Anti-type-i allergy agent, Anti-type-i allergy composition, method for producing Anti-type-i allergy agent, method for producing Anti-type-i allergy composition, and method for using Anti-type-i allergy

Abstract

To provide an anti-type I allergy agent having a synergistic and remarkable anti-type I allergy effect by combining lactic acid bacteria with rosmarinic acid or its salt, to provide a composition for anti-type I allergy, to provide a method for producing the anti-type I allergy agent, to provide a method for producing the composition for anti-type I allergy, and to provide a method for using the composition for anti-type I allergy.SOLUTION: The anti-type I allergy agent contains a lactic acid bacterium specified by accession number NITEP 755 and rosmarinic acid or a salt thereof as active ingredients.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to an anti-type I allergy agent, a composition for anti-type I allergy, a method for producing an anti-type I allergy agent, a method for producing a composition for anti-type I allergy, and a method for using the composition for anti-type I allergy. [Background technology]

[0002] In recent years, the number of people with allergic diseases has been rapidly increasing in Japan, and a nationwide survey conducted by the Ministry of Health, Labor and Welfare in 2019 showed that the prevalence of hay fever was 42.5%. As such, type I allergies, including hay fever, have become a social problem that troubles many people.

[0003] The suppressive effects of various food ingredients on hay fever have been reported, and the effectiveness of food ingredients with anti-inflammatory properties, such as polyphenols, has been revealed.

[0004] Non-Patent Document 1 suggests that epigallocatechin gallate (EGCG), a polyphenol contained in green tea, improves airway inflammation in asthma model mice and is useful as a therapeutic agent for asthma. Also, Non-Patent Document 2 suggests that β-1,4 mannobiose (MNB) reduces allergic symptoms in cedar pollen allergy model mice and is useful as a therapeutic agent for hay fever. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Epigallocatechin gallate ameliorates airway inflammation by regulating Treg / Th17 imbalance in an asthmatic mouse model.Int immunopharmacol.2019 Jul;72:422-428. [Non-patent document 2] Therapeutic Effects of β1,4 Mannobiose in a Balb / c Mouse Model of Intranasally-Induced Pollen Allergy.Allergology International.2013;62:65-76 Summary of the Invention [Problem to be solved by the invention]

[0006] As the number of people suffering from type I allergies, including hay fever, increases year by year, there has been a need for the development of new anti-type I allergy drugs.

[0007] The present invention has been made in view of the above circumstances, and aims to provide an anti-type I allergy agent that has a synergistic and significant anti-type I allergy effect by combining lactic acid bacteria with rosmarinic acid or a salt thereof, an anti-type I allergy composition, a method for producing an anti-type I allergy agent, a method for producing an anti-type I allergy composition, and a method for using the composition for anti-type I allergy. [Means for solving the problem]

[0008] In order to achieve the above object, the anti-type I allergy agent according to the first aspect of the present invention comprises: The active ingredients are lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or its salt.

[0009] The anti-type I allergy composition according to the second aspect of the present invention comprises: The active ingredients are lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or its salt.

[0010] A method for producing an anti-type I allergy agent according to a third aspect of the present invention comprises: The method includes a step of adding lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

[0011] A method for producing an anti-type I allergy composition according to a fourth aspect of the present invention comprises: The method includes a step of adding lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

[0012] The method for anti-type I allergy according to the fifth aspect of the present invention comprises: This method uses lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof for the purpose of preventing type I allergy. [Effects of the Invention]

[0013] According to the present invention, it is possible to provide an anti-type I allergy agent, an anti-type I allergy composition, a method for producing an anti-type I allergy agent, a method for producing an anti-type I allergy composition, and a method for using the composition for anti-type I allergy, which have a synergistic and significant anti-type I allergy effect by combining lactic acid bacteria with rosmarinic acid. [Brief explanation of the drawings]

[0014] [Figure 1] FIG. 1 shows the experimental schedule for the pollen allergy model mice of this example. [Figure 2] FIG. 1 is a graph showing the effect of each test group on the symptoms of a pollen allergy model mouse, where (A) is the number of nose-scratching actions, and (B) is the number of sneezes. [Figure 3] FIG. 1 is a graph showing the amount of IL-10 mRNA expression measured in each test group. [Figure 4] This is an electrophoretic diagram showing the quantification of IgE receptor α-chain protein in each test group. DETAILED DESCRIPTION OF THE INVENTION

