Downy mildew resistant brassica plants

Abstract

To provide a Brassica plant exhibiting downy mildew resistance.SOLUTION: The downy mildew resistant Brassica plant of the present disclosure comprises a downy mildew resistance locus on chromosome 6.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present disclosure relates to downy mildew resistant Brassica plants. [Background technology]

[0002] Downy mildew of Brassica rapa plants, caused by the downy mildew fungus Hyaloperonospora brassicae, has occurred in major Chinese cabbage and turnip-producing areas in Japan, Korea, China, and other countries. Infected plants develop light brown lesions, and as the infection spreads, the outer leaves die. In Chinese cabbage, the infection may also spread to the head leaves. One method of controlling downy mildew is to spray chemicals, but while this method is effective in delaying the onset of the disease, it cannot completely prevent the disease from occurring.

[0003] One method for imparting downy mildew resistance is to cultivate Chinese cabbage plants containing a downy mildew resistance locus (Takii Seed Co., Ltd., Seiko series). Non-Patent Document 1 also discloses a Brassica rapa plant that has a downy mildew resistance locus on chromosome 4. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Zhang, Bin, et al. "BrRLP48, encoding a receptor-like protein, involved in downy mildew resistance in Brassica rapa." Frontiers in plant science 9 (2018): 1708. Summary of the Invention [Problem to be solved by the invention]

[0005] The Chinese cabbage plants of the Seiko series (e.g., Seiko 75) are resistant to downy mildew. However, downy mildew fungi have emerged that can infect these Chinese cabbage plants. Therefore, there is a need for new Brassica plants that are resistant to downy mildew.

[0006] Therefore, an object of the present disclosure is to provide a Brassica plant that exhibits resistance to downy mildew. [Means for solving the problem]

[0007] To achieve the above objectives, the downy mildew resistant Brassica plants of the present disclosure comprise a downy mildew resistance locus on chromosome 6.

[0008] The method for producing a downy mildew-resistant Brassica plant of the present disclosure (hereinafter referred to as the "production method") includes the following steps (a) and (b): (a) crossing the downy mildew-resistant Brassica plant of the present disclosure with another Brassica plant; (b) selecting a downy mildew-resistant Brassica plant from the Brassica plants obtained in step (a) or their progeny lines.

[0009] The method of the present disclosure for imparting downy mildew resistance to a Brassica plant (hereinafter referred to as the "imparting method") comprises an introduction step of introducing a downy mildew resistance locus on chromosome 6 into a Brassica plant.

[0010] The detection method of the present disclosure is a method for detecting downy mildew resistance in a Brassica plant (hereinafter referred to as the "detection method"), and includes a detection step of detecting a downy mildew resistance gene locus on chromosome 6 in a test Brassica plant.

[0011] The screening method of the present disclosure is a method for screening a downy mildew-resistant Brassica plant (hereinafter referred to as "screening method"), The method includes a selection step of selecting, from test Brassica plants, Brassica plants containing a downy mildew resistance locus on chromosome 6 as downy mildew-resistant Brassica plants. [Effects of the Invention]

[0012] According to the present disclosure, a Brassica plant that is resistant to downy mildew can be provided. [Brief explanation of the drawings]

[0013]

Figure 1

Figure 2

[0014] <Definition> As used herein, "Brassica plants" refers to plants of the Brassicaceae family ( Brassicaceae ) means a plant classified in the genus Brassica. Specific examples of the Brassica plant include, for example, the Rapa species ( Brassica rapa ), cabbage seeds ( Brassica oleracea ), Brassica napus ( Brassica napus ) and the like. Examples of the Rapa species include rape, Chinese cabbage, turnip, komatsuna, bok choy, nozawana, mizuna, saishin, and mibuna. Examples of the cabbage species include cabbage, cauliflower, broccoli, kale, kohlrabi, Chinese broccoli, and snapdragon. Examples of the Brassica species include rapeseed and rutabaga. In this specification, the Brassica plant is, for example, a cultivated Brassica plant. The cultivated Brassica plant can also be referred to as, for example, a cultivated variety of a Brassica plant.

[0015] As used herein, "downy mildew" refers specifically to an infectious disease caused by the downy mildew fungus Hyaloperonospora brassicae, a type of filamentous fungus. Downy mildew is known to cause yellow to light brown lesions on infected plant leaves, which then wither and fall off, resulting in poor growth.

[0016] As used herein, "downy mildew pathogen" or "pathogen" (hereinafter also referred to as "downy mildew pathogen") refers to a fungus classified as Hyaloperonospora brassicae.

[0017] As used herein, "downy mildew resistance" refers to the ability to inhibit or suppress the occurrence of disease caused by infection with downy mildew fungi and / or the progression of disease that has occurred. Specific examples of the "downy mildew resistance" include the prevention of disease caused by infection with downy mildew fungi and / or the cessation, inhibition, suppression, reduction, or delay of the progression of disease that has occurred. The downy mildew resistance can also be referred to as downy mildew resistance or downy mildew tolerance.

[0018] As used herein, the term "downy mildew resistance locus" (hereinafter also referred to as "resistance locus") refers to a quantitative trait locus (QTL) or gene region that confers downy mildew resistance. The quantitative trait locus generally refers to a chromosomal region involved in the expression of a quantitative trait.

[0019] As used herein, the term "plant body" or "plant" refers to an individual plant that refers to the entire plant.

[0020] As used herein, "plant part" or "plant part" refers to a part of an individual plant.

[0021] The present disclosure will be described below using examples, but the present disclosure is not limited to the following examples and can be implemented with any modifications. Furthermore, the descriptions in this disclosure are mutually applicable unless otherwise specified. In this specification, the expression "to" is used to include the numerical or physical values ​​before and after it. In this specification, the expression "A and / or B" includes "A only," "B only," and "both A and B."

[0022] <Downy mildew resistant Brassica plants> In one aspect, the present disclosure provides a Brassica plant that is resistant to downy mildew. The downy mildew-resistant Brassica plant of the present disclosure comprises a downy mildew resistance locus on chromosome 6. According to the present disclosure, a Brassica plant having downy mildew resistance can be provided.

[0023] The Brassica plant may be a pure Brassica plant of each plant species, or may be a hybrid (interspecific hybrid) between the target Brassica plant and a closely related species of the target Brassica plant, or a hybrid (intergeneric hybrid) between the target Brassica plant and a closely related genus of the target Brassica plant. Examples of the closely related species include each plant species in the Brassica plant. Examples of the closely related genus of the Brassica plant include the Brassicaceae family ( Brassicaceae ) of the genus Radish ( Raphanus ) (hereinafter also referred to as "plants of the genus Raphanus"). The plants of the genus Raphanus include, for example, plants of the genus Raphanus ( Raphanus sativus var. Longipinnatus Examples of the radish species include Japanese radish, radish, etc.

[0024] In the Brassica plants of the present disclosure, the downy mildew resistance is conferred by the presence of a downy mildew resistance locus on chromosome 6.

