Compounds and methods for modulating ATXN1

Modified oligonucleotides targeting ATXN1 RNA and protein effectively treat SCA1 by reducing their activity, addressing the lack of treatment options for this neurodegenerative disorder and improving symptoms and progression.

JP2026012176APending Publication Date: 2026-01-23IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025145172
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-05-01
Filing Date
2025-09-02
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

There is currently no specific treatment for spinocerebellar ataxia type 1 (SCA1), a progressive and fatal neurodegenerative disorder caused by an expansion of a CAG repeat in the ATXN1 gene, leading to symptoms like ataxic gait, limb ataxia, cognitive impairment, and cerebellar atrophy, with a high mortality rate within 10 to 15 years.

Method used

Development of compounds, particularly modified oligonucleotides, to reduce the amount or activity of ATXN1 RNA and protein, targeting specific neurodegenerative diseases such as SCA1, using oligomeric compounds that hybridize with ATXN1 RNA to decrease its expression and activity.

Benefits of technology

The compounds effectively ameliorate symptoms of SCA1, including ataxic gait, limb ataxia, and cognitive impairment, and delay the progression of cerebellar and brainstem atrophy, providing a therapeutic benefit for patients with SCA1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026012176000001
    Figure 2026012176000001
  • Figure 2026012176000002
    Figure 2026012176000002
  • Figure 2026012176000003
    Figure 2026012176000003
Patent Text Reader

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN1RNA in cells or subjects, and in certain cases reducing the amount of ATXN1 in cells or subjects.SOLUTION: Provided are oligomeric compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of ATXN1 nucleic acids, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar-moiety and a modified internucleoside linkage. The compounds, etc., are useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application is filed with a Sequence Listing in electronic format. The Sequence Listing is provided as a file named BIOL0355WOSEQ_ST25.txt, created on April 26, 2021, and having a size of 1.32 MB. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of ATXN1 RNA in a cell or subject, and in certain cases, reducing the amount of ATXN1 protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. Such symptoms and characteristics include ataxic gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, atrophy of the cerebellum and brainstem as seen on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem as detected by magnetic resonance spectroscopy (MRS), and death within 10 to 15 years from the onset of symptoms. Such neurodegenerative diseases include spinocerebellar ataxia type 1. [Background technology]

[0003] Spinocerebellar ataxia type 1 (SCA1) is a progressive, fatal neurodegenerative disorder that affects 1-2 in 100,000 people worldwide. SCA1 is caused by an expansion of a CAG repeat in the coding region of the gene encoding ataxin-1 (ATXN1). Accumulation of mutant ataxin-1 protein leads to degeneration of Purkinje cells and brainstem nuclei. Symptoms and characteristics of SCA1 include ataxic gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, cerebellar and brainstem atrophy seen on magnetic resonance imaging (MRI), cerebellar and brainstem neurochemical abnormalities detected by magnetic resonance spectroscopy (MRS), and death within 10 to 15 years from symptom onset (see, e.g., Ju, H., Kokubu, H., and Lim, J., Mol. Neurobiol. 50:866-874, 2014; Ortiz, JP, Orr, HT, in Polyglutamine Disorders, Nobrega, C. and Almeida, L., eds., Advances in Exp. Med. And Biol., 1049:135-145, 2018).

[0004] There is no specific treatment for SCA1, and current treatments are limited to supportive care for individual symptoms.

[0005] There is currently a lack of acceptable options for the treatment of neurodegenerative diseases, such as SCA1. Accordingly, it is an object herein to provide compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0006] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN1 RNA, and in certain embodiments, for reducing the expression of ATXN1 protein in a cell or a subject. In certain embodiments, the subject has a neurodegenerative disease. In certain embodiments, the subject has spinocerebellar ataxia type 1 (SCA1). In certain embodiments, compounds useful for reducing the amount or activity of ATXN1 RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing the amount or activity of ATXN1 RNA are modified oligonucleotides. In certain embodiments, compounds useful for reducing the expression of ATXN1 protein are oligomeric compounds. In certain embodiments, compounds useful for reducing the expression of ATXN1 protein are modified oligonucleotides. Useful compounds are modified oligonucleotides.

[0007] Also provided are methods useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is spinocerebellar ataxia type 1. In certain embodiments, the symptoms or characteristics include ataxic gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, atrophy of the cerebellum and brainstem as seen on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem as detected by magnetic resonance spectroscopy (MRS), and death within 10 to 15 years from symptom onset. DETAILED DESCRIPTION OF THE INVENTION

[0008] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and not limiting. As used herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" and other forms, such as "includes" and "included," is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components comprising a single unit and elements and components comprising multiple subunits, unless specifically stated otherwise.

[0009] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, papers, and reference sequence records in GenBank, ENSEMBL, and NCBI, are expressly incorporated herein by reference in their entirety for the portions of the documents discussed herein.

[0010] definition Unless otherwise defined, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, other publications, and other materials referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise indicated, the following terms have the following meanings:

[0012] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group present in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0014] As used herein, a "2'-MOE nucleoside" refers to a nucleoside containing a 2'-MOE sugar moiety. It means a nucleoside containing

[0015] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" in reference to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.

[0018] As used herein, "5-methylcytosine" means a cytosine modified by the attachment of a methyl group at position 5. 5-methylcytosine is a modified nucleobase.

[0019] As used herein, "administering" means giving an agent to a subject.

[0020] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0021] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0022] As used herein, "ameliorating" with respect to treatment means an improvement in at least one symptom compared to the same symptom in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset or progression of the severity or frequency of the symptom. In certain embodiments, the symptoms or characteristics are ataxic gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, atrophy of the cerebellum and brainstem seen on magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected by magnetic resonance spectroscopy (MRS), and death within 10 to 15 years from symptom onset.

[0023] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0024] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety containing two rings, where the second ring is formed via a bridge connecting two atoms of the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In some embodiments, the furanosyl sugar moiety is a ribosyl moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.

[0025] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions (eg, inside a cell, animal, or human).

[0026] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide, or one or more portions thereof, and the nucleobases of another nucleic acid, or one or more portions thereof, can hydrogen bond with each other when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of the other nucleic acid are aligned in opposite directions. As used herein, complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are permitted. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to another oligonucleotide or to a target nucleic acid at every nucleobase position of the shorter of the two oligonucleotides, or at every nucleoside position if the oligonucleotides are the same length.

[0027] As used herein, "conjugate group" means a group of atoms that is directly or indirectly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide.

[0028] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0029] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0030] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" refers to nucleobases that are immediately adjacent to one another in a sequence.

[0031] As used herein, "cEt" means a 4'-2' bridge in place of the 2'OH group of a ribosyl sugar moiety, which bridge has the formula 4'-CH(CH3)-O-2', with the methyl group in the bridge adopting the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety having a 4'-2' bridge in place of the 2'OH group of a ribosyl sugar moiety, which bridge has the formula 4'-CH(CH3)-O-2', with the methyl group in the bridge adopting the S configuration. "cEt" means constrained ethyl.

[0032] As used herein, "cEt nucleoside" refers to a nucleoside containing a cEt sugar moiety. As used herein, a "chirally enriched population" refers to a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules in the population containing a particular stereochemical configuration at a particular chiral center is increased relative to the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom. A chirally enriched population of molecules having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0033] As used herein, "chiral controlled" with respect to an internucleoside bond means that the chirality of that bond is enriched in a particular stereochemical configuration.

[0034] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, at least 70% of which are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0035] As used herein, "gapmer" refers to a modified oligonucleotide containing an internal region having multiple nucleosides that support RNase H cleavage, separated by external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a "gap," and the external regions can be referred to as "wings." The internal region is a deoxyribonucleotide region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5' end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, position 2, position 3, position 4, or position 5 of the gap, with the remaining nucleosides in the gap being 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0036] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is suitable for oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

[0037] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0038] As used herein, " internucleoside bond" refers to the covalent bond between consecutive nucleosides in an oligonucleotide.As used herein, " modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond." Phosphorothioate internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0039] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0040] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety containing a modification (such as a substituent) that does not form a bridge between two atoms of the sugar to form a second ring.

[0041] As used herein, "mismatch" or "non-complementary" means that when the first and second oligonucleotides are aligned, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or target nucleic acid.

[0042] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0043] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" refers to an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar modification or internucleoside linkage modification.

[0044] As used herein, "nucleoside" refers to a compound or compound fragment containing a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside containing a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0045] As used herein, "oligomeric compound" refers to an oligonucleotide and optionally one or more additional features (such as a conjugate group or a terminal group). An oligomeric compound can be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or can be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleic acid base sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0046] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, where each nucleoside and each internucleoside linkage can be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0047] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to a subject. Particular such carriers are: The pharmaceutical compositions can be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0048] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.

[0049] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a specific cell line.

[0050] As used herein, "prodrug" refers to an exogenous form of a therapeutic agent that is converted to a different form within a subject or its cells. Typically, the conversion of the prodrug within the subject is facilitated by the activity of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0051] As used herein, "reducing the amount or activity" refers to a decrease or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.

[0052] As used herein, "RNA" means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0053] As used herein, "RNAi compound" refers to an antisense compound that acts to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid, at least in part, through RISC or Ago2. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound regulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0054] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that hybridizes at least partially with itself.

[0055] As used herein, "standard in vitro assay" or "standard cellular assay" means the assay described in Example 1 and reasonable variations thereof.

[0056] As used herein, "standard in vivo assay" means the assay described in Example 6 and reasonable variations thereof.

[0057] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center with random stereochemical configuration. For example, in a population of molecules containing a stereorandom chiral center, the number of molecules with the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules with the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a chiral center that is a stereorandom phosphorothioate nucleoside. It is an inter-sid bond.

[0058] As used herein, "subject" means a human or non-human animal.

[0059] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0060] As used herein, "sugar surrogate" refers to a modified sugar moiety, other than a furanosyl moiety, that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group, within an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0061] As used herein, "symptom or feature" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or a medical professional examining or testing the subject. In certain embodiments, the feature is apparent on an invasive diagnostic test, including, but not limited to, a post-mortem examination. In certain embodiments, the feature is apparent on an MRI scan of the brain.

[0062] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that is intended to be affected by an antisense compound.

[0063] As used herein, "target region" means that portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0064] As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to the end of an oligonucleotide.

[0065] As used herein, "therapeutically effective amount" refers to an amount of an agent that provides a therapeutic benefit to a subject, e.g., ameliorates a symptom or characteristic of a disease.

[0066] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0067] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an ATXN1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0068] Embodiment 2. Oligomerization involving modified oligonucleotides consisting of 12 to 30 linked nucleosides wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of SEQ ID NOs: 22 to 3624 or SEQ ID NO: 3655.

[0069] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleic acid bases of any of SEQ ID NOs: 3625 to 3654 or 3656 to 3669.

[0070] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, a portion of equal length from nucleobases 5472 to 5552 of SEQ ID NO: 1; a portion of equal length from nucleobases 5906 to 6005 of SEQ ID NO: 1; an equal length portion of nucleobases 7868 to 7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481 to 8514 of SEQ ID NO: 1; or Equal length segments of nucleobases 446679 to 446706 of SEQ ID NO: 2 wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to:

[0071] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, SEQ ID NO: 196, SEQ ID NO: 274, SEQ ID NO: 352, SEQ ID NO: 430, SEQ ID NO: 508, SEQ ID NO: 2578, SEQ ID NO: 2655, SEQ ID NO: 2732, SEQ ID NO: 2809, SEQ ID NO: 2886, SEQ ID NO: 2963, SEQ ID NO: 3121, SEQ ID NO: 3122, SEQ ID NO: 3190, SEQ ID NO: 3191, SEQ ID NO: 3192, SEQ ID NO: 3262, SEQ ID NO: 3330, SEQ ID NO: 3331, SEQ ID NO: 3332, SEQ ID NO: 3401, SEQ ID NO: 3402, SEQ ID NO: 3575, SEQ ID NO: 3577, SEQ ID NO: 3620, SEQ ID NO: 3624, SEQ ID NOs: 3638 to 3640, SEQ ID NOs: 3653 to 3655, SEQ ID NO: 3662, SEQ ID NO: 3665, SEQ ID NO: 3669, SEQ ID NO: 42, SEQ ID NO: 120, SEQ ID NO: 198, SEQ ID NO: 276, SEQ ID NO: 509, SEQ ID NO: 587, SEQ ID NO: 2502, SEQ ID NO: 2579, SEQ ID NO: 2656, SEQ ID NO: 2733, SEQ ID NO: 2810, SEQ ID NO: 2887, SEQ ID NO: 2964, SEQ ID NO: 3585, SEQ ID NOs: 3588 to 3590, SEQ ID NO: 3615, SEQ ID NO: 3618, SEQ ID NO: 3622, SEQ ID NO: 3657, SEQ ID NO: 3660, SEQ ID NO: 3661, SEQ ID NO: 3663, SEQ ID NO: 3664, SEQ ID NOs: 3666 to 3668, SEQ ID NO: 48, SEQ ID NO: 126, SEQ ID NO: 2044, SEQ ID NO: 2121, SEQ ID NO: 128, SEQ ID NO: 206, SEQ ID NO: 284, SEQ ID NO: 1045, SEQ ID NO: 1122, SEQ ID NO: 1199, and SEQ ID NO: 1276, or SEQ ID NO: 2475, SEQ ID NO: 2552, SEQ ID NO: 2629, SEQ ID NO: 2706, SEQ ID NO: 2783, SEQ ID NO: 3627 to 3630, SEQ ID NO: 3644 At least 8, at least 9, at least 10, at least The oligomeric compounds, wherein said modified oligonucleotide has a nucleobase sequence comprising 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleobases.

[0072] Embodiment 6. 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0073] Embodiment 7. 7. The oligomeric compound according to any of embodiments 1 to 6, wherein said modified oligonucleotide comprises at least one modified nucleoside.

[0074] Embodiment 8. 8. The oligomeric compound of embodiment 7, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0075] Embodiment 9. 9. The oligomeric compound of embodiment 8, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0076] Embodiment 10. 10. The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0077] Embodiment 11. 11. The oligomeric compound of any of embodiments 7-10, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

[0078] Embodiment 12. 12. The oligomeric compound of embodiment 11, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe modified sugar moiety.

[0079] Embodiment 13. 9. The oligomeric compound according to any of embodiments 7-8, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

[0080] Embodiment 14. 14. The oligomeric compound of embodiment 13, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

[0081] Embodiment 15. The oligomeric compound of any of embodiments 1-8 or embodiments 11-14, wherein said modified oligonucleotide does not comprise a bicyclic sugar moiety.

[0082] Embodiment 16. 16. The method of any one of embodiments 1 to 15, wherein the modified oligonucleotide is a gapmer. The oligomeric compounds described above.

[0083] Embodiment 17. the modified oligonucleotide comprises a sugar motif, the sugar motif comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and A 3' region consisting of 1 to 6 linked 3' region nucleosides Including, 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyfuranosyl sugar moiety.

[0084] Embodiment 18. the modified oligonucleotide comprises a sugar motif, the sugar motif comprising: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides Including, 18. The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0085] Embodiment 19. the modified oligonucleotide comprises a sugar motif, the sugar motif comprising: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and A 3' region consisting of five linked 3' region nucleosides Including, 18. The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0086] Embodiment 20. the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and 18. The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0087] Embodiment 21. the modified oligonucleotide is a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides and each of the 5' region nucleosides comprises a 2'-MOE sugar moiety, each of the 3' region nucleosides is selected from 2'-MOE nucleosides and cEt nucleosides; 18. The oligomeric compound of embodiment 17, wherein each of the region nucleosides comprises a 2'-β-D-deoxynucleoside.

