Crispr - cpf1 associated methods, compositions and components for cancer immunotherapy

Abstract

To provide CRISPR / Cpf1 associated compositions and methods for treating cancers.SOLUTION: Inhibitory centromere promoter factor 1 (Cpf1) gRNA molecules are provided that comprise a targeting domain that is complementary with a target domain of one T-cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC and TRBC genes.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Priority claims This application claims priority to U.S. Provisional Patent Application No. 62 / 304,057, filed March 4, 2016, the contents of which are incorporated by reference herein in their entirety.

[0002] Sequence Listing This specification references a Sequence Listing (submitted electronically on March 3, 2017 as a .txt file named "0841770140Sseqlist.txt"). The .txt file was created on March 2, 2017 and is 721,000 bytes in size. The entire contents of the Sequence Listing are incorporated herein by reference.

[0003] The present invention relates to CRISPR / Cpf1-related methods, compositions and components for editing target nucleic acid sequences or modulating the expression of target nucleic acid sequences, and their uses in the context of cancer immunotherapy, including adoptive transfer of engineered T cells or T cell precursors. [Background technology]

[0004] Adoptive transfer of genetically engineered T cells has entered clinical testing as a therapeutic approach. Typically, the approach involves 1) obtaining white blood cells from a subject by apheresis; 2) selecting / enriching T cells; 3) activating T cells by cytokine treatment; 4) introducing a cloned T cell receptor (TCR) gene or a chimeric antigen receptor (CAR) gene by retroviral transduction, lentiviral transduction, or electroporation; 5) expanding T cells by cytokine treatment; 6) conditioning the subject, usually by lymphodepletion; and 7) infusing the genetically engineered T cells into the subject.

[0005] Sources of cloned TCR genes (TRAC and TRBC) include rare T cell populations isolated from individuals with specific malignancies and T cell clones isolated from T cell receptor-humanized mice immunized with specific tumor antigens or tumor cells. Following adoptive transfer, TCR-engineered T cells recognize their cognate antigenic peptides presented by major histocompatibility complex (MHC) proteins on the surface of tumor cells. Antigen binding stimulates signal transduction pathways leading to T cell activation and proliferation. Stimulated T cells then mount a cytotoxic antitumor cell response, typically involving a secretory complex containing granzyme B, perforin, and granulysin, to induce tumor cell apoptosis.

[0006] Chimeric antigen receptor (CAR) genes typically encode artificial T cell receptors, including an extracellular tumor antigen-binding domain derived from the single-chain antibody variable fragment (scFv) domain of a monoclonal antibody, fused to a cytoplasmic effector domain via a hinge and transmembrane domain. The effector domain is typically derived from the CD3-ζ chain of the T cell co-receptor complex, and may also include domains derived from the CD28 and / or CD137 receptor proteins. The CAR extracellular domain binds to tumor antigens in an MHC-independent manner, as described for TCR-engineered T cells, resulting in the activation and proliferation of T cells, leading to cytotoxic anti-tumor effects.

[0007] To date, at least 15 different tumor antigens have been targeted in clinical trials of engineered T cells. Some trials have reported antitumor activity. The greatest success has been in hematologic malignancies. For example, adoptive transfer of CAR-T cells engineered to target the B-cell antigen CD19 has resulted in multiple partial and complete responses in subjects with lymphoma, acute lymphoblastic leukemia, acute lymphocytic leukemia, and B-cell acute lymphocytic leukemia. In contrast, trials targeting other tumor types, particularly solid tumors including renal cell carcinoma, neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, and prostate cancer, have been less successful. In many of these trials, very few patients experienced objective responses. Summary of the Invention [Means for solving the problem]

[0008] Summary of Subject Matter of the Disclosure The methods and compositions disclosed herein provide cancer treatment using an immunotherapy approach involving the administration of genetically engineered T cells or T cell precursors to a subject. One approach to treating a subject with cancer involves isolating T cells from the subject, genetically modifying them to target antigens expressed by cancer cells, and then reintroducing them into the subject through a process known as adoptive T cell transfer. Genetically modifying T cells involves the introduction of transmembrane T cell receptor (TCR) or chimeric antigen receptor (CAR) genes that encode TCR or CAR proteins, respectively, that specifically recognize specific cancer antigens. In certain embodiments, the binding of tumor-expressed antigens to the antigen-binding domain of the TCR or CAR protein initiates a signaling cascade, leading to T cell activation, proliferation, and ultimately the destruction of cancer cells via a cytotoxic immune response (Kershaw et al., 2013 NatRevCancer 13, 525-541).

[0009] Adoptive T cell transfer, which utilizes genetically modified T cells, has entered clinical trials for the treatment of solid and hematologic malignancies. Results to date have been mixed. In hematologic malignancies (especially lymphoma, chronic lymphocytic leukemia (CLL), and acute lymphocytic leukemia (ALL)), the majority of patients in several phase 1 and 2 trials have achieved at least a partial response, with some patients achieving a complete response (Kochenderfer, JNet et al., 2012 Blood 119, 2709-2720). However, fewer responses have been observed in most tumor types (including melanoma, renal cell carcinoma, and colorectal cancer) (Johnson, LA et al., 2009 Blood 114, 535-546; Lamers, CH et al., 2013 Mol. Ther. 21, 904-912; Warren, RS et al., 1998 Cancer Gene Ther. 5, S1-S2). Thus, there is a need to improve the efficacy of adoptive transfer of modified T cells in cancer therapy.

[0010] Factors that limit the effectiveness of genetically modified T cells as cancer therapeutics include: (1) T cell proliferation, e.g., limited proliferation of T cells following adoptive transfer; (2) T cell survival, e.g., induction of T cell apoptosis by factors in the tumor environment; and (3) T cell function, e.g., inhibition of cytotoxic T cell function by inhibitory factors secreted by host immune cells and cancer cells. The methods and compositions disclosed herein address one or more of these limitations by modifying the expression of T cell-expressed genes that affect T cell proliferation, survival, and / or function.

[0011] In certain embodiments, the methods and compositions disclosed herein may be used to affect T cell proliferation (e.g., by inactivating genes that inhibit T cell proliferation). In certain embodiments, the methods and compositions disclosed herein may be used to affect T cell survival (e.g., by inactivating genes that mediate T cell apoptosis). In certain embodiments, the methods and compositions disclosed herein may be used to affect T cell function (e.g., by inactivating genes encoding immunosuppressive and inhibitory (e.g., anergy-inducing) signaling factors). In certain embodiments, the methods and compositions disclosed herein may be used to improve T cell persistence. In certain embodiments, the methods and compositions disclosed herein may be utilized individually or in combination to affect one or more of the factors that limit the effectiveness of genetically modified T cells as cancer therapeutics, e.g., T cell proliferation, T cell survival, T cell function, T cell persistence, or any combination thereof.

[0012] The methods and compositions disclosed herein can be used to affect T cell proliferation, survival, persistence, and / or function by modifying one or more T cell-expressed genes, such as one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the methods and compositions disclosed herein can be used to affect T cell proliferation by modifying one or more T cell-expressed genes, such as the CBLB and / or PTPN6 genes. In certain embodiments, the methods and compositions disclosed herein can be used to affect T cell survival by modifying one or more T cell-expressed genes, such as the FAS and / or BID genes. In certain embodiments, the methods and compositions disclosed herein can be used to affect T cell function by modifying one or more T cell-expressed genes, such as the CTLA4, PDCD1, TRAC, and / or TRBC genes. In certain embodiments, the methods and compositions disclosed herein can be used to improve T cell persistence by modifying the B2M gene.

[0013] In certain embodiments, one or more T cell-expressed genes, including but not limited to, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, are independently targeted as targeted knockouts to affect, for example, T cell proliferation, survival, persistence, and / or function. In certain embodiments, the methods of the disclosure comprise knocking out one T cell-expressed gene (e.g., one selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes). In certain embodiments, the methods of the disclosure comprise independently knocking out two T cell-expressed genes (e.g., two selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes). In certain embodiments, the disclosed methods include independently knocking out three T cell-expressed genes, e.g., three selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the disclosed methods include independently knocking out four T cell-expressed genes, e.g., four selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the disclosed methods include independently knocking out five T cell-expressed genes, e.g., five selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the disclosed methods include independently knocking out six T cell expressed genes, e.g., six selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the disclosed methods include independently knocking out seven T cell expressed genes, e.g., seven selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.In certain embodiments, the methods of the disclosure include independently knocking out each of eight T cell expressed genes, e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0014] In addition to the genes described above, several other T cell-expressed genes may be targeted to affect the efficacy of engineered T cells. Such genes include, but are not limited to, TGFBRI, TGFBRII, and TGFBRIII (Kershaw et al. 2013 NatRevCancer 13, 525-541). In certain embodiments, one or more of the TGFBRI, TGFBRII, and TGFBRIII genes may be modified individually or in combination using the methods disclosed herein. In certain embodiments, one or more of the TGFBRI, TGFBRII, and TGFBRIII genes may be modified individually or in combination with any one or more of the eight genes described above (i.e., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes) using the methods of the present disclosure.

[0015] In certain embodiments, the methods and compositions disclosed herein modify the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene by targeting a gene location (e.g., a knockout location), e.g., a location within a non-coding region (e.g., a promoter region) or a coding region, or by targeting a transcribed sequence, e.g., an intronic or exonic sequence, of the gene. In certain embodiments, the coding sequence, e.g., a coding region, e.g., an early coding region, of a gene (e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene) is targeted for modification or knockout of expression. In certain embodiments, a location in a non-coding region (e.g., a promoter region) of a T cell-expressed gene (e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene) is targeted for modification or knockout of expression of the T cell-expressed gene.

[0016] In certain embodiments, the methods and compositions disclosed herein modify the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes by targeting the coding sequence of the gene. In certain embodiments, the coding sequence is an initial coding sequence. In certain embodiments, the coding sequence of the gene is targeted to knock out the expression of a T cell-expressed gene.

[0017] In certain embodiments, the methods and compositions disclosed herein modify the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes by targeting the non-coding sequences of the genes. In certain embodiments, the non-coding sequences include sequences within the promoter region, enhancer sequences, intron sequences, sequences within the 3'UTR, polyadenylation signal sequences, or combinations thereof. In certain embodiments, the non-coding sequences of the genes are targeted to knock out the expression of the genes.

[0018] In certain embodiments, the methods of the present disclosure include knocking out one or two alleles of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene, e.g., by inducing a modification in the gene. In certain embodiments, the modification comprises an insertion, deletion, mutation, or a combination thereof.

[0019] In certain embodiments, the targeted knockout approach is mediated by non-homologous end joining (NHEJ) using the CRISPR / Cpf1 system, which includes the Cpf1 enzyme.

[0020] "T cell targeted FAS knockout locus," as used herein, refers to a position in the FAS gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of functional FAS gene product expression (e.g., knockout of functional FAS gene product expression). In certain embodiments, the position is in a coding region, e.g., an early coding region, of the FAS gene.

[0021] "T cell targeted BID knockout locus," as used herein, refers to a position in the BID gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of functional BID gene product expression (e.g., knockout of functional BID gene product expression). In certain embodiments, the position is in a coding region of the BID gene, e.g., in the early coding region.

[0022] A "T cell targeted CTLA4 knockout locus," as used herein, refers to a position in the CTLA4 gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional CTLA4 gene product (e.g., knockout of expression of a functional CTLA4 gene product). In certain embodiments, the position is in a coding region of the CTLA gene, e.g., an early coding region.

[0023] A "T cell targeted PDCD1 knockout locus," as used herein, refers to a position in the PDCD1 gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional PDCD1 gene product (e.g., knockout of expression of a functional PDCD1 gene product). In certain embodiments, the position is in a PDCD1 gene coding region, e.g., an early coding region.

[0024] A "T cell targeted CBLB knockout locus," as used herein, refers to a position in the CBLB gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional CBLB gene product (e.g., knockout of expression of a functional CBLB gene product). In certain embodiments, the position is in a coding region of the CBLB gene, e.g., an early coding region.

[0025] A "T cell targeted PTPN6 knockout location," as used herein, refers to a location in the PTPN6 gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional PTPN6 gene product (e.g., knockout of expression of a functional PTPN6 gene product). In certain embodiments, the location is in a coding region of the PTPN6 gene, e.g., an early coding region.

[0026] "T cell targeted B2M knockout locus," as used herein, refers to a position in the B2M gene that, if modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional B2M gene product (e.g., knockout of expression of a functional B2M gene product). In certain embodiments, the position is in a coding region, e.g., an early coding region, of the B2M gene.

[0027] "T cell targeted TRAC knockout locus," as used herein, refers to a position in the TRAC gene that, when modified, e.g., by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional TRAC gene product (e.g., knockout of expression of a functional TRAC gene product). In certain embodiments, the position is in a coding region of the TRAC gene, e.g., an early coding region.

[0028] As used herein, a "T cell-targeted TRBC knockout site" refers to a site in the TRBC gene that, when modified, for example, by NHEJ-mediated modification, results in reduced or eliminated expression of a functional TRBC gene product (e.g., knockout of functional TRBC gene product expression). In certain embodiments, the site is in a coding region of the TRBC gene, for example, in the early coding region.

[0029] "T cell targeted FAS locus," as used herein, refers to any T cell targeted FAS knockout locus, as described herein.

[0030] "T cell targeted BID locus," as used herein, refers to any T cell targeted BID knockout locus, as described herein.

[0031] "T cell targeted CTLA4 locus," as used herein, refers to any T cell targeted CTLA4 knockout locus, as described herein.

[0032] "T cell targeted PDCD1 locus," as used herein, refers to any T cell targeted PDCD1 knockout locus, as described herein.

[0033] "T cell targeted CBLB locus," as used herein, refers to any T cell targeted CBLB knockout locus, as described herein.

[0034] "T cell targeted PTPN6 locus," as used herein, refers to any T cell targeted PTPN6 knockout locus, as described herein.

[0035] "T cell targeted B2M locus," as used herein, refers to any T cell targeted B2M knockout locus, as described herein.

[0036] "T cell targeted TRAC locus," as used herein, refers to any T cell targeted TRAC knockout locus, as described herein.

[0037] "T cell-targeted TRBC locus," as used herein, refers to any T cell-targeted TRBC knockout locus, as described herein.

[0038] A "T cell targeted knockout locus," as used herein, refers to any of a T cell targeted FAS knockout locus, a T cell targeted BID knockout locus, a T cell targeted CTLA4 knockout locus, a T cell targeted PDCD1 knockout locus, a T cell targeted CBLB knockout locus, a T cell targeted PTPN6 knockout locus, a T cell targeted B2M knockout locus, a T cell targeted TRAC knockout locus, or a T cell targeted TRBC knockout locus, as described herein.

[0039] "T cell target locus," as used herein, refers to any T cell target knockout locus, as described herein.

[0040] In one embodiment, disclosed herein is a gRNA molecule, e.g., an isolated or non-naturally occurring gRNA molecule, that includes a targeting domain that is complementary to a target domain of one T cell-expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0041] In certain embodiments, the targeting domain of the gRNA molecule is configured to achieve a cleavage event, e.g., a double-strand break, sufficiently close to the T cell target locus (e.g., the T cell target knockout locus) in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene to allow for modification, e.g., NHEJ-associated modification, of the T cell target locus (e.g., the T cell target knockout locus) in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene. In certain embodiments, the targeting domain is configured such that the cleavage event, e.g., a double-stranded break, is located within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the T cell target locus (e.g., the T cell target knockout locus). The double-stranded break may be located upstream or downstream of the T cell knockout target locus (e.g., the T cell target knockout locus) in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene.

[0042] In certain embodiments, a second gRNA molecule comprising a second targeting domain is configured to effect a cleavage event, e.g., a double-stranded break, sufficiently close to the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene to allow modification, e.g., NHEJ-associated modification, of the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene, alone or in combination with the cleavage placed by the first gRNA molecule. In certain embodiments, the targeting domains of the first and second gRNA molecules are configured such that the double-stranded breaks are located within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position, independently for each gRNA molecule. In certain embodiments, the two sets of double-stranded breaks are located on either side of the nucleotides of the T cell target position (e.g., the T cell target knockout position) in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene. In certain embodiments, the two sets of double-stranded breaks are placed on either side, e.g., upstream or downstream, of nucleotides of the T cell target position (e.g., the T cell target knockout position) in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene. In certain embodiments, the double-stranded breaks may be accompanied by an additional double-stranded break placed by a second gRNA molecule, as discussed below.For example, the targeting domain of the first gRNA molecule is configured such that a double-stranded break is positioned upstream of a T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location; and the targeting domain of the second gRNA molecule is configured to position a double-stranded break downstream of a T cell target locus in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target locus.

[0043] In certain embodiments, when two or more gRNAs are used to place two or more cleavage events in target nucleic acid, for example, two sets of double-stranded breaks, the two or more cleavage events are caused by the same or different Cpf1 protein.In certain embodiments, when two gRNAs are used to place two sets of double-stranded breaks in target nucleic acid, a single Cpf1 nuclease is used to create both double-stranded breaks.In certain embodiments, when two or more Cpf1 proteins are used, the Cpf1 proteins are from different species.

[0044] When multiple T cell expressed genes are targeted for modification in a cell, the target nucleic acid can be modified, e.g., cleaved, by one or more Cpf1 proteins. For example, if two genes are targeted for modification, e.g., if both T cell expressed genes are targeted for knockout, the same or different Cpf1 proteins can be used to target each gene. In certain embodiments, both T cell expressed genes (or each targeted gene in a cell) are cleaved by a Cpf1 nuclease to generate a double-stranded break. In certain embodiments, both T cell expressed genes (or each targeted gene in a cell) are cleaved by a Cpf1 molecule to generate a double-stranded break. In certain embodiments, one or more T cell expressed genes in a cell can be modified by cleavage with a Cpf1 nuclease. When two or more Cpf1 proteins are used to cleave target nucleic acids, e.g., different genes, in a cell, the Cpf1 proteins can be derived from different bacterial species. For example, one or more T cell expressible genes in a cell may be modified by cleavage with a Cpf1 protein from one bacterial species, and one or more T cell expressible genes in the same cell may be modified by cleavage with a Cpf1 protein from a different bacterial species. In certain embodiments, when two or more Cpf1 proteins from different species are used, they may be delivered simultaneously or sequentially to control the cleavage specificity at a desired gene at a desired location in a target nucleic acid.

[0045] In certain embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite strands of the target nucleic acid molecule. In certain embodiments, the gRNA molecule and the second gRNA molecule are configured so that the PAM faces outward.

[0046] In certain embodiments, a location in the coding region, e.g., early coding region, of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene is targeted, e.g., for knockout. In certain embodiments, the targeting domain comprises a nucleotide sequence identical to, or differing from, a nucleotide sequence selected from SEQ ID NOs: 1-3707 by no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 nucleotides. In certain embodiments, the targeting domain comprises a nucleotide sequence selected from SEQ ID NOs: 1-3707.

[0047] In certain embodiments, when the T cell target knockout location is in a FAS coding region, e.g., an early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 2326-3094.

[0048] In certain embodiments, when the T cell target knockout location is in a BID coding region, e.g., the early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 3284-3385.

[0049] In certain embodiments, when the T cell target knockout location is in the CTLA4 coding region, e.g., the early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 64-370.

[0050] In certain embodiments, when the T cell target knockout location is in the PDCD1 coding region, e.g., the early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 1-63.

[0051] In certain embodiments, when the T cell target knockout location is a CBLB coding region, e.g., an early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 504-2325.

[0052] In certain embodiments, when the T cell target knockout location is in the PTPN6 coding region, e.g., the early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 371-503.

[0053] In certain embodiments, when the T cell target knockout location is in a B2M coding region, e.g., an early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 3095-3283.

[0054] In certain embodiments, when the T cell target knockout location is in a TRAC coding region, e.g., an early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 3386-3588.

[0055] In certain embodiments, when the T cell target knockout location is a TRBC coding region, e.g., an early coding region, and multiple gRNAs are used to place breaks, e.g., two double-stranded breaks, in the target nucleic acid sequence, e.g., to generate one or more indels, each guide RNA is independently selected from SEQ ID NOs: 3589-3707.

[0056] In certain embodiments, the gRNA further comprises a direct repeat domain. In certain embodiments, the direct repeat domain is 15-20 nucleotides in length. In certain embodiments, the direct repeat domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3708-3710.

[0057] In certain embodiments, the gRNA molecule is a unimodular (also referred to as a "single molecule") gRNA. In certain embodiments, the targeting domain is 15-25 nucleotides in length. In certain embodiments, the targeting domain is 18 nucleotides in length. In certain embodiments, the targeting domain is 19 nucleotides in length. In certain embodiments, the targeting domain is 20 nucleotides in length. In certain embodiments, the targeting domain is 21 nucleotides in length. In certain embodiments, the targeting domain is 22 nucleotides in length. In certain embodiments, the targeting domain is 23 nucleotides in length.

[0058] The cleavage event, e.g., a double-strand break, is generated by the Cpf1 molecule. In certain embodiments, the Cpf1 molecule catalyzes the double-strand break.

[0059] Additionally, the presently disclosed subject matter provides a nucleic acid composition, e.g., an isolated or non-naturally occurring nucleic acid composition, e.g., a DNA composition, comprising (a) a first nucleotide sequence encoding a first gRNA molecule as described above. In certain embodiments, the nucleic acid composition further comprises (b) a second nucleotide sequence encoding a Cpf1 molecule. The Cpf1 molecule is capable of forming a double-stranded break in a target nucleic acid. In certain embodiments, the Cpf1 molecule is selected from the group consisting of an Acidaminococcus sp. BV3L6 strain Cpf1 molecule (AsCpf1), a Lachnospiraceae bacterium ND2006 Cpf1 molecule (LbCpf1), and a Lachnospiraceae bacterium MA2020 (Lb2Cpf1). In certain embodiments, the second nucleotide sequence is set forth in SEQ ID NO:3722, SEQ ID NO:3723, or SEQ ID NO:3724.