[0025] Among the Brassica plants, the Rapa species is known to have chromosomes 1 to 10. The Cabbage species is known to have chromosomes 1 to 9. The Brassica species is known to have chromosomes 1 to 19. The chromosomes in the Brassica plants are, for example, Chiifu-401-42 (Rapa species plants: Brassica rapa ), TO1000DH3 (cabbage seeds plants: Brassica oleracea ), or Darmor-bzh (Brassica napus plant: Brassica napusThe nucleotide sequence information of the genome of the target Brassica plant can be determined by comparing the nucleotide sequence information of the genome of Chiifu-401-42, TO1000DH3, or Darmor-bzh based on the nucleotide sequence information of the genome of the Brassica plant of interest. The comparison can be performed using analysis software such as BLAST or FASTA with default parameters. The nucleotide sequence information of the genome is available, for example, from the Plant GARDEN website (Rapa species: https: / / plantgarden.jp / ja / download / t3711 / t3711.G001 / , Cabbage species: https: / / plantgarden.jp / ja / download / t3712 / t3712.G001 / , Brassica napus species: https: / / plantgarden.jp / ja / download / t3708 / t3708.G002 / ).

[0026] The Brassica plant of the present disclosure comprises a resistance locus on chromosome 6. However, the Brassica plant of the present disclosure is not limited thereto, and may, for example, have the resistance locus on chromosome 6 on any chromosome other than chromosome 6 instead of chromosome 6. As a specific example, when the Brassica plant is a Rapa plant, the Brassica plant having the resistance locus may have the resistance locus on chromosome 6 on any of chromosomes 1, 2, 3, 4, 5, 7, 8, 9, and 10. When the Brassica plant is a Cabbage plant, the Brassica plant having the resistance locus may have the resistance locus on chromosome 6 on any of chromosomes 1, 2, 3, 4, 5, 7, 8, and 9. When the Brassica plant is a Brassica napus plant, the Brassica plant having the resistance locus may have the resistance locus on chromosome 6 on any of chromosomes 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19.

[0027] Among the radish plants, which are closely related species to the Brassica plants, the radish species is known to have chromosomes 1 to 9. The chromosomes in the radish plants are, for example, identified by the Okute-Sakurajima (Radish species plants: Raphanus sativus var. Longipinnatus The genome sequence of the target plant in the genus Radish can be determined by comparing it with the genome sequence of Okute-Sakurajima based on the genome sequence information of Okute-Sakurajima. The genome sequence is available, for example, from the Plant GARDEN website (https: / / plantgarden.jp / ja / download / t3726 / t3726.G003 / ).

[0028] In the case of a Raphanus plant, which is a closely related species of the Brassica plant, and which is a Raphanus species plant, the Raphanus plant having the resistance locus may have the resistance locus on chromosome 6 on any one of chromosomes 1, 2, 3, 4, 5, 7, 8, or 9.

[0029] The resistance locus is an incompletely dominant locus. Therefore, the Brassica plant of the present disclosure may, for example, contain the resistance locus on chromosome 6 in a heterozygous form or a homozygous form. In the latter case, the resistant Brassica plant may contain at least one resistance locus on a chromosome other than chromosome 6, for example, one resistance locus on a chromosome other than chromosome 6, or two resistance loci on a chromosome other than chromosome 6. When two resistance loci are contained on a chromosome other than chromosome 6, the resistant Brassica plant may, for example, contain the two resistance loci on the same chromosome or on different chromosomes.

[0030] The number of downy mildew resistance genes that contribute to the downy mildew resistance of the resistance locus may be one gene or multiple genes. As shown in the Examples below, considering the inheritance pattern of downy mildew resistance in the present disclosure, it is presumed that the downy mildew resistance at the resistance locus is controlled by a downy mildew resistance gene that is inherited in an incompletely dominant manner. However, this presumption does not limit the present disclosure in any way.

[0031] The resistance locus can be defined using a molecular marker that indicates the location on a chromosome, i.e., the position, i.e., the molecular marker linked to the locus of interest. Techniques for defining loci such as QTLs using molecular markers can be well known in the art.

[0032] The molecular marker used to define the resistance locus is not particularly limited. Examples of the molecular marker include SNP markers, AFLP (amplified fragment length polymorphism) markers, RFLP (restriction fragment length polymorphism) markers, microsatellite markers, SCAR (sequence-characterized amplified region) markers, and CAPS (cleaved amplified polymorphic sequence) markers. In the present disclosure, one type of molecular marker may be used, or two or more types may be used in combination. When an SNP marker is used as the molecular marker, the SNP marker may be, for example, a single SNP, or a combination of two or more SNPs, i.e., an SNP marker set.

[0033] The resistance locus is linked to some or all of the SNP markers described below. Therefore, the present disclosure allows the resistance locus to be defined, for example, by using the SNP markers. Specific examples of the resistance locus include: (1) being defined by the SNP markers (hereinafter also referred to as "specific"); (2) being defined by a base sequence containing the SNP markers; (3) being defined by a region between two of the SNP markers, i.e., by a locus location; and combinations thereof. When the resistance locus is defined by a combination, examples of the combination include the following:

[0034] A combination of (1) and (2); A combination of (1) and (3); A combination of (2) and (3); A combination of (1), (2) and (3).

[0035] (1) Identification by SNP markers The resistance locus may be defined by, for example, the SNP marker, as described in (1) above. The SNP marker is not particularly limited, and examples thereof include SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7. For analysis of these SNPs, see, for example, References 1 to 4 listed below. Furthermore, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7 are SNP markers newly identified by the present inventors, and a person skilled in the art can identify the loci of the SNP markers based on the nucleotide sequences containing these SNP markers, as described below. Reference 1: Erik W. Ohlson et.al., “Identification and Mapping of Late Blight Resistance Quantitative Trait Loci in Tomato Accession PI163245”, The Plant Genome, vol.11, no.3, 180007. Reference 2: Hamilton JP, Sim SC, Stoffel K, Van Deynze A, Buell CR, et al. (2012) “Single Nucleotide Polymorphism Discovery in Cultivated Tomato via Sequencing by Synthesis.”, The Plant Genome 5. Reference 3: Sim SC, Durstewitz G, Plieske J, Wieseke R, Ganal MW, et al., (2012) “Development of a Large SNP Genotyping Array and Generation of High-Density.”, Genetic Maps in Tomato. PLoS ONE 7(7) Reference 4: Blanca J, Can izares J, Cordero L, Pascual L, Diez MJ, et al., (2012) “Variation Revealed by SNP Genotyping and Morphology Provides Insight into the Origin of the Tomato.”, PLoS ONE 7(10)

[0036] The SNP1 indicates a polymorphism in which the underlined base enclosed in parentheses in the base sequence of SEQ ID NO: 1 below (the 99th base of SEQ ID NO: 1) is A. That is, when SNP1 is A, the Brassica plant is resistant to downy mildew, and when the base is other than A (for example, G), the Brassica plant is susceptible to downy mildew. The base sequence of SEQ ID NO: 1 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP1 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP1 can be identified as the 1844155th base on chromosome 6 in the genome base sequence information (Plant GARDEN). SEQ ID NO:1: 5'-CTCTGATTCTCTCGTCCATGGCGGACATCGACATCACCACCGGAAACGAGCCGCTGATCAACCGCGAAAACAACAGAAACAAAGTCTTTAACCGCTGC[ A ]TCTCACACCAGCAAGACGAGCTACAGAGCTTCCGTAAATACCTGAGATGGATGTGCGTGGACCACTCGAGTCCATGGACTGCGATCCTCTCGTGGACCAT-3'