[0088] Embodiment 22. the modified oligonucleotide comprises a sugar motif, the sugar motif comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and A 3' region consisting of 1 to 6 linked 3' region nucleosides Including, each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety; The central region has the formula: (Nd)(Nx)(Nd)n and wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside; 17. The oligomeric compound according to any one of embodiments 1 to 16, wherein n is 6 to 8.

[0089] Embodiment 23. the modified oligonucleotide comprises a sugar motif, the sugar motif comprising: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and A 3' region consisting of four linked 3' region nucleosides Including, each of the 5' region nucleosides and each of the 3' region nucleosides are selected from 2'-MOE nucleosides and cEt nucleosides; The central region has the formula: (Nd)(Nx)(Nd)n and wherein Nx is a 2'-OMe nucleoside and each Nd is a 2'-β-D-deoxynucleoside; 17. The oligomeric compound according to any one of embodiments 1 to 16, wherein n is 7.

[0090] Embodiment 24. 24. The oligomeric compound according to any of embodiments 1 to 23, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0091] Embodiment 25. 25. The oligomeric compound of embodiment 24, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0092] Embodiment 26. 26. The oligomeric compound of embodiment 24 or embodiment 25, wherein said modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0093] Embodiment 27. The oligomeric compound of embodiment 24 or embodiment 26, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0094] Embodiment 28. The oligomeric compound of any of embodiment 24, embodiment 26, or embodiment 27, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0095] Embodiment 29. the modified oligonucleotide has an internucleoside linkage motif selected from: soooosssssssssssooss, sssossssssssssssss, sssosssssssssss, or soooooossssssssss; The oligomeric compound of any one of embodiments 1-24 or 26-28, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.

[0096] Embodiment 30. 30. The oligomeric compound according to any one of embodiments 1 to 29, wherein said modified oligonucleotide comprises a modified nucleobase.

[0097] Embodiment 31. 31. The oligomeric compound according to embodiment 30, wherein said modified nucleobase is 5-methylcytosine.

[0098] Embodiment 32. 32. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 16-18, 14-20, 15-17, 15-25, 16-20, or 17-20 linked nucleosides.

[0099] Embodiment 33. The oligomeric compound of any of embodiments 1-2, 4-19, 22, or 24-31, wherein the modified oligonucleotide consists of 18-22 or 18-20 linked nucleosides.

[0100] Embodiment 34. The oligomeric compound of any of embodiments 1-17 or 20-32, wherein said modified oligonucleotide consists of 17 linked nucleosides.

[0101] Embodiment 35. The oligomeric compound of any of embodiments 1-2, 4-19, 22, or 24-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0102] Embodiment 36. 36. The oligomeric compound according to any one of embodiments 1 to 35, consisting of said modified oligonucleotide.

[0103] Embodiment 37. 36. The oligomeric compound according to any of embodiments 1 to 35, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0104] Embodiment 38. 38. The oligomeric compound according to embodiment 37, wherein the conjugate linker consists of a single bond. thing.

[0105] Embodiment 39. 38. The oligomeric compound according to embodiment 37, wherein said conjugate linker is cleavable.

[0106] Embodiment 40. 38. The oligomeric compound of embodiment 37, wherein said conjugate linker comprises 1 to 3 linker nucleosides.

[0107] Embodiment 41. 41. The oligomeric compound according to any of embodiments 37 to 40, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0108] Embodiment 42. 41. The oligomeric compound according to any of embodiments 37 to 40, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0109] Embodiment 43. The oligomeric compound of any one of embodiments 1-35 or embodiments 37-42, comprising a terminal group.

[0110] Embodiment 44. 44. The oligomeric compound according to any one of embodiments 1 to 43, wherein said oligomeric compound is a single-stranded oligomeric compound.

[0111] Embodiment 45. The oligomeric compound of any of embodiments 1-39 or embodiments 41-42, wherein said oligomeric compound does not comprise a linker nucleoside.

[0112] Embodiment 46. An oligomeric duplex comprising an oligomeric compound according to any of embodiments 1 to 43 or embodiment 45.

[0113] Embodiment 47. An antisense compound comprising an oligomeric compound according to any one of embodiments 1 to 45 or an oligomeric duplex according to embodiment 46, or an antisense compound consisting of said oligomeric compound or said oligomeric duplex.

[0114] Embodiment 48. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 45 or an oligomeric duplex according to embodiment 46, and a pharmaceutically acceptable carrier or diluent.

[0115] Embodiment 49. The pharmaceutical composition of embodiment 48, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.

[0116] Embodiment 50. 50. The pharmaceutical composition of embodiment 49, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the artificial cerebrospinal fluid.

[0117] Embodiment 51. A method comprising administering to a subject the pharmaceutical composition of any of embodiments 48 to 50.

[0118] Embodiment 52. A method for treating an ATXN1-related disease, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 48 to 50 to an individual having or at risk of developing an ATXN1-related disease, thereby treating the ATXN1-related disease.

[0119] Embodiment 53. The method of embodiment 52, wherein the ATXN1-associated disease is spinocerebellar ataxia type 1.

[0120] Embodiment 54. The method of any of embodiments 51-52, wherein at least one symptom or feature of the ATXN1-associated disease is ameliorated.

[0121] Embodiment 55. The method of embodiment 54, wherein the symptom or characteristic is ataxic gait or limb ataxia, cognitive impairment, difficulty speaking or swallowing, atrophy of the cerebellum and / or brainstem seen on magnetic resonance imaging (MRI), neurochemical abnormalities of the cerebellum and / or brainstem detected by magnetic resonance spectroscopy (MRS), or death within 10 to 15 years from symptom onset.

[0122] Embodiment 56. The method of any of embodiments 51-53, wherein the ATXN1 level in the individual is reduced.

[0123] Embodiment 57. The chemical structure below: [ka] or a salt thereof.

[0124] Embodiment 58. The chemical structure below: [ka] or a salt thereof.

[0125] Embodiment 59. The chemical structure below: [ka] or a salt thereof.

[0126] Embodiment 60. The chemical structure below: [ka] or a salt thereof.

[0127] Embodiment 61. The chemical structure below: [ka] or a salt thereof.

[0128] Embodiment 62. The chemical structure below: [ka] or a salt thereof.

[0129] Embodiment 63. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0130] Embodiment 64. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0131] Embodiment 65. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0132] Embodiment 66. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0133] Embodiment 67. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0134] Embodiment 68. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0135] Embodiment 69. The modified oligonucleotide of embodiments 57 to 62, which is a sodium salt or a potassium salt.

[0136] Embodiment 70. Chemical notation for: Ges m CEO Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo Teo Tes m Ces Ae (SEQ ID NO: 126) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0137] Embodiment 71. Chemical notation for: Ges m CEO Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe (SEQ ID NO: 1045) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0138] Embodiment 72. Chemical notation for: Ges m CEO mCeo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes m Ce (sequence number 2552) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0139] Embodiment 73. Chemical notation for: Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m CEO m Ces Aes Te (SEQ ID NO: 3190) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0140] Embodiment 74. Chemical notation for: m Ces m CEO m Ceo Geo Tes Ads Tds Tds m CDs m Cds Tds m Cds Tds Tds Ads m CEO m Ceo Aes Tes m Ce (SEQ ID NO: 3590) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0141] Embodiment 75. Chemical notation for: Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m A compound comprising a modified oligonucleotide represented by Ce (SEQ ID NO: 3638), In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0142] Embodiment 76. 79. The compound of any of embodiments 73-78, comprising the modified oligonucleotide covalently linked to a conjugate group.

[0143] Embodiment 77. A chiral enriched population of modified oligonucleotides described in any of embodiments 57 to 68, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0144] Embodiment 78. The population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration. 78. The chiral enriched population of embodiment 77.

[0145] Embodiment 79. 78. The chirally enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides in which the stereochemical configuration of each phosphorothioate internucleoside linkage is an independently selected specific one.

[0146] Embodiment 80. 78. The chiral enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides in which one particular phosphorothioate internucleoside linkage has the (Rp) configuration and each of the remaining phosphorothioate internucleoside linkages has the (Sp) configuration.

[0147] Embodiment 81. 78. The chiral enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages having, in 5'→3' order, the Sp configuration, the Sp configuration, and the Rp configuration.

[0148] Embodiment 82. 69. The population of modified oligonucleotides of any of embodiments 57-68, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

[0149] Embodiment 83. A pharmaceutical composition comprising a population of modified oligonucleotides according to any of embodiments 77 to 82 and a pharmaceutically acceptable diluent or carrier.

[0150] Embodiment 84. A pharmaceutical composition comprising a modified oligonucleotide or compound according to any of embodiments 62 to 75 and a pharmaceutically acceptable diluent or carrier.

[0151] Embodiment 85. The pharmaceutical composition of embodiment 84, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline.

[0152] 86. The pharmaceutical composition of embodiment 85, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and said artificial cerebrospinal fluid or phosphate buffered saline.

[0153] Embodiment 87. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an ATXN1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0154] Embodiment 88. 88. The oligomeric compound of embodiment 87, wherein said ATXN1 nucleic acid has the nucleobase sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0155] Embodiment 89. The nucleobase sequence of said modified oligonucleotides comprises equal length segments of nucleobases: a portion of equal length from nucleobases 5472 to 5552 of SEQ ID NO: 1; a portion of equal length from nucleobases 5906 to 6005 of SEQ ID NO: 1; an equal length portion of nucleobases 7868 to 7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481 to 8514 of SEQ ID NO: 1; or Equal length segments of nucleobases 446679 to 446706 of SEQ ID NO: 2 The oligomeric compound of embodiment 87 or embodiment 88, which is at least 80% complementary to

[0156] Embodiment 90. The nucleobase sequence of said modified oligonucleotides comprises equal length segments of nucleobases: an equal length portion of nucleobases 5489 to 5508 of SEQ ID NO: 1; an equal length portion of nucleobases 5491 to 5507 of SEQ ID NO: 1; a portion of equal length from nucleobases 5912 to 5931 of SEQ ID NO: 1; an equal length portion of nucleobases 7892 to 7911 of SEQ ID NO: 1; a portion of equal length from nucleobases 8481 to 8500 of SEQ ID NO: 1, or Equal length segments of nucleobases 446680 to 446699 of SEQ ID NO: 2 90. The oligomeric compound according to any of embodiments 87-89, which is at least 80% complementary to

[0157] Embodiment 91. 91. The oligomeric compound of any of embodiments 87-90, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the ATXN1 nucleic acid.

[0158] Embodiment 92. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of SEQ ID NOs: 22 to 3624 or SEQ ID NO: 3655.

[0159] Embodiment 93. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleic acid bases of any of SEQ ID NOs: 3625 to 3654 or 3656 to 3669.

[0160] 94. The oligomeric compound of embodiment 92 or embodiment 93, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 22-3669.

[0161] 95. 95. The oligomeric compound of embodiment 94, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 22 to 3669.

[0162] 96. SEQ ID NO: 196, SEQ ID NO: 274, SEQ ID NO: 352, SEQ ID NO: 430, SEQ ID NO: 508, SEQ ID NO: 2578, SEQ ID NO: 2655, SEQ ID NO: 2732, SEQ ID NO: 2809, SEQ ID NO: 2886, SEQ ID NO: 2963, SEQ ID NO: 3121, SEQ ID NO: 3122, SEQ ID NO: 3190, SEQ ID NO: 3191, SEQ ID NO: 3192, SEQ ID NO: 3262, SEQ ID NO: 3330, SEQ ID NO: 3331, SEQ ID NO: 3332, SEQ ID NO: 3401, SEQ ID NO: 3402, SEQ ID NO: 3575, SEQ ID NO: 3577, SEQ ID NO: 3620, SEQ ID NO: 3624, SEQ ID NOs: 3638 to 3640, SEQ ID NOs: 3653 to 3655, SEQ ID NO: 3662, SEQ ID NO: 3665, SEQ ID NO: 3669, SEQ ID NO: 42, SEQ ID NO: 120, SEQ ID NO: 198, SEQ ID NO: 276, SEQ ID NO: 509, SEQ ID NO: 587, SEQ ID NO: 2502, SEQ ID NO: 2579, SEQ ID NO: 2656, SEQ ID NO: 2733, SEQ ID NO: 2810, SEQ ID NO: 2887, SEQ ID NO: 2964, SEQ ID NO: 3585, SEQ ID NOs: 3588 to 3590, SEQ ID NO: 3615, SEQ ID NO: 3618, SEQ ID NO: 3622, SEQ ID NO: 3657, SEQ ID NO: 3660, SEQ ID NO: 3661, SEQ ID NO: 3663, SEQ ID NO: 3664, SEQ ID NOs: 3666 to 3668, SEQ ID NO: 48, SEQ ID NO: 126, SEQ ID NO: 2044, SEQ ID NO: 2121, SEQ ID NO: 128, SEQ ID NO: 206, SEQ ID NO: 284, SEQ ID NO: 1045, SEQ ID NO: 1122, SEQ ID NO: 1199, and SEQ ID NO: 1276, or SEQ ID NO: 2475, SEQ ID NO: 2552, SEQ ID NO: 2629, SEQ ID NO: 2706, SEQ ID NO: 2783, SEQ ID NO: 3627 to 3630, SEQ ID NO: 3644 96. The oligomeric compound of any of embodiments 92-95, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleobases of a sequence selected from:

[0163] 97. 96. The oligomeric compound of any of embodiments 92-95, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or 17 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 3638.

[0164] Embodiment 98. 96. The oligomeric compound of any of embodiments 92-95, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 126, SEQ ID NO: 1045, SEQ ID NO: 2552, SEQ ID NO: 3190, or SEQ ID NO: 3590.

[0165] Embodiment 99. 99. The oligomeric compound of embodiment 97 or embodiment 98, wherein the modified oligonucleotide consists of 17 to 30 linked nucleosides and has a nucleobase sequence comprising any of the following nucleobase sequences: 126, 1045, 2552, 3190, 3590, or 3638.

[0166] Embodiment 100. The modified oligonucleotide is 126, 1045, 2552, 3190, 3590, or 3638 of any one of the nucleobase sequences.

[0167] Embodiment 101. The oligomeric compound of any of embodiments 92 to 100, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the ATXN1 nucleic acid, and the ATXN1 nucleic acid has the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0168] Embodiment 102. 102. The oligomeric compound according to any of embodiments 87-101, wherein at least one nucleoside of said modified oligonucleotide comprises a modified sugar moiety.

[0169] Embodiment 103. 103. The oligomeric compound of embodiment 102, wherein said modified sugar moiety comprises a bicyclic sugar moiety.

[0170] Embodiment 104. 104. The oligomeric compound of embodiment 103, wherein said bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0171] Embodiment 105. 105. The oligomeric compound of any of embodiments 102-104, wherein said modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0172] Embodiment 106. 106. The oligomeric compound of embodiment 105, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe modified sugar moiety.

[0173] Embodiment 107. 107. The oligomeric compound according to any of embodiments 102 to 106, wherein at least one nucleoside of said modified oligonucleotide comprises a sugar surrogate.

[0174] Embodiment 108. The oligomeric compound according to embodiment 107, wherein said sugar surrogate is selected from morpholino and PNA.

[0175] Embodiment 109. The oligomeric compound according to any of embodiments 87-102 or embodiments 105-108, wherein said modified oligonucleotide does not comprise a bicyclic sugar moiety.

[0176] Embodiment 110. The oligomeric compound according to any of embodiments 87 to 109, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0177] Embodiment 111. 111. The oligomeric compound according to embodiment 110, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0178] Embodiment 112. The oligomeric compound according to embodiment 110 or embodiment 111, wherein each internucleoside linkage is a modified internucleoside linkage.

