassettes (one encoding the genome editing reagent and one encoding the inducing nucleic acid sequence) are present in a single nucleic acid sequence or are expressed from two separate nucleic acid sequences. According to certain embodiments, the genome editing reagent and the inducing nucleic acid sequence are expressed from two separate nucleic acid sequences.
[0283] Certain embodiments of the present teachings suggest the use of the lipid particles described herein for the delivery of polynucleotides encoding large proteins described herein to cells. Thus, according to an aspect of the present invention, there is provided a method for producing a heterologous protein of interest, comprising contacting a cell with a lipid particle disclosed herein and producing the heterologous protein of interest.
[0284] According to certain embodiments, the contacting is performed in vivo.
[0285] According to other particular embodiments, the contacting is performed in vitro or ex vivo.
[0286] According to certain embodiments, the method includes maintaining (e.g., culturing) the cells under conditions that allow expression of the protein of interest, such as appropriate temperature (e.g., 37°C), atmosphere (e.g., air + 5% CO), pH, light, media, additives, etc.
[0287] According to certain embodiments, the method comprises recovering the protein of interest from the cells following contacting, according to standard procedures.
[0288] The protein of interest may be a genome editing endonuclease, and as described in detail above, an aspect of the present invention provides a method for creating a genetic mutation in a cell, the method comprising contacting the cell with a lipid particle disclosed herein and creating a genetic mutation in the cell.
[0289] According to certain embodiments, the method further comprises, following said contacting, administering said cells to a subject having a disease in need of treatment, non-limiting examples of which are described below.
[0290] According to a further or alternative aspect of the invention there is provided a cell produced by the method.
[0291] According to a further or alternative aspect of the invention, there is provided a cell produced by the method for treating a disease in a subject in need thereof.
[0292] Cells used in accordance with certain embodiments of the present invention may be autologous or non-autologous, and may be syngeneic or non-syngeneic to the subject, i.e., allogeneic or xenogeneic, with each possibility representing a separate embodiment of the present invention.
[0293] According to certain embodiments, the cells are autologous to the subject.
[0294] According to certain embodiments, the cells are non-autologous to the subject.
[0295] Certain embodiments suggest the use of the lipid particles described herein for the delivery to cells of polynucleotides encoding large proteins described herein, and thus certain embodiments of the present invention contemplate the use of the lipid particles in methods of treating diseases in which expression of such proteins is beneficial.
[0296] Thus, in one aspect of the present invention, there is provided a method for treating a disease in which exogenous expression of a protein in a subject's cells is effective, the method comprising administering to the subject a therapeutically effective amount of a lipid particle disclosed herein, thereby treating the disease in the subject.
[0297] According to a further or alternative aspect of the present invention, there is provided a lipid particle as disclosed herein for use in treating a disease in which exogenous expression of a protein in the cells of a subject is beneficial.
[0298] According to a further or alternative aspect of the present invention, there is provided a method for treating a disease in which the creation of a genetic mutation in a subject's cells is beneficial, the method comprising administering to the subject a therapeutically effective amount of a lipid particle disclosed herein, thereby treating the disease in the subject.
[0299] According to a further or alternative aspect of the present invention, there is provided a lipid particle as disclosed herein for use in treating a disease in which the creation of a genetic mutation in the cells of a subject is beneficial.
[0300] As used herein, the term "treating" or "treatment" means inhibiting, preventing, or arresting the occurrence of a pathology (disease, disorder, or condition) and / or alleviating, ameliorating, or resolving a pathology or its symptoms. Those skilled in the art will appreciate that various methodologies and assays can be used to assess the progression of a condition, and similarly, various methodologies and assays can be used to assess the alleviation, remission, or remission of a condition.
[0301] As used herein, the term "subject" includes mammals of any age or sex, preferably humans. According to certain embodiments, the term "subject" refers to a subject suffering from a pathology (disease, disorder, or condition).
[0302] According to certain embodiments, the subject is a human.
[0303] According to certain embodiments, the disease is an inflammatory disease, non-limiting examples of which include inflammatory diseases associated with hypersensitivity, autoimmune diseases (e.g., cardiovascular diseases, rheumatoid diseases, glandular diseases, gastrointestinal diseases, skin diseases, liver diseases, neurological diseases, muscular diseases, kidney diseases, reproductive diseases, connective tissue diseases, and systemic diseases), infectious diseases (e.g., chronic infectious diseases, subacute infectious diseases, acute infectious diseases, viral diseases (e.g., AIDS, coronavirus), bacterial diseases, protozoal diseases, parasitic diseases, fungal diseases, mycoplasmal diseases, and prion diseases), and cancer.
[0304] According to a particular embodiment, the disease is cancer.
[0305] As used herein, the term cancer encompasses both malignant and pre-malignant cancers.
[0306] According to certain embodiments, the cancer comprises a malignant cancer.
[0307] The cancer that can be treated by the method of some embodiments of the present invention is any solid or non-solid cancer and / or cancerous metastasis. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. Further specific examples of such cancers include squamous cell carcinoma, lung cancer (such as small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma), cancer of the peritoneum, hepatocellular carcinoma, gastric cancer (such as digestive cancer), pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, renal or kidney cancer, liver cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, and various types of head and neck cancer, as well as B-cell lymphomas (low-grade / follicular non-Hodgkin's lymphoma (NHL), small lymphocytic (SL) NHL, intermediate-grade / follicular NHL, intermediate-grade diffuse NHL, high-grade immunoblastic NHL, diffuse large B-cell lymphoma, and the like). These include: lymphoma (such as DLBCL, high-grade lymphoblastic NHL, high-grade small non-cleaved cell NHL, bulky disease NHL, mantle cell lymphoma, AIDS-related lymphoma, and Waldenstrom's macroglobulinemia), T-cell lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute promyelocytic leukemia (APL), hairy cell leukemia, chronic myeloblastic leukemia (CML), post-transplant lymphoproliferative disorder (PTLD), as well as abnormal blood vessel proliferation associated with phacomatosis, edema (e.g., associated with brain tumors), and Meigs' syndrome. Preferably, the cancer is selected from the group consisting of breast cancer, colorectal cancer, rectal cancer, non-small cell lung cancer, non-Hodgkin's lymphoma (NHL), renal cell carcinoma, prostate cancer, liver cancer, pancreatic cancer, soft tissue sarcoma, Kaposi's sarcoma, carcinoid carcinoma, head and neck cancer, melanoma, ovarian cancer, mesothelioma, and multiple myeloma. Cancerous conditions amenable to treatment in accordance with the present invention include metastatic cancer.
[0308] According to certain embodiments, the cancer is glioblastoma.
[0309] According to certain embodiments, the cancer is ovarian cancer.
[0310] According to certain embodiments, the cancer comprises a pre-malignant cancer.
