Translatable molecules and synthesis thereof

Abstract

Therapeutic mRNA molecules are provided that are expressible to provide a target polypeptide or protein.SOLUTION: The RNA molecule can contain one or more 5-methoxyuridines and 5-methylcytidines. Further provided is a DNA template that can be transcribed to provide a target mRNA and that can have altered nucleotides such as reduced deoxyadenosine. The present invention also provides a process for producing a therapeutic mRNA molecule. An RNA molecule can be translated in vitro or in vivo to provide an active polypeptide or protein.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to the field of molecular biology, biologics and therapeutics produced by translatable molecules. More specifically, the present invention relates to methods, structures and compositions for the synthesis of molecules with translational activity to generate active polypeptides or proteins for use in vivo and as therapeutics.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted electronically as an ASCII file named ARC4097WO_SL.txt. [Background technology]

[0003] The use of RNA molecules in therapeutics is a promising goal.In particular, RNA molecules can be engineered to affect or treat rare diseases that cannot be approached as easily by other means.It will be useful to use synthetic RNA to control or enhance the production and purity of polypeptides or proteins, especially those directly related to disease.However, the potential of RNA therapeutics has long been difficult to realize.

[0004] Weaknesses of using RNA molecules as pharmaceutical agents include a general lack of ability to control or vary the structure to enhance therapeutic properties, and a general lack of predictability regarding modification or change of chemical structure to modulate properties associated with drug success.

[0005] For example, increasing the level of a therapeutic moiety in vivo is an important factor in drug success, and therefore compositions and methods for increasing the efficiency of RNA translation, and in particular, increasing the amount of translated polypeptide or protein, are desirable results.

[0006] Furthermore, structural modifications that increase the efficiency of production of translatable RNA may improve the apparent and / or intrinsic activity of the RNA and thus contribute to new therapeutic effects. Summary of the Invention [Problem to be solved by the invention]

[0007] There is an urgent need for translationally active molecules, structures, and compositions to provide active polypeptides and proteins both in vitro and in vivo. Such new molecules with functional cytoplasmic half-lives to produce active peptides and proteins can give rise to new drug molecules and therapeutic modalities.

[0008] There is a need for translatable molecules and methods for their synthesis that may have increased specific activity, longevity or other properties over native mRNA to be used in methods and compositions for producing and delivering active polypeptides and proteins in medicine. [Means for solving the problem]

[0009] The present invention provides methods and compositions for a broad platform for designing and implementing RNA agents and other therapeutic modalities for rare diseases.

[0010] The present disclosure includes methods and compositions for novel molecules with translational activity that can be used to provide active polypeptides, proteins, or fragments thereof in a variety of settings.

[0011] In some embodiments, the present invention provides a process for producing RNA, comprising the step of providing a DNA molecule that can be transcribed to provide RNA. In the DNA, a specific codon in the open reading frame of the DNA can be replaced with an alternative codon, and the codon is in-frame in the reading frame. The DNA molecule can be transcribed in the presence of nucleoside triphosphates, a 5' cap, and one or more chemically modified nucleoside triphosphates to form a product mixture. RNA can be isolated and purified from the mixture. The RNA can contain natural and chemically modified nucleotides.

[0012] In certain embodiments, the present invention provides a method for synthesizing RNA. The process for producing RNA can include a step of providing a DNA molecule that can be transcribed to provide RNA. In the DNA, certain deoxyadenosine nucleotides in the open reading frame of the DNA can be replaced with non-deoxyadenosine nucleotides. The DNA can further include a promoter for transcribing the non-coding strand. The DNA molecule can be transcribed in the presence of nucleoside triphosphates, a 5' cap, and one or more chemically modified nucleoside triphosphates to form a product mixture. The RNA can be isolated and purified from the mixture. The RNA can contain natural and chemically modified nucleotides.

[0013] The RNA product molecules generated by the processes of the present invention can have functional cytoplasmic half-lives for producing polypeptides and proteins that can be active for therapeutic modalities and for use in vaccines and immunotherapy.

[0014] The RNA molecules produced by the process of the present invention may be translatable messenger molecules that may have a long half-life, particularly in the cytoplasm of a cell. The longer duration of the translatable messenger molecules of the present invention may be significant for providing active translation products to ameliorate, prevent, or treat disease.

[0015] The present disclosure provides a range of structures for translatable molecules with increased specific activity and / or life span over native mRNA. The translatable molecules of the invention can be used in medicine and for methods and compositions for producing and delivering active peptides and proteins.

[0016] The present invention further provides processes for generating translatable RNA molecules with enhanced properties for providing and delivering polypeptides and proteins.

[0017] Embodiments of the present disclosure can provide a wide range of novel translatable messenger RNA molecules that can contain a variety of chemically modified nucleotides.

[0018] The translatable molecules of the invention can be used to provide polypeptides or proteins in vitro, ex vivo or in vivo.

[0019] The translatable messenger molecules of the present invention can be designed to provide highly efficient expression of the expression product, polypeptide, protein or fragment thereof. Expression can be in vitro, ex vivo or in vivo.

[0020] In some embodiments, the messenger molecules of the present invention have an increased cytoplasmic half-life relative to the native mature mRNA that provides the same expression product. The structures and compositions of the present invention can provide an increased functional half-life relative to the native mature mRNA.

[0021] In a further aspect, the translatable messenger molecules of the invention can provide increased activity as drugs to provide polypeptide or protein products compared to native mature mRNA, hi some embodiments, the translatable molecules can reduce the expected dosage levels that would be required for effective therapy.

[0022] In additional embodiments, the present invention provides methods for ameliorating, preventing, or treating a disease or condition in a subject, the method comprising administering to the subject a composition containing a translatable molecule of the present invention.

[0023] The disease or condition may be, inter alia, a rare disease, a chronic disease, a liver disease or cancer.

[0024] In certain embodiments, the present invention provides methods for producing a polypeptide or protein in vivo by administering to a mammal a composition containing a translatable RNA molecule, The polypeptide or protein may be defective in a disease or condition of the subject or mammal.

[0025] The present invention further provides methods for producing therapeutic polypeptides or proteins in vitro or in vivo by transfecting cells with translatable molecules. The polypeptide or protein can be defective in a disease or condition of a subject or mammal.

[0026] Embodiments of the present invention include the following:

[0027] An RNA that can be expressed to provide a target polypeptide or protein, wherein the occurrence of uridine in the coding sequence region of the RNA is reduced by at least 20% compared to a wild-type mRNA that can be expressed to provide the target polypeptide or protein, and the RNA contains one or more 5-methoxyuridines.

[0028] The above RNA, wherein 10 to 100% of the uridines in the RNA are 5-methoxyuridine.The above RNA, wherein one or more 5-methylcytidines are contained.The above RNA, wherein 10 to 100% of the cytidines in the RNA are 5-methylcytidine.

[0029] An RNA as described above, wherein the occurrence of uridines in the coding sequence region of the RNA is reduced by at least 35% compared to a wild-type mRNA expressible to provide a target polypeptide or protein.

[0030] The above-mentioned RNA is translatable to express a polypeptide or protein having at least 75% identity to the target polypeptide or protein.The above-mentioned RNA is translatable to express a polypeptide or protein having at least 85% identity, or 90% identity, or 95% identity to the target polypeptide or protein.

[0031] The RNA as described above, comprising a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region and a tail region.The RNA as described above, comprising a translation enhancer in the 5' or 3' untranslated region.

[0032] The above-mentioned RNA, which is translatable in vitro, ex vivo or in vivo. The above-mentioned RNA, which comprises 50 to 15,000 nucleotides. The above-mentioned RNA, wherein the target polypeptide or protein is a polypeptide, protein, protein fragment, antibody, antibody fragment, vaccine immunogen or vaccine toxoid.

[0033] The RNA described above has at least two-fold increased translation efficiency in vivo compared to native mRNA expressing the target polypeptide or protein.The RNA described above has five-fold or less reduced immunogenicity compared to native mRNA expressing the target polypeptide or protein.

[0034] The above-mentioned RNA, wherein the target polypeptide or protein is an expression product of a gene selected from EPO, AAT, ADIPOQ, F9, TTR and BIRC5, or a fragment thereof.

[0035] Embodiments of the present invention further contemplate DNA encoding the RNA described above.

[0036] In some aspects, the present invention provides a composition comprising the RNA described above and a pharmaceutically acceptable carrier. The carrier can comprise a transfection reagent, a nanoparticle, or a liposome.

[0037] The present invention includes a method for preventing, treating, or ameliorating at least one symptom of a disease or condition in a subject in need thereof, comprising administering to the subject a composition as described above. The composition can be used in medical therapy or in treatment of the human or animal body.

[0038] In a further embodiment, the invention comprises a range of DNA templates that can be transcribed for expression of a target polypeptide or protein, wherein the DNA templates comprise a non-coding sequence template region, wherein deoxyadenosine nucleotides in the non-coding sequence template region are replaced with non-deoxyadenosine nucleotides, and wherein the occurrence of deoxyadenosine in the template region is reduced by at least 20% compared to a wild-type gene that can be transcribed for expression of the target polypeptide or protein.

[0039] The DNA template may be double-stranded and may include a coding non-template strand complementary to the non-coding template strand. The DNA template may have at least 35% reduced occurrence of deoxyadenosine in the template region compared to a wild-type gene transcribable for expression of a target polypeptide or protein. The DNA template may be transcribable for expression of a polypeptide or protein having at least 75% identity to the target polypeptide or protein. The DNA template may be transcribable for expression of a polypeptide or protein having at least 85%, 90%, or 95% identity to the target polypeptide or protein. The DNA template may have a target polypeptide or protein that is an expression product or fragment of a gene selected from EPO, AAT, ADIPOQ, F9, TTR, and BIRC5. The DNA template may comprise a plasmid, a linear polynucleotide, a PCR product, a synthetic oligonucleotide, a cloned oligonucleotide, or reverse-transcribed RNA.

[0040] The present invention provides a process for producing RNA having an RNA coding region for expressing a target polypeptide or protein, comprising: providing a DNA molecule comprising a non-coding template region encoding an RNA, wherein deoxyadenosine nucleotides in the portion of the non-coding template region encoding the RNA coding region are replaced by non-deoxyadenosine nucleotides, and the DNA further comprises a promoter for transcribing the template region; transcribing the template region in the presence of nucleoside triphosphates and one or more chemically modified nucleoside triphosphates to form a product mixture; Isolating RNA, wherein the RNA comprises natural and chemically modified nucleotides.

[0023] We further contemplate a process comprising:

[0041] In the above process, the chemically modified nucleoside may be 5-methoxyuridine. The chemically modified nucleoside may be 5-methoxyuridine and 5-methylcytidine.

[0042] In some embodiments, the chemically modified nucleoside is selected from the group consisting of 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylester uridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl-pseudouridine, N 1 -Hydroxypseudouridine, N 1 -Methylpseudouridine, 2'-O-methyl-N 1 -methylpseudouridine, N 1 -Ethylpseudouridine, N 1 -hydroxymethylpseudouridine and arauridine.

[0043] In the above process, the chemically modified nucleoside can replace 10 to 100% of the otherwise identical but chemically unmodified nucleotides in the RNA, or 50 to 100% of the otherwise identical but chemically unmodified nucleotides in the RNA, or 10 to 80% of the otherwise identical but chemically unmodified nucleotides in the RNA, or 50 to 80% of the otherwise identical but chemically unmodified nucleotides in the RNA.

[0044] In the above process, the occurrence of deoxyadenosine in the template region may be reduced by at least 20% compared to a wild-type gene transcribable for expression of a target polypeptide or protein, In the above process, the occurrence of deoxyadenosine in the template region is reduced by at least 35% compared to a wild-type gene transcribable for expression of a target polypeptide or protein.

[0045] In certain embodiments, the step of transcribing DNA can be performed with a 5' cap. The RNA can include a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region, and a tail region. The step of transcribing can be performed with an RNA polymerase, such as SP6, T7, or T3 phage RNA polymerase. The promoter can be double-stranded.

[0046] In the above-described process, the level of double-stranded RNA impurities in the product mixture may be reduced by at least two-fold compared to the same process without replacing deoxyadenosine nucleotides. The level of double-stranded RNA impurities in the product mixture may be less than 5%, or less than 1%, or less than 0.1% of the total RNA.

[0047] Embodiments of the present invention also contemplate synthetic RNAs comprising the products of the above-described processes.

[0048] The present invention includes a composition comprising the RNA described above and a pharmaceutically acceptable carrier. The carrier may comprise a transfection reagent, a nanoparticle, or a liposome.

[0049] In some embodiments, the present invention includes methods for preventing, treating, or ameliorating at least one symptom of a disease or condition in a subject in need thereof by administering to the subject a composition of RNA described above.

[0050] The compositions can be used for medical therapy or in the treatment of the human or animal body. The compositions can be used in the preparation or manufacture of a medicament for preventing, ameliorating, delaying the onset of, or treating a disease or condition in a subject in need thereof. [Brief explanation of the drawings]

[0051] [Figure 1] Figure 1 illustrates a process for producing a translatable ARC-RNA molecule of the present invention. A double-stranded DNA molecule is provided having a non-coding template strand of nucleotides that can be transcribed to provide a targeted product RNA. The double-stranded DNA contains an open reading frame in the template strand, and the template is an alternative variant from the wild-type or native version. As shown in Figure 1, certain deoxyadenosine nucleotides can be replaced in the template by non-deoxyadenosine nucleotides, while the codon assignment to the target product can be preserved (S101). The double-stranded DNA further includes a double-stranded promoter, such as a T7 promoter, for transcribing the template strand. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates, which may include a 5' cap (shown), to form a product mixture (S103). The ARC-RNA product can be isolated and purified from the product mixture (S105). ARC-RNA products are translatable molecules containing natural and chemically modified nucleotides with enhanced translation efficiency and specificity.

[0052] [Figure 2]Figure 2 illustrates a process for producing a translatable ARC-RNA molecule of the present invention. A single-stranded DNA molecule is provided having a non-coding template strand of nucleotides that can be transcribed to provide a product RNA. The DNA contains an open reading frame in the template strand, and the template is an alternative variant from the wild-type or native version. As shown in Figure 2, certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides in the template, while the codon assignment to the target product can be preserved (S101). The DNA further comprises a promoter to form a product mixture. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates that may include a 5' cap (S103). The ARC-RNA product can be isolated and purified from the product mixture (S105).

[0053] [Figure 3] 3 shows an embodiment of a method for providing a template for a translatable molecule of the present invention. Based on the reference sequence of the ORF of the template, certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides in the template, while preserving the codon assignment to the target product. In some methods, deoxyadenosine nucleotides can be replaced starting from the 5' end of the ORF. In yet another method, deoxyadenosine nucleotides can be replaced starting from the 3' end of the ORF. In an additional method, deoxyadenosine nucleotides can be replaced randomly throughout the ORF.

[0054] [Figure 4]Figure 4 shows the results of surprisingly increased human EPO protein production for the translatable molecules of the present invention. Human EPO ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand and a reduced deoxythymidine nucleotide (reduced T) in the complementary non-template strand. Synthesis with 5-methoxyuridine (5MeOU, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOU) compared to wild-type mRNA with a similar reduced T. Figure 4 shows the surprisingly high translation efficiency of ARC-RNA (5MeOU) compared to wild-type hEPO mRNA (UTP).

[0055] [Figure 5] Figure 5 shows the results of surprisingly increased human F9 protein production for the translatable molecules of the present invention. Human F9 ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand and a reduced deoxythymidine nucleotide ("reduced T") in the complementary non-template strand. Synthesis with 5-methoxyuridine (5MeOU, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA(5MeOU) compared to wild-type mRNA with a similar reduced T. Figure 5 shows the surprisingly high translation efficiency of ARC-RNA(5MeOU) compared to wild-type hF9 mRNA(UTP).

[0056] [Figure 6]Figure 6 shows the results of surprisingly reduced impurity levels in the process for synthesizing hF9 translatable molecules of the present invention. Figure 6 shows the results of dot blots to detect double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The translatable ARC-RNA(5MeOU) synthesis product for hF9 showed surprisingly reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MeOU and with a similarly reduced T. Thus, the ARC-RNA(5MeOU) synthesis process with reduced T composition of the template surprisingly reduced the level of double-stranded RNA impurities in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention provided surprisingly reduced levels of double-stranded RNA impurities.

[0057] [Figure 7] Figure 7 shows the results of surprisingly reduced impurity levels in the process for synthesizing hAAT translatable molecules of the present invention. Figure 7 shows the results of dot blots to detect double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The translatable ARC-RNA(5MeOU) synthesis product for hAAT showed surprisingly reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MeOU and with a similarly reduced T. Thus, the ARC-RNA(5MeOU) synthesis process with a reduced T composition of the template surprisingly reduced the level of double-stranded RNA impurities in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention provided surprisingly reduced levels of double-stranded RNA impurities.

[0058] [Figure 8]Figure 8 shows the results of surprisingly increased human adiponectin protein production for the translatable molecules of the present invention. Human adiponectin ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand and a reduced deoxythymidine nucleotide ("reduced T") in the complementary non-template strand. Synthesis with 5-methoxyuridine (5MeOU, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOU) compared to wild-type mRNA with a similar reduced T. Figure 8 shows the surprisingly high translation efficiency of ARC-RNA (5MeOU) compared to wild-type human adiponectin mRNA (UTP). The translation efficiency of ARC-RNA (5MeOU) was also surprisingly higher compared to a similar RNA, human adiponectin mRNA (N1MPU), made with N1-methylpseudouridine (100%).

[0059] [Figure 9] Figure 9 shows the results of surprisingly reduced impurity levels in the process for synthesizing human adiponectin translatable molecules of the present invention. Figure 9 shows the results of dot blots for detecting double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The translatable ARC-RNA(5MeOU) synthesis product for human adiponectin showed surprisingly reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MeOU and with a similarly reduced T. Thus, the ARC-RNA(5MeOU) synthesis process with a reduced T composition of the template surprisingly reduced the level of double-stranded RNA impurities in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention provided surprisingly reduced levels of double-stranded RNA impurities.

[0060] [Figure 10] Figure 10 shows the results of surprisingly increased cynomolgus monkey EPO protein production for the translatable molecules of the present invention. Cynomolgus monkey cmEPO ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand and a reduced complementary deoxythymidine nucleotide ("reduced T") in the non-template strand. Synthesis with 5-methoxyuridine (5MeOU, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOU) compared to wild-type mRNA with a similar reduced T. Figure 10 shows the surprisingly high translation efficiency of ARC-RNA (5MeOU) compared to wild-type cynomolgus monkey cmEPO mRNA (UTP). The translation efficiency of ARC-RNA (5MeOU) was also surprisingly higher compared to a similar RNA, cmEPO mRNA (N1MPU), made with N1-methylpseudouridine (100%).

[0061] [Figure 11]Figure 11 shows the results of surprisingly reduced impurity levels in the process for synthesizing mouse EPO translatable molecules of the present invention. Figure 11 shows the results of dot blots to detect double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The translatable ARC-RNA (5MeOU) synthesis product for mouse EPO showed surprisingly reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MeOU and with a similarly reduced T. Under the same conditions and synthesis, the translatable ARC-RNA (5MC / 5MeOU) synthesis product for mouse EPO also showed surprisingly further reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MC / 5MeOU. Thus, the ARC-RNA (5MC / 5MeOU) synthesis process with reduced T composition of the template surprisingly reduced the double-stranded RNA impurity level in the synthesis mixture. As shown in Figure 11, similar advantageously reduced double-stranded RNA impurity levels were found in the synthesis mixtures for monkey mAdipo mRNA and mfEPO mRNA.

[0062] [Figure 12] Figure 12 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 12 shows the results of a cytokine assay for IFN-α produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone with other NTPs, 5MeOU with other NTPs, or a combination of 5MC / 5MeOU with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of IFN-α.

[0063] [Figure 13]Figure 13 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 13 shows the results of a cytokine assay for RANTES produced in human dendritic cells (DCs) using the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone with other NTPs, 5MeOU with other NTPs, or a combination of 5MC / 5MeOU with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of RANTES.

[0064] [Figure 14] Figure 14 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 14 shows the results of a cytokine assay for IL-6 produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone together with other NTPs, 5MeOU together with other NTPs, or a combination of 5MC / 5MeOU together with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of IL-6.

[0065] [Figure 15] Figure 15 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 15 shows the results of a cytokine assay for MIP-1a produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone together with other NTPs, 5MeOU together with other NTPs, or a combination of 5MC / 5MeOU together with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of MIP-1a.

[0066] [Figure 16] Figure 16 shows the results of surprisingly increased human EPO protein production in vivo for the translatable molecules of the present invention. Figure 16 shows the results for hEPO protein expression after injecting mice with hEPO ARC-mRNA at a dose of 0.3 mg / kg. hEPO in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0067] [Figure 17] Figure 17 shows the results of surprisingly increased cynomolgus monkey EPO protein production in vivo for the translatable molecules of the present invention. Figure 17 shows the results for cmEPO protein expression after injecting mice with cmEPO ARC-mRNA at a dose of 0.3 mg / kg. cmEPO in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by more than three-fold.

[0068] [Figure 18]Figure 18 shows the results of surprisingly increased human F9 protein production in vivo for the translatable molecules of the present invention. Figure 18 shows the results for hF9 protein expression after injecting mice with hF9 ARC-mRNA at a dose of 0.3 mg / kg. hF9 in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0069] [Figure 19] Figure 19 shows the results of surprisingly increased human adiponectin protein production in vivo for the translatable molecules of the present invention. Figure 19 shows the results regarding hAdipo protein expression after injecting hAdipo ARC-mRNA into mice at a dose of 0.3 mg / kg. hAdipo in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0070] [Figure 20] Figure 20 shows the results of surprisingly increased human AAT protein production in vivo for the translatable molecules of the present invention. Figure 20 shows the results for hAAT protein expression after injecting mice with hAAT ARC-mRNA at a dose of 0.3 mg / kg. hAAT in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by up to approximately 4-fold.

[0071] [Figure 21] Figure 21 shows the results of reduced immunogenicity for the translatable molecules of the present invention in vivo. Figure 21 shows the results of a cytokine assay produced in mice using the hEPO ARC-RNA (5MeOU) of the present invention and detected in serum 6 hours after injection. ARC-RNAs synthesized with 5MeOU and templates of reduced T composition showed significantly reduced immunogenicity compared to synthetic mRNAs with the same sequence but containing only natural nucleotides. hEPO ARC-RNA (5MeOU) did not stimulate a cytokine response in vivo compared to the UTP control. DETAILED DESCRIPTION OF THE INVENTION

[0072] The present invention provides a range of novel agents and compositions to be used in therapeutic applications. The molecules and compositions of the present invention can be used, for example, to ameliorate, prevent or treat diseases, including rare and chronic diseases, among others.

[0073] In some embodiments, the present invention encompasses synthetic, purified, and / or isolated translatable polynucleotide molecules for expressing human polypeptides, proteins, or fragments thereof, comprising naturally occurring and chemically modified nucleotides, and encoding the polypeptides, proteins, or fragments.

[0074] Embodiments of the present invention can provide nucleic acids that, when introduced into cells, can have improved properties, such as increased expression levels, reduced immune response, and increased lifespan, compared to wild-type nucleic acids.

[0075] In some embodiments, the translatable molecule of the present invention can provide a modified mRNA. The modified mRNA can encode one or more biologically active peptides, polypeptides, or proteins. The modified mRNA can contain one or more modifications compared to wild-type mRNA. The mRNA modification can be located in any region of the molecule, including the coding region, the untranslated region, or the cap or tail region.

[0076] As used herein, the term "translatable" can be used interchangeably with the term "expressible." These terms can refer to the ability of a polynucleotide or a portion thereof to provide a polypeptide through transcription and / or translation events in a process using biological molecules, or in a cell, or in a natural biological setting. In some settings, translation is a process that can occur when ribosomes make polypeptides in a cell. In translation, messenger RNA (mRNA) can be decoded by ribosomes to produce a specific amino acid chain or polypeptide. A translatable oligomer or polynucleotide can provide a coding sequence region (usually a CDS) or a portion thereof, which can be processed to provide a polypeptide, protein, or a fragment thereof.

[0077] The translatable oligomer or polynucleotide of the present invention can provide a coding sequence region and can include various untranslated sequences, such as a 5' cap, a 5' untranslated region (5'UTR), a 3' untranslated region (3'UTR), and a tail region.

[0078] In some embodiments, the translatable molecule can include a 5' cap, a 5' UTR, a translation initiation sequence such as a Kozak sequence, a CDS, a 3' UTR, and a tail region.