[0179] Embodiment 113. The oligomeric compound according to embodiment 112, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0180] Embodiment 114. 112. The oligomeric compound according to any of embodiments 110-111, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

[0181] Embodiment 115. 110. The oligomeric compound according to any of embodiments 87-109, wherein each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0182] Embodiment 116. 116. The oligomeric compound according to any of embodiments 87-115, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

[0183] Embodiment 117. the modified oligonucleotide has an internucleoside linkage motif selected from: soooosssssssssssooss, sssossssssssssssss, sssosssssssssss, or soooooossssssssss; 117. The oligomeric compound according to embodiment 116, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.

[0184] Embodiment 118. 118. The oligomeric compound according to any of embodiments 87-117, wherein said modified oligonucleotide comprises a modified nucleobase.

[0185] Embodiment 119. 119. The oligomeric compound according to embodiment 118, wherein said modified nucleobase is 5-methylcytosine.

[0186] Embodiment 120. 34. The oligomeric compound according to any one of embodiments 1 to 33, wherein said modified oligonucleotide comprises a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides.

[0187] Embodiment 121. The oligomeric compound of embodiment 120, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside.

[0188] Embodiment 122. The oligomeric compound of embodiment 120 or embodiment 121, wherein said deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

[0189] Embodiment 123. 123. The oligomeric compound of any of embodiments 120-122, wherein each nucleoside immediately adjacent to said deoxy region comprises a modified sugar moiety.

[0190] Embodiment 124. the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and adjacent on the 3' side to a 3' exoregion consisting of 1 to 6 linked 3' region nucleosides; the 3'-most nucleoside of said 5' region comprises a modified sugar moiety; 123. The oligomeric compound according to any of embodiments 120-122, wherein the 5'-most nucleoside of said 3' region comprises a modified sugar moiety.

[0191] Embodiment 125. 125. The oligomeric compound of embodiment 124, wherein each nucleoside of said 3' region comprises a modified sugar moiety.

[0192] Embodiment 126. The oligomeric compound of embodiment 124 or embodiment 125, wherein each nucleoside of said 5' region comprises a modified sugar moiety.

[0193] Embodiment 127. the modified oligonucleotide is 5' region consisting of 1 to 6 linked nucleosides a deoxy region consisting of 6 to 10 linked nucleosides, and 3' region consisting of 1 to 6 linked nucleosides and 127. The oligomeric compound of embodiments 120-126, wherein each of said 5' region nucleosides and each of said 3' region nucleosides comprises a modified sugar moiety.

[0194] Embodiment 128. the modified oligonucleotide is a 5' region consisting of six linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and A 3' region consisting of four linked nucleosides and The oligomeric compound of embodiment 127, wherein each of said 5' region nucleosides and each of said 3' region nucleosides is a 2'-MOE nucleoside and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside.

[0195] Embodiment 129. the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a central region consisting of 10 linked nucleosides, and A 3' region consisting of five linked nucleosides and The oligomeric compound of embodiment 127, wherein each of said 5' region nucleosides and each of said 3' region nucleosides is a 2'-MOE nucleoside and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside.

[0196] Embodiment 130. the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a deoxy region consisting of eight linked nucleosides, and A 3' region consisting of four linked nucleosides and The oligomeric compound of embodiment 127, wherein each of said 5' region nucleosides and each of said 3' region nucleosides is a 2'-MOE nucleoside and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside.

[0197] Embodiment 131. the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a deoxy region consisting of eight linked nucleosides, and A 3' region consisting of four linked nucleosides and The oligomeric compound of embodiment 127, wherein each of said 5' region nucleosides is a 2'-MOE nucleoside, each of said 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside.

[0198] Embodiment 132. the modified oligonucleotide is a 5' region consisting of 3 to 7 linked nucleosides; a deoxy region consisting of 6 to 8 linked nucleosides, and 3' region consisting of 3 to 6 linked nucleosides and Each of the 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and the 5' region has the following formula: (Nk)n(Nd)(Nx) and wherein each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside; The oligomeric compound of any of embodiments 87-119, wherein n is 1-5.

[0199] Embodiment 133. the modified oligonucleotide is a 5' region consisting of seven linked nucleosides; a deoxy region consisting of six linked nucleosides, and A 3' region consisting of four linked nucleosides and Each of the 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and the 5' region has the following formula: (Nk)n(Nd)(Nx) and wherein each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside; The oligomeric compound of any of embodiments 87-119, wherein n is 5 or greater.

[0200] Embodiment 134. The modified oligonucleotide may be 12 to 30, 12 to 22, 12 to 20, or 14 to 1 The oligomeric compound according to any of embodiments 87-133, consisting of 8, 16-18, 14-20, 15-17, 15-25, 16-20, or 17-20 linked nucleosides.

[0201] Embodiment 135. The oligomeric compound according to any of embodiments 87 to 132, wherein said modified oligonucleotide consists of 18 to 22 or 18 to 20 linked nucleosides.

[0202] Embodiment 136. The oligomeric compound according to any of embodiments 87 to 133, wherein said modified oligonucleotide consists of 17 linked nucleosides.

[0203] Embodiment 137. The oligomeric compound according to any of embodiments 87 to 132, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0204] Embodiment 138. Chemical notation for: Ges m CEO Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo Teo Tes m Ces Ae (SEQ ID NO: 126) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0205] Embodiment 139. Chemical notation for: Ges m CEO Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe (SEQ ID NO: 1045) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0206] Embodiment 140. Chemical notation for: Ges m CEO m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds mCeo Teo Tes Tes m Ce (sequence number 2552) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0207] Embodiment 141. Chemical notation for: Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m CEO m Ces Aes Te (SEQ ID NO: 3190) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0208] Embodiment 142. Chemical notation for: m Ces m CEO m Ceo Geo Tes Ads Tds Tds m CDs m Cds Tds m Cds Tds Tds Ads m CEO m Ceo Aes Tes m Ce (SEQ ID NO: 3590) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0209] Embodiment 143. Chemical notation for: Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m Ce (sequence number 3638) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage.

[0210] Embodiment 144. 144. The oligomeric compound according to any one of embodiments 87 to 143, consisting of said modified oligonucleotide.

[0211] Embodiment 145. 145. The oligomeric compound according to any of embodiments 87 to 144, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0212] Embodiment 146. 146. The oligomeric compound according to embodiment 145, wherein said conjugate linker consists of a single bond.

[0213] Embodiment 147. The oligomeric compound according to embodiment 145, wherein said conjugate linker is cleavable.

[0214] Embodiment 148. The oligomeric compound according to embodiment 145, wherein said conjugate linker comprises 1 to 3 linker nucleosides.

[0215] Embodiment 149. The oligomeric compound according to any of embodiments 145 to 148, wherein said conjugate linker does not comprise any linker nucleosides.

[0216] 150. 149. The oligomeric compound according to any of embodiments 145 to 148, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0217] Embodiment 151. 149. The oligomeric compound according to any of embodiments 145 to 148, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0218] Embodiment 152. The oligomeric compound of any one of embodiments 87-143 or embodiments 146-148, comprising a terminal group.

[0219] Embodiment 153. 153. The oligomeric compound of embodiment 152, wherein said terminal group is an abasic sugar moiety.

[0220] Embodiment 154. The oligomeric compound according to any one of embodiments 87 to 153, wherein said oligomeric compound is a single-stranded oligomeric compound.

[0221] Embodiment 155. The chemical structure below: [ka] or a salt thereof.

[0222] Embodiment 156. The chemical structure below: [ka] or a salt thereof.

[0223] Embodiment 157. The chemical structure below: [ka] or a salt thereof.

[0224] Embodiment 158. The chemical structure below: [ka] or a salt thereof.

[0225] Embodiment 159. The chemical structure below: [ka] or a salt thereof.

[0226] Embodiment 160. The chemical structure below: [ka] or a salt thereof.

[0227] Embodiment 161. The modified oligonucleotide of any of embodiments 155 to 160, which is a sodium or potassium salt.

[0228] Embodiment 162. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0229] Embodiment 163. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0230] Embodiment 164. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0231] 165. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0232] Embodiment 166. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0233] Embodiment 167. The chemical structure below: [ka] A modified oligonucleotide having the formula:

[0234] Embodiment 168. A chiral enriched population of oligomeric compounds according to any of embodiments 87 to 154 or a chiral enriched population of modified oligonucleotides according to embodiments 155 to 167, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0235] Embodiment 169. 169. The chiral enriched population of embodiment 168, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

[0236] Embodiment 170. 16. The population is enriched for modified oligonucleotides in which the stereochemical configuration of each phosphorothioate internucleoside linkage is an independently selected specific one. 9. A chiral enriched population according to claim 9.

[0237] Embodiment 171. 171. The chiral enriched population of embodiment 170, wherein the population is enriched for modified oligonucleotides in which one particular phosphorothioate internucleoside linkage has the (Rp) configuration and each of the remaining phosphorothioate internucleoside linkages has the (Sp) configuration.

[0238] Embodiment 172. 172. The chiral enriched population of embodiment 171, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages having, in 5'→3' order, the Sp configuration, the Sp configuration, and the Rp configuration.

[0239] Embodiment 173. A population of oligomeric compounds comprising the modified oligonucleotides of any of embodiments 87 to 154, or the population of modified oligonucleotides of embodiments 155 to 167, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0240] Embodiment 174. 154. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound described in any one of embodiments 87 to 154.

[0241] Embodiment 175. 175. The oligomeric duplex of embodiment 174, wherein said second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 30 linked nucleosides, and the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of said first modified oligonucleotide.

[0242] Embodiment 176. The oligomeric duplex of embodiment 174 or embodiment 175, wherein said modified oligonucleotide of said first oligomeric compound comprises a 5' stabilizing phosphate group.

[0243] Embodiment 177. 177. The oligomeric duplex of embodiment 176, wherein said stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate.

[0244] Embodiment 178. 178. The oligomeric duplex of any of embodiments 174-177, wherein said modified oligonucleotide of said first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate.

[0245] Embodiment 179. 179. The oligomeric duplex of any of embodiments 174-178, wherein said modified oligonucleotide of said first oligomeric compound comprises a 2'-NMA sugar moiety.

[0246] Embodiment 180. 179. The oligomeric duplex of any of embodiments 174-179, wherein at least one nucleoside of said second modified oligonucleotide comprises a modified sugar moiety.

[0247] Embodiment 181. 181. The oligomeric duplex of embodiment 180, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0248] Embodiment 182. The oligomeric duplex of embodiment 181, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0249] Embodiment 183. 183. The oligomeric duplex of embodiment 182, wherein the modified sugar moiety of said second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0250] Embodiment 184. The oligomeric duplex of embodiment 183, wherein said non-bicyclic modified sugar moiety of said second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0251] Embodiment 185. 185. The oligomeric duplex of any of embodiments 174-184, wherein at least one nucleoside of said second modified oligonucleotide comprises a sugar surrogate.

[0252] Embodiment 186. 186. The oligomeric duplex of any of embodiments 174-185, wherein at least one internucleoside linkage of said second modified oligonucleotide is a modified internucleoside linkage.

[0253] Embodiment 187. The oligomeric duplex of embodiment 186, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0254] Embodiment 188. The oligomeric duplex of any of embodiments 174-187, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

[0255] Embodiment 189. 189. The oligomeric duplex of any of embodiments 174-188, wherein each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0256] Embodiment 190. 189. The oligomeric duplex of any of embodiments 174-189, wherein each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.

[0257] Embodiment 191. 191. The oligomeric duplex of any of embodiments 174-190, wherein said second modified oligonucleotide comprises at least one modified nucleobase.

[0258] Embodiment 192. 192. The oligomeric duplex of embodiment 191, wherein said modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

[0259] Embodiment 193. 193. The oligomeric duplex of any of embodiments 174-192, wherein said second modified oligonucleotide comprises a conjugate group.

[0260] Embodiment 194. 194. The oligomeric duplex of embodiment 193, wherein said conjugate group comprises a conjugate linker and a conjugate moiety.

[0261] Embodiment 195. The oligomeric duplex of embodiment 193 or embodiment 194, wherein the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide.

[0262] Embodiment 196. The oligomeric duplex of embodiment 193 or embodiment 194, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the second modified oligonucleotide.

[0263] Embodiment 197. 197. The oligomeric duplex of any of embodiments 193-196, wherein said second modified oligonucleotide comprises a terminal group.

[0264] Embodiment 198. 198. The oligomeric duplex of embodiment 197, wherein said terminal group is an abasic sugar moiety.

[0265] Embodiment 199. The second modified oligonucleotide is 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25 199. The oligomeric duplex of any of embodiments 174-198, consisting of 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0266] Embodiment 200. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of embodiments 87 to 154, or a modified oligonucleotide according to any one of embodiments 155 to 167.

[0267] Embodiment 201. The antisense agent of embodiment 200, wherein the antisense agent is an oligomeric duplex as described in any of embodiments 174-199.

[0268] Embodiment 202. The antisense agent of embodiment 200 or embodiment 201, wherein the antisense agent is an RNaseH agent capable of reducing the amount of ATXN1 nucleic acid by activating RNaseH.

[0269] Embodiment 203. 203. The antisense agent of any of embodiments 200-202, wherein the conjugate group comprises a cell targeting moiety.

[0270] Embodiment 204. A pharmaceutical composition comprising an oligomeric compound according to any of embodiments 87-154, a modified oligonucleotide according to any of embodiments 155-167, a population according to any of embodiments 168-173, an oligomeric duplex according to any of embodiments 174-199, or an antisense agent according to any of embodiments 200-203, and a pharmaceutically acceptable carrier or diluent.

[0271] Embodiment 205. The pharmaceutical composition of embodiment 204, wherein the pharmaceutically acceptable diluent is water, phosphate buffered saline, or artificial cerebrospinal fluid.

[0272] Embodiment 206. 206. The pharmaceutical composition of embodiment 205, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and said artificial cerebrospinal fluid.

[0273] Embodiment 207. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 87-154, a modified oligonucleotide according to any one of embodiments 155-167, a population according to any one of embodiments 168-173, an oligomeric duplex according to any one of embodiments 174-199, an antisense agent according to any one of embodiments 200-203, or a pharmaceutical composition according to any one of embodiments 204-206.

[0274] Embodiment 208. A method of treating an ATXN1-related disease, comprising administering to a subject having an ATXN1-related disease a therapeutically effective amount of an oligomeric compound according to any one of embodiments 87-154, a modified oligonucleotide according to any one of embodiments 155-167, a population according to any one of embodiments 168-173, an oligomeric duplex according to any one of embodiments 174-199, an antisense agent according to any one of embodiments 200-203, or a pharmaceutical composition according to any one of embodiments 204-206, thereby treating the ATXN1-related disease.

[0275] Embodiment 209. The method of embodiment 208, wherein said ATXN1-associated disease is spinocerebellar ataxia type 1.

[0276] Embodiment 210. The method of any of embodiments 208-209, wherein at least one symptom or feature of the ATXN1-associated disease is ameliorated.

[0277] Embodiment 211. If the symptoms or features include ataxic gait or limb ataxia, cognitive impairment, difficulty speaking or swallowing, cerebellar and / or brainstem atrophy seen on magnetic resonance imaging (MRI), cerebellar and / or brainstem neurochemical abnormalities detected by magnetic resonance spectroscopy (MRS), 211. The method of embodiment 210, wherein the disease is fatal or occurs within 10 to 15 years from symptom onset.

[0278] Embodiment 212. The method of any of embodiments 208-211, wherein the ATXN1 level in the subject is reduced.

[0279] Embodiment 213. 10. A method for reducing expression of ATXN1 in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 87-154, a modified oligonucleotide according to any one of embodiments 155-167, a population according to any one of embodiments 168-173, an oligomeric duplex according to any one of embodiments 174-199, an antisense agent according to any one of embodiments 200-203, or a pharmaceutical composition according to any one of embodiments 204-206.

[0280] Embodiment 214. 214. The method of embodiment 213, wherein the cell is a CNS cell.