[0311] Premalignant cancers (or precancers) are well characterized and known in the art (see, e.g., Berman JJ. and Henson DE., 2003. Classifying the precancers: a metadata approach. BMC Med Inform Decis Mak. 3:8). Classes of premalignant cancers amenable to treatment by the methods of the present invention include acquired small or microprecancers, acquired large lesions with nuclear atypia, precursor lesions occurring with hereditary hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasia and diffuse dysplasia. Non-limiting examples of small precancers include HGSIL (high-grade squamous intraepithelial lesions of the cervix), AIN (anal intraepithelial neoplasia), vocal cord dysplasia, aberrant crypt foci (of the colon), and PIN (prostatic intraepithelial neoplasia). Non-limiting examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD (angioimmunoblastic lymphadenopathy with dysproteinemia), atypical meningioma, gastric polyp, large-plaque psoriasis, myelodysplasia, papillary transitional cell intraepithelial carcinoma, refractory anemia with excess blasts, and Schneiderian papilloma. Non-limiting examples of precursor lesions that occur with inherited hyperplastic syndromes that progress to cancer include atypical mole syndrome, C-cell adenomatosis, and MEA. Non-limiting examples of acquired diffuse hyperplasia and diffuse dysplasia include AIDS, atypical lymphoid hyperplasia, Paget's disease of bone, post-transplant lymphoproliferative disease, and ulcerative colitis.
[0312] According to certain embodiments, the disease is an infectious disease.
[0313] As used herein, the term "infectious disease" or "infectious disease" refers to a disease caused by a pathogen. Non-limiting examples of pathogens include viral pathogens, bacterial pathogens, such as intracellular mycobacterial pathogens (e.g., Mycobacterium tuberculosis, etc.), intracellular bacterial pathogens (e.g., Listeria monocytogenes, etc.), or intracellular protozoan pathogens (e.g., Leishmania and Trypanosoma, etc.), parasitic diseases, fungal diseases, and prion diseases.
[0314] Methods for analyzing infection are known in the art and are based either on serology, protein markers or nucleic acid analysis.
[0315] According to certain embodiments, the disease is a viral infection.
[0316] Non-limiting examples of viral infections include human immunodeficiency virus (HIV)-induced acquired immune deficiency syndrome (AIDS), coronavirus, influenza, rhinovirus infection, viral meningitis, Epstein-Barr virus (EBV) infection, hepatitis A, B, or C virus infection, measles, papillomavirus infection / warts, cytomegalovirus (CMV) infection, herpes simplex virus infection, yellow fever, Ebola virus infection, rabies, and the like.
[0317] According to certain embodiments, the disease is viral pneumonia. Non-limiting examples of viruses that cause pneumonia include influenza viruses and coronaviruses.
[0318] According to certain embodiments, the disease is a coronavirus infection.
[0319] According to certain embodiments, clinical manifestations of coronavirus infection include symptoms selected from the group consisting of lung inflammation, alveolar damage, fever, cough, shortness of breath, diarrhea, organ failure, pneumonia and / or septic shock.
[0320] As used herein, a "coronavirus" is an enveloped, positive-strand RNA virus that belongs to the Coronaviridae family, order Nidovirales.
[0321] Examples of coronaviruses contemplated herein include, but are not limited to, 229E, NL63, OC43, and HKU1, the first two of which are classified as antigenic determinant 1 and the latter two as antigenic determinant 2, and which typically cause upper respiratory tract infections with symptoms similar to the common cold.
[0322] However, coronaviruses originating from animals can evolve into species that are infectious and deadly to humans. Thus, specific examples of coronaviruses contemplated herein are SARS-CoV, Middle East Respiratory Syndrome coronavirus (MERS-CoV), and the recently identified SAR-CoV-2 (which causes 2019-nCoV (also referred to as "COVID-19").
[0323] Although specific emphasis is placed on SAR-CoV-2, it should be understood that any coronavirus strain is contemplated in this application.
[0324] According to certain embodiments, the disease is SAR-CoV-2 infection.
[0325] In certain embodiments, the disease is a neurodegenerative disease (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, myasthenia gravis, amyotrophic lateral sclerosis).
[0326] According to certain embodiments, the disease is a metabolic disease (eg, diabetes, lysosomal storage disorders (eg, Gaucher disease), metabolic syndrome, obesity).
[0327] According to certain embodiments, the disease is a genetic disease associated with a protein deficiency or dysfunction.
[0328] Non-limiting examples of genetic diseases include cystic fibrosis, muscular dystrophy, beta thalassemia, sickle cell anemia, Huntington's disease, and ATTR amyloidosis.
[0329] The lipid particles or cells in some embodiments of the present invention may be administered to an organism as is, or as a pharmaceutical composition mixed with a suitable carrier or excipient.
[0330] As used herein, the term "pharmaceutical composition" refers to a formulation of one or more active ingredients described herein with other chemical components, such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
[0331] As used herein, the term "active ingredient" refers to a lipid particle encapsulating a nucleic acid sequence encoding a protein that is responsible for a biological effect, or a cell in contact with a lipid particle encapsulating a nucleic acid sequence encoding a protein.
[0332] The phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier," used interchangeably hereinafter, refer to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. Such phrases include adjuvants.
[0333] As used herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Non-limiting examples of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.
[0334] Techniques for drug formulation and administration may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
[0335] Suitable routes of administration can include, for example, oral, rectal, transmucosal, especially intranasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injection, as well as intrathecal, direct intraventricular, intracardiac (e.g., into the right or left ventricular cavity, into the common carotid artery), intravenous, intraperitoneal, intranasal or intraocular injection.
[0336] Traditional approaches to drug delivery to the central nervous system (CNS) include neurosurgical strategies (e.g., intracerebral or intracerebroventricular injection), molecular engineering aimed at engineering drugs that utilize one of the endogenous transport pathways of the BBB (e.g., the creation of chimeric fusion proteins containing a transport peptide with affinity for an endothelial cell surface molecule combined with a drug that cannot cross the BBB by itself), pharmacological strategies designed to increase the lipid solubility of drugs (e.g., conjugation of water-soluble drugs to lipid or cholesterol carriers), and transient disruption of BBB integrity by hyperosmotic disruption (by injecting mannitol solutions into the carotid artery or using biologically active agents such as angiotensin peptides). However, each of these strategies has limitations, including inherent risks associated with invasive surgical procedures, size limitations imposed by the limitations inherent in endogenous transport systems, potentially undesirable biological side effects associated with systemic administration of chimeric molecules containing carrier motifs that may be active outside the CNS, and the risk of brain damage within regions of the brain where the BBB is disrupted, resulting in suboptimal delivery methods.
[0337] Alternatively, the pharmaceutical composition may be administered in a local rather than systemic manner, for example, by injection of the pharmaceutical composition into a tissue region of the patient.
[0338] Pharmaceutical compositions of some embodiments of the present invention may be manufactured by processes well known in the art, for example, by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
[0339] Thus, pharmaceutical compositions for use in accordance with some embodiments of the present invention can be formulated in a conventional manner using one or more physiologically acceptable carriers, including excipients and adjuvants, which facilitate processing of the active ingredient into a pharmaceutically acceptable formulation. Appropriate formulations will vary depending on the selected route of administration.
[0340] For injection, the active ingredient of the pharmaceutical composition can be formulated in an aqueous solution, preferably in a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0341] For oral administration, pharmaceutical compositions can be easily formulated by combining the active compound with pharmaceutically acceptable carriers known in the art. Such carriers allow the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc. for oral ingestion by patients. Pharmaceutical preparations for oral use can be prepared by using solid excipients, optionally milling the resulting mixture, and processing the mixture into granules, after adding suitable excipients as needed to obtain tablets or dragee cores. Suitable excipients include, in particular, sugars including lactose, sucrose, mannitol, or sorbitol, cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or fillers such as physiologically acceptable polymers, such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
[0342] Sugar-coated core is provided with suitable coating.For this purpose, can optionally use concentrated sugar solution, which can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solution and suitable organic solvent or solvent mixture.For identification or to characterize different combinations of active compound dosage, dyes or pigments can be added to tablet or sugar-coated coating.