[0079] In certain embodiments, the translatable molecule can include a 5' cap (m7GpppGm), a 5' UTR of tobacco etch virus (TEV), a Kozak sequence, a human CDS, a 3' UTR of xenopus beta-globin (XbG), and a tail region.

[0080] In additional embodiments, the human CDS can include a codon-modified sequence.

[0081] In certain embodiments, the codon assignments of the modified mRNA and the encoded amino acid sequence may be conserved, but the level of G or C nucleotides in a region of the modified mRNA may be increased compared to the level in the same region of the wild-type mRNA. The increased level of G or C may be present in any region of the molecule, including the coding region.

[0082] The level of GC content of the modified mRNA may be increased by at least 1%, or at least 2%, or at least 3%, or at least 4%, or at least 5%, or at least 6%, or at least 7%, or at least 8%, or at least 9%, or at least 10%, or at least 11%, or at least 12%, or at least 13%, or at least 14%, or at least 15%, or at least 16%, or at least 17%, or at least 18% compared to the wild-type mRNA.

[0083] The level of GC content of the modified mRNA may be increased by 1-3%, or 4-6%, or 7-9%, or 10-12%, or 13-15%, or 16-20% compared to the wild-type mRNA.

[0084] In further embodiments, the codon assignments of the modified mRNA and the encoded amino acid sequence may be conserved, but the level of U nucleotides in a region of the modified mRNA may be reduced compared to the level in the same region of the wild-type mRNA. The reduced level of U may be present in any region of the molecule, including the coding region.

[0085] The level of U content of the modified mRNA may be reduced by at least 1%, or at least 2%, or at least 3%, or at least 4%, or at least 5%, or at least 6%, or at least 7%, or at least 8%, or at least 9%, or at least 10%, or at least 12% compared to the wild-type mRNA.

[0086] The level of U content of the modified mRNA may be reduced by 1%, or 2%, or 3%, or 4%, or 5%, or 6%, or 7%, or 8%, or 9%, or 10% compared to the wild-type mRNA.

[0087] In some embodiments, a translatable molecule of the invention can comprise a coding sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to a portion of a reference mRNA sequence, such as a human wild-type mRNA sequence.

[0088] In some embodiments, a translatable molecule of the invention can comprise a coding sequence with 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 15, or 20 or more synonymous or non-synonymous codon replacements compared to a reference mRNA sequence, such as a human wild-type mRNA sequence.

[0089] In some embodiments, a non-coding template sequence transcribable to provide a translatable molecule of the invention can, when transcribed, provide a translatable molecule that is at least 80%, or 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% identical to a portion of a reference mRNA sequence, such as a human wild-type mRNA sequence.

[0090] In some embodiments, a non-coding template sequence transcribable to provide a translatable molecule of the invention can, when transcribed, provide a translatable molecule with 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 15, or 20 or more synonymous or non-synonymous codon replacements compared to a reference mRNA sequence, such as a human wild-type mRNA sequence.

[0091] In some embodiments, the translatable molecules of the invention can be used to express polypeptides that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to a reference polypeptide or portion of a protein sequence, such as a human wild-type protein sequence.

[0092] In some embodiments, the translatable molecules of the invention can be used to express polypeptides that have 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 15, or 20 or more variant amino acid residues compared to a reference polypeptide or protein sequence, such as a human wild-type protein sequence.

[0093] In some embodiments, the translatable molecule of the invention can encode a fusion protein comprising a full-length or fragment or portion of a native human protein fused to another sequence, for example, by an N- or C-terminal fusion, In some embodiments, the N- or C-terminal sequence can be a signal sequence or a cell targeting sequence.

[0094] The translatable molecule can contain one or more LNA monomers.

[0095] The translatable molecules of the invention can be used in methods for ameliorating, preventing, or treating diseases or conditions associated with polypeptides or proteins. The translation efficiency of the translatable molecules of the invention can be increased compared to native mRNA.

[0096] A translatable molecule of the present invention having one or more chemically modified nucleotides can have reduced immunogenicity compared to native mRNA or synthetic mRNA having the same sequence and containing only natural nucleotides.

[0097] In some embodiments, the translatable molecule of the present invention can have reduced immunogenicity compared with native mRNA.Translatable molecule may have the same sequence and be less immunogenic than the synthetic RNA molecule that contains only natural nucleotides.Some methods for measuring immunogenicity include measuring the secretion of cytokines such as IL-12, IFN-α, TNF-α, RANTES, MIP-1a or b, IL-6, IFN-b, IFN-g or IL-8, and the expression of DC activation markers such as CD83, HLA-DR, CD80 and CD86.

[0098] In certain embodiments, the immunogenicity of the translatable molecule may be reduced by 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more compared to the native mRNA or compared to a synthetic RNA molecule having the same sequence and containing only natural nucleotides.

[0099] The translatable molecules of the present invention having one or more chemically modified nucleotides can have increased translation efficiency compared to native mRNA or synthetic mRNA having the same sequence and containing only natural nucleotides.

[0100] In certain embodiments, the translation efficiency of a translatable molecule can be increased by 30%, 50%, 70%, 100%, 150%, 200%, or more compared to native mRNA or to a synthetic RNA molecule having the same sequence and containing only natural nucleotides. Translation efficiency can be performed in vitro, ex vivo, or in vivo.

[0101] Embodiments of the present invention further encompass a process for producing RNA molecules for expressing a polypeptide or protein, wherein the RNA molecules contain natural and chemically modified nucleotides and encode a polypeptide or protein, or a fragment thereof. The process can include transcribing a DNA template in the presence of chemically modified nucleoside triphosphates to form a product mixture, and purifying the product mixture to isolate the RNA product. Such a process can advantageously reduce the level of double-stranded RNA impurities in the product.

[0102] In the process of the present invention, the translatable molecule of the present invention can be synthesized with UTP replaced by 5-methoxy-UTP. The level of replacement can be 30% UTP replaced by 5-methoxy-UTP, or 40% UTP replaced by 5-methoxy-UTP, or 50% UTP replaced by 5-methoxy-UTP, or 60% UTP replaced by 5-methoxy-UTP, or 70% UTP replaced by 5-methoxy-UTP, or 80% UTP replaced by 5-methoxy-UTP, or 90% UTP replaced by 5-methoxy-UTP, or 100% UTP replaced by 5-methoxy-UTP.

[0103] In the process of the present invention, the translatable molecule of the present invention can be synthesized with CTP replaced by 5-methyl-CTP. The level of replacement can be 30% CTP replaced by 5-methyl-CTP, or 40% CTP replaced by 5-methyl-CTP, or 50% CTP replaced by 5-methyl-CTP, or 60% CTP replaced by 5-methyl-CTP, or 70% CTP replaced by 5-methyl-CTP, or 80% CTP replaced by 5-methyl-CTP, or 90% CTP replaced by 5-methyl-CTP, or 100% CTP replaced by 5-methyl-CTP.

[0104] The molecule of the present invention can be a translatable messenger RNA molecule.In some embodiments, RNA agent can have a particularly long half-life in cytoplasm.Long-lasting messenger molecule can be used to improve, prevent or treat the disease related to polypeptide or protein level in subjects.

[0105] In some embodiments, the present invention provides a process for producing a translatable product RNA molecule. A double-stranded DNA molecule can be provided having a non-coding template strand of nucleotides that can be transcribed to provide a product RNA. The double-stranded DNA can contain an open reading frame in the template strand, and the template can be an alternative variant from a wild-type or native version. In the template, the codon assignment to the target RNA product can be conserved, but certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides. The double-stranded DNA can further include a double-stranded promoter for transcribing the template strand, such as a T7 promoter. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates, which may include a 5' cap, to form a product mixture. The product RNA can be isolated and purified from the product mixture.

[0106] The product RNA can be a translatable molecule containing natural and chemically modified nucleotides and with enhanced translation efficiency and resulting activity.

[0107] In a further aspect, the present invention provides a process for producing a translatable RNA molecule. A single-stranded DNA molecule can be provided having a non-coding template strand of nucleotides that can be transcribed to provide a product RNA. The DNA can contain an open reading frame in the template strand, and the template can be an alternative variant from a wild-type or native version. In the template, the codon assignment to the target RNA product can be preserved, but certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides. The DNA can further include a promoter. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates, which may include a 5' cap, to form a product mixture. The product RNA can be isolated and purified from the product mixture.

[0108] The properties of the translatable compounds of the present invention arise according to their molecular structure, and the overall molecular structure as a whole can provide significant benefits based on such properties. Embodiments of the present invention can provide translatable molecules with one or more properties that advantageously provide enhanced effectiveness in regulating protein expression or concentration or modulating protein activity. The molecules and compositions of the present invention can provide pharmaceuticals for clinical use and can provide formulations for therapeutic agents for various diseases and conditions.

[0109] The present invention provides a surprisingly wide range of translatable molecules that can be translated to provide active peptides or proteins in vitro and in vivo.

[0110] The translatable structures and compositions can have increased translational activity and cytoplasmic half-life. In these embodiments, the translatable structures and compositions can provide increased functional half-life in the cytoplasm of mammalian cells over native mRNA molecules. The translatable molecules of the invention can have an increased active half-life relative to the corresponding native mRNA.

[0111] A wide range of novel translatable molecules are provided herein, each of which can incorporate a specific linker group. The linker group can be attached mid-chain in the translatable molecule. Each linker group can also be attached to a nucleobase.

[0112] A process for producing a translatable RNA molecule of the present invention is illustrated in Figure 1. A double-stranded DNA molecule is provided having a non-coding template strand of nucleotides that can be transcribed to provide a targeted product RNA. The double-stranded DNA contains an open reading frame in the template strand, and the template is an alternative variant from the wild-type or native version. As shown in Figure 1, certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides while preserving the codon assignment to the target product. The double-stranded DNA further comprises a double-stranded promoter for transcribing the template strand, such as a T7 promoter. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates, which may include a 5' cap, to form a product mixture. The RNA product can be isolated and purified from the product mixture. The RNA product is a translatable molecule containing natural and chemically modified nucleotides and has enhanced translation efficiency and resulting activity.

[0113] A process for producing a translatable RNA molecule of the present invention is illustrated in Figure 2. A single-stranded DNA molecule is provided having a non-coding template strand of nucleotides that can be transcribed to provide a product RNA. The DNA contains an open reading frame in the template strand, and the template is an alternative variant from the wild-type or native version. As shown in Figure 2, certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides in the template, while the codon assignment to the target product can be preserved. The DNA further comprises a promoter. The DNA can be transcribed with one or more chemically modified nucleoside triphosphates in the presence of nucleoside triphosphates, which may include a 5' cap, to form a product mixture. The RNA product can be isolated and purified from the product mixture.

[0114] 3 shows an embodiment of a method for providing a template for a translatable molecule of the present invention. Based on the reference sequence of the ORF of the template, certain deoxyadenosine nucleotides can be replaced by non-deoxyadenosine nucleotides in the template, while preserving the codon assignment to the target product. In some methods, deoxyadenosine nucleotides can be replaced starting from the 5' end of the ORF. In yet another method, deoxyadenosine nucleotides can be replaced starting from the 3' end of the ORF. In an additional method, deoxyadenosine nucleotides can be replaced randomly throughout the ORF.

[0115] In some aspects, the linker group can be a monomer. The monomers can be attached to form a chain molecule. In the chain molecules of the present invention, the linker group monomer can be attached at any point in the chain.

[0116] In certain embodiments, linker group monomers can be attached in the chain molecules of the present invention such that the linker group monomers are near the ends of the chain or at any position within the chain.

[0117] Herein, a chain molecule may also be referred to as an oligomer.

[0118] In a further aspect, each linker group of a strand molecule can be attached to a nucleobase. The presence of nucleobases in a strand molecule can provide the sequence of the nucleobases in the strand molecule.

[0119] In certain embodiments, the present invention provides translatable oligomeric molecules having chain structures that incorporate novel combinations of linker group monomers along with certain natural, non-natural, modified, or chemically modified nucleotides.

[0120] The oligomeric molecules of the invention can display a sequence of nucleobases and can be designed to express a polypeptide or protein in vitro, ex vivo, or in vivo. The expressed polypeptide or protein can have various forms of activity, including activity corresponding to the protein expressed from natural mRNA, or activity corresponding to a negative or dominant negative protein.

[0121] In some aspects, the present invention can provide active translatable oligomeric molecules that have a base sequence complementary to at least a fragment of a native nucleic acid molecule of a cell.

[0122] In some embodiments, the cell may be a eukaryotic cell, a mammalian cell, or a human cell.

[0123] The present invention provides structures, methods and compositions for translatable oligomeric drugs incorporating linker group monomers. The oligomeric molecules of the invention can be used as active agents in formulations for therapeutic drugs.

[0124] The present invention provides a range of translatable molecules that are useful in providing a therapeutic effect due to their longevity of activity in providing expressed peptides or proteins.

[0125] In certain embodiments, the translatable molecule can be structured as an oligomer composed of monomers. The oligomeric structure of the invention can contain one or more linker group monomers along with certain nucleotides.

[0126] In certain embodiments, a translatable molecule can contain a sequence of nucleobases that can be designed, in part, to have sufficient homology with a native polynucleotide sequence to express a peptide or protein of either isoform.

[0127] In some embodiments, the translatable molecule can be from about 200 to about 12,000 monomers in length or more. In certain embodiments, the translatable molecule can be between 200 and 12,000 monomers in length, or between 200 and 10,000 monomers, or between 200 and 8,000 monomers, or between 200 and 6,000 monomers, or between 200 and 5,000 monomers, or between 200 and 4,000 monomers, or between 200 and 3,600 monomers, or between 200 and 3,200 monomers, or between 200 and 3,000 monomers, or between 200 and 2,800 monomers, or between 200 and 2,600 monomers, or between 200 and 2,400 monomers, or between 200 and 2,200 monomers, or between 600 and 3,200 monomers, or between 600 and 3,000 monomers, or between 600 and 2,600 monomers.

[0128] In some embodiments, the translatable molecule can be from about 200 to about 12,000 bases in length or more. In certain embodiments, the translatable molecule can be 200 to 12,000 bases in length, or 200 to 10,000 bases, or 200 to 8,000 bases, or 200 to 6,000 bases, or 200 to 5,000 bases, or 200 to 4,000 bases, or 200 to 3,600 bases, or 200 to 3,200 bases, or 200 to 3,000 bases, or 200 to 2,800 bases, or 200 to 2,600 bases, or 200 to 2,400 bases, or 200 to 2,200 bases, or 600 to 3,200 bases, or 600 to 3,000 bases, or 600 to 2,600 bases.

[0129] A translatable molecule of the invention can include a 5' cap, a monomeric 5' untranslated region, a monomeric coding region, a monomeric 3' untranslated region, and a monomeric tail region.

[0130] A translatable molecule of the present invention can comprise a region of sequence or structure that is operable for translation in a cell or has the functionality of a region of an mRNA, including, for example, the 5' cap, 5' untranslated region, coding region, 3' untranslated region and polyA tail.

[0131] The present invention further contemplates methods for delivering one or more vectors or one or more translatable molecules to a cell.

[0132] In some embodiments, one or more translatable molecules can be delivered to cells in vitro, ex vivo, or in vivo. Viral and non-viral transfer methods, as known in the art, can be used to introduce translatable molecules in mammalian cells. The translatable molecules can be delivered in a pharmaceutically acceptable vehicle or, for example, encapsulated in liposomes.

[0133] In some embodiments, the translatable constructs and compositions of the present invention can reduce the number and frequency of transfections required for cell fate manipulation in culture compared to utilizing native compositions.

[0134] In additional aspects, the present invention provides increased activity for mRNA-based drugs compared to the use of native compositions, allowing for reduced dosage levels required for effective therapy.

[0135] In a further aspect, the present invention provides increased activity for translatable or mRNA-based molecules compared to the use of native mRNA as an active agent.

[0136] In some aspects, the present invention can provide translatable molecules that can reduce the cellular innate immune response compared to that induced by a naturally occurring nucleic acid, peptide, or protein.

[0137] The present invention can provide synthetic translatable molecules that are refractory to deadenylation compared to native molecules.

[0138] In certain embodiments, the present invention can provide synthetic translatable molecules with increased specific activity and longer functional half-life compared to native molecules. The synthetic translatable molecules of the present invention can provide increased levels of ectopic protein expression. When the translatable molecules are used as vectors, cellular delivery can be increased, and the cytotoxic innate immune response can be limited, allowing for higher levels of ectopic protein expression to be achieved. The translatable molecules of the present invention can have increased specific activity and longer functional half-life than mRNA.

[0139] In certain embodiments, the translatable molecule can have multiple mutations from the native mRNA or the disease-associated mRNA.

[0140] In a further embodiment, the invention can provide translatable molecules with cleavable delivery and targeting moieties attached to the 3' end.

[0141] In general, the specific activity for a synthetic translatable molecule delivered by transfection can be considered as the number of molecules of expressed protein per delivered transcript per unit time.

[0142] As used herein, translation efficiency refers to a measure of the production of proteins or polypeptides by translation of messenger molecules in vitro or in vivo.

[0143] The present invention provides a range of translatable molecules that can contain one or more UNA monomers and multiple nucleic acid monomers, which can be translated to express a polypeptide or protein. UNA monomers are described in WO / 2016 / 070166. In some embodiments, the present invention includes a range of translatable molecules that can contain one or more UNA monomers in the tail region, which can be translated to express a polypeptide or protein. In some embodiments, the translatable molecule can include a 3' polyA tail containing one or more UNA monomers. In some embodiments, the 3' polyA tail can contain 2, 3, 4, 5, 10, or more UNA monomers.

[0144] In some embodiments, the translatable molecule can contain a modified 5' cap.

[0145] In a further embodiment, the translatable molecule can contain a monomeric translation-enhancing 5' untranslated region.

[0146] In additional embodiments, the translatable molecule can contain a monomeric translation-enhancing 3' untranslated region.

[0147] The translatable molecules of the present invention can exhibit increased translation efficiency in vivo compared to native mRNA encoding the same translation product, for example, the translation efficiency can be increased by 10%, 20%, 30%, 40%, 50%, 100% or more compared to a reference mRNA, such as native mRNA or human wild-type mRNA.

[0148] In another embodiment, the translatable molecules of the invention can exhibit at least a 2-fold, 3-fold, 5-fold or 10-fold increased translation efficiency in vivo compared to a reference mRNA, such as a native mRNA or a human wild-type mRNA.

[0149] In further embodiments, the translatable molecule can provide increased levels of a polypeptide or protein in vivo compared to a native mRNA encoding the same polypeptide or protein, for example, the level of the polypeptide or protein can be increased by 10%, or 20%, or 30%, or 40%, or 50%, or 100% or more in vivo compared to a reference mRNA, such as a native mRNA or human wild-type mRNA.

[0150] In further embodiments, the translatable molecule is capable of producing at least a 2-fold, 3-fold, 5-fold, or 10-fold increased level of a polypeptide or protein in vivo compared to the native or reference mRNA.

[0151] In additional embodiments, the invention provides methods for treating a disease or condition in a subject by administering to the subject a composition containing a translatable molecule.

[0152] Mutant templates in the process for translatable molecules The mutant DNA template of the present disclosure can exhibit advantages in the process for producing translatable molecules and the efficiency of translatable molecules.Variants of the template can be used to enhance the incorporation of modified nucleotides or monomers into the RNA products of the present invention.In certain embodiments, variants of the template can be used to enhance the structural features of translatable molecules.Enhanced structural features of translatable molecules can provide unexpectedly advantageous properties, including the translation efficiency of providing polypeptide or protein products.

[0153] In some aspects of the invention, template variants can include a reduction in the occurrence or frequency of certain nucleotides in the template strand. The reduction in the occurrence of certain nucleotides can provide a form of altering the structures and processes of the present disclosure to achieve surprisingly improved properties of the translatable RNA product.

[0154] Embodiments of the invention may require a mutant DNA template in the process for creating a translatable molecule. The DNA molecule may have a non-coding template strand of nucleotides that can be transcribed to provide a target RNA.

[0155] The target RNA can be any RNA, native or unknown, synthetic or derived from natural sources.

[0156] In some embodiments, mutant DNA templates can be used in which the open reading frame of the template strand is transformed into an alternative form.

[0157] In certain embodiments, a DNA template can be used in which alternative nucleotides are used based on codon degeneracy.

[0158] In additional embodiments, the DNA template can have deoxyadenosine nucleotides replaced by non-deoxyadenosine nucleotides, although the codon assignments can be conserved.

[0159] The embodiment of the present invention advantageously utilizes alternative codons in the DNA template of the present invention to be used in the process for producing translatable RNA molecules.The variation that can be achieved in the DNA template of the present invention can be much greater in scope than for cells and organisms that require preferred codons in many processes.In the present invention, a wide range of alternative codons and positions can be used in the DNA template to transcribe RNA molecules.

[0160] In a further embodiment of the present invention, the template variant can include a reduction in the occurrence or frequency of a certain nucleotide in the template strand.For example, the occurrence of deoxyadenosine in the template can be reduced to a level of less than 25% of the nucleotides in the template.In yet another example, the occurrence of deoxyadenosine in the template can be reduced to a level of less than 20% of the nucleotides in the template.In some examples, the occurrence of deoxyadenosine in the template can be reduced to a level of less than 16% or 14% of the nucleotides in the template.In a particular example, the occurrence of deoxyadenosine in the template can be reduced to a level of less than 12% of the nucleotides in the template.

[0161] Inherent codon redundancy allows for up to six different codons for a single amino acid. However, synonymous codons may not have equal priority in cells and organisms. Furthermore, codon preference can vary between different genes and can have functional effects. Codon degeneracy is generally poorly understood and has unpredictable effects on nucleic acid structure and processes. How codon substitution affects ribosomes, protein folding, translation, and RNA degradation is generally unknown.

[0162] In some embodiments, the level of T can be reduced in the non-template strand, i.e., the coding strand, by replacing a triplet codon containing two or more Ts with another synonymous codon that contains fewer Ts than the original triplet. For example, valine encoded by GTT can be replaced by GTC, GTA, or GTG. Serine encoded by TCT, TCC, TCA, TCG, AGT can be replaced by AGC. A complementary change will occur in the template strand.

[0163] In certain embodiments, the level of T can be reduced in the non-template strand, i.e., the coding strand, by replacing every codon with a synonymous codon, with each replacement reducing the level of T.

[0164] In some embodiments, to increase expression levels, mutant templates can have a reduced number of rare codons. See, e.g., Mauro, A critical analysis of codon optimization in human therapeutics, Trends Mol Med 2014, Vol. 20(11), pp. 604-613.

[0165] In some aspects, any combination of synonymous codon replacements can be made in the mutant templates of the present invention.

[0166] As is known in the art, various additional or synonymous codon replacements can be made.

[0167] Some examples of codon replacements in the coding non-template strand are shown in Table 1. For mutant templates, complementary replacements are made in the template strand.

[0168] [Table 1]

[0169] Functional mutant templates for translatable molecules The functional mutant DNA templates of the present disclosure can have a structure that reflects enhanced placement of alternative codons.

[0170] The functional mutant templates of the invention can be utilized to enhance the incorporation of modified nucleotides or monomers in RNA products.

[0171] In certain embodiments, functional mutant templates can be utilized to enhance structural features of the translatable molecule, such as translation efficiency.

[0172] In some embodiments, functional variant templates can have a reduced occurrence or frequency of certain nucleotides in the non-coding template strand. The reduced occurrence of certain nucleotides can provide a form for altering the structures and processes of the present disclosure to achieve surprisingly improved properties of the translatable RNA product.

[0173] In certain embodiments, functional mutant templates of the invention can have a reduced occurrence or frequency of deoxyadenosine nucleotides in the non-coding template strand, where the deoxyadenosine nucleotides are reduced starting from the 5' end and extending towards the 3' end of the template.

[0174] In a further embodiment, a functional mutant template of the invention can have a reduced occurrence or frequency of deoxyadenosine nucleotides in the non-coding template strand, where the deoxyadenosine nucleotides are reduced starting from the 3' end and extending towards the 5' end of the template.

[0175] In additional aspects, functional variant templates of the invention can have a reduced occurrence or frequency of deoxyadenosine nucleotides in the non-coding template strand, where the deoxyadenosine nucleotides are randomly reduced in the template structure.

[0176] In certain embodiments, a functional mutant template of the invention can replace all deoxyadenosine nucleotides in the non-coding template strand with non-deoxyadenosine nucleotides in the template structure.