[0281] Embodiment 215. Use of an oligomeric compound according to any one of embodiments 87 to 154, a modified oligonucleotide according to any one of embodiments 155 to 167, a population according to any one of embodiments 168 to 173, an oligomeric duplex according to any one of embodiments 174 to 199, an antisense agent according to any one of embodiments 200 to 203, or a pharmaceutical composition according to any one of embodiments 204 to 206 for treating an ATXN1-related disorder.

[0282] Embodiment 216. Use of an oligomeric compound according to any one of embodiments 87 to 154, a modified oligonucleotide according to any one of embodiments 155 to 167, a population according to any one of embodiments 168 to 173, an oligomeric duplex according to any one of embodiments 174 to 199, an antisense agent according to any one of embodiments 200 to 203, or a pharmaceutical composition according to any one of embodiments 204 to 206 in the manufacture of a medicament for treating an ATXN1-related disorder.

[0283] Embodiment 217. The use of embodiment 215 or embodiment 216, wherein the ATXN1-associated disease is spinocerebellar ataxia type 1.

[0284] I. Specific Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.

[0285] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0286] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions in other types of modified sugar moieties.

[0287] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents on the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ), [Each R in the formula m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10and alkyl, as well as the 2'-substituents described in Cook et al., US Pat. No. 6,531,584; Cook et al., US Pat. No. 5,859,221; and Cook et al., US Pat. No. 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to: 5'-meryl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include one or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0288] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n ))) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is alkyl.

[0289] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0290] In certain embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0291] In certain embodiments, modified furanosyl sugar moieties and nucleosides comprising such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2' position compared to the 2'-deoxyfuranosyl sugar moiety, and therefore, such sugar moieties can have a total of 16 isomeric configurations. Unless otherwise specified, 2'-modified sugar moieties described herein have the β-D-ribosyl isomeric configuration.

[0292] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' linking sugar substitutions include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 7,741,457). al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), al., US 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a , and R bare independently H, a protecting group, or C1-C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0293] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups independently selected from the following: -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-; During the ceremony: x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkynyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heterocyclic radical aryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0294] It is possible to generate a large amount of nucleic acids in a stable manner, as described in Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J. Org. Chem.,2006,71,7731-7740,Singh et al.,Chem. Commun.,1998,4,455-456;Koshkin et al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg. Med. Chem. Lett.,1998,8,2219-2222;Singh et al.,J. Org. Chem.,1998,63,10035-10039;Srivastava et al.,J. Am. Chem. Soc.,2007,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al.US6,770,748;Imanishi et al.,USRE44,779;Wengel et al.,US6,794,499; al.,US6,670,461;Wengel et al.,US7,034,133;Wengel et al.,US8,080,644;Wengel et al.,US8,034,909; al.,US6,525,191;Torsten et al.,WO2004 / 106356;Wengel et al.,WO1999 / 014226;Seth et al.,WO2007 / 134181;Seth et al.,US7,547,684;Seth et al.,US7,666,854;Seth et al al.,US8,088,746;Seth et al.,US7,750,131;Seth et al.,US8,030,467;Seth et al.,US8,268,980;Seth et al.,US8,546,556;Seth et al.,U.See US Pat. No. 8,530,640; Migawa et al., US Pat. No. 9,012,421; Seth et al., US Pat. No. 8,501,805; and published U.S. patent applications Allerson et al., US 2008 / 0039618 and Migawa et al., US 2015 / 0191727.

[0295] In certain embodiments, bicyclic sugar moieties and nucleosides comprising such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleic acid Bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a specific bicyclic nucleoside (e.g., LNA or cEt) is identified in exemplary embodiments herein, it is in the β-D configuration unless otherwise specified.

[0296] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0297] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substitutions, as described above. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5'-position.

[0298] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acids (HNA), anitol nucleic acids (ANA), mannitol nucleic acids (MNA) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; Swayze et al., US 8,796,437; and Swayze et al., US 9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), as well as nucleosides containing additional modified THP compounds having the formula: [ka] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl.

[0299] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleotides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H. In certain embodiments, R1 is methoxy and R2 is H. In certain embodiments, R1 is methoxyethoxy and R2 is H.

[0300] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a nucleoside having the following formula: [ka] means a sugar substitute having the formula:

[0301] In certain embodiments, for example, morpholinos may be modified from the morpholino structures described above, e.g., by adding or modifying various substituents. Such sugar surrogates are referred to herein as "modified morpholinos."

[0302] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and Manoharan et al. al., WO2011 / 133876.

[0303] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art and can be used in modified nucleosides.

[0304] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise unmodified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise modified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise nucleobases (referred to as abasic nucleosides).

[0305] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-alapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5 -halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include bases in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0306] The slightly less expensive snowflakes and the slightly more expensive snowflakes The main ingredient is Manoharan et al.,US2003 / 0158403;Manoharan et al.,US2003 / 0175906;Dinh et al.,US4,845,205;Spielvogel et al.,US5,130,302;Rogers et al.,US5,134,066;Bischofberger et al al.,US5,175,273;Urdea et al.,US5,367,066;Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al al.,US5,484,908;Matteucci et al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al al.,US5,596,091;Cook et al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941;Cook et al.,US5,811,534;Cook et al.,US5,750,692; al.,US5,948,903;Cook et al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al.,6,166,199;

[0307] 3. Specific modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside linkage.Two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom.Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester (including phosphodiester linkage) "P(O2)=O" (also referred to as unmodified linkage or naturally occurring linkage), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P(O2)=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkages include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can alter, and typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as racemic mixtures or as individual enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0308] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages in which all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as is well understood by those skilled in the art, each individual phosphorothioate in an individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be synthesized using synthetic methods known in the art, e.g., Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 0 15555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be of stereorandom or specific stereochemical configuration.

[0309] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additionally, neutral internucleoside linkages include nonionic linkages containing siloxanes (dialkylsiloxanes), nonionic linkages containing carboxylate esters, nonionic linkages containing carboxamides, nonionic linkages containing sulfides, nonionic linkages containing sulfonate esters, and nonionic linkages containing amides (see, e.g., Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi, et al., J. Am. Chem. Soc. 1999, 103:111-112, 1999). and PD Cook,Eds.,ACS Symposium Series. 580; Chapters 3 and 4, 40-65). Additionally, neutral internucleoside linkages include non-ionic linkages containing a mixture of N, O, S, and CH element moieties. In certain embodiments, the neutral internucleoside linkage is any of those described in WO2021 / 030778, which is incorporated herein by reference.

[0310] B. Specific motifs In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases independent of the sequence of the nucleobases).

[0311] 1. Specific glycomotifs In certain embodiments, oligonucleotides comprise one or more types of modified and / or unmodified sugar moieties arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif. In some cases, such sugar motifs are referred to herein as "sugar motifs." The sugar modifications include, but are not limited to, any of the sugar modifications discussed above.

[0312] In certain embodiments, modified oligonucleotides have a gapmer motif, which is defined by two outer regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap contains one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric sugar gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0313] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0314] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0315] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, nucleosides on the gap side of each wing / gap junction comprise a 2'-deoxyribosyl sugar moiety, and nucleosides on the wing side of each wing / gap junction comprise a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer comprises a modified sugar moiety. In certain embodiments, one of the nucleosides of the gap comprises a modified sugar moiety, and the remaining nucleosides of the gap each comprise a 2'-deoxyribosyl sugar moiety.

[0316] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, where each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide comprises: Uniformly Modified Oligonucleotides In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0317] Here, the lengths (number of nucleosides) of the three regions of a gapmer can be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is a modification of each sugar moiety in each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of five linked nucleosides containing modified sugar moieties in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked nucleosides containing modified sugar moieties in the 3'-wing. A 5-8-5 mixed wing gapmer or a 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing.

[0318] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1 2'-MOE nucleoside, 2 linked 2'-MOE nucleosides, 3 linked 2'-MOE nucleosides, 4 linked 2'-MOE nucleosides, 5 linked 2'-MOE nucleosides, 6 linked 2'-MOE nucleosides, or 7 linked 2'-MOE nucleosides, and Y is selected from 7 linked deoxynucleosides, 8 linked deoxynucleosides, 9 linked deoxynucleosides, 10 linked deoxynucleosides, or 11 linked deoxynucleosides.

[0319] In certain embodiments, the modified oligonucleotide is one of the following (5'→3'): eeeeeddddddddkkee or eeeeedyddddddkkee wherein "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, "k" represents a cEt sugar moiety, and y represents a 2'-OMe sugar moiety.

[0320] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, a modified oligonucleotide Some or all of the cytosine nucleobases in the nucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0321] In certain embodiments, a modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within three nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within three nucleosides of the 5' end of the oligonucleotide.

[0322] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is present in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0323] 3. Specific internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P(O2)=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O2)=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages within the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, all of the internucleoside linkages are either phosphodiester or phosphorothioate internucleoside linkages, and the chiral motif is the following (5'→3'): Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp wherein each "Sp" represents an (Sp) phosphorothioate internucleoside linkage, each "Rp" is an Rp internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing such an internucleoside linkage motif.

[0324] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of soooossssssssssoss(5'→3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sssosssssssssssss(5'→3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sssossssssssss(5'→3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0325] C. A specific length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested in an oocyte injection model for their ability to induce cleavage of a target nucleic acid. 25 nucleobase-long oligonucleotides containing 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target nucleic acid, although this was inferior to oligonucleotides containing no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides (including those with one or three mismatches).

[0326] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, with the proviso that X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 1 3-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14- 28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25 , 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18 ~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26, 19~29, 19~28, 19~29, 19~30, 20~21, 20~22, 20~23, 20~24, 20~25, 20~26, 20~27, 20~28, 20~29, 20~30, 21~22, 21~23, 21~24, 21~25, 21~26, 21~27, 21~28, 21~29, 21~30, 22~23, 22~24, 22~2 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, 29-30, 29-30, 26-27, 26-28, 26-29, 26-30, 29-30, 28-29, 28-30, 29 ...

[0327] D. Certain Modified Oligonucleotides In certain embodiments, the modifications described above (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each of these parameters is independent of the other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not conform to the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be identical to or different from each other and may be identical to or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.

[0328] E. Specific populations of modified oligonucleotides A population of modified oligonucleotides in which all modified oligonucleotides in the population have the same molecular formula can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides in the chiral enriched population are enriched in β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in the chiral enriched population are enriched in both β-D ribosyl sugar moieties in a specific stereochemical configuration and at least one specific phosphorothioate internucleoside linkage.

[0329] F. Nucleic Acid Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, the oligonucleotides have a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In some embodiments, the nucleobase sequence of a portion or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0330] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of the oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of the oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of the oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of the oligonucleotide.

[0331] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0332] A. Specific Conjugate Groups In certain embodiments, the oligonucleotide is covalently bound to one or more conjugate groups. In certain embodiments, the conjugate group modulates one or more properties of the bound oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide.Specific conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937) , a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620).

[0333] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0334] In certain embodiments, the conjugate group comprises an active drug substance such as, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicin, barbiturate, cephalosporin, sulfa drug, antidiabetic drug, antibacterial drug, or antibiotic drug.

[0335] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker.In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond).In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain or an oligomer of repeating units of ethylene glycol, nucleoside, or amino acid units.

[0336] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0337] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, e.g., one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide, provided herein. Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0338] Examples of conjugate linkers include, but are not limited to, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, where a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0339] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desired for the linker nucleoside to be cleaved from the oligomeric compound after the oligomeric compound reaches the target site. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0340] As used herein, linker nucleosides are not considered part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also contains a conjugate group comprising a conjugated linker containing linker nucleosides, those linker nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the oligonucleotide's percent complementarity to the reference nucleic acid. For example, an oligomeric compound may contain (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 linker nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound exceeds 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutively linked nucleosides in such oligomeric compounds does not exceed 30. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0341] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in some situations, oligomeric compounds containing particular conjugate moieties are better taken up by particular cell types, but once the oligomeric compound is taken up, the conjugate group is cleaved to release the unconjugated oligonucleotide or parent oligonucleotide. It is desirable to release the oligonucleotide. Therefore, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises an atomic group having one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or in an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0342] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or a phosphodiester bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0343] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphodiester internucleoside bond and covalently linked to the conjugate linker or the remainder of the conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0344] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the following general formula: [ka] and In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0345] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0346] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety is covalently linked to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0347] B. Specific end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0348] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0349] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and produce at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acids. Such antisense compounds comprise a nucleic acid sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in such a manner as to produce significant undesired antisense activity.

[0350] In certain antisense activities, the hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in the cleavage of the target nucleic acid via RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, the antisense compounds described herein are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0351] In certain antisense activities, antisense compounds or portions of antisense compounds are loaded into the RNA-induced silencing complex (RISC), which ultimately cleaves the target nucleic acid. For example, certain antisense compounds cause the cleavage of the target nucleic acid by Argonaute. The antisense compounds loaded into RISC are RNAi compounds. RNAi The compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0352] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In some embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0353] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a nucleic acid encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or subject.

[0354] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0355] A. Complementarity / Mismatch to Target Nucleic Acid Mismatch bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was capable of reducing the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14-nucleobase oligonucleotides and 28- and 42-nucleobase oligonucleotides composed of two or three tandem oligonucleotide sequences, respectively, for their ability to terminate human DHFR translation in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, although to a lesser extent than either the 28 nucleobase or 42 nucleobase antisense oligonucleotides.

[0356] In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and include a portion that is 100% or completely complementary to the target nucleic acid. In certain such embodiments, the nucleic acid base length of the portion that has complete complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24.

[0357] In certain embodiments, the oligonucleotide contains one or more mismatched nucleobases compared to the target nucleic acid. In certain embodiments, such mismatches reduce the antisense activity against the target, while the activity against non-targets is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, starting from the 5' end of the gap region. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, or 6, starting from the 5' end of the 5' wing region or the 3' wing region.

[0358] B.ATXN1 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to a target nucleic acid, wherein the target nucleic acid is an ATXN1 nucleic acid. In certain embodiments, the ATXN1 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_000332.3), SEQ ID NO: 2 (the complement of nucleotides 16296001-16764000 of GENBANK Accession No. NC_000006.12), SEQ ID NO: 3 (GENBANK Accession No. NM_001128164.1), SEQ ID NO: 4 (GENBANK Accession No. BC011026.1), SEQ ID NO: 5 (GENBANK Accession No. BC029401.1), or SEQ ID NO: 6 (GENBANK Accession No. BC047894.1).

[0359] In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NOs: 1-6 reduces the amount of ATXN1 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NOs: 1-6 reduces the amount of ATXN1 in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to any of SEQ ID NOs: 1-6 ameliorates one or more symptoms or characteristics of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SCA1. In certain embodiments, the symptoms or features are selected from ataxic gait and limb ataxia, cognitive impairment, difficulty speaking and swallowing, cerebellar and brainstem atrophy seen on magnetic resonance imaging (MRI), cerebellar and brainstem neurochemical abnormalities detected by magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset.

[0360] In certain embodiments, oligomeric compounds complementary to any of SEQ ID NOS: 1-6 are capable of detectably reducing the amount of ATXN1 RNA in vitro when used according to standard cellular assays by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NOS: 1, 2, 3, 4, 5, or 6 are capable of detectably reducing the amount of ATXN1 RNA in CSF of a subject when used according to standard cellular assays by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NOS: 1, 2, 3, 4, 5, or 6 are capable of detectably reducing the amount of ATXN1 RNA in CSF of a subject. In certain embodiments, an oligomeric compound complementary to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 has the ability to detectably reduce the amount of ATXN1 in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0361] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to a target nucleic acid, the target nucleic acid being expressed in pharmacologically relevant tissues. In certain embodiments, the pharmacologically relevant tissues are cells and tissues that make up the central nervous system. Such tissues include the cortex, cerebellum, and brainstem.