[0015] (1. Anti-type I allergy agent / composition for anti-type I allergy) The anti-type I allergy agent or anti-type I allergy composition of the present invention (hereinafter referred to as the anti-type I allergy agent / composition of the present invention) contains, as active ingredients, a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

[0016] The "lactic acid bacterium identified by accession number NITE P-755" contained in the anti-type I allergy agent / composition of the present invention was deposited under accession number NITE P-755 at the Patent Microorganisms Depositary Center of the National Institute of Technology and Evaluation, located at 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, on May 14, 2009. In this specification, the lactic acid bacterium identified by accession number NITE P-755 may be referred to as "Pediococcus sp. KB1" or "KB1." For details of the culture conditions, bacteriological properties, and other aspects of the lactic acid bacterium of the present invention, see Japanese Patent Application Laid-Open No. 2011-41499.

[0017] As a result of intensive research, the present inventors have discovered that "lactic acid bacteria identified by Accession No. NITE P-755," which have immunostimulatory activity and gastric juice resistance, have a novel use in that they exert an anti-type I allergy effect, and furthermore, that when used in combination with rosmarinic acid, the anti-type I allergy effect is surprisingly synergistically enhanced, leading to the present invention. Rosmarinic acid is a type of polyphenol, and it is particularly noteworthy that, among the many polyphenols present, rosmarinic acid in particular can exert a remarkable anti-type I allergy effect when combined with "lactic acid bacteria identified by Accession No. NITE P-755."

[0018] In the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" may be live cells, killed cells, treated cells, or a mixture thereof. It may also be a part of the cell, such as the cell membrane or cytoplasm. Here, live cells refer to live lactic acid bacteria, and include culture solutions of lactic acid bacteria, suspensions of the culture solutions, crude products, purified products, and cell powders obtained by drying live lactic acid bacteria by freeze-drying, spray-drying, or the like, without limitation, as long as they are live. Furthermore, killed cells refer to lactic acid bacteria that have been sterilized by subjecting live lactic acid bacteria to physical or chemical treatment, such as heat treatment or radiation treatment, and include cell powders obtained by drying sterilized lactic acid bacteria by freeze-drying, spray-drying, or the like, without limitation, as long as they are killed. The treated bacterial cells refer to disrupted bacterial cells obtained by homogenizing, enzymatically treating, ultrasonicating, etc., and also include powder of disrupted bacterial cells obtained by drying the disrupted bacterial cells by freeze-drying, spray-drying, etc. The "lactic acid bacteria identified by Accession No. NITE P-755" contained in the anti-type I allergy agent / composition of the present invention is preferably in the form of live bacterial cells, killed bacterial cells, treated bacterial cells, or a mixture thereof.

[0019] In the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" can be cultured under the culture conditions described in JP 2011-41499 A. The lactic acid bacteria can be grown by culturing them in any medium suitable for the growth of the lactic acid bacteria strain (e.g., MRS medium, LBS medium, Rogosa medium, etc.) at a predetermined temperature for a predetermined period of time. After culturing, the bacterial cells can be harvested, for example, by centrifuging the culture (culture solution) under predetermined conditions. The "lactic acid bacteria identified by Accession No. NITE P-755" used in the present invention may also be cultured (fermented) in the presence of ingredients such as milk, vegetables, fruits, soy milk, etc. As described above, the bacterial cells can be harvested by centrifugation after culturing. In the present invention, the culture (fermented product) obtained in this manner, the harvested bacterial cells, a suspension or concentrate of the culture or bacterial cells, or a powder obtained by drying the culture, bacterial cells, suspension, or concentrate by freeze-drying, spray-drying, or the like can also be used. These preparations can be carried out according to methods known in the art.

[0020] The rosmarinic acid contained in the anti-type I allergy agent / composition of the present invention is a compound having the following structural formula: Rosmarinic acid may be synthesized, commercially available, or extracted from any plant. [ka]

[0021] In this specification, salts of rosmarinic acid include, for example, inorganic salts with sodium, magnesium, potassium, calcium, aluminum, etc.; salts with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts with basic amino acids such as lysine, ornithine, arginine, etc.; and ammonium salts. The salts may be acid addition salts, and specific examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, ethanesulfonic acid, etc.; and acidic amino acids such as aspartic acid, glutamic acid, etc.

[0022] As used herein, the term "anti-type I allergy" refers to the exertion of preventive or therapeutic effects against various diseases or symptoms caused by type I allergy. As used herein, "prevention" of a disease or symptom includes suppressing or delaying the onset of the disease or symptom, and suppressing its recurrence, while "treatment" of a disease or symptom includes not only complete treatment of the disease or symptom, but also alleviating symptoms and suppressing its progression.