[0177] A DNA template transcribable for expression of a target polypeptide or protein can have a non-coding sequence template region, in which codon assignments may be conserved, but deoxyadenosine nucleotides in the non-coding sequence template region are replaced with non-deoxyadenosine nucleotides, and the occurrence of deoxyadenosine in the template region is reduced by at least 20% compared to a wild-type gene transcribable for expression of a target polypeptide or protein. In some embodiments, the occurrence of deoxyadenosine in the template region is reduced by at least 25% compared to a wild-type gene transcribable for expression of a target polypeptide or protein. In further embodiments, the occurrence of deoxyadenosine in the template region is reduced by at least 30% compared to a wild-type gene transcribable for expression of a target polypeptide or protein. In additional embodiments, the occurrence of deoxyadenosine in the template region is reduced by at least 35% compared to a wild-type gene transcribable for expression of a target polypeptide or protein. The occurrence of deoxyadenosine in the template region may be reduced by at least 40%, or 45%, or 50% compared to a wild-type gene transcribed for expression of the target polypeptide or protein.

[0178] In some embodiments, the occurrence of deoxythymidine in the non-template sequence region may be reduced by at least 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50% compared to a wild-type gene transcribed for expression of a target polypeptide or protein.

[0179] Some examples of codon replacements in the coding non-template strand are shown in Table 2. For functional mutant templates, complementary replacements are made in the template strand.

[0180] [Table 2]

[0181] Processes with chemically modified nucleotides and polynucleotides Embodiments of the present invention can provide processes for the production of translatable molecules, where the translatable molecules can include one or more types of chemically modified nucleotides.

[0182] Embodiments of the present invention contemplate processes for the production of translatable molecules, wherein the translatable molecules incorporate one or more types of chemically modified nucleotides, resulting in the production of translatable molecules with reduced levels of impurities, such as double-stranded impurities.

[0183] In certain embodiments, the level of double-stranded impurities in the processes of the invention may be reduced by 2-fold, or 3-fold, or 5-fold, or 10-fold, or 20-fold or more compared to processes that use only natural NTPs.

[0184] In certain embodiments, the present invention can provide processes for the production of translatable molecules, wherein the translatable molecules incorporate one or more types of chemically modified nucleotides, resulting in the production of translatable molecules with advantageously reduced levels of impurities, such as double-stranded impurities, such that the product translatable molecules can be utilized without further purification.

[0185] The translatable molecules of the present invention having chemically modified nucleotides can provide enhanced properties for therapeutic uses of the translatable molecules.

[0186] Translatable molecules of the present invention having chemically modified nucleotides can provide advantageously increased expression levels in vitro, ex vivo or in vivo compared to a reference, such as wild-type mRNA.

[0187] In some aspects, translatable molecules of the invention having chemically modified nucleotides can provide an advantageously reduced immune response in vitro, ex vivo or in vivo compared to a reference, such as wild-type mRNA.

[0188] In certain embodiments, translatable molecules of the invention having chemically modified nucleotides can provide advantageously increased intracellular life span in vitro, ex vivo, or in vivo compared to a reference, such as wild-type mRNA.

[0189] An example of a chemically modified nucleotide is 5-methoxyuridine (5MeOU).

[0190] In certain embodiments, the translatable molecules of the invention can replace uridine with 5-methoxyuridine. The level of replacement can be 30% uridine replaced by 5-methoxyuridine, or 40% uridine replaced by 5-methoxyuridine, or 50% uridine replaced by 5-methoxyuridine, or 60% uridine replaced by 5-methoxyuridine, or 70% uridine replaced by 5-methoxyuridine, or 80% uridine replaced by 5-methoxyuridine, or 90% uridine replaced by 5-methoxyuridine, or 100% uridine replaced by 5-methoxyuridine.

[0191] An example of a combination of chemically modified nucleotides is a combination of 5-methoxyuridine (5MeOU) and 5-methylcytidine (5MC). In a combination of chemically modified nucleotides, both types of chemically modified nucleotides are incorporated into the same polynucleotide.

[0192] As used herein, in the context of oligomeric sequences, the symbol N can represent any naturally occurring nucleotide monomer or any modified nucleotide monomer.

[0193] As used herein, in the context of oligomeric sequences, the symbol Q represents a non-natural, modified, or chemically modified nucleotide monomer.

[0194] Additional examples of chemically modified nucleotides include 5-hydroxyuridine, 5-alkyluridine, 5-hydroxyalkyluridine, 5-carboxyuridine, 5-carboxyalkylester uridine, 5-formyluridine, 5-alkoxyuridine, 5-alkynyluridine, 5-halouridine, 2-thiouridine, and 6-alkyluridine.

[0195] Additional examples of chemically modified nucleotides include 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-fluorouridine, 5-iodouridine, 2-thiouridine, and 6-methyluridine.

[0196] Additional examples of chemically modified nucleotides include 5-methoxycarbonylmethyl-2-thiouridine, 5-methylaminomethyl-2-thiouridine, 5-carbamoylmethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 1-methyl-3-[3-amino-3-carboxypropy]pseudouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethyluridine, 5-methyldihydrouridine, 5-taurinomethyluridine, 5-taurinomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 2'-O-methylpseudouridine, 2-thio-2'-O-methyluridine, and 3,2'-O-dimethyluridine.

[0197] Additional examples of chemically modified nucleotides include 5-hydroxycytidine, 5-alkylcytidine, 5-hydroxyalkylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-alkoxycytidine, 5-alkynylcytidine, 5-halocytidine, 2-thiocytidine, N 4 -Alkylcytidine, N 4 -aminocytidine, N 4 -acetylcytidine and N 4 ,N 4 -Dialkylcytidines.

[0198] Additional examples of chemically modified nucleotides include 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, 5-propynylcytidine, 5-bromocytidine, 5-iodocytidine, and 2-thiocytidine; N 4 -methylcytidine, N 4 -aminocytidine, N 4 -acetylcytidine and N 4 ,N 4 -Dimethylcytidine.

[0199] Additional examples of chemically modified nucleotides include N 6 -methyladenosine, 2-aminoadenosine, 3-methyladenosine, 8-azaadenosine, 7-deazaadenosine, 8-oxoadenosine, 8-bromoadenosine, 2-methylthio-N 6 -methyladenosine, N 6 -Isopentenyl adenosine, 2-methylthio-N 6 -Isopentenyl adenosine, N 6 -(cis-Hydroxyisopentenyl)adenosine, 2-methylthio-N 6 -(cis-hydroxyisopentenyl)adenosine, N 6 -Glycinylcarbamoyladenosine, N6-Threonylcarbamoyl-adenosine, N 6 -methyl-N 6 -Threonylcarbamoyl-adenosine, 2-methylthio-N 6-Threonylcarbamoyl-adenosine, N 6 ,N 6 -Dimethyladenosine, N6-hydroxynorvalylcarbamoyladenosine, 2-methylthio-N 6 -hydroxynorvalylcarbamoyl-adenosine, N 6 -acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, alpha-thio-adenosine, 2'-O-methyl-adenosine, N 6 ,2'-O-dimethyl-adenosine,N 6 ,N 6 ,2'-O-trimethyl-adenosine, 1,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N 6 -methyl-purine, 1-thio-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine and N 6 -[19-amino-pentaoxanonadecyl]-adenosine.

[0200] Additional examples of modified or chemically modified nucleotides include N l -Alkylguanosine, N 2 -Alkylguanosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 8-bromoguanosine, O 6 -Alkylguanosine, xanthosine, inosine and N l -Alkyl inosines are included.

[0201] Additional examples of chemically modified nucleotides include N l -methylguanosine, N 2 -methylguanosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 8-bromoguanosine, O 6 -methylguanosine, xanthosine, inosine and N l -methylinosine.

[0202] Additional examples of chemically modified nucleotides include pseudouridines. l -Alkylpseudouridine, N l -Cycloalkylpseudouridine, N 1 -Hydroxypseudouridine, N 1 -Hydroxyalkylpseudouridine, N l -phenylpseudouridine, N l -phenylalkylpseudouridine, N l -aminoalkylpseudouridine, N 3 -Alkylpseudouridine, N 6 -Alkylpseudouridine, N 6 -Alkoxypseudouridine, N 6 -Hydroxypseudouridine, N 6 -Hydroxyalkylpseudouridine, N 6 -Morpholinopseudouridine, N 6 -phenylpseudouridine and N 6 Examples of pseudouridines include N-halopseudouridines. l -Alkyl-N 6 -Alkylpseudouridine, N l -Alkyl-N 6 -Alkoxypseudouridine, N l -Alkyl-N 6 -Hydroxypseudouridine, N l -Alkyl-N 6 -Hydroxyalkylpseudouridine, N l -Alkyl-N 6 -Morpholinopseudouridine, N l -Alkyl-N 6 -phenylpseudouridine and N l -Alkyl-N 6 In these examples, the alkyl, cycloalkyl, and phenyl substituents may be unsubstituted or further substituted with alkyl, halo, haloalkyl, amino, or nitro substituents.

[0203] Additional examples of pseudouridines include N l -methylpseudouridine, N l -Ethylpseudouridine, N l -Propylpseudouridine, N l -Cyclopropylpseudouridine, N l -phenylpseudouridine, N l -aminomethylpseudouridine, N 3 -methylpseudouridine, N 1 -hydroxypseudouridine and N 1 -hydroxymethylpseudouridine.

[0204] Additional examples of chemically modified nucleotides include 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylester uridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl-pseudouridine, N-methyl-pseudouridine, N-methyl-N ... 1 -Hydroxypseudouridine, N 1 -Methylpseudouridine, 2'-O-methyl-N 1 -methylpseudouridine, N 1 -Ethylpseudouridine, N 1 -hydroxymethylpseudouridine and alauridine.

[0205] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include any such nucleotides known in the art, such as 2'-O-methyl ribonucleotides, 2'-O-methyl purine nucleotides, 2'-deoxy-2'-fluoro ribonucleotides, 2'-deoxy-2'-fluoro pyrimidine nucleotides, 2'-deoxyribonucleotides, 2'-deoxy purine nucleotides, universal base nucleotides, 5-C-methyl-nucleotides, and inverted deoxy abasic monomeric residues.

[0206] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include 3'-end stabilized nucleotides, 3'-glyceryl nucleotides, 3'-inverted abasic nucleotides, and 3'-inverted thymidines.

[0207] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include locked nucleic acid nucleotides (LNA), glycol nucleic acid (GNA), 2'-O,4'-C-methylene-(D-ribofuranosyl) nucleotides, 2'-methoxyethoxy (MOE) nucleotides, 2'-methyl-thio-ethyl, 2'-deoxy-2'-fluoronucleotides, and 2'-O-methyl nucleotides.

[0208] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include 2',4'-constrained 2'-O-methoxyethyl (cMOE) and 2'-O-ethyl (cEt) modified DNA.

[0209] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include 2'-amino nucleotides, 2'-O-amino nucleotides, 2'-C-allyl nucleotides, and 2'-O-allyl nucleotides.

[0210] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include nucleotide monomers with modified bases, such as 5-(3-amino)propyluridine and 5-(2-mercapto)ethyluridine.

[0211] Additional examples of non-natural, modified and chemically modified nucleotide monomers include 2'-O-aminopropyl substituted nucleotides.

[0212] Additional examples of non-natural, modified, and chemically modified nucleotide monomers include replacement of the 2'-OH group of the nucleotide with 2'-R, 2'-OR, 2'-halogen, 2'-SR, or 2'-amino, where R can be H, alkyl, alkenyl, or alkynyl.

[0213] Additional examples of nucleotide monomers include pseudouridine (psi-uridine) and 1-methylpseudouridine.

[0214] Additional examples of chemically modified nucleotide monomers include nucleotides having base modifications, nucleoside or nucleotide structure modifications, sugar modifications, or linkage modifications.

[0215] Examples of nucleic acid monomers include non-natural, modified, and chemically modified nucleotides, including any such nucleotides known in the art.

[0216] Some examples of modified nucleotides are shown in Saenger, Principles of Nucleic Acid Structure, Springer-Verlag, 1984; Rozenski J., Crain PF, McCloskey JA, The RNA Modification Database: 1999 update, Nucleic Acids Res., 1999; Vol. 27, pp. 196-197.

[0217] Modalities for peptides and proteins The RNA molecules of the present invention can be used to ameliorate, prevent, or treat disease by protein or enzyme modulation or replacement. The RNA molecules of the present invention can be administered to regulate, modulate, increase, or decrease the concentration or effectiveness of a native enzyme in a subject.

[0218] In some aspects, the protein can be an unmodified, naturally occurring enzyme in which the subject has an abnormal abundance.

[0219] In a further embodiment, RNA molecules can be delivered to a cell or subject and translated to provide increased levels of a native polypeptide or protein.

[0220] The RNA molecules of the invention can be used to ameliorate, prevent or treat disease by modulating or introducing a polypeptide or protein, in such embodiments, the translatable molecules of the invention can be administered to regulate, modulate, increase or decrease the concentration or effectiveness of a peptide or protein in a subject, where the peptide or protein is non-naturally occurring or mutated compared to the native peptide or protein.

[0221] The polypeptide or protein delivered by the RNA molecules of the present disclosure can be a modified, non-natural, exogenous, or synthetic polypeptide or protein that has a pharmacological effect in a subject.

[0222] In some embodiments, an RNA molecule can be delivered to a cell or subject and translated to provide for the secretion or concentration of a peptide or protein.

[0223] The subject can be a human subject, a human patient, or a mammal.

[0224] Nucleotide sequences shown herein are from left to right 5' to 3' unless otherwise indicated.

[0225] The polypeptides, proteins, or protein fragments provided by the polynucleotides of the present disclosure may be variants of the polypeptide or protein of interest. The variant polypeptide or protein may have at least about 50%, 60%, 70%, 80%, 90%, or 95% sequence identity to the polypeptide or protein of interest.

[0226] In some embodiments, the translatable molecules of the invention can encode homologs, variants or fragments of a human protein, which can have one or more amino acid substitutions, deletions and / or insertions compared to the wild-type or naturally occurring human protein while retaining protein activity.

[0227] In a further embodiment, the translatable molecule of the invention can encode a protein that is identical or nearly identical to a human protein.

[0228] For example, a translatable molecule can encode an amino acid sequence that is at least 80%, or 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% or more identical to the amino acid sequence of a reference polypeptide or protein, such as a human wild-type protein.

[0229] In yet another example, the translatable molecule can encode an amino acid sequence that can have 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 15, or 20 or more amino acid substitutions, deletions, and / or insertions compared to the amino acid sequence of a reference polypeptide or protein, such as a human wild-type protein.

[0230] Examples of polypeptides and proteins of the present disclosure include human EPO, human factor IX (hF9), human alpha-1-antitrypsin (hAAT), and human adiponectin (hAdipo), among others.

[0231] disease Examples of diseases for enzyme modulation include lysosomal diseases such as Gaucher disease, Fabry disease, mucopolysaccharidoses (MPS) and related diseases including MPS I, MPS II (Hunter syndrome) and MPS VI, and glycogen storage disease type II.

[0232] Examples of diseases for enzyme modulation include hematological diseases, such as sickle cell disease, thalassemia, methemoglobinemia, hemoglobin B 12 These include anemia due to intrinsic factor deficiency, spherocytosis, glucose-6-phosphate dehydrogenase deficiency, and pyruvate kinase deficiency.

[0233] Examples of diseases for enzyme modulation include hemophilia, von Willebrand's disease, protein S deficiency, age-related macular degeneration, trinucleotide repeat disorders, muscular dystrophies, insertion mutation disorders, DNA repair deficiency disorders, and deletion mutation disorders.

[0234] Examples of diseases and / or conditions for which the translatable molecules of the invention can be translated to provide active agents include those diseases and / or conditions set forth in Table 3.

[0235] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6]

[0236] Modalities for immune modulation The RNA molecules of the invention can be translatable to provide an active protein, hi certain embodiments, the translatable RNA molecule can provide an active RNA immunization agent or RNA vaccine component.

[0237] The present invention can provide vaccination with RNA molecules encoding target antigens. The RNA molecules can induce immune responses after being captured by antigen-presenting cells. The synthetic and isolated RNA molecules of the present invention can provide control over immunogenic response parameters as well as pharmacokinetic properties.

[0238] In certain aspects, the present disclosure provides a method for RNA vaccine.The synthetic and isolated RNA molecule of the present invention can be delivered to cells or subjects in molecular form or in various carriers.Examples of carriers include liposomes, coated nanoparticles, or cells transfected with RNA agents.In certain embodiments, RNA agents can be used as adjuvants or to stimulate innate immune response.

[0239] The RNA agents of the present invention can provide effective therapeutic agents at low doses.

[0240] The RNA vaccines of the present disclosure can advantageously provide a safe and effective genetic vaccine by inducing an immune response that has both cellular and humoral components. Generally, the RNA vaccines of the present invention can be used to express proteins.

[0241] In some embodiments, the RNA vaccine can advantageously provide protein synthesis in the cytoplasm. In certain embodiments, the RNA vaccine of the present invention can provide internalization, release, and transport of exogenous translatable RNA in the cytoplasm.

[0242] In certain embodiments, the RNA vaccines of the present invention can encode a protein antigen that can be translated by the host cell.

[0243] In further embodiments, some RNA vaccines of the present disclosure can encode tumor antigens, viral antigens, or allergens.

[0244] Modalities for administering the RNA vaccines of the present invention can include intravenous, intranodal, intradermal, subcutaneous and intrasplenic.

[0245] Embodiments of the present invention can further provide RNA vaccines with increased translational half-lives that can be used to reduce the required dose and antigen exposure, as well as the risk of inducing tolerance.

[0246] The RNA vaccines of the present invention can provide immunological benefits without the risk of genomic integration of components, and can reduce the risk of mutagenesis compared to other genetic vaccines.

[0247] Additional embodiments of the present disclosure include RNA molecules that have translational activity, which can be described by their cytoplasmic half-life in mammalian cells, which can be determined by the time required for 50% of the translatable molecule to be degraded in the cell.

[0248] The translatable molecules of the invention can be precursors of active molecules that can be used in the treatment of a condition or disease in a subject.

[0249] In some embodiments, the translatable molecule of the invention can be a pharmacologically active molecule that has an increased half-life in the cytoplasm of mammalian cells.

[0250] Aspects of the present invention provide structures and compositions for translatable molecules that are oligomeric compounds. The translatable compounds can be active agents for pharmaceutical compositions. The oligomeric molecules of the present invention can be used as active agents in formulations for delivering peptide and protein therapeutics.

[0251] Oligomeric compounds of the invention can have lengths of about 200 to about 12,000 bases in length. Translatable oligomeric compounds of the invention can have lengths of about 1800, or about 1900, or about 2000, or about 2100, or about 2200, or about 2300, or about 2400, or about 2500 bases in length.

[0252] In a further aspect, the oligomeric translatable compounds of the invention can be pharmacologically active molecules that can be used as active pharmaceutical ingredients to generate peptide or protein active agents in vitro, in vivo, or ex vivo.

[0253] In some aspects, the translatable molecules of the invention can have any number of phosphorothioate intermonomer linkages at any intermonomer position.

[0254] In some embodiments, any one or more of the intermonomer linkages of the translatable molecule can be phosphodiester, phosphorothioate, including dithioate, chiral phosphorothioate, and other chemically modified forms.

[0255] Enhanced Translation The translatable molecules of the present invention can incorporate regions that enhance the translation efficiency of the molecule.

[0256] Generally, translational enhancer regions known in the art can be incorporated into the structure of a translatable molecule to increase peptide or protein yield.

[0257] A translatable molecule containing a translational enhancer region can provide increased production of a peptide or protein.

[0258] In some embodiments, a translational enhancer region can comprise or be located in the 5' or 3' untranslated region of a translatable molecule.

[0259] Examples of translational enhancer regions include the naturally occurring enhancer regions from the TEV 5'UTR and the Xenopus beta-globin 3'UTR.

[0260] Molecular Structure and Sequence The translatable molecule can be designed to express a target peptide or protein. In some embodiments, the target peptide or protein can be associated with a condition or disease in a subject.

[0261] In some embodiments, the base sequence of the translatable molecule can include a portion that is identical to at least an effective portion or domain of the base sequence of an mRNA, the effective portion being sufficient to confer therapeutic activity on the translation product of the translatable molecule.

[0262] In some aspects, the invention provides active translatable oligomeric molecules that have a base sequence identical to at least a fragment of a native nucleic acid molecule of a cell.

[0263] In certain embodiments, the base sequence of the translatable molecule can include a portion that is identical to the base sequence of the mRNA, except for one or more base mutations. The number of mutations in the translatable molecule should not exceed an amount that would produce a translation product of the translatable molecule that has significantly less activity than the mRNA.

[0264] The oligomeric translatable molecules of the invention can display a sequence of nucleobases and can be designed to express peptides or proteins in vitro, ex vivo, or in vivo. The expressed peptides or proteins can have various forms of activity, including activity corresponding to the protein expressed from native or naturally occurring mRNA.

[0265] In some embodiments, a translatable molecule of the invention can have a chain length of about 200 to 15,000 monomers.

[0266] Molecular cap structure The translatable molecules of the present invention can have their 5' ends capped with one of a variety of groups as known in the art.

[0267] In some embodiments, the 5' cap can be a m7GpppGm cap.

[0268] In further embodiments, the 5' cap can be selected from m7GpppA, m7GpppC; an unmethylated cap analog (e.g., GpppG); a dimethylated cap analog (e.g., m2,7GpppG), a trimethylated cap analog (e.g., m2,2,7GpppG), a dimethylated symmetric cap analog (e.g., m7Gpppm7G), or an anti-reverse cap analog (e.g., ARCA; m7,2'OmeGpppG, m72'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG, and their tetraphosphate derivatives) [see, e.g., Jemielity, J. et al., RNA 9: 1108-1122 (2003)].

[0269] In additional embodiments, the 5' cap can be an ARCA cap [3'-OMe-m7G(5')pppG].

[0270] The 5' cap is mCAP [m7G(5')ppp(5')G,N 7-methyl-guanosine-5'-triphosphate-5'-guanosine].

[0271] The 5' cap can be resistant to hydrolysis.

[0272] Some examples of 5' cap structures are described in WO2015 / 051169, WO2015 / 061491, US8,093,367 and US8,304,529.

[0273] Untranslated region In some embodiments, the translatable molecule can include a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR).

[0274] In some embodiments, a translatable molecule can include a 5' UTR that is at least about 25, 50, 75, 100, 125, 150, 175, 200, 300, 400, or 500 nucleotides in length. In further embodiments, the 5' UTR can contain about 50-300 nucleotides, e.g., about 75-250 nucleotides, or about 100-200 nucleotides, or about 120-150 nucleotides, or about 135 nucleotides.

[0275] In some embodiments, the 5'UTR may be derived from a reference mRNA.

[0276] In some examples, the 5'UTR may be derived from an mRNA for a histone, tubulin, globin, GAPDH, actin, or a citric acid cycle enzyme.

[0277] In other embodiments, the 5'UTR sequence can include a partial sequence of the CMV immediate early 1 (IE1) gene.

[0278] In some embodiments, the 5'UTR can comprise a sequence selected from the 5'UTRs of human IL-6, alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human transthyretin, human haptoglobin, human alpha-1-antichymotrypsin, human antithrombin, human alpha-1-antitrypsin, human albumin, human beta globin, human complement C3, human complement C5, SynK, AT1G58420, mouse beta globin, mouse albumin and tobacco etch virus, or a fragment of any of the foregoing.

[0279] In a further embodiment, the 5'UTR may be derived from tobacco etch virus (TEV).

[0280] In some embodiments, the translatable oligomeric molecule can comprise an internal ribosome entry site (IRES). The IRES can enable translation initiation in an end-independent manner. In certain embodiments, the IRES can be located in the 5'UTR. In other embodiments, the IRES can be located outside the 5'UTR.

[0281] In some embodiments, a translatable molecule can include a 3' UTR that is at least about 25, 50, 75, 100, 125, 150, 175, 200, 300, 400, or 500 nucleotides in length. In some embodiments, the 3' UTR can contain about 50-300 nucleotides, e.g., about 75-250 nucleotides, or about 100-200 nucleotides, or about 140-175 nucleotides, or about 160 nucleotides.

[0282] In some embodiments, the 3'UTR can comprise a sequence selected from the 3'UTRs of alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human haptoglobin, human antithrombin, human alpha globin, human beta globin, human complement C3, human growth factor, human hepcidin, MALAT-1, mouse beta globin, mouse albumin, and Xenopus beta globin, or a fragment of any of the foregoing.

[0283] In some embodiments, the 3'UTR may be derived from Xenopus beta globin.

[0284] Some examples of UTRs can be found in US Pat. No. 9,149,506.