[0362] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more antisense compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0363] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0364] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0365] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating the pharmaceutical composition will depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0366] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to a subject, including a human. The oligonucleotides include one or more oligonucleotides capable of synthesizing the oligonucleotide. Thus, for example, the present disclosure is directed to pharmaceutically acceptable salts of the oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0367] Lipid moieties have been used in various ways in nucleic acid therapy. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of drugs to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of drugs to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of drugs to muscle tissue.

[0368] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0369] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0370] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3 wt.% benzyl alcohol, 8 wt.% of the nonpolar surfactant Polysorbate 80™, and 65 wt.% polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied significantly without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants can be substituted for Polysorbate 80™, the fraction size of polyethylene glycol can be varied, other biocompatible polymers can replace polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.

[0371] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Certain pharmaceutical compositions suitable for use in injectable pharmaceutical compositions include: Vehicles include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0372] VII. Specific Compositions 1. Compound No. 994509 In certain embodiments, compound number 994509 is a 5-10-5 nucleotide analog having the sequence GCACGGTATTAGTGTCTTCA(5'→3') (SEQ ID NO: 126). It is characterized as an MOE gapmer, in which nucleosides 1 to 5 and nucleosides 16 to 20 (5'→3') are each 2'-MOE nucleosides, and nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides. The internucleoside linkages between nucleoside 2 and nucleoside 3, between nucleoside 3 and nucleoside 4, between nucleoside 4 and nucleoside 5, between nucleoside 16 and nucleoside 17, and between nucleoside 17 and nucleoside 18 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 14 and nucleoside 15, between nucleoside 15 and nucleoside 16, between nucleoside 18 and nucleoside 19, and between nucleoside 19 and nucleoside 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0373] In certain embodiments, compound number 994509 has the following chemical designation (5'→3'): Ges m CEO Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds mCeo Teo Tes m Ces Ae (SEQ ID NO: 126) is represented by In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0374] In certain embodiments, compound number 994509 has the following chemical structure: [ka] is expressed by

[0375] In certain embodiments, the sodium salt of Compound No. 994509 has the following chemical structure: [ka] is expressed by

[0376] 2. Compound No. 1040500 In certain embodiments, compound number 1040500 is a 5-10-5 nucleotide having the sequence GCTTCTCAAATCAGGTGTAC (5'→3') (SEQ ID NO: 1045). It is characterized as an MOE gapmer, in which nucleosides 1 to 5 and nucleosides 16 to 20 (5'→3') are each 2'-MOE nucleosides, and nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides. The internucleoside linkages between nucleoside 2 and nucleoside 3, between nucleoside 3 and nucleoside 4, between nucleoside 4 and nucleoside 5, between nucleoside 16 and nucleoside 17, and between nucleoside 17 and nucleoside 18 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 1 and nucleoside 2, between nucleoside 5 and nucleoside 6, and between nucleoside 6 and nucleoside 18 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 14 and nucleoside 15, between nucleoside 15 and nucleoside 16, between nucleoside 18 and nucleoside 19, and between nucleoside 19 and nucleoside 20 are phosphorothioate internucleoside linkages, and each cytosine is 5-methyl. It is lucitosine.

[0377] In certain embodiments, compound number 1040500 has the following chemical designation (5'→3'): Ges m CEO Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe (SEQ ID NO: 1045) is represented by In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0378] In certain embodiments, compound number 1040500 has the following chemical structure: [ka] is expressed by

[0379] In certain embodiments, the sodium salt of compound number 1040500 has the following chemical structure: [ka] is expressed by

[0380] 3. Compound No. 1041927 In certain embodiments, compound number 1041927 is a 5-10-5 nucleotide analog having the sequence GCCTTTATAACTTTTCTTTC(5'→3') (SEQ ID NO: 2552). It is characterized as an MOE gapmer, in which nucleosides 1 to 5 and nucleosides 16 to 20 (5'→3') are each 2'-MOE nucleosides, and nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides. The internucleoside linkages between nucleoside 2 and nucleoside 3, between nucleoside 3 and nucleoside 4, between nucleoside 4 and nucleoside 5, between nucleoside 16 and nucleoside 17, and between nucleoside 17 and nucleoside 18 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 14 and nucleoside 15, between nucleoside 15 and nucleoside 16, between nucleoside 18 and nucleoside 19, and between nucleoside 19 and nucleoside 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0381] In certain embodiments, compound number 1041927 has the following chemical designation (5'→3'): Ges m CEO m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes m Ce (sequence number 2552) is represented by In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0382] In certain embodiments, compound number 1041927 has the following chemical structure: [ka] is expressed by

[0383] In certain embodiments, the sodium salt of compound number 1041927 has the following chemical structure: [ka] is expressed by

[0384] 4. Compound No. 1055001 In certain embodiments, compound number 1055001 is a 5-10-5 nucleotide analog having the sequence TTCAGTTTAGTTGCAGCCAT(5'→3') (SEQ ID NO: 3190). It is characterized as an MOE gapmer, in which nucleosides 1 to 5 and nucleosides 16 to 20 (5'→3') are each 2'-MOE nucleosides, and nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides. The internucleoside linkages between nucleoside 2 and nucleoside 3, between nucleoside 3 and nucleoside 4, between nucleoside 4 and nucleoside 5, between nucleoside 16 and nucleoside 17, and between nucleoside 17 and nucleoside 18 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 14 and nucleoside 15, between nucleoside 15 and nucleoside 16, between nucleoside 18 and nucleoside 19, and between nucleoside 19 and nucleoside 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0385] In certain embodiments, compound number 1055001 has the following chemical designation (5'→3'): Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m CEO m Ces Aes Te (sequence number 3190) is represented by In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0386] In certain embodiments, compound number 1055001 has the following chemical structure: [ka] is expressed by

[0387] In certain embodiments, the sodium salt of compound number 1055001 has the following chemical structure: [ka] is expressed by

[0388] 5. Compound No. 1371311 In certain embodiments, compound No. 1371311 is characterized as a 5-10-5 MOE gapmer having the sequence CCCGTATTCCTCTTACCATC (5'→3') (SEQ ID NO: 3590), wherein nucleosides 1-5 and nucleosides 16-20 (5'→3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkages between nucleoside 2 and nucleoside 3, between nucleoside 3 and nucleoside 4, between nucleoside 4 and nucleoside 5, between nucleoside 16 and nucleoside 17, and between nucleoside 17 and nucleoside 18 are phosphodiesterase (PDE)-linked nucleotides. Internucleoside bond: between nucleoside 1 and nucleoside 2, between nucleoside 5 and nucleoside 6, between nucleoside 6 and nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 14 The internucleoside linkages between nucleoside 15 and nucleoside 16, between nucleoside 18 and nucleoside 19, and between nucleoside 19 and nucleoside 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0389] In certain embodiments, compound number 1371311 has the following chemical designation (5'→3'): m Ces m CEO m Ceo Geo Tes Ads Tds Tds m CDs m Cds Tds m Cds Tds Tds Ads m CEO m Ceo Aes Tes m Ce (SEQ ID NO: 3590) is represented by In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0390] In certain embodiments, compound number 1371311 has the following chemical structure: [ka] is expressed by

[0391] In certain embodiments, the sodium salt of Compound No. 1371311 has the following chemical structure: [ka] is expressed by

[0392] 6. Compound No. 1385293 In certain embodiments, compound number 1385293 is characterized as a 5-8-4 MOE gapmer having the sequence TCAGTTTAGTTGCAGCC(5'→3') (SEQ ID NO: 3638), wherein nucleosides 1-5 and nucleosides 14-17 (5'→3') are each 2'-MOE nucleosides, nucleosides 6-13 are each 2'-β-D-deoxynucleosides, the internucleoside linkages between nucleoside 4 and nucleoside 5 and between nucleoside 14 and nucleoside 15 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleoside 1 and nucleoside 2, between nucleoside 3 and nucleoside 4, between nucleoside 5 and nucleoside 6, and between nucleoside 6 and nucleoside 17 are phosphodiester internucleoside linkages. The internucleoside linkages between nucleoside 7, between nucleoside 7 and nucleoside 8, between nucleoside 8 and nucleoside 9, between nucleoside 9 and nucleoside 10, between nucleoside 10 and nucleoside 11, between nucleoside 11 and nucleoside 12, between nucleoside 12 and nucleoside 13, between nucleoside 13 and nucleoside 14, between nucleoside 15 and nucleoside 16, and between nucleoside 16 and nucleoside 17 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0393] In certain embodiments, compound number 1385293 has the following chemical designation (5'→3'): Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m Ce (SEQ ID NO: 3638), In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0394] In certain embodiments, compound number 1385293 has the following chemical structure: [ka] is expressed by

[0395] In certain embodiments, the sodium salt of Compound No. 1385293 has the following chemical structure: [ka] is expressed by

[0396] VIII. Specific Hotspot Areas In certain embodiments, the nucleobases within the ranges specified below comprise hotspot regions of the ATXN1 nucleic acid. In certain embodiments, modified oligonucleotides complementary to hotspot regions of the ATXN1 nucleic acid achieve an average of greater than 75% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to hotspot regions of the ATXN1 nucleic acid achieve an average of 24% or more ATXN1 RNA reduction in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to hotspot regions of the ATXN1 nucleic acid achieve an average of 45% or more ATXN1 RNA reduction in vivo in a standard in vivo assay.

[0397] 1. Nucleic acid bases 5472 to 5552 of SEQ ID NO: 1 or nucleic acid bases 459725 to 459805 of SEQ ID NO: 2 In certain embodiments, nucleobases 5472 to 5552 of SEQ ID NO: 1 or nucleobases 459725 to 459805 of SEQ ID NO: 2 comprise a hotspot region. The modified oligonucleotide is complementary to nucleobases 5472-5552 of SEQ ID NO: 1 or nucleobases 459725-459805 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a mixed-wing gapmer.

[0398] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-4 MOE gapmer or a 5-8-4 mixed MOE / cEt gapmer. In certain embodiments, the mixed wing gapmer has a sugar motif of eeeeeddddddddkkee (5'→3' order), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside in the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at position 2 of the gap (5'→3'). In certain embodiments, a gapmer has a sugar motif of eeeeedyddddddddeeeee or eeeeedyddddddkkee (5' to 3' order), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0399] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssosssssssssssss, sssosssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0400] The nucleobase sequences of SEQ ID NO: 196, SEQ ID NO: 274, SEQ ID NO: 352, SEQ ID NO: 430, SEQ ID NO: 508, SEQ ID NO: 2578, SEQ ID NO: 2655, SEQ ID NO: 2732, SEQ ID NO: 2809, SEQ ID NO: 2886, SEQ ID NO: 2963, SEQ ID NO: 3121, SEQ ID NO: 3122, SEQ ID NO: 3190, SEQ ID NO: 3191, SEQ ID NO: 3192, SEQ ID NO: 3262, SEQ ID NO: 3330, SEQ ID NO: 3331, SEQ ID NO: 3332, SEQ ID NO: 3401, SEQ ID NO: 3402, SEQ ID NO: 3575, SEQ ID NO: 3577, SEQ ID NO: 3620, SEQ ID NO: 3624, SEQ ID NOs: 3638 to 3640, SEQ ID NOs: 3653 to 3655, SEQ ID NO: 3662, SEQ ID NO: 3665, and SEQ ID NO: 3669 are complementary to nucleobases 5472 to 5552 of SEQ ID NO: 1 or nucleobases 459725 to 459805 of SEQ ID NO: 2.

[0401] Compound numbers 994446 to 994450, Compound numbers 1040296 to 1040301, Compound numbers 1055001 to 1055011, Compound number 1342062, Compound number 1342063, Compound number 1342067, Compound number 1342068, Compound number 1365271, Compound number 1365272, Compound number 1365274, Compound number 13 65294, Compound No. 1365299, Compound No. 1365300, Compound No. 1371818, Compound No. 1371821, Compound No. 1371827, Compound No. 1371829, Compound No. 1371837, Compound No. 1371843, Compound No. 1371866, Compound No. 1371869, Compound No. 1371871, Compound No. 137187 The nucleic acid base sequences of Compound Nos. 6, 1385293, 1394156 to 1394160, 1394162, 1394164, 1394166 to 1394168, 1394533, 1394544, 1394546, 1394549, and 1394553 are complementary to nucleic acid bases 5472 to 5552 of SEQ ID NO: 1 or nucleic acid bases 459725 to 459805 of SEQ ID NO: 2.

[0402] In certain embodiments, modified oligonucleotides complementary to nucleobases 5472-5552 of SEQ ID NO:1 or nucleobases 459725-459805 of SEQ ID NO:2 achieve at least 58% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 5472-5552 of SEQ ID NO:1 or nucleobases 459725-459805 of SEQ ID NO:2 achieve an average of 90% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 5472-5552 of SEQ ID NO:1 or nucleobases 459725-459805 of SEQ ID NO:2 achieve an average of 52% ATXN1 RNA reduction in vivo in a standard in vivo assay.

[0403] 2. Nucleic acid bases 5906 to 6005 of SEQ ID NO: 1 or nucleic acid bases 460159 to 460258 of SEQ ID NO: 2 In certain embodiments, nucleobases 5906-6005 of SEQ ID NO: 1 or nucleobases 460159-460258 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 5906-6005 of SEQ ID NO: 1 or nucleobases 460159-460258 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is a mixed-wing gapmer.

[0404] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-4 MOE gapmer or a 5-8-4 mixed MOE / cEt gapmer. In certain embodiments, the mixed wing gapmer has a sugar motif of eeeeeddddddddkkee (5'→3' order), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety.

[0405] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssosssssssssssss, sssosssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0406] SEQ ID NO: 42, SEQ ID NO: 120, SEQ ID NO: 198, SEQ ID NO: 276, SEQ ID NO: 509, SEQ ID NO: 587, SEQ ID NO: 2502, SEQ ID NO: 2579, SEQ ID NO: 2656, SEQ ID NO: 2733, SEQ ID NO: 2810, SEQ ID NO: 2887, SEQ ID NO: 2964, SEQ ID NO: 3585, SEQ ID NOs: 3588 to 3590, SEQ ID NO: 3615, SEQ ID NO: 3618, SEQ ID NO: 3622 The nucleic acid base sequences of SEQ ID NO: 3657, SEQ ID NO: 3660, SEQ ID NO: 3661, SEQ ID NO: 3663, SEQ ID NO: 3664, and SEQ ID NOs: 3666 to 3668 are complementary to nucleic acid bases 5906 to 6005 of SEQ ID NO: 1 or nucleic acid bases 460159 to 460258 of SEQ ID NO: 2.

[0407] Compound numbers 994458 to 994463, Compound numbers 1040327 to 1040333, Compound number 1367569, Compound number 1367580 to 1367581, Compound number 1367589 to 1367591, Compound number 1371311, Compound number 1371820, Compound number 1371823, Compound number 1371825, Compound number 1371842, Compound number 1371865, Compound number 1371868, Compound number 1371870, Compound number 1371873, Compound number 137 The nucleic acid base sequences of Compound No. 1875, Compound No. 1371877, Compound No. 1394161, Compound No. 1394163, Compound No. 1394165, Compound No. 1394524, Compound No. 1394538, Compound No. 1394541, Compound No. 1394543, Compound No. 1394545, Compound No. 1394548, and Compound Nos. 1394550 to 1394552 are complementary to nucleic acid bases 5906 to 6005 of SEQ ID NO: 1 or nucleic acid bases 460159 to 460258 of SEQ ID NO: 2.

[0408] In certain embodiments, modified oligonucleotides complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2 achieve at least 26% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2 achieve an average of 78% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 5906-6005 of SEQ ID NO:1 or nucleobases 460159-460258 of SEQ ID NO:2 achieve an average of 51% ATXN1 RNA reduction in a standard in vivo assay.