[0060] In certain embodiments, the nucleic acid composition further comprises (c) a third nucleotide sequence encoding a second gRNA molecule comprising a targeting domain complementary to a targeting domain of one T cell-expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the second gRNA targets the same T cell target location as the first gRNA molecule.

[0061] In certain embodiments, (a) and (b) are present on one nucleic acid molecule, e.g., one vector, e.g., one viral vector, e.g., an AAV vector. Exemplary AAV vectors that may be used in any of the described compositions and methods include AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, modified AAV3 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, aAAV.rh64R1 vectors, and modified AAV.rh64R1 vectors. In certain embodiments, (a) is present on a first nucleic acid molecule, such as a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (b) is present on a second nucleic acid molecule, such as a second vector, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.

[0062] In certain embodiments, (a) and (c) are present on one nucleic acid molecule, for example, one vector, for example, one viral vector, for example, one AAV vector.In certain embodiments, (a) and (c) are present on different vectors.For example, (a) can be present on a first nucleic acid molecule, for example, a first vector, for example, a first viral vector, for example, a first AAV vector; (c) can be present on a second nucleic acid molecule, for example, a second vector, for example, a second AAV vector.In certain embodiments, the first and second nucleic acid molecules are AAV vectors.

[0063] In certain embodiments, (a), (b), and (c) are present on one nucleic acid molecule, such as one vector, for example, one viral vector, for example, an AAV vector. In certain embodiments, the nucleic acid molecule is an AAV vector. In certain embodiments, one of (a), (b), and (c) is present on a first nucleic acid molecule, such as a first vector, for example, a first viral vector, for example, a first AAV vector; the second and third of (a), (b), and (c) are encoded on a second nucleic acid molecule, such as a second vector, for example, a second vector, for example, a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.

[0064] In certain embodiments, (a) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, a first AAV vector, etc.; (b) and (c) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.

[0065] In certain embodiments, (b) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (a) and (c) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.

[0066] In certain embodiments, (c) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (b) and (a) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.

[0067] In certain embodiments, each of (a), (b), and (c)(i) is present on a different nucleic acid molecule, such as a different vector, e.g., a different viral vector, e.g., a different AAV vector. For example, (a) may be present on a first nucleic acid molecule, (b) may be present on a second nucleic acid molecule, and (c)(i) may be present on a third nucleic acid molecule. The first, second, and third nucleic acid molecules may be AAV vectors.

[0068] The nucleic acids described herein may comprise a promoter operably linked to a sequence encoding a gRNA molecule (a), such as a promoter described herein. The nucleic acids may further comprise a second promoter operably linked to a sequence encoding a second, third, and / or fourth gRNA molecule (c), such as a promoter described herein. The promoter and the second promoter are different from each other. In certain embodiments, the promoter and the second promoter are the same. The nucleic acids described herein may further comprise a promoter operably linked to a sequence encoding a Cpf1 molecule (b), such as a promoter described herein.

[0069] The presently disclosed subject matter also provides a composition comprising (a) a gRNA molecule as described above. In certain embodiments, the composition further comprises (b) a Cpf1 molecule, e.g., a Cpf1 molecule as described above. In certain embodiments, the composition further comprises (c) a second gRNA molecule as described above. In certain embodiments, the composition of any one of claims 66-70, the composition is a ribonucleoprotein composition comprising a Cpf1 protein and a ribonucleic acid molecule encoding the gRNA molecule.

[0070] The presently disclosed subject matter further provides a method of modifying a cell, e.g., modifying the structure, e.g., sequence, of a target nucleic acid in a cell, comprising: contacting the cell with (a) a gRNA molecule described above, and (b) a Cpfl molecule described above, and optionally (c) a second gRNA molecule described above. In another aspect, disclosed herein is a method of treating a subject (e.g., a subject suffering from cancer), e.g., modifying the structure, e.g., sequence, of a target nucleic acid in the subject, comprising: contacting the subject (or a cell from the subject) with (a) a gRNA described above; and (b) a Cpfl molecule described above, and optionally (c) a second gRNA molecule described above.

[0071] In certain embodiments, the method of modifying a cell, e.g., modifying the structure, e.g., the sequence, of a target nucleic acid in a cell, comprises modifying two or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0072] In certain embodiments, the method of modifying a cell comprises modifying two or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0073] In certain embodiments, the method of modifying a cell comprises modifying three or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0074] In certain embodiments, the method of modifying a cell comprises modifying four or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0075] In certain embodiments, the method of modifying a cell comprises modifying five or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0076] In certain embodiments, the method of modifying a cell comprises modifying six or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0077] In certain embodiments, the method of modifying a cell comprises modifying seven or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0078] In certain embodiments, the method of modifying a cell comprises modifying each of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

[0079] In certain embodiments, the method comprises contacting a cell from a subject afflicted with cancer, wherein the cancer is selected from the group consisting of lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DLCL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.

[0080] The cells may be from a subject that would benefit from having one or more alterations at one or more T cell target locations in one or more T cell expressed genes.

[0081] In certain embodiments, the cells are T cells. The contacting may be performed ex vivo, and the contacted cells may be returned to the subject's body after the contacting step. In certain embodiments, the T cells are engineered T cells, such as engineered CAR (chimeric antigen receptor) T cells or engineered TCR (T cell receptor) T cells. In certain embodiments, the T cells are engineered to express a TCR or CAR before, after, or simultaneously with introducing a modification into the T cell-targeted knockout location of a T cell-expressed gene.

[0082] In certain embodiments, the contacting step comprises contacting the cell with a nucleic acid composition as described above. In certain embodiments, the contacting step comprises contacting the cell with a composition as described above. In certain embodiments, the composition is a ribonucleoprotein composition.

[0083] In certain embodiments, the contacting comprises contacting the cell with a nucleic acid molecule, e.g., a vector, e.g., an AAV vector, an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rh10 vector, a modified AAV.rh10 vector, an AAV.rh32 / 33 vector, a modified AAV.rh32 / 33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh64R1 vector, or a modified AAV.rh64R1 vector.

[0084] In certain embodiments, the contacting comprises delivering to the cell a Cpf1 molecule of (b) as a protein or mRNA, a nucleic acid molecule encoding (a), and optionally (c).

[0085] In certain embodiments, the contacting comprises delivering to the cell a Cpf1 molecule of (b) as a protein or mRNA, a gRNA of (a) as RNA, and optionally a second gRNA of (c) as RNA.

[0086] In certain embodiments, the contacting comprises delivering to the cell a nucleic acid composition encoding the gRNA of (a) as RNA, optionally the second gRNA of (c) as RNA, and the Cpf1 molecule of (b).

[0087] The presently disclosed subject matter further provides a reaction mixture comprising a gRNA molecule as described above, a nucleic acid composition as described above, or a composition as described above, and a cell, e.g., a cell derived from a subject that would benefit from one or more modifications at one or more T cell target locations in one or more T cell expressed genes.

[0088] The presently disclosed subject matter further provides kits comprising: (a) a gRNA molecule, or a nucleic acid composition encoding a gRNA, as described above, and one or more of the following: (b) a Cpfl molecule, as described above; (c) a second gRNA molecule, as described above.

[0089] The presently disclosed subject matter further provides modified gRNA molecules. In certain embodiments, the modified gRNA molecule comprises a modification at or near its 5'-end. In certain embodiments, the gRNA molecule comprises a modification at or near its 3'-end. In certain embodiments, the gRNA molecule comprises a modification at or near its 5'-end and a modification at or near its 3'-end. In certain embodiments, the modification is located within 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides of the 5'-end. In certain embodiments, the modification is located within 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides of the 3'-end. In certain embodiments, the modification causes the gRNA molecule to exhibit increased stability against nucleases when introduced into T cells. In certain embodiments, the modifications result in the gRNA molecule exhibiting a reduced innate immune response when introduced into T cells, which in certain embodiments involves the induction of cytokine expression.

[0090] Additionally, the presently disclosed subject matter provides a gRNA molecule as described above for use in treating cancer in a subject. In certain embodiments, the gRNA molecule is used in combination with (b) a Cpf1 molecule.

[0091] The presently disclosed subject matter further provides the use of the gRNA molecule described above in the manufacture of a medicament for treating cancer in a subject. In certain embodiments, the medicament further comprises (b) a Cpf1 molecule.

[0092] The presently disclosed subject matter further provides a nucleic acid composition as described above for use in treating cancer in a subject.

[0093] The presently disclosed subject matter further provides a composition as described above for use in treating cancer in a subject.

[0094] The presently disclosed subject matter further provides use of a nucleic acid composition described above in the manufacture of a medicament for treating cancer in a subject.

[0095] The presently disclosed subject matter still further provides use of a composition described above in the manufacture of a medicament for treating cancer in a subject.

[0096] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Methods and materials similar to or equivalent to those described herein can be used in the present invention or in the testing of the present invention, and suitable methods and materials are listed below.All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.In addition, materials, methods and examples are intended to be illustrative only and are not intended to be limiting.

[0097] Headings, including numerical and alphabetical headings and subheadings, are for organizational and presentation purposes only and are not intended to be limiting.

[0098] Other features and advantages of the invention will become apparent from the detailed description, the drawings, and the claims. [Brief explanation of the drawings]

[0099] [Figure 1] 1 depicts the structure of a gRNA molecule according to certain non-limiting embodiments of the presently disclosed subject matter. [Figure 2] Evaluation of Cpf1 RNPs in a biochemical cleavage assay is shown. The activity of several RNPs targeting the TRAC locus was assessed in an in vitro cleavage assay. A PCR product corresponding to the 450 bp exon 1 of TRAC was incubated with identified TRAC RNPs at a 1:1 ratio. The approximate expected size of the band that should result from successful cleavage is listed for each TRAC RNP. All RNPs appeared to be active, although two RNPs (GWED545 and GWED546) appeared to be more active. [Figure 3A]Figure 1 shows an analysis of TCRα / β expression in CD4+ T cells treated with Cpf1 TRAC-specific RNPs. Activated human CD4+ T cells were electroporated with RNPs designed to target the TRAC locus. Four days after electroporation, cells were stained with TCRα / β antibodies and analyzed by FCM. The frequency of TCRα / β-negative cells is shown graphically for each crRNA tested. Treatment with two RNPs (GWED545 and GWED546) resulted in a significant frequency of TCRα / β-negative cells, demonstrating the ability of the RNPs to correctly edit the TRAC locus, resulting in reduced surface protein expression. [Figure 3B] Analysis of TCRα / β expression in CD4+ T cells treated with Cpf1 TRAC-specific RNPs. Representative FCM plots are plotted for two RNPs that yielded significant TCRα / β-negative cells compared to Cpf1 apo controls, and for an RNP that failed to eliminate surface TCRα / β cells in this assay. [Figure 4] The viability of Cpf1 RNP is shown. Treatment of cells with Cpf1 RNP did not result in loss of viability. The frequency of viable lymphocytes was determined by mapping forward scatter to side scatter for each RNP. The frequency of viable lymphocytes is shown graphically for each RNP tested. [Figure 5] This figure shows molecular analysis of the ability of Cpf1 to edit human T cells using T7E1. The results confirmed that Cpf1 can edit human T cells. gDNA from RNP-treated human T cells was harvested 4 days after electroporation. The TRAC locus was amplified using specific primers, and the PCR product was subjected to a T7E1 assay. Briefly, the PCR product was denatured, reannealed, and finally treated with T7E1 enzyme, which cleaved mismatched double-stranded DNA at the site of the mismatch. The cleavage rate by T7E1 enzyme, assessed by quantification of the cleavage products on an agarose gel, correlated with the percentage of genome editing at the target locus. The data from this assay was plotted and supports the data observed by FACS in Figure 3. [Figure 6] Analysis of TCRα / β expression in CD4+ T cells from a second donor treated with Cpf1 TRAC-specific RNPs is shown. Activated human CD4+ T cells were electroporated with RNPs corresponding to GWED545 and GWED546. Four days after electroporation, cells were stained with TCRα / β antibodies and analyzed by FCM. The frequency of TCRα / β-negative cells is shown graphically. The loss of TCRα / β in cells treated with Cpf1 RNPs GWED545 and GWED546 demonstrates that Cpf1 can reproducibly edit human T cells across multiple donors. [Figure 7] Eukaryotic mRNA cap structures are shown. DETAILED DESCRIPTION OF THE INVENTION

[0100] definition As used herein, the term "about" or "approximately" means that a particular value determined by one of ordinary skill in the art is within an acceptable error range, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 3 standard deviations or more than 3 standard deviations, per practice in the art. Alternatively, "about" can mean within a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold of a value.

[0101] "Domain" is used herein to describe a protein or nucleic acid portion. Unless otherwise specified, a domain does not have to have any particular functional property.

[0102] Calculation of homology or sequence identity (the terms are used interchangeably herein) between two sequences is performed as follows: The sequences are aligned for optimal comparison purposes (e.g., for optimal alignment, gaps can be inserted into one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for comparison purposes). Optimal alignment is evaluated as the highest score using the GAP program in the GCG software package, with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5, using a Blosum62 weight matrix. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide sequence sites are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences.

[0103] As used herein, an "inhibitory Cpf1 gRNA molecule" refers to a gRNA molecule that includes a targeting domain that is complementary to a targeting domain on a nucleic acid that includes a sequence encoding a component of the CRISPR / Cpf1 system introduced into a cell or subject. The inhibitory Cpf1 gRNA does not target an endogenous cellular or subject sequence. In certain embodiments, the inhibitory Cpf1 gRNA molecule includes a targeting domain that is complementary to a target sequence on: (a) a nucleic acid molecule encoding a Cpf1 molecule; (b) a nucleic acid molecule encoding a gRNA (target gene gRNA) that includes a targeting domain that targets a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene; or on multiple nucleic acid molecules encoding CRISPR / Cpf1 components, e.g., both (a) and (b). In certain embodiments, the nucleic acid molecule encoding the CRISPR / Cpf1 component, e.g., the Cpf1 molecule or the target gene gRNA, includes multiple targeting domains that are complementary to the inhibitory Cpf1 gRNA targeting domain. In certain embodiments, the inhibitory Cpf1 gRNA molecule complexes with the Cpf1 molecule, resulting in Cpf1-mediated inactivation of the target nucleic acid molecule, e.g., by cleavage or by binding to the nucleic acid molecule, and resulting in the cessation or reduction of production of CRISPR / Cpf1 system components. In certain embodiments, the Cpf1 molecule forms two complexes: a complex with the target gene gRNA that includes the Cpf1 molecule and modifies the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene; and a complex with the inhibitory Cpf1 gRNA molecule that includes the Cpf1 molecule and acts to prevent further production of the CRISPR / Cpf1 system component, e.g., the Cpf1 molecule or the target gene gRNA molecule. In certain embodiments, the inhibitory Cpf1 gRNA molecule / Cpf1 molecule complex binds to or promotes cleavage of a regulatory region sequence for the Cpf1 molecule, e.g., a promoter, a sequence encoding a transcribed region, an exon, or an intron operably linked to a sequence encoding the Cpf1 molecule.In certain embodiments, the inhibitory Cpf1 gRNA molecule / Cpf1 molecule complex binds to or promotes cleavage of a regulatory region sequence, e.g., a promoter operably linked to the gRNA molecule or a sequence encoding the gRNA molecule. In certain embodiments, the inhibitory Cpf1 gRNA, e.g., a Cpf1-targeting inhibitory Cpf1 gRNA molecule or a target gene gRNA-targeting inhibitory Cpf1 gRNA molecule, limits the effectiveness of Cpf1 molecule / target gene gRNA molecule complex-mediated gene targeting. In certain embodiments, the inhibitory Cpf1 gRNA imposes temporal, expression level, or other constraints on the activity of the Cpf1 molecule / target gene gRNA molecule complex. In certain embodiments, the inhibitory Cpf1 gRNA reduces off-target or other undesirable activity. In certain embodiments, the inhibitory Cpf1 gRNA molecule limits the activity of a component of the Cpf1 system by inhibiting, e.g., completely or substantially completely, the production of that component.

[0104] "Modulator," as used herein, refers to an entity, such as, for example, an agent, that can alter the activity (e.g., enzymatic activity, transcriptional activity, or translational activity), amount, distribution, or structure of a molecule or gene sequence of interest. In certain embodiments, modulation includes cleavage, e.g., breaking a covalent or non-covalent bond, or formation of a covalent or non-covalent bond, e.g., attaching a moiety to the molecule of interest. In certain embodiments, a modulator alters the three-dimensional, secondary, tertiary, or quaternary structure of the molecule of interest. A modulator may increase, decrease, initiate, or eliminate an activity of interest.

[0105] "Large molecule," as used herein, refers to a molecule having a molecular weight of at least 2, 3, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 kD. Large molecules include proteins, polypeptides, nucleic acids, biologics, and carbohydrates.

[0106] "Polypeptide," as used herein, refers to a polymer of amino acids having fewer than 100 amino acid residues. In certain embodiments, it has fewer than 50, 20, or 10 amino acid residues.

[0107] "Non-homologous end joining" or "NHEJ," as used herein, refers to ligation-mediated and / or non-template-mediated repair, including, for example, forward NHEJ (cNHEJ), alternative NHEJ (altNHEJ), microhomology-mediated end joining (MMEJ), and synthesis-dependent microhomology-mediated end joining (SD-MMEJ).

[0108] As used herein, a "reference molecule," e.g., a reference Cpf1 molecule or a reference gRNA, refers to a molecule to which a subject molecule, e.g., a subject Cpf1 molecule or a subject gRNA molecule, e.g., a modified or candidate Cpf1 molecule, is compared. For example, a Cpf1 molecule may be characterized as having 10% or less of the nuclease activity of the reference Cpf1 molecule. Examples of reference Cpf1 molecules include naturally occurring, unmodified Cpf1 molecules, such as the Cpf1 molecule of Acidaminococcus spp. (e.g., strain BV3L6 ("AsCpf1")) or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")), as described in Zetsche et al., Cell (2015); 163:759-771. In certain embodiments, a reference Cpf1 molecule is a naturally occurring Cpf1 molecule that has the closest sequence identity or homology to the Cpf1 molecule to which it is being compared. In certain embodiments, a reference Cpf1 molecule is a sequence, such as a naturally occurring or known sequence, e.g., a parent form to which changes, such as mutations, have been made.

[0109] "Substituted" or "replaced," as used herein in reference to molecular modification, does not necessarily imply a limitation on the process, but merely that a replacement entity is present.

[0110] "Small molecule," as used herein, refers to a compound having a molecular weight of less than about 2 kD, for example, less than about 2 kD, less than about 1.5 kD, less than about 1 kD, or less than about 0.75 kD.

[0111] "Subject," as used herein, can mean either a human or a non-human animal. The term includes, but is not limited to, mammals (e.g., humans, other primates, pigs, rodents (e.g., mice and rats or hamsters), rabbits, guinea pigs, cows, horses, cats, dogs, sheep, and goats). In certain embodiments, the subject is a human. In certain embodiments, the subject is poultry.

[0112] "Treat," "treating," and "treatment," as used herein, refer to the treatment of a disease in a mammal, e.g., a human, including, for example, (a) inhibiting the disease, i.e., arresting or preventing its progression; (b) palliating the disease, i.e., causing regression of the disease state; and (c) curing the disease.

[0113] "X," as used herein in the context of an amino acid sequence, refers to any amino acid (eg, any of the 20 naturally occurring amino acids) unless otherwise specified.

[0114] Improving cancer immunotherapy In one embodiment, the compositions and methods disclosed herein can be used to affect the proliferation of engineered T cells by modifying one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. For engineered T cells to mount an effective anti-tumor response, they must: 1) proliferate appropriately following transfer into a subject to provide a sufficient number of specific tumor-targeting T cells; 2) survive long enough to maintain the necessary anti-tumor activity in the subject; and 3) avoid the influence of inhibitory factors produced by immune cells, tumor cells, and other cells in the tumor environment so that the engineered T cells maintain a functional anti-tumor phenotype. Poor proliferation and / or survival, as well as sensitivity to inhibitory factors, can contribute to the lack of efficacy of engineered T cells in subjects with cancer. The methods and compositions disclosed herein address these issues to improve the efficacy of engineered T cells as cancer therapy.

[0115] In certain embodiments, the compositions and methods disclosed herein can be used to modify the CBLB gene to affect the proliferation of engineered T cells. In certain embodiments, reduced or absent expression of the Casitas B-lineage lymphoma b protein (encoded by CBLB) is believed to reduce the need for exogenous interleukin signaling to promote the proliferation of engineered T cells following transfer into a subject (Stromnes, I M et al., 2010 J. Clin. Invest. 120, 3722-3734).

[0116] In certain embodiments, the compositions and methods disclosed herein can be used to modify the PTPN6 gene to affect the proliferation of genetically engineered T cells. In certain embodiments, reduced or absent expression of the Src homology region 2 domain-containing phosphatase-1 protein (encoded by PTPN6) is thought to result in increased short-term accumulation of transferred T cells, which subsequently improves anti-tumor activity (Stromnes, I M et al., 2012 J. Immunol. 189, 1812-1825).

[0117] In certain embodiments, the compositions and methods disclosed herein can be used to modify the FAS gene to affect the proliferation of genetically engineered T cells. In certain embodiments, reduced or absent Fas protein expression is believed to inhibit the induction of T cell apoptosis by Fas ligand, a factor expressed by many cancer types (Dotti, G. et al., 2005 Blood 105, 4677-4684).