[0023] Diseases or symptoms to which the anti-type I allergy agent or composition of the present invention is applicable include, but are not limited to, hay fever, allergic rhinitis, atopic dermatitis, allergic dermatitis, bronchial asthma, urticaria, allergic conjunctivitis, anaphylactic shock, discomfort caused by allergens (runny nose, stuffy nose, itchy feeling, sneezing, itchy eyes, etc.), etc. In the present specification, allergens include, but are not limited to, house dust, dirt, pollen (cedar, cypress, alder, white birch, Japanese sawara, ragweed, mugwort, Chinese knotweed, grass family plants, etc.), dust mites, mold, bacteria, and animal dander.

[0024] The anti-type I allergy agent or composition of the present invention may exert its anti-type I allergy effect, for example, by acting on IL-10 (interleukin-10). IL-10 is an inhibitory cytokine that has been reported to suppress the production of inflammatory cytokines such as TNF-α and IL-18; directly inhibit cell activation by acting on immune cells such as T cells and macrophages; and reduce the antigen-presenting ability of dendritic cells. The more severe the allergic symptoms, the lower the IL-10 production. The anti-type I allergy agent or composition of the present invention is useful for treating or preventing type I allergy, for example, by effectively promoting IL-10 production. Therefore, the present specification also discloses an IL-10 production promoter containing, as active ingredients, a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof, which can similarly exert a strong anti-type I allergy effect.

[0025] The anti-type I allergy agent or composition of the present invention may exert its anti-type I allergy effect, for example, by acting on the IgE receptor. The IgE receptor (FcεRI) is a receptor for immunoglobulin E (IgE), which causes allergies. In mast cells, the IgE receptor is composed of an α chain, a β chain, and a dimeric γ chain. The α chain binds to the Fc region of the IgE antibody in its extracellular domain, the β chain affects the strength of intracellular transmission of IgE antibody-mediated stimuli, and the γ chain is responsible for intracellular signal transduction. The more severe the allergic symptoms, the greater the expression levels of the α chain, β chain, and γ chain of the IgE receptor. The anti-type I allergy agent or composition of the present invention may exert its anti-type I allergy effect, for example, by reducing the expression level and / or number of IgE receptors. For example, it may exert its anti-type I allergy effect by reducing the expression level of the α chain of the IgE receptor, or it may exert its anti-type I allergy effect by reducing the expression level of the γ chain of the IgE receptor. Therefore, this specification also discloses an IgE receptor inhibitor, an IgE receptor α-chain expression inhibitor, or an IgE receptor γ-chain expression inhibitor, which contain as active ingredients the lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof, and these can also exert a high anti-type I allergy effect.

[0026] The anti-type I allergy agent / composition according to the present invention is administered to a subject requiring the therapeutic or preventive effect of anti-type I allergy, for example, mammals such as rodents including mice, rats, hamsters, and guinea pigs, primates including humans, chimpanzees, and rhesus monkeys, livestock including pigs, cows, goats, horses, and sheep, and pets including dogs and cats. The preferred subject is humans.

[0027] The method of administration of the anti-type I allergy agent / composition of the present invention can be appropriately selected from oral administration, external application, topical administration, intravenous administration, intraperitoneal administration, intradermal administration, sublingual administration, etc. The dosage form may also be any, and an appropriate drug delivery system (DDS) may be used. These dosage forms are produced by formulating the active ingredient using conventional methods. Furthermore, various pharmaceutically acceptable pharmaceutical substances can be blended as needed for the formulation. Pharmaceutical substances can be appropriately selected depending on the dosage form of the formulation, and examples include buffering agents, surfactants, stabilizers, preservatives, excipients, diluents, additives, disintegrants, binders, coating agents, lubricants, glidants, flavoring agents, sweeteners, solubilizers, etc.

[0028] The anti-type I allergy agent / composition of the present invention can be prepared into various formulations by mixing it with a base or carrier commonly used in pharmaceuticals or quasi-drugs, and, if necessary, with additives commonly used in pharmaceuticals or quasi-drugs (e.g., surfactants, stabilizers, antioxidants, colorants, dispersants, chelating agents, pH adjusters, preservatives, thickeners, irritation reducers, etc.) according to conventional methods, followed by emulsification or solubilization as necessary. In addition to the essential components of the present invention, the "lactic acid bacteria identified by Accession No. NITE P-755" and rosmarinic acid or a salt thereof, optional components (e.g., other anti-allergy agents, anti-inflammatory agents, cooling agents, disinfectants, vitamins, organic acids, moisturizing ingredients, polyhydric alcohols, scrubbing agents, UV-absorbing ingredients, UV-scattering ingredients, astringent ingredients, peptides or derivatives thereof, amino acids or derivatives thereof, cleansing ingredients, keratin softening ingredients, cell activating ingredients, blood circulation promoting ingredients, powders, etc.) within the scope of the present invention.