[0037] The SNP2 indicates a polymorphism in which the underlined base enclosed in parentheses in the base sequence of SEQ ID NO: 2 below (the 100th base of SEQ ID NO: 2) is T. That is, when the SNP2 is T, the Brassica plant is resistant to downy mildew, and when the SNP2 is a base other than T (for example, C), the Brassica plant is susceptible to downy mildew. The base sequence of SEQ ID NO: 2 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP2 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP2 can be identified as the 1818542nd base on chromosome 6 in the genome base sequence information (Plant GARDEN). SEQ ID NO: 2:5'-AAAAGAGATGAACGTAACATGCATCATACAACATCAATCATCCATGCAAGAAAAACATGAACACTCCCAAATATTTCTCTCACTTCAAACTTATATAAA[ T ]CTTACACTAATTACACAACCCAATCAGCATTTGATACAGTATGGTGATCATCAAGTTATTAATACATGTCTTATTCTTCTTCCTCGTTAATTCTTTTCAT-3'

[0038] The SNP3 indicates a polymorphism in which the underlined base enclosed in parentheses in the base sequence of SEQ ID NO: 3 below (the 100th base of SEQ ID NO: 3) is G. That is, when SNP3 is G, the Brassica plant is resistant to downy mildew, and when the base is other than G (for example, A), the Brassica plant is susceptible to downy mildew. The base sequence of SEQ ID NO: 3 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP3 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP3 can be identified as the 1896789th base on chromosome 6 in the genome base sequence information (Plant GARDEN). SEQ ID NO: 3:5'-CTGTCTGAATGAGTTCGATGAAACTTACAGATTTATTTGTTATTTTATTTTTGGTTCATGTCTGCAACAGACTGCTTATATAGATGTTTGTGATGACAC[ G ]AGCTACGCTTTCCGCGCAAAATCTCTTCAGGCAGAGGCCCTTGCTGCCAATGTCCCGGCGATTACAACAGCTGGAATATATCCAGGAGTTAGCAATGGTG-3'

[0039] The SNP4 represents a polymorphism in which the underlined base enclosed in parentheses in the nucleotide sequence of SEQ ID NO: 4 (the 100th base of SEQ ID NO: 4) is G. That is, when SNP4 is G, the Brassica plant is resistant to downy mildew, and when the base is other than G (for example, C), the Brassica plant is susceptible to downy mildew. The nucleotide sequence of SEQ ID NO: 4 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP4 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP4 can be identified as the 1831338th base on chromosome 6 in the genome nucleotide sequence information (Plant GARDEN). SEQ ID NO: 4: 5'-ACACTTGAATCGAACTGTTTACAGAGAAGTCGTTGCTTTAAAGTCATATATAAAGTCCCAAAATTCCGTCAAATTAAGAACTCCCTCTATTTGCTTGTT G ]TAGCTCTTTAATTCAAGGAAGAGAGAAAAGCCATTAACCAAGTTCAGAACCAGCAGCCGTGGCGAGCATCAATCACGAGATTCCATGAAACAAAACACAC-3'

[0040] The SNP5 indicates a polymorphism in which the underlined base enclosed in parentheses in the nucleotide sequence of SEQ ID NO: 5 below (the 100th base of SEQ ID NO: 5) is C. That is, when SNP5 is C, the Brassica plant is resistant to downy mildew, and when SNP5 is a base other than C (for example, A), the Brassica plant is susceptible to downy mildew. The nucleotide sequence of SEQ ID NO: 5 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP5 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP4 can be identified as the 1796083 base on chromosome 6 in the genome nucleotide sequence information (Plant GARDEN). SEQ ID NO: 5:5'-GGATCTCTTGTTACCAAATCAGCCTACTACGATCTCCAACTCGTAATCTCTCTCTCTCATTTCTTACGAGTATTAAGGTTCAGATTTGTGTCCTGAATC[ C ]TTTAATTATAAGCTTTTGTTATCTGACATTGCAGGCGAGAGAGGAGATGTCTCGGGAGAGACTGCGTTATTTGGAAGCTATGGTAACATCTCATTCTCTT-3'

[0041] SNP6 indicates a polymorphism in which the underlined base enclosed in parentheses in the base sequence of SEQ ID NO: 1 below (the 68th base of SEQ ID NO: 1) is A. That is, when SNP6 is A, the Brassica plant is resistant to downy mildew, and when the base is other than A (for example, G), the Brassica plant is susceptible to downy mildew. The base sequence of SEQ ID NO: 1 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. SNP6 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, SNP6 can be identified as the 1844124th base on chromosome 6 in the genome base sequence information (Plant GARDEN). SEQ ID NO: 1: 5'-CTCTGATTCTCTCGTCCATGGCGGACATCGACATCACCACCGGAAACGAGCCGCTGATCAACCGCGA A ]AACAACAGAAACAAAGTCTTTAACCGCTGCATCTCACACCAGCAAGACGAGCTACAGAGCTTCCGTAAATACCTGAGATGGATGTGCGTGGACCACTCGAGTCCATGGACTGCGATCCTCTCGTGGACCAT-3'

[0042] The SNP7 indicates a polymorphism in which the underlined base enclosed in parentheses in the base sequence of SEQ ID NO: 1 (the 104th base of SEQ ID NO: 1) is A. That is, when SNP7 is A, the Brassica plant is resistant to downy mildew, and when the base is other than A (for example, G), the Brassica plant is susceptible to downy mildew. The base sequence of SEQ ID NO: 1 can be obtained, for example, from a Brassica plant, specifically a Chinese cabbage plant, deposited under Accession No. FERM BP-22496, as described below. The SNP7 can also be identified from publicly known information on databases such as the aforementioned websites. Specifically, the SNP7 can be identified as the 1844160th base on chromosome 6 in the genome base sequence information (Plant GARDEN). SEQ ID NO: 1:5'-CTCTGATTCTCTCGTCCATGGCGGACATCGACATCACCACCGGAAACGAGCCGCTGATCAACCGCGAAAACAACAGAAACAAAGTCTTTAACCGCTGCATCTC[ A ]CACCAGCAAGACGAGCTACAGAGCTTCCGTAAATACCTGAGATGGATGTGCGTGGACCACTCGAGTCCATGGACTGCGATCCTCTCGTGGACCAT-3'

[0043] The locations of the SNP markers on the chromosomes are not particularly limited. For example, the SNP markers are located on chromosome 6 of a Brassica plant in the following order from upstream (SNP5) to downstream (SNP3): SNP5, SNP2, SNP4, SNP6, SNP1, SNP7, and SNP3.

[0044] The number of SNP markers possessed by the resistance locus is not particularly limited, and may be, for example, any one, two, three, four, five, six, or all seven of the SNP markers. Note that the association between these seven types of polymorphisms (SNP markers) and downy mildew resistance has not been reported before, and these are novel polymorphisms involved in downy mildew resistance that were discovered for the first time by the present inventors.