[0118] In certain embodiments, the compositions and methods disclosed herein can be used to modify the BID gene to affect the proliferation of genetically engineered T cells, and reduced or absent Bid protein expression is believed to prevent the induction of T cell apoptosis following Fas pathway activation (Lei, XY et al., 2009 Immunol. Lett. 122, 30-36).

[0119] In certain embodiments, the compositions and methods disclosed herein may be used to modify the CTLA4 gene, thereby reducing the effect of immunosuppressive factors on genetically engineered T cells. In certain embodiments, reduced or absent expression of cytotoxic T-lymphocyte-associated antigen 4 (encoded by CTLA4) is believed to abrogate the induction of an unresponsive state ("anergy") following engagement of CD80 or CD86 expressed by antigen-presenting cells in the tumor environment (Shrikant, P. et al., 1999 Immunity 11, 483-493).

[0120] In certain embodiments, the compositions and methods disclosed herein may be used to modify the PDCD1 gene, thereby reducing the effects of immunosuppressive factors on genetically engineered T cells. In certain embodiments, reduced or absent expression of programmed cell death protein 1 (encoded by PDCD1) is believed to prevent T cell apoptosis induction by binding of PD1 ligands expressed by tumor cells or cells within the tumor environment (Topalian, SLet et al., 2012 N. Engl. J. Med. 366, 2443-2454).

[0121] In certain embodiments, the compositions and methods disclosed herein can be used to modify the TRAC and / or TRBC genes to improve T cell specificity and safety. In certain embodiments, reduced or absent T cell receptor (encoded by TRAC and TRBC) expression is believed to prevent graft-versus-host disease by eliminating T cell receptor recognition and host tissue responses. Thus, this approach can be used to generate "universal" T cells (Torikai et al., 2012 Blood 119, 5697-5705). In certain embodiments, reduced or absent expression of the TRAC and / or TRBC genes reduces or eliminates mispairing of endogenous T cell receptors with exogenously introduced, engineered T cell receptors, thereby improving therapeutic efficacy (Provasi et al., 2012 Nature Medicine 18, 807-815).

[0122] In certain embodiments, the compositions and methods disclosed herein can be used to improve T cell persistence by modifying the B2M gene. In certain embodiments, reduced or absent expression of beta-2-microglobulin (encoded by B2M) reduces MHC1 surface expression on T cells. Because "foreign" peptides derived from the introduced CAR or engineered TCR can be presented by class I MHC on the surface of engineered T cells, removal of beta-2 microglobulin can reduce the likelihood of host rejection of infused engineered T cells, resulting in hypoimmunogenic cells for adoptive immunotherapy (Mandal et al., Cell Stem Cell, 2014). In certain embodiments, reduced or absent expression of beta-2-microglobulin is used to generate "readily available" engineered T cells for allotransplantation (Riolobos et al., Mol. Ther., 2013).

[0123] In certain embodiments, the compositions and methods disclosed herein can be used to reduce one or more genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes to improve cancer immunotherapy treatment using engineered T cells.

[0124] Disclosed herein is an approach to treating cancer through immunotherapy using the compositions and methods described herein.

[0125] In one approach, one or more genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes are targeted for targeted knockout to, for example, affect T cell proliferation, survival, function, and / or persistence. In certain embodiments, the approach involves knocking out one T cell-expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. In certain embodiments, the approach involves knocking out two T cell-expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out three T cell-expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out four T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out five T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out six T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out seven T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes. In certain embodiments, the approach involves knocking out eight T cell expressed genes selected from the group consisting of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC genes.

[0126] In certain embodiments, the method includes initiating treatment of the subject after disease onset, hi certain embodiments, the method includes initiating treatment of the subject sufficiently after disease onset, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 24, or 36 months after onset of cancer.

[0127] In certain embodiments, the methods involve initiating treatment of a subject at an advanced stage of the disease.

[0128] Overall, initiating treatment of subjects at all stages of the disease is expected to benefit the subject.

[0129] Cancers that may be treated using the compositions and methods disclosed herein include blood cancers and solid tumors.For example, cancers that may be treated using the compositions and methods disclosed herein include, but are not limited to, lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DELL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.

[0130] Methods for modifying one or more T cell-expressed genes As disclosed herein, one or more T cell expressed genes, e.g., one or more selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, can be targeted (e.g., modified) by gene editing, e.g., using the CRISPR-Cpf1 mediated methods described herein.

[0131] The methods and compositions disclosed herein provide for targeting (e.g., modifying) T cell target loci in one or more T cell-expressed genes, e.g., one or more selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. T cell target loci can be targeted (e.g., modified) by gene editing, for example, using CRISPR-Cpf1-mediated methods to target (e.g., modify) one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0132] Disclosed herein are methods of targeting (e.g., modifying) T cell target loci in one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0133] Targeting (e.g., modifying) T cell target loci can include, for example, knocking out one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes: (a) an insertion or deletion (e.g., an NHEJ-mediated insertion or deletion) of one or more nucleotides near or within the coding region (e.g., the early coding region) of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes; or (b) is achieved by deletion (e.g., NHEJ-mediated deletion) of genomic sequences comprising at least a portion of one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0134] All approaches result in the targeting (e.g., modification) of one or more T cell expressed genes, such as the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0135] In certain embodiments, the methods described herein introduce one or more truncations near the coding region in at least one allele of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, the methods described herein introduce two or more truncations flanking at least a portion of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. The two or more truncations remove (e.g., delete) genomic sequence comprising at least a portion of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. All of the methods described herein result in the targeting (e.g., modification) of one or more T cell expressed genes, such as the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0136] Targeting (e.g., modification) of one or more T cell-expressed genes, such as FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes, can be mediated by any mechanism. Exemplary mechanisms that may be associated with modification of one or more T cell-expressed genes, such as FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes, include, but are not limited to, non-homologous end joining (e.g., classical or alternative), microhomology-mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template-mediated), and synthesis-dependent strand annealing (SDSA).

[0137] Knockout of one or more T cell-expressed genes by introducing insertions or deletions In certain embodiments, the method comprises introducing an insertion or deletion of another nucleotide near (e.g., in the early coding region) a T cell targeted knockout position in one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. As described herein, in certain embodiments, the method comprises introducing one or more breaks (e.g., double-strand breaks) into the T cell targeted knockout position, e.g., in the coding region (e.g., in the early coding region, e.g., within 500 bp of the start codon, or in the remaining coding sequence, e.g., the first 500 bp downstream of the start codon) of one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, NHEJ-mediated repair of the breaks allows NHEJ-mediated introduction of an indel near or within the T cell targeted knockout position.

[0138] In certain embodiments, a double-stranded break is introduced (e.g., positioned by a single gRNA molecule) at or near the T cell target knockout location in one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, a single gRNA molecule (e.g., with Cpf1 nuclease) is used to create a double-stranded break at or near the T cell target knockout location, e.g., in a coding region (e.g., in the early coding region, e.g., within 500 bp of the start codon, or in the remaining coding sequence, e.g., the first 500 bp downstream from the start codon). In certain embodiments, the break is positioned to avoid undesired target chromosomal elements, e.g., repetitive elements, e.g., Alu repeats.

[0139] In certain embodiments, two sets of cuts (e.g., two double-stranded breaks) are introduced (e.g., positioned by two gRNA molecules) at or near the T cell target knockout location in one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, two gRNA molecules (e.g., one or two Cpf1 nucleases) are used to create two double-stranded breaks that flank the T cell target knockout location, e.g., a coding region (e.g., the early coding region, e.g., within 500 bp of the start codon, or the remaining coding sequence, e.g., the first 500 bp downstream of the start codon). In certain embodiments, the gRNA molecules are configured such that both sets of cuts are positioned upstream or downstream of the T cell target knockout location. In certain embodiments, the gRNA molecule is configured such that one set of cuts is placed upstream of the T cell target knockout location and a second set of cuts is placed downstream thereof, in certain embodiments, the cuts are positioned to avoid undesired target chromosomal elements, e.g., repetitive elements, e.g., Alu repeats.

[0140] In certain embodiments, two or more (e.g., three or four) gRNA molecules are used with one Cpf1 molecule. In certain embodiments, when two or more (e.g., three or four) gRNAs are used with two or more Cpf1 molecules, at least one Cpf1 molecule is derived from a different species than the other Cpf1 molecules. For example, when two gRNA molecules are used with two Cpf1 molecules, one Cpf1 molecule may be derived from one species and the other Cpf1 molecule may be derived from a different species. If desired, both Cpf1 species are used to generate a double-stranded break.

[0141] When multiple genes are targeted for modification in a cell, the targeted nucleic acids can be modified, e.g., cleaved, by one or more Cpf1 proteins (e.g., Cpf1 nucleases). For example, if two genes are targeted for modification, e.g., both genes are targeted for knockout, the same or different Cpf1 proteins can be used to target each gene. In certain embodiments, both genes (or each gene targeted in a cell) are cleaved by Cpf1 nuclease to generate double-stranded breaks. In certain embodiments, both genes (or each gene targeted in a cell) are cleaved by Cpf1 nuclease to generate double-stranded breaks. In certain embodiments, one or more genes in a cell can be modified by cleavage with Cpf1 nuclease. When two or more Cpf1 proteins are used to cleave target nucleic acids, e.g., different genes, in a cell, the Cpf1 proteins can be derived from different bacterial species. For example, one or more genes in a cell may be modified by cleavage with a Cpf1 protein from one bacterial species, and one or more genes in the same cell may be modified by cleavage with a Cpf1 protein from a different bacterial species. In certain embodiments, when two or more Cpf1 proteins from different species are used, they may be delivered simultaneously or sequentially to control cleavage specificity in a desired gene at a desired location in a target nucleic acid.

[0142] In certain embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite strands of the target nucleic acid molecule. In certain embodiments, the gRNA molecule and the second gRNA molecule are configured so that the PAM faces outward.

[0143] Knockout of one or more T cell expressed genes by deletion (e.g., NHEJ-mediated deletion) of genomic sequences that include at least a portion of one or more T cell expressed genes. In certain embodiments, the methods involve introducing a deletion of a genomic sequence comprising at least a portion of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. As described herein, in certain embodiments, the methods involve introducing two double-stranded breaks, one 5' and the other 3' to (i.e., flanking) the T cell-targeted knockout location. In certain embodiments, two gRNAs, e.g., unimolecular (or chimeric) or modular gRNA molecules, are configured to position the two sets of breaks (e.g., two double-stranded breaks) on opposite sides of the T cell-targeted knockout location in one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0144] In certain embodiments, the methods include deleting (e.g., NHEJ-mediated deletion) a genomic sequence comprising at least a portion of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. As described herein, in certain embodiments, the methods include introducing two sets of breaks (e.g., a pair of double-stranded breaks) flanking a region (e.g., a coding region (e.g., an early coding region)) or a non-coding region (e.g., a promoter region, an enhancer region, an intron, a 3'UTR, and / or a polyadenylation signal sequence) in one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, NHEJ-mediated repair of the break allows for modification of one or more T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes, as described herein, which reduces or eliminates expression of the gene, e.g., to knock out one or both alleles of one or more T cell expressed genes.

[0145] In certain embodiments, two sets of cuts (e.g., two double-stranded cuts) are introduced (e.g., positioned by two gRNA molecules) at or near the T cell target knockout locus in one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes. In certain embodiments, two gRNA molecules (e.g., together with one or two Cpf1 nucleases) are used to generate the two sets of cuts to flank the T cell target knockout locus; e.g., the gRNA molecules are configured such that one set of cuts is positioned upstream and the second set of cuts is positioned downstream of the T cell target knockout locus. In certain embodiments, the cuts are positioned to avoid undesired target chromosomal elements, e.g., repetitive elements, e.g., Alu repeats.

[0146] In certain embodiments, two or more (e.g., three or four) gRNA molecules are used with one Cpf1 molecule. In certain embodiments, when two or more (e.g., three or four) gRNAs are used with two or more Cpf1 molecules, at least one Cpf1 molecule is derived from a different species than the other Cpf1 molecules. For example, when two gRNA molecules are used with two Cpf1 molecules, one Cpf1 molecule may be derived from one species and the other Cpf1 molecule may be derived from a different species. If desired, both Cpf1 species are used to generate a double-stranded break.

[0147] When multiple genes are targeted for modification in a cell, the targeted nucleic acids can be modified, e.g., cleaved, by one or more Cpf1 proteins (e.g., Cpf1 nucleases). For example, if two genes are targeted for modification, e.g., both genes are targeted for knockout, the same or different Cpf1 proteins can be used to target each gene. In certain embodiments, both genes (or each gene targeted in a cell) are cleaved by Cpf1 nuclease to generate double-stranded breaks. In certain embodiments, both genes (or each gene targeted in a cell) are cleaved by Cpf1 nuclease to generate double-stranded breaks. In certain embodiments, one or more genes in a cell can be modified by cleavage with Cpf1 nuclease. When two or more Cpf1 proteins are used to cleave target nucleic acids, e.g., different genes, in a cell, the Cpf1 proteins can be derived from different bacterial species. For example, one or more genes in a cell may be modified by cleavage with a Cpf1 protein from one bacterial species, and one or more genes in the same cell may be modified by cleavage with a Cpf1 protein from a different bacterial species. In certain embodiments, when two or more Cpf1 proteins from different species are used, they may be delivered simultaneously or sequentially to control cleavage specificity in a desired gene at a desired location in a target nucleic acid.

[0148] In certain embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite strands of the target nucleic acid molecule. In certain embodiments, the gRNA molecule and the second gRNA molecule are configured so that the PAM faces outward.

[0149] In certain embodiments, adoptive transfer of genetically engineered T cells may provide a potential treatment for cancer. A gene encoding a cell surface receptor is inserted into the T cells. The genetically engineered T cells can detect tumor-associated antigens, which can be used to distinguish tumor cells from most normal tissues.

[0150] Knockout of one or two alleles of a target gene (e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC gene) may be performed after disease onset, but is preferably performed early in the disease course.

[0151] I.gRNA molecule As used herein, the term "gRNA molecule" refers to a nucleic acid that facilitates specific targeting or homing of a gRNA molecule / Cpf1 molecule complex to a target nucleic acid. A gRNA molecule can be unimodular (having a single RNA molecule, also referred to as a "unimolecule," e.g., a chimeric gRNA), or modular (comprising multiple, typically two, separate RNA molecules). In certain embodiments, the gRNA molecule is a unimodular gRNA.

[0152] In certain embodiments, the gRNA molecule comprises, from 5' to 3': a direct repeat domain and a targeting domain as shown in Figure 1. In certain embodiments, the gRNA molecule is 15-100 (e.g., 15-30, 30-50, 50-70, 70-80, or 80-100) nucleotides in length. In certain embodiments, the gRNA molecule is 30-50 (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides in length. In certain embodiments, the gRNA molecule is 38 nucleotides in length. In certain embodiments, the gRNA molecule is 39 nucleotides in length. In certain embodiments, the gRNA molecule is 40 nucleotides in length. In certain embodiments, the gRNA molecule is 41 nucleotides in length. In certain embodiments, the gRNA molecule is 42 nucleotides in length. In certain embodiments, the gRNA molecule is 43 nucleotides in length. In certain embodiments, the gRNA molecule is 44 nucleotides in length. In certain embodiments, the gRNA molecule is 45 nucleotides in length.

[0153] Direct repeat domains In certain embodiments, the direct repeat domain is 10 to 30 (e.g., 10 to 15, 15 to 20, 20 to 25, or 20 to 30) nucleotides in length. In certain embodiments, the direct repeat domain is 15 to 25 (e.g., 15 to 20, or 20 to 25) nucleotides in length. In certain embodiments, the direct repeat domain is 15 to 20 (e.g., 15, 16, 17, 18, 19, or 20) nucleotides in length. In certain embodiments, the direct repeat domain is 20 to 25 (e.g., 20, 21, 22, 23, 24, or 25) nucleotides in length. In certain embodiments, the direct repeat domain is 20 nucleotides in length. In certain embodiments, the direct repeat domain is 21 nucleotides in length.

[0154] In a particular embodiment, the direct repeat domain comprises the nucleotide sequence set forth in SEQ ID NO: 3708, which is described below. UAAUUUCUACUCUUGUAGAU [SEQ ID NO: 3708]

[0155] In a particular embodiment, the direct repeat domain comprises the nucleotide sequence set forth in SEQ ID NO: 3709, which is described below. UAAUUUCUACUAAGUGUAGAU [SEQ ID NO: 3709]

[0156] In a particular embodiment, the direct repeat domain comprises the nucleotide sequence set forth in SEQ ID NO: 3710, which is described below. GAAUUUCUACUAUUGUAGAU [SEQ ID NO: 3710]

[0157] The gRNA molecule AsCpf1 comprises a direct repeat domain comprising the nucleotide sequence set forth in SEQ ID NO:3708.

[0158] The gRNA molecule LbCpf1 contains a direct repeat domain comprising the nucleotide sequence set forth in SEQ ID NO: 3709.

[0159] The gRNA molecule Lb2Cpf1 contains a direct repeat domain comprising the nucleotide sequence set forth in SEQ ID NO: 3710.

[0160] In certain embodiments, the direct repeat domain comprises one single stem loop.

[0161] In certain embodiments, the direct repeat domain comprises a nucleotide sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous to the sequence set forth in SEQ ID NO:3708, SEQ ID NO:3709, or SEQ ID NO:3710.

[0162] In certain embodiments, the direct repeat domain comprises a nucleotide sequence comprising at least one modification of the sequence set forth in SEQ ID NO:3708, SEQ ID NO:3709, or SEQ ID NO:3710. The modification does not substantially interfere with, or does not interfere with, or result in, the cleavage activity of the gRNA molecule. In certain embodiments, the at least one modification is selected from an insertion, a deletion, a mutation, and a combination thereof. In certain embodiments, the at least one modification is in the stem-loop that preserves the RNA duplex. In certain embodiments, the at least one modification comprises at least one mutation. In certain embodiments, the at least one modification does not disrupt the stem-loop duplex structure. In certain embodiments, the at least one modification is not within the last three nucleotides of the 3' end of the sequence set forth in SEQ ID NO:3708, SEQ ID NO:3709, or SEQ ID NO:3710. In certain embodiments, the at least one modification is not within the last two nucleotides of the 3' end of the sequence set forth in SEQ ID NO:3708, SEQ ID NO:3709, or SEQ ID NO:3710. In certain embodiments, at least one modification is absent from the last nucleotide at the 3' end of the sequence set forth in SEQ ID NO: 3708, SEQ ID NO: 3709, or SEQ ID NO: 3710. In certain embodiments, the direct repeat domain comprises or has no more than five modifications, no more than four modifications, no more than three modifications, no more than two modifications, or one modification. In certain embodiments, the direct repeat domain comprises or has one, two, three, four, or five modifications.

[0163] Targeted Domains The targeting domain of the gRNA of the present disclosure is complementary to a targeting domain on a target nucleic acid. In certain embodiments, the targeting domain is complementary to a target nucleic acid in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC gene, for example, the targeting domain has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3707. Guidance on selecting a targeting domain can be found, for example, in Zetsche et al., Cell (2015); 163: 759-771.

[0164] In certain embodiments, the targeting domain comprises a nucleotide sequence that is complementary to a target sequence on a target nucleic acid, e.g., at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% complementary, e.g., fully complementary. Because the targeting domain is part of an RNA molecule, it will contain the base uracil (U), while any DNA encoding the gRNA molecule will contain the base thymine (T). In certain embodiments, the complementarity of the targeting domain to the target sequence contributes to the specificity of the interaction of the gRNA molecule / Cpf1 molecule complex with the target nucleic acid. In certain embodiments, in a targeting domain and target sequence pair, a uracil base in the targeting domain pairs with an adenine base in the target sequence. In certain embodiments, the targeting domain is 5 to 50 (e.g., 5 to 10, 10 to 20, 20 to 30, 30 to 40, or 40 to 50) nucleotides in length. In certain embodiments, the targeting domain is 15 to 30 (e.g., 15 to 25 or 25 to 30) nucleotides in length. In certain embodiments, the targeting domain is 15 to 25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.

[0165] In certain embodiments, the targeting domain is 18 nucleotides in length. In certain embodiments, the targeting domain is 19 nucleotides in length. In certain embodiments, the targeting domain is 20 nucleotides in length. In certain embodiments, the targeting domain is 21 nucleotides in length. In certain embodiments, the targeting domain is 22 nucleotides in length. In certain embodiments, the targeting domain is 23 nucleotides in length. In certain embodiments, the targeting domain is 24 nucleotides in length.

[0166] Typically, a targeting domain has perfect complementarity to the target sequence. In certain embodiments, a targeting domain has or includes 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides that are not complementary to the corresponding nucleotides of the targeting domain.

[0167] In certain embodiments, the targeting domain comprises 1, 2, 3, 4, or 5 nucleotides that are complementary to corresponding nucleotides in the targeting domain within 5 nucleotides of its 5' end. In certain embodiments, the targeting domain comprises 1, 2, 3, 4, or 5 nucleotides that are complementary to corresponding nucleotides in the targeting domain within 5 nucleotides of its 3' end.

[0168] In certain embodiments, the targeting domain comprises 1, 2, 3, or 4 nucleotides within 5 nucleotides of its 5' end that are not complementary to the corresponding nucleotides in the targeting domain. In certain embodiments, the targeting domain comprises 1, 2, 3, or 4 nucleotides within 5 nucleotides of its 3' end that are not complementary to the corresponding nucleotides in the targeting domain.

[0169] In certain embodiments, the degree of complementarity, in combination with other properties of the gRNA, is sufficient to allow targeting of the Cpf1 molecule to the target nucleic acid.

[0170] In certain embodiments, the targeting domain includes two consecutive nucleotides that are not complementary to the targeting domain ("non-complementary nucleotides"), such as, for example, two consecutive non-complementary nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.

[0171] In certain embodiments, no two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are complementary to the targeting domain.