[0343] Orally available pharmaceutical compositions include push-fit capsules made of gelatin and soft sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules may contain the active ingredient in a mixture with a filler such as lactose, a binder such as starch, a lubricant such as talc or magnesium stearate, and optionally, a stabilizer. In soft capsules, the active ingredient may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol. Additionally, stabilizers may be added. All formulations for oral administration should be in a dosage appropriate for the selected route of administration.
[0344] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0345] For administration by nasal inhalation, the active ingredient for use according to some embodiments of the present invention is conveniently delivered in the form of aerosol spray formulation from a pressurized pack or nebulizer using suitable propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane or carbon dioxide.In the case of pressurized aerosol, dosage unit can be determined by providing a valve to deliver a metered amount.Capsules and cartridges, for example, made of gelatin, can be formulated to contain a powder mixture of the compound and a suitable powder base, for example, lactose or starch, for use in a dispenser.
[0346] The pharmaceutical compositions described herein can be formulated for parenteral administration, for example, by bolus injection or continuous infusion. Injectable formulations can be provided in unit dosage form, for example, in ampoules or multi-dose containers, optionally with the addition of preservatives. The compositions can be suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.
[0347] Pharmaceutical compositions for parenteral administration include aqueous solutions of water-soluble active ingredients.In addition, suspensions of active ingredients can be prepared as suitable oily or aqueous-based injection suspensions.Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil or synthetic fatty acid esters such as ethyl oleate, triglycerides or liposomes.Aqueous injection suspensions can contain agents that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.Optionally, the suspension can also contain suitable stabilizers or agents that increase the solubility of the active ingredient to allow the preparation of highly concentrated solutions.
[0348] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water-based solution, before use.
[0349] The pharmaceutical compositions of some embodiments of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, eg, conventional suppository bases such as cocoa butter or other glycerides.
[0350] Pharmaceutical compositions suitable for use in connection with some embodiments of the present invention include compositions containing an active ingredient in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount refers to an amount of active ingredient effective to prevent, alleviate or ameliorate symptoms of, or prolong the survival of, the disorder (e.g., acute liver disease) being treated.
[0351] Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
[0352] For any preparation used in the method of the present invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.For example, the dose can be formulated in animal models to achieve a desired concentration or titer.This information can be used to more accurately determine the useful dose in humans.
[0353] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined in vitro, in cell cultures, or in experimental animals by standard pharmaceutical procedures. Data obtained from these in vitro and cell culture assays and animal studies can be used to determine a range of dosages for use in humans. Dosages can vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration, and dosage can be chosen by the individual physician in consideration of the patient's condition (see, for example, Fingl et al. (1975), in "The Pharmacological Basis of Therapeutics", Ch. 1, p. 1).
[0354] Dosage and administration intervals can be individually adjusted to achieve a level of active ingredient sufficient to induce or suppress a biological effect (minimum effective concentration, MEC). The MEC varies with each formulation but can be estimated based on in vitro data. The dosage required to achieve the MEC varies depending on individual characteristics and the route of administration. Detection assays can be used to determine plasma concentrations.
[0355] Depending on the severity and responsiveness of the condition to be treated, dosage may be single or multiple administrations over the course of treatment lasting from several days to several weeks, or until a cure is achieved or the disease state is eliminated.
[0356] The amount of composition administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
[0357] The active ingredients in some embodiments of the present invention can be administered to a subject as a single agent or in combination with other established or experimental therapeutic regimens for treating the disease, including, but not limited to, analgesics, chemotherapeutic agents, radiotherapeutic agents, cytotoxic therapy (conditioning), hormone therapy, antibodies, antibiotics, anti-inflammatory agents, immunosuppressants, and other therapeutic regimens known in the art (e.g., surgery).
[0358] The compositions of some embodiments of the present invention may, if desired, be provided in a pack or dispenser device, such as a kit approved by the FDA (U.S. Food and Drug Administration), which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, be a blister pack comprising metal or plastic foil. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also have a notice associated with the container in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, reflecting that the composition form has been approved by that agency for administration to humans or animals. Such notice may, for example, be in the form of a label approved by the U.S. Food and Drug Administration for prescription drugs or in the form of an approved product insert. Compositions comprising the formulations of the present invention, formulated in a compatible pharmaceutical carrier, may also be prepared, placed in an appropriate container, and labeled for the treatment or diagnosis of an indicated condition, as detailed above.
[0359] As used herein, the term "about" refers to ±10%.
[0360] The terms "comprise," "comprising," "include," "including," "having," and their conjugations mean "including but not limited to."
[0361] The term "consisting of" means "including and limited to."
[0362] The term "consisting essentially of" means that a composition, method, or structure may include additional ingredients, steps, and / or moieties, but only if the additional ingredients, steps, and / or moieties do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.
[0363] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, "a compound" or "at least one compound" can include multiple compounds, including mixtures thereof.
[0364] Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and is not an inflexible limitation on the scope of the invention. Thus, the description of a range should be considered to specifically disclose all of the possible subranges and individual numerical values within that range. For example, description of a range such as 1 to 6 specifically discloses subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values within that range, e.g., 1, 2, 3, 4, 5, and 6. This applies regardless of the magnitude of the range.
[0365] Whenever a numerical range is recited herein, it is intended to include any recited number (fractional or integer) within the recited range. The phrases "range between" a first designated number and a second designated number and "range from" a first designated number to a second designated number are used interchangeably herein and are intended to include the first designated number and the second designated number, and all fractional and integer numbers therebetween.
[0366] As used herein, the term "method" means any manner, means, technique, or procedure for accomplishing a given task, including, but not limited to, those known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry, and medicine, or those that can be readily developed by practitioners from known manners, means, techniques, and procedures.
[0367] When referring to a particular sequence listing, it should be understood that such reference also encompasses sequences that substantially correspond to the complementary sequence, including minor sequence variations. Sequence variations are the result of, for example, sequencing errors, cloning errors, or other changes that result in base substitutions, deletions, or additions, provided that the frequency of such variations is less than 1 in 50 bases, or less than 1 in 100 bases, or less than 1 in 200 bases, or less than 1 in 500 bases, or less than 1 in 1000 bases, or less than 1 in 5,000 bases, or less than 1 in 10,000 bases.
[0368] It is to be understood that features of the invention that are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or combination with other embodiments described herein. Features described in connection with various embodiments are not deemed essential to those embodiments, unless the embodiment is inoperable without the feature.
[0369] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. [Example]
[0370] Reference is now made to the following examples, which together with the above descriptions illustrate, in a non-limiting manner, some embodiments of the present invention.