[0045] The combination of the SNP markers is not particularly limited, and examples thereof include the following combinations. A combination of SNP1 and SNP2, Combination of SNP1 and SNP3 Combination of SNP1 and SNP4 Combination of SNP1 and SNP5 Combination of SNP1 and SNP6 Combination of SNP1 and SNP7 Combination of SNP2 and SNP3 Combination of SNP2 and SNP4 Combination of SNP2 and SNP5 Combination of SNP2 and SNP6 Combination of SNP2 and SNP7 Combination of SNP3 and SNP4 Combination of SNP3 and SNP5 Combination of SNP3 and SNP6 Combination of SNP3 and SNP7 Combination of SNP4 and SNP5 Combination of SNP4 and SNP6 Combination of SNP4 and SNP7 Combination of SNP5 and SNP6 Combination of SNP5 and SNP7 Combination of SNP6 and SNP7 Combination of SNP1, SNP2, and SNP3 Combination of SNP1, SNP2, and SNP4 Combination of SNP1, SNP2, and SNP5 Combination of SNP1, SNP2, and SNP6 Combination of SNP1, SNP2, and SNP7 Combination of SNP1, SNP3, and SNP4 Combination of SNP1, SNP3, and SNP5 Combination of SNP1, SNP3, and SNP6 Combination of SNP1, SNP3, and SNP7 Combination of SNP1, SNP4, and SNP5 Combination of SNP1, SNP4, and SNP6 Combination of SNP1, SNP4, and SNP7 Combination of SNP1, SNP5, and SNP6 Combination of SNP1, SNP5, and SNP7 Combination of SNP1, SNP6, and SNP7 Combination of SNP2, SNP3, and SNP4 Combination of SNP2, SNP3, and SNP5 Combination of SNP2, SNP3, and SNP6 Combination of SNP2, SNP3, and SNP7 Combination of SNP2, SNP4, and SNP5 Combination of SNP2, SNP4, and SNP6 Combination of SNP2, SNP4, and SNP7 Combination of SNP2, SNP5, and SNP6 Combination of SNP2, SNP5, and SNP7 Combination of SNP2, SNP6, and SNP7 Combination of SNP1, SNP2, SNP3, and SNP4 Combination of SNP1, SNP2, SNP3, and SNP5 Combination of SNP1, SNP2, SNP3, and SNP6 Combination of SNP1, SNP2, SNP3, and SNP7 Combination of SNP1, SNP2, SNP4, and SNP5 Combination of SNP1, SNP2, SNP4, and SNP6 Combination of SNP1, SNP2, SNP4, and SNP7 Combination of SNP1, SNP2, SNP5, and SNP6 Combination of SNP1, SNP2, SNP5, and SNP7 Combination of SNP1, SNP2, SNP6, and SNP7 Combination of SNP1, SNP3, SNP4, and SNP5 Combination of SNP1, SNP3, SNP4, and SNP6 Combination of SNP1, SNP3, SNP4, and SNP7 Combination of SNP1, SNP3, SNP5, and SNP6 Combination of SNP1, SNP3, SNP5, and SNP7 Combination of SNP1, SNP3, SNP6, and SNP7 Combination of SNP1, SNP4, SNP5, and SNP6 Combination of SNP1, SNP4, SNP5, and SNP7 Combination of SNP1, SNP4, SNP6, and SNP7 Combination of SNP1, SNP5, SNP6, and SNP7 Combination of SNP2, SNP3, SNP4, and SNP5 Combination of SNP2, SNP3, SNP4, and SNP6 Combination of SNP2, SNP3, SNP4, and SNP7 Combination of SNP2, SNP3, SNP5, and SNP6 Combination of SNP2, SNP3, SNP5, and SNP7 Combination of SNP2, SNP3, SNP6, and SNP7 Combination of SNP2, SNP4, SNP5, and SNP6 Combination of SNP2, SNP4, SNP5, and SNP7 Combination of SNP2, SNP4, SNP6, and SNP7 Combination of SNP2, SNP5, SNP6, and SNP7 Combination of SNP1, SNP2, SNP3, SNP4, and SNP5 Combination of SNP1, SNP2, SNP3, SNP4, and SNP6 Combination of SNP1, SNP2, SNP3, SNP4, and SNP7 Combination of SNP1, SNP2, SNP3, SNP5, and SNP6 Combination of SNP1, SNP2, SNP3, SNP5, and SNP7 Combination of SNP1, SNP2, SNP3, SNP6, and SNP7 Combination of SNP1, SNP2, SNP4, SNP5, and SNP6 Combination of SNP1, SNP2, SNP4, SNP5, and SNP7 Combination of SNP1, SNP2, SNP4, SNP6, and SNP7 Combination of SNP1, SNP2, SNP5, SNP6, and SNP7 Combination of SNP1, SNP3, SNP4, SNP5, and SNP6 Combination of SNP1, SNP3, SNP4, SNP5, and SNP7 Combination of SNP1, SNP3, SNP4, SNP6, and SNP7 Combination of SNP1, SNP3, SNP5, SNP6, and SNP7 Combination of SNP1, SNP4, SNP5, SNP6, and SNP7 Combination of SNP2, SNP3, SNP4, SNP5, and SNP6 Combination of SNP2, SNP3, SNP4, SNP5, and SNP7 Combination of SNP2, SNP3, SNP4, SNP6, and SNP7 Combination of SNP2, SNP3, SNP5, SNP6, and SNP7 Combination of SNP2, SNP4, SNP5, SNP6, and SNP7 Combination of SNP1, SNP2, SNP3, SNP4, SNP6, and SNP7 Combination of SNP1, SNP2, SNP4, SNP5, SNP6, and SNP7 Combination of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7 Among the above combinations, the following combinations are preferred, for example, because they have a higher correlation with downy mildew resistance. A combination of SNP1 and SNP2, Combination of SNP1 and SNP4 Combination of SNP2 and SNP4 Combination of SNP1, SNP2, and SNP4

[0046] (2) Identification by base sequence including SNP markers The resistance locus may be defined by, for example, a nucleotide sequence containing the SNP marker, as described in (2) above. The resistance locus may consist of or include the nucleotide sequence.

[0047] The base sequence containing the SNP marker is not particularly limited, and examples thereof include the polynucleotides (a) to (g) described below. The polynucleotides (a) to (g) correspond to base sequences containing the SNP markers SNP1 to SNP7, respectively.

[0048] The polynucleotide (a) is a base sequence containing SNP1, and is, for example, the polynucleotide (a1), (a2), or (a3) ​​below. The polynucleotide (a1), (a2), or (a3) ​​is, for example, a polynucleotide that has a function equivalent to that of the polynucleotide (a1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (a2) or (a3) ​​exhibits downy mildew resistance.

[0049] (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved and one or several nucleotides have been deleted, substituted, inserted and / or added in the nucleotide sequence of (a1); (a3) A polynucleotide comprising a base sequence that conserves the 99th base (A) of (a1) and has an identity of 80% or more to the base sequence of (a1).

[0050] In the polynucleotide (a1), the underlined base (A) enclosed in parentheses in SEQ ID NO: 1 corresponds to the polymorphism of SNP 1. The polynucleotide (a1) can be obtained, for example, from a Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0051] In the polynucleotide (a2), the one or several is, for example, 1 to 39, 1 to 29, 1 to 21, 1 to 19, 1 to 15, 1 to 11, 1 to 10, 1 to 9, 1 to 7, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0052] In the polynucleotide of (a3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0053] The polynucleotide (b) is a base sequence containing SNP2, and is, for example, the polynucleotide (b1), (b2), or (b3) below. The polynucleotides (b2) and (b3) are, for example, polynucleotides that have a function equivalent to that of the polynucleotide (b1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (b2) or (b3) exhibits downy mildew resistance.

[0054] (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) A polynucleotide comprising a base sequence that conserves the 100th base (T) of (b1) and has 80% or more identity to the base sequence of (b1).