[0172] In certain embodiments, non-complementary nucleotides are present within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or in a region more than 5 nucleotides away from one or both ends of the targeting domain.

[0173] In certain embodiments, the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3707.

[0174] Any of the targeting domains set forth in SEQ ID NOs: 1-63 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the PDCD1 gene.

[0175] Any of the targeting domains set forth in SEQ ID NOs: 64-370 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the CTLA4 gene.

[0176] Any of the targeting domains set forth in SEQ ID NOs: 371-503 can be used together with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the PTPN6 gene.

[0177] Any of the targeting domains set forth in SEQ ID NOs: 504-2325 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the CBLB gene.

[0178] Any of the targeting domains set forth in SEQ ID NOs: 2326-3094 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the FAS gene.

[0179] Any of the targeting domains set forth in SEQ ID NOs: 3095-3283 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1")) or strain MA2020 ("Lb2Cpf1")) to knock out the B2M gene.

[0180] Any of the targeting domains set forth in SEQ ID NOs: 3284-3385 ​​can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the BID gene.

[0181] Any of the targeting domains set forth in SEQ ID NOs: 3386-3588 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")), or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the TRAC gene.

[0182] Any of the targeting domains set forth in SEQ ID NOs: 3589-3707 can be used in conjunction with Cpf1 from Acidaminococcus species (e.g., strain BV3L6 ("AsCpf1")) or Lachnospiraceae bacterium (strain ND2006 ("LbCpf1") or strain MA2020 ("Lb2Cpf1")) to knock out the TRBC gene.

[0183] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3433, which is described below. AGAAUCAAAAUCGGUGAAUAGGC (SEQ ID NO: 3433)

[0184] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3587, which is described below. UUUGAGAAUCAAAAUCGGUGAAU (SEQ ID NO: 3587)

[0185] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3538, which is described below. GUCUGUGAUAUACACAUCAGAAU (SEQ ID NO: 3538)

[0186] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3461, which is described below. CACAUGCAAAGUCAGAUUUGUUG (SEQ ID NO: 3461)

[0187] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3475, which is described below. CAUGUGCAAACGCCUUCAACAAC (SEQ ID NO: 3475)

[0188] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3524, which is described below. GAUUCUCAAACAAAUGUGUCACA (SEQ ID NO: 3524)

[0189] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3566, which is described below. UCUGUGAUAUACACAUCAGAAUC (SEQ ID NO: 3566)

[0190] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3517, which is described below. GAGUCUCUCAGCUGGUACACGGC (SEQ ID NO: 3517)

[0191] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3573, which is described below. UGACACAUUUGUUUGAGAAUCAA (SEQ ID NO: 3573)

[0192] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3580, which is described below. UUGCUCCAGGCCACAGCACUGUU (SEQ ID NO: 3580)

[0193] In certain embodiments, the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 3454, which is described below. AUUCUCAAACAAAUGUGUCACAA (SEQ ID NO: 3454)

[0194] In certain embodiments, the targeting domain comprises a nucleotide sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous to one sequence selected from the group consisting of SEQ ID NOs: 1-3707.

[0195] In certain embodiments, the targeting domain comprises a nucleotide sequence comprising at least one modification of a sequence selected from the group consisting of SEQ ID NOS: 1-3707. In certain embodiments, the modification is one or more modifications disclosed in Section VIII. In certain embodiments, at least one modification renders the targeting domain less susceptible to degradation or more biocompatible, e.g., less immunogenic. By way of example, the backbone of the targeting domain may be modified with phosphorothioates or other modifications described in Section VIII. In certain embodiments, the nucleotides of the targeting domain may comprise a 2' modification, e.g., a 2-acetylation, e.g., a 2' methylation, or other modifications described in Section VIII.

[0196] In certain embodiments, at least one modification is selected from insertion, deletion, mutation, and combinations thereof.In certain embodiments, the targeting domain comprises 1, 2, 3, 4, 5, 6, 7, or 8 or more modifications.In certain embodiments, the targeting domain comprises 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end.In certain embodiments, the targeting domain comprises 1, 2, 3, or 4 modifications within 5 nucleotides of its 3' end.

[0197] In certain embodiments, the targeting domain comprises a modification of two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.

[0198] In certain embodiments, any two consecutive nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are unmodified. In certain embodiments, any nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are unmodified.

[0199] Modifications in the targeting domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing candidate modifications in the system described in Section IV. gRNAs having candidate targeting domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be evaluated in the system of Section IV. Candidate targeting domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cpfl molecule system known to be functional for a selected target and evaluated.

[0200] In certain embodiments, all modified nucleotides are complementary to and can hybridize with corresponding nucleotides present in the target domain, hi certain embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 or more modified nucleotides are not complementary to or can hybridize with corresponding nucleotides present in the target domain.

[0201] II. How to design gRNA Methods for selecting, designing, and validating targeting domains for use in the gRNAs described herein are provided. Exemplary targeting domains for incorporation into gRNAs are also provided herein.

[0202] Methods for target sequence selection and validation, as well as off-target analysis, are described, for example, in Mali et al., 2013 SCIENCE 339(6121):823-826; Hsu et al. NAT BIOTECHNOL, 31(9):827-32; Fu et al., 2014 NAT BIOTECHNOL, doi:10.1038 / nbt.2808. PubMed PMID:24463574; Heigwer et al., 2014 NAT METHODS 11(2):122-3. doi:10.1038 / nmeth.2812. PubMed PMID:24481216; Bae et al., 2014 BIOINFORMATICS PubMed PMID:24463181; Xiao A et al., 2014 BIOINFORMATICS PubMed PMID:24463182. PMID:24389662; and Zetsche et al., Cell (2015); 163:759-771.

[0203] In certain embodiments, software tools can be used to optimize the selection of gRNA targeting domains within a user's target sequence, e.g., to minimize total off-target activity across the genome. Off-target activity can be other than cleavage. For example, for each possible targeting domain of a gRNA molecule to be used with a Cpf1 molecule (e.g., AsCpf1, LbCpf1, or Lb2Cpf1), the software tool can identify all possible off-target sequences across the genome that contain a specified maximum number of mismatched base pairs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). The cleavage efficiency at each off-target sequence can be predicted, e.g., using an experimentally derived weighting scheme. Other functions, such as automated reagent design for gRNA vector construction, primer design for on-target surveyor assays, and primer design for high-throughput detection and quantification of off-target cleavage via next-generation sequencing, can also be included in the tool. Candidate gRNA molecules can be evaluated by methods well known in the art or as described in Section IV.

[0204] In certain embodiments, gRNAs for use with Cpf1 molecules are identified using a DNA sequence search algorithm, such as using application-specific gRNA design software based on the public tool cas-offinder (Bae et al. Bioinformatics. 2014;30(10):1473-1475). The application-specific gRNA design software scores guides after calculating their genome-wide off-target propensity. Typically, matches ranging from perfect matches to seven mismatches are considered for guides ranging in length from 17 to 24. Once off-target sites have been computationally determined, an aggregate score is calculated for each guide and summarized in a tabular output using a web interface. In addition to identifying potential gRNA sites adjacent to a PAM sequence (e.g., a (T)xN PAM, e.g., a TTTN PAM), the software also identifies all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. The genomic DNA sequence of each gene is obtained from the UCSC Genome Browser, and the sequence is screened for repetitive elements using the publicly available RepeatMasker program. RepeatMasker searches the test DNA sequence for repetitive elements and low-complexity regions. The result is a detailed annotation of the repeats present in a given query sequence.

[0205] Following identification, gRNAs were ranked into tiers based on distance to the target site (based on identifying close matches in the human genome containing relevant PAMs). In a specific embodiment, for AsCpf1, LbCpf1, or Lb2Cpf1, the PAM is the TTTN PAM. The targeting domains for first-tier gRNA molecules target within the first 500 bp of the coding sequence downstream of the start codon in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC gene. The targeting domains for second-tier gRNA molecules target the remainder of the coding sequence of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC gene. In certain scenarios, if the coding sequence of a gene is shorter than 500 bp, all of the targeting domains of the gRNA molecules were included in the first tier. Note that the hierarchy is non-inclusive (each gRNA is listed only once for a strategy).

[0206] Table 1 provides exemplary targeting domains according to the first design and layering strategy. As an example, 18-mer, 19-mer, 20-mer, 21-mer, 22-mer, 23-mer, or 24-mer targeting domains were designed. Exemplary gRNAs (referred to by SEQ ID NO:) designed for use with AsCpf1, LbCpf-1, or Lb2Cpf1 molecules identified using this layering-based approach for knocking out the expression of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes are listed in Table 1. In certain embodiments, the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains set forth in SEQ ID NOs: 1-3707 in Table 1 can be used in conjunction with an AsCpf1, LbCpf1, or Lb2Cpf1 molecule to decrease, reduce, or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes.

[0207] JPEG2026016399000002.jpg45164

[0208] III.Cpf1 molecule Cpf1 molecules of various species can be used in the methods and compositions disclosed herein. In certain embodiments, the Cpf1 molecule is selected from an Acidaminococcus species (e.g., strain BV3L6) molecule ("AsCpf1"), a Lachnospiraceae bacterium (e.g., strain ND2006) molecule ("LbCpf1"), and a Lachnospiraceae bacterium (e.g., strain MA2020) molecule ("Lb2Cpf1").

[0209] As used herein, the term Cpf1 molecule or Cpf1 polypeptide refers to a molecule or polypeptide that can interact with a gRNA molecule and, in coordination with the gRNA molecule, home or localize to a site containing a target domain and a PAM sequence. As used herein, the terms Cpf1 molecule and Cpf1 polypeptide include naturally occurring Cpf1 molecules and engineered, altered, or modified Cpf1 molecules or Cpf1 polypeptides that differ by at least one amino acid residue from, for example, a reference sequence, e.g., a most similar naturally occurring Cpf1 molecule.

[0210] The structure of the Francisella novicida U112 Cpf1 ("FnCpf1") molecule has been determined (Zetsche et al., Cell (2015); 163:759-771). Cpf1 is a single RNA-guided endonuclease lacking a trans-activating crRNA (tracrRNA). See Zetsche (2015), incorporated by reference in its entirety. Cpf1 utilizes a short T-rich protospacer adjacent motif ("PAM") to cleave target DNA. See ibid. Cpf1 cleaves DNA via a staggered DNA double-strand break, imparting a 4-nt or 5-nt 5' overhang. See ibid. The 5' overhang can facilitate gene insertion via the non-homologous end joining (NHEJ) mechanism. AsCpf1 and LbCpf1 have been shown to exhibit nuclease activity in human cells. See ibid. Naturally occurring Cpf1 molecules contain an N-terminal mixed alpha / beta domain and a C-terminal RuvC-like endonuclease domain ("RuvC domain"). The RuvC domain contains three separate RuvC motifs: RuvC I, RuvC II, and RuvC III. Unlike Cas9, Cpf1 lacks the HNH endonuclease domain. Naturally occurring Cpf1 molecules also contain a helical region between RuvC I and RuvC II and a zinc finger-like domain between RuvC II and RuvC III. The structure of naturally occurring Cpf1 molecules is described in Zetsche (2015).

[0211] The RuvC domain contains all the catalytic residues of FnCpf1, e.g., D 917 , E 1006 , and D 1255 The RuvC domain cleaves both strands of the target DNA, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC, generating a double-stranded break.

[0212] The Cpf1 molecule or Cpf1 polypeptide of the present disclosure interacts with a guide RNA (gRNA) molecule and, in cooperation with the gRNA molecule, localizes to a site comprising a target domain and a PAM sequence. In certain embodiments, the ability of the Cpf1 molecule or Cpf1 polypeptide to interact with and cleave a target nucleic acid is PAM sequence dependent. The PAM sequence is a sequence in the target nucleic acid. In certain embodiments, cleavage of the target nucleic acid occurs upstream of the PAM sequence. In certain embodiments, cleavage of the target nucleic acid occurs downstream of the PAM sequence. Cpf1 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In certain embodiments, the PAM is a T-rich PAM. In certain embodiments, the PAM is a nucleotide sequence (T) x N, where X is 1-10 and N is A, G, C, or T. In certain embodiments, X is 2, such that the PAM is TTN. In certain embodiments, X is 3, such that the PAM is TTTN. In certain embodiments, a Cpf1 molecule (e.g., AsCpf1, LbCpf1, or Lb2Cpf1) recognizes the sequence motif TTTN and directs cleavage of a target nucleic acid sequence 1-24 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24) bp downstream from the sequence. The ability of the Cpf1 molecule to recognize the PAM sequence can be determined by an in vitro selection assay described in Pattanayak et al., NATURE BIOTECHNOLOGY (2013); 31(9): 839-843.

[0213] In certain embodiments, the Cpf1 molecule or Cpf1 polypeptide: is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous to: less than about 2%, about 5%, about 10%, about 15%, about 20%, about 30%, or about 40% of the amino acid residues differ when compared to: differs by at least 1, 2, 5, 10, or 20 amino acids, but not more than 100, 80, 70, 60, 50, 40, or 30 amino acids, from: Contains an amino acid sequence identical to: Any Cpf1 molecule sequence disclosed herein, or a naturally occurring Cpf1 molecule sequence, for example, a Cpf1 molecule from a species listed herein or described in Zetsche (2015).

[0214] In certain embodiments, the Cpfl molecule or Cpfl polypeptide is an engineered Cpfl molecule or polypeptide that differs from a reference Cpfl molecule or polypeptide. In certain embodiments, the reference Cpfl molecule or polypeptide is a naturally occurring Cpfl molecule or polypeptide. In certain embodiments, the engineered Cpfl molecule or polypeptide retains or substantially retains the nuclease (e.g., endonuclease) activity of the reference Cpfl molecule or polypeptide. In certain embodiments, the engineered Cpfl molecule or polypeptide retains at least about 70%, about 80%, about 90%, about 95%, or about 99% of the nuclease activity of the reference Cpfl molecule or polypeptide.

[0215] One or more mutations or modifications can be introduced into a reference Cpfl molecule, e.g., a naturally occurring Cpfl molecule. Such mutations or modifications can include substitutions (e.g., conservative substitutions or substitutions of non-essential amino acids); insertions; and / or deletions. As used herein, the term "non-essential" amino acid residue refers to a residue that can be modified from the wild-type sequence of a Cpfl molecule, e.g., a naturally occurring Cpfl molecule, without abolishing or substantially altering Cpfl activity (e.g., nuclease / cleavage activity). In certain embodiments, a Cpfl molecule or Cpfl polypeptide contains one or more mutations or modifications, e.g., at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50 mutations or modifications, but fewer than 200, 100, or 80 mutations or modifications, relative to a reference Cpfl molecule, e.g., a naturally occurring Cpfl molecule. The mutations and modifications can be in a mixed alpha / beta domain, a RuvC domain, or a mixture of alpha / beta and RuvC domains.

[0216] In certain embodiments, the engineered Cpf1 molecule or engineered Cpf1 polypeptide comprises cleavage properties that differ from those of a naturally occurring Cpf1 molecule, e.g., that differ from the most closely homologous naturally occurring Cpf1 molecule. For example, the Cpf1 molecule or Cpf1 polypeptide may differ from a naturally occurring Cpf1 molecule in the following ways: for example, by the ability to modulate reduced or increased double-stranded nucleic acid cleavage (endonuclease activity), e.g., compared to a naturally occurring Cpf1 molecule (e.g., AsCpf1, LbCpf-1, or Lb2Cpf1); or by the ability to cleave nucleic acid molecules, e.g., double-stranded nucleic acid molecules, being excluded.

[0217] In certain embodiments, the engineered Cpf1 molecule or Cpf1 polypeptide is, for example, a fusion of two or more different Cpf1 molecules or Cpf1 polypeptides, e.g., two or more naturally occurring Cpf1 molecules of different species, For example, a fragment of a naturally occurring Cpf1 molecule of one species may be fused to a fragment of a Cpf1 molecule of a second species.

[0218] Naturally occurring Cpfl molecules can recognize specific PAM sequences, such as the 5'-TTTN PAM sequence described above for AsCpfl, LbCpf-1, and Lb2Cpfl. In certain embodiments, engineered Cpfl molecules or engineered Cpfl polypeptides have altered PAM specificity (e.g., affect PAM recognition) compared to a reference Cpfl molecule. For example, naturally occurring Cpfl molecules can be modified, e.g., by modifying the PAM sequence, e.g., to alter the PAM recognition recognized by the Cpfl molecule or Cpfl polypeptide, thereby reducing off-target sites and / or improving specificity; or eliminating the PAM recognition requirement. In certain embodiments, Cpfl molecules can be modified, e.g., to increase the length of the PAM recognition sequence and / or improve Cpfl specificity to a high identity level, e.g., to reduce off-target sites and increase specificity. In certain embodiments, the length of the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10, or 15 amino acids in length.

[0219] Cpf1 molecules or Cpf1 polypeptides that recognize different PAM sequences and / or have reduced off-target activity can be created using directed evolution. Representative methods and systems that can be used for the directed evolution of Cpf1 molecules are described, for example, in Esvelt et al. Nature 2011, 472(7344):499-503. Candidate Cpf1 molecules can be evaluated, for example, by the methods described in Section IV.

[0220] In certain embodiments, engineered Cpf1 molecules and engineered Cpf1 polypeptides contain one or more deletions that reduce the size of the molecule, while retaining or substantially retaining (e.g., substantially not affecting or reducing) desired Cpf1 properties, such as essentially unique structure, Cpf1 nuclease activity (e.g., endonuclease activity; i.e., the ability to cleave both strands of a double-stranded nucleic acid to create a double-stranded break), and / or nucleic acid molecule, e.g., target nucleic acid or gRNA, recognition activity. The smaller the size of the engineered Cpf1 molecule, the greater the flexibility of delivery methods, thereby increasing its utility for genome editing. In certain embodiments, the engineered Cpf1 molecules and engineered Cpf1 polypeptides further contain one or more linkers, wherein the linkers are positioned between the amino acid residues flanking the deletion.

[0221] In certain embodiments, the nucleic acid composition encoding the Cpf1 molecule or Cpf1 polypeptide comprises a synthetic nucleic acid sequence. For example, the synthetic nucleic acid sequence may be chemically modified. In certain embodiments, the sequence mRNA has one or more, for example, all of the following characteristics: capping, polyadenylation, substitution with 5-methylcytidine and / or pseudouridine.

[0222] Additionally or alternatively, the synthetic nucleic acid sequence may be codon-optimized, e.g., at least one uncommon or less common codon is replaced by a common codon. For example, the synthetic nucleic acid may direct the synthesis of an optimized messenger mRNA, e.g., optimized for expression in a mammalian expression system, e.g., as described herein.

[0223] Additionally or alternatively, the nucleic acid encoding the sequence molecule or sequence polypeptide may contain a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.

[0224] An exemplary human codon-optimized nucleic acid sequence encoding AsCpf1 is shown in SEQ ID NO: 3722, which is described below. JPEG2026016399000003.jpg43154JPEG2026016399000004.jpg238154JPEG2026016399000005.jpg59154

[0225] The corresponding amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO:3722 is set forth in SEQ ID NO:3725, which is described below. JPEG2026016399000006.jpg111154

[0226] An exemplary human codon-optimized nucleic acid sequence encoding LbCpf1 is shown in SEQ ID NO: 3723, which is described below. JPEG2026016399000007.jpg42154JPEG2026016399000008.jpg238154JPEG2026016399000009.jpg42154

[0227] The corresponding amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO:3723 is set forth in SEQ ID NO:3726, which is described below. JPEG2026016399000010.jpg106154

[0228] An exemplary human codon-optimized nucleic acid sequence encoding Lb2Cpf1 is shown in SEQ ID NO: 3724, which is described below. JPEG2026016399000011.jpg66154JPEG2026016399000012.jpg238154JPEG2026016399000013.jpg14153

[0229] The corresponding amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO:3724 is set forth in SEQ ID NO:3727, which is described below. JPEG2026016399000014.jpg106154

[0230] Regions involved in Cpf1 activity, e.g., less conserved or non-conserved regions spatially distal to the interface with the target nucleic acid molecule and / or gRNA, represent candidate regions or domains for deletion that do not substantially affect or reduce Cpf1 activity.

[0231] For sequence comparison, typically one sequence serves as reference sequence, and it is compared with test sequence.When using sequence comparison algorithm, test and reference sequence are input into computer, and if necessary, partial sequence coordinates are designated, and sequence algorithm program parameters are designated.Default program parameters can be used or alternative parameters can be designated.Then, sequence comparison algorithm calculates the percent sequence identity of test sequence compared with standard sequence based on program parameters.The method of sequence alignment for comparison is well known in the art. Optimal sequence alignment for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology).

[0232] Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0233] The percent identity between two amino acid sequences can also be estimated using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4:11-17, which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent identity between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:444-453, which has been incorporated into the GAP program of the GCG software package (available at www.gcg.com), using either a Blossom62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6.

[0234] IV. Functional analysis of candidate molecules Candidate Cpf1 molecules, candidate gRNA molecules, and candidate Cpf1 molecule / gRNA molecule complexes can be evaluated by methods known in the art or as described herein. For example, a representative method for evaluating the endonuclease activity of Cpf1 molecules is described, for example, in Zetsche et al., Cell (2015); 163: 759-771.