[0371] The nomenclature used herein and the laboratory procedures employed in the present invention generally include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, "Molecular Cloning: A Laboratory Manual" by Sambrook et al. (1989); "Current Protocols in Molecular Biology" Volumes I-III, Ausubel, RM, ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; and Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. (1998), methods described in U.S. Patent Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659, and 5,272,057; "Cell Biology: A Laboratory Handbook," Volumes I-III, Cellis, JE, ed. (1994); "Culture of Animal Cell - A Manual of Basic Technique" by Freshney, Wiley-Liss, NY (1994), Third Edition; "Current Protocols in Immunology," Volumes I-III, Coligan JE, ed.(1994), Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994), Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W.H. Freeman and Co., New York (1980). Available immunoassays are widely described in the patent and scientific literature, e.g., U.S. Pat. Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771, and 5,281,521; "Oligonucleotide Synthesis," Gait, MJ, ed. (1984), “Nucleic Acid Hybridization” Hames, BD, and Higgins SJ, eds. (1985), “Transcription and Translation” Hames, BD, and Higgins SJ, Eds. (1984), “Animal Cell Culture” Freshney, RI, ed. (1986), “Immobilized Cell and Enzyms” IRL Press, (1986), "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol.1-317, Academic Press, "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996). All of the above references are incorporated herein by reference in their entirety. Other general references are provided throughout this application. The procedures described therein are believed to be well known in the art and are provided for the convenience of the reader. All information contained therein is incorporated herein by reference.
[0372] Materials and Methods Cell lines: HEK293 cells (ATCC, CRL-1573), HCT116 (ATCC, CRL-247), A549 (ATCC, CRL-185), Ovcar8, and NCI / ADR-RES (NAR) (Cohen K et al., ACS Nano 2014) were maintained in DMEM or RPMI-1640 (Gibco, Thermo-Fisher Scientific, Inc.) supplemented with 10% FBS (Biological Industries, Israel), 1% L-glutamine (Gibco, Thermo-Fisher Scientific, Inc.), and 1% penicillin-streptomycin-nystatin (Biological Industries, Israel). 005 cells (Marumoto T et al., Nature Med 2009) were maintained in a known stem cell medium. eGFP-expressing cells, HEK293, and NAR cells were stably transfected with pQCXIP-GFP / d2. All cells were periodically checked for mycoplasma contamination over a 2-month period using an EZ-PCR Mycoplasma Test Kit (Biological Industries, Israel).
[0373] RNA sequences: The following sgRNAs were designed and synthesized by Integrated DNA technologies. The sgRNAs comprised approximately 20 nt of target sequence and sgRNA core sequence: target sequence GFP: GACCAGGAUGGGCACCACCC / sgRNA core (SEQ ID NO: 1); mouse PLK1: CTAGCACACCAACACGTCGT / sgRNA core (SEQ ID NO: 2); human PLK1: AATTACATAGCTCCCGAGGT / sgRNA core (SEQ ID NO: 3). Mouse PLK1 was used for all 005 experiments, and human PLK1 was used for all HEK293, HCT116, NAR, A549, and Ovcar8 experiments. CleanCap™ Cas9 mRNA (modified, SEQ ID NO: 4) was purchased from Trilink Biotenologies Inc. To enhance RNA stability and minimize immunogenicity, Cas9 mRNA was chemically modified with 5-methoxyuridine, and highly modified sgRNAs were used (IDT sgRNA XT). 10,11 .
[0374] Preparation of lipid nanoparticles (LNPs): Ionizable cationic lipids Dlin-MC3-DMA (MC3), lipid 8 (L8), lipid 1 (L1), lipid 6 (L6), lipid 8 (L8), and lipid 10 (L10) were prepared by known methods. 7,20 The lipid mixture was synthesized according to the method described in the previous section. Cholesterol, DSPC, PEG-DMG, and DSPE-PEG were purchased from Avanti Polar Lipids Inc. One volume of ethanol solution of the lipid mixture (ionizable lipid, DSPC, cholesterol, DMG-PEG, and DSPE-PEG in a molar ratio of 50:10.5:38:1.4:0.1) and three volumes of citrate buffer solution of Cas9 mRNA / sgRNA (polynucleotide to ionizable lipid molar ratio of 1:10) were injected into a microfluidic mixer, Nanoassemblyr (Precision Nano Systems Inc.), at a flow rate of 12 ml min -1The resulting LNPs were mixed at 100°C for 16 hours. To remove ethanol, the LNPs were dialyzed twice against phosphate-buffered saline (PBS) (pH 7.4). A schematic diagram of the process is shown in Figure 1A. The resulting LNPs encapsulating the Cas9 mRNA and the indicated sgRNAs are referred to here as cLNPs.
[0375] Particle size distribution: The particle size distribution and ζ-potential of cLNPs were measured by dynamic light scattering using a Malvern nano ZS ζ-sizer (Malvern Instruments). For particle size measurements, cLNPs were diluted 1:20 with PBS. All samples used showed a PDI of less than 0.2. For ζ-potential measurements, cLNPs were diluted 1:200 with double-distilled water.
[0376] Transmission electron microscopy: A drop of aqueous solution containing cLNPs was placed on a carbon-coated copper grid, dried, and analyzed with a JEOL 1200 EX transmission electron microscope.
[0377] LNP incorporation of ASSET and targeted cLNP assembly: To incorporate ASSET into cLNPs, ASSET was incubated with LNPs (1:36, ASSET:RNA weight ratio) at 4°C for 48 hours as previously described (Kedmi et al., Nature Nanotech 2018). Anti-human EGFR antibody (clone ICR10, Bio-Rad Laboratories, Inc.) or rat IgG2a isotype control (clone 2A3, BioXcell, NH, USA) was added.
[0378] RNA quantification and encapsulation: To quantify RNA within cLNPs and determine RNA encapsulation rates, the Quant-iT RiboGreen RNA assay (Life Technology) was used according to the manufacturer's protocol. Briefly, 2 μl of cLNPs or a known concentration of ribosomal RNA dilution was diluted to a final volume of 100 μl in TE buffer (10 mM Tris-HCl, 20 mM EDTA) in the presence or absence of 0.5% Triton X-100 (Sigma-Aldrich) in a 96-well fluorescence plate (Costar, Corning). The particles were permeabilized by incubating the plate at 40°C for 10 minutes before adding 99 μl of TE buffer and 1 μl of RiboGreen reagent to each well. The plate was then shaken at room temperature for 5 minutes, and fluorescence (excitation wavelength 485 nm, emission wavelength 528 nm) was measured using a plate reader according to the manufacturer's protocol.
[0379] In Vitro Uptake Analysis: For in vitro uptake analysis, 20% of the total RNA content of cLNPs was replaced with an equal amount of a short Cy5.5-labeled DNA oligo (Cy5.5 AGCTCTGTTTACGTCCCAGC, SEQ ID NO: 5). 6 Cells were incubated with 0.1–1 μg / ml LNP for 2 h at 37°C. After three PBS washes, binding of labeled cLNP was assessed by flow cytometry (Cytoflex™ and Cytexpert™ software, Beckman-Coulter, USA). Analysis was performed with FlowJo™ software (FlowJo LLC, USA).
[0380] In Vitro Transfection: Cells were counted using trypan blue (Biological industries) and 0.1 × 10 6Cells were plated in 12-well tissue culture plates (Greiner Bio-One, Germany) containing 1 ml of growth medium. Mock (PBS) or cLNPs containing 0.1–2 μg of RNA were added to the wells, and the treated cells were incubated for 24–120 h under standard culture conditions. Cells were then washed three times and incubated with fresh medium. Cells were harvested after 72–96 h for flow cytometry or 24–28 h for cell cycle analysis. For 005 cells, cLNPs were preincubated with 0.001 mg / ml ApoE3 (Peprotech, USA) before addition to the cells.
[0381] EGFP decay assay: Cells were harvested 72 hours after transfection and the % of EGFP-negative cells was assessed using Cytoflex™ and Cytexpert™ software (Beckman-Coulter, USA). Analysis was performed using FlowJo™ software (Becton Dickinson, USA).