[0285] stop codon In some embodiments, the translatable molecule can include a sequence downstream of the CDS that results in a triple stop codon, hi some embodiments, the translatable molecule can include the sequence AUAAGUGAA (SEQ ID NO: 1) downstream of the CDS.

[0286] Translation begins In some embodiments, the translatable molecule can include a translation initiation site.

[0287] In certain embodiments, the translation initiation site can be a Kozak sequence. Some examples are found in Kozak, Marilyn (1988) Mol. and Cell Biol., 8:2737-2744; Kozak, Marilyn (1991) J. Biol. Chem., 266:19867-19870; Kozak, Marilyn (1990) Proc Natl. Acad. Sci. USA, 87:8301-8305; and Kozak, Marilyn (1989) J. Cell Biol., 108:229-241.

[0288] In some embodiments, a translation start site can be inserted upstream of the CDS.

[0289] In a further embodiment, a translation start site can be inserted downstream of the 5'UTR.

[0290] Molecular tail structure In some embodiments, the translatable molecule may comprise a tail region that may function to protect the molecule from exonuclease degradation.

[0291] In some embodiments, the tail region may be a polyA tail.

[0292] A polyA tail can be attached to a translatable molecule using a variety of methods known in the art. For example, polyA polymerase can be used to add the tail to synthetic or in vitro transcribed RNA. Other methods include using a transcription vector to encode the polyA tail, or using a ligase (e.g., by splint ligation using T4 RNA ligase and / or T4 DNA ligase), in which case polyA can be ligated to the 3' end of the sense RNA. In some embodiments, a combination of any of the above methods can be utilized.

[0293] In some embodiments, the translatable molecule can include a 3' poly-A tail structure. The length of the poly-A tail can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides or longer. In some embodiments, the 3' poly-A tail can contain about 5 to 300 adenosine nucleotides, e.g., about 30 to 250 adenosine nucleotides, or about 60 to 220 adenosine nucleotides, or about 80 to 200 adenosine nucleotides, or about 90 to about 150 adenosine nucleotides, or about 100 to about 120 adenosine nucleotides. In some examples, the 3' poly-A tail can be about 100 nucleotides in length, or 115 nucleotides in length.

[0294] In some embodiments, the translatable molecule can comprise a 3' poly-C tail structure. In some embodiments, the length of the poly-C tail can be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides or more. In some embodiments, the 3' poly-C tail can contain about 5 to 300 cytosine nucleotides, e.g., about 30 to 250 cytosine nucleotides, or about 60 to 220 cytosine nucleotides, or about 80 to about 200 cytosine nucleotides, or about 90 to 150 cytosine nucleotides, or about 100 to about 120 cytosine nucleotides. In some embodiments, the 3' poly-C tail can be about 100 nucleotides in length, or 115 nucleotides in length.

[0295] In a further embodiment, the poly-C tail can be attached to the poly-A tail. The poly-C tail can be attached to the 5' end of the poly-A tail or to the 3' end of the poly-A tail.

[0296] In some embodiments, the length of the polyA and / or polyC tail can be varied to affect the stability of the translatable molecule.

[0297] Genetic basis of translatable molecules In some embodiments, the translatable molecules of the invention can be structured to provide peptides or proteins that are nominally expressed by any part of the genome. Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins are provided below.

[0298] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: neoplasms, PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; Bcl2; PPAR alpha; PPAR gamma; WT1 (Wilms' tumor); FGF receptor family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (androgen receptor); TSG101; IGF; IGF receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 receptor; Igf 2 receptor; Bax; Bcl2; caspase family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Apc.

[0299] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: age-related macular degeneration, schizophrenia, Aber; Ccl2; Cc2; cp (ceruloplasmin); Timp3; cathepsin D; Vldlr; Ccr2 neuregulin 1 (Nrg1); Erb4 (neuregulin receptor); complexin 1 (Cplx1); Tph1 tryptophan hydroxylase; Tph2 tryptophan hydroxylase 2; neurexin 1; GSK3; GSK3a; GSK3b.

[0300] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: 5-HTT (Slc6a4); COMT; DRD (Drd1a); SLC6A3; DAOA; DTNBP1; Dao (Dao1).

[0301] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include the following: trinucleotide repeat disorders, HTT (Huntington's Dx); SBMA / SMAX1 / AR (Kennedy Dx); FXN / X25 [Friedrich ataxia]; ATX3 (Machado-Joseph Dx); ATXN1 and ATXN2 (Spinocerebellar ataxia); DMPK (myotonic dystrophy); Atrophin-1 and Atn1 (DRPLA Dx); CBP (Creb-BP-generalized instability); VLDLR (Alzheimer's); Atxn7; Atxn10.

[0302] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: fragile X syndrome, FMR2; FXR1; FXR2; mGLUR5.

[0303] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: secretase-associated disorders, APH-1 (alpha and beta); presenilin (Psen1); nicastrin (Ncstn); PEN-2.

[0304] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Nos1.

[0305] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Parp1.

[0306] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Nat1; Nat2.

[0307] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: prion-related disorders, Prp;

[0308] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: ALS disease, SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a; VEGF-b; VEGF-c).

[0309] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: drug addiction, Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Gria1 (alcohol).

[0310] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: autism, Mecp2; BZRAP1; MDGA2; Sema5A; Neurexin 1; Fragile X [FMR2 (AFF2); FXR1; FXR2; Mglur5].

[0311] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Alzheimer's disease, E1; CHIP; UCH; UBB; Tau; LRP; PICALM; clusterin; PS1; SORL1; CR1; Vld1r; Uba1; Uba3; CHIP28 (Aqp1, aquaporin 1); Uchl1; Uchl3; APP.

[0312] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: inflammation, IL-10; IL-1 (IL-1a; IL-1b); IL-13; IL-17 (IL-17a (CTLA8); IL-17b; IL-17c; IL-17d; IL-17f); IL-23; Cx3er1; ptpn22; TNFa; NOD2 / CARD15 for IBD; IL-6; IL-12 (IL-12a; IL-12b); CTLA4; Cx3cl1.

[0313] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Parkinson's disease, x-synuclein; DJ-1; LRRK2; Parkin; PINK1.

[0314] Examples of genes for which translatable molecules can be used to express the corresponding peptide or protein include: blood and coagulation diseases and disorders, anemia (CDAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1, PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT); bare lymphocyte syndrome (TAPBP, TPSN, TAP2, ABCB3, PSF); 2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5), bleeding disorders (TBXA2R, P2RX1, P2X1); factor H and factor H-like 1 (HF1, CFH, HUS); factor V and factor VIII (MCFD2); factor VII deficiency (F7); factor X deficiency (F10); factor XI deficiency (F11); factor XII deficiency (F12, HAF); factor XIIIA deficiency (F13A1, F13A); factor XIIIB deficiency (F13B); Fanconi anemia ( FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCD1, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596); hemophagocytic lymphohistiocytosis disorders (PRF1, HPLH2, UNC13D, MUNC13-4, HPLH3, HLH3, FHL3); hemophilia A (F8, F8C, HEMA); hemophilia B (F9, Factor IX, HEMB), bleeding disorders (PI, ATT, F5); white blood cell (leukocyte) deficiencies and disorders (ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4); sickle cell anemia (HBB); thalassemia (HBA2, HBB, HBD, LCRB, HBA1).

[0315] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cellular dysregulation and oncology diseases and disorders, B-cell non-Hodgkin's lymphoma (BCL7A, BCL7); leukemia (TAL1, TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1A1, IK1, LYF1, HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3, A F1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B, AF10, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NF NS, PTPN11, PTP2C, SHP2, NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1, NFE1, ABL1, NQO1, DIA4, NMOR1, NUP214, D9S46E, CAN, CAIN).

[0316] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: inflammatory and immune-related diseases and disorders, AIDS (KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12, SDF1); autoimmune lymphoproliferative syndrome (TNFRSF6, APT1, FAS, CD95, ALPS1A); combined immunodeficiency (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection [IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5)]; immunodeficiency (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI); inflammation (IL-10, IL-1(IL -1a, IL-1b), IL-13, IL-17(IL-17a(CTLA8), IL-17b, IL-17c, IL-17d, IL-17f, II-23, Cx3cr1, ptpn22, TNF a, NOD2 / CARD15, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3cl1) for IBD; severe combined immunodeficiency (SCID) (JAK3, JAKL, D CLRE1C, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDX1, SCIDX, IMD4).

[0317] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include metabolic, liver, kidney, and protein diseases and disorders, amyloid neuropathies (TTR, PALB); amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); cystic fibrosis (CFTR, BG213071, ABCC7, CF, MRP7); glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM). hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), liver failure, early onset and neurological disorders (SCOD1, SCO1), hepatic lipase deficiency (LIPC), hepatoblastoma, cancer and carcinoma (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5); medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); polycystic kidney and liver disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63).

[0318] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: lipoprotein lipase, APOA1, APOC3 and APOA4.

[0319] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: muscular / skeletal diseases and disorders, Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne muscular dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); facioscapulohumeral muscular dystrophy (FSHMD1A, FSHD1A); muscular dystrophies (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DA G2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRIM32, HT2A, LGMD2H, FKRP, M DC1C, LGMD2I, TTN, CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN, RSMD1, PLEC1, PLTN, EBS1); osteopetrosis (LRP 5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1, TIRC7, OC116, OPTB1); muscle atrophy (VAPB, VAPC , ALS8, SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1).

[0320] Examples of genes for which translatable molecules can be used to express the corresponding peptide or protein include: neurological and neuronal type diseases and disorders, ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, VEGF-c); Alzheimer's disease (APP, AAA, CVAP, AD1, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1, MPO, PACIP1, PAXIP1L, P TIP, A2M, BLMH, BMH, PSEN1, AD3); autism (Mecp2, BZRAP1, MDGA2, Sema5A, Neurexin1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); fragile X syndrome (FMR2, FXR1, FXR2, mGLUR5); Huntington's disease and disease-like disorders (HD, IT15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17); Parkinson's disease (NR4A2, NURR1, NOT, TINUR , SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJ1, PARK7, LRRK2, PARK8, PINK1, PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ , DBH, NDUFV2); Rett syndrome (MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-synuclein, DJ-1); schizophrenia [neuregulin 1 (Nrg1), Er b4 (neuregulin receptor), complexin 1 (Cplx1), Tph1 tryptophan hydroxylase, Tph2, tryptophan hydroxylase 2, neurexin 1, GSK3, GSK3a, GSK3b, 5-HTT (Slc6a4), COMT, DRD (Drd1a), SLC6A3, DAOA, DTNBP1, Dao (Dao1)]; secretase-related disorders [APH-1 (alpha and beta), presenilin (Psen1), nicastrin, (Ncstn), PEN-2, Nos1, Parp1, Nat1, Nat2];Trinucleotide repeat disorders [HTT (Huntington's disease), SBMA / SMAX1 / AR (Kennedy disease), FXN / X25 (Friedreich's ataxia), ATX3 (Machado-Joseph disease), ATXN1 and ATXN2 (Spinocerebellar ataxia), DMPK (Myotonic dystrophy), Atrophin-1 and Atn1 (DRPLA disease), CBP (Creb-BP-generalized instability), VLDLR (Alzheimer's disease), Atxn7, Atxn10];

[0321] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Occular diseases and disorders, age-related macular degeneration [Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsin D, Vldlr, Ccr2]; cataracts (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQP0, CRYAB, CRYA2, C TPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM , KRIT1); Corneal opacification and dystrophy (APOA1, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, M1S1, VSX1, RINX, PPCD, PPD, KTCN, COL 8A2, FECD, PPCD2, PIP5K3, CFD); squamous congenital (KERA, CNA2); glaucoma (MYOC, TIGR, GLC1A, JOAG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1B1, GLC3A, OPA1, NTG, NPG, CYP1B1, GLC3A); Leber congenital amaurosis (CRB1, RP12, CRX, CORD2, CRD, RPGRIP1, LCA6, CORD9, RPE65, RP20, AIPL1, LCA 4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3); macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, PRPH2, PRPH, AVMD, AOFMD, VMD2).

[0322] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: epilepsy, myoclonic, EPM2A, MELF, EPM2 Lafora type, 254780 epilepsy, myoclonic, NHLRC1, EPM2A, EPM2B Lafora type, 254780.

[0323] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Duchenne muscular DMD, BMD dystrophy, 310200 (3) KIR3DS1 progression to AIDS, delayed / rapid KIR3DL1, NKAT3, NKB1, AMB11, (3).

[0324] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: AIDS, delayed / rapid KIR3DL1, NKAT3, NKB1, AMB11, (3) KIR3DS1 progression to AIDS, 609423 (3) rapid IFNG progression to AIDS, resistance to CXCL12, SDF1 (3).

[0325] Examples of genes from which translatable molecules can be used to express the corresponding peptides or proteins include: alpha-1-antitrypsin deficiency, SERPINA1 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1]; SERPINA2 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2]; SERPINA3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3]; SERPINA5 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5]; SERPINA6 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6]; SERPINA7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7]; and SERPLNA6 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6).

[0326] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: PI3K / AKT signaling, PRKCE; ITGAM; ITGA5; IRAK1; PRKAA2; EIF2AK2; PTEN; EIF4E; PRKCZ; GRK6; MAPK1; TSC1; PLK1; AKT2; IKBKB; PIK3CA; CDK8; CDKN1B; NFKB2; BCL2; PIK3CB; PPP2R1A; MAPK8; BCL2L1; MAPK3; TSC2; ITGA1; KRAS; EIF4EBP1; RELA; PRK CD;NOS3;PRKAA1;MAPK9;CDK2;PPP2CA;PIM1;ITGB7;YWHAZ;ILK;TP53;RAF1.;IKBKG;RELB;DYRK1A;CDKN1A;ITGB1;MAP2K2;JAK1;AKT1;JAK2;PIK3R1;CHUK ;PDPK1;PPP2R5C;CTNNB1.;MAP2K1;NFKB1;PAK3;ITGB3;CCND1;GSK3A;FRAP1;SFN;ITGA2;TTK;CSNK1A1;BRAF;GSK3B;AKT3;FOXO1;SGK;HSP90AA1;RPS6KB1.

[0327] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: ERK / MAPK signaling, PRKCE; ITGAM; ITGA5; HSPB1; IRAK1; PRKAA2; EIF2AK2; RAC1; RAP1A; TLN1; EIF4E; ELK1; GRK6; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; CREB1; PRKCI; PTK2; FOS; RPS6KA4; PIK3CB; PPP2R1A; PIK3C3; MAPK8; MAPK3; ITGA1;ETS1;KRAS;MYCN;EIF4EBP1;PPARG;PRKCD;PRKAA1;MAPK9;SRC;CDK2;PPP2CA;PIM1;PIK3C2A;ITGB7;YWHAZ;PPP1CC;KSR1;PXN;RAF1;FYN;DY RK1A;ITGB1;MAP2K2;PAK4;PIK3R1;STAT3;PPP2R5C;MAP2K1;PAK3;ITGB3;ESR1;ITGA2;MYC;TTK;CSNK1A1;CRKL;BRAF;ATF4;PRKCA;SRF;STAT1;SGK.

[0328] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: serine / threonine protein kinases, CDK16; PCTK1; CDK5R1.

[0329] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glucocorticoid receptor signaling, RAC1; TAF4B; EP300; SMAD2; TRAF6; PCAF; ELK1; MAPK1; SMAD3; AKT2; IKBKB; NCOR2; UBE2I; PIK3CA; CREB1; FOS; HSPA5; NFKB2; BCL2; MAP3K14; STAT5B; PIK3CB; PIK3C3; MAPK8; BCL2L1; MAPK3; TSC22D3; MAPK10; NRIP1 ;KRAS;MAPK13;RELA;STAT5A;MAPK9;NOS2A;PBX1;NR3C1;PIK3C2A;CDKN1C;TRAF2;SERPINE1;NCOA3;MAPK14;TNF;RAF1;IKBKG;MAP3K7;CREBBP;CDKN1A; MAP2K2;JAK1;IL8;NCOA2;AKT1;JAK2;PIK3R1;CHUK;STAT3;MAP2K1;NFKB1;TGFBR1;ESR1;SMAD4;CEBPB;JUN;AR;AKT3;CCL2;MMP1;STAT1;IL6;HSP90AA1.

[0330] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: axon guidance signaling, PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; ADAM12; IGF1; RAC1; RAP1A; E1F4E; PRKCZ; NRP1; NTRK2; ARHGEF7; SMO; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; AKT2; PIK3CA; ERBB2; PRKC1; PTK2; CFL1; GNAQ; PIK3CB;CXCL12;PIK3C3;WNT11;PRKD1;GNB2L1;ABL1;MAPK3;ITGA1;KRAS;RHOA;PRKCD;PIK3C2A;ITGB7;GLI2;PXN;VASP;RAF1;FYN;ITGB1;M AP2K2;PAK4;ADAM17;AKT1;PIK3R1;GLI1;WNT5A;ADAM10;MAP2K1;PAK3;ITGB3;CDC42;VEGFA;ITGA2;EPHA8;CRKL;RND1;GSK3B;AKT3;PRKCA.

[0331] Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins include: ephrin receptor signaling, PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; IRAK1; PRKAA2; EIF2AK2; RAC1; RAP1A; GRK6; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; PLK1; AKT2; DOK1; CDK8; CREB1; PTK2; CFL1; GNAQ; MAP3K14; CXCL1 2;MAPK8;GNB2L1;ABL1;MAPK3;ITGA1;KRAS;RHOA;PRKCD;PRKAA1;MAPK9;SRC;CDK2;PIM1;ITGB7;PXN;RAF1;FYN;DYRK1A;ITGB1;MAP2K2 ;PAK4, AKT1;JAK2;STAT3;ADAM10;MAP2K1;PAK3;ITGB3;CDC42;VEGFA;ITGA2;EPHA8;TTK;CSNK1A1;CRKL;BRAF;PTPN13;ATF4;AKT3;SGK.

[0332] Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins include: actin cytoskeleton signaling, ACTN4; PRKCE; ITGAM; ROCK1; ITGA5; IRAK1; PRKAA2; EIF2AK2; RAC1; INS; ARHGEF7; GRK6; ROCK2; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; PTK2; CFL1; PIK3CB; MYH9; DIAPH1; PI K3C3;MAPK8;F2R;MAPK3;SLC9A1;ITGA1;KRAS;RHOA;PRKCD;PRKAA1;MAPK9;CDK2;PIM1;PIK3C2A;ITGB7;PPP1CC;PXN;VIL2;RAF1; GSN;DYRK1A;ITGB1;MAP2K2;PAK4;PIP5K1A;PIK3R1;MAP2K1;PAK3;ITGB3;CDC42;APC;ITGA2;TTK;CSNK1A1;CRKL;BRAF;VAV3;SGK.

[0333] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Huntington's disease signaling, PRKCE; IGF1; EP300; RCOR1; PRKCZ; HDAC4; TGM2; MAPK1; CAPNS1; AKT2; EGFR; NCOR2; SP1; CAPN2; PIK3CA; HDAC5; CREB1; PRKC1; HSPA5; REST; GNAQ; PIK3CB; PIK3C3 ;MAPK8;IGF1R;PRKD1;GNB2L1;BCL2L1;CAPN1;MAPK3;CASP8;HDAC2;HDAC7A;PRKCD;HDAC11;MAPK9;HDAC9;PIK3C2A;HDAC3;T P53;CASP9;CREBBP;AKT1;PIK3R1;PDPK1;CASP1;APAF1;FRAP1;CASP2;JUN;BAX;ATF4;AKT3;PRKCA;CLTC;SGK;HDAC6;CASP3.

[0334] Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins include: apoptosis signaling, PRKCE; ROCK1; BID; IRAK1; PRKAA2; EIF2AK2; BAK1; BIRC4; GRK6; MAPK1; CAPNS1; PLK1; AKT2; IKBKB; CAPN2; CDK8; FAS; NFKB2; BCL2; MAP3K14; MAPK8; BCL2L 1;CAPN1;MAPK3;CASP8;KRAS;RELA;PRKCD;PRKAA1;MAPK9;CDK2;PIM1;TP53;TNF;RAF1;IKBKG;RELB;CASP9;DYRK1A;MA P2K2;CHUK;APAF1;MAP2K1;NFKB1;PAK3;LMNA;CASP2;BIRC2;TTK;CSNK1A1;BRAF;BAX;PRKCA;SGK;CASP3;BIRC3;PARP1.

[0335] Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins include: B cell receptor signaling, RAC1; PTEN; LYN; ELK1; MAPK1; RAC2; PTPN11; AKT2; IKBKB; PIK3CA; CREB1; SYK; NFKB2; CAMK2A; MAP3K14; PIK3CB; PIK3C3; MAPK8; BCL2L1; ABL 1;MAPK3;ETS1;KRAS;MAPK13;RELA;PTPN6;MAPK9;EGR1;PIK3C2A;BTK;MAPK14;RAF1;IKBKG;RELB;MAP3K7;MAP2K 2;AKT1;PIK3R1;CHUK;MAP2K1;NFKB1;CDC42;GSK3A;FRAP1;BCL6;BCL10;JUN;GSK3B;ATF4;AKT3;VAV3;RPS6KB1.

[0336] Examples of genes for which translatable molecules can be used to express the corresponding peptides or proteins include: leukocyte extravasation signaling, ACTN4; CD44; PRKCE; ITGAM; ROCK1; CXCR4; CYBA; RAC1; RAP1A; PRKCZ; ROCK2; RAC2; PTPN11; MMP14; PIK3CA; PRKCI; PTK2; PIK3CB; CXCL12; PIK3C3;MAPK8;PRKD1;ABL1;MAPK10;CYBB;MAPK13;RHOA;PRKCD;MAPK9;SRC;PIK3C2A;BTK;MAPK14;NOX1;PXN;VI L2;VASP;ITGB1;MAP2K2;CTNND1;PIK3R1;CTNNB1;CLDN1;CDC42;F11R;ITK;CRKL;VAV3;CTTN;PRKCA;MMP1;MMP9.

[0337] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: integrin signaling, ACTN4; ITGAM; ROCK1; ITGA5; RAC1; PTEN; RAP1A; TLN1; ARHGEF7; MAPK1; RAC2; CAPNS1; AKT2; CAPN2; P1K3CA; PTK2; PIK3CB; PIK3C3; MAPK8; CAV1; CAPN1; ABL1; MAPK3; ITGA1; KRAS; RHOA; SRC; PIK3C2A; ITGB7; PPP1CC; ILK; PXN; VASP; RAF1; FYN; ITGB1; MAP2K2; PAK4; AKT1; PIK3R1; TNK2; MAP2K1; PAK3; ITGB3; CDC42; RND3; ITGA2; CRKL; BRAF; GSK3B; AKT3.

[0338] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include acute phase response signaling, IRAK1; SOD2; MYD88; TRAF6; ELK1; MAPK1; PTPN11; AKT2; IKBKB; PIK3CA; FOS; NFKB2; MAP3K14; PIK3CB; MAPK8; RIPK1; MAPK3; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; FTL; NR3C1; TRAF2; SERPINE1; MAPK14; TNF; RAF1; PDK1; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; FRAP1; CEBPB; JUN; AKT3; IL1R1; IL6.

[0339] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: PTEN signaling, ITGAM; ITGA5; RAC1; PTEN; PRKCZ; BCL2L11; MAPK1; RAC2; AKT2; EGFR; IKBKB; CBL; PIK3CA; CDKN1B; PTK2; NFKB2; BCL2; PIK3CB; BCL2L1; MAPK3; ITGA1; KRAS; ITGB7; ILK; INSR; RAF1; IKBKG; CASP9; CDKN1A; ITGB1; MAP2K2; AKT1; PIK3R1; CHUK; PDGFRA; PDPK1; MAP2K1; NFKB1; ITGB3; CDC42; CCND1; GSK3A; ITGA2; GSK3B; AKT3; FOXO1; CASP3; RPS6KB1.

[0340] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: p53 signaling, PTEN; EP300; BBC3; PCAF; FASN; BRCA1; GADD45A; BIRC5; AKT2; PIK3CA; CHEK1; TP53INP1; BCL2; PIK3CB; PIK3C3; MAPK8; THBS1; ATR; BCL2L1; E2F1; PMAIP1; CHEK2; TNFRSF10B; TP73; RB1; HDAC9; CDK2; PIK3C2A; MAPK14; TP53; LRDD; CDKN1A; HIPK2; AKT1; RIK3R1; RRM2B; APAF1; CTNNB1; SIRT1; CCND1; PRKDC; ATM; SFN; CDKN2A; JUN; SNAI2; GSK3B; BAX; AKT3.