[0409] 3. Nucleic acid bases 7868 to 7911 of SEQ ID NO: 1 or nucleic acid bases 462121 to 462164 of SEQ ID NO: 2 In certain embodiments, nucleobases 7868-7911 of SEQ ID NO: 1 or nucleobases 462121-462164 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 7868-7911 of SEQ ID NO: 1 or nucleobases 462121-462164 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer.

[0410] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer.

[0411] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssosssssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0412] Nucleobases of SEQ ID NO: 48, SEQ ID NO: 126, SEQ ID NO: 2044, and SEQ ID NO: 2121 The sequence is complementary to nucleobases 7868 to 7911 of SEQ ID NO:1 or nucleobases 462121 to 462164 of SEQ ID NO:2.

[0413] The nucleic acid base sequences of compound Nos. 994508, 994509, 1040499, 1040450, 1394513, and 1394529 are complementary to nucleic acid bases 7868 to 7911 of SEQ ID NO: 1 or nucleic acid bases 462121 to 462164 of SEQ ID NO: 2.

[0414] In certain embodiments, modified oligonucleotides complementary to nucleobases 7868-7911 of SEQ ID NO:1 or 462121-462145 of SEQ ID NO:2 achieve at least 61% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 7868-7911 of SEQ ID NO:1 or 462121-462145 of SEQ ID NO:2 achieve an average of 79% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 7868-7911 of SEQ ID NO:1 or nucleobases 462121-462164 of SEQ ID NO:2 achieve an average of 53% ATXN1 RNA reduction in vivo in a standard in vivo assay.

[0415] 4. Nucleic acid bases 8481 to 8514 of SEQ ID NO: 1 or nucleic acid bases 462734 to 462767 of SEQ ID NO: 2 In certain embodiments, nucleobases 8481-8514 of SEQ ID NO: 1 or nucleobases 462734-462767 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 8481-8514 of SEQ ID NO: 1 or nucleobases 462734-462767 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer.

[0416] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer.

[0417] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssosssssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0418] The nucleic acid base sequences of SEQ ID NO: 128, SEQ ID NO: 206, SEQ ID NO: 284, SEQ ID NO: 1045, SEQ ID NO: 1122, SEQ ID NO: 1199, and SEQ ID NO: 1276 are complementary to nucleic acid bases 8481 to 8514 of SEQ ID NO: 1 or nucleic acid bases 462734 to 462767 of SEQ ID NO: 2.

[0419] The nucleic acid base sequences of compound numbers 994525 to 994527, compound numbers 1040500 to 1040503, compound number 1394514, and compound number 1394525 are complementary to nucleic acid bases 8481 to 8514 of SEQ ID NO: 1 or nucleic acid bases 462734 to 462767 of SEQ ID NO: 2.

[0420] In certain embodiments, sequences within 8481 to 8514 of SEQ ID NO: 1 or 4627 of SEQ ID NO: 2 Modified oligonucleotides complementary to nucleobases 8481-8514 of SEQ ID NO: 1 or nucleobases 462734-462767 of SEQ ID NO: 2 achieve an average of 79% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 8481-8514 of SEQ ID NO: 1 or nucleobases 462734-462767 of SEQ ID NO: 2 achieve an average of 48% ATXN1 RNA reduction in vivo in a standard in vivo assay.

[0421] 5. Nucleic acid bases 446679 to 446706 of SEQ ID NO: 2 In certain embodiments, nucleobases 446679-446706 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 446679-446706 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer.

[0422] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer.

[0423] In certain embodiments, 446679-446706 of SEQ ID NO:2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to 446679-446706 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide has a length of 20 nucleobases. In certain embodiments, the modified oligonucleotide has a length of 17 nucleobases. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are holothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5'→3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssossssssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0424] The nucleic acid base sequences of SEQ ID NO: 2475, SEQ ID NO: 2552, SEQ ID NO: 2629, SEQ ID NO: 2706, SEQ ID NO: 2783, SEQ ID NOs: 3627 to 3630, and SEQ ID NO: 3644 are complementary to nucleic acid bases 446679 to 446706 of SEQ ID NO: 2.

[0425] The nucleic acid base sequences of compound numbers 1041926 to 1041930, compound number 1364282, compound number 1365258 to 1365261, compound number 1365282 to 1365284, compound number 1365287, and compound number 1394522 are complementary to nucleic acid bases 446679 to 446706 of SEQ ID NO: 2.

[0426] In certain embodiments, modified oligonucleotides complementary to nucleobases 446679-446706 of SEQ ID NO:2 achieve at least 67% ATXN1 RNA reduction in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 446679-446706 of SEQ ID NO:2 achieve an average of 81% ATXN1 RNA reduction in vitro in a standard cell assay.

[0427] 6. Additional Hotspot Areas In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins at the nucleobase of SEQ ID NO: 1 identified in the "SEQ ID NO: 1 Start Site" column and ends at the nucleobase of SEQ ID NO: 1 identified in the "SEQ ID NO: 1 End Site" column. In certain embodiments, the modified oligonucleotide is complementary within any of hotspot regions 1-53 defined in the table below. In certain embodiments, the modified oligonucleotide is 17 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length.

[0428] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-4 MOE gapmer or a 5-8-4 mixed MOE / cEt gapmer. In certain embodiments, the mixed wing gapmer has a sugar motif of eeeeeddddddddkkee (5'→3' order), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside in the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at position 2 of the gap (5'→3'). In certain embodiments, a gapmer has a sugar motif of eeeeedyddddddddeeeee or eeeeedyddddddkkee (5' to 3' order), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0429] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order, and in certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssssooss, sssosssssssssssss, sssosssssssssss, or soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0430] The nucleobase sequences of the compounds listed in the "Compound number targeted within" column in the tables below are complementary to specific hotspot regions of SEQ ID NO: 2. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO: targeted within" column in the tables below are complementary to target sequences within specific hotspot regions of SEQ ID NO: 2.

[0431] In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve at least a "minimum % in vitro reduction" (minimum % reduction compared to untreated control cells) of ATXN1 RNA in vitro in a standard cellular assay (as shown in the table below). In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve an average "average % in vitro reduction" (average % reduction compared to untreated control cells) of ATXN1 RNA in vitro in a standard cellular assay (as shown in the table below). In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve up to a "maximum % in vitro reduction" (maximum % reduction compared to untreated control cells) of ATXN1 RNA in vitro in a standard cellular assay (as shown in the table below). In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve an average "average % in vitro reduction" (average % reduction compared to untreated control cells) of ATXN1 RNA in vitro in a standard cellular assay (as shown in the table below). On average, mice achieve the "mean % in vivo reduction" (mean % reduction compared to PBS-treated animals) of ATXN1 RNA (as shown in the table below). Note that due to the transgenic mouse model used, only compounds targeting nucleosides 435531-464889 of SEQ ID NO:2 were tested in vivo. "nd" indicates that in vivo data are unavailable for compounds targeting within that range. In other cases, the mean in vivo reduction is for a subset of compounds targeting within a given hotspot, and not all compounds were tested in vivo. Table 1-1 Table 1-2 Table 1-3 Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 [Table 1-16]

[0432] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is incorporated herein by reference in its entirety.

[0433] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples serve only to illustrate, and are not intended to limit, the compounds described herein. Each of the references, GenBank accession numbers, etc. listed in this application is incorporated herein by reference in its entirety.

[0434] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" where necessary, in practice, those sequences may be modified with any combination of chemical modifications. Those of skill in the art will readily recognize that such designation of "RNA" or "DNA" to describe modified oligonucleotides is arbitrary in certain instances. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH in place of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) in place of uracil of RNA). Thus, including but not limited to those in the sequence listing, Nucleic acid sequences provided herein that are not intended to encompass nucleic acids comprising any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. As a further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" can be used in conjunction with such compounds containing RNA bases, whether modified or unmodified, e.g., those having the sequence "AUCGAUCG," as well as those having some DNA bases and some RNA bases, such as "AUCGATCG," and those having "AT m CGAUCG" wherein: m C encompasses any oligomeric compound having such a nucleobase sequence, including, but not limited to, those containing oligomeric compounds having other modified nucleobases, such as those exhibiting a cytosine base containing a methyl group at the 5-position.

[0435] Certain compounds described herein (e.g., modified oligonucleotides) contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), α or β, such as in the case of sugar anomers, or (D) or (L), such as in the case of amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the depicted compound. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise indicated. Similarly, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0436] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include: 1Isotopic substitutions encompassed in the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 Non-radioactive isotope substitutions include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitutions may confer novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions may make the compounds suitable for research or diagnostic purposes, such as imaging.