[0382] NGS analysis of gene editing: For sequencing analysis, genomic DNA was extracted using QuickExtract™ DNA extraction solution (Lucigen Inc.) according to the manufacturer's protocol. To generate unique P5 and P7 indices for Illumina sequencing, amplification was performed using two rounds of PCR with locus-specific primers containing universal tails. Following PCR, 1x SPRI bead cleanup and library quantification by qPCR (IDT) were performed prior to sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry, 150-bp paired-end reads) (Illumina, San Diego, CA, USA). Data were analyzed using a custom-designed pipeline. Data were demultiplexed (Picard tools v2.9, www(dot)github(dot)com / broadinstitute / picard), forward and reverse reads were concatenated into extended amplicons (flash v1.2.11), and reads were aligned to the GRCh38 genome reference (bwa mem v0.7.15) and assigned to targets (bedtools tags v2.25). Reads with a base quality score below 10 were excluded. For each target, edits were calculated as the percentage of total reads containing an INDEL within an 8-bp window around the cut site.
[0383] Cell cycle and cell viability studies: For cell cycle analysis, 5 × 10 cells were cultured 48 hours after LNP transfection. 5Cells were harvested, washed with ice-cold PBS, and fixed with 70% ethanol for 1 hour. Subsequently, cells were washed twice with cold PBS and incubated with 15 μg / mL 2-(4-amidinophenyl)-6-indocarbamidine dihydrochloride (DAPI) (Merck, KGaA, Darmstadt, Germany) in 300 μL of PBS at 37°C for 10 minutes. Fluorescence was measured by flow cytometry. Apoptosis was assessed by flow cytometry using Annexin V-APC (Biolegend, Inc: 640941) and DAPI according to the manufacturer's recommendations. At least 2 × 10 cells were collected. 4 Cell data were acquired using Cytoflex™ and Cytexpert™ software (Beckman-Coulter, USA). Analysis was performed using FlowJo™ software. For cell cycle analysis, the Dean-Jett-Fox model was applied to at least 10,000 gated cells. Cell viability assessment was performed using the XTT Cell Proliferation Kit (Biological Industries, Israel) according to the manufacturer's protocol.
[0384] Animal Experiments: All animal protocols were approved by the Institutional Animal Care and Usage Committee of Tel Aviv University and complied with current regulations and standards of the Israel Ministry of Health. All animal experiments were performed in a double-blind manner, with researchers blinded to group assignment and treatments given. At the beginning of each experiment, mice were blindly randomly assigned.
[0385] In vivo glioblastoma model: Eight-week-old female C57BL / 6JOlaHsd mice (Envigo, Rehovot, Israel) were anesthetized, secured in a Kopf Stereotaxic Alignment System, and implanted with 3 × 10 glioblastoma cells in a 1.5 μL volume. 5005 glioblastoma (GBM) cells were injected at a flow rate of 0.3 μl / min using an automated syringe pump. The injection was performed in the right anterior hemisphere, approximately 1.5 mm lateral and 2 mm posterior to bregma, at a depth of 2.3 mm. To monitor tumor growth, bioluminescence imaging (IVIS-Spectrum CT, Perkin Elmer Inc.) was performed every 5 days after tumor cell implantation. 15 mg / kg of XenoLight D-luciferin (122799, Perkin Elmer Inc.) was injected subcutaneously. Bioluminescence analysis was performed using Living Image software (Perkin Elmer Inc.). Ten days after tumor inoculation, mice were anesthetized and secured in a Kopf stereotaxic alignment system. A 1.5 μL volume of 0.05 mg / kg Cas9 mRNA / GFP sgRNA (sgGFP-cLNPs), Cas9 mRNA / PLK1 sgRNA (sgPLK1-cLNPs), or PBS was injected at a flow rate of 0.3 μL / min using an automated syringe pump. The injections were made into the right anterior hemisphere, approximately 1.5 mm lateral and 2 mm posterior to bregma, at a depth of 2.3 mm. At the indicated time points, mice were euthanized, and brains were harvested. Single-cell suspensions were prepared using a Neural Tissue Dissociation Kit (P) (Miltenyi Biotech, USA) and a gentleMACS™ dissociator according to the manufacturer's protocol.
[0386] To investigate the in vivo tumor distribution of cLNPs, 20% of the total RNA content of sgGFP-cLNPs was replaced with an equal amount of a short Cy5.5-labeled DNA oligo (Cy5.5 AGCTCTGTTTACGTCCCAGC, SEQ ID NO: 5). Six hours after injection, mice were euthanized and their brains were harvested. For fluorescent staining, coronal brain sections (40 μm) were cut using a microtome and imaged using a confocal laser scanning microscope.
[0387] In vivo ovarian cancer model: 3 × 10 8-week-old female Hsd:athymic nude-Foxn1nu mice (Envigo, Rehovot, Israel) were infected with 6Ovcar8-mCherry cells were injected intraperitoneally. To monitor tumor growth, fluorescent imaging (IVIS-Spectrum CT, Perkin Elmer Inc.) was performed weekly after tumor cell implantation. Fluorescence analysis was performed using Living Image software (Perkin Elmer Inc.). Ten and 17 days after tumor inoculation, mice were intraperitoneally injected with 0.75 mg / kg of anti-EGFR-targeted sgGFP-cLNPs, isotype control-targeted sgGFP-cLNPs, anti-EGFR-targeted sgPLK1-cLNPs, or isotype control-targeted sgPLK1-cLNPs.
[0388] In vivo toxicity and immunogenicity: Ten-week-old female C57BL / 6 mice (Envigo Laboratories) were intravenously injected with 1 mg / kg of sgGFP-cLNP. 24 hours after injection, blood was collected for biochemistry using a Cobas-6000 instrument, and complete blood counts were performed using a Sysmex and Advia-120 (AML, Israel). Serum was separated and stored at -80°C until cytokine analysis, which was performed at Pharmaseed preclinical CRO, Israel.
[0389] Statistical Analysis: Statistical analysis for comparing two experimental groups was performed using a two-tailed Student's t-test. For experiments involving multiple groups, one-way or two-way ANOVA with Tukey's correction was used to calculate differences between multiple populations. Kaplan-Meier survival curves were used to analyze survival rates. A value of P<0.05 was considered statistically significant. Analyses were performed using Prism 7 (GraphPad software). Differences that were not significant were indicated as ns; * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001. Established criteria for excluding animals from experiments were based on the health, behavior, and welfare of the animals as required by ethical guidelines.
[0390] Example 1 Preparation of lipid nanoparticles encapsulating Cas9 mRNA and sgRNA The large size of Cas9 (160 kDa, 4300 b) and sgRNA (approximately 31 kDa, 130 b) has been an obstacle to conventional viral and non-viral delivery into cells. To overcome this loading limit, a novel ionizable amino lipid library, the gold standard, was developed. 7 We designed lipid nanoparticles (LNPs) to encapsulate both Cas9 mRNA and sgRNA using the ionizable cationic lipid DLin-MC3-DMA (hereafter referred to as MC3) or the ionizable cationic lipid Lipid 8 (L8) (Figure 1A). This reduces exposure to nucleases and prevents off-target gene modification. 8,9 To minimize the risk of infection, we chose Cas9 mRNA instead of plasmid DNA. Specifically, the sequence of Cas9 isolated from Streptococcus pyogenes (SpCas9) was used in this study. To increase RNA stability and minimize immunogenicity, we chemically modified the Cas9 mRNA with 5-methoxyuridine and used a highly modified sgRNA (IDT sgRNA XT). 10,11 The resulting lipid nanoparticles encapsulating Cas9 mRNA and sgRNA are referred to herein as CRISPR LNPs or cLNPs. The resulting L8-based cLNPs had uniform particle size, with a diameter of 79.3 ± 1.71 nm, a polydispersity index of 0.085, and a ζ-potential of 7.6 ± 0.45 mV as shown by transmission electron microscopy and dynamic light scattering, which were similar to those of the MC3-based cLNPs (Figure 1B and Table 1 below). The encapsulation rates of Cas9 mRNA and sgRNA in L8- and MC3-based LNPs were similarly high (>90%) (Figure 1C).