[0341] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: aryl hydrocarbon receptor signaling, HSPB1; EP300; FASN; TGM2; RXRA; MAPK1; NQO1; NCOR2; SP1; ARNT; CDKN1B; FOS; CHEK1; SMARCA4; NFKB2; MAPK8; ALDH1A1; ATR; E2F1; MAPK3; NRIP1; CHEK2; RELA; TP73; GSTP1; RB1; SRC; CDK2; AHR; NFE2L2; NCOA3; TP53; TNF; CDKN1A; NCOA2; APAF1; NFKB1; CCND1; ATM; ESR1; CDKN2A; MYC; JUN; ESR2; BAX; IL6; CYP1B1; HSP90AA1.

[0342] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: xenobiotic metabolism signaling, PRKCE; EP300; PRKCZ; RXRA; MAPK1; NQO1; NCOR2; PIK3CA; ARNT; PRKCI; NFKB2; CAMK2A; PIK3CB; PPP2R1A; PIK3C3; MAPK8; PRKD1; ALDH1A1; MAP K3;NRIP1;KRAS;MAPK13;PRKCD;GSTP1;MAPK9;NOS2A;ABCB1;AHR;PPP2CA;FTL;NFE2L2;PIK3C2A;PPARGC1A;MAPK 14;TNF;RAF1;CREBBP;MAP2K2;PIK3R1;PPP2R5C;MAP2K1;NFKB1;KEAP1;PRKCA;EIF2AK3;IL6;CYP1B1;HSP90AA1.

[0343] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: SAPK / JNK signaling, PRKCE; IRAK1; PRKAA2; EIF2AK2; RAC1; ELK1; GRK6; MAPK1; GADD45A; RAC2; PLK1; AKT2; PIK3CA; FADD; CDK8; PIK3CB; PIK3C3; MAPK8; RIPK1; GNB2L1; IRS1; MAPK3; MAPK10; DAXX; KRAS; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; TRAF2; TP53; LCK; MAP3K7; DYRK1A; MAP2K2; PIK3R1; MAP2K1; PAK3; CDC42; JUN; TTK; CSNK1A1; CRKL; BRAF; SGK.

[0344] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: PPAr / RXR signaling, PRKAA2; EP300; INS; SMAD2; TRAF6; PPARA; FASN; RXRA; MAPK1; SMAD3; GNAS; IKBKB; NCOR2; ABCA1; GNAQ; NFKB2; MAP3K14; STAT5B; MAPK8; IRS1; MAPK3; KRAS; RELA; PRKAA1; PPARGC1A; NCOA3; MAPK14; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; JAK2; CHUK; MAP2K1; NFKB1; TGFBR1; SMAD4; JUN; IL1R1; PRKCA; IL6; HSP90AA1; ADIPOQ.

[0345] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: NF-KB signaling, IRAK1; EIF2AK2; EP300; INS; MYD88; PRKCZ; TRAF6; TBK1; AKT2; EGFR; IKBKB; PIK3CA; BTRC; NFKB2; MAP3K14; PIK3CB; PIK3C3; MAPK8; RIPK1; HDAC2; KRAS; RELA; PIK3C2A; TRAF2; TLR4; TNF; INSR; LCK; IKBKG; RELB; MAP3K7; CREBBP; AKT1; PIK3R1; CHUK; PDGFRA; NFKB1; TLR2; BCL10; GSK3B; AKT3; TNFAIP3; IL1R1.

[0346] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: neuregulin signaling, ERBB4; PRKCE; ITGAM; ITGA5; PTEN; PRKCZ; ELK1; MAPK1; PTPN11; AKT2; EGFR; ERBB2; PRKCI; CDKN1B; STAT5B; PRKD1; MAPK3; ITGA1; KRAS; PRKCD; STAT5A; SRC; ITGB7; RAF1; ITGB1; MAP2K2; ADAM17; AKT1; PIK3R1; PDPK1; MAP2K1; ITGB3; EREG; FRAP1; PSEN1; ITGA2; MYC; NRG1; CRKL; AKT3; PRKCA; HSP90AA1; RPS6KB1.

[0347] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Wnt & beta-catenin signaling, CD44; EP300; LRP6; DVL3; CSNK1E; GJA1; SMO; AKT2; PIN1; CDH1; BTRC; GNAQ; MARK2; PPP2R1A; WNT11; SRC; DKK1; PPP2CA; SOX6; SFRP2:ILK; LEF1; SOX9; TP53; MAP3K7; CREBBP; TCF7L2; AKT1; PPP2R5C; WNT5A; LRP5; CTNNB1; TGFBR1; CCND1; GSK3A; DVL1; APC; CDKN2A; MYC; CSNK1A1; GSK3B; AKT3; SOX2.

[0348] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: insulin receptor signaling, PTEN; INS; EIF4E; PTPN1; PRKCZ; MAPK1; TSC1; PTPN11; AKT2; CBL; PIK3CA; PRKCI; PIK3CB; PIK3C3; MAPK8; IRS1; MAPK3; TSC2; KRAS; EIF4EBP1; SLC2A4; PIK3C2A; PPP1CC; INSR; RAF1; FYN; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; PDPK1; MAP2K1; GSK3A; FRAP1; CRKL; GSK3B; AKT3; FOXO1; SGK; RPS6KB1.

[0349] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: IL-6 signaling, HSPB1; TRAF6; MAPKAPK2; ELK1; MAPK1; PTPN11; IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK3; MAPK10; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; ABCB1; TRAF2; MAPK14; TNF; RAF1; IKBKG; RELB; MAP3K7; MAP2K2; IL8; JAK2; CHUK; STAT3; MAP2K1; NFKB1; CEBPB; JUN; IL1R1; SRF; IL6.

[0350] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: hepatic cholestasis, PRKCE; IRAK1; INS; MYD88; PRKCZ; TRAF6; PPARA; RXRA; IKBKB; PRKCI; NFKB2; MAP3K14; MAPK8; PRKD1; MAPK10; RELA; PRKCD; MAPK9; ABCB1; TRAF2; TLR4; TNF; INSR; IKBKG; RELB; MAP3K7; IL8; CHUK; NR1H2; TJP2; NFKB1; ESR1; SREBF1; FGFR4; JUN; IL1R1; PRKCA; IL6.

[0351] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: IGF-1 signaling, IGF-1; PRKCZ; ELK1; MAPK1; PTPN11; NEDD4; AKT2; PIK3CA; PRKC1; PTK2; FOS; PIK3CB; PIK3C3; MAPK8; 1GF1R; IRS1; MAPK3; IGFBP7; KRAS; PIK3C2A; YWHAZ; PXN; RAF1; CASP9; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3; FOXO1; SRF; CTGF; RPS6KB1.

[0352] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: NRF2-mediated oxidative stress response, PRKCE; EP300; SOD2; PRKCZ; MAPK1; SQSTM1; NQO1; PIK3CA; PRKC1; FOS; PIK3CB; P1K3C3; MAPK8; PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL; NFE2L2; PIK3C2A; MAPK14; RAF1; MAP3K7; CREBBP; MAP2K2; AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAP1; GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1.

[0353] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: liver, fibrosis / hepatic stellate cell activation, EDN1; IGF1; KDR; FLT1; SMAD2; FGFR1; MET; PGF; SMAD3; EGFR; FAS; CSF1; NFKB2; BCL2; MYH9; IGF1R; IL6R; RELA; TLR4; TNF; RELB; IL8; PDGFRA; NFKB1; TGFBR1; SMAD4; VEGFA; BAX; IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9.

[0354] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: PPAR signaling, EP300; INS; TRAF6; PPARA; RXRA; MAPK1; IKBKB; NCOR2; FOS; NFKB2; MAP3K14; STAT5B; MAPK3; NRIP1; KRAS; PPARG; RELA; STAT5A; TRAF2; PPARGC1A; TNF; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA; MAP2K1; NFKB1; JUN; IL1R1; HSP90AA1.

[0355] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Fc epsilon RI signaling, PRKCE; RAC1; PRKCZ; LYN; MAPK1; RAC2; PTPN11; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; MAPK8; PRKD1; MAPK3; MAPK10; KRAS; MAPK13; PRKCD; MAPK9; PIK3C2A; BTK; MAPK14; TNF; RAF1; FYN; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3; VAV3; PRKCA.

[0356] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: G protein-coupled receptor signaling, PRKCE; RAP1A; RGS16; MAPK1; GNAS; AKT2; IKBKB; PIK3CA; CREB1; GNAQ; NFKB2; CAMK2A; PIK3CB; PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAF1; IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK; PDPK1; STAT3; MAP2K1; NFKB1; BRAF; ATF4; AKT3; PRKCA.

[0357] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: inositol phosphate metabolism, PRKCE; IRAK1; PRKAA2; EIF2AK2; PTEN; GRK6; MAPK1; PLK1; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3; MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1; MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK.

[0358] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: PDGF signaling, EIF2AK2; ELK1; ABL2; MAPK1; PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; CAV1; ABL1; MAPK3; KRAS; SRC; PIK3C2A; RAF1; MAP2K2; JAK1; JAK2; PIK3R1; PDGFRA; STAT3; SPHK1; MAP2K1; MYC; JUN; CRKL; PRKCA; SRF; STAT1; SPHK2.

[0359] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: VEGF signaling, ACTN4; ROCK1; KDR; FLT1; ROCK2; MAPK1; PGF; AKT2; PIK3CA; ARNT; PTK2; BCL2; PIK3CB; PIK3C3; BCL2L1; MAPK3; KRAS; HIF1A; NOS3; PIK3C2A; PXN; RAF1; MAP2K2; ELAVL1; AKT1; PIK3R1; MAP2K1; SFN; VEGFA; AKT3; FOXO1; PRKCA.

[0360] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: natural killer cell signaling, PRKCE; RAC1; PRKCZ; MAPK1; RAC2; PTPN11; KIR2DL3; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; PRKD1; MAPK3; KRAS; PRKCD; PTPN6; PIK3C2A; LCK; RAF1; FYN; MAP2K2; PAK4; AKT1; PIK3R1; MAP2K1; PAK3; AKT3; VAV3; PRKCA.

[0361] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cell cycle: G1 / S checkpoint regulation, HDAC4; SMAD3; SUV39H1; HDAC5; CDKN1B; BTRC; ATR; ABL1; E2F1; HDAC2; HDAC7A; RB1; HDAC11; HDAC9; CDK2; E2F2; HDAC3; TP53; CDKN1A; CCND1; E2F4; ATM; RBL2; SMAD4; CDKN2A; MYC; NRG1; GSK3B; RBL1; HDAC6.

[0362] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: T cell receptor signaling, RAC1; ELK1; MAPK1; IKBKB; CBL; PIK3CA; FOS; NFKB2; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; RELA, PIK3C2A; BTK; LCK; RAF1; IKBKG; RELB, FYN; MAP2K2; PIK3R1; CHUK; MAP2K1; NFKB1; ITK; BCL10; JUN; VAV3.

[0363] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: death receptor signaling, CRADD; HSPB1; BID; BIRC4; TBK1; IKBKB; FADD; FAS; NFKB2; BCL2; MAP3K14; MAPK8; RIPK1; CASP8; DAXX; TNFRSF10B; RELA; TRAF2; TNF; IKBKG; RELB; CASP9; CHUK; APAF1; NFKB1; CASP2; BIRC2; CASP3; BIRC3.

[0364] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: FGF signaling, RAC1; FGFR1; MET; MAPKAPK2; MAPK1; PTPN11; AKT2; PIK3CA; CREB1; PIK3CB; PIK3C3; MAPK8; MAPK3; MAPK13; PTPN6; PIK3C2A; MAPK14; RAF1; AKT1; PIK3R1; STAT3; MAP2K1; FGFR4; CRKL; ATF4; AKT3; PRKCA; HGF.

[0365] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: GM-CSF signaling, LYN; ELK1; MAPK1; PTPN11; AKT2; PIK3CA; CAMK2A; STAT5B; PIK3CB; PIK3C3; GNB2L1; BCL2L1; MAPK3; ETS1; KRAS; RUNX1; PIM1; PIK3C2A; RAF1; MAP2K2; AKT1; JAK2; PIK3R1; STAT3; MAP2K1; CCND1; AKT3; STAT1.

[0366] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: amyotrophic lateral sclerosis signaling, BID; IGF1; RAC1; BIRC4; PGF; CAPNS1; CAPN2; PIK3CA; BCL2; PIK3CB; PIK3C3; BCL2L1; CAPN1; PIK3C2A; TP53; CASP9; PIK3R1; RAB5A; CASP1; APAF1; VEGFA; BIRC2; BAX; AKT3; CASP3; BIRC3.

[0367] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: JAK / Stat signaling, PTPN1; MAPK1; PTPN11; AKT2; PIK3CA; STAT5B; PIK3CB; PIK3C3; MAPK3; KRAS; SOCS1; STAT5A; PTPN6; PIK3C2A; RAF1; CDKN1A; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; STAT3; MAP2K1; FRAP1; AKT3; STAT1.

[0368] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: nicotinate and nicotinamide metabolism, PRKCE; IRAK1; PRKAA2; EIF2AK2; GRK6; MAPK1; PLK1; AKT2; CDK8; MAPK8; MAPK3; PRKCD; PRKAA1; PBEF1; MAPK9; CDK2; PIM1; DYRK1A; MAP2K2; MAP2K1; PAK3; NT5E; TTK; CSNK1A1; BRAF; SGK.

[0369] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: chemokine signaling, CXCR4; ROCK2; MAPK1; PTK2; FOS; CFL1; GNAQ; CAMK2A; CXCL12; MAPK8; MAPK3; KRAS; MAPK13; RHOA; CCR3; SRC; PPP1CC; MAPK14; NOX1; RAF1; MAP2K2; MAP2K1; JUN; CCL2; PRKCA.

[0370] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: IL-2 signaling, ELK1; MAPK1; PTPN11; AKT2; PIK3CA; SYK; FOS; STAT5B; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; SOCS1; STAT5A; PIK3C2A:LCK; RAF1; MAP2K2; JAK1; AKT1; PIK3R1; MAP2K1; JUN; AKT3.

[0371] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: synaptic long-term depression, PRKCE; IGF1; PRKCZ; PRDX6; LYN; MAPK1; GNAS; PRKC1; GNAQ; PPP2R1A; IGF1R; PRKID1; MAPK3; KRAS; GRN; PRKCD; NOS3; NOS2A; PPP2CA; YWHAZ; RAF1; MAP2K2; PPP2R5C; MAP2K1; PRKCA.

[0372] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: estrogen receptor signaling, TAF4B; EP300; CARM1; PCAF; MAPK1; NCOR2; SMARCA4; MAPK3; NRIP1; KRAS; SRC; NR3C1; HDAC3; PPARGC1A; RBM9; NCOA3; RAF1; CREBBP; MAP2K2; NCOA2; MAP2K1; PRKDC; ESR1; ESR2.

[0373] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: protein ubiquitination pathway, TRAF6; SMURF1; BIRC4; BRCA1; UCHL1; NEDD4; CBL; UBE2I; BTRC; HSPA5; USP7; USP10; FBXW7; USP9X; STUB1; USP22; B2M; BIRC2; PARK2; USP8; USP1; VHL; HSP90AA1; BIRC3.

[0374] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: IL-10 signaling, TRAF6; CCR1; ELK1; IKBKB; SP1; FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; MAPK14; TNF; IKBKG; RELB; MAP3K7; JAK1; CHUK; STAT3; NFKB1; JUN; IL1R1; IL6.

[0375] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: VDR / RXR activation, PRKCE; EP300; PRKCZ; RXRA; GADD45A; HES1; NCOR2; SP1; PRKC1; CDKN1B; PRKD1; PRKCD; RUNX2; KLF4; YY1; NCOA3; CDKN1A; NCOA2; SPP1; LRP5; CEBPB; FOXO1; PRKCA.

[0376] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: TGF-beta signaling, EP300; SMAD2; SMURF1; MAPK1; SMAD3; SMAD1; FOS; MAPK8; MAPK3; KRAS; MAPK9; RUNX2; SERPINE1; RAF1; MAP3K7; CREBBP; MAP2K2; MAP2K1; TGFBR1; SMAD4; JUN; SMAD5.

[0377] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Toll-like receptor signaling, IRAK1; EIF2AK2; MYD88; TRAF6; PPARA; ELK1; IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; TLR4; MAPK14; IKBKG; RELB; MAP3K7; CHUK; NFKB1; TLR2; JUN.

[0378] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: p38 MAPK signaling, HSPB1; IRAK1; TRAF6; MAPKAPK2; ELK1; FADD; FAS; CREB1; DDIT3; RPS6KA4; DAXX; MAPK13; TRAF2; MAPK14; TNF; MAP3K7; TGFBR1; MYC; ATF4; IL1R1; SRF; STAT1.

[0379] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: neurotrophin / TRK signaling, NTRK2; MAPK1; PTPN11; PIK3CA; CREB1; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; PIK3C2A; RAF1; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; CDC42; JUN; ATF4.

[0380] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: FXR / RXR activation, INS; PPARA; FASN; RXRA; AKT2; SDC1; MAPK8; APOB; MAPK10; PPARG; MTTP; MAPK9; PPARGC1A; TNF; CREBBP; AKT1; SREBF1; FGFR4; AKT3; FOXO1.

[0381] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: synaptic long-term potentiation, PRKCE; RAP1A; EP300; PRKCZ; MAPK1; CREB1; PRKC1; GNAQ; CAMK2A; PRKD1; MAPK3; KRAS; PRKCD; PPP1CC; RAF1; CREBBP; MAP2K2; MAP2K1; ATF4; PRKCA.

[0382] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: calcium signaling, RAP1A; EP300; HDAC4; MAPK1; HDAC5; CREB1; CAMK2A; MYH9; MAPK3; HDAC2; HDAC7A; HDAC11; HDAC9; HDAC3; CREBBP; CALR; CAMKK2; ATF4; HDAC6.

[0383] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: EGF signaling, ELK1; MAPK1; EGFR; PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; PIK3C2A; RAF1; JAK1; PIK3R1; STAT3; MAP2K1; JUN; PRKCA; SRF; STAT1.

[0384] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: hypoxia signaling in the cardiovascular system, EDN1; PTEN; EP300; NQO1; UBE21; CREB1; ARNT; HIF1A; SLC2A4; NOS3; TP53; LDHA; AKT1; ATM; VEGFA; JUN; ATF4; VHL; HSP90AA1.

[0385] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: LPS / IL-1 mediated inhibition of RXR function, IRAK1; MYD88; TRAF6; PPARA; RXRA; ABCA1, MAPK8; ALDH1A1; GSTP1; MAPK9; ABCB1; TRAF2; TLR4; TNF; MAP3K7; NR1H2; SREBF1; JUN; IL1R1.

[0386] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: LXR / RXR activation, FASN; RXRA; NCOR2; ABCA1; NFKB2; IRF3; RELA; NOS2A; TLR4; TNF; RELB; LDLR; NR1H2; NFKB1; SREBF1; IL1R1; CCL2; IL6; MMP9.

[0387] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: amyloid processing, PRKCE; CSNK1E; MAPK1; CAPNS1; AKT2; CAPN2; CAPN1; MAPK3; MAPK13; MAPT; MAPK14; AKT1; PSEN1; CSNK1A1; GSK3B; AKT3; APP.

[0388] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: IL-4 signaling, AKT2; PIK3CA; PIK3CB; PIK3C3; IRS1; KRAS; SOCS1; PTPN6; NR3C1; PIK3C2A; JAK1; AKT1; JAK2; PIK3R1; FRAP1; AKT3; RPS6KB1.

[0389] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cell cycle: G2 / M DNA damage checkpoint regulation, EP300; PCAF; BRCA1; GADD45A; PLK1; BTRC; CHEK1; ATR; CHEK2; YWHAZ; TP53; CDKN1A; PRKDC; ATM; SFN; CDKN2A.

[0390] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: nitric oxide signaling in the cardiovascular system, KDR; FLT1; PGF; AKT2; PIK3CA; PIK3CB; PIK3C3; CAV1; PRKCD; NOS3; PIK3C2A; AKT1; PIK3R1; VEGFA; AKT3; HSP90AA1.

[0391] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: purine metabolism NME2; SMARCA4; MYH9; RRM2; ADAR; EIF2AK4; PKM2; ENTPD1; RAD51; RRM2B; TJP2; RAD51C; NT5E; POLD1; NME1.

[0392] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cAMP-mediated signaling, RAP1A; MAPK1; GNAS; CREB1; CAMK2A; MAPK3; SRC; RAF1; MAP2K2; STAT3; MAP2K1; BRAF; ATF4.

[0393] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: mitochondrial dysfunction Notch signaling, SOD2; MAPK8; CASP8; MAPK10; MAPK9; CASP9; PARK7; PSEN1; PARK2; APP; CASP3 HES1; JAG1; NUMB; NOTCH4; ADAM17; NOTCH2; PSEN1; NOTCH3; NOTCH1; DLL4.

[0394] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: endoplasmic reticulum stress pathway, HSPA5; MAPK8; XBP1; TRAF2; ATF6; CASP9; ATF4; EIF2AK3; CASP3.

[0395] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: pyrimidine metabolism, NME2; AICDA; RRM2; EIF2AK4; ENTPD1; RRM2B; NT5E; POLD1; NME1.

[0396] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: Parkinson signaling, UCHL1; MAPK8; MAPK13; MAPK14; CASP9; PARK7; PARK2; CASP3.

[0397] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cardiac & beta adrenergic signaling, GNAS; GNAQ; PPP2R1A; GNB2L1; PPP2CA; PPP1CC; PPP2R5C.

[0398] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glycolysis / gluconeogenesis, HK2; GCK; GPI; ALDH1A1; PKM2; LDHA; HK1.

[0399] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: interferon signaling, IRF1; SOCS1; JAK1; JAK2; IFITM1; STAT1; IFIT3.

[0400] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: sonic hedgehog signaling, ARRB2; SMO; GLI2; DYRK1A; GLI1; GSK3B; DYRKIB.

[0401] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glycerophospholipid metabolism, PLD1; GRN; GPAM; YWHAZ; SPHK1; SPHK2.

[0402] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: phospholipid degradation, PRDX6; PLD1; GRN; YWHAZ; SPHK1; SPHK2.

[0403] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: tryptophan metabolism, SIAH2; PRMT5; NEDD4; ALDH1A1; CYP1B1; SIAH1.

[0404] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: lysine degraders, SUV39H1; EHMT2; NSD1; SETD7; PPP2R5C.

[0405] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: nucleotide excision, ERCC5; ERCC4; XPA; XPC; ERCC1.

[0406] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: repair pathways starch and sucrose metabolism, UCHL1; HK2; GCK; GPI; HK1.

[0407] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: amino sugar metabolism, NQO1; HK2; GCK; HK1.

[0408] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: arachidonic acid metabolism, PRDX6; GRN; YWHAZ; CYP1B1.

[0409] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: circadian rhythm signaling, CSNK1E; CREB1; ATF4; NR1D1.

[0410] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: the coagulation system, BDKRB1; F2R; SERPINE1; F3.

[0411] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: dopamine receptor signaling, PPP2R1A; PPP2CA; PPP1CC; PPP2R5C.

[0412] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glutathione metabolism, IDH2; GSTP1; ANPEP; IDH1.

[0413] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glycerolipid metabolism, ALDH1A1; GPAM; SPHK1; SPHK2.

[0414] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: linoleic acid metabolism, PRDX6; GRN; YWHAZ; CYP1B1.

[0415] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: methionine metabolism, DNMT1; DNMT3B; AHCY; DNMT3A.

[0416] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: pyruvate metabolism, GLO1; ALDH1A1; PKM2; LDHA.

[0417] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: arginine and proline metabolism, ALDH1A1; NOS3; NOS2A.

[0418] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: eicosanoid signaling, PRDX6; GRN; YWHAZ.

[0419] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: fructose and mannose metabolism, HK2; GCK; HK1.

[0420] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: galactose metabolism, HK2; GCK; HK1.

[0421] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: stilbene, coumarine and lignin biosynthesis, PRDX6; PRDX1; TYR.

[0422] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: antigen presentation pathway, CALR; B2M.

[0423] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: steroid biosynthesis, NQO1; DHCR7.

[0424] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: butanoate metabolism, ALDH1A1; NLGN1.

[0425] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: citric acid cycle, IDH2; IDH1.

[0426] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: fatty acid metabolism, ALDH1A1; CYP1B1.

[0427] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glycerophospholipid metabolism, PRDX6; CHKA.

[0428] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: histidine metabolism, PRMT5; ALDH1A1.

[0429] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: inositol metabolism, ERO1L; APEX1.

[0430] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: metabolism of xenobiotics by cytochrome p450, GSTP1; CYP1B1.

[0431] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: methane metabolism, PRDX6; PRDX1.