[0235] Binding and cleavage assay: testing the endonuclease activity of Cpf1 molecules The ability of the Cpf1 / gRNA complex to bind and cleave target nucleic acids can be assessed in a plasmid cleavage assay. In this assay, synthetic or in vitro transcribed gRNA molecules are preannealed by heating to 95°C and slowly cooling to room temperature. Native or restriction-digested linearized plasmid DNA (300 ng (approximately 8 nM)) is incubated with purified Cpf1 protein molecules (50–500 nM) and gRNA (50–500 nM, 1:1) in Cpf1 plasmid cleavage buffer (20 mM HEPES pH 7.5, 150 mM KCl, 0.5 mM DTT, 0.1 mM EDTA) in the presence or absence of 10 mM MgCl2 at 37°C for 60 min. The reaction was stopped with 5x DNA loading buffer (30% glycerol, 1.2% SDS, 250 mM EDTA), separated by 0.8 or 1% agarose gel electrophoresis, and visualized by ethidium bromide staining. The resulting degradation products indicate whether the Cpf1 molecule cleaves both DNA strands or only one of the two strands. For example, linear DNA products indicate cleavage of both DNA strands. Nicked, open-circular products indicate cleavage of only one of the two strands.

[0236] Alternatively, the ability of the Cpf1 / gRNA complex to bind and cleave target nucleic acids can be assessed in an oligonucleotide DNA cleavage assay. In this assay, DNA oligonucleotides (10 pmol) are radiolabeled by incubating with 5 units of T4 polynucleotide kinase and approximately 3–6 pmol (approximately 20–40 mCi) of [γ-32P]-ATP in 1x T4 polynucleotide kinase reaction buffer in a 50 μL reaction at 37°C for 30 min. After heat inactivation (65°C for 20 min), the reaction is purified by passage through a column to remove unincorporated label. Double-stranded substrates (100 nM) are generated by annealing the labeled oligonucleotide with an equimolar amount of unlabeled complementary oligonucleotide at 95°C for 3 min, followed by slow cooling to room temperature. In the cleavage assay, gRNA molecules are annealed by heating to 95°C for 30 s, followed by slow cooling to room temperature. Cpf1 (500 nM final concentration) is preincubated with annealed gRNA molecules (500 nM) in cleavage assay buffer (20 mM HEPES pH 7.5, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 5% glycerol) in a total volume of 9 μl. The reaction is initiated by the addition of 1 μl of target DNA (10 nM) and incubated at 37 °C for 1 h. The reaction is quenched by the addition of 20 μl of loading dye (5 mM EDTA, 0.025% SDS, 5% glycerol in formamide) and heated to 95 °C for 5 min. Cleavage products are separated on a 12% denaturing polyacrylamide gel containing 7 M urea and visualized by phosphorimaging. The resulting cleavage products indicate whether the complementary strand, the non-complementary strand, or both have been cleaved.

[0237] Either or both of these assays can be used to assess the suitability of a candidate gRNA molecule or a candidate Cpf1 molecule.

[0238] Binding assay: Testing the binding of Cpf1 molecules to target DNA Representative methods for assessing the binding of Cpf1 molecules to target DNA are described, for example, in Zetsche et al., Cell (2015); 163: 759-771.

[0239] For example, in electrophoretic mobility shift assays, target DNA duplexes are formed by mixing 10 nmol of each strand in deionized water, heating to 95°C for 3 minutes, and slowly cooling to room temperature. All DNA is purified on an 8% native gel containing 1x TBE. DNA bands are visualized by UV shadowing, excised, and eluted by immersing the gel pieces in DEPC-treated H2O. The eluted DNA is ethanol precipitated and dissolved in DEPC-treated H2O. DNA samples are 5'-end labeled with T4 polynucleotide kinase using [γ-32P]-ATP for 30 minutes at 37°C. The polynucleotide kinase is heat denatured at 65°C for 20 minutes, and unincorporated radiolabel is removed using a column. Binding assays are performed in a total volume of 10 μl in a buffer containing 20 mM HEPES pH 7.5, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, and 10% glycerol. Cpf1 protein molecules are programmed with equimolar amounts of preannealed gRNA molecules and titrated from 100 pM to 1 μM. Radiolabeled DNA is added to a final concentration of 20 pM. Samples are incubated at 37°C for 1 hour and then separated at 4°C on an 8% native polyacrylamide gel containing 1x TBE and 5 mM MgCl2. The gel is dried, and the DNA is visualized by phosphorimaging.

[0240] Differential Scanning Fluorimetry (DSF) The thermal stability of the Cpf1-gRNA ribonucleoprotein (RNP) complex can be measured by DSF. This technique measures the thermal stability of a protein, which can be increased under favorable conditions, such as the addition of a binding RNA molecule, such as a gRNA.

[0241] The assay is performed using two different protocols, one to test the best stoichiometric ratio of gRNA:Cpf1 protein and the other to determine the best solution conditions for RNP formation.

[0242] To determine the best solution for forming RNP complexes, a 2 μM aqueous solution of Cpf1 plus 10× SYPRO Orange® (Life Technologies catalog number S-6650) was dispensed into a 384-well plate. Equimolar amounts of gRNA diluted in solutions of various pH levels and salt were then added. After a 10-second incubation at room temperature and a brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C was run with a 1°C temperature increase every 10 seconds using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler with Bio-Rad CFX Manager software.

[0243] The second assay consisted of mixing various concentrations of gRNA with 2 μM Cpf1 in the optimal buffer from Assay 1 above and incubating for 10 seconds at room temperature in a 384-well plate. An equal volume of optimal buffer + 10x SYPRO Orange® (Life Technologies catalog number S-6650) was added, and the plate was sealed with Microseal® B adhesive (MSB-1001). Following a brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C was run with a 1°C temperature increase every 10 seconds using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler with Bio-Rad CFX Manager software.

[0244] V. Genome Editing Approaches In general, it is understood that the modification of any gene according to the method described herein can be mediated by any mechanism, and any method is not limited to a specific mechanism.Representative mechanisms that may be involved in gene modification include, but are not limited to, non-homologous end joining (e.g., classical or alternative), microhomology-mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template-mediated), and SDSA (synthesis-dependent strand annealing).Described herein is a representative method for targeting knockout of one or both alleles of FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6, B2M, TRAC, and / or TRBC genes using NHEJ (see Section V.1).In certain embodiments, it is further contemplated that the disclosed method may target two or more of FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6, B2M, TRAC, and TRBC genes for knockout.

[0245] V.1 NHEJ Approaches for Gene Targeting As described herein, nuclease-induced non-homologous end joining (NHEJ) can be used to perform target gene-specific knockout. Nuclease-induced NHEJ can also be used to remove (e.g., delete) sequence insertions in a gene of interest.

[0246] In certain embodiments, genome modifications associated with the methods described herein are believed to depend on nuclease-induced NHEJ and the error-prone nature of the NHEJ repair pathway. NHEJ repairs double-strand breaks in DNA by joining the two ends together; however, the original sequence is usually restored only if the two identical, compatible ends formed by the double-strand break are perfectly ligated. The DNA ends of the double-strand break are often subjected to enzymatic processing, resulting in the addition or removal of nucleotides from one or both strands prior to rejoining of the ends. This results in the presence of insertion and / or deletion (indel) mutations of DNA sequences at the NHEJ repair site. Two-thirds of these mutations typically alter the reading frame, thus resulting in non-functional proteins. In addition, mutations that maintain the reading frame but insert or delete significant amounts of sequence can disrupt protein functionality. This is locus-dependent, as mutations in important functional domains of proteins are likely to be less tolerated than mutations in non-critical regions.

[0247] Indel mutations generated by NHEJ are unpredictable in nature; however, at a given cleavage site, certain indel sequences are favored and overrepresented in the population, likely due to small microhomology regions. Deletions can vary widely in length; most commonly, they range from 1 to 50 bp, but they can easily reach lengths exceeding 100 to 200 bp. Insertions tend to be shorter and often contain short sequence duplications adjacent to and surrounding the cleavage site. However, large insertions can be obtained, and in these cases, the inserted sequence is often traced to other regions of the genome or to plasmid DNA present in the cell.

[0248] Because NHEJ is a mutagenic process, it can also be used to delete small sequence motifs, unless a specific final sequence is required. When a double-strand break is targeted near a short target sequence, the repair deletion mutation caused by NHEJ often extends to the unwanted nucleotide and thus removes it. For the deletion of larger DNA fragments, two double-strand breaks, one on each side of the sequence, can be introduced, removing the entire intervening sequence and resulting in NHEJ between the ends. Both of these approaches can be used to delete specific DNA sequences; however, the error-prone nature of NHEJ may still generate indel mutations at the repair site.

[0249] For example, NHEJ-mediated indels can be used to target genes, such as coding regions, such as the early coding region of the target gene, to knock out (i.e., eliminate expression) the target gene.For example, the early coding region of the target gene includes the first exon of the coding sequence, or the sequence immediately following the transcription start site, within 500bp (for example, less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50bp) of the transcription start site.

[0250] In certain embodiments, NHEJ-mediated indels are introduced into one or more T cell expressible genes. In certain embodiments, when Cpf1 double-stranded nuclease is used to introduce mutations into two T cell expressible genes, for example, any two of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs that target both genes are provided together with Cpf1 double-stranded nuclease. In certain embodiments, when Cpf1 double-stranded nuclease is used to introduce mutations into three T cell expressible genes, for example, any three of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs that target all three genes are provided together with Cpf1 double-stranded nuclease. In certain embodiments where Cpf1 double-stranded nuclease is used to introduce mutations into four T cell expressed genes, e.g., any four of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs targeting all four genes are provided along with the Cpf1 double-stranded nuclease. In certain embodiments where Cpf1 double-stranded nuclease is used to introduce mutations into five T cell expressed genes, e.g., any five of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs targeting all five genes are provided along with the Cpf1 double-stranded nuclease. In certain embodiments in which Cpf1 double-stranded nuclease is used to introduce mutations into any six of six T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs targeting all six genes are provided along with the Cpf1 double-stranded nuclease.In certain embodiments where Cpf1 double-stranded nuclease is used to introduce mutations into any seven of seven T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs targeting all seven genes are provided along with the Cpf1 double-stranded nuclease. In certain embodiments where Cpf1 double-stranded nuclease is used to introduce mutations into each of eight T cell expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes, individual gRNAs or gRNA pairs targeting all eight genes are provided along with the Cpf1 double-stranded nuclease.

[0251] Positioning of double-strand breaks relative to target locations In certain embodiments in which a gRNA and Cpf1 nuclease create a double-stranded break for the purpose of inducing NHEJ-mediated indels, the gRNA, e.g., a unimodular gRNA molecule, is configured to place a single double-stranded break near the nucleotide at the target position. In certain embodiments, the cleavage site is 0 to 30 bp away from the target position (e.g., less than 30 bp, less than 25 bp, less than 20 bp, less than 15 bp, less than 10 bp, less than 9 bp, less than 8 bp, less than 7 bp, less than 6 bp, less than 5 bp, less than 4 bp, less than 3 bp, less than 2 bp, or less than 1 bp away from the target position). In certain embodiments, the cleavage site is 1 to 24 bp away from the target position.

[0252] Double-stranded cleavage Cpf1 molecule can be used in the methods and compositions described herein to generate bilateral cleavage at target position.Double-stranded cleavage can be generated on both sides of target position to remove the nucleic acid sequence between two cleavage (for example, delete the region between two cleavage).In certain embodiments, two gRNAs are configured to place double-stranded cleavage on both sides of target position.

[0253] V.2 gRNA and Cpf1 molecules in genome editing methods The gRNA molecules disclosed herein (e.g., those disclosed in Section I) can be used with the Cpfl molecules disclosed herein (e.g., those disclosed in Section III) to create a double-stranded break and alter the sequence of a target nucleic acid, e.g., a target location or a target genetic signature. In certain embodiments, for example, when targeting a Cpfl molecule to create a double-stranded break, the gRNA positions the double-stranded break (i) within 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location, or (ii) sufficiently close that the target location is within the region of end resection.

[0254] VI. Target cells For example, Cpf1 molecules and gRNA molecules, such as Cpf1 molecule / gRNA molecule complexes, can be used to engineer cells, e.g., to edit target nucleic acids in a wide variety of cells.

[0255] In certain embodiments, cells are engineered by editing (e.g., inducing mutations in) one or more target genes, e.g., as described herein. In certain embodiments, the expression of one or more target genes (e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes) is modulated. In certain embodiments, cells are engineered ex vivo by editing (e.g., inducing mutations in) one or more target genes and / or modulating the expression of one or more target genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes, and administered to a subject. Sources of target cells for ex vivo engineering include, for example, the subject's blood, the subject's umbilical cord blood, or the subject's bone marrow. Sources of target cells for ex vivo engineering also include, for example, xenogeneic donor blood, umbilical cord blood, or bone marrow.

[0256] The molecules Cpf1 and gRNA described herein can be delivered to target cells. In certain embodiments, the target cells are T cells such as CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, natural killer T cells (NKT cells), regulatory T cells (Treg), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells) or dendritic cells. In certain embodiments, the target cell is an iPS cell, or a cell derived from an iPS cell, e.g., an induced pluripotent stem (iPS) cell, that has been generated from a subject and engineered, modified (e.g., mutagenized), or has had the expression of one or more target genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC genes, manipulated, for example, to differentiate into a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, a central memory T cell, or an effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell, or a hematopoietic stem cell.

[0257] In certain embodiments, the target cells are modified to contain specific T cell receptor (TCR) genes (e.g., TRAC and TRBC genes). In certain embodiments, the TCR has binding specificity for a tumor-associated antigen, such as carcinoembryonic antigen (CEA), GP100, melanoma antigen recognized by T cells 1 (MART1), melanoma antigen A3 (MAGEA3), NYESO1, or p53.

[0258] In certain embodiments, the target cells are modified to contain a specific chimeric antigen receptor (CAR). In certain embodiments, the CAR has binding specificity for a tumor-associated antigen, such as CD19, CD20, carbonic anhydrase IX (CAIX), CD171, CEA, ERBB2, GD2, alpha-folate receptor, Lewis Y antigen, prostate-specific membrane antigen (PSMA), or tumor-associated glycoprotein 72 (TAG72).

[0259] In certain embodiments, the target cells are engineered to bind, for example, by a TCR or CAR, to one or more of the following tumor antigens: Tumor antigens include AD034, AKT1, BRAP, CAGE, CDX2, CLP, CT-7, CT8 / HOM-TES-85, cTAGE-1, fibulin-1, HAGE, HCA587 / MAGE-C2, hCAP-G, HCE661, HER2 / neu, HLA-Cw, HOM-HD-21 / galectin-9, HOM-MEEL-40 / SSX2, HOM-RCC-3.1.3 / CAXII, HOXA7, HOXB6, Hu, HUB1, KM-HN-3, KM-KN-1, KOC1, KOC2, KOC3, LAGE-1, MAGE-1, MAGE-4a, MPP11, MSLN, NNP-1, NY-BR-1, and NY-BR-1. NY-REN-3 / NY-CO-38, NY-REN-33 / SNC6, NY-REN-43, NY-REN-65, NY-REN-9, NY-SAR-35, OGFr, PLU-1, Rab38, RBPJκ, RHAMM, SCP1, SCP-1, SSX3, SSX4, SSX5, TOP2A, TOP2B, or tyrosinase.

[0260] VII. Delivery, Formulations, and Routes of Administration Components, such as Cpf1 molecules and gRNA molecules, can be introduced into target cells in various forms using various delivery methods and formulations. See, for example, Tables 2 and 3. When Cpf1 or gRNA components are encoded as DNA for delivery, the DNA typically, but not necessarily, includes a regulatory region for expression, such as a promoter. Useful promoters for Cpf1 molecule sequences include, for example, the CMV promoter, the EF-1a promoter, the EFS promoter, the MSCV promoter, the PGK promoter, the CAG promoter, the skeletal alpha actin promoter, the muscle creatine kinase promoter, the dystrophin promoter, the alpha myosin heavy chain promoter, and the smooth muscle actin promoter. Useful promoters for gRNA sequences include, for example, the H1, 7SJ, EF-1a, tRNA, or U6 promoter. Promoters of similar or different strengths can be selected to regulate the expression of the components. The sequence encoding the Cpf1 molecule may include a nuclear localization signal (NLS), such as the SV40 NLS. In certain embodiments, the sequence encoding the Cpf1 molecule comprises at least two nuclear localization signals. In certain embodiments, the promoters of the Cpf1 molecule or the gRNA molecule may be independently inducible, tissue-specific, or cell-specific.

[0261] JPEG2026016399000015.jpg115164

[0262] Table 3 summarizes the various delivery methods for the components of the CRISPR / Cpf1 system, e.g., the Cpf1 molecular components and the gRNA molecular components, described herein.

[0263] JPEG2026016399000016.jpg176164

[0264] DNA-based delivery of Cpf1 molecules and / or one or more gRNA molecules The nucleic acid composition encoding the Cpf1 molecule and / or gRNA molecule can be administered to a subject or delivered into a cell by methods known in the art or as described herein. For example, the DNA encoding Cpf1 and / or the DNA encoding gRNA can be delivered by, for example, a vector (e.g., a viral vector or a non-viral vector), a non-vector-based method (e.g., using naked DNA or a DNA complex), or a combination thereof.

[0265] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding the gRNA is delivered by a vector (e.g., a viral vector / virus or a plasmid).

[0266] In certain embodiments, the vector comprises a sequence encoding a Cpf1 molecule and / or a gRNA molecule. In certain embodiments, the vector further comprises a sequence encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, mitochondrial localization), e.g., fused to the Cpf1 molecule sequence. For example, the vector may comprise a nuclear localization sequence (e.g., from SV40) fused to the sequence encoding the Cpf1 molecule.

[0267] For example, one or more regulatory / control elements, such as a promoter, enhancer, intron, polyadenylation signal, Kozak consensus sequence, internal ribosome entry site (IRES), 2A sequence, and splice acceptor or donor, may be included in the vector. In certain embodiments, the promoter is recognized by RNA polymerase II (e.g., a CMV promoter). In certain embodiments, the promoter is recognized by RNA polymerase III (e.g., a U6 promoter). In certain embodiments, the promoter is a regulatable promoter (e.g., an inducible promoter). In certain embodiments, the promoter is a constitutive promoter. In certain embodiments, the promoter is a tissue-specific promoter. In certain embodiments, the promoter is a viral promoter. In certain embodiments, the promoter is a non-viral promoter.

[0268] In certain embodiments, the vector or delivery vehicle is a viral vector (e.g., for recombinant virus production). In certain embodiments, the virus is a DNA virus (e.g., a dsDNA or ssDNA virus). In certain embodiments, the virus is an RNA virus (e.g., a ssRNA virus). Representative viral vectors / viruses include, for example, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), vaccinia viruses, poxviruses, and herpes simplex viruses.

[0269] In certain embodiments, the virus infects dividing cells. In certain embodiments, the virus infects non-dividing cells. In certain embodiments, the virus infects both dividing and non-dividing cells. In certain embodiments, the virus can integrate into the host genome. In certain embodiments, the virus is modified to, for example, have immunocompromise in humans. In certain embodiments, the virus is replication-competent. In certain embodiments, the virus is replication-defective, e.g., one or more coding regions for genes required for additional rounds of virion replication and / or packaging are replaced with other genes or deleted. In certain embodiments, the virus causes transient expression of Cpfl molecules and / or gRNA molecules. In certain embodiments, the virus causes persistent expression of Cpfl molecules and / or gRNA molecules, e.g., for at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 9 months, 1 year, 2 years, or permanently. The packaging capacity of the virus may vary, for example, from at least about 4 kb to at least about 30 kb, such as at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, or 50 kb.

[0270] In certain embodiments, viral vectors recognize specific cell types or tissues. For example, viral vectors can be pseudotyped with different / alternative viral envelope glycoproteins; engineered with cell-type-specific receptors (e.g., genetic modification of one or more viral envelope glycoproteins to incorporate targeting ligands, such as peptide ligands, single-chain antibodies, or growth factors); and / or engineered to have bispecific molecular bridges, one end of which recognizes a viral glycoprotein and the other end of which recognizes a moiety on the target cell surface (e.g., ligand-receptor, monoclonal antibody, avidin-biotin, and chemical linkage).

[0271] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by a recombinant retrovirus. In certain embodiments, the retrovirus (e.g., Moloney murine leukemia virus) contains a reverse transcriptase, e.g., which allows integration into the host genome. In certain embodiments, the retrovirus is replication-competent. In certain embodiments, the retrovirus is replication-defective, e.g., one or more coding regions for genes required for additional rounds of virion replication and packaging are replaced with other genes or deleted.

[0272] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by recombinant lentivirus. For example, the lentivirus is replication-defective, for example, does not contain one or more genes required for viral replication.

[0273] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by a recombinant adenovirus. In certain embodiments, the adenovirus is modified to have immunosuppression in humans.

[0274] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by recombinant AAV. In certain embodiments, the AAV does not integrate its genome into the genome of a host cell, for example, a target cell, as described herein. In certain embodiments, the AAV can integrate its genome into the genome of a host cell, for example, a target cell, as described herein. In certain embodiments, the AAV is a self-complementary adeno-associated virus (scAAV), for example, an scAAV that packages both strands that anneal together to form double-stranded DNA. AAV serotypes that can be used in the disclosed methods include AAV1, AAV2, modified AAV2 (e.g., modified with Y444F, Y500F, Y730F, and / or S662V), AAV3, modified AAV3 (e.g., modified with Y705F, Y731F, and / or T492V), AAV4, AAV5, AAV6, modified AAV6 (e.g., modified with S663V and / or T492V), AAV8, AAV8.2, AAV9, AAV rhl0; pseudotyped AAVs, such as AAV2 / 8, AAV2 / 5, and AAV2 / 6, can also be used in the disclosed methods. In certain embodiments, the AAV capsid that may be used in the methods described herein is a capsid sequence from serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, AAV.rh64R1, or AAV7m8.

[0275] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding the gRNA is delivered in a re-engineered AAV capsid, which has, for example, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence homology to capsid sequences from serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh32 / 33, AAV.rh43, or AAV.rh64R1.

[0276] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by a chimeric AAV capsid. Exemplary chimeric AAV capsids include, but are not limited to, AAV9i1, AAV2i8, AAV-DJ, AAV2G9, AAV2i8G9, or AAV8G9.