[0029] The dosage and frequency of administration of the anti-type I allergy agent / composition of the present invention can be appropriately determined by a person skilled in the art depending on the type of disease or symptom, the patient's health condition, age, weight, administration route, administration form, etc., so that an effective amount is administered to the patient.

[0030] The anti-type I allergy agent or composition according to the present invention may be ingested, for example, as a food or drink. Specific examples of foods and drinks include soft drinks, energy drinks, health foods, foods for specified health uses, functional foods, functionally active foods, nutritional supplements, supplements, and health foods or supplementary foods including beverages. By orally ingesting the anti-type I allergy agent or composition according to the present invention, for example, on a daily basis, an effective anti-type I allergy effect can be obtained.

[0031] (2. Method for producing an anti-type I allergy agent or anti-type I allergy composition) The method for producing the anti-type I allergy agent or anti-type I allergy composition of the present invention comprises the step of adding lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof. Details of the lactic acid bacteria, rosmarinic acid or a salt thereof, and "anti-type I allergy" according to the present invention are the same as those described above.

[0032] The production method of the present invention will be described below by way of an example. A predetermined amount of killed lactic acid bacteria identified by accession number NITE P-755 and a predetermined amount of rosmarinic acid are added to, for example, a predetermined solution, semi-solid, or solid (e.g., powder, granules, etc.) and mixed to obtain an anti-type I allergy agent or anti-type I allergy composition.

[0033] The present invention also includes an anti-type I allergy agent or anti-type I allergy composition obtained by the above-mentioned production method.

[0034] (3. Methods Used for Anti-Type I Allergy) The method according to the present invention is a method for using lactic acid bacteria identified by accession number NITE P-755 and rosmarinic acid or a salt thereof for the purpose of anti-type I allergy. Details of the lactic acid bacteria, rosmarinic acid or a salt thereof, and "anti-type I allergy" according to the present invention are the same as those described above.

[0035] In the method according to the present invention, for example, an agent or composition containing the lactic acid bacteria identified by Accession No. NITE P-755 and rosmarinic acid or a salt thereof as active ingredients can be used to treat, for example, hay fever, allergic rhinitis, atopic dermatitis, allergic dermatitis, bronchial asthma, urticaria, allergic conjunctivitis, anaphylactic shock, and allergen-induced discomfort (runny nose, stuffy nose, itchy feeling, sneezing, itchy eyes, etc.). The method according to the present invention can achieve a high anti-type I allergy effect and a high therapeutic or preventive effect against the above allergic symptoms or allergic diseases.

[0036] (4. Conclusion) As described above, the present invention provides an anti-type I allergy agent, anti-type I allergy composition, method for producing an anti-type I allergy agent, method for producing an anti-type I allergy composition, and method for using the anti-type I allergy agent to achieve a synergistic anti-type I allergy effect by combining lactic acid bacteria with rosmarinic acid or a salt thereof. While lactic acid bacteria or rosmarinic acid alone have traditionally not been effective against type I allergies, the inventors of the present invention have, through extensive research, discovered that combining "lactic acid bacteria identified by Accession No. NITE P-755" with rosmarinic acid or a salt thereof exerts a synergistic and significant anti-type I allergy effect, thereby completing the present invention. Given the increasing number of people suffering from type I allergy symptoms or diseases each year, the present invention is expected to be useful as a novel and effective anti-type I allergy agent or composition. [Example]

[0037] The present invention will be specifically described below with reference to examples, although the present invention is not limited to these examples.

[0038] Using a mouse model of hay fever, we investigated the inhibitory effect of combined use of killed cells of Pediococcus sp. KB1 (NITE P-755) (hereinafter referred to as "KB1") and rosmarinic acid on type I allergy.