[0055] In the polynucleotide (b1), the underlined base (T) enclosed in parentheses in SEQ ID NO: 2 corresponds to the polymorphism of SNP 2. The polynucleotide (b1) can be obtained, for example, from the Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0056] In the polynucleotide (b2), the one or several is, for example, 1 to 40, 1 to 30, 1 to 22, 1 to 20, 1 to 15, 1 to 11, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0057] In the polynucleotide (b3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0058] The polynucleotide (c) is a base sequence containing the SNP3, and is, for example, the polynucleotide (c1), (c2), or (c3) below. The polynucleotide (c1), (c2), or (c3) is, for example, a polynucleotide that has a function equivalent to that of the polynucleotide (c1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (c2) or (c3) exhibits downy mildew resistance.

[0059] (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) A polynucleotide comprising a base sequence that conserves the 100th base (G) of (c1) and has 80% or more identity to the base sequence of (c1).

[0060] In the polynucleotide (c1), the underlined base (G) enclosed in parentheses in SEQ ID NO: 3 corresponds to the polymorphism of SNP3. The polynucleotide (c1) can be obtained, for example, from the Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0061] In the polynucleotide (c2), the one or several is, for example, 1 to 40, 1 to 30, 1 to 22, 1 to 20, 1 to 15, 1 to 11, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0062] In the polynucleotide (c3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0063] The polynucleotide (d) is a base sequence containing the SNP4, and is, for example, the polynucleotide (d1), (d2), or (d3) below. The polynucleotides (d1), (d2), and (d3) are, for example, polynucleotides that have a function equivalent to that of the polynucleotide (d1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (d2) or (d3) exhibits downy mildew resistance.

[0064] (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) A polynucleotide comprising a base sequence that conserves the 100th base (G) of (d1) and has 80% or more identity to the base sequence of (d1).

[0065] In the polynucleotide (d1), the underlined base (G) enclosed in parentheses in SEQ ID NO: 4 corresponds to the polymorphism of SNP4. The polynucleotide (d1) can be obtained, for example, from the Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0066] In the polynucleotide (d2), the one or several is, for example, 1 to 40, 1 to 30, 1 to 22, 1 to 20, 1 to 15, 1 to 11, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0067] In the polynucleotide (d3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0068] The polynucleotide (e) is a base sequence containing the SNP5, and is, for example, the polynucleotide (e1), (e2), or (e3) below. The polynucleotides (e1), (e2), and (e3) are, for example, polynucleotides that have a function equivalent to that of the polynucleotide (e1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (e2) or (e3) exhibits downy mildew resistance.

[0069] (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) A polynucleotide comprising a base sequence that conserves the 100th base (C) of (e1) and has an identity of 80% or more to the base sequence of (e1).

[0070] In the polynucleotide (e1), the underlined base (C) enclosed in parentheses in SEQ ID NO: 5 corresponds to the polymorphism of SNP 5. The polynucleotide (e1) can be obtained, for example, from the Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0071] In the polynucleotide (e2), the one or several is, for example, 1 to 40, 1 to 30, 1 to 22, 1 to 20, 1 to 15, 1 to 11, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0072] In the polynucleotide (e3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0073] The polynucleotide (f) is a base sequence containing the SNP6, and is, for example, the polynucleotide (f1), (f2), or (f3) below. The polynucleotides (f1), (f2), and (f3) are, for example, polynucleotides that have a function equivalent to that of the polynucleotide (f1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (f2) or (f3) exhibits downy mildew resistance.

[0074] (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide comprising a base sequence in which the 68th base (A) of (a1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) A polynucleotide comprising a base sequence that conserves the 68th base (A) of (f1) and has 80% or more identity to the base sequence of (f1).

[0075] In the polynucleotide (f1), the underlined base (A) enclosed in parentheses in SEQ ID NO: 1 corresponds to the polymorphism of SNP 6. The polynucleotide (f1) can be obtained, for example, from a Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0076] In the polynucleotide (f2), the one or several is, for example, 1 to 39, 1 to 29, 1 to 21, 1 to 19, 1 to 15, 1 to 11, 1 to 10, 1 to 9, 1 to 7, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0077] In the polynucleotide (f3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0078] The polynucleotide (g) is a base sequence containing SNP7, and is, for example, the polynucleotide (g1), (g2), or (g3) below. The polynucleotides (g1), (g2), and (g3) are, for example, polynucleotides that have a function equivalent to that of the polynucleotide (g1) with respect to downy mildew resistance at the resistance locus. The equivalent function means, for example, that a Brassica plant having a downy mildew resistance locus identified by the polynucleotide (g2) or (g3) exhibits downy mildew resistance.

[0079] (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1).

[0080] In the polynucleotide (g1), the underlined base (A) enclosed in parentheses in SEQ ID NO: 1 corresponds to the polymorphism of SNP 7. The polynucleotide (g1) can be obtained, for example, from the Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0081] In the polynucleotide (g2), the one or several is, for example, 1 to 39, 1 to 29, 1 to 21, 1 to 19, 1 to 15, 1 to 11, 1 to 10, 1 to 9, 1 to 7, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0082] In the polynucleotide (g3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0083] The number of base sequences containing the SNP markers that the resistance locus has, i.e., the number of base sequences containing SNP markers linked to the resistance locus, is not particularly limited, and may be, for example, any one, two, three, four, five, six, or all seven of the polynucleotides (a) to (g).

[0084] The combination of base sequences containing the SNP markers is not particularly limited, and examples thereof include the following combinations. A combination of polynucleotides (a) and (b), A combination of polynucleotides (a) and (c) A combination of polynucleotides (a) and (d) A combination of polynucleotides (a) and (e) A combination of polynucleotides (a) and (f) A combination of polynucleotides (a) and (g) A combination of polynucleotides (b) and (c) A combination of polynucleotides (b) and (d) A combination of polynucleotides (b) and (e) A combination of polynucleotides (b) and (f) A combination of polynucleotides (b) and (g) A combination of polynucleotides (c) and (d) A combination of polynucleotides (c) and (e) A combination of polynucleotides (c) and (f) A combination of polynucleotides (c) and (g) A combination of polynucleotides (d) and (e) A combination of polynucleotides (d) and (f) A combination of polynucleotides (d) and (g) A combination of polynucleotides (e) and (f) A combination of polynucleotides (e) and (g) A combination of polynucleotides (f) and (g) A combination of polynucleotides (a), (b), and (c) A combination of polynucleotides (a), (b), and (d). A combination of polynucleotides (a), (b), and (e). A combination of polynucleotides (a), (b), and (f) A combination of polynucleotides (a), (b), and (g). A combination of polynucleotides (a), (c), and (d). A combination of polynucleotides (a), (c), and (e). A combination of polynucleotides (a), (c), and (f) A combination of polynucleotides (a), (c), and (g). A combination of polynucleotides (a), (d), and (e). A combination of polynucleotides (a), (d), and (f) A combination of polynucleotides (a), (d), and (g). A combination of polynucleotides (a), (e), and (f) A combination of polynucleotides (a), (e), and (g). A combination of polynucleotides (a), (f), and (g). A combination of polynucleotides (b), (c), and (d). A combination of polynucleotides (b), (c), and (e). A combination of polynucleotides (b), (c), and (f) A combination of polynucleotides (b), (c), and (g). A combination of polynucleotides (b), (d), and (e). A combination of polynucleotides (b), (d), and (f) A combination of polynucleotides (b), (d), and (g). A combination of polynucleotides (b), (e), and (f) A combination of polynucleotides (b), (e), and (g). A combination of polynucleotides (b), (f), and (g). A combination of polynucleotides (a), (b), (c), and (d). A combination of polynucleotides (a), (b), (c), and (e). A combination of polynucleotides (a), (b), (c), and (f) A combination of polynucleotides (a), (b), (c), and (g). A combination of polynucleotides (a), (b), (d), and (e). A combination of polynucleotides (a), (b), (d), and (f) A combination of polynucleotides (a), (b), (d), and (g). A combination of polynucleotides (a), (b), (e), and (f) A combination of polynucleotides (a), (b), (e), and (g). A combination of polynucleotides (a), (b), (f), and (g). A combination of polynucleotides (a), (c), (d), and (e). A combination of polynucleotides (a), (c), (d), and (f) A combination of polynucleotides (a), (c), (d), and (g). A combination of polynucleotides (a), (c), (e), and (f) A combination of polynucleotides (a), (c), (e), and (g). A combination of polynucleotides (a), (c), (f), and (g). A combination of polynucleotides (b), (c), (d), and (e). A combination of polynucleotides (b), (c), (d), and (f) A combination of polynucleotides (b), (c), (d), and (g). A combination of polynucleotides (b), (c), (e), and (f) A combination of polynucleotides (b), (c), (e), and (g). A combination of polynucleotides (b), (d), (e), and (f) A combination of polynucleotides (b), (d), (e), and (g). A combination of polynucleotides (b), (e), (f), and (g). A combination of polynucleotides (a), (b), (c), (d), and (e). Combinations of polynucleotides (a), (b), (c), (d), (e), (f), and (g) Among the above combinations, the following combinations are preferred, for example, because they have a higher correlation with downy mildew resistance. A combination of polynucleotides (a) and (b), A combination of polynucleotides (a) and (d) A combination of polynucleotides (b) and (d) A combination of polynucleotides (a), (b), and (d).