[0277] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding the gRNA is delivered by a hybrid virus, e.g., a hybrid of one or more of the viruses described herein. In certain embodiments, the hybrid virus is a hybrid of AAV (e.g., of any AAV serotype) with bocavirus, B19 virus, porcine AAV, goose AAV, feline AAV, canine AAV, or MVM.

[0278] Packaging cells are used to form viral particles capable of infecting target cells. Examples of such cells include 293 cells, which can package adenovirus, and ψ2 or PA317 cells, which can package retrovirus. Viral vectors used in gene therapy are usually generated by producer cell lines that package nucleic acid vectors into viral particles. The vector typically contains minimal viral sequences necessary for packaging and, if applicable, subsequent integration into host or target cells; other viral sequences are replaced by expression cassettes encoding proteins to be expressed, such as Cpf1. For example, AAV vectors used in gene therapy typically contain only the inverted terminal repeat (ITR) sequences from the AAV genome necessary for packaging and gene expression in host or target cells. Missing viral functions are provided in trans by the packaging cell line. The viral DNA is then packaged into a cell line containing a helper plasmid encoding other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in significant amounts due to the lack of ITR sequences. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV.

[0279] In certain embodiments, viral vectors have the ability to recognize cell types and / or tissue types. For example, viral vectors can be pseudotyped with different / alternative viral envelope glycoproteins; engineered with cell type-specific receptors (e.g., genetic modification of viral envelope glycoproteins to incorporate targeting ligands such as peptide ligands, single-chain antibodies, growth factors, etc.); and / or engineered with bispecific molecular bridges that recognize viral glycoproteins at one end and target cell surface moieties at the other end (e.g., ligand receptors, monoclonal antibodies, avidin-biotin, and chemical linkages).

[0280] In certain embodiments, viral vectors achieve cell-type-specific expression. For example, tissue-specific promoters can be constructed to restrict transgene (Cpf1 and gRNA) expression only in specific target cells. Vector specificity can also be mediated by microRNA-dependent regulation of transgene expression. In certain embodiments, viral vectors have increased fusion efficiency between the viral vector and target cell membrane. For example, fusion-competent proteins such as hemagglutinin (HA) can be incorporated to increase viral uptake into cells. In certain embodiments, viral vectors have nuclear localization capabilities. For example, certain viruses that require nuclear membrane degradation (during cell division) and therefore do not infect non-dividing cells can be modified to incorporate a nuclear localization peptide into the viral matrix protein, thereby enabling transduction of non-proliferating cells.

[0281] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by a non-vector-based method (e.g., using naked DNA or DNA complexes). For example, the DNA can be delivered by, for example, organically modified silica or silicate (Ormosil), electroporation, transient cell compaction or squeezing (e.g., as described in Lee, et al.

[2012] Nano Lett 12:6322-27), gene gun, sonoporation, magnetofection, lipid-mediated transfection, dendrimers, inorganic nanoparticles, calcium phosphate, or a combination thereof.

[0282] In certain embodiments, delivery via electroporation comprises mixing cells with DNA encoding Cpf1 and / or gRNA in a cartridge, chamber, or cuvette and applying one or more electrical impulses of a defined duration and amplitude. In certain embodiments, delivery via electroporation is performed using a system in which cells are mixed with DNA encoding Cpf1 and / or gRNA in a container connected to a device (e.g., a pump) that supplies the mixture to the cartridge, chamber, or cuvette, in which one or more electrical impulses of a defined duration and amplitude are applied, and then the cells are delivered to a second container.

[0283] In certain embodiments, the DNA encoding Cpf1 and / or the DNA encoding gRNA is delivered by a combination of vector and non-vector-based methods. For example, virosomes contain liposomes combined with inactivated viruses (e.g., HIV or influenza viruses), which can result in more efficient gene transfer than either viral or liposomal methods alone.

[0284] In certain embodiments, the delivery vehicle is a non-viral vector. In certain embodiments, the non-viral vector is an inorganic nanoparticle. Representative inorganic nanoparticles include, for example, magnetic nanoparticles (e.g., Fe3MnO2) and silica. The outer surface of the nanoparticle can be conjugated to a positively charged polymer (e.g., polyethyleneimine, polylysine, polyserine) that allows for the attachment (e.g., conjugation or entrapment) of a payload. In certain embodiments, the non-viral vector is an organic nanoparticle. Exemplary organic nanoparticles include, for example, SNALP liposomes containing cationic lipids together with a neutral helper lipid coated with polyethylene glycol (PEG) and a protamine-nucleic acid complex coated with a lipid coating. Exemplary lipids for gene transfer are shown below in Table 4.

[0285] JPEG2026016399000017.jpg235164

[0286] Exemplary polymers for gene transfer are shown below in Table 5.

[0287] JPEG2026016399000018.jpg236164

[0288] In certain embodiments, the vehicle has targeting modifications to enhance target cell update of nanoparticles and liposomes, such as cell-specific antigens, monoclonal antibodies, single-chain antibodies, aptamers, polymers, sugars, and cell-penetrating peptides. In certain embodiments, the vehicle utilizes fusogenic and endosome-destabilizing peptides / polymers. In certain embodiments, the vehicle undergoes acid-induced conformational changes (e.g., to accelerate endosomal leakage of cargo). In certain embodiments, stimulus-cleavable polymers are used, for example, for release within cellular compartments. For example, disulfide-based cationic polymers that are cleaved in the reducing cellular environment can be used.

[0289] In certain embodiments, the delivery vehicle is a biological non-viral delivery vehicle. In certain embodiments, the vehicle is an attenuated bacterium (e.g., an attenuated bacterium that is invasive but attenuated to prevent pathology and that has been naturally or artificially modified to express the transgene (e.g., Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, etc.)). longum, and modified Escherichia coli; bacteria with nutritional and tissue-specific tropism to target specific cells; bacteria with modified surface proteins to alter target cell specificity). In certain embodiments, the vehicle is a genetically modified bacteriophage (e.g., modified phage with increased packaging capacity, less immunogenicity, containing mammalian plasmid maintenance sequences, and with incorporated targeting ligands). In certain embodiments, the vehicle is a mammalian virus-like particle. For example, modified viral particles can be generated (e.g., by "empty" particle purification followed by production of a virus with the desired cargo). (by in vitro assembly). Vehicles can also be modified to incorporate targeting ligands and alter target tissue specificity. In certain embodiments, the vehicle is a biological liposome. For example, biological liposomes are phospholipid-based particles derived from human cells (e.g., erythrocyte ghosts, which are red blood cells broken down into spherical structures derived from a subject (e.g., tissue targeting can be achieved by attachment of various tissue- or cell-specific ligands); or secreted exosomes of endocytic origin—subject-derived membrane-bound nanovesicles (30-100 nm) (e.g., which can be produced from various cell types and therefore can be taken up by cells without the need for ligand targeting).

[0290] In certain embodiments, one or more nucleic acid compositions (e.g., DNA molecules) other than the components of the CRISPR / Cpf1 system, e.g., the Cpf1 molecular components and / or gRNA molecular components described herein, are delivered. In certain embodiments, the nucleic acid composition is delivered simultaneously with one or more of the components of the CRISPR / Cpf1 system. In certain embodiments, the nucleic acid composition is delivered before or after (e.g., less than about 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, or 4 weeks) the delivery of one or more of the components of the Cpf1 system. In certain embodiments, the nucleic acid composition is delivered by a means different from that of one or more of the components of the CRISPR / Cpf1 system, e.g., the Cpf1 molecular components and / or gRNA molecular components. The nucleic acid composition can be delivered by any of the delivery methods described herein. For example, the nucleic acid molecule can be delivered by a viral vector, e.g., a retrovirus or lentivirus, and the Cpf1 and / or gRNA molecular components can be delivered by electroporation. In certain embodiments, the nucleic acid composition encodes a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, or TRBC gene.

[0291] Delivery of RNA encoding Cpf1 molecules RNA encoding a Cpf1 molecule and / or gRNA molecule can be delivered into cells, e.g., target cells described herein, by methods known in the art or as described herein. For example, RNA encoding Cpf1 and / or RNA encoding gRNA can be delivered by, e.g., microinjection, electroporation, transient cell compaction or squeezing (e.g., as described in Lee, et al.,

[2012] Nano Lett 12:6322-27), lipid-mediated transfection, peptide-mediated delivery, or a combination thereof. RNA encoding Cpf1 and / or RNA encoding gRNA can be conjugated to a molecule that promotes uptake by target cells (e.g., target cells described herein).

[0292] In certain embodiments, delivery via electroporation involves mixing cells with RNA and / or gRNA molecules encoding Cpf1 molecules in a cartridge, chamber, or cuvette and applying one or more electrical impulses of a defined duration and amplitude. In certain embodiments, delivery via electroporation is performed using a system in which cells are mixed with RNA and / or gRNA molecules encoding Cpf1 molecules in a container connected to a device (e.g., a pump) that supplies the mixture to the cartridge, chamber, or cuvette, and one or more electrical impulses of a defined duration and amplitude are applied to the cartridge, chamber, or cuvette, after which the cells are delivered to a second container. The RNA encoding Cpf1 and / or the RNA encoding gRNA may be linked to a molecule that facilitates uptake by target cells (e.g., target cells described herein).

[0293] Delivery of Cpf1 molecule protein Cpf1 molecules can be delivered into cells by methods known in the art or as described herein. For example, Cpf1 protein molecules can be delivered by, for example, microinjection, electroporation, transient cell compaction or squeezing (e.g., as described in Lee, et al.,

[2012] Nano Lett 12:6322-27), lipid-mediated transfection, peptide-mediated delivery, or a combination thereof. Delivery can involve DNA encoding a gRNA or the gRNA itself.

[0294] In certain embodiments, delivery via electroporation comprises mixing cells with or without Cpf1 molecules and gRNA molecules in a cartridge, chamber, or cuvette, and applying one or more electrical impulses of a defined duration and amplitude. In certain embodiments, delivery via electroporation is performed using a system in which cells are mixed with or without Cpf1 molecules and gRNA molecules in a container connected to a device (e.g., a pump) that supplies the mixture to the cartridge, chamber, or cuvette, in which one or more electrical impulses of a defined duration and amplitude are applied in the cartridge, chamber, or cuvette, and then the cells are delivered to a second container.

[0295] RNP delivery of Cpf1 molecule protein and gRNA In certain embodiments, the Cpf1 molecule and gRNA are delivered to target cells via ribonucleoprotein (RNP) delivery. In certain embodiments, the Cpf1 molecule is provided as a protein, and the gRNA molecule is provided as transcribed or synthesized RNA. The gRNA molecule can be produced by chemical synthesis. In certain embodiments, the gRNA molecule forms an RNP complex with the Cpf1 molecule protein under appropriate conditions prior to delivery to the target cell. In certain embodiments, the appropriate conditions include incubating the Cpf1 molecule protein and gRNA at room temperature for at least about 10 minutes. The RNP complex can be delivered to the target cell by any appropriate method known in the art, such as electroporation, lipid-mediated transfection, protein- or DNA-based shuttles, mechanical force, or hydraulic force. In certain embodiments, the RNP complex is delivered to the target cell by electroporation.

[0296] VIII. Modified Nucleosides, Nucleotides, and Nucleic Acids Modified nucleosides and modified nucleotides can be present in nucleic acids, for example, particularly gRNAs, but also in nucleic acids encoding Cpf1 molecules. The modifications disclosed in this section can be made in addition to or instead of any of the specific gRNA molecule modifications described above. As used herein, a "nucleoside" is defined as a compound containing a five-carbon sugar molecule (pentose or ribose) or a derivative thereof and one organic base, a purine or pyrimidine, or a derivative thereof. As used herein, a "nucleotide" is defined as a nucleoside that further includes a phosphate group.

[0297] Modified nucleosides and nucleotides may include one or more of the following: (i) modifications, such as, for example, substitution of one or both of the non-bonded phosphate oxygens and / or one or more of the bonded phosphate oxygens in the phosphodiester backbone linkages; (ii) modifications, such as, for example, substitutions of components of the ribose sugar, such as the 2' hydroxyl on the ribose sugar; (iii) radical replacement of the phosphate moiety with a “dephospho” linker; (iv) modification or substitution of naturally occurring nucleobases; (v) substitutions or modifications of the ribose phosphate backbone; (vi) modification of the 3' or 5' end of the oligonucleotide, such as, for example, removal, modification, or substitution of the terminal phosphate group or conjugation of a moiety; and (vii) Sugar modifications.

[0298] The above-listed modifications can be mixed to provide modified nucleosides and nucleotides that can have two, three, four or more modifications.For example, modified nucleosides or nucleotides can have modified sugars and modified nucleic acid bases.In certain embodiments, each base of gRNA is modified, for example, all bases have modified phosphate groups, for example, all are phosphorothioate groups.In certain embodiments, all or substantially all phosphate groups of single molecule or modular gRNA molecule are replaced with phosphorothioate groups.

[0299] In certain embodiments, modified nucleotides, such as, for example, nucleotides having modifications as described herein, can be incorporated into nucleic acids, such as, for example, "modified nucleic acids." In certain embodiments, a modified nucleic acid comprises one, two, three, or more modified nucleotides. In certain embodiments, at least 5% (e.g., at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%) of the positions in the modified nucleic acid are modified nucleotides.

[0300] Unmodified nucleic acids may be easily degraded, for example, by cellular nucleases. For example, nucleases may hydrolyze nucleic acid phosphodiester bonds. Thus, in one aspect, the modified nucleic acids described herein may contain one or more modified nucleosides or nucleotides, for example, to introduce stability to nucleases.

[0301] In certain embodiments, the modified nucleosides, nucleotides, and nucleic acids described herein, when introduced into a cell population, can exhibit a reduced innate immune response. The term "innate immune response" includes a cellular response to foreign nucleic acids, including single-stranded nucleic acids, generally of viral or bacterial origin, which includes the induction of cytokine expression and release, specifically interferons, and cell death. In certain embodiments, the modified nucleosides, nucleotides, and nucleic acids described herein can interfere with the binding of major groove interaction partners to nucleic acids. In certain embodiments, the modified nucleosides, nucleotides, and nucleic acids described herein, when introduced into a cell population, can exhibit a reduced innate immune response and also interfere with the binding of major groove interaction partners to nucleic acids.

[0302] Chemical Group Definition As used herein, "alkyl" is intended to refer to a straight-chain or branched-chain saturated hydrocarbon group. Examples of alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl and isopropyl), butyl (e.g., n-butyl, isobutyl, t-butyl), pentyl (e.g., n-pentyl, isopentyl, neopentyl), and the like. An alkyl group can contain 1 to about 20, 2 to about 20, 1 to about 12, 1 to about 8, 1 to about 6, 1 to about 4, or 1 to about 3 carbon atoms.

[0303] As used herein, "aryl" refers to a monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) aromatic hydrocarbon, such as, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, etc. In certain embodiments, aryl groups have from 6 to about 20 carbon atoms.

[0304] As used herein, "alkenyl" refers to an aliphatic group containing at least one double bond.

[0305] As used herein, "alkynyl" refers to a straight or branched hydrocarbon chain containing 2 to 12 carbon atoms and characterized by having one or more triple bonds. Examples of alkynyl groups include, but are not limited to, ethynyl, propargyl, and 3-hexynyl.

[0306] As used herein, "arylalkyl" or "aralkyl" refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group. Aralkyl includes groups in which two or more hydrogen atoms are replaced by aryl groups. Examples of "arylalkyl" or "aralkyl" include benzyl, 2-phenylethyl, 3-phenylpropyl, 9-fluorenyl, benzhydryl, and trityl groups.

[0307] As used herein, "cycloalkyl" refers to a cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon group having 3 to 12 carbons. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclopentyl, and cyclohexyl.

[0308] As used herein, "heterocyclyl" refers to a monovalent radical of a heterocyclic ring system. Exemplary heterocyclyls include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, pyrrolidonyl, piperidinyl, pyrrolinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, and morpholinyl.

[0309] As used herein, "heteroaryl" refers to a monovalent radical of a heterocyclic aromatic ring system. Examples of heteroaryl moieties include, but are not limited to, imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrrolyl, furanyl, indolyl, thiophenylpyrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolizinyl, purinyl, naphthyridinyl, quinolyl, and pteridinyl.

[0310] Phosphate backbone modification phosphate group In certain embodiments, the phosphate group of modified nucleotide can be modified by replacing one or more oxygen atoms with different substituents.In addition, modified nucleotide, such as the modified nucleotide present in modified nucleic acid, can comprise the complete replacement of unmodified phosphate moiety with modified phosphate as described herein.In certain embodiments, the modification of phosphate backbone can comprise the modification that produces either uncharged linker or charged linker with asymmetric charge distribution.

[0311] Examples of modified phosphate groups include phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate and phosphotriester.In certain embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following groups: sulfur (S), selenium (Se), BR3 (where R can be, for example, hydrogen, alkyl, or aryl), C (for example, alkyl group, aryl group, etc.), H, NR2 (where R can be, for example, hydrogen, alkyl, or aryl), or OR (where R can be, for example, alkyl or aryl).The phosphorous atom in an unmodified phosphate group is achiral.However, the replacement of one of the non-bridging oxygens with one of the above atoms or atom groups can make the phosphorous atom chiral; that is, the phosphorous atom in the phosphate group modified in this way is a stereocenter. The stereogenic phosphorous atom may be in either the "R" configuration (Rp herein) or the "S" configuration (Sp herein).

[0312] In phosphorodithioates, both non-bridging oxygens are replaced with sulfur. The phosphorus center of phosphorodithioates is achiral, which precludes the formation of oligoribonucleotide diastereomers. In certain embodiments, modification of one or both non-bridging oxygens can also include replacing the non-bridging oxygens with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl).

[0313] Phosphate linkers can also be modified by replacement of the bridging oxygen (i.e., the oxygen linking the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Substitutions can occur at either linking oxygen or at both linking oxygens.

[0314] Phosphate group substitution The phosphate group may be replaced by a non-phosphorus-containing connector. In certain embodiments, the charged phosphate group may be replaced by a neutral moiety.

[0315] Examples of moieties that can replace the phosphate group include, without limitation, for example, methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0316] Substitution of the ribonucleotide backbone Nucleic acid-mimicking scaffolds can also be constructed, in which the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleoside or nucleotide surrogates. In certain embodiments, the nucleobase can be anchored by the surrogate backbone. Examples include, without limitation, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0317] sugar modification Modified nucleosides and nucleotides may contain one or more modifications to the sugar. For example, the 2' hydroxyl group (OH) may be modified or replaced with several different "oxy" or "deoxy" substituents. In certain embodiments, modification of the 2' hydroxyl group may increase the stability of nucleic acids because the hydroxyl can no longer deprotonate to form a 2'-alkoxide ion. The 2'-alkoxide may catalyze decomposition by intramolecular nucleophilic attack on the linker atom.

[0318] Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CHO) nand CH2CH2OR, where R can be, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In certain embodiments, the "oxy"-2' hydroxyl group modification can include "locked" nucleic acids (LNAs), in which the 2' hydroxyl is, for example, C 1~6 Alkylene or C 1~6 They may be linked to the 4' carbon of the same ribose sugar by a heteroalkylene bridge, representative bridges being methylene, propylene, ether, or amino bridges; O-amino (where amino can be, for example, NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino); and aminoalkoxy, O(CH) n -amino, where amino can be, for example, NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino. In certain embodiments, "oxy"-2' hydroxyl group modifications include methoxyethyl groups (MOE), (OCHCHOCH, e.g., PEG derivatives).

[0319] "Deoxy" modifications include hydrogen (i.e., the deoxyribose sugar of, for example, the overhanging portion of a partial dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, for example, NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CHCHNH) nExamples include CH2CH2-amino (wherein amino can be, for example, as described herein), -NHC(O)R (wherein R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted with amino as described herein.

[0320] Sugars may also contain one or more carbons with the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, modified nucleic acids include, for example, nucleotides containing arabinose as the sugar. Nucleotide "monomers" may have an α-linkage at the 1' position of the sugar, such as, for example, α-nucleosides. Modified nucleic acids also include "abasic" sugars that lack the C-1' nucleobase. These abasic sugars may also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids also include one or more sugars in the L-form, such as, for example, L-nucleosides.

[0321] Generally, RNA comprises the sugar ribose, which is a five-membered ring with oxygen.Representative modified nucleosides and modified nucleotides include, but are not limited to, the replacement of oxygen in ribose (for example, with sulfur (S), selenium (Se), or alkylene, such as methylene or ethylene);Addition of double bond (for example, replacing ribose with cyclopentenyl or cyclohexenyl);Ribose ring contraction (for example, forming a four-membered ring of cyclobutane or oxetane);Ribose ring expansion (for example, forming a six- or seven-membered ring with additional carbon or heteroatom, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, morpholino, also having phosphoramidate backbone). In certain embodiments, modified nucleotides include polycyclic forms (e.g., tricyclic; and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced with a glycol unit attached to the phosphodiester bond), threose nucleic acids (TNA, in which the ribose is replaced with α-L-threofuranosyl-(3'→2')).

[0322] Modifications on nucleic acid bases The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can contain modified nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to provide modified nucleosides and modified nucleotides that can be incorporated into modified nucleic acids. The nucleobases of nucleotides can be independently selected from purines, pyrimidines, and purine or pyrimidine analogs. In certain embodiments, the nucleobases include, for example, synthetic derivatives of naturally occurring bases.