[0039] (Creation of a mouse model of hay fever) Five-week-old BALB / c male mice (CLEA Japan, Inc.) were housed at a room temperature of 23°C, humidity of 60-65%, and a 12-hour light-dark cycle (9:00-21:00). Food and drinking water (distilled water) were available ad libitum. After pre-hospitalization for 5 days, the mice were divided into the following five groups. Each group contained six mice. The test schedule is shown in Figure 1. -Sham control group (hereinafter referred to as "Sham group"): 0.2 mL of PBS was orally administered - Positive control (hereinafter referred to as "Control group"): Oral administration of 0.2 mL of PBS Pediococcus sp. KB1 (NITE P-755) group (hereinafter referred to as "KB1 group"): 10 mg / animal of KB1 dissolved in 0.2 mL of PBS was orally administered. - Rosmarinic acid group (hereinafter referred to as "RA group"): 30 mg / kg of rosmarinic acid dissolved in 0.2 mL of PBS was orally administered Pediococcus sp. KB1 + rosmarinic acid group (hereinafter referred to as "KB1 + RA group"): 10 mg / animal of KB1 and 30 mg / kg of rosmarinic acid dissolved in 0.2 mL of PBS were orally administered.

[0040] (Exam Schedule) After a 5-day pre-breeding period, the KB1, RA, and KB1+RA groups were treated with KB1, rosmarinic acid, or KB1 and rosmarinic acid, 6 days a week. One week after the start of oral administration, the first sensitization was performed. The control, KB1, RA, and KB1+RA groups received a suspension of 1 μg of Cryj1 and 2 mg / L Al(OH)3 in 0.2 mL of PBS (Fujifilm Wako Pure Chemical Industries, Ltd.) intraperitoneally three times at weekly intervals (primary sensitization). Subsequently, starting the day after the final primary sensitization, 0.5 μg of Cryj1 dissolved in 10 μL of PBS was administered intranasally for 10 consecutive days (secondary sensitization). Behavioral observations and dissections were performed on day 31. These animal experiments were conducted in accordance with the guidelines of Hokkaido University and approved by the Hokkaido University Animal Care and Use Committee.

[0041] (Spleen tissue collection) Two hours after the last intranasal administration, the rats were anesthetized with isoflurane (animal isoflurane, Zoetis Japan Co., Ltd.) and the spleens were removed.

[0042] (Behavioral observation) Regarding nose scratching and sneezing, the number of nose scratching and sneezing were counted for 10 minutes immediately after sensitization on the last day of intranasal administration. The more severe the allergic symptoms, the more frequent the nose scratching and sneezing.

[0043] (Quantification of IL-10 mRNA expression in spleen tissue using real-time PCR)

[0044] IL-10 (interleukin-10) is an inhibitory cytokine that suppresses the production of inflammatory cytokines such as IFN-γ and reduces the antigen-presenting ability of dendritic cells. The more severe the allergic symptoms, the lower the production of IL-10.

[0045] 100 mg of spleen tissue was homogenized in 1 mL of TRISOL reagent (Invitrogen). After allowing to stand at room temperature for 5 minutes, 200 μL of chloroform was added. The mixture was vortexed for 15 seconds and centrifuged at 12,000 g at 4°C for 15 minutes. 500 μL of the aqueous layer was taken, 500 μL of 2-propanol was added, and the mixture was allowed to stand at room temperature for 10 minutes. After centrifugation at 12,000 g at 4°C for 10 minutes, the supernatant was removed. 1 mL of 75% ethanol (25% DEPC-treated water) was added, and the mixture was centrifuged at 12,000 g at 4°C for 5 minutes. After removing the supernatant, the mixture was dried in a centrifugal evaporator. 30 μL of DEPC-treated water was added to dissolve the tissue, and the RNA concentration was determined using a BioSpec-nano (Shimazubiotech) spectrophotometer.

[0046] To generate cDNA, a 20 μL reaction mixture (Oligo dT Primer 1 μL, dNTP Mixture 1 μL, 5× PrimeScript Buffer 4 μL, RNA Inhibitor 0.5 μL, PrimeScript RTase 1 μL, total RNA + RNase-free dH2O 12.5 μL) was prepared and subjected to enzymatic reaction under the following conditions: 10 minutes at 30°C, 10 minutes at 42°C, 60 minutes at 99°C, and 5 minutes at infinity. Quantification was performed using the Step One Plus Real-time PCR system (Life Technologies) with the KAPA SYBR FAST Universal qPCR Kit (Kapa Biosystems) and the following primers:

[0047] The sequences of the primers used in the experiment are as follows: IL-10 Forward: GCCCCAGGCAGAGAAGCATGG (SEQ ID NO: 1) IL-10 Reverse: GGGGAGAAATCGATGACAGCGCC (SEQ ID NO: 2) GAPDH Forward: TTCACCACCATGGAGAAGGC (SEQ ID NO: 3) GAPDH Reverse: GGCATGGACTGTGGTCATGA (SEQ ID NO: 4)

[0048] (Analysis of IgE receptor α-chain expression in spleen tissue by Western blot analysis)

[0049] The IgE receptor (FcεRI) is a receptor for immunoglobulin E (IgE), which causes allergies. In mast cells, the IgE receptor is composed of an α chain, a β chain, and a dimeric γ chain, and the α chain (FcεRIα) plays a role in binding to the Fc region of IgE antibodies in the extracellular domain.

[0050] Western blot analysis was performed to quantify FcεRIα protein in spleen as follows. 1 mL of RIPA buffer (Fujifilm Wako Pure Chemical Industries, Ltd.) was added to 50 mg of spleen tissue, homogenized, and protein was extracted according to the manufacturer's instructions. For polyacrylamide gel electrophoresis (SDS-PAGE), 20 μg of each protein sample, a molecular weight marker (MagicMark XP Standard: Invitrogen), and a 3-color Prestained XL-Ladder (Antegral Inc.) were loaded and separated at 180 mA for 40 minutes. NuPAGE™ Bis-Tris Mini Protein Gels, 10%, 1 mm (Thermo Fisher Scientific) were used for transfer at 20 V for 7 minutes, and protein content was detected using Cleary Western ECL Substrate (BIO RAD) on an LAS-1000 (Fujifilm Wako Pure Chemical Industries, Ltd.). The primary antibody (β-actin) used was Anti-β Actin (mouse)-HRP (Proteintech) (diluted 4000-fold with TBST). The primary antibody (FcεRIα) used was FcεRIα (X-22) (mouse)-HRP (Santa Cruz Biotechnology) (diluted 500-fold with 3% BSA / TBST). The secondary antibody (rabbit) used was HRP-conjugated anti-rabbit IgG antibody (Cell Signaling Technology) (diluted 4000-fold with TBST).

[0051] (result) Regarding the effect on nose-scratching behavior (Figure 2(A)), a tendency for a decrease was observed in the KB1 and RA groups, but there was no significant difference compared to the control group. On the other hand, a significant decrease was observed in the KB1+RA group compared to the control group. Thus, the combined use of KB1 and rosmarinic acid significantly reduced nose-scratching behavior, indicating that the combination of the two effectively suppresses type I allergy.

[0052] Regarding the effect on sneezing (Figure 2(B)), a tendency for a decrease was observed in the KB1 group, but there was no significant difference compared to the control group. On the other hand, a significant decrease was observed in the RA group and the KB1+RA group, and the number of sneezes in the KB1+RA group was even lower than in the RA group. Thus, the combined use of KB1 and rosmarinic acid significantly reduced the number of sneezes, indicating that the combination of the two effectively suppresses type I allergies.

[0053] Regarding the effect on IL-10 mRNA expression (Figure 3), significant increases were observed in the KB1 group, RA group, and KB1 + RA group, and a synergistic increase in IL-10 mRNA expression was also observed in the KB1 + RA group. Thus, the combined use of KB1 and rosmarinic acid significantly increased the mRNA expression of IL-10, an inhibitory cytokine, indicating that the combination of the two effectively suppresses type I allergy.

[0054] Regarding the effect on FcεRIα protein (Figure 4), a decrease was observed in the KB1 group and the KB1 + RA group, but a significant decrease in FcεRIα protein was also observed in the KB1 + RA group. Thus, the combined use of KB1 and rosmarinic acid significantly decreased FcεRIα protein, which binds to the Fc region of IgE antibodies, indicating that the combination of the two effectively suppresses type I allergy.

[0055] These findings demonstrate that the combination of KB1 and rosmarinic acid exerts a significant anti-type I allergy effect through a synergistic effect. Anti-type I allergy agents and compositions combining KB1 and rosmarinic acid are expected to be highly useful in clinical settings.

Claims

1. An anti-type I allergy agent containing as active ingredients a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

2. An anti-type I allergy composition containing as active ingredients a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

3. A method for producing an anti-type I allergy agent, comprising the step of adding a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

4. A method for producing an anti-type I allergy composition, comprising the step of adding a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

5. A method for preventing type I allergy, comprising using a lactic acid bacterium identified by accession number NITE P-755 and rosmarinic acid or a salt thereof.

Images