[0085] (3) Identification by the region between the two SNP markers As described above, the resistance locus is linked to an SNP marker. Therefore, as described in (3) above, the resistance locus may be defined, for example, by the nucleotide sequence of the region between the two SNP markers or the region defined by the two SNP markers (also referred to as the locus position, locus region, or mapping region). The nucleotide sequence of the region between the two SNP markers is not particularly limited, and examples thereof include the nucleotide sequence of the region between two SNP markers on the chromosome selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7. The nucleotide sequence of the region between the two SNP markers can be determined, for example, by the nucleotide sequence of the region between the corresponding two SNP markers in the Brassica plant deposited under accession number FERM BP-22496 (hereinafter also referred to as the "deposited line") described below. When referring to the nucleotide sequence of the deposited line, the nucleotide sequence of the region between the two SNP markers may, for example, completely or partially match the nucleotide sequence of the deposited line. In the latter case, for example, the nucleotide sequence of the region between the two SNP markers may be such that a Brassica plant having a resistance locus identified by the nucleotide sequence of the region between the two SNP markers exhibits downy mildew resistance. The partial match can be defined, for example, by the identity to the nucleotide sequence of the deposited line. The identity may be, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more.

[0086] When the resistance locus is identified by (3) above, it can also be said that the resistance locus is located in the region between the sites of the two SNP markers. In this case, the presence of the resistance locus confers resistance to downy mildew to the Brassica plant, for example. When the resistance locus is identified by the region in which it is located, the resistance locus may further be identified by, for example, combining it with the SNP marker or a nucleotide sequence containing the SNP marker. Furthermore, when the resistance locus is identified by (3) above, it can also be said that the resistance locus is included in or exists in the genomic region between the sites of the two SNP markers.

[0087] As described above, the upstream end and downstream end of the region can be identified, for example, by the sites of the two SNP markers. The region may be, for example, between the sites of the two SNP markers, and may or may not include both or one of the sites of the two SNP markers. Furthermore, when the region includes the sites of the SNP markers, the upstream end and the downstream end of the region are the sites of the SNP markers, and the bases at the upstream end and the downstream end may be, for example, the underlined bases in the above-mentioned base sequence, or may be other bases.

[0088] The two SNP markers that define the region are not particularly limited, and the following combinations can be exemplified. (1) The SNP at the upstream end is SNP5 or SNP2, and the SNP at the downstream end is SNP3, SNP1, or SNP4; (2) the SNP at the upstream end is SNP5 and the SNP at the downstream end is SNP3; (3) the SNP at the upstream end is SNP2 and the SNP at the downstream end is SNP3; (4) the SNP at the upstream end is SNP5 and the SNP at the downstream end is SNP1; (5) The SNP at the upstream end is SNP2, and the SNP at the downstream end is SNP1. Among the above combinations, the following combinations are preferred, for example, because they have a high correlation with downy mildew resistance. A combination of (2) to (5) above; Among the above combinations, the following combinations are more preferred because they have a higher correlation with downy mildew resistance. A combination of (2) above.

[0089] When the resistance locus is defined by the region between the two SNP markers, the resistance locus preferably further has the SNP marker located in the region. Specifically, the resistance locus preferably has an SNP marker selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7 in the region, and more preferably has an SNP marker selected from the group consisting of SNP1, SNP2, and SNP4.

[0090] The SNP marker located in the region may be, for example, one or both of the two SNP marker sites that define the region on the chromosome, or may be an SNP marker located between the two SNP marker sites that define the region. The former is also referred to as an SNP marker at the end of the region, and the latter is also referred to as an SNP marker within the region. The SNP marker located in the region may be, for example, both an SNP marker at the end of the region and an SNP marker within the region.

[0091] The SNP markers within the region include, for example, SNP markers located between the upstream and downstream SNP marker sites that define the region, and can be designed by conventional methods in the technical field of the present application. The SNP markers within the region can be designed, for example, with reference to Reference 5 below. Specifically, first, the nucleotide sequence between SNP1 and SNP2 of the deposited strain is used as a reference sequence, and nucleotide sequence information obtained by short read sequencing or the like is mapped to detect polymorphisms such as SNPs. The SNP markers can then be designed, for example, by creating a primer set that distinguishes the detected polymorphisms. Reference 5: Identification and Molecular Mapping of a Gummy Stem Blight Resistance Gene in Wild Watermelon (Citrullus amarus) Germplasm PI 189225, Plant Disease (2020) vol. 104 No.1 p16-24

[0092] The resistance locus is, for example, the downy mildew resistance locus on chromosome 6 of a Brassica plant deposited under accession number FERM BP-22496, which will be described later.

[0093] The downy mildew-resistant Brassica plant of the present disclosure exhibits resistance to downy mildew. In the present disclosure, the downy mildew resistance of a Brassica plant can be expressed by the disease severity calculated from the disease severity index after evaluating the disease severity of the Brassica plant according to the method described in Example 1 below. The explanation in Example 1 below can be used to calculate the disease severity using this method. For example, a Brassica plant can be evaluated as disease-resistant when the disease severity is 2 or less, and as susceptible when the disease severity is greater than 2. When the downy mildew resistance is determined based on the disease severity, the disease severity is the average disease severity (average disease severity) of multiple Brassica plants. The number of Brassica plants (surveyed individuals or survey populations) used to determine the downy mildew resistance is, for example, a number that allows for statistical testing with downy mildew-susceptible Brassica plants, specifically 40 to 50 plants.