[0323] Uracil In certain embodiments, the modified nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include, without limitation, pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho). 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), uridine 5-hydroxyacetic acid (cmo 5 U), uridine 5-hydroxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm 5 U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s2U), 5-aminomethyl-2-thio-uridine (nm 5 s2U), 5-methylaminomethyl-uridine (mnm 5 U), 5-methylaminomethyl-2-thiouridine (mnm 5 s2U), 5-methylaminomethyl-2-selenium-containing uridine (mnm 5 se 2 U), 5-carbamoylmethyl-uridine (ncm 5 U), 5-carboxymethylaminomethyl-uridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouridine (cmnm 5 s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τcm 5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thiouridine (τm 5 s2U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 5-methyl-2-thiouridine (m 5 s2U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m 5 D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thiouridine (inm 5 s2U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m 5 Um), 2'-O-methyl-pseudouridine (ψm), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, pyrazolo[3,4-d]pyrimidine, xanthine, and hypoxanthine.

[0324] cytosine In certain embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include, without limitation, 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (act), 5-formyl-cytidine (f 5 C), N4-methyl-cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k 2 C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m 5 Cm), N4-acetyl-2'-O-methyl-cytidine (ac 4Cm), N4,2'-O-dimethyl-cytidine (m 4 Cm), 5-formyl-2'-O-methyl-cytidine (f 5 Cm), N4,N4,2'-O-trimethyl-cytidine (m 4 2Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine.

[0325] Adenine In certain embodiments, the modified nucleobase is a modified adenine. Representative nucleobases and nucleosides having modified adenine include, without limitation, 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenosine, 7-deaza-8-aza-adenosine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m 1 A), 2-methyl-adenosine (m 2 A), N6-methyl-adenosine (m 6 A), 2-methylthio-N6-methyl-adenosine (ms2m 6 A), N6-isopentenyl-adenosine (i 6 A), 2-methylthio-N6-isopentenyl-adenosine (ms 2 i 6 A), N6-(cis-hydroxyisopentenyl)adenosine (io 6 A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io 6 A), N6-glycinylcarbamoyl-adenosine (g 6 A), N6-threonylcarbamoyl-adenosine (t 6 A), N6-methyl-N6-threonylcarbamoyl-adenosine (m 6 t 6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms 2 g 6 A), N6,N6-dimethyl-adenosine (m 6 2A), N6-hydroxynorvalylcarbamoyl-adenosine (hn 6 A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn 6 A), N6-acetyl-adenosine (ac 6 A), 7-methyl-adenosine, 2-methylthio-adenosine, 2-methoxy-adenosine, α-thio-adenosine, 2'-O-methyl-adenosine (Am), N 6 ,2'-O-dimethyl-adenosine (m 6 Am), N 6 -methyl-2'-deoxyadenosine, N6,N6,2'-O-trimethyl-adenosine (m 6 2Am), 1,2'-O-dimethyl-adenosine (m 1 Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanone adecyl)-adenosine.

[0326] Guanine In certain embodiments, the modified nucleobase is a modified guanine. Representative nucleobases and nucleosides having a modified guanine include, without limitation, inosine (I), 1-methyl-inosine (m ... 1 I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyosine (yW), peroxywyosine (o2yW), hydroxywyosine (OHyW), and low-modified hydroxywyosine (OHyW). *), 7-deaza-guanosine, queosine (Q), epoxyqueosine (oQ), galactosyl-queosine (galQ), mannosyl-queosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), archaeosine (G + ), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m 7 G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m'G), N2-methyl-guanosine (m 2 G), N2,N2-dimethyl-guanosine (m 2 2G), N2,7-dimethyl-guanosine (m 2 ,7G), N2,N2,7-dimethyl-guanosine (m 2 ,2,7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m 2 Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m 2 2Gm), 1-methyl-2'-O-methyl-guanosine (m'Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m 2 ,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m'Im), O 6 -phenyl-2'-deoxyinosine, 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O 6 -methyl-guanosine, O 6 -methyl-2'-deoxyguanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.

[0327] Representative modified gRNA In certain embodiments, the modified nucleic acid may be a modified gRNA. It should be understood that any gRNA described herein may be modified in accordance with this section, including any gRNA containing a targeting domain comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1-3707. As discussed herein, transiently expressed or delivered nucleic acids may be prone to degradation, e.g., by cellular nucleases. Thus, in one aspect, the modified gRNA described herein may contain one or more modified nucleosides or nucleotides that introduce stability against nucleases. In certain embodiments, certain modified gRNAs described herein can elicit a reduced innate immune response from certain cells, particularly cells of the invention (e.g., T cells). As discussed above, the term "innate immune response" includes a cellular response to foreign nucleic acids, including single-stranded nucleic acids, generally of viral or bacterial origin, which includes the induction of cytokine expression and release, specifically interferon, and cell death.

[0328] For example, as discussed herein, the inventors have seen improvements in ex vivo gene editing in certain cell types (e.g., T cells) when the 5' end of a gRNA is modified by the incorporation of a eukaryotic mRNA cap structure or cap analog. The present invention encompasses the recognition that the improvements observed with 5'-capping gRNAs can be extended to gRNAs modified in other ways to achieve the same type of structural or functional result (e.g., when ex vivo transcribed gRNAs are modified by the incorporation of modified nucleosides or nucleotides, by the incorporation of a 3' polyA sequence, and / or by treatment with a phosphatase such as calf intestinal alkaline phosphatase to remove the 5' triphosphate group, etc.).

[0329] Thus, in certain embodiments, the methods and compositions discussed herein provide methods and compositions in which gRNAs are modified at or near their 5' ends (e.g., within 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides of their 5' ends). In certain embodiments, the 5' ends of the gRNAs are modified by incorporation of a eukaryotic mRNA cap structure or cap analog (e.g., a G(5')ppp(5')G cap analog, a m7G(5')ppp(5')G cap analog, or a 3'-O-Me-m7G(5')ppp(5')G anti-reverse cap analog (ARCA)), as shown in Figure 7. The cap or cap analog can be incorporated either during chemical synthesis or in vitro transcription of the gRNA. In certain embodiments, the in vitro transcribed gRNA is modified by treatment with a phosphatase (e.g., calf intestinal alkaline phosphatase) to remove the 5' triphosphate group.

[0330] In certain embodiments, the gRNA comprises a modification at or near its 3' end (e.g., within 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides of its 3' end). For example, in certain embodiments, the 3' end of the gRNA is modified by the addition of one or more (e.g., 25-200) adenine (A) residues. The polyA sequence can be included in the nucleic acid encoding the gRNA (e.g., a plasmid, a PCR product, a viral genome) or can be added to the gRNA during chemical synthesis or following in vitro transcription using a polyadenosine polymerase (e.g., E. coli poly(A) polymerase). In certain embodiments, the gRNA can be modified with a 3'-terminal U-ribose. For example, the two terminal hydroxyl groups of U ribose can be oxidized to aldehyde groups, with concomitant opening of the ribose ring resulting in the modified nucleoside shown below (shown below): JPEG2026016399000019.jpg28154, where "U" can be unmodified or modified uridine. In certain embodiments, the 3' terminal U can be modified with a 2'3' cyclic phosphate as shown below: JPEG2026016399000020.jpg35154, where "U" can be an unmodified or modified uridine. In certain embodiments, gRNA molecules may contain a 3' nucleotide, which can be stabilized against degradation, e.g., by incorporating one or more of the modified nucleotides described herein. In certain embodiments, for example, uridine can be substituted with a modified uridine, such as, for example, 5-(2-amino)propyluridine and 5-bromouridine, or any of the modified uridines described herein; adenosine and guanosine can be substituted with a modified adenosine or guanosine with a modification at the 8th position, such as, for example, 8-bromoguanosine, or any of the modified adenosines and guanosines described herein.

[0331] In certain embodiments, the gRNA comprises both a modification at or near its 5' end and a modification at or near its 3' end. In certain embodiments, the in vitro transcribed gRNA contains both a 5' cap structure or cap analog and a 3' polyA sequence. In certain embodiments, the in vitro transcribed gRNA is modified by treatment with a phosphatase (e.g., calf intestinal alkaline phosphatase) to remove the 5' triphosphate group and comprise a 3' polyA sequence.

[0332] While the foregoing focuses on terminal modifications, it is understood that the methods and compositions discussed herein may use gRNAs that include one or more modified nucleosides or nucleotides at one or more non-terminal positions and / or at one or more terminal positions in the gRNA sequence.

[0333] In certain embodiments, sugar-modified ribonucleotides may be incorporated into the gRNA, e.g., where the 2'OH group is replaced with a group selected from H, OR, R (where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), halo, SH, SR (where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), amino (where amino can be, e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or an amino acid); or cyano (CN). In certain embodiments, the phosphate backbone may be modified as described herein, e.g., with a phosphorothioate group. In certain embodiments, one or more of the nucleotides of the gRNA may each independently be a 2'-sugar modified, such as 2'-O-methyl, 2'-O-methoxyethyl; or a 2'-fluoro modified, including, for example, 2'-F or 2'-O-methyl, adenosine (A), 2'-F or 2'-O-methyl, cytidine (C), 2'-F or 2'-O-methyl, uridine (U), 2'-F or 2'-O-methyl, thymidine (T), 2'-F or 2'-O-methyl; guanosine (G), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.

[0334] In certain embodiments, gRNAs include "locked" nucleic acids (LNAs), in which the 2' OH group can be linked to the 4' carbon on the same ribose sugar, for example, by a C1-6 alkylene or C1-6 heteroalkylene bridge, representative bridges including methylene, propylene, ether, or amino bridges; O-amino (amino can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino); and aminoalkoxy or O(CH2). n -amino (amino can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino).

[0335] In certain embodiments, gRNAs include modified nucleotides that are polycyclic (e.g., tricyclic; and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, in which the ribose is replaced by a glycol unit attached to a phosphodiester bond), or threose nucleic acids (TNAs, in which the ribose is replaced with α-L-threofuranosyl-(3'→2')).

[0336] Generally, gRNA molecules contain the sugar ribose, a five-membered ring containing oxygen. Exemplary modified gRNAs include, without limitation, replacement of oxygen in ribose (e.g., with sulfur (S), selenium (Se), or alkylenes such as methylene or ethylene); double bond addition (e.g., replacing ribose with cyclopentenyl or cyclohexenyl); ribose ring contraction (e.g., forming a four-membered ring of cyclobutane or oxetane); and ribose ring expansion (e.g., forming a six- or seven-membered ring with additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, or morpholino, which also has a phosphoramidate backbone). While the majority of sugar analog modifications are located at the 2' position, other sites, including the 4' position, are also subject to modification. In certain embodiments, gRNAs contain 4'-S, 4'-Se, or 4'-C-aminomethyl-2'-O-Me modifications.

[0337] In certain embodiments, deazanucleotides, such as 7-deaza-adenosine, can be incorporated into gRNA. In certain embodiments, O- and N-alkylated nucleotides, such as N6-methyladenosine, can be incorporated into gRNA. In certain embodiments, one or more or all nucleotides in a gRNA molecule are deoxyribonucleotides.

[0338] XI. Inhibitory Cpf1 gRNA molecules and their use to limit the activity of the Cpf1 system Methods and compositions that use or include nucleic acids, e.g., DNA, encoding a Cpf1 molecule or a gRNA molecule can additionally use or include an "inhibitory Cpf1 gRNA molecule." An inhibitory Cpf1 gRNA can limit the activity of other CRISPR / Cfp1 components introduced into a cell or subject. In certain embodiments, the gRNA molecule includes a targeting domain that is complementary to a targeting domain on a nucleic acid that includes a sequence encoding a component of the CRISPR / Cpf1 system that is introduced into a cell or subject. In certain embodiments, the inhibitory Cpf1 gRNA molecule includes a targeting domain that is complementary to a target sequence on: (a) a nucleic acid encoding a Cpf1 molecule; (b) a nucleic acid encoding a gRNA molecule (target gene gRNA) that includes a targeting domain that targets a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and / or TRBC gene; or on multiple nucleic acids encoding CRISPR / Cpf1 components, e.g., both (a) and (b). The inhibitory Cpf1 gRNA molecule can complex with the Cpf1 molecule to inactivate a system component. In certain embodiments, the Cpf1 molecule / inhibitory Cpf1 gRNA molecule complex inactivates a nucleic acid comprising a sequence encoding the Cpf1 molecule. In certain embodiments, the Cpf1 molecule / inhibitory Cpf1 gRNA molecule complex inactivates a nucleic acid comprising a sequence encoding a target gene gRNA molecule. In certain embodiments, the Cpf1 molecule / inhibitory Cpf1 gRNA molecule complex imposes temporal, expression level, or other constraints on the activity of the Cpf1 molecule / target gene gRNA molecule complex. In certain embodiments, the Cpf1 molecule / inhibitory Cpf1 gRNA molecule complex reduces off-target or other undesired activity. In certain embodiments, the inhibitory Cpf1 gRNA molecule targets a coding sequence or regulatory region, such as a promoter, to negatively regulate a CRISPR / Cpf1 system component. For example, an inhibitory Cpf1 gRNA may target the coding sequence of a Cpf1 molecule, a regulatory region that regulates expression of the Cpf1 molecule coding sequence, e.g., a promoter, or a sequence located between the two.In certain embodiments, the inhibitory Cpf1 gRNA molecule targets the coding sequence of the target gene gRNA or a regulatory region, e.g., a promoter. In certain embodiments, the inhibitory Cpf1 gRNA, e.g., a Cpf1-targeting inhibitory Cpf1 gRNA molecule or a target gene gRNA-targeting inhibitory Cpf1 gRNA molecule, or a nucleic acid encoding the same, is introduced separately, e.g., after the Cpf1 molecule or the nucleic acid encoding the same. For example, a first vector, e.g., a viral vector, e.g., an AAV vector, can introduce a nucleic acid encoding a Cpf1 molecule and one or more target gene gRNA molecules, and a second vector, e.g., a viral vector, e.g., an AAV vector, can introduce a nucleic acid encoding an inhibitory Cpf1 gRNA molecule, e.g., a Cpf1-targeting gRNA molecule or a target gene gRNA-targeting gRNA molecule. In certain embodiments, the second vector can be introduced after the first vector. In certain embodiments, an inhibitory Cpf1 gRNA molecule, e.g., a Cpf1-targeting inhibitory Cpf1 gRNA molecule or a target gene gRNA-targeting inhibitory Cpf1 gRNA molecule, or a nucleic acid encoding the same, may be introduced together with, e.g., simultaneously with, or in the same vector as, a Cpf1 molecule or a nucleic acid encoding the same, but under a transcriptional control element, e.g., a promoter or enhancer, that is subsequently activated, e.g., such that transcription of Cpf1 is reduced after a period of time. In certain embodiments, the transcriptional control element is endogenously activated. In certain embodiments, the transcriptional element is activated via the introduction of an external trigger.

[0339] Typically, the nucleic acid sequence encoding an inhibitory Cpf1 gRNA molecule, e.g., a Cpf1-targeting gRNA molecule, is under the control of a different regulatory region, e.g., a promoter, than the nucleic acid encoding a negatively regulating component, e.g., a Cpf1 molecule. In certain embodiments, "different regulatory region" simply refers to not being under the control of a single regulatory region, e.g., a promoter, that is operably linked to both regulatory sequences. In certain embodiments, "different" refers to a "different regulatory region" in terms of the type or variety of regulatory region. For example, the sequence encoding an inhibitory Cpf1 gRNA molecule, e.g., a Cpf1-targeting gRNA molecule, is under the control of a regulatory region, e.g., a promoter, that has a lower level of expression or is expressed later than the sequence encoding the negatively regulating component, e.g., a nucleic acid encoding a Cpf1 molecule.

[0340] By way of example, a sequence encoding an inhibitory Cpf1 gRNA molecule, e.g., a Cpf1-targeting inhibitory Cpf1 gRNA molecule, can be under the control of a regulatory region (e.g., a promoter) described herein, e.g., the human U6 small nuclear promoter or the human H1 promoter. In certain embodiments, a sequence encoding a negatively regulating component, e.g., a nucleic acid encoding a Cpf1 molecule, can be under the control of a regulatory region (e.g., a promoter) described herein, e.g., the CMV, EF-1a, MSCV, PGK, or CAG regulatory promoter. [Example]

[0341] The following examples are illustrative only and are not intended to limit the scope or content of the present invention in any way.

[0342] Example 1 - Delivery of Cpf1 / crRNA RNP to T cells First generation CD4 +To demonstrate Cpf1-mediated cleavage in T cells, purified Acidaminococcus sp. BV3L6 Cpf1 ("AsCpf1") was complexed with 11 different gRNAs (also referred to as "crRNAs") designed against the TCR alpha chain (Table 6). GWED539 contains a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO:3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO:3433. GWED540 contains a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO:3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO:3587. GWED541 contains a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO:3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO:3538. GWED542 contains a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO:3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO:3461. GWED543 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3475. GWED544 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3524. GWED545 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3566. GWED546 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3517. GWED547 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3573. GWED548 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO: 3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO: 3580.GWED549 comprises a direct repeat domain having the nucleotide sequence set forth in SEQ ID NO:3708 and a targeting domain having the nucleotide sequence set forth in SEQ ID NO:3454.

[0343] JPEG2026016399000021.jpg97164

[0344] Each RNP complex was delivered by electroporation, and the ability of individual RNPs to target and cleave the TRAC locus was assessed by flow cytometry (FCM) and T7E1 assay.

[0345] Purification of AsCpf1 enzyme A 3.9-kb gene segment corresponding to residue 1307 of AsCpf1 was obtained by gene synthesis using the provided SapI Electra cloning arms (DNA 2.0 Cloning System) and the C-terminus nucleoplasmin NLS. The synthetic construct, cloned into the pUC57 vector, was excised by SapI digestion and Electra cloned into the pD441-NH, pD441-CH (high copy), and pD421-NH (low copy) Escherichia coli (E. coli) expression vectors (DNA 2.0, Electra Cloning System).

[0346] Plasmids containing the AsCpf1 gene (N-term His (high copy), C-term His (high copy), or N-term His (low copy)) were transformed or electroporated into bacterial expression strains, and the proteins were expressed and purified using the following method. All AsCpf1 constructs contain a C-terminal nucleoplasmin NLS sequence, although an SV40 NLS on the N or C terminus is also applicable. After transforming or electroporating the plasmids into protein-expressing bacterial cells (e.g., Rosetta 2 cells), several resulting colonies were added to 0.5 mL of Brain Heart and Lung (BHL) medium or another rich medium without antibiotics. After 30 minutes to 1 hour, or when the cell suspension appeared turbid, 0.5 mL of BHL medium or other rich medium and antibiotics (chloramphenicol and kanamycin) were added to the culture. When the culture appeared turbid (OD = 0.6), the culture volume was doubled until the volume reached 8 mL. The entire culture was then transferred to up to 1 L of Terrific Broth (Teknova) medium + antibiotics + 1 mL of 1000x metal solution (Teknova) + 200 μL of 1 M magnesium sulfate solution. The culture was grown at 37°C. The culture OD was measured after 1–2 hours or when the culture flask appeared slightly turbid. At this point, the OD was measured hourly, or, if appropriate, until the OD reached 1.0–1.5. Once the OD reached 1.0–1.5, the flask was transferred to a colder temperature (18–25°C), and the OD was again checked after 30 minutes to 1 hour. When the culture reached an OD of approximately 2.0, protein expression was induced by adding IPTG. The cells were grown at 18°C ​​for 12–16 hours (this time could be varied up to 3 days, as needed). The culture was then harvested and pelleted using a large centrifuge and either lysed immediately or kept frozen at -80°C until the day of lysis.

[0347] Cell pellets expressing AsCpf1 were lysed using a microfluidizer. 1–10 g of dried cell pellet was resuspended in 70 mL of lysis buffer (50 mM Tris pH 8.0, 1 mM TCEP [Tris(2-carboxyethyl)phosphine] or DTT (dithiothreitol), 10–20% glycerol, and 300–1000 mM NaCl or KCl). Alternatively, cells were lysed using the BPER (ThermoFisher) chemical lysis kit, BugBuster (EMD Millipore) chemical lysis kit, or our own chemical lysis reagent containing the same buffer in the presence of 1% Triton X-100 to disrupt the cell membrane, and the folded AsCpf1 was extracted. Finally, cells can be lysed using a sonicator using the same lysis buffer as in the microfluidizer method, but without 1% Triton X-100 or any other mild zwitterionic detergents.

[0348] The cell lysate was spun down in a centrifuge, and the cell pellet was discarded. The supernatant was filtered through a 0.2 μm or 0.45 μm filter and loaded onto a HisTrap Ni-NTA column (GE Healthcare) or a gravity column using a HIsPur Ni-NTA slurry (Thermo Fisher). In both cases, the slurry in the HisTrap or gravity column was equilibrated with lysis buffer and then subjected to several washes of 5×–20× column volumes with lysis buffer also containing 30 mM imidazole. Finally, His-tagged AsCpf1 was eluted from the Ni-NTA resin in the HisTrap or gravity column using lysis buffer with 250–500 mM imidazole.

[0349] The AsCpf1 protein was then concentrated to approximately 5 mL using a filter with a molecular weight cutoff of 100 kDa or less and loaded onto an AKTA Pure (GE Healthcare) FPLC instrument equipped with a size-exclusion column. Alternatively, due to the net positive charge (+8) of the 6xHis-AsCpf1-NLS construct, AsCpf1 could be loaded onto a cation exchange column and purified using a 100 mM to 1000 mM NaCl gradient over 40 minutes. NaCl could also be replaced with KCl. Alternatively, AsCpf1 (+3 net charge) with the 3xFLAG tag (-7 net charge) and without the NLS (+5 net charge) would be negatively charged and could bind to an anion exchange column and be purified by increasing the salt gradient. The buffer for size-exclusion or cation-exchange purification was 50 mM HEPES, pH 7.5, 1 mM TCEP or DTT, 10%–20% glycerol, and 250 mM NaCl constant ionic strength (size exclusion) or 100 mM to 1000 mM NaCl ionic strength (cation exchange). HEPES can be substituted with any buffer with a buffering capacity in the pH range of 6.5–8.5. AsCpf1 protein eluted in 2 mL fractions and was detected by UV absorbance on an FPLC instrument, resulting in a single major peak. Fractions from this peak were pooled and analyzed by SDS-PAGE to determine the presence and purity of AsCpf1. SDS-PAGE showed a clear band at the expected 150 kDa molecular weight marker without any contaminating bands. Additionally, examination of the AsCpf1 absorbance spectrum showed a well-defined protein with no measurable nucleic acid contamination, as determined by the 260 / 280 UV absorbance ratio.