[0432] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: phenylalanine metabolism, PRDX6; PRDX1.

[0433] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: propionate metabolism, ALDH1A1; LDHA.

[0434] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: selenoamino acid metabolism, PRMT5; AHCY.

[0435] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: sphingolipid metabolism, SPHK1; SPHK2.

[0436] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: aminophosphonate metabolism, PRMT5.

[0437] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: androgen and estrogen metabolism, PRMT5.

[0438] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: ascorbate and aldarate metabolism, ALDH1A1.

[0439] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: bile acid biosynthesis, ALDH1A1;

[0440] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: cysteine ​​metabolism, LDHA.

[0441] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: fatty acid biosynthesis, FASN;

[0442] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: glutamate receptor signaling, GNB2L1.

[0443] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: NRF2-mediated oxidative stress response, PRDX1.

[0444] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: pentose phosphate pathway, GPI.

[0445] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: pentose and glucuronate interconversion, UCHL1.

[0446] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: retinol metabolism, ALDH1A1.

[0447] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: riboflavin metabolism, TYR.

[0448] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: tyrosine metabolism, PRMT5, TYR.

[0449] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: ubiquinone biosynthesis, PRMT5.

[0450] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: valine, leucine and isoleucine degradative, ALDH1A1.

[0451] Examples of genes from which translatable molecules can be used to express corresponding peptides or proteins include: glycine, serine and threonine metabolism, CHKA.

[0452] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: lysine degradation, ALDH1A1.

[0453] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: pain / taste, TRPM5; TRPA1.

[0454] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: pain, TRPM7; TRPC5; TRPC6; TRPC1; Cnr1; cnr2; Grk2; Trpa1; Pomc; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca; Prkacb; Prkar1a; Prkar2a.

[0455] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: mitochondrial function, AIF; CytC; SMAC (Diablo); Aifm-1; Aifm-2.

[0456] Examples of genes for which translatable molecules can be used to express corresponding peptides or proteins include: developmental neurology, BMP-4; chordin (Chrd); noggin (Nog); WNT (Wnt2; Wnt2b; Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b; Wnt9a; Wnt9b; Wnt10a; Wnt10b; Wnt16); beta-catenin; Dkk-1; Frizzled-related protein; Otx-2; Gbx2; FGF-8; reelin; Dab1; unc-86 (Pou4f1 or Brn3a); Numb; Reln.

[0457] Additional synthetic methods In various aspects, the invention provides methods for the synthesis of translatable molecules.

[0458] The translatable molecules of the present invention can be synthesized and isolated using the methods disclosed herein or any related techniques known in the art.

[0459] Some methods for preparing nucleic acids are described, for example, in Merino, Chemical Synthesis of Nucleoside Analogues, (2013); Gait, Oligonucleotide synthesis: a practical approach (1984); Herdewijn, Oligonucleotide Synthesis, Methods in Molecular Biology, Vol. 288 (2005).

[0460] In some embodiments, translatable molecules can be produced by in vitro transcription (IVT) reactions. A mixture of nucleoside triphosphates (NTPs) can be polymerized, for example, using T7 reagent, to obtain RNA from a DNA template. The DNA template can be degraded with RNase-free DNase, and the RNA can be separated by column isolation.

[0461] In some embodiments, a ligase can be used to ligate a synthetic oligomer to the 3' end of an RNA molecule or RNA transcript to form a translatable molecule. The synthetic oligomer ligated to the 3' end can advantageously provide poly-A tail functionality and resistance to its removal by 3'-exoribonucleases. The ligated product translatable molecule can have increased specific activity and provide increased levels of ectopic protein expression.

[0462] In certain embodiments, the ligated product translatable molecules of the invention can be made from RNA transcripts with native specificity. The ligated products can be synthetic molecules that retain the structure of the RNA transcript at the 5' end to ensure compatibility with the native specificity.

[0463] In further embodiments, the ligated product translatable molecules of the invention can be generated from exogenous RNA transcripts or non-naturally occurring RNA. The ligated product can be a synthetic molecule that retains the structure of RNA.

[0464] In general, the canonical mRNA degradation pathway in cells involves the following steps: (i) the polyA tail is gradually trimmed to a short stub by a 3' exonuclease, shutting down loop-forming interactions required for efficient translation and leaving the cap open to attack; (ii) a decapping complex removes the 5' cap; and (iii) the unprotected and intranslation-incompetent transcript remainder is degraded by 5' and 3' exonuclease activities.

[0465] Embodiments of the present invention involve novel translatable structures that may have increased translation activity over native transcripts. The translatable molecules can prevent exonucleases from trimming the poly-A tail in the process of deadenylation.

[0466] Embodiments of the present invention provide structures, compositions, and methods for translatable molecules that contain natural nucleotides along with one or more chemically modified monomers and can provide translatable molecules with increased functional half-lives.

[0467] Pharmaceutical Composition In some aspects, the invention provides pharmaceutical compositions comprising a translatable compound and a pharmaceutically acceptable carrier.

[0468] The pharmaceutical composition may be capable of local or systemic administration. In some embodiments, the pharmaceutical composition may be capable of any administration modality. In certain embodiments, administration may be intravenous, subcutaneous, pulmonary, intramuscular, intraperitoneal, transdermal, oral, or nasal.

[0469] Embodiments of the present invention include pharmaceutical compositions containing a translatable compound in a lipid formulation.

[0470] In some embodiments, the pharmaceutical composition may comprise one or more lipids selected from cationic lipids, anionic lipids, sterols, pegylated lipids, and combinations of any of the foregoing.

[0471] In certain embodiments, the pharmaceutical composition may be substantially free of liposomes.

[0472] In further embodiments, the pharmaceutical composition may comprise liposomes or nanoparticles.

[0473] Some examples of lipids and lipid compositions for delivery of the active molecules of the present invention are described in WO / 2015 / 074085, which is hereby incorporated by reference in its entirety.

[0474] In additional embodiments, the pharmaceutical composition may contain the oligomeric compound within a viral or bacterial vector.

[0475] The pharmaceutical compositions of the present disclosure can include carriers, diluents, or excipients as known in the art. Examples of pharmaceutical compositions and methods are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (AR Gennaro ed. 1985), and Remington, The Science and Practice of Pharmacy, 21st Edition (2005).

[0476] Examples of excipients for pharmaceutical compositions include antioxidants, suspending agents, dispersing agents, preservatives, buffers, tonicity agents and surfactants.

[0477] An effective dose of an agent or pharmaceutical preparation of the present invention may be an amount sufficient to cause translation of a translatable molecule in a cell.

[0478] A therapeutically effective dose can be an amount of an agent or formulation sufficient to cause a therapeutic effect. A therapeutically effective dose can be administered in one or more separate administrations by different routes.

[0479] A therapeutically effective dose may result in a serum level of active agent after administration of 1-1000 pg / ml, or 1-1000 ng / ml, or 1-1000 μg / ml or more.

[0480] A therapeutically effective dose of an active agent in vivo may be a dose of 0.001 to 0.01 mg / kg body weight, or 0.01 to 0.1 mg / kg, or 0.1 to 1 mg / kg, or 1 to 10 mg / kg, or 10 to 100 mg / kg.

[0481] A therapeutically effective dose of an active agent in vivo may be 0.001 mg / kg body weight, or 0.01 mg / kg, or 0.1 mg / kg, or 1 mg / kg, or 2 mg / kg, or 3 mg / kg, or 4 mg / kg, or 5 mg / kg or more.

[0482] In vitro transcription (IVT) for synthesis The following protocol is for a 200µl IVT reaction using NEB HiScribe T7 reagent, which should yield approximately 1mg of RNA. A 2.5x NTP mix was prepared as required by thawing individual 100mM NTP stocks (ATP, GTP, CTP, and UTP nucleotides, or chemically modified counterparts) and pooling them together. For the IVT reaction, approximately 2-4µg of template was used per 200µl reaction. 10x IVT reaction buffer, 2.5x dNTP mix, template DNA, and T7 RNA polymerase were mixed thoroughly by pipetting and incubated at 37°C for 4 hours. To degrade the DNA template, the IVT reaction was diluted with 700µl of nuclease-free water, and then 10x DNase I buffer and 20µl of RNase-free DNase I were added to the IVT mixture and incubated at 37°C for 15 minutes. The diluted (to 1 ml) and DNase-treated reaction was then purified using a Qiagen RNeasy Maxi column according to the manufacturer's instructions, with a final elution in RNase-free water. The purified RNA was then quantified by UV absorbance; the A260 / A280 should be approximately 1.8-2.2 depending on the resuspension buffer used.

[0483] Enzymatic capping of IVT mRNA For enzymatic capping, we used a 50x scaled-up version of NEB's one-step capping and 2'O-methylation reaction, suitable for processing up to 1 mg of IVT transcripts. Based on the assumption that transcripts would be as short as 100 nt in length, 10 μg RNA in a 20 μl reaction was recommended. However, higher substrate-to-reaction volumes were generally tolerated for longer (approximately 300-600 nt) mRNA transcripts. Prior to initiating the capping reaction, the RNA was denatured at 65°C for 5 minutes and then snap-cooled to reduce any secondary conformation. For a total 1 ml capping reaction, 1 mg of denatured RNA in 700 μl of nuclease-free water was used with the combined 100 μl (10x) capping buffer, 50 μl (10 mM) GTP, 50 μl (4 mM) SAM, 50 μl (10 U / μl) vaccinia capping enzyme, and 50 μl of mRNA cap 2'-O-methyltransferase (50 U / μl) and incubated at 37°C for 1 hour. The resulting capped mRNA was eluted using RNAse-free water, repurified on an RNeasy column, and quantified by nanodrop. mRNA was also visualized on a gel by running 500 μg of purified product per lane on a denaturing gel after denaturation and flash cooling to remove secondary structure.

[0484] Dot Blot Each mRNA sample (100 ng) was dotted onto a Biodyne® precut modified nylon membrane (Thermo Scientific, catalog #77016) (0.45 μm, 8 × 12 cm). The membrane was blocked by incubation in 5% nonfat dry milk in TBS-T buffer [50 mM Tris HCl, 150 mM NaCl (pH 7.4), and 0.05% Tween 20] for 1 hour, followed by incubation with the primary antibody anti-ds-RNA mAb J2 [English and Scientific Consulting K ft., Hungary, J2 monoclonal antibody (mAb), mouse, IgG2a, batch #J2-1507, 1.0 mg / mL]. After the 1-hour incubation period, the membrane was washed with TBS-T buffer (4 × 7-minute washes for 7 minutes each). The membrane was then incubated with secondary antibody [Life Technologies, goat anti-mouse IgG, (H+L), HRP conjugate, catalog #16066] for 1 h at room temperature, followed by six washes with TBS-T (6 × 5 min) and then one wash with TBS (5 min). The resulting membrane was incubated with ECL reagent (SUPERSIGNAL WEST PICO AND FEMTO MIX, Thermo Scientific, catalog #34080 and 34095) for 3–4 min and then incubated with Chemidoc-It. 2 Exposure was carried out under white light inside the imaging system. [Example]

[0485] Example A Template cloning example pIDT-SMART(Kan) (1962 bp, IDT DNA) was modified by point mutation to remove NotI and MluI restriction sites. At the EcoRV site, the resulting plasmid was inserted with a 1226 bp DNA fragment containing the following DNA elements: stuffer DNA + T7 RNA promoter, 5' UTR from tobacco etch virus (TEV), human EPO ORF, sequence containing the 3' UTR from the Xenopus beta globin (XbG) gene, polyA120, and BspQI restriction enzyme site + T7 terminator + stuffer DNA.

[0486] The resulting parental plasmid (pIDT-SMART-T7-TEV-hEPO-XbG-pA120) had a total length of 3188 bp. The parental plasmid was used to clone alternative ORFs.

[0487] Constructs containing the TEV 5'UTR were constructed as follows: For the Fluc, hEPO, and cmEPO constructs, the plasmid was linearized with NcoI and XhoI, and a synthesized ORF DNA fragment containing NcoI and XhoI sites was inserted using T4 DNA ligase. For the hAdipo, hAAT, and F9 constructs, the synthesized ORF DNA fragment contained 20-25 bp of plasmid sequence flanking the designed ORF and was cloned into the same linearized plasmid by seamless cloning.

[0488] The SynK-cmEPO-XbG plasmid construct was generated by synthesizing DNA fragments containing the SynK 5'UTR and cmEPO ORF with AflII and XhoI sites, which were then cloned with T4 DNA ligase into the parent plasmid linearized with AflII and XhoI.

[0489] Examples of hEPO constructs are shown in Table 4.

[0490] [Table 4]

[0491] The nucleotide T and GC composition of the wild-type protein coding sequence is shown in Table 5.

[0492] [Table 5]

[0493] Example B hEPO template and mRNA Figure 4 shows the results of surprisingly increased human EPO protein production for the translatable molecules of the present invention. Human EPO ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand, along with a reduced complementary deoxythymidine nucleotide (reduced T) in the non-template strand. Synthesis with 5-methoxyuridine (5MeOu, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOu) compared to wild-type mRNA with a similar reduced T.

[0494] Figure 4 shows the surprisingly high translation efficiency of ARC-mRNA(5MeOU) compared to wild-type hEPO mRNA(UTP). First, ARC-mRNA(5MeOU) showed superior expression efficiency at all levels of template T composition compared to hEPO mRNA(UTP).

[0495] Furthermore, Figure 4 shows that the ARC-mRNA(5MeOU) product showed unexpectedly superior expression efficiency at levels of 13–16% of the template T composition compared to either wild-type or “reduced T” hEPO mRNA(UTP).

[0496] Furthermore, when codon substitutions were randomized, ARC-mRNA (5MeOU) showed unexpectedly excellent expression efficiency at a 14% template T composition.

[0497] The composition of the hEPO template is shown in Table 6.

[0498] [Table 6]

[0499] See human EPO ORF. Sense strand, non-template. NM_000799.3:182-763 CDS Homo sapiens erythropoietin. (SEQ ID NO: 8) atgggggtgcacgaatgtcctgcctggctgtggcttctcctgtccctgctgtcgctccctctgggcctcccagtcctgggcgccccaccacgcctcatctgtgacagccgagtcctggagaggtacctcttggaggccaaggagg ccgagaatatcacgacgggctgtgctgaacactgcagcttgaatgagaatatcactgtcccagacaccaaagttaatttctatgcctggaagaggatggaggtcgggcagcaggccgtagaagtctggcagggcctggccctgctg tcggaagctgtcctgcggggccaggccctgttggtcaactcttcccagccgtgggagcccctgcagctgcatgtggataaagccgtcagtggccttcgcagcctcaccactctgcttcgggctctgggagcccagaaggaagcca tctcccctccagatgcggcctcagctgctccactccgaacaatcactgctgacactttccgcaaactcttccgagtctactccaatttcctccggggaaagctgaagctgtacacaggggaggcctgcaggacaggggacagatga

[0500] (SEQ ID NO: 9) hEPO sense strand, non-template. 3'-lowest_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCCGACACCTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0501] (SEQ ID NO: 10) hEPO sense strand, non-template. 3'-14%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCCGACACCTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0502] (SEQ ID NO: 11) hEPO sense strand, non-template. 3’_16%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCCGACACCTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0503] (SEQ ID NO: 12) hEPO sense strand, non-template. 3'_18%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCCGACACCTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0504] (SEQ ID NO: 13) hEPO sense strand, non-template. 3’_20%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0505] (SEQ ID NO: 14) hEPO sense strand, non-template. 5’_14%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0506] (SEQ ID NO: 15) hEPO sense strand, non-template. 5’_16%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0507] (SEQ ID NO: 16) hEPO sense strand, non-template. 5’_18%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0508] (SEQ ID NO: 17) hEPO sense strand, non-template. 5’_20%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0509] (SEQ ID NO: 18) hEPO sense strand, non-template. Random_14%_T. ATGGGGGTGCACGAATGCCCTGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCTTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCTCCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCTGACACCTTCCGCAAACTCTTCCGAGTCTACTCCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0510] (SEQ ID NO: 19) hEPO sense strand, non-template. Random_16%_T. ATGGGGGTGCACGAATGTCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCCGAACACTGCAGCTTGAACGAGAATATCACCGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGATAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCTCTGGGAGCCCAGAAGGAAGCCATCAGCCCTCCAGATGCGGCCAGCGCCGCTCCACTCCGAACAATCACCGCCGACACTTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA S

[0511] S S (SEQ ID NO: 20) hEPO sense strand, non-template. Random_18%_T. SATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGAGCCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCTGAACACTGCAGCCTGAATGAGAATATCACTGTCCCAGACACCAAAGTGAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGTTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCCCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGACGCGGCCTCAGCTGCCCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACAGCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0512] (SEQ ID NO: 21) hEPO sense strand, non-template. Random_20%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGCTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0513] (SEQ ID NO: 22) TEV-hEPO-XbG sense strand, non-template. 3'-minimum_T (1014 nt).

[0514] (SEQ ID NO: 23) TEV-hEPO-XbG sense strand, non-template. 3'_14%_T (1014 nt).

[0515] (SEQ ID NO: 24) TEV-hEPO-XbG sense strand, non-template. 3'_16%_T (1014 nt).

[0516] (SEQ ID NO: 25) TEV-hEPO-XbG sense strand, non-template. 3'_18%_T (1014 nt).

[0517] (SEQ ID NO: 26) TEV-hEPO-XbG sense strand, non-template. 3'_20%_T (1014 nt).

[0518] (SEQ ID NO: 27) TEV-hEPO-XbG sense strand, non-template. 5'_14%_T (1014 nt).

[0519] (SEQ ID NO: 28) TEV-hEPO-XbG sense strand, non-template. 5'_16%_T (1014 nt).

[0520] (SEQ ID NO: 29) TEV-hEPO-XbG sense strand, non-template. 5'_18%_T (1014 nt).

[0521] (SEQ ID NO: 30) TEV-hEPO-XbG sense strand, non-template. 5'_20%_T (1014 nt).

[0522] (SEQ ID NO: 31) TEV-hEPO-XbG sense strand, non-template. Random_14%_T (1014 nt).

[0523] (SEQ ID NO: 32) TEV-hEPO-XbG sense strand, non-template. Random_16%_T (1014 nt).

[0524] (SEQ ID NO: 33) TEV-hEPO-XbG sense strand, non-template. Random_18%_T (1014 nt).

[0525] (SEQ ID NO: 34) TEV-hEPO-XbG sense strand, non-template. Random_20%_T (1014 nt).

[0526] (Allocation number 35) TEV-hEPO-XbG ARC-mRNA. 3' Minimum T (10¹⁴ nt).

[0527] (SEQ ID NO: 36) TEV-hEPO-XbG ARC-mRNA. 3'_14%_T (1014 nt).

[0528] (SEQ ID NO: 37) TEV-hEPO-XbG ARC-mRNA. 3'_16%_T (1014 nt).

[0529] (SEQ ID NO: 38) TEV-hEPO-XbG ARC-mRNA. 3'_18%_T (1014 nt).

[0530] (SEQ ID NO: 39) TEV-hEPO-XbG ARC-mRNA. 3'_20%_T (1014 nt).

[0531] (SEQ ID NO: 40) TEV-hEPO-XbG ARC-mRNA. 5'_14%_T (1014 nt).

[0532] (SEQ ID NO: 41) TEV-hEPO-XbG ARC-mRNA. 5'_16%_T (1014 nt).

[0533] (SEQ ID NO: 42) TEV-hEPO-XbG ARC-mRNA. 5'_18%_T (1014 nt).

[0534] (SEQ ID NO: 43) TEV-hEPO-XbG ARC-mRNA. 5'_20%_T (1014 nt).

[0535] (SEQ ID NO: 44) TEV-hEPO-XbG ARC-mRNA. Random_14%_T (1014 nt).

[0536] (SEQ ID NO: 45) TEV-hEPO-XbG ARC-mRNA. Random_16%_T(1014nt).

[0537] (SEQ ID NO: 46) TEV-hEPO-XbG ARC-mRNA. Random_18%_T(1014nt).

[0538] (SEQ ID NO: 47) TEV-hEPO-XbG ARC-mRNA. Random_20%_T(1014nt).

[0539] Example C hF9 template and mRNA Figure 5 shows the results of surprisingly increased human F9 protein production for the translatable molecules of the present invention. Human F9 ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand, along with a reduced complementary deoxythymidine nucleotide ("reduced T") in the non-template strand. Synthesis with 5-methoxyuridine (5MeOu, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOu) compared to wild-type mRNA with a similar reduced T.

[0540] Figure 5 shows the surprisingly high translation efficiency of ARC-mRNA(5MeOU) compared to wild-type hF9 mRNA(UTP). First, Figure 5 shows that the ARC-mRNA(5MeOU) product exhibited surprisingly excellent expression efficiency at a template T composition of 13-14%. Because neither wild-type nor "reduced T" hEPO mRNA(UTP) increased at lower levels of template T composition, the increased expression efficiency of ARC-mRNA(5MeOU) at lower levels of template T composition of 13-14% is unexpectedly advantageous.

[0541] Furthermore, Figure 5 shows that when codon replacement was performed randomly, ARC-mRNA (5MeOU) showed unexpectedly excellent expression efficiency at a template T composition of 14 to 16%.

[0542] Figure 6 shows the results of surprisingly reduced impurity levels in the process for synthesizing hF9 translatable molecules of the present invention. Figure 6 shows the results of a dot blot for detecting double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The ARC-RNA(5MeOU) "reduced T" synthesis product, which is translatable for hF9, showed surprisingly reduced dot blot intensity compared to the similar "reduced T" mRNA(UTP) synthesis product. Thus, the ARC-RNA(5MeOU) synthesis process with a reduced T composition of the template surprisingly reduced the double-stranded RNA impurity level in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention with a reduced T composition of the template provided surprisingly reduced levels of double-stranded RNA impurities. This result is surprising because, as shown in Figure 6, the "reduced T" mRNA(UTP) synthesis product showed increased levels of double-stranded RNA impurities at lower template T compositions.

[0543] The template composition of hF9 is shown in Table 7.

[0544] [Table 7]

[0545] See human F9 ORF. Sense strand, non-template. NM_000133.3:30-1415 CDS Homo sapiens clotting factor IX. (SEQ ID NO: 48)

[0546] (SEQ ID NO: 49) hF9 sense strand, non-template. 3'-lowest-T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACATCACGACGGGCTGCGCCGAACACTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGAGCGAAGCCGTCCTGCGGGGCCAGGCCCTGCTGGTCAACAGCAGCCAGCCGTGGGAGCCCCTGCAGCTGCACGTGGACAAAGCCGTCAGCGGCCTGCGCAGCCTCACCACCCTGCTGCGGGCCCTGGGAGCCCAGAAGGAAGCCATCAGCCCCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACAATCACCGCCGACACCTTCCGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGA

[0547] (SEQ ID NO: 50) hF9 sense strand, non-template. 3'-lowest-T.

[0548] (SEQ ID NO: 51) hF9 sense strand, non-template. 3'_14%_T.

[0549] (SEQ ID NO: 52) hF9 sense strand, non-template. 3'_16%_T.

[0550] (SEQ ID NO: 53) hF9 sense strand, non-template. 3'_18%_T.

[0551] (SEQ ID NO: 54) hF9 sense strand, non-template. 3'_20%_T.

[0552] (SEQ ID NO: 55) hF9 sense strand, non-template. 5'_14%_T.

[0553] (SEQ ID NO: 56) hF9 sense strand, non-template. 5'_16%_T.

[0554] (SEQ ID NO: 57) hF9 sense strand, non-template. 5'_18%_T.

[0555] (SEQ ID NO: 58) hF9 sense strand, non-template. 5'_20%_T.

[0556] (SEQ ID NO: 59) hF9 sense strand, non-template. Random_14%_T.

[0557] (SEQ ID NO: 60) hF9 sense strand, non-template. Random_16%_T.

[0558] (SEQ ID NO: 61) hF9 sense strand, non-template. Random_18%_T.

[0559] (SEQ ID NO: 62) hF9 sense strand, non-template. Random_20%_T.