[0437] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in terms of their protonated (free acid) form or their ionized, cationic (salt) form; however, aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphodiester bonds of an oligonucleotide in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. Furthermore, a particular oligonucleotide may have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms in multiple positions, all in equilibrium. The term "oligonucleotide" is intended to encompass all such forms. Drawn structures necessarily represent a single form. Nevertheless, unless otherwise specified, such drawings are intended to encompass corresponding forms as well. Herein, a structure depicting the free acid of a compound followed by the term "or a salt thereof" explicitly encompasses all such forms, whether fully or partially protonated, deprotonated, or associated with a cation. In certain instances, one or more specific cations are identified. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution comprising potassium. Or the oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0438] Certain specific doses are described herein. The doses may be in the form of dosage units. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As noted above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for purposes of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, although the mass of the protons counts toward the dose weight, the mass of the Na+ ions does not. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1371311 is equal to the number of fully protonated molecules weighing 10 mg. This weight corresponds to 10.59 mg of solvent-free, sodium acetate-free, and anhydrous sodiated Compound No. 1371311. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating dosage. The present invention includes, but is not limited to, the following aspects. [Aspect 1] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an ATXN1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 2] 2. The oligomeric compound of embodiment 1, wherein the ATXN1 nucleic acid has the nucleobase sequence of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. [Aspect 3] The nucleobase sequence of said modified oligonucleotides comprises equal length segments of nucleobases: a portion of equal length from nucleobases 5472 to 5552 of SEQ ID NO: 1; a portion of equal length from nucleobases 5906 to 6005 of SEQ ID NO: 1; an equal length portion of nucleobases 7868 to 7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481 to 8514 of SEQ ID NO: 1; or Equal length segments of nucleobases 446679 to 446706 of SEQ ID NO: 2 3. The oligomeric compound of embodiment 1 or embodiment 2, wherein the oligomeric compound is at least 80% complementary to [Aspect 4] The nucleobase sequence of said modified oligonucleotides comprises equal length segments of nucleobases: an equal length portion of nucleobases 5489 to 5508 of SEQ ID NO: 1; an equal length portion of nucleobases 5491 to 5507 of SEQ ID NO: 1; a portion of equal length from nucleobases 5912 to 5931 of SEQ ID NO: 1; an equal length portion of nucleobases 7892 to 7911 of SEQ ID NO: 1; a portion of equal length from nucleobases 8481 to 8500 of SEQ ID NO: 1, or Equal length segments of nucleobases 446680 to 446699 of SEQ ID NO: 2 4. The oligomeric compound according to any one of embodiments 1 to 3, which is at least 80% complementary to: [Aspect 5] The oligomeric compound of any of aspects 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the ATXN1 nucleic acid. [Aspect 6] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of SEQ ID NOs: 22 to 3624 or SEQ ID NO: 3655. [Aspect 7] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleic acid bases of any of SEQ ID NOs: 3625 to 3654 or 3656 to 3669. [Aspect 8] The oligomeric compound of embodiment 6 or embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 22 to 3669. [Aspect 9] 9. The oligomeric compound according to aspect 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 22 to 3669. [Aspect 10] SEQ ID NO: 196, SEQ ID NO: 274, SEQ ID NO: 352, SEQ ID NO: 430, SEQ ID NO: 508, SEQ ID NO: 2578, SEQ ID NO: 2655, SEQ ID NO: 2732, SEQ ID NO: 2809, SEQ ID NO: 2886, SEQ ID NO: 2963, SEQ ID NO: 3121, SEQ ID NO: 3122, SEQ ID NO: 3190, SEQ ID NO: 3191, SEQ ID NO: 3192, SEQ ID NO: 3262, SEQ ID NO: 3330, SEQ ID NO: 3331, SEQ ID NO: 3332, SEQ ID NO: 3401, SEQ ID NO: 3402, SEQ ID NO: 3575, SEQ ID NO: 3577, SEQ ID NO: 3620, SEQ ID NO: 3624, SEQ ID NOs: 3638 to 3640, SEQ ID NOs: 3653 to 3655, SEQ ID NO: 3662, SEQ ID NO: 3665, SEQ ID NO: 3669, SEQ ID NO: 42, SEQ ID NO: 120, SEQ ID NO: 198, SEQ ID NO: 276, SEQ ID NO: 509, SEQ ID NO: 587, SEQ ID NO: 2502, SEQ ID NO: 2579, SEQ ID NO: 2656, SEQ ID NO: 2733, SEQ ID NO: 2810, SEQ ID NO: 2887, SEQ ID NO: 2964, SEQ ID NO: 3585, SEQ ID NOs: 3588 to 3590, SEQ ID NO: 3615, SEQ ID NO: 3618, SEQ ID NO: 3622, SEQ ID NO: 3657, SEQ ID NO: 3660, SEQ ID NO: 3661, SEQ ID NO: 3663, SEQ ID NO: 3664, SEQ ID NOs: 3666 to 3668, SEQ ID NO: 48, SEQ ID NO: 126, SEQ ID NO: 2044, SEQ ID NO: 2121, SEQ ID NO: 128, SEQ ID NO: 206, SEQ ID NO: 284, SEQ ID NO: 1045, SEQ ID NO: 1122, SEQ ID NO: 1199, and SEQ ID NO: 1276, or SEQ ID NO: 2475, SEQ ID NO: 2552, SEQ ID NO: 2629, SEQ ID NO: 2706, SEQ ID NO: 2783, SEQ ID NO: 3627 to 3630, SEQ ID NO: 3644 10. The oligomeric compound of any of Aspects 6-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleobases of a sequence selected from the group consisting of: [Aspect 11] 10. The oligomeric compound of any of aspects 6-9, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or 17 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 3638. [Aspect 12] 10. The oligomeric compound of any of Aspects 6-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 126, SEQ ID NO: 1045, SEQ ID NO: 2552, SEQ ID NO: 3190, or SEQ ID NO: 3590. [Aspect 13] 12. The oligomeric compound of embodiment 10 or embodiment 11, wherein the modified oligonucleotide consists of 17 to 30 linked nucleosides and has a nucleobase sequence comprising any of the following nucleobase sequences: 126, 1045, 2552, 3190, 3590, or 3638. [Aspect 14] 14. The oligomeric compound of embodiment 13, wherein said modified oligonucleotide has a nucleobase sequence consisting of any one of 126, 1045, 2552, 3190, 3590, or 3638 nucleobase sequences. [Aspect 15] The nucleobase sequences of the modified oligonucleotides are identical to portions of the ATXN1 nucleic acid of equal length. 15. The oligomeric compound of any of aspects 6-14, wherein the ATXN1 nucleic acid is at least 85%, at least 90%, at least 95%, or 100% complementary to an ATXN1 nucleic acid having the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. [Aspect 16] 16. The oligomeric compound according to any one of aspects 1 to 15, wherein at least one nucleoside of said modified oligonucleotide comprises a modified sugar moiety. [Aspect 17] 17. The oligomeric compound of embodiment 16, wherein said modified sugar moiety comprises a bicyclic sugar moiety. [Aspect 18] 18. The oligomeric compound of embodiment 17, wherein said bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-. [Aspect 19] 19. The oligomeric compound of any one of aspects 16 to 18, wherein said modified nucleoside comprises a non-bicyclic modified sugar moiety. [Aspect 20] 20. The oligomeric compound of embodiment 19, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe modified sugar moiety. [Aspect 21] 21. The oligomeric compound according to any one of aspects 16 to 20, wherein at least one nucleoside of said modified oligonucleotide comprises a sugar surrogate. [Aspect 22] 22. The oligomeric compound according to aspect 21, wherein said sugar surrogate is selected from morpholinos and PNAs. [Aspect 23] The oligomeric compound according to any one of embodiments 1 to 16 or embodiments 19 to 22, wherein said modified oligonucleotide does not comprise a bicyclic sugar moiety. [Aspect 24] 24. The oligomeric compound according to any one of aspects 1 to 23, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage. [Aspect 25] 25. The oligomeric compound according to embodiment 24, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 26] 26. The oligomeric compound according to embodiment 24 or embodiment 25, wherein each internucleoside linkage is a modified internucleoside linkage. [Aspect 27] 27. The oligomeric compound according to embodiment 26, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 28] 26. The oligomeric compound according to any one of aspects 24 to 25, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage. [Aspect 29] 24. The oligomeric compound according to any one of aspects 1 to 23, wherein each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Aspect 30] At least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate nucleosides. 30. The oligomeric compound according to any one of embodiments 1 to 29, wherein the linkage is an intertrigoside linkage. [Aspect 31] the modified oligonucleotide has an internucleoside linkage motif selected from: soooosssssssssssooss, sssossssssssssssss, sssosssssssssss, or soooooossssssssss; 22. The oligomeric compound according to embodiment 21, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage. [Aspect 32] 32. The oligomeric compound according to any one of aspects 1 to 31, wherein said modified oligonucleotide comprises a modified nucleobase. [Aspect 33] 33. The oligomeric compound according to embodiment 32, wherein said modified nucleobase is 5-methylcytosine. [Aspect 34] 34. The oligomeric compound according to any one of aspects 1 to 33, wherein the modified oligonucleotide comprises a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides. [Aspect 35] 35. The oligomeric compound according to embodiment 34, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside. [Aspect 36] 36. The oligomeric compound of embodiment 34 or embodiment 35, wherein said deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. [Aspect 37] 37. The oligomeric compound of any of embodiments 34-36, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. [Aspect 38] the deoxy region is adjacent on the 5' side to a 5' region consisting of 1 to 6 linked 5' region nucleosides and adjacent on the 3' side to a 3' exoregion consisting of 1 to 6 linked 3' region nucleosides; the 3'-most nucleoside of said 5' region comprises a modified sugar moiety; the 5'-most nucleoside of the 3' region comprises a modified sugar moiety; 37. The oligomeric compound according to any one of aspects 34 to 36. [Aspect 39] 39. The oligomeric compound according to embodiment 38, wherein each nucleoside of said 3' region comprises a modified sugar moiety. [Aspect 40] 40. The oligomeric compound according to embodiment 38 or embodiment 39, wherein each nucleoside of said 5' region comprises a modified sugar moiety. [Aspect 41] the modified oligonucleotide is a 5' region consisting of 1 to 6 linked nucleosides; a deoxy region consisting of 6 to 10 linked nucleosides, and 3' region consisting of 1 to 6 linked nucleosides and 41. The oligomeric compound according to any one of aspects 34 to 40, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety. [Aspect 42] the modified oligonucleotide is a 5' region consisting of six linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and A 3' region consisting of four linked nucleosides and 42. The oligomeric compound of embodiment 41, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the deoxy region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 43] the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a central region consisting of 10 linked nucleosides, and A 3' region consisting of five linked nucleosides and 42. The oligomeric compound of embodiment 41, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the deoxy region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 44] the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a deoxy region consisting of eight linked nucleosides, and A 3' region consisting of four linked nucleosides and 42. The oligomeric compound of embodiment 41, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the deoxy region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 45] the modified oligonucleotide is a 5' region consisting of five linked nucleosides; a deoxy region consisting of eight linked nucleosides, and A 3' region consisting of four linked nucleosides and 42. The oligomeric compound of aspect 41, wherein each of said 5' region nucleosides is a 2'-MOE nucleoside, each of said 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 46] the modified oligonucleotide is a 5' region consisting of 3 to 7 linked nucleosides; a deoxy region consisting of 6 to 8 linked nucleosides, and 3' region consisting of 3 to 6 linked nucleosides and Each of the 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and the 5' region has the following formula: (Nk)n(Nd)(Nx) and wherein each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside; The oligomeric compound according to any one of aspects 1 to 33, wherein n is 1 to 5. [Aspect 47] the modified oligonucleotide is a 5' region consisting of seven linked nucleosides; a deoxy region consisting of six linked nucleosides, and A 3' region consisting of four linked nucleosides and Each of the 3' region nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and the 5' region has the following formula: (Nk)n(Nd)(Nx) and wherein each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, and Nd is a 2'-β-D-deoxynucleoside; 34. The oligomeric compound according to any one of aspects 1 to 33, wherein n is 5 or greater. [Aspect 48] 48. The oligomeric compound of any one of aspects 1 to 47, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 16 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, or 17 to 20 linked nucleosides. [Aspect 49] 47. The oligomeric compound according to any one of aspects 1 to 46, wherein the modified oligonucleotide consists of 18 to 22 or 18 to 20 linked nucleosides. [Aspect 50] 48. The oligomeric compound according to any one of aspects 1 to 47, wherein said modified oligonucleotide consists of 17 linked nucleosides. [Aspect 51] 47. The oligomeric compound according to any one of aspects 1 to 46, wherein the modified oligonucleotide consists of 20 linked nucleosides. [Aspect 52] Chemical notation for: Ges m CEO Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo Teo Tes m Ces Ae (SEQ ID NO: 126) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 53] Chemical notation for: Ges m CEO Teo Teo m Ces Tds m Cds Ads Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe (SEQ ID NO: 1045) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 54] Chemical notation for: Ges m CEO m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes m Ce (sequence number 2552) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 55] Chemical notation for: Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m CEO m Ces Aes Te (sequence number 3190) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 56] Chemical notation for: m Ces m CEO m Ceo Geo Tes Ads Tds Tds m CDs m Cds Tds m Cds Tds Tds Ads m CEO m Ceo Aes Tes m Ce (SEQ ID NO: 3590) A compound comprising a modified oligonucleotide represented by: In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 57] Chemical notation for: Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m A compound comprising a modified oligonucleotide represented by Ce (SEQ ID NO: 3638), In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The compound wherein o is a phosphodiester internucleoside linkage. [Aspect 58] 58. The oligomeric compound according to any one of aspects 1 to 57, comprising the modified oligonucleotide. [Aspect 59] 59. The oligomeric compound according to any one of embodiments 1 to 58, comprising a conjugate group comprising a conjugate moiety and a conjugate linker. [Aspect 60] 60. The oligomeric compound according to embodiment 59, wherein said conjugate linker consists of a single bond. [Aspect 61] 60. The oligomeric compound according to embodiment 59, wherein said conjugate linker is cleavable. [Aspect 62] 60. The oligomeric compound of embodiment 59, wherein said conjugate linker comprises 1 to 3 linker nucleosides. [Aspect 63] 62. The oligomeric compound according to any one of aspects 59 to 61, wherein said conjugate linker does not comprise any linker nucleosides. [Aspect 64] 63. The oligomeric compound of any one of aspects 59 to 62, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Aspect 65] 63. The oligomeric compound of any of aspects 59 to 62, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Aspect 66] The oligomeric compound of any one of embodiments 1 to 57 or embodiments 60 to 65, comprising a terminal group. [Aspect 67] 67. The oligomeric compound according to embodiment 66, wherein said terminal group is an abasic sugar moiety. [Aspect 68] 68. The oligomeric compound according to any one of aspects 1 to 67, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 69] The chemical structure below: [ka] or a salt thereof. [Aspect 70] The chemical structure below: [ka] or a salt thereof. [Aspect 71] The chemical structure below: [ka] or a salt thereof. [Aspect 72] The chemical structure below: [ka] or a salt thereof. [Aspect 73] The chemical structure below: [ka] or a salt thereof. [Aspect 74] The chemical structure below: [ka] or a salt thereof. [Aspect 75] 75. The modified oligonucleotide according to any one of embodiments 69 to 74, which is a sodium salt or a potassium salt. [Aspect 76] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 77] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 78] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 79] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 80] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 81] The chemical structure below: [ka] A modified oligonucleotide having the formula: [Aspect 82] 82. A chiral enriched population of an oligomeric compound according to any one of embodiments 1 to 68 or a chiral enriched population of a modified oligonucleotide according to embodiments 69 to 81, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. [Aspect 83] 83. The chiral enriched population of embodiment 82, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration. [Aspect 84] 84. The chirally enriched population of embodiment 83, wherein the population is enriched in modified oligonucleotides in which the stereochemical configuration of each phosphorothioate internucleoside linkage is of an independently selected particular type. [Aspect 85] 85. The chiral enriched population of embodiment 84, wherein the population is enriched for modified oligonucleotides having one particular phosphorothioate internucleoside linkage having the (Rp) configuration and each of the remaining phosphorothioate internucleoside linkages having the (Sp) configuration. [Aspect 86] 86. The chiral enriched population of embodiment 85, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages having, in 5' to 3' order, the Sp configuration, the Sp configuration, and the Rp configuration. [Aspect 87] A population of oligomeric compounds comprising a modified oligonucleotide according to any one of aspects 1 to 68, or a population of modified oligonucleotides according to aspects 69 to 81, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom. [Aspect 88] 69. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of any one of Aspects 1 to 68. [Aspect 89] 89. The oligomeric duplex of embodiment 88, wherein said second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 30 linked nucleosides, and wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of said first modified oligonucleotide. [Aspect 90] The oligomeric duplex of embodiment 88 or embodiment 89, wherein said modified oligonucleotide of said first oligomeric compound comprises a 5' stabilizing phosphate group. [Aspect 91] The oligomeric duplex of embodiment 90, wherein said stabilizing phosphate group comprises cyclopropylphosphonate or vinylphosphonate. [Aspect 92] 92. The oligomeric duplex of any of aspects 88-91, wherein said modified oligonucleotide of said first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate. [Aspect 93] 93. The oligomeric duplex of any of embodiments 88-92, wherein said modified oligonucleotide of said first oligomeric compound comprises a 2'-NMA sugar moiety. [Aspect 94] 94. The oligomeric duplex of any of embodiments 88-93, wherein at least one nucleoside of said second modified oligonucleotide comprises a modified sugar moiety. [Aspect 95] 95. The oligomeric duplex of embodiment 94, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. [Aspect 96] 96. The oligomeric duplex of embodiment 95, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-. [Aspect 97] 97. The oligomeric duplex of embodiment 96, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety. [Aspect 98] 98. The oligomeric duplex of embodiment 97, wherein said non-bicyclic modified sugar moiety of said second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety. [Aspect 99] 99. The oligomeric duplex of any of embodiments 88 to 98, wherein at least one nucleoside of said second modified oligonucleotide comprises a sugar surrogate. [Aspect 100] 90. The oligomeric duplex of any of embodiments 88 to 99, wherein at least one internucleoside linkage of said second modified oligonucleotide is a modified internucleoside linkage. [Aspect 101] At least one modified internucleoside linkage of the second modified oligonucleotide is a phosphodiester. 101. The oligomeric duplex according to embodiment 100, wherein the internucleoside linkages are holothioate. [Aspect 102] 102. The oligomeric duplex of any of embodiments 88 to 101, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage. [Aspect 103] 103. The oligomeric duplex of any of embodiments 88 to 102, wherein each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Aspect 104] 104. The oligomeric duplex of any of embodiments 88-103, wherein each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. [Aspect 105] The oligomeric duplex of any of embodiments 88 to 104, wherein said second modified oligonucleotide comprises at least one modified nucleobase. [Aspect 106] The oligomeric duplex of embodiment 105, wherein said modified nucleobase of said second modified oligonucleotide is 5-methylcytosine. [Aspect 107] 107. The oligomeric duplex of any of embodiments 88 to 106, wherein the second modified oligonucleotide comprises a conjugate group. [Aspect 108] 108. The oligomeric duplex of embodiment 107, wherein said conjugate group comprises a conjugate linker and a conjugate moiety. [Aspect 109] The oligomeric duplex of embodiment 108 or embodiment 109, wherein the conjugate group is attached to the second modified oligonucleotide at a 5' end of the second modified oligonucleotide. [Aspect 110] The oligomeric duplex of embodiment 108 or embodiment 109, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the second modified oligonucleotide. [Aspect 111] 112. The oligomeric duplex of any of embodiments 108 to 111, wherein the second modified oligonucleotide comprises a terminal group. [Aspect 112] 113. The oligomeric duplex of embodiment 112, wherein said terminal group is an abasic sugar moiety. [Aspect 113] The second modified oligonucleotide is 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25 114. The oligomeric duplex of any of embodiments 88-113, consisting of 1, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides. [Aspect 114] 82. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of aspects 1 to 68, or a modified oligonucleotide according to any one of aspects 69 to 81. [Aspect 115] The antisense agent according to embodiment 115, wherein said antisense agent is an oligomeric duplex according to any of embodiments 88 to 113. [Aspect 116] The antisense agent according to embodiment 115 or embodiment 116, wherein said antisense agent is an RNaseH agent having the ability to reduce the amount of ATXN1 nucleic acid by activation of RNaseH. [Aspect 117] 118. The antisense agent of any of embodiments 115-117, wherein the conjugate group comprises a cell targeting moiety. [Aspect 118] A pharmaceutical composition comprising an oligomeric compound according to any one of aspects 1 to 68, a modified oligonucleotide according to any one of aspects 69 to 81, a population according to any one of aspects 82 to 87, an oligomeric duplex according to any one of aspects 88 to 114, or an antisense agent according to any one of aspects 115 to 117, and a pharmaceutically acceptable carrier or diluent. [Aspect 119] 119. The pharmaceutical composition according to embodiment 118, wherein said pharmaceutically acceptable diluent is water, phosphate buffered saline, or artificial cerebrospinal fluid. [Aspect 120] 120. The pharmaceutical composition of embodiment 119, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and said artificial cerebrospinal fluid. [Aspect 121] A method comprising administering to a subject an oligomeric compound according to any one of aspects 1 to 68, a modified oligonucleotide according to any one of aspects 69 to 81, a population according to any one of aspects 82 to 87, an oligomeric duplex according to any one of aspects 88 to 114, an antisense agent according to any one of aspects 115 to 117, or a pharmaceutical composition according to any one of aspects 118 to 120. [Aspect 122] A method of treating an ATXN1-related disease, the method comprising administering to a subject having an ATXN1-related disease a therapeutically effective amount of the oligomeric compound according to any one of embodiments 1 to 68, the modified oligonucleotide according to any one of embodiments 69 to 81, the population according to any one of embodiments 82 to 87, the oligomeric duplex according to any one of embodiments 88 to 114, the antisense agent according to any one of embodiments 115 to 117, or the pharmaceutical composition according to any one of embodiments 118 to 120, thereby treating the ATXN1-related disease. [Aspect 123] 123. The method of embodiment 122, wherein the ATXN1-associated disease is spinocerebellar ataxia type 1. [Aspect 124] A method according to any one of aspects 122 to 123, wherein at least one symptom or feature of the ATXN1-associated disease is ameliorated. [Aspect 125] 125. The method of claim 124, wherein the symptom or feature is ataxic gait or limb ataxia, cognitive impairment, difficulty speaking or swallowing, atrophy of the cerebellum and / or brainstem seen on magnetic resonance imaging (MRI), neurochemical abnormalities of the cerebellum and / or brainstem detected by magnetic resonance spectroscopy (MRS), or death within 10 to 15 years of symptom onset. [Aspect 126] A method according to any one of aspects 122 to 125, wherein the level of ATXN1 in the subject is reduced. [Aspect 127] A method for reducing expression of ATXN1 in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 68, a modified oligonucleotide according to any one of embodiments 69 to 81, a population according to any one of embodiments 82 to 87, an oligomeric duplex according to any one of embodiments 88 to 114, an antisense agent according to any one of embodiments 115 to 117, or a pharmaceutical composition according to any one of embodiments 118 to 120. [Aspect 128] 128. The method of embodiment 127, wherein the cell is a CNS cell. [Aspect 129] 120. Use of an oligomeric compound according to any one of aspects 1 to 68, a modified oligonucleotide according to any one of aspects 69 to 81, a population according to any one of aspects 82 to 87, an oligomeric duplex according to any one of aspects 88 to 114, an antisense agent according to any one of aspects 115 to 117, or a pharmaceutical composition according to any one of aspects 118 to 120 for treating an ATXN1 related disease. [Aspect 130] 120. Use of an oligomeric compound according to any one of aspects 1 to 68, a modified oligonucleotide according to any one of aspects 69 to 81, a population according to any one of aspects 82 to 87, an oligomeric duplex according to any one of aspects 88 to 114, an antisense agent according to any one of aspects 115 to 117, or a pharmaceutical composition according to any one of aspects 118 to 120 in the manufacture of a medicament for treating an ATXN1 related disease. [Aspect 131] Use according to embodiment 129 or embodiment 130, wherein said ATXN1 associated disease is spinocerebellar ataxia type 1. [Example]

[0439] Example 1: In vitro effects of 5-10-5 MOE gapmer-modified oligonucleotides on human ATXN1 RNA (single dose) We designed modified oligonucleotides complementary to the human ATXN1 nucleic acid and tested their effects on ATXN1 mRNA at a single dose in vitro in a series of experiments using similar culture conditions.