[0391] [Table 1]
[0392] Example 2 L8-based cNLPs, but not MC3-based cLNPs, induce in vitro gene disruption in transfected cells In the next step, MC3- or L8-based LNPs harboring Cas9 mRNA and GFP sgRNA (MC3-sgGFP-cLNP or L8-sgGFP-cLNP, respectively), or L8-based LNPs harboring Cas9 mRNA and PLK1 sgRNA (L8-sgPLK1-cLNP), were used to assess the uptake of cLNPs by cells and their ability to induce gene disruption.
[0393] To assess cellular uptake of LNPs, HEK293 cells were incubated with increasing concentrations of Cy5.5-labeled MC3- or L8-based cLNPs and analyzed by flow cytometry (Figure 1D). In vitro gene disruption of GFP was observed by flow cytometry as a loss of GFP fluorescence after incubation of MC3-sgGFP-cLNPs or L8-sgGFP-cLNPs with GFPH-expressing HEK293 cells (HEK / GFP cells). 12 The uptake of MC3-based cLNPs was approximately 1.5-fold higher than that of L8-based cLNPs, but MC3-based cLNPs failed to disrupt GFP expression at any tested concentration (0.1–1.0 μg / ml total RNA). On the other hand, L8-based cLNPs disrupted GFP in a concentration-dependent manner, with GFP fluorescence detected in only 4% of treated cells at the highest concentration of L8-sgGFP-cLNP (Figure 1E).
[0394] We determined the efficiency and specificity of gene disruption by next-generation sequencing of the GFP and PLK1 genomic loci in HEK / GFP cells after incubation with L8-sgGFP-cLNPs or L8-sgPLK1-cLNPs. Genomic DNA was efficiently modified at the targeted loci (94% GFP, 98% PLK1), whereas less than 0.1% of non-targeted loci were edited (Figures 1F-1I). L8-sgGFP-cLNPs did not significantly affect cell viability at any tested concentration (Figure 5). Thus, L8-based cLNPs enabled efficient and specific gene editing with low toxicity.
[0395] The genome editing activity of L8-sgGFP-cLNP was further confirmed in multiple cancer cell lines expressing GFP, specifically, mouse glioblastoma multiforme (GMBH), human ovarian cancer 8 (OV8), human A549 lung adenocarcinoma, human NCI-ADR (NAR) highly drug-resistant ovarian cancer, and human HCT116 malignant colorectal cancer (Figure 12).
[0396] Example 3 L8-based cNLP harboring PLK1 sgRNA induces cell death in vitro PLK1 is a kinase required for mitosis, and its deletion leads to G2 / M cell cycle arrest and cell death in dividing cells. Therefore, we tested the ability of L8-based LNPs (L8-sgPLK1-cLNPs) harboring Cas9 mRNA and PLK1 sgRNA to induce in vitro cell death as a result of genome editing. Treatment of HEK293 cells with 0.5 μg / ml of L8-sgPLK1-cLNPs resulted in G2 / M arrest after 48 hours, whereas control L8-sgGFP-cLNPs had no effect on the cell cycle profile (Figure 1H and Figure 6A). After 96 hours of treatment, cells treated with 0.5 μg / ml of L8-sgPLK1-cLNPs were only 20% viable compared to untreated or L8-sgGFP-cLNP-treated cells by XTT assay or Annexin V-DAPI staining (Figure 1I and Figures 6B-6C). The preserved cell viability following treatment with L8-sgGFP-cLNPs (Figure 1I) suggests that L8-based cLNPs have low toxicity at therapeutically relevant concentrations.
[0397] To explore the therapeutic genome editing potential of the engineered L8-based cLNPs, we performed lentiviral gene editing of two aggressive and difficult-to-treat cancer cell lines, namely, Tp53, activated H-Ras, and Akt. + / - Murine glioblastoma (GBM) stem cell-like 005 cell line isolated from glioblastoma formed after intracerebral transduction in mice 13,14and human Ovcar8 (OV8), a high-grade serous ovarian adenocarcinoma cell line that is highly drug-resistant and metastasizes to form ascites. 15,16 The murine GBM005 cells share similar lethal characteristics with human GBM, including high invasiveness, angiogenesis, pleomorphism, and infiltration by immune cells. 13,14 Similar to human ovarian cancer, which is usually not diagnosed until after metastatic dissemination within the peritoneum, intraperitoneal injection of OV8 results in the formation of drug-resistant, metastatic high-grade ovarian cancer grafts.
[0398] Incubation of GBM005 or OV8 with L8-sgPLK1-cLNP efficiently disrupted the PLK1 gene, resulting in 84% and 91% genome editing, respectively, unlike L8-sgGFP-cLNP (Figure 2A, Figure 2D, and Figure 7A-7B). Disruption of PLK1 potently caused cell cycle arrest measured after 48 h (Figure 2B, Figure 2E, Figure 8A, and Figure 8C) and reduced cell viability after 96 h, as determined by XTT assay, by 5-fold in GBM005 and 10-fold in OV8 (Figure 2C and Figure 2F). Similarly, staining of dead cells with Annexin V and / or DAPI increased following incubation with L8-sgPLK1-cLNP, but not L8-sgGFP-cLNP (Figure 8B and Figure 8D). Thus, L8-sgPLK1-cLNP efficiently disrupted the target gene, leading to cell cycle arrest and death of GBM005 and OV8 cancer cell lines in vitro.
[0399] Example 4 L8-based cNLP induces gene disruption in vivo and can be used for therapeutic genome editing To evaluate the therapeutic potential of L8-based cLNPs against cancer, we needed to address two major concerns of CRISPR / Cas9 therapy: potential toxicity and immunogenicity. In initial studies, we assessed liver toxicity, blood counts, and serum inflammatory cytokines 24 hours after intravenous injection of 1 mg / kg L8-sgGFP-cLNPs into C57BL / 6 mice (Figures 9A–9C). There was no overt clinical toxicity, and no significant changes in liver enzymes [alanine transaminase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP)], blood counts, or a panel of cytokines (IL-1β, IL-2, TNF-α, IFN-γ, IL-10) after injection. These results suggest that systemic administration of cLNPs at therapeutically effective doses is not associated with overall toxicity or immunogenicity.
[0400] In the next step, we used two tumor mouse models to evaluate whether the high genome editing efficiency observed in vitro could be translated into therapeutic efficacy in vivo.