[0560] (SEQ ID NO: 63) TEV-hF9-XbG sense strand, non-template. 3'_lowest_T. (1818 nt)

[0561] (SEQ ID NO: 64) TEV-hF9-XbG sense strand, non-template. 3'_14%_T. (1818 nt)

[0562] (SEQ ID NO: 65) TEV-hF9-XbG sense strand, non-template. 3'_16%_T. (1818 nt)

[0563] (SEQ ID NO: 66) TEV-hF9-XbG sense strand, non-template. 3'_18%_T. (1818 nt)

[0564] (SEQ ID NO: 67) TEV-hF9-XbG sense strand, non-template. 3'_20%_T. (1818 nt)

[0565] (SEQ ID NO: 68) TEV-hF9-XbG sense strand, non-template. 5'_14%_T. (1818 nt)

[0566] (SEQ ID NO: 69) TEV-hF9-XbG sense strand, non-template. 5'_16%_T. (1818 nt)

[0567] (SEQ ID NO: 70) TEV-hF9-XbG sense strand, non-template. 5'_18%_T. (1818 nt)

[0568] (SEQ ID NO: 71) TEV-hF9-XbG sense strand, non-template. 5'_20%_T. (1818 nt)

[0569] (SEQ ID NO: 72) TEV-hF9-XbG sense strand, non-template. Random_14%_T. (1818 nt)

[0570] (SEQ ID NO: 73) TEV-hF9-XbG sense strand, non-template. Random_16%_T. (1818 nt)

[0571] (SEQ ID NO: 74) TEV-hF9-XbG sense strand, non-template. Random_18%_T. (1818 nt)

[0572] (SEQ ID NO: 75) TEV-hF9-XbG sense strand, non-template. Random_20%_T. (1818 nt)

[0573] (Allocation number 76) TEV-hF9-XbG ARC-mRNA. 3' Minimum T. (1818nt)

[0574] (SEQ ID NO: 77) TEV-hF9-XbG ARC-mRNA. 3'_14%_T. (1818 nt)

[0575] (SEQ ID NO: 78) TEV-hF9-XbG ARC-mRNA. 3'_16%_T. (1818 nt)

[0576] (SEQ ID NO: 79) TEV-hF9-XbG ARC-mRNA. 3'_18%_T. (1818nt)

[0577] (SEQ ID NO: 80) TEV-hF9-XbG ARC-mRNA. 3'_20%_T. (1818 nt)

[0578] (SEQ ID NO: 81) TEV-hF9-XbG ARC-mRNA. 5'_14%_T. (1818nt)

[0579] (SEQ ID NO: 82) TEV-hF9-XbG ARC-mRNA. 5'_16%_T. (1818 nt)

[0580] (SEQ ID NO: 83) TEV-hF9-XbG ARC-mRNA. 5'_18%_T. (1818nt)

[0581] (SEQ ID NO: 84) TEV-hF9-XbG ARC-mRNA. 5'_20%_T. (1818 nt)

[0582] (SEQ ID NO: 85) TEV-hF9-XbG ARC-mRNA. Random_14%_T. (1818 nt)

[0583] (SEQ ID NO: 86) TEV-hF9-XbG ARC-mRNA. Random_16%_T. (1818 nt)

[0584] (SEQ ID NO: 87) TEV-hF9-XbG ARC-mRNA. Random_18%_T. (1818 nt)

[0585] (SEQ ID NO: 88) TEV-hF9-XbG ARC-mRNA. Random_20%_T. (1818 nt)

[0586] Example D Human alpha-1-antitrypsin (hAAT) template and mRNA Figure 7 shows the results of surprisingly reduced impurity levels in the process for synthesizing hAAT translatable molecules of the present invention. Figure 7 shows the results of dot blots for detecting double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The ARC-RNA(5MeOU) "reduced T" synthesis product, which is translatable for hAAT, showed surprisingly reduced dot blot intensity compared to the similar "reduced T" mRNA(UTP) synthesis product. Thus, the ARC-RNA(5MeOU) synthesis process with a reduced T composition of the template surprisingly reduced the double-stranded RNA impurity level in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention with a reduced T composition of the template provided surprisingly reduced levels of double-stranded RNA impurities. As shown in Figure 7, this result is surprising because the "reduced T" mRNA(UTP) synthesis product showed increased levels of double-stranded RNA impurities at lower template T compositions.

[0587] The composition of the hAAT template is shown in Table 8.

[0588] [Table 8]

[0589] See human AAT ORF. Sense strand, non-template. NM_000295.4:262-1518 Homo sapiens serpin family A member 1 (SERPINA1). (SEQ ID NO: 89)

[0590] (SEQ ID NO: 90) hAAT sense strand, non-template. 3'_lowest_T.

[0591] (SEQ ID NO: 91) hAAT sense strand, non-template. 3'_16%_T.

[0592] (SEQ ID NO: 92) hAAT sense strand, non-template. 3'_18%_T.

[0593] (SEQ ID NO: 93) hAAT sense strand, non-template. 3'_20%_T.

[0594] (SEQ ID NO: 94) hAAT sense strand, non-template. 5'_16%_T

[0595] (SEQ ID NO: 95) hAAT sense strand, non-template. 5'_18%_T

[0596] (SEQ ID NO: 96) hAAT sense strand, non-template. 5'_20%_T.

[0597] (SEQ ID NO: 97) hAAT sense strand, non-template. Random_16%_T.

[0598] (SEQ ID NO: 98) hAAT sense strand, non-template. Random_18%_T.

[0599] (SEQ ID NO: 99) hAAT sense strand, non-template. Random_20%_T.

[0600] (Layout No. 100) TEV-hAAT-XbG center lock, non-cast type. 3' Minimum T. (1689nt)

[0601] (SEQ ID NO: 101) TEV-hAAT-XbG sense strand, non-template. 3'_16%_T. (1689 nt)

[0602] (SEQ ID NO: 102) TEV-hAAT-XbG sense strand, non-template. 3'_18%_T. (1689 nt)

[0603] (SEQ ID NO: 103) TEV-hAAT-XbG sense strand, non-template. 3'_20%_T. (1689 nt)

[0604] (SEQ ID NO: 104) TEV-hAAT-XbG sense strand, non-template. 5'_16%_T. (1689 nt)

[0605] (SEQ ID NO: 105) TEV-hAAT-XbG sense strand, non-template. 5'_18%_T. (1689 nt)

[0606] (SEQ ID NO: 106) TEV-hAAT-XbG sense strand, non-template. 5'_20%_T. (1689 nt)

[0607] (SEQ ID NO: 107) TEV-hAAT-XbG sense strand, non-template. Random_16%_T. (1689 nt)

[0608] (SEQ ID NO: 108) TEV-hAAT-XbG sense strand, non-template. Random_18%_T. (1689 nt)

[0609] (SEQ ID NO: 109) TEV-hAAT-XbG sense strand, non-template. Random_20%_T. (1689 nt)

[0610] (Layout No. 110) TEV-hAAT-XbG ARC-mRNA. 3' Minimum T. (1689nt)

[0611] (Pairing number 111) TEV-hAAT-XbG ARC-mRNA. 3'_16%_T. (1689nt)

[0612] (Pairing number 112) TEV-hAAT-XbG ARC-mRNA. 3'_18%_T. (1689nt)

[0613] (Pairing number 113) TEV-hAAT-XbG ARC-mRNA. 3'_20%_T. (1689nt)

[0614] (Pairing number 114) TEV-hAAT-XbG ARC-mRNA. 5'_16%_T. (1689nt)

[0615] (Pairing number 115) TEV-hAAT-XbG ARC-mRNA. 5'_18%_T. (1689nt)

[0616] (Pairing number 116) TEV-hAAT-XbG ARC-mRNA. 5'_20%_T. (1689nt)

[0617] (SEQ ID NO: 117) TEV-hAAT-XbG ARC-mRNA. Random_16%_T. (1689 nt)

[0618] (SEQ ID NO: 118) TEV-hAAT-XbG ARC-mRNA. Random_18%_T. (1689 nt)

[0619] (SEQ ID NO: 119) TEV-hAAT-XbG ARC-mRNA. Random_20%_T. (1689 nt)

[0620] Example E Human adiponectin (hAdipo) template and mRNA Figure 8 shows the results of surprisingly increased human adiponectin protein production for the translatable molecules of the present invention. Human adiponectin ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand, along with a reduced complementary deoxythymidine nucleotide ("reduced T") in the non-template strand. Synthesis with 5-methoxyuridine (5MeOu, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOu) compared to wild-type mRNA with a similar reduced T.

[0621] Figure 8 shows the surprisingly high translation efficiency of ARC-mRNA(5MeOU) compared to wild-type hAdipo mRNA(UTP). First, ARC-mRNA(5MeOU) showed superior expression efficiency at all levels of template T composition compared to hAdipo mRNA(UTP). Furthermore, ARC-mRNA(5MeOU) showed unexpectedly superior expression efficiency at all levels of template T composition compared to hAdipo mRNA(N1MPU).

[0622] Furthermore, Figure 8 shows that the ARC-mRNA(5MeOU) product exhibited excellent expression efficiency at a template T composition of 12-14%. The increased expression efficiency of ARC-mRNA(5MeOU) at a lower template T composition of 12-14% was unexpectedly advantageous because "reduced T" hAdipo mRNA(UTP) did not increase at lower template T compositions.

[0623] In addition, Figure 8 shows that the translation efficiency of ARC-RNA (5MeOU) also increased with N 1The results show that the expression levels were surprisingly higher compared to a similar RNA, WT human adiponectin mRNA (N1MPU), made with -methylpseudouridine (100%).

[0624] Figure 9 shows the results of surprisingly reduced impurity levels in the process for synthesizing hAdipo translatable molecules of the present invention. Figure 9 shows the results of a dot blot to detect double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The ARC-RNA(5MeOU) "reduced T" synthesis product, which is translatable for hAdipo, showed surprisingly reduced dot blot intensity compared to the similar "reduced T" mRNA(UTP) synthesis product. Thus, the ARC-RNA(5MeOU) synthesis process with a reduced T composition of the template surprisingly reduced the level of double-stranded RNA impurities in the synthesis mixture. The process for synthesizing ARC-RNA(5MeOU) molecules of the present invention with a reduced T composition of the template provided surprisingly reduced levels of double-stranded RNA impurities. This result is surprising because, as shown in Figure 9, the "reduced T" mRNA(UTP) synthesis product showed increased levels of double-stranded RNA impurities at lower template T compositions.

[0625] The composition of the hAdipo template is shown in Table 9.

[0626] [Table 9]

[0627] Human Adipo ORF reference. Sense strand, non-template. NM_001177800.1:136-870 Homo sapiens adiponectin, (ADIPOQ), containing C1Q and collagen domains. (SEQ ID NO: 120) atgctgttgctgggagctgttctactgctattagctctgcccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcccctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatccgggccataatggggccccaggccgtgatggcagagatggcacccctggtgagaagggtgagaaaggagatccaggtcttattggtcctaagggagacatcggtgaaaccggagtacccggggctgaaggtccccgaggctttccgggaatccaaggcaggaaaggagaacctggagaaggtgcctatgtataccgctcagcattcagtgtgggattggagacttacgttactatccccaacatgcccattcgctttaccaagatcttctacaatcagcaaaaccactatgatggctccactggtaaattccactgcaacattcctgggctgtactactttgcctaccacatcacagtctatatgaaggatgtgaaggtcagcctcttcaagaaggacaaggctatgctcttcacctatgatcagtaccaggaaaataatgtggaccaggcctccggctctgtgctcctgcatctggaggtgggcgaccaagtctggctccaggtgtatggggaaggagagcgtaatggactctatgctgataatgacaatgactccaccttcacaggctttcttctctaccatgacaccaactga

[0628] (SEQ ID NO: 121) hAdipo sense strand, non-template. 3'_lowest_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGCTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAACGGGGCCCCAGGCCGGGACGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGACCCAGGCCTGATCGGCCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTCGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0629] (SEQ ID NO: 122) hAdipo sense strand, non-template. 3’_14%_T. ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAACGGGGCCCCAGGCCGGGACGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGACCCAGGCCTGATCGGCCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTCGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0630] (SEQ ID NO: 123) hAdipo sense strand, non-template. 3’_16%_T. ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTCGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0631] (SEQ ID NO: 124) hAdipo sense strand, non-template. 3’_18%_T. ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTCGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0632] (SEQ ID NO: 125) hAdipo sense strand, non-template. 3’_20%_T. ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0633] (SEQ ID NO: 126) hAdipo sense strand, non-template. 5’_14%_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGCTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAACGGGGCCCCAGGCCGGGACGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGACCCAGGCCTGATCGGCCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTCGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

[0634] (SEQ ID NO: 127) hAdipo sense strand, non-template. 5’_16%_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGCTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAACGGGGCCCCAGGCCGGGACGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGACCCAGGCCTGATCGGCCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

[0635] (SEQ ID NO: 128) hAdipo sense strand, non-template. 5’_18%_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGCTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAACGGGGCCCCAGGCCGGGACGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGACCCAGGCCTGATCGGCCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

[0636] (SEQ ID NO: 129) hAdipo sense strand, non-template. 5’_20%_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGCTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAACGGGGCCCCAGGCCGGGACGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

[0637] (SEQ ID NO: 130) hAdipo sense strand, non-template. Random_14%_T. ATGCTGTTGCTGGGAGCCGTGCTACTGCTACTGGCCCTGCCCGGCCACGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCACCCGGGCCACAATGGGGCCCCAGGCCGGGATGGCAGAGACGGCACCCCCGGCGAGAAGGGCGAGAAAGGAGATCCAGGCCTGATCGGTCCCAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTATGTATACCGCAGCGCATTCAGTGTGGGATTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGCAAATTCCACTGCAACATCCCCGGGCTGTACTACTTTGCCTACCACATCACAGTCTACATGAAGGACGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGACCAGTACCAGGAAAACAACGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGTAACGGACTCTACGCCGACAACGACAACGACAGCACCTTCACAGGCTTCCTGCTCTACCACGACACCAACTGA

[0638] (SEQ ID NO: 131) hAdipo sense strand, non-template. Random_16%_T. ATGCTGCTGCTGGGAGCCGTGCTACTGCTACTGGCTCTGCCCGGTCACGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAACGGGGCCCCAGGCCGGGATGGCAGAGACGGCACCCCTGGCGAGAAGGGTGAGAAAGGAGACCCAGGCCTGATCGGCCCTAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCCGAAGGCCCCCGAGGCTTCCCGGGAATCCAAGGCAGGAAAGGAGAACCCGGAGAAGGCGCCTATGTATACCGCAGCGCATTCAGTGTGGGATTGGAGACTTACGTTACCATCCCCAACATGCCCATTCGCTTCACCAAGATCTTCTACAACCAGCAAAACCACTACGACGGCAGCACCGGTAAATTCCACTGCAACATCCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTACGATCAGTACCAGGAAAATAATGTGGACCAGGCCAGCGGCAGCGTGCTCCTGCACCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGGAACGGACTCTACGCCGACAACGACAATGACAGCACCTTCACAGGCTTCCTGCTCTACCATGACACCAACTGA

[0639] (SEQ ID NO: 132) hAdipo sense strand, non-template. Random_18%_T. ATGCTGTTGCTGGGAGCCGTTCTACTGCTACTGGCTCTGCCCGGCCATGACCAGGAAACCACGACCCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCACCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGACGGCACCCCCGGCGAGAAGGGTGAGAAAGGAGATCCAGGTCTGATCGGTCCTAAGGGAGACATCGGCGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGCGCCTACGTATACCGCAGCGCATTCAGCGTGGGACTGGAGACCTACGTGACCATCCCCAACATGCCCATCCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGACGGCTCCACTGGCAAATTCCACTGCAACATTCCCGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCCATGCTGTTCACCTACGATCAGTACCAGGAAAACAATGTGGACCAGGCCAGCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTACGGGGAAGGAGAGCGTAACGGACTCTATGCCGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

[0640] (SEQ ID NO: 133) hAdipo sense strand, non-template. Random_20%_T. ATGCTGTTGCTGGGAGCCGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTGCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGACGGCAGAGATGGCACCCCCGGTGAGAAGGGTGAGAAAGGAGACCCAGGTCTTATTGGCCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGCCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGCGCCTATGTATACCGCAGCGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCAGCACCGGTAAATTCCACTGCAACATCCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTGTTCACCTATGACCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTACGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTGCTCTACCATGACACCAACTGA

[0641] (SEQ ID NO: 134) TEV-hAdipo-XbG sense strand, non-template. 3'_minimum_T. (1167 nt)

[0642] (SEQ ID NO: 135) TEV-hAdipo-XbG sense strand, non-template. 3'_14%_T. (1167 nt)

[0643] (SEQ ID NO: 136) TEV-hAdipo-XbG sense strand, non-template. 3'_16%_T. (1167 nt)

[0644] (SEQ ID NO: 137) TEV-hAdipo-XbG sense strand, non-template. 3'_18%_T. (1167 nt)

[0645] (SEQ ID NO: 138) TEV-hAdipo-XbG sense strand, non-template. 3'_20%_T. (1167 nt)

[0646] (SEQ ID NO: 139) TEV-hAdipo-XbG sense strand, non-template. 5'_14%_T. (1167 nt)

[0647] (SEQ ID NO: 140) TEV-hAdipo-XbG sense strand, non-template. 5'_16%_T. (1167 nt)

[0648] (SEQ ID NO: 141) TEV-hAdipo-XbG sense strand, non-template. 5'_18%_T. (1167 nt)

[0649] (SEQ ID NO: 142) TEV-hAdipo-XbG sense strand, non-template. 5'_20%_T. (1167 nt)

[0650] (SEQ ID NO: 143) TEV-hAdipo-XbG sense strand, non-template. Random_14%_T. (1167 nt)

[0651] (SEQ ID NO: 144) TEV-hAdipo-XbG sense strand, non-template. Random_16%_T. (1167 nt)

[0652] (SEQ ID NO: 145) TEV-hAdipo-XbG sense strand, non-template. Random_18%_T. (1167 nt)

[0653] (SEQ ID NO: 146) TEV-hAdipo-XbG sense strand, non-template. Random_20%_T. (1167 nt)

[0654] (Allocation number 147) TEV-hAdipo-XbG ARC-mRNA. 3' Minimum T. (1167nt)

[0655] (Pairing number 148) TEV-hAdipo-XbG ARC-mRNA. 3'_14%_T. (1167nt)

[0656] (Allocation number 149) TEV-hAdipo-XbG ARC-mRNA. 3'_16%_T. (1167nt)

[0657] (Allocation number 150) TEV-hAdipo-XbG ARC-mRNA. 3'_18%_T. (1167nt)

[0658] (Pairing number 151) TEV-hAdipo-XbG ARC-mRNA. 3'_20%_T. (1167nt)

[0659] (Pairing number 152) TEV-hAdipo-XbG ARC-mRNA. 5'_14%_T. (1167nt)

[0660] (Allocation number 153) TEV-hAdipo-XbG ARC-mRNA. 5'_16%_T. (1167nt)

[0661] (Pairing number 154) TEV-hAdipo-XbG ARC-mRNA. 5'_18%_T. (1167nt)

[0662] (Pairing number 155) TEV-hAdipo-XbG ARC-mRNA. 5'_20%_T. (1167nt)

[0663] (SEQ ID NO: 156) TEV-hAdipo-XbG ARC-mRNA. Random_14%_T. (1167nt)

[0664] (SEQ ID NO: 157) TEV-hAdipo-XbG ARC-mRNA. Random_16%_T. (1167nt)

[0665] (SEQ ID NO: 158) TEV-hAdipo-XbG ARC-mRNA. Random_18%_T. (1167nt)

[0666] (SEQ ID NO: 159) TEV-hAdipo-XbG ARC-mRNA. Random_20%_T. (1167 nt)

[0667] Example F Cynomolgus monkey EPO (cmEPO) template and mRNA Figure 10 shows the results of surprisingly increased cynomolgus monkey EPO protein production for the translatable molecules of the present invention. Cynomolgus monkey EPO ARC-RNA was synthesized using a DNA template with a reduced deoxyadenosine nucleotide in the open reading frame of the template strand and a reduced complementary deoxythymidine nucleotide ("reduced T") in the non-template strand. Synthesis with 5-methoxyuridine (5MeOu, 100%) was also performed. ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagent. Cell culture medium was collected 24 hours after transfection. ELISA was used to detect protein production by ARC-RNA (5MeOu) compared to wild-type mRNA with a similar reduced T.

[0668] Figure 10 shows the surprisingly high translation efficiency of ARC-mRNA(5MeOU) compared to wild-type cmEPO mRNA(UTP). First, Figure 10 shows that the ARC-mRNA(5MeOU) product exhibited surprisingly excellent expression efficiency at template T composition levels of 13-16%. Furthermore, Figure 10 shows that the ARC-mRNA(5MeOU) product exhibited surprisingly excellent expression efficiency compared to cmEPO mRNA(N1MPU) at template T composition levels of 13-16%.

[0669] Furthermore, Figure 10 shows that when codon replacement was performed randomly, ARC-mRNA (5MeOU) showed unexpectedly excellent expression efficiency at a template T composition of 14 to 16%.

[0670] In addition, Figure 10 shows that the translation efficiency of ARC-RNA (5MeOU) also increased with N 1 The results show that the expression of WT cmEPO mRNA (N1MPU) was surprisingly higher than that of a similar RNA produced with -methylpseudouridine (100%).

[0671] The composition of the cmEPO template is shown in Table 10.

[0672] [Table 10]

[0673] See cynomolgus monkey EPO ORF. Sense strand, non-template. NM_001284561.1:220-798 Macaca fascicularis erythropoietin (cmEPO). (SEQ ID NO: 160) atgggggtgcacgaatgtcctgcctggctgtggcttctcctgtctctgctgtcgctccctctgggcctcccagtcccgggcgccccaccacgcctcatctgtgacagccgagtcctggagaggtacctcttggaggccaaggag gccgagaatgtcacgatgggctgttccgaaagctgcagcttgaatgagaatatcaccgtcccagacaccaaagttaacttctatgcctggaagaggatggaggtcgggcagcaggctgtagaagtctggcagggcctggccctgc tctcagaagctgtcctgcggggccaggccgtgttggccaactcttcccagcctttcgagcccctgcagctgcacatggataaagccatcagtggccttcgcagcatcaccactctgcttcgggcgctgggagcccaggaagccat ctccctcccagatgcggcctcggctgctccactccgaaccatcactgctgacactttctgcaaactcttccgagtctactccaatttcctccggggaaagctgaagctgtacacgggggaggcctgcaggagaggggacagatga

[0674] (SEQ ID NO: 161) cmEPO sense strand, non-template. 3'_lowest_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0675] (SEQ ID NO: 162) cmEPO sense strand, non-template. 3'_14%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0676] (SEQ ID NO: 163) cmEPO sense strand, non-template. 3’_16%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCTCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATGTCACGATGGGCTGTTCCGAAAGCTGCAGCTTGAATGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0677] (SEQ ID NO: 164) cmEPO sense strand, non-template. 3'_18%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCTCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATGTCACGATGGGCTGTTCCGAAAGCTGCAGCTTGAATGAGAATATCACCGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCTGTCCTGCGGGGCCAGGCCGTGTTGGCCAACTCTTCCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0678] (SEQ ID NO: 165) cmEPO sense strand, non-template. 3’_20%_T. ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCTCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATGTCACGATGGGCTGTTCCGAAAGCTGCAGCTTGAATGAGAATATCACCGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCTGTCCTGCGGGGCCAGGCCGTGTTGGCCAACTCTTCCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGTGGCCTTCGCAGCATCACCACTCTGCTTCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCTCGGCTGCTCCACTCCGAACCATCACTGCTGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0679] (SEQ ID NO: 166) cmEPO sense strand, non-template. 5’_14%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0680] (SEQ ID NO: 167) cmEPO sense strand, non-template. 5’_16%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGTGGCCTTCGCAGCATCACCACTCTGCTTCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCTCGGCTGCTCCACTCCGAACCATCACTGCTGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0681] (SEQ ID NO: 168) cmEPO sense strand, non-template. 5’_18%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAATATCACCGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCTGTCCTGCGGGGCCAGGCCGTGTTGGCCAACTCTTCCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGTGGCCTTCGCAGCATCACCACTCTGCTTCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCTCGGCTGCTCCACTCCGAACCATCACTGCTGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA [[ID=跟2]]