[0094] An example of a Brassica plant of the present disclosure is the Brassica plant deposited under accession number FERM BP-22496 or a progeny line thereof. The progeny line, for example, has the resistance locus. Deposit information is shown below. Type of deposit: International deposit Name of depository institution: National Institute of Technology and Evaluation, Patent Organism Depositary Center Address: Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818, Japan Accession number: FERM BP-22496 Identification mark: Takii37 Received: May 2, 2024

[0095] The Brassica plant of the present disclosure can also be produced, for example, by introducing the downy mildew resistance locus into a Brassica plant. The method for introducing the downy mildew resistance locus into the Brassica plant is not particularly limited, and examples include hybridization with the Brassica plant of the present disclosure, embryo culture, or a conventionally known genetic engineering technique. Examples of the genetic engineering technique include methods using genetic recombination technology and genome editing technology. The downy mildew resistance locus to be introduced can be, for example, the downy mildew resistance locus described above. When introducing the downy mildew resistance locus by hybridization with the Brassica plant of the present disclosure, the Brassica plant of the present disclosure used for hybridization preferably contains the downy mildew resistance locus in a homozygous form, for example.

[0096] In the case of Brassica plants, as disclosed in Japanese Patent No. 5551534, the desired gene locus is generally introgressed through interspecific hybridization. Therefore, the introduction of the downy mildew resistance gene locus into the Brassica plant may be carried out, for example, by interspecific hybridization. The interspecific hybridization can be carried out, for example, between a Rapa plant and a Cabbage plant, or between a Rapa plant and a Brassica plant.

[0097] The characteristics of the Brassica plant of the present disclosure other than downy mildew resistance, such as morphological and ecological characteristics, are not particularly limited.

[0098] The Brassica plants of the present disclosure may further have other resistances.

[0099] <Downy mildew-resistant Brassica plant parts> In another aspect, the present disclosure provides a part of a Brassica plant that is resistant to downy mildew. The present disclosure is a part of the downy mildew-resistant Brassica plant of the present disclosure.

[0100] Examples of the plant parts include plant cells, plant protoplasts, plant cell cultures or tissue cultures capable of regenerating plants, plant callus, plant clumps, plant cells isolated from plants or plant parts, meristematic cells, flowers, petals, flower buds, pistils, corollas, pollen, leaves, petioles, leaf pith, cotyledons, ovaries, embryos, ovules, hypocotyls, embryo sacs, egg cells, microspores, anthers, cuttings, scions, rootstocks, roots, root tips, seeds, fruits, stems, stalks, and seedlings. Examples of the plant parts include organs, tissues, cells, and vegetative propagules, and any of these may be used. Examples of the organs include petals, corollas, flowers, leaves, seeds, fruits, stems, and roots. Examples of the tissues are parts of the organs. The pollen may be mature or immature pollen.

[0101] The plant parts of the present disclosure can be produced, for example, by obtaining a desired part of a Brassica plant of the present disclosure.

[0102] <Method for producing downy mildew-resistant Brassica plants> In another aspect, the present disclosure provides a method for producing a Brassica plant that is resistant to downy mildew. The method for producing a downy mildew-resistant Brassica plant of the present disclosure (hereinafter also referred to as the "production method") comprises the following steps (a) and (b). The production method of the present disclosure may comprise only the following step (a):

[0103] (a) crossing (mating) the downy mildew-resistant Brassica plant of the present disclosure with another Brassica plant; (b) selecting a downy mildew-resistant Brassica plant from the Brassica plants obtained in step (a) or their progeny lines.

[0104] According to the production method of the present disclosure, by crossing the Brassica plant of the present disclosure with another Brassica plant, a Brassica plant exhibiting resistance to downy mildew can be obtained from the resulting progeny line. According to the production method of the present disclosure, any Brassica plant can be used to breed a Brassica plant variety exhibiting resistance to downy mildew. Therefore, the production method of the present disclosure can also be referred to as, for example, a breeding method or a cultivation method.

[0105] In the production method of the present disclosure, the description of the downy mildew resistance marker can refer to the description of the downy mildew resistance marker in Brassica plants of the present disclosure, i.e., the description of the downy mildew resistance gene locus on chromosome 6.

[0106] In step (a), the downy mildew-resistant Brassica plant used as the first parent may be any Brassica plant of the present disclosure. The Brassica plant of the present disclosure is preferably, for example, the Brassica plant deposited under accession number FERM BP-22496 described above or a progeny thereof. The downy mildew-resistant Brassica plant used as the first parent in step (a) can also be obtained, for example, by the screening method of the present disclosure described below. Therefore, the downy mildew-resistant Brassica plant may be prepared, for example, by selecting from a test Brassica plant by step (x) described below prior to step (a). (x) selecting the downy mildew-resistant Brassica plant of the present disclosure from test Brassica plants.

[0107] In the step (x), the selection of the downy mildew-resistant Brassica plant can be carried out, for example, by directly and / or indirectly evaluating (detecting) the downy mildew resistance of the test Brassica plant and selecting the downy mildew-resistant Brassica plant. The direct evaluation (detection) can be carried out using the above-mentioned explanation for the evaluation method using the disease severity of downy mildew resistance.

[0108] When the indirect evaluation is carried out, in step (x), for example, the presence or absence of the downy mildew resistance marker can be used as an indicator to select a downy mildew-resistant Brassica plant. Specifically, in step (x), the selection of the downy mildew-resistant Brassica plant can be said to be the selection of a Brassica plant having the downy mildew resistance marker, i.e., the downy mildew resistance locus on chromosome 6. For this reason, step (x) can be carried out, for example, by steps (x1) and (x2) below.

[0109] (x1) a detection step of detecting the presence or absence of the downy mildew resistance marker on the chromosome of the test Brassica plant. (x2) a selection step of selecting the test Brassica plant as a downy mildew-resistant Brassica plant based on the presence of the downy mildew resistance marker.

[0110] As described above, the selection in step (x) is, for example, the selection of a Brassica plant having the downy mildew resistance marker. Specifically, the resistant Brassica plant can be selected by detecting the downy mildew resistance marker in the test Brassica plant.

[0111] The detection of the resistance locus in step (x1) can be carried out, for example, as described for Brassica plants of the present disclosure, by detecting a downy mildew resistance marker that confers downy mildew resistance, i.e., a Brassica plant having the downy mildew resistance locus on chromosome 6. The detection of the resistance locus will be described later.

[0112] In step (x2), for example, if the downy mildew resistance marker is present in one chromosome of a pair of chromosomes, the test Brassica plant may be selected as the resistant Brassica plant, or if the downy mildew resistance marker is present in both chromosomes of a pair of chromosomes, the test Brassica plant may be selected as the resistant Brassica plant, the latter being preferred.

[0113] Specific examples of the selection in the step (x) are given below, but the present disclosure is not limited to these.

[0114] In the production method of the present disclosure, when the resistance locus is detected as the downy mildew resistance marker, the detection of the presence or absence of the downy mildew resistance marker in step (x1) can be carried out by detecting the presence or absence of the resistance locus.

[0115] The detection of the resistance locus in step (x1) can be performed using, for example, (1) the SNP marker, (2) a base sequence containing the SNP marker, (3) a region between the sites of the two SNP markers, or a combination thereof, which define the downy mildew resistance locus. Specifically, in step (x1), for example, a molecular marker such as an SNP associated with the resistance locus is detected on a chromosome of the test Brassica plant, and the presence or absence of the downy mildew resistance locus is detected from the obtained detection results.

[0116] (1) Identification by SNP markers The selection in step (x) is, for example, selection of a Brassica plant having a downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7. The selected SNP marker is not particularly limited, and for example, the explanation for "(1) Identification by SNP marker" in the Brassica plant of the present disclosure can be used.