[0350] The pooled fractions of AsCpf1 were analyzed using the predicted extinction coefficient of AsCpf1 (143,940 M) as displayed in the UniProt Prot-param tool on the NCBI website and measured at an absorbance of 280. -1 cm -1), concentrated down to 50 μM. These aliquots were stored at 4° C. for immediate use or flash frozen in liquid nitrogen and stored at −80° C. for long-term storage.

[0351] crRNA was produced by chemical synthesis and complexed with the purified protein described above by incubating the protein and crRNA at room temperature for at least 15 minutes before delivery to cells. The complexed RNPs were used in two separate assays. RNPs were used in an in vitro cleavage assay, in which RNPs were incubated with a PCR product corresponding to exon 1 of the TRAC locus. RNPs were incubated with the PCR product at a 1:1 molar ratio and incubated at 37°C for 15 minutes. After incubation, the reaction mixture was treated with proteinase K at 42°C for 20 minutes. Cleavage was visualized on a PAGE gel. Cleavage was observed for most RNPs, but two showed significant cleavage (Figure 2). Fractions of each RNP complex were also analyzed using activated human primary CD4 +T cells (cultured in complete medium supplemented with IL-2, IL-7, and IL-15) were electroporated with Cpf1 RNP at a ratio of 1 μg / 100,000 cells. Four days after electroporation, TCRα / β expression was monitored on the cells by flow cytometry using a Brilliant Violet 421 (BioLegend)-conjugated antibody specific for TCRα / β. Two RNPs (GWED545 and GWED546) significantly reduced TCRα / β expression on transfected cells, compared with many RNPs that did not affect TCRα / β expression (Figure 3). Additionally, cell viability was not adversely affected by treatment with Cpf1 RNP (Figure 4). To confirm that the generation of TCRα / β-negative cells was the result of genome editing at the TRAC locus, gDNA was harvested and a T7E1 assay was performed. Briefly, the T7E1 assay involves amplification, purification, and size confirmation of a 450-bp PCR product, denaturation of the PCR product, and rehybridization by heating to 95°C followed by slow cooling. The hybridized PCR product was then digested with T7 endonuclease I (or other mismatch-sensitive enzyme), which recognizes and cleaves mismatched DNA. If indels were present in the original template DNA, denaturation and reannealing of the amplicon resulted in hybridization of DNA strands bearing different indels, resulting in mismatched double-stranded DNA. Digestion products can be visualized by gel electrophoresis or capillary electrophoresis. The percentage of cleaved DNA (density of cleaved products divided by the densities of cleaved and uncleaved DNA) was used to estimate percent NHEJ using the following formula: %NHEJ=(1-(1-percent cleaved)). 1 / 2 The T7E1 assay was sensitive down to approximately 2-5% NHEJ. Indeed, the data confirm the presence of DNA modifications at the TRAC locus for RNPs that downregulated TCRα / β expression (Figure 5).

[0352] To determine whether Cpf1 can cleave human T cells from multiple donors, RNPs consisting of GWED545 crRNA and GWED546 crRNA were electroporated into activated human T cells from a second donor. Four days after electroporation, editing efficiency was assessed by FACS analysis using Brilliant Violet 421 (BioLegend)-conjugated antibodies specific for TCRα / β. The ability of these two RNPs to edit human T cells across two donors was confirmed by the loss of TCRα / β expression (Figure 6).

[0353] Incorporation by Reference All publications, patents, sequence listings, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent, sequence listing, or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application will control, including any definitions herein.

[0354] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. Certain embodiments are also within the scope of the following claims.

Claims

1. An inhibitory centromere promoter factor 1 (Cpf1) gRNA molecule comprising a targeting domain that is complementary to the target domain of one T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

2. The inhibitory Cpf1 gRNA molecule of claim 1 , further comprising a direct repeat domain.

3. 3. The inhibitory Cpf1 gRNA molecule of claim 2, wherein the direct repeat domain is 15-20 nucleotides in length.

4. 4. The inhibitory Cpf1 gRNA molecule of claim 2 or 3, wherein the direct repeat domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3708-3710.

5. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 4, wherein the targeting domain is targeted for knockout of expression of the T cell expressed gene.

6. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 5, wherein the target domain is within the coding region of the T cell expressed gene.

7. The inhibitory Cpf1 gRNA molecule of claim 6, wherein the coding region is an early coding region of the T cell expressed gene.

8. 5. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 4, wherein the targeting domain is configured to provide a double-stranded break within 500, 450, 400, 350, 300, 250, 200, 150, 100, 50, 25, or 10 nucleotides of a T cell target knockout position.

9. 9. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 8, wherein the targeting domain comprises a nucleotide sequence identical to or differing from a nucleotide sequence selected from SEQ ID NOs: 1-3707 by no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 nucleotides.

10. The inhibitory Cpf1 gRNA molecule of claim 9, wherein the targeting domain comprises a nucleotide sequence selected from SEQ ID NOs: 1-3707.

11. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 10, wherein the targeting domain is 15 to 25 nucleotides in length.

12. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 18 nucleotides in length.

13. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 19 nucleotides in length.

14. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 20 nucleotides in length.

15. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 21 nucleotides in length.

16. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 22 nucleotides in length.

17. 12. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 23 nucleotides in length.

18. The inhibitory Cpf1 gRNA molecule of claim 11, wherein the targeting domain is 24 in length.

19. The inhibitory Cpf1 gRNA molecule according to any one of claims 1 to 18, wherein the inhibitory Cpf1 gRNA is a unimodular inhibitory Cpf1 gRNA molecule.

20. (a) a nucleic acid composition comprising a first nucleotide sequence encoding a first inhibitory Cpf1 gRNA molecule comprising a targeting domain that is complementary to a target domain of one T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

21. The nucleic acid composition of claim 20, wherein the first inhibitory Cpf1 gRNA molecule is an inhibitory Cpf1 gRNA molecule described in any one of claims 1 to 19.

22. 22. The nucleic acid composition of claim 20 or 21, further comprising a direct repeat domain.

23. 23. The nucleic acid composition of claim 22, wherein the direct repeat domain is 15 to 20 nucleotides in length.

24. 24. The nucleic acid composition of claim 22 or 23, wherein the direct repeat domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3708-3710.

25. 25. The nucleic acid composition of any one of claims 20 to 24, wherein the targeting domain is targeted for knockout of expression of the T cell expressed gene.

26. 26. The nucleic acid composition of any one of claims 20 to 25, wherein the targeting domain is within the coding region of the T cell expressed gene.

27. 27. The nucleic acid composition of claim 26, wherein the coding region is an early coding region of the T cell expressed gene.

28. 28. The nucleic acid composition of any one of claims 20-27, wherein the targeting domain is configured to provide a double-stranded break within 500, 450, 400, 350, 300, 250, 200, 150, 100, 50, 25, or 10 nucleotides of a T cell target knockout position.

29. 29. The nucleic acid composition of any one of claims 20-28, wherein the targeting domain comprises a nucleotide sequence identical to or differing from a nucleotide sequence selected from SEQ ID NOs: 1-3707 by no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 nucleotides.

30. 30. The nucleic acid composition of claim 29, wherein the targeting domain comprises a nucleotide sequence selected from SEQ ID NOs: 1-3707.

31. 31. The nucleic acid composition of any one of claims 20 to 30, wherein the targeting domain is 15 to 25 nucleotides in length.

32. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 18 nucleotides in length.

33. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 19 nucleotides in length.

34. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 20 nucleotides in length.

35. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 21 nucleotides in length.

36. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 22 nucleotides in length.

37. 32. The nucleic acid composition of claim 31 , wherein the targeting domain is 23 nucleotides in length.

38. 32. The nucleic acid composition of claim 31, wherein the targeting domain is 24 in length.

39. 39. The nucleic acid composition of any one of claims 20 to 38, further comprising (b) a second nucleotide sequence encoding a Cpf1 molecule.

40. 40. The nucleic acid composition of claim 39, wherein the Cpf1 molecule forms a double-stranded break in the target nucleic acid.

41. 41. The nucleic acid composition of claim 39 or 40, wherein the Cpf1 molecule is selected from the group consisting of an Acidaminococcus sp. strain BV3L6 Cpf1 molecule (AsCpf1), a Lachnospiraceae bacterium ND2006 Cpf1 molecule (LbCpf1), and a Lachnospiraceae bacterium MA2020 (Lb2Cpf1).

42. The nucleic acid composition of any one of claims 39 to 41, wherein the second nucleotide sequence is set forth in SEQ ID NO: 3722, SEQ ID NO: 3723, or SEQ ID NO: 3724.

43. The nucleic acid composition according to any one of claims 39 to 42, wherein (a) and (b) are present on one nucleic acid molecule.

44. 44. The nucleic acid composition of claim 43, wherein the nucleic acid molecule is an AAV vector.

45. 45. The nucleic acid composition of claim 43 or 44, wherein (a) is present on a first nucleic acid molecule; and (b) is present on a second nucleic acid molecule.

46. 46. ​​The nucleic acid composition of claim 45, wherein the first nucleic acid molecule and the second nucleic acid molecule are AAV vectors or LV vectors.

47. 48. The nucleic acid composition of any one of claims 39-47, further comprising: (c) a third nucleotide sequence encoding a second inhibitory Cpf1 gRNA molecule comprising a targeting domain that is complementary to a second target domain of a T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

48. The nucleic acid composition of claim 47, wherein the second inhibitory Cpf1 gRNA molecule is an inhibitory Cpf1 gRNA molecule described in any one of claims 1 to 19.

49. The nucleic acid composition of claim 47 or 48, wherein the first inhibitory Cpf1 gRNA molecule and the second inhibitory Cpf1 gRNA molecule generate two sets of double-stranded breaks flanking the T cell target knockout position.

50. 50. The nucleic acid composition of any one of claims 47-49, wherein the targeting domain of the second inhibitory Cpf1 gRNA molecule comprises a nucleotide sequence identical to or differing from a nucleotide sequence selected from SEQ ID NOs: 1-3707 by no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 nucleotides.

51. 51. The nucleic acid composition of claim 50, wherein the targeting domain of the second inhibitory Cpf1 gRNA comprises a nucleotide sequence selected from SEQ ID NOs: 1-3707.

52. The nucleic acid composition of any one of claims 47 to 51, wherein (a) and (c) are present on a single nucleic acid molecule.

53. 53. The nucleic acid composition of claim 52, wherein the nucleic acid molecule is an AAV vector or an LV vector.

54. 52. The nucleic acid composition of any one of claims 47 to 51, wherein (a) is present on a first nucleic acid molecule; and (c) is present on a second nucleic acid molecule.

55. 55. The nucleic acid composition of claim 54, wherein the first nucleic acid molecule and the second nucleic acid molecule are AAV vectors or LV vectors.

56. 52. The nucleic acid composition of any one of claims 47 to 51, wherein (a), (b), and (c) are present on a single nucleic acid molecule.

57. 57. The nucleic acid composition of claim 56, wherein the nucleic acid molecule is an AAV vector or an LV vector.

58. 52. The nucleic acid composition of any one of claims 47-51, wherein one of (a), (b), and (c) is encoded on a first nucleic acid molecule; and the second and third of (a), (b), and (c) are encoded on a second nucleic acid molecule.

59. 59. The nucleic acid composition of claim 58, wherein the first nucleic acid molecule and the second nucleic acid molecule are AAV vectors or LV vectors.

60. 60. The nucleic acid composition of claim 58 or 59, wherein (a) is present on a first nucleic acid molecule; and (b) and (c) are present on a second nucleic acid molecule.

61. 60. The nucleic acid composition of claim 58 or 59, wherein (b) is present on a first nucleic acid molecule; and (a) and (c) are present on a second nucleic acid molecule.

62. 60. The nucleic acid composition of claim 58 or 59, wherein (c) is present on a first nucleic acid molecule; and (b) and (a) are present on a second nucleic acid molecule.

63. 63. The nucleic acid composition of any one of claims 20 to 62, wherein the nucleic acid composition comprises a promoter operably linked to (a).

64. 64. The nucleic acid composition of any one of claims 39 to 63, wherein the nucleic acid composition comprises a promoter operably linked to (b).

65. 65. The nucleic acid composition of any one of claims 47 to 64, wherein the nucleic acid composition comprises a second promoter operably linked to (c).

66. (a) a composition comprising an inhibitory Cpf1 gRNA molecule according to any one of claims 1 to 19.

67. 67. The composition of claim 66, further comprising (b) a Cpf1 molecule.

68. 68. The composition of claim 67, wherein the Cpf1 molecule forms a double-stranded break in the target nucleic acid.

69. 69. The composition of claim 67 or 68, wherein the Cpf1 molecule is selected from the group consisting of an Acidaminococcus sp. strain BV3L6 Cpf1 molecule (AsCpf1), a Lachnospiraceae bacterium ND2006 Cpf1 molecule (LbCpf1), and a Lachnospiraceae bacterium MA2020 (Lb2Cpf1).

70. 70. The composition of any one of claims 66 to 69, further comprising (c) a second inhibitory Cpf1 gRNA molecule.

71. 71. The composition of any one of claims 66 to 70, which is a ribonucleoprotein composition comprising a Cpf1 protein and a ribonucleic acid molecule encoding said inhibitory Cpf1 gRNA molecule.

72. 1. A method of modifying a cell, comprising: (a) an inhibitory Cpf1 gRNA according to any one of claims 1 to 19; and (b) Cpf1 molecule The method comprises contacting the

73. 73. The method of claim 72, wherein the Cpf1 molecule forms a double-stranded break in the target nucleic acid.

74. 74. The method of claim 72 or 73, wherein the Cpf1 molecule is selected from the group consisting of an Acidaminococcus sp. strain BV3L6 Cpf1 molecule (AsCpf1), a Lachnospiraceae bacterium ND2006 Cpf1 molecule (LbCpf1), and a Lachnospiraceae bacterium MA2020 (Lb2Cpf1).

75. 75. The method of any one of Claims 72-74, further comprising contacting the cell with (c) a second inhibitory Cpf1 gRNA molecule comprising a targeting domain that is complementary to a second target domain of a T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

76. 76. The method of any one of claims 72 to 75, wherein the cells are derived from a subject suffering from cancer.

77. 77. The method of claim 76, wherein the cancer is selected from the group consisting of lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DLCL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.

78. 78. The method of any one of claims 72-77, wherein the cells are derived from a subject that would benefit from one or more modifications of one or more T cell target locations in one or more T cell expressed genes.

79. 79. The method of any one of claims 72 to 78, wherein the cell is a T cell.

80. 80. The method of claim 79, wherein the T cells are engineered T cells.

81. 81. The method of claim 80, wherein the engineered T cells are engineered chimeric antigen receptor (CAR) T cells.

82. 81. The method of claim 80, wherein the engineered T cells are engineered TCR (T cell receptor) T cells.

83. 83. The method of any one of claims 79-82, wherein the T cell is engineered to express a TCR or a CAR prior to introducing an alteration into a T cell expressed gene at a T cell targeted knockout location.

84. 83. The method of any one of claims 79-82, wherein the T cell is engineered to express a TCR or CAR after introducing an alteration into a T cell expressed gene at a T cell targeted knockout location.

85. 83. The method of any one of claims 79-82, wherein the T cells are engineered to express a TCR or CAR simultaneously with introducing an alteration into a T cell expressed gene within a T cell targeted knockout location.

86. 86. The method of any one of claims 72 to 85, wherein said contacting is carried out in vitro.

87. 87. The method of any one of claims 72 to 86, wherein the contacted cells are returned to the subject's body.

88. 88. The method of any one of claims 72 to 87, wherein said contacting comprises contacting said cell with a nucleic acid composition of any one of claims 20 to 65.

89. 88. The method of any one of claims 72 to 87, wherein said contacting comprises contacting said cell with a composition of any one of claims 66 to 71.

90. 1. A method of treating a subject, comprising: (a) an inhibitory Cpf1 gRNA according to any one of claims 1 to 35; and (b) Cpf1 molecule The method comprises contacting the

91. 91. The method of claim 90, wherein the Cpf1 molecule forms a double-stranded break in the target nucleic acid.

92. 92. The method of claim 90 or 91, wherein the Cpf1 molecule is selected from the group consisting of an Acidaminococcus sp. strain BV3L6 Cpf1 molecule (AsCpf1), a Lachnospiraceae bacterium ND2006 Cpf1 molecule (LbCpf1), and a Lachnospiraceae bacterium MA2020 (Lb2Cpf1).

93. 93. The method of any one of claims 90-92, further comprising contacting the cell with (c) a second inhibitory Cpf1 gRNA molecule comprising a targeting domain that is complementary to a second target domain of a T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes.

94. 94. The method of any one of claims 90 to 93, wherein the subject is suffering from cancer.

95. 95. The method of claim 94, wherein the cancer is selected from the group consisting of lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DLCL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.

96. 96. The method of any one of claims 90-95, wherein the subject will benefit from one or more modifications of one or more T cell target locations in one or more T cell expressed genes.

97. 97. The method of any one of claims 90 to 96, wherein the cell is a T cell.

98. 98. The method of claim 97, wherein the T cells are engineered T cells.

99. 99. The method of claim 98, wherein the engineered T cells are engineered chimeric antigen receptor (CAR) T cells.

100. 99. The method of claim 98, wherein the engineered T cells are engineered T cell receptor (TCR) T cells.

101. 101. The method of any one of claims 97-100, wherein the T cell is engineered to express a TCR or CAR prior to introducing an alteration into a T cell expressed gene at a T cell targeted knockout location.

102. 101. The method of any one of claims 97-100, wherein the T cell is engineered to express a TCR or CAR after introducing an alteration into a T cell expressed gene at a T cell targeted knockout location.

103. 101. The method of any one of claims 97-100, wherein the T cells are engineered to express a TCR or CAR simultaneously with introducing an alteration into a T cell expressed gene at a T cell targeted knockout location.

104. 104. The method of any one of claims 90 to 103, wherein said contacting is carried out in vitro.

105. 105. The method of any one of claims 90 to 104, wherein the contacted cells are returned to the subject's body.

106. The method of any one of claims 90 to 105, wherein said contacting comprises contacting said cell with a nucleic acid composition of any one of claims 20 to 65.

107. 106. The method of any one of claims 90 to 105, wherein said contacting comprises contacting said cell with a composition of any one of claims 66 to 71.

108. (a) an inhibitory Cpf1 gRNA molecule according to any one of claims 1 to 19, a nucleic acid composition according to any one of claims 20 to 65, or a composition according to any one of claims 66 to 71, and (b) cells from a subject that would benefit from one or more modifications of one or more T cell targeted knockout positions in one or more T cell expressed genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes. A reaction mixture comprising:

109. (a) an inhibitory Cpf1 gRNA molecule according to any one of claims 1 to 19, or a nucleic acid composition encoding an inhibitory Cpf1 gRNA, and one or more of the following: (b) Cpf1 molecule; (c) a second inhibitory Cpf1 gRNA molecule comprising a targeting domain that is complementary to a second target domain of a T cell expressed gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, and TRBC genes; and (d) a nucleic acid composition encoding one or more of (b) and (c). Kit including:

110. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 19, wherein the inhibitory Cpf1 gRNA molecule comprises a modification at or near its 5' end.

111. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 19, wherein the inhibitory Cpf1 gRNA molecule comprises a modification at or near its 3' end.

112. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 19, wherein the inhibitory Cpf1 gRNA molecule comprises a modification at or near its 5' end and a modification at or near its 3' end.

113. 113. The inhibitory Cpf1 gRNA molecule of claim 110 or 112, wherein the modification is within 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 nucleotides of its 5' end.

114. 113. The inhibitory Cpf1 gRNA molecule of claim 111 or 112, wherein the modification is within 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 nucleotides of its 3' end.

115. The inhibitory Cpf1 gRNA molecule of any one of claims 110 to 114, wherein the modification results in the inhibitory Cpf1 gRNA molecule exhibiting increased stability against nucleases when introduced into T cells.

116. The inhibitory Cpf1 gRNA molecule of any one of claims 110 to 114, wherein the modification results in the inhibitory Cpf1 gRNA molecule exhibiting a reduced innate immune response when introduced into T cells.

117. The inhibitory Cpf1 gRNA molecule of claim 116, wherein the innate immune response is accompanied by induction of cytokine expression.

118. 20. The inhibitory Cpf1 gRNA molecule of any one of claims 1 to 19 for use in treating cancer in a subject.

119. The inhibitory Cpf1 gRNA molecule of claim 118, wherein the inhibitory Cpf1 gRNA molecule is used in combination with (b) a Cpf1 molecule.

120. 20. Use of an inhibitory Cpf1 gRNA molecule according to any one of claims 1 to 19 in the manufacture of a medicament for the treatment of cancer in a subject.

121. The use of claim 120, wherein the medicament further comprises (b) a Cpf1 molecule.

122. The nucleic acid composition of any one of claims 20 to 65, for use in treating cancer in a subject.

123. 72. The composition of any one of claims 66 to 71 for use in treating cancer in a subject.

124. 66. Use of the nucleic acid composition of any one of claims 20 to 65 in the manufacture of a medicament for treating cancer in a subject.

125. 72. Use of a composition according to any one of claims 66 to 71 in the manufacture of a medicament for treating cancer in a subject.

Images