[0682] (SEQ ID NO: 169) cmEPO sense strand, non-template. 5’_20%_T. It should be noted that in the original text, there is a misspelling in "[[ID=跟2]]", which should be "". The above translation is based on the corrected content.ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGTCTCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATGTCACGATGGGCTGTTCCGAAAGCTGCAGCTTGAATGAGAATATCACCGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCTGTCCTGCGGGGCCAGGCCGTGTTGGCCAACTCTTCCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGTGGCCTTCGCAGCATCACCACTCTGCTTCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCTCGGCTGCTCCACTCCGAACCATCACTGCTGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0683] (SEQ ID NO: 170) cmEPO sense strand, non-template. Random_14%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAATATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0684] (SEQ ID NO: 171) cmEPO sense strand, non-template. Random_16%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTTCTCCTGAGCCTGCTGTCGCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCTCCGAAAGCTGCAGCTTGAATGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGCGGCCTTCGCAGCATCACCACTCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCAGCGCTGCCCCACTCCGAACCATCACTGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0685] (SEQ ID NO: 172) cmEPO sense strand, non-template. Random_18%_T. ATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTTCTCCTGTCTCTGCTGAGCCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGTTCCGAAAGCTGCAGCTTGAACGAGAATATCACCGTCCCAGACACCAAAGTGAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGTTGGCCAACAGCTCCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGTGGCCTGCGCAGCATCACCACTCTGCTTCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCAGCGCTGCTCCACTCCGAACCATCACTGCTGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0686] (SEQ ID NO: 173) cmEPO sense strand, non-template. Random_20%_T. ATGGGGGTGCACGAATGCCCTGCCTGGCTGTGGCTTCTCCTGTCTCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATGTCACGATGGGCTGTTCCGAAAGCTGCAGCCTGAATGAGAATATCACCGTCCCAGACACCAAAGTTAACTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCTGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCTCAGAAGCTGTCCTGCGGGGCCAGGCCGTGTTGGCCAACTCTTCCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGATAAAGCCATCAGTGGCCTTCGCAGCATCACCACTCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCTCCCTCCCAGATGCGGCCTCGGCTGCTCCACTCCGAACCATCACTGCTGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGA

[0687] (SEQ ID NO: 174) Sense strand of SynK-cmEPO-XbG, non-template. 3’_minimum_T. (913 nt) AGGAAACTTAAGAACTTAAAAAAAAAAATCAAAATGGCCGCCACCATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGACTCGAGCTAGTGACTGACTAGGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTACAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACATTCTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0688] (SEQ ID NO: 175) Sense strand of SynK-cmEPO-XbG, non-template. 3’_14%_T. (913 nt) AGGAAACTTAAGAACTTAAAAAAAAAAATCAAAATGGCCGCCACCATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGACTCGAGCTAGTGACTGACTAGGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTACAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACATTCTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0689] (SEQ ID NO: 176) SynK-cmEPO-XbG sense strand, non-template. 5’_14%_T. (913 nt) AGGAAACTTAAGAACTTAAAAAAAAAAATCAAAATGGCCGCCACCATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCCCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAACATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCCTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACTTTCTGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGACTCGAGCTAGTGACTGACTAGGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTACAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACATTCTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0690] (SEQ ID NO: 177) SynK-cmEPO-XbG sense strand, non-template. Random_14%_T. (913 nt) AGGAAACTTAAGAACTTAAAAAAAAAAATCAAAATGGCCGCCACCATGGGGGTGCACGAATGCCCCGCCTGGCTGTGGCTGCTCCTGAGCCTGCTGAGCCTCCCTCTGGGCCTCCCAGTCCCGGGCGCCCCACCACGCCTCATCTGCGACAGCCGAGTCCTGGAGAGGTACCTCCTGGAGGCCAAGGAGGCCGAGAACGTCACGATGGGCTGCAGCGAAAGCTGCAGCCTGAACGAGAATATCACCGTCCCAGACACCAAAGTGAACTTCTACGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTCAGCGAAGCCGTCCTGCGGGGCCAGGCCGTGCTGGCCAACAGCAGCCAGCCTTTCGAGCCCCTGCAGCTGCACATGGACAAAGCCATCAGCGGCCTGCGCAGCATCACCACCCTGCTGCGGGCGCTGGGAGCCCAGGAAGCCATCAGCCTCCCAGACGCGGCCAGCGCCGCCCCACTCCGAACCATCACCGCCGACACCTTCTGCAAACTCTTCCGAGTCTACAGCAACTTCCTCCGGGGAAAGCTGAAGCTGTACACGGGGGAGGCCTGCAGGAGAGGGGACAGATGACTCGAGCTAGTGACTGACTAGGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTACAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACATTCTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0691] (Allocation number 178) SynK-cmEPO-XbG ARC-mRNA. 3' Minimum T. (913nt) 5'-cap-AGGAAACUUAAGAACUUAAAAAAAAAAAUCAAAAUGGCCGCCACCAUGGGGGUGCACGAAUGCCCCGCCUGGCUGUGGCUGCUCCUGAGCCUGCUGAGCCUCCCCCUGGGCCUCCCAGUCCCGGGCGCCCCACCACGCCUCAUCUGCGACAGCCGAGUCCUGGAGAGGUACCUCCUGGAGGCCAAGGAGGCCGAGAACGUCACGAUGGGCUGCAGCGAAAGCUGCAGCCUGAACGAGAACAUCACCGUCCCAGACACCAAAGUGAACUUCUACGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUCAGCGAAGCCGUCCUGCGGGGCCAGGCCGUGCUGGCCAACAGCAGCCAGCCCUUCGAGCCCCUGCAGCUGCACAUGGACAAAGCCAUCAGCGGCCUGCGCAGCAUCACCACCCUGCUGCGGGCGCUGGGAGCCCAGGAAGCCAUCAGCCUCCCAGACGCGGCCAGCGCCGCCCCACUCCGAACCAUCACCGCCGACACCUUCUGCAAACUCUUCCGAGUCUACAGCAACUUCCUCCGGGGAAAGCUGAAGCUGUACACGGGGGAGGCCUGCAGGAGAGGGGACAGAUGACUCGAGCUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0692] (Array number 179) SynK-cmEPO-XbG ARC-mRNA. 3’_14%_T. (913nt) 5'-cap-AGGAAACUUAAGAACUUAAAAAAAAAAAUCAAAAUGGCCGCCACCAUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGAGCCUGCUGAGCCUCCCCCUGGGCCUCCCAGUCCCGGGCGCCCCACCACGCCUCAUCUGCGACAGCCGAGUCCUGGAGAGGUACCUCCUGGAGGCCAAGGAGGCCGAGAACGUCACGAUGGGCUGCAGCGAAAGCUGCAGCCUGAACGAGAACAUCACCGUCCCAGACACCAAAGUGAACUUCUACGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUCAGCGAAGCCGUCCUGCGGGGCCAGGCCGUGCUGGCCAACAGCAGCCAGCCCUUCGAGCCCCUGCAGCUGCACAUGGACAAAGCCAUCAGCGGCCUGCGCAGCAUCACCACCCUGCUGCGGGCGCUGGGAGCCCAGGAAGCCAUCAGCCUCCCAGACGCGGCCAGCGCCGCCCCACUCCGAACCAUCACCGCCGACACCUUCUGCAAACUCUUCCGAGUCUACAGCAACUUCCUCCGGGGAAAGCUGAAGCUGUACACGGGGGAGGCCUGCAGGAGAGGGGACAGAUGACUCGAGCUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0693] (SEQ ID NO: 180) SynK-cmEPO-XbG ARC-mRNA. 5'_14%_T. (913 nt) 5'-cap-AGGAAACUUAAGAACUUAAAAAAAAAAAUCAAAAUGGCCGCCACCAUGGGGGUGCACGAAUGCCCCGCCUGGCUGUGGCUGCUCCUGAGCCUGCUGAGCCUCCCCCUGGGCCUCCCAGUCCCGGGCGCCCCACCACGCCUCAUCUGCGACAGCCGAGUCCUGGAGAGGUACCUCCUGGAGGCCAAGGAGGCCGAGAACGUCACGAUGGGCUGCAGCGAAAGCUGCAGCCUGAACGAGAACAUCACCGUCCCAGACACCAAAGUGAACUUCUACGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUCAGCGAAGCCGUCCUGCGGGGCCAGGCCGUGCUGGCCAACAGCAGCCAGCCCUUCGAGCCCCUGCAGCUGCACAUGGACAAAGCCAUCAGCGGCCUGCGCAGCAUCACCACCCUGCUGCGGGCGCUGGGAGCCCAGGAAGCCAUCAGCCUCCCAGACGCGGCCAGCGCCGCCCCACUCCGAACCAUCACCGCCGACACUUUCUGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACGGGGGAGGCCUGCAGGAGAGGGGACAGAUGACUCGAGCUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0694] (Array No. 181) SynK-cmEPO-XbG ARC-mRNA. Random_14%_T. (913 nt) 5'-cap-AGGAAACUUAAGAACUUAAAAAAAAAAAUCAAAAUGGCCGCCACCAUGGGGGUGCACGAAUGCCCCGCCUGGCUGUGGCUGCUCCUGAGCCUGCUGAGCCUCCCUCUGGGCCUCCCAGUCCCGGGCGCCCCACCACGCCUCAUCUGCGACAGCCGAGUCCUGGAGAGGUACCUCCUGGAGGCCAAGGAGGCCGAGAACGUCACGAUGGGCUGCAGCGAAAGCUGCAGCCUGAACGAGAAUAUCACCGUCCCAGACACCAAAGUGAACUUCUACGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUCAGCGAAGCCGUCCUGCGGGGCCAGGCCGUGCUGGCCAACAGCAGCCAGCCUUUCGAGCCCCUGCAGCUGCACAUGGACAAAGCCAUCAGCGGCCUGCGCAGCAUCACCACCCUGCUGCGGGCGCUGGGAGCCCAGGAAGCCAUCAGCCUCCCAGACGCGGCCAGCGCCGCCCCACUCCGAACCAUCACCGCCGACACCUUCUGCAAACUCUUCCGAGUCUACAGCAACUUCCUCCGGGGAAAGCUGAAGCUGUACACGGGGGAGGCCUGCAGGAGAGGGGACAGAUGACUCGAGCUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0695] (SEQ ID NO: 182) TEV-cmEPO-XbG sense strand, non-template. 3'_lowest_T. (1011 nt)

[0696] (SEQ ID NO: 183) TEV-cmEPO-XbG sense strand, non-template. 3'_14%_T. (1011 nt)

[0697] (SEQ ID NO: 184) TEV-cmEPO-XbG sense strand, non-template. 5'_14%_T. (1011 nt)

[0698] (SEQ ID NO: 185) TEV-cmEPO-XbG sense strand, non-template. Random_14%_T. (1011 nt)

[0699] (Allocation number 186) TEV-cmEPO-XbG ARC-mRNA. 3' Minimum T. (10¹¹ nt)

[0700] (Partition code 187) TEV-cmEPO-XbG ARC-mRNA. 3'_14%_T. (10¹¹nt)

[0701] (Partition code 188) TEV-cmEPO-XbG ARC-mRNA. 5'_14%_T. (10¹¹nt)

[0702] (SEQ ID NO: 189) TEV-cmEPO-XbG ARC-mRNA. Random_14%_T. (1011 nt)

[0703] Example G Fluc. Photinus luciferase (Fluc+, Promega; Fluc) template and mRNA

[0704] The composition of the Fluc template is shown in Table 11.

[0705] [Table 11]

[0706] See Fluc ORF. Sense strand, non-template. Fluc_plus_pGL3_Promega (U47295.2:88-1740 cloning vector pGL3-Basic). (SEQ ID NO: 190)

[0707] (SEQ ID NO: 191) Fluc sense strand, non-template. Min_T.

[0708] (SEQ ID NO: 192) Fluc sense strand, non-template. 3'_16%_T.

[0709] Example H Reduced impurities in the process for ARC-mRNA Figure 11 shows the results of surprisingly reduced impurity levels in the process for synthesizing mouse EPO translatable molecules of the present invention. Figure 11 shows the results of dot blots to detect double-stranded RNA impurities in the synthesis mixture (nitrocellulose membrane, J2 antibody for detecting dsRNA). The translatable ARC-RNA (5MeOU) synthesis product for mouse EPO showed surprisingly reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MeOU and with a similarly reduced T. Under the same conditions and synthesis, the translatable ARC-RNA (5MC / 5MeOU) synthesis product for mouse EPO also showed surprisingly further reduced dot blot intensity compared to the wild-type mRNA synthesis product without 5MC / 5MeOU. Thus, the ARC-RNA (5MC / 5MeOU) synthesis process with reduced T composition of the template surprisingly reduced the double-stranded RNA impurity level in the synthesis mixture. As shown in Figure 11, similar advantageously reduced double-stranded RNA impurity levels were found in the synthesis mixtures for monkey mAdipo mRNA and mfEPO mRNA.

[0710] The double-stranded RNA impurity levels of mouse EPO for FIG. 11 are shown in Table 12.

[0711] [Table 12]

[0712] The double-stranded RNA impurity levels of mfEPO for FIG. 11 are shown in Table 13.

[0713] [Table 13]

[0714] Example I Reduced immunogenicity of ARC-mRNA Figure 12 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 12 shows the results of a cytokine assay for IFN-α produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone with other NTPs, 5MeOU with other NTPs, or a combination of 5MC / 5MeOU with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of IFN-α.

[0715] Figure 13 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 13 shows the results of a cytokine assay for RANTES produced in human dendritic cells (DCs) using the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone with other NTPs, 5MeOU with other NTPs, or a combination of 5MC / 5MeOU with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of RANTES.

[0716] Figure 14 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 14 shows the results of a cytokine assay for IL-6 produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone together with other NTPs, 5MeOU together with other NTPs, or a combination of 5MC / 5MeOU together with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of IL-6.

[0717] Figure 15 shows the results of reduced immunogenicity for the translatable molecules of the present invention. Figure 15 shows the results of a cytokine assay for MIP-1a produced in human dendritic cells (DCs) by the cmEPO ARC-RNA of the present invention. ARC-RNA was synthesized using UTP alone together with other NTPs, 5MeOU together with other NTPs, or a combination of 5MC / 5MeOU together with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis. ARC-RNA synthesized using 5MeOU or a combination of 5MC / 5MeOU showed significantly reduced immunogenicity in the production of MIP-1a.

[0718] Example J Enhanced expression of ARC-mRNA Figure 16 shows the results of surprisingly increased human EPO protein production in vivo for the translatable molecules of the present invention. Figure 16 shows the results for hEPO protein expression after injecting mice with hEPO ARC-mRNA at a dose of 0.3 mg / kg. hEPO in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0719] Figure 17 shows the results of surprisingly increased cynomolgus monkey EPO protein production in vivo for the translatable molecules of the present invention. Figure 17 shows the results for cmEPO protein expression after injecting mice with cmEPO ARC-mRNA at a dose of 0.3 mg / kg. cmEPO in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by more than three-fold.

[0720] Figure 18 shows the results of surprisingly increased human F9 protein production in vivo for the translatable molecules of the present invention. Figure 18 shows the results for hF9 protein expression after injecting mice with hF9 ARC-mRNA at a dose of 0.3 mg / kg. hF9 in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0721] Figure 19 shows the results of surprisingly increased human adiponectin protein production in vivo for the translatable molecules of the present invention. Figure 19 shows the results regarding hAdipo protein expression after injecting hAdipo ARC-mRNA into mice at a dose of 0.3 mg / kg. hAdipo in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by approximately 2-fold.

[0722] Figure 20 shows the results of surprisingly increased human AAT protein production in vivo for the translatable molecules of the present invention. Figure 20 shows the results for hAAT protein expression after injecting mice with hAAT ARC-mRNA at a dose of 0.3 mg / kg. hAAT in mouse serum was measured by ELISA. ARC-RNA was synthesized using 5MeOU along with other NTPs using a template with reduced T composition. 5MeOU was used at 100% in the synthesis. ARC-RNA synthesized with 5MeOU using a template with reduced T composition showed significantly increased protein production in vivo, increasing by up to approximately 4-fold.

[0723] Example K Reduced immunogenicity of ARC-mRNA Figure 21 shows the results of reduced immunogenicity for the translatable molecules of the present invention in vivo. Figure 21 shows the results of a cytokine assay produced in mice using the hEPO ARC-RNA (5MeOU) of the present invention and detected in serum 6 hours after injection. ARC-RNAs synthesized with 5MeOU and templates of reduced T composition showed significantly reduced immunogenicity compared to synthetic mRNAs with the same sequence but containing only natural nucleotides. hEPO ARC-RNA (5MeOU) did not stimulate a cytokine response in vivo compared to the UTP control.

[0724] All publications, patents and literature specifically mentioned herein are hereby incorporated by reference for all purposes.

[0725] It is understood that this invention is not limited to the particular methodology, protocols, materials, and reagents described, as these may vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention, which will be encompassed by the appended claims.

[0726] It should be noted that, herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Similarly, the terms "a" [or "an"], "one or more," and "at least one" can be used interchangeably herein. It should also be noted that the terms "comprise," "comprises," "comprising," "containing," "including," and "having" can be used interchangeably.

[0727] Without further elaboration, it is believed that one skilled in the art can, based on the preceding description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

[0728] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose.

Claims

1. 1. An RNA expressible to provide a target polypeptide or protein, wherein the occurrence of uridine in the coding sequence region of the RNA is reduced by at least 20% compared to a wild-type mRNA expressible to provide the target polypeptide or protein, and wherein the RNA contains one or more 5-methoxyuridines.

2. The RNA of claim 1, wherein 10 to 100% of the uridines in the RNA are 5-methoxyuridine, or 50 to 80% of the uridines in the RNA are 5-methoxyuridine.

3. The RNA of claim 1, which contains one or more 5-methylcytidines.

4. The RNA of claim 1, wherein 10 to 100% of the cytidines in the RNA are 5-methylcytidines.

5. 2. The RNA of claim 1, wherein the occurrence of uridines in the coding sequence region of the RNA is reduced by at least 35% compared to a wild-type mRNA that can be expressed to provide a target polypeptide or protein.

6. The RNA of claim 1, wherein uridines are randomly substituted starting from the 5' end of the coding sequence region, starting from the 3' end of the coding sequence region, or throughout the coding sequence region.

7. The RNA of claim 1, selected from SEQ ID NOs: 35-47, 76-88, 110-119 and 147-159.

8. The RNA of claim 1, which is translatable to express a polypeptide or protein having at least 75% identity to a target polypeptide or protein.

9. The RNA of claim 1, which is translatable to express a polypeptide or protein having at least 85% identity to a target polypeptide or protein.

10. The RNA of claim 1, comprising a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region and a tail region.

11. The RNA of claim 1, which comprises a translation enhancer in the 5' or 3' untranslated region.

12. The RNA of claim 1, which is translatable in vitro, ex vivo or in vivo.

13. The RNA of claim 1, comprising 50 to 15,000 nucleotides.

14. The RNA of claim 1 , wherein the target polypeptide or protein is a polypeptide, protein, protein fragment, antibody, antibody fragment, vaccine immunogen, or vaccine toxoid.

15. 2. The RNA of claim 1, which has at least a two-fold increased translation efficiency in vivo compared to a native mRNA expressing the target polypeptide or protein.

16. The RNA of claim 1, which has immunogenicity that is reduced by at least 5-fold compared to native mRNA expressing the target polypeptide or protein.

17. 2. The RNA of claim 1, wherein the target polypeptide or protein is an expression product or a fragment thereof of a gene selected from EPO, AAT, ADIPOQ, F9, TTR and BIRC5.

18. A DNA encoding the RNA of claim 1.

19. A composition comprising the RNA according to any one of claims 1 to 17 and a pharmaceutically acceptable carrier.

20. 20. The composition of claim 19, wherein the carrier comprises a transfection reagent, a nanoparticle, or a liposome.

21. 20. A method for preventing, treating or ameliorating at least one symptom of a disease or condition in a subject in need thereof, comprising contacting the subject's cells with the composition of claim 19.

22. 20. The composition of claim 19 for use in medical therapy.

23. 20. The composition of claim 19 for use in the treatment of the human or animal body.

24. A DNA template transcribable for expression of a target polypeptide or protein, wherein the DNA template comprises a non-coding sequence template region, wherein deoxyadenosine nucleotides in the non-coding sequence template region are replaced with non-deoxyadenosine nucleotides, and wherein the occurrence of deoxyadenosine in the template region is reduced by at least 20% compared to a wild-type gene transcribable for expression of the target polypeptide or protein.

25. 25. The DNA template of claim 24, wherein the DNA is double-stranded and comprises a coding non-template strand that is complementary to a non-coding template strand.

26. 25. The DNA template of claim 24, wherein the occurrence of deoxyadenosine in the template region is reduced by at least 35% compared to a wild-type gene transcribable for expression of a target polypeptide or protein.

27. 25. The DNA template of claim 24, which is transcribable for expression of a polypeptide or protein having at least 75% identity to a target polypeptide or protein.

28. 25. The DNA template of claim 24, which is transcribable for expression of a polypeptide or protein having at least 85% identity to a target polypeptide or protein.

29. 25. The DNA template of claim 24, wherein the non-coding sequence template region is complementary to a sequence selected from SEQ ID NOs: 9-21, 49-62, 90-99 and 121-133.

30. 25. The DNA template of claim 24, wherein the target polypeptide or protein is an expression product or a fragment thereof of a gene selected from EPO, AAT, ADIPOQ, F9, TTR and BIRC5.

31. 25. The DNA template of claim 24, wherein the DNA comprises a plasmid, a linear polynucleotide, a PCR product, a synthetic oligonucleotide, a cloned oligonucleotide, or reverse-transcribed RNA.

32. 1. A process for producing RNA having an RNA coding region for expressing a target polypeptide or protein, comprising: providing a DNA molecule comprising a non-coding template region encoding an RNA, wherein deoxyadenosine nucleotides in the portion of the non-coding template region encoding the RNA coding region are replaced by non-deoxyadenosine nucleotides, and the DNA further comprises a promoter for transcribing the template region; transcribing the non-coding template region in the presence of nucleoside triphosphates and one or more chemically modified nucleoside triphosphates to form a product mixture; Isolating RNA, wherein the RNA comprises natural and chemically modified nucleotides. A process involving:

33. 33. The process of claim 32, wherein the chemically modified nucleoside comprises 5-methoxyuridine.

34. 33. The process of claim 32, wherein the nucleoside triphosphates comprise 80% 5-methoxy-UTP and 20% UTP.

35. 33. The process of claim 32, wherein the chemically modified nucleosides comprise 5-methoxyuridine and 5-methylcytidine.

36. Chemically modified nucleosides include 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylester uridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl-pseudouridine, N-methylur ... １ -hydroxypseudouridine, N １ -methylpseudouridine, 2'-O-methyl-N １ -methylpseudouridine, N １ -Ethylpseudouridine, N １ 33. The process of claim 32, wherein the hydroxymethyl pseudouridine is selected from hydroxymethyl pseudouridine and arauidine.

37. 33. The process of claim 32, wherein the chemically modified nucleosides replace 10-100% of the otherwise identical chemically unmodified nucleotides in the RNA, or 50-80% of the otherwise identical chemically unmodified nucleotides in the RNA.

38. 33. The process of claim 32, wherein the occurrence of deoxyadenosine in the template region is reduced by at least 20% compared to a wild-type gene transcribed for expression of the target polypeptide or protein.

39. 33. The process of claim 32, wherein the occurrence of deoxyadenosine in the template region is reduced by at least 35% compared to a wild-type gene transcribed for expression of the target polypeptide or protein.

40. 33. The process of claim 32, wherein the step of transcribing the DNA is performed with a 5' cap.

41. 33. The process of claim 32, wherein the RNA comprises a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region and a tail region.

42. 33. The process of claim 32, wherein the transcribing step is performed by an RNA polymerase.

43. 33. The process of claim 32, wherein the transcribing step is performed by SP6, T7, or T3 phage RNA polymerase.

44. 33. The process of claim 32, wherein the promoter is double-stranded.

45. 33. The process of claim 32, wherein the level of double-stranded RNA impurities in the product mixture is reduced by at least two-fold compared to the same process without substituting deoxyadenosine nucleotides.

46. 33. The process of claim 32, wherein the level of double-stranded RNA impurities in the product mixture is less than 5%, or less than 1%, or less than 0.1% of total RNA.

47. 33. A synthetic RNA comprising the product of claim 32.

48. 48. A composition comprising the RNA of claim 47 and a pharmaceutically acceptable carrier.

49. 49. The composition of claim 48, wherein the carrier comprises a transfection reagent, a nanoparticle, or a liposome.

50. 49. A method for preventing, treating or ameliorating at least one symptom of a disease or condition in a subject in need thereof, the method comprising contacting cells of the subject with the composition of claim 48.

51. 51. The method of claim 50, wherein the administration is intravenous, subcutaneous, pulmonary, intratumoral, intramuscular, intraperitoneal, intradermal, oral, topical, inhaled, or nasal.

52. 49. The composition of claim 48 for use in medical therapy.

53. 49. A composition according to claim 48 for use in the treatment of the human or animal body.

54. 49. Use of the composition of claim 48 for preparing or manufacturing a medicament for preventing, ameliorating, delaying the onset of or treating a disease or condition in a subject in need thereof.

Images