[0401] The first model was the GBM model. Due to its sequestering nature, the brain prevents the entry of most systemically administered drugs. Therefore, intracranial drug administration may overcome this limitation and improve efficacy. 17,18 To this end, GBM005 expressing GFP, mCherry, and luciferase was stereotactically injected into the hippocampus of mice (Figure 3A). Tumors were allowed to grow for 10 days, and Cy5.5-labeled cLNPs or PBS were injected intratumorally. Mice were euthanized 6 hours later, and tumor sites were visualized by fluorescence microscopy. Cy5.5-labeled cLNPs diffused from the tumor (Figure 3B).
[0402] To evaluate gene editing, 0.05 mg / kg of L8-sgGFP-cLNP was stereotactically injected into established tumors. Mice were euthanized 7 days later and analyzed for GFP expression by flow cytometry. A single intracranial injection significantly reduced tumor cell GFP fluorescence by approximately two-fold, indicating in vivo gene disruption (Figures 3C-3D).
[0403] To evaluate whether L8-sgPLK1-cLNP inhibited tumor growth, GBM005-bearing mice were stereotactically injected once with 0.05 mg / kg of L8-sgPLK1-cLNP or L8-sgGFP-cLNP (Figure 3E). A single intratumoral injection of L8-sgPLK1-cLNP significantly reduced tumor growth, as measured by live animal luciferase activity (Figures 3F–3G), and increased median survival from 32.5 days to 48 days compared with the control group (Figure 3H). L8-sgGFP-cLNP had no protective effect. Thirty percent of L8-sgPLK1-cLNP-treated mice survived to the end of the experiment (60 days), whereas control mice died within 40 days. To our knowledge, these findings represent the highest survival rates achieved by a single treatment for this malignancy.
[0404] The second model was an ovarian cancer model. In this setting, we used L8-sgPLK1-cLNP with a targeting moiety attached to promote gene editing in tumor cells and reduce toxicity and editing in non-transformed cells. Specifically, OV8 tumor cells highly express the epidermal growth factor receptor (EGFR). 21 Therefore, we targeted cLNPs to OV8 by coating OV8 with anti-EGFR. To evaluate the antitumor effect, mice bearing OV8-mCherry metastases were intravenously injected with 0.75 mg / kg of anti-hEGFR-conjugated L8-sgPLK1-cLNPs or L8-sgGFP-cLNPs 10 and 17 days after tumor inoculation (Figure 4A). Tumor growth was monitored using mCherry in vivo imaging. Treatment with anti-EGFR-targeted L8-sgPLK1-cLNPs significantly inhibited tumor growth (Figures 4B-4C, p<0.001) and increased overall survival by approximately 80% (Figure 4D). No significant difference was observed in the survival rate of control mice treated with anti-EGFR-targeted L8-sgGFP-cLNPs (Figure 4D).
[0405] These findings highlight the therapeutic potential of targeted L8-based c-LNPs, for example, in the treatment of disseminated tumors.
[0406] Example 5 L10- and L1-based cNLPs induce in vitro gene disruption in transfected cells, whereas L6-based cLNPs are inferior In the next step, a novel ionizable amino lipid library 7 We evaluated the gene disruption-inducing activity of several cLNPs, including other ionizable cationic lipids derived from IL-10, specifically lipid 10 (L10), lipid 1 (L1), and lipid 6 (L6). To this end, we generated L10-, L1-, and L6-based LNPs (L10-sgGFP-cLNP, L1-sgGFP-cLNP, and L6-sgGFP-cLNP, respectively) encapsulating Cas9 mRNA and GFP sgRNA. We then evaluated their GFP silencing efficacy in HEK / GFP cells and compared them with L8-sgGFP-cLNP and MC3-sgGFP-cLNP.
[0407] As shown in Figures 10 and 11, L10-based cLNPs showed the highest encapsulation rate and genome editing activity, L1-based cLNPs showed effective activity with a lower encapsulation rate, and L6-based cLNPs had inferior activity.
[0408] While the present invention has been described in conjunction with specific embodiments thereof, many alterations, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alterations, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0409] All publications, patents, and patent applications mentioned in this application are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. Nor should section headings, to the extent used, be construed as necessarily limiting. Furthermore, documents relating to the prior application of this application are also incorporated herein by this reference in their entirety.
[0410] References (Other references are cited throughout this application.) 1 Foo, J. & Michor, F. Evolution of acquired resistance to anti-cancer therapy. J Theor Biol 355, 10-20, doi:10.1016 / j.jtbi.2014.02.025 (2014). 2 Hamis, S., Nithiarasu, P. & Powathil, GG What does not kill a tumour may make it stronger: <em> in silico< / em> Insights into Chemotherapeutic Drug Resistance. bioRxiv, 230318, doi:10.1101 / 230318 (2018). 3 Tam, YK, Madden, TD & Hope, MJ Pieter Cullis' quest for a lipid-based, fusogenic delivery system for nucleic acid therapeutics: success with siRNA so what about mRNA? Journal of Drug Targeting 24, 774-779, doi:10.1080 / 1061186X.2016.1221955 (2016). 4 Oberli, M. A. et al. Lipid Nanoparticle Assisted mRNA Delivery for Potent Cancer Immunotherapy. Nano Letters 17, 1326-1335, doi:10.1021 / acs.nanolett.6b03329 (2017). 5 Senis, E. et al. CRISPR / Cas9-mediated genome engineering: An adeno-associated viral (AAV) vector toolbox. Biotechnology Journal 9, 1402-1412, doi:doi:10.1002 / biot.201400046 (2014). 6 Yin, H. et al. Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nature biotechnology 32, 551-553, doi:10.1038 / nbt.2884 (2014). 7 Ramishetti, S. et al. Combinatorial library of lipid nanoparticles for RNA delivery to Leukocytes. Advanced Materials (2019). 8 Liang, X. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Journal of Biotechnology 208, 44-53 (2015). 9 Kim, S., Kim, D., Cho, S. W., Kim, J. & Kim, J.-S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research 24, 1012-1019, doi:10.1101 / gr.171322.113 (2014). 10 Kauffman, K. J. et al. Efficacy and immunogenicity of unmodified and pseudouridine-modified mRNA delivered systemically with lipid nanoparticles in vivo. Biomaterials 109, 78-87, doi:10.1016 / j.biomaterials.2016.09.006 (2016). 11 Granot, Y. & Peer, D. Delivering the right message: Challenges and opportunities in lipid nanoparticles-mediated modified mRNA therapeutics - An innate immune system standpoint. Seminars in Immunology 34, 68-77 (2017). 12 Fu, Y. et al. High frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature biotechnology 31, 822-826, doi:10.1038 / nbt.2623 (2013). 13 Marumoto, T. et al. Development of a novel mouse glioma model using lentiviral vectors. Nature Medicine 15, 110-116, doi:10.1038 / nm.1863 (2009). 14 Friedmann-Morvinski, D. et al. Targeting NF-κB in glioblastoma: A therapeutic approach. Sci Adv 2, e1501292-e1501292, doi:10.1126 / sciadv.1501292 (2016). 15 Hallas-Potts, A., Dawson, J. C. & Herrington, C. S. Ovarian cancer cell lines derived from non-serous carcinomas migrate and invade more aggressively than those derived from high-grade serous carcinomas. Scientific Reports 9, 5515, doi:10.1038 / s41598-019-41941-4 (2019). 