[0440] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages. These gapmers are 20 nucleoside long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and five 2'-MOE-modified nucleosides in the 3' and 5' wings. The gapmer motif is eeeeeddddddddddeeeee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. The gapmer internucleoside linkage motif is sooosssssssssssooss(5'→3'), where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0441] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_000332.3) or SEQ ID NO: 2 (the complementary strand of nucleotides 16296001 to 16764000 of GENBANK Accession No. NC_000006.12). "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.

[0442] The density was 10,000 cells / well and the treatment time was 48 hours. Cultured A-431 cells were treated with the modified oligonucleotides at a concentration of 4,000 nM according to the method described above. At the end of the cell treatment period, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT PCR. ATXN1 RNA levels were measured using human ATXN1 primer probe set RTS37573 (forward sequence CATCCAGAGTGCAGAGATAAGC (designated herein as SEQ ID NO: 11), reverse sequence ACTCTACCAAAACTTCAACGCT (designated herein as SEQ ID NO: 12), probe sequence AGAGGATTGAAGACAGCCATAGCCC (designated herein as SEQ ID NO: 13)). ATXN1 RNA levels were normalized to total RNA content measured by RIBOGREEN®. Results are shown in the table below as a percentage of ATXN1 RNA levels relative to those of untreated control cells (% control). Each table represents results from an individual assay plate. Asterisks ( * Compound numbers marked with a ) indicate the complementarity of the modified oligonucleotide to the amplified region of the primer-probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplified region. [Table 2-1] Table 2-2 Table 2-3 Table 3-1 Table 3-2 Table 3-3 Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 5-1 Table 5-2 Table 5-3 Table 5-4 [Table 6-1] [Table 6-2] [Table 6-3] [Table 7-1] [Table 7-2] [Table 7-3] [Table 8-1] [Table 8-2] [Table 8-3] [Table 9-1] [Table 9-2] [Table 9-3]

[0443] Example 2: In vitro effects of 5-10-5 MOE gapmer-modified oligonucleotides on human ATXN1 RNA (single dose) We designed modified oligonucleotides complementary to the human ATXN1 nucleic acid and tested their effects on ATXN1 mRNA at a single dose in vitro in a series of experiments using similar culture conditions.

[0444] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed internucleoside linkages. These gapmers are 20 nucleoside long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and five 2'-MOE-modified nucleosides in each of the 3' and 5' wings. The gapmer motif is eeeeeddddddddddeeeee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar and "e" represents a 2'-MOE-modified ribosyl sugar. The gapmer internucleoside linkage motif is sooosssssssssssooss(5'→3'), where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0445] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the human gene sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table is SEQ ID NO: 1, SEQ ID NO: 2, or is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No. NM_001128164.1). "N / A" indicates that the particular gene sequence and modified oligonucleotide are not 100% complementary.

[0446] Cultured A-431 cells were treated with modified oligonucleotides at a concentration of 4,000 nM by free uptake at a density of 10,000 cells / well for 48 hours. At the end of the cell treatment period, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT-PCR. ATXN1 RNA levels were measured using the human ATXN1 primer probe set RTS37575 (forward sequence GTATAGGCTGAGGCTACCTGT (referred to herein as SEQ ID NO: 14), reverse sequence GATCCAGGCTCTTCATGAGG (referred to herein as SEQ ID NO: 15), probe sequence ACAGCAGCTCTGGATGAACATTCACT (referred to herein as SEQ ID NO: 16)). ATXN1 RNA levels were normalized to total RNA content measured by RIBOGREEN®. Results are shown in the table below as a percentage of ATXN1 RNA levels relative to those of untreated control cells (% control). Asterisks ( * Compound numbers marked with a ) indicate the complementarity of the modified oligonucleotide to the amplified region of the primer-probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplified region. [Table 10-1] [Table 10-2] [Table 10-3] [Table 11-1] [Table 11-2] [Table 11-3] Table 12-1 Table 12-2 Table 12-3 Table 13-1 Table 13-2 Table 13-3 Table 14-1 Table 14-2 Table 14-3 Table 15-1 Table 15-2 Table 15-3 Table 16-1 Table 16-2 Table 16-3 Table 17-1 Table 17-2 Table 17-3 Table 18-1 Table 18-2 Table 18-3 Table 19-1 Table 19-2 Table 19-3 Table 20-1 Table 20-2 Table 20-3 Table 21-1 Table 21-2 Table 21-3 Table 22-1 Table 22-2 Table 22-3 Table 23-1 Table 23-2 Table 23-3 Table 24-1 Table 24-2 Table 24-3 Table 25-1 Table 25-2 Table 25-3 Table 26-1 Table 26-2 Table 26-3 Table 27-1 Table 27-2 Table 27-3 Table 28-1 Table 28-2 Table 28-3 Table 29-1 Table 29-2 Table 29-3 Table 30-1 Table 30-2 Table 30-3 Table 31-1 Table 31-2 Table 31-3 Table 32-1 Table 32-2 Table 32-3 Table 33-1 Table 33-2 Table 33-3 Table 34-1 Table 34-2 Table 34-3 Table 35-1 Table 35-2 Table 35-3 Table 36-1 Table 36-2 Table 36-3 Table 37-1 Table 37-2 Table 37-3 Table 38-1 Table 38-2 Table 38-3 Table 39-1 Table 39-2 Table 39-3 Table 40-1 Table 40-2 Table 40-3 Table 41-1 Table 41-2 Table 41-3 Table 42-1 Table 42-2 Table 42-3 Table 43-1 Table 43-2 Table 43-3 Table 44-1 Table 44-2 [Table 44-3] [Table 45-1] [Table 45-2] [Table 45-3] [Table 46-1] [Table 46-2] [Table 46-3] [Table 47-1] [Table 47-2] [Table 47-3] [Table 48]

[0447] Example 3: In vitro effects of modified oligonucleotides on human ATXN1 RNA (multiple doses) Selected modified oligonucleotides from the above examples were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells / well were treated with various concentrations of the modified oligonucleotides identified in the table below, using free uptake. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and ATXN1 RNA levels were measured by quantitative real-time RT-PCR. RNA levels were measured using the human ATXN1 primer probe set RTS37573 described above. ATXN1 levels were adjusted for total RNA content, as measured by RIBOGREEN®. The results shown in the table below represent the percent reduction in ATXN1 RNA relative to that of untreated controls. Where possible, the 50% inhibitory concentration (IC) of each modified oligonucleotide was calculated using linear regression on a log / linear plot of the data in Excel. 50 ) was calculated. [Table 49] [Table 50] [Table 51] [Table 52]

[0448] Example 4: Design of modified oligonucleotides complementary to human ATXN1 nucleic acids The modified oligonucleotides shown in the table below were designed and synthesized.

[0449] The compounds in Table 53 are 5-10-5 MOE gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 20, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of five 2'-MOE nucleosides, and a 3' wing segment consisting of five 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeddddddddddeeeee (5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. These gapmers have a sooosssssssssssooss(5'→3') internucleoside linkage motif, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 53-1] [Table 53-2]

[0450] The compounds in Table 54 are 5-10-5 MOE gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 20, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of five 2'-MOE nucleosides, and a 3' wing segment consisting of five 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeddddddddddeeeee (5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. These gapmers have an internucleoside linkage motif of sssossssssssssssss(5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 54]

[0451] The compounds in Table 55 are 6-10-4 MOE gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 20, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of six 2'-MOE nucleosides, and a 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeed The structure is dddddddddeeee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. Gapmers have an internucleoside linkage motif of soooooossssssssssoss(5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 55-1] [Table 55-2] [Table 55-3]

[0452] The compounds in Table 56 are 5-8-4 mixed MOE / cEt gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 17, with the central gap segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of five 2'-MOE nucleosides, and the 3' wing segment consisting of two cEt nucleosides and two 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeddddddddkkee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety, "k" represents a cEt sugar moiety, and "e" represents a 2'-MOE sugar moiety. These gapmers have an internucleoside linkage motif of sssossssssssssoss(5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 56]

[0453] The compounds in Table 57 are 5-8-4 mixed gapmers with mixed internucleoside linkages. These mixed gapmers have mixed cEt / MOE wings and a 2'-OMe-modified nucleoside at position 2 of the gap. The nucleoside length of these gapmers is 17, with the 5' wing segment consisting of five 2'-MOE nucleosides and the 3' wing segment consisting of two cEt nucleosides and two 2'-MOE nucleosides. The gap is 8 nucleoside long and has 2'-β-D-deoxyribosyl sugar moiety-containing nucleosides at positions 1, 3, 4, 5, 6, 7, and 8 of the gap (counting from the 5' end) and a 2'-OMe nucleoside at position 2 of the gap (counting from the 5' end). The sugar motif of these mixed gapmers is eeeeedyddddddkkee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "y" represents a 2'-O-methylribose sugar moiety. where "k" represents a cEt sugar moiety and "e" represents a 2'-MOE sugar moiety. These gapmers have an internucleoside linkage motif of sssosssssssssss (5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 57]

[0454] The compounds in Table 58 are 5-8-4 MOE gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 17, with the central gap segment consisting of eight 2'-β-D-deoxynucleosides, the 5' wing segment consisting of five 2'-MOE nucleosides, and the 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeddddddddeeee (5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. These gapmers have an internucleoside linkage motif of sssossssssssssoss(5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 58]

[0455] The compounds in Table 59 are 5-10-5 MOE gapmers with mixed internucleoside linkages. These gapmers have a nucleoside length of 20 and a central gap segment. The gapmers consist of 10 2'-β-D-deoxynucleosides, the 5' wing segment consists of five 2'-MOE nucleosides, and the 3' wing segment consists of five 2'-MOE nucleosides. The sugar motif of these gapmers is eeeeeddddddddddeeeee(5'→3'), where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. These gapmers have an internucleoside linkage motif of sooosssssssssssooss(5'→3'), where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. [Table 59]

[0456] Example 5: Long-term tolerability evaluation of modified oligonucleotides complementary to human ATXN1 in rats In separate studies conducted under the same conditions, the modified oligonucleotides described above were tested in Sprague-Dawley rats to assess their long-term tolerability. Each Sprague-Dawley rat received a single intrathecal (IT) delivery of a 3 mg dose of oligonucleotide or PBS. Each animal was weighed and evaluated for adverse events weekly by a trained observer. Adverse events were defined as neurological dysfunction not observed in PBS-treated control animals. These neurological dysfunctions included, but were not limited to, abnormal stridor, gait abnormalities, tremors, respiratory abnormalities, paralysis, and spasticity. No adverse events were observed during the study period in animals treated with Compound #994509, Compound #1040500, Compound #1041927, Compound #1055001, Compound #1371311, or Compound #1385293.

[0457] Example 6: Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice A transgenic mouse model was developed in the laboratories of Dr. Harry Orr and Dr. Michael Koob at the University of Minnesota. The construct contained exon 8, intron 8, and exon 9 (including the entire 3'UTR) of human Atxn1 (Banfi et al. Nat. Genet. 7:513-520, 1994) (including nucleosides 435531 to 464889 of SEQ ID NO: 2) (flanked by Frt sites for FLP recombinase) and the selectable marker Hygro (flanked by LoxN sites for CRE recombinase). This construct was injected into mouse blastocysts. The human sequences (exon 8, intron 8, and exon 9) replace exon 7, intron 7, and exon 8 of mouse Atxn1. Removal of the Hygro cassette via recombination resulted in chimeric mice expressing the human coding sequence (exons 8 and 9). In this model, human RNA is expressed in the brain and spinal cord, and there is a single-base deletion that results in a stop codon at amino acid 190, so no protein is produced.

[0458] The transgenic mice described above were used to test the activity of the modified oligonucleotides described above.

[0459] process ATXN1 transgenic mice were treated once with a 300 μg ICV bolus of modified oligonucleotide. PBS was administered to groups of 3–4 mice on each treatment day as a negative control. PCR values ​​were normalized to the PBS control group for each mouse treated on the same day. In some cases, individual mice treated with a given modified oligonucleotide were treated on different days. The results reported for each modified oligonucleotide in the tables below represent the average of 1–3 independent experiments, corresponding to 1–5 treated mice for each modified oligonucleotide.

[0460] RNA analysis After two weeks of treatment, mice were sacrificed, and RNA was extracted from cerebral cortex tissue for real-time qPCR analysis of ATXN1 RNA expression using primer probe set RTS37573 (described above). Results are shown as percent change in RNA (vs. PBS control) (RNA amount was normalized to mouse cyclophilin A). Data shown as "nd" (not available) means that data for that tissue was not available for that compound.

[0461] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of ATXN1 RNA compared to the PBS control. [Table 60-1] [Table 60-2] [Table 60-3] [Table 60-4] [Table 60-5] [Table 60-6] [Table 60-7] [Table 60-8] [Table 60-9] [Table 60-10] [Table 60-11] [Table 60-12]

[0462] Example 7: Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice (multiple doses) The modified oligonucleotides described above were tested in the ATXN1 transgenic mice described herein above.

[0463] process ATXN1 transgenic mice were divided into groups of 3-4 mice each. Each mouse received a single ICV bolus of modified oligonucleotides at the doses listed in the table below, and the mice were sacrificed 2 weeks later. For each experiment, a group of 4 mice received PBS as a negative control. Each table represents a separate experiment.

[0464] RNA analysis Mice were sacrificed two weeks later, and RNA was extracted from cerebral cortex tissue for real-time PCR analysis using primer probe set RTS37573 to measure ATXN1 RNA expression. Results are shown as percent change in RNA (vs. PBS control). (RNA levels were normalized to mouse cyclophilin A, measured with primer probe set m_cyclo24, described previously herein.) ED50 values ​​were calculated using GraphPad Prism. N / A indicates that it was not possible to reliably calculate an ED50 value for that experiment.

[0465] As shown in the table below, treatment with modified oligonucleotides resulted in a dose-dependent reduction of ATXN1 RNA compared to the PBS control. [Table 61] Table 62 Table 63 Table 64 Table 65

Claims

[Claim 1] The invention described herein.