16 Mooney, R. et al. Enhanced Delivery of Oncolytic Adenovirus by Neural Stem Cells for Treatment of Metastatic Ovarian Cancer. Mol Ther Oncolytics 12, 79-92, doi:10.1016 / j.omto.2018.12.003 (2018). 17 Gutkin, A., Cohen, Z. R. & Peer, D. Harnessing nanomedicine for therapeutic intervention in glioblastoma. Expert Opinion on Drug Delivery 13, 1573-1582, doi:10.1080 / 17425247.2016.1200557 (2016). 18 Rosenblum, D., Joshi, N., Tao, W., Karp, J. M. & Peer, D. Progress and challenges towards targeted delivery of cancer therapeutics. Nature Communications 9, 1410, doi:10.1038 / s41467-018-03705-y (2018). 19 Veiga, N. et al. Cell specific delivery of modified mRNA expressing therapeutic proteins to leukocytes. Nature Communications 9, 4493, doi:10.1038 / s41467-018-06936-1 (2018). 20 Kedmi, R. et al. A modular platform for targeted RNAi therapeutics. Nature Nanotechnology 13, 214-219, doi:10.1038 / s41565-017-0043-5 (2018). 21 Kang, X., Patel, D., Ng, S. & Melchior, M. Enhanced antitumor activity with anti-epidermal growth factor receptor monoclonal antibody cetuximab in combination with carboplatin in preclinical human ovarian carcinoma models. Molecular Cancer Therapeutics 6, B46 (2007). 22 Wang, D. et al. Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning. Nature Communications 10, 4284, doi:10.1038 / s41467-019-12281-8 (2019). 23 Kleinstiver, B. P. et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 523, 481, doi:10.1038 / nature14592 (2015). 24 Kleinstiver, B. P. et al. High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature 529, 490-495, doi:10.1038 / nature16526 (2016). 25 Vakulskas, C. A. et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine 24, 1216-1224, doi:10.1038 / s41591-018-0137-0 (2018). 26 Slaymaker, I. M. et al. Rationally engineered Cas9 nucleases with improved specificity. Science (New York, N.Y.) 351, 84-88, doi:10.1126 / science.aad5227 (2016). 27 Wilbie, D., Walther, J. & Mastrobattista, E. Delivery Aspects of CRISPR / Cas for in Vivo Genome Editing. Accounts of chemical research 52, 1555-1564, doi:10.1021 / acs.accounts.9b00106 (2019). 28 Xu, C.-F. et al. Rational designs of in vivo CRISPR-Cas delivery systems. Advanced Drug Delivery Reviews (2019). 29 Mout, R., Ray, M., Lee, Y.-W., Scaletti, F. & Rotello, V. M. In Vivo Delivery of CRISPR / Cas9 for Therapeutic Gene Editing: Progress and Challenges. Bioconjug Chem 28, 880-884, doi:10.1021 / acs.bioconjchem.7b00057 (2017). 30 Hsu, P. D., Lander, E. S. & Zhang, F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell 157, 1262-1278, doi:10.1016 / j.cell.2014.05.010 (2014). 31 Long, C. et al. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 351, 400 (2016). 32 Long, C. et al. Prevention of muscular dystrophy in mice by CRISPR / Cas9-mediated editing of germline DNA. Science 345, 1184 (2014). 33 Nelson, C. E. & Gersbach, C. A. Engineering Delivery Vehicles for Genome Editing. Annual Review of Chemical and Biomolecular Engineering 7, 637-662, doi:10.1146 / annurev-chembioeng-080615-034711 (2016). 34 Finn, J. D. et al. A Single Administration of CRISPR / Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing. Cell Reports 22, 2227-2235 (2018). 35 Li, H. et al. In vivo genome editing restores haemostasis in a mouse model of haemophilia. Nature 475, 217, doi:10.1038 / nature10177 (2011). [Sequence List Free Text]
[0411] SEQ ID NO: 1: GFP sgRNA core SEQ ID NO: 2: Mouse PLK1 gRNA core SEQ ID NO: 3: Human PLK1 gRNA core SEQ ID NO: 4: Cas9 mRNA SEQ ID NO: 5: 5' Cy5.5-labeled DNA oligo, 5' Cy5.5 is bound to positions 1 to 20
Claims
1. 1. A lipid particle comprising a cationic lipid encapsulating a nucleic acid sequence, said nucleic acid sequence encoding a protein of at least 500 amino acids in length, said cationic lipid having the formula I: 【Chemistry 1】 (In the formula, m is 0 or 1; A1 and A2 are each independently a saturated or unsaturated, linear, unbranched alkylene chain at least 8 carbon atoms in length; L1 is a first linking group that is alkylene of 1 to 4 carbon atoms in length; X is —O—C(═O)— or —NH—C(═O), L2 is a second linking group that is alkylene of 1 to 4 carbon atoms in length, and R1 and R2 are each independently hydrogen, alkyl, or cycloalkyl, or R1 and R2 together with the nitrogen to which they are attached form a heteroalicyclic ring; However, when X is —O—C(═O)—, m is 1. Lipid particles represented by
2. The lipid particle of claim 1 , wherein the lipid particle comprises a targeting antibody.
3. The lipid particle of claim 1 or 2, wherein the nucleic acid sequence comprises a ribosome binding site sequence, a start codon, and an in-frame stop codon.
4. The lipid particle according to any one of claims 1 to 3, wherein the nucleic acid sequence is mRNA.
5. The lipid particle according to any one of claims 1 to 4, wherein the protein is an enzyme.
6. The lipid particle of claim 5 , wherein the enzyme is a genome-editing endonuclease.
7. The lipid particle of claim 6, wherein the genome editing endonuclease is a CRISPR-associated endonuclease.
8. The lipid particle of claim 6 or 7, further comprising a nucleic acid sequence that guides the genome editing endonuclease to a target gene.
9. The lipid particle of claim 8, wherein the nucleic acid sequence that guides the genome editing endonuclease to the target gene is a gRNA of a CRISPR system.
10. The lipid particle according to claim 8 or 9, wherein the target gene is PLK1.
11. The lipid particle according to any one of claims 1 to 10, wherein the particle is a nanoparticle having a particle size of 30 to 150 nm as measured by a laser particle size discrimination method.
12. 1. A method for producing lipid particles for delivery of nucleic acid sequences, comprising: 【Chemistry 2】 (In the formula, m is 0 or 1; A1 and A2 are each independently a saturated or unsaturated, linear, unbranched alkylene chain at least 8 carbon atoms in length; L1 is a first linking group that is alkylene of 1 to 4 carbon atoms in length; X is —O—C(═O)— or —NH—C(═O), L2 is a second linking group that is alkylene of 1 to 4 carbon atoms in length, and R1 and R2 are each independently hydrogen, alkyl, or cycloalkyl, or R1 and R2 together with the nitrogen to which they are attached form a heteroalicyclic ring; However, when X is —O—C(═O)—, m is 1. encapsulating a nucleic acid sequence within a lipid particle comprising a cationic lipid represented by The method, wherein the nucleic acid sequence encodes a protein at least 500 amino acids in length.
13. A method for producing a heterologous protein of interest, comprising contacting a cell with the lipid particle of any one of claims 1 to 11 to produce the heterologous protein of interest.
14. A method for creating a genetic mutation in a cell, the method comprising contacting the cell with a lipid particle according to any one of claims 6 to 11, thereby creating a genetic mutation in the cell.
15. The lipid particle of claim 10 or 11 for use in treating cancer in a subject.
Citation Information
Patent Citations
Cationic lipids for nucleic acid delivery and preparations thereof
JP2020512272A