[0117] (2) Identification by base sequence including SNP markers The selection in step (x) is, for example, selection of a Brassica plant having a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of (a), (b), (c), (d), (e), (f), and (g). The polynucleotides (a), (b), (c), (d), (e), (f), and (g) can be identified by, for example, the explanation for "(2) Identification by nucleotide sequence including SNP markers" in the Brassica plant of the present disclosure.

[0118] (3) Identification by the region between the two SNP markers The selection in step (x) is, for example, selection of a Brassica plant having a downy mildew resistance locus that includes the nucleotide sequence of a region between two SNP markers on the chromosome selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7. The nucleotide sequence of the region between the two SNP markers can be determined by reference to the explanation in "(3) Identification by the region between the two SNP markers" for Brassica plants of the present disclosure.

[0119] As a specific example, the selection in step (x) may include the selection of a Brassica plant having a downy mildew resistance locus located between the SNP markers SNP3 and SNP5, SNP5 and SNP1, SNP2 and SNP3, or SNP2 and SNP1 on the chromosome.

[0120] When detecting the presence or absence of a nucleotide sequence in the region between the two SNP markers, in step (x1), for example, the nucleotide sequence of the genome (genomic DNA) of the test Brassica plant is decoded. Then, in step (x1), the obtained nucleotide sequence is compared with the nucleotide sequence of the genome (genomic DNA) of the deposited line, and detection can be performed based on whether the nucleotide sequences match. The nucleotide sequence can be decoded, for example, using a sample containing the genome (genomic DNA) of the test Brassica plant, a sequencing reagent, and a sequencer. The comparison of the nucleotide sequences can be performed, for example, using nucleotide sequence analysis software (e.g., the aforementioned BLAST). The region of the obtained nucleotide sequence to be compared is the region between the two SNP markers. Specifically, the decoded sequence in step (x1) can be determined by scaffolding using a single-molecule sequencer, for example, as described in Reference 6 below. Thus, in step (x1), a Brassica plant having a base sequence that matches the base sequence of the region between the two SNP markers in the deposited line or that satisfies the aforementioned identity can be identified (or detected) as a test Brassica plant containing the resistance locus. In step (x1), the detection may be performed on the entire genome of the test Brassica plant, or on a portion of the genome. Furthermore, the detection may be performed on all chromosomes, or on a portion of chromosomes. Then, in step (x2), for example, a test Brassica plant containing the resistance locus is selected as a Brassica plant of the present disclosure or its progeny line, i.e., a Brassica plant exhibiting downy mildew resistance. Reference 6: Improved Brassica rapa reference genome by single-molecule sequencing and chromosome conformation capture technologies, https: / / doi.org / 10.1038 / s41438-019-0210-y

[0121] When detecting a resistance locus in the genomic region between the sites of the two SNP markers, the resistance locus may be detected by QTL analysis in the step (x1). The QTL analysis allows for the identification of a chromosomal region that contributes to downy mildew resistance in the test Brassica plant. For example, the following Reference 7 can be referenced for a method of QTL analysis in Brassica plants. Then, in the step (x2), a test Brassica plant that contains the resistance locus in the region between the two SNP sites on the chromosome is selected as the Brassica plant of the present disclosure or its progeny line, i.e., a Brassica plant that exhibits downy mildew resistance. Reference 7: Yu, Shuancang, et al. "Construction of a sequence-based bin map and mapping of QTLs for downy mildew resistance at four developmental stages in Chinese cabbage (Brassica rapa L. ssp. pekinensis)." Molecular Breeding 36 (2016): 1-12.

[0122] The chromosome for detecting the presence or absence of the downy mildew resistance gene locus is preferably chromosome 6.

[0123] The Brassica plant of the present disclosure can be produced, for example, by the below-described method of providing the plant. Therefore, the production method of the present disclosure may include the following step (y). For example, the explanation of the below-described method of providing the plant of the present disclosure can be used for the following step (y). (y) A step of producing a Brassica plant resistant to the present disclosure from a target Brassica plant (production step)

[0124] Furthermore, in step (a), the Brassica plant used as the other parent is not particularly limited, and may be, for example, a Brassica plant with or without known downy mildew resistance, a Brassica plant with or without other resistance, or the downy mildew-resistant Brassica plant of the present disclosure. As described above, interspecific or intergeneric hybridization is possible among Brassica plants. Therefore, in step (a), the target Brassica plant and the Brassica plant used as the other parent may be of the same species or different species. Specific examples of combinations (in no particular order) of the target Brassica plant and the Brassica plant used as the other parent include a combination of a Rapa species plant and a Cabbage species plant, and a Rapa species plant and a Brassica species plant.

[0125] In the step (a), the method for crossbreeding the downy mildew-resistant Brassica plant with the other Brassica plant is not particularly limited, and known methods (for example, Japanese Patent No. 5551534) can be used.

[0126] In step (b), the target for selecting a downy mildew-resistant Brassica plant may be, for example, the Brassica plant obtained in step (a), or a progeny line obtained from that Brassica plant. Specifically, the target may be, for example, an F1 Brassica plant obtained by the crossing in step (a), or a progeny line thereof. The progeny line may be, for example, a self-crossed progeny or backcrossed progeny of the F1 Brassica plant obtained by the crossing in step (a), or a Brassica plant obtained by crossing the F1 Brassica plant with another Brassica plant.

[0127] In the step (b), the selection of a downy mildew-resistant Brassica plant can be carried out, for example, by directly or indirectly confirming the downy mildew resistance.

[0128] In step (b), the direct confirmation can be carried out by, for example, evaluating the downy mildew resistance of the obtained F1 Brassica plant or its progeny line based on the aforementioned disease severity. Specifically, for example, the F1 Brassica plant or its progeny line is inoculated with, for example, downy mildew fungus, and the downy mildew resistance is evaluated based on the aforementioned disease severity; a disease severity of 2 or less can be evaluated as disease-resistant, and a disease severity of more than 2 can be evaluated as susceptible. In this case, for example, the F1 Brassica plant or its progeny line that meets the predetermined criteria can be selected as a downy mildew-resistant Brassica plant.

[0129] In the step (b), the selection by indirect confirmation can be carried out, for example, by the following steps (b1) and (b2). (b1) a detection step of detecting the presence or absence of a downy mildew resistance marker on the chromosome of the Brassica plant obtained in the step (a) or its progeny line. (b2) a selection step of selecting the Brassica plant or its progeny obtained in step (a) as a downy mildew-resistant Brassica plant based on the presence of the downy mildew resistance marker.

[0130] The selection of downy mildew-resistant Brassica plants by indirect confirmation in step (b) can be carried out, for example, by detecting the presence or absence of the downy mildew resistance marker, in the same manner as described in step (x).

[0131] In the production method of the present disclosure, it is preferable to further cultivate the downy mildew-resistant Brassica plant selected in step (b).

[0132] In this way, the Brassica plant or its progeny line confirmed to be downy mildew-resistant can be selected as a downy mildew-resistant Brassica plant.

[0133] The production method of the present disclosure may further include a seed collection step of collecting seeds from the progeny line obtained by crossbreeding.

[0134] The production method of the present disclosure includes the steps (a) and (b), but the present disclosure is not limited thereto and may include only the step (a). In this case, the Brassica plant of the present disclosure used in the step (a) preferably contains the resistance locus in a homozygous form.

[0135] <Screening method for downy mildew-resistant Brassica plants> In another aspect, the present disclosure provides a method for screening for a Brassica plant that is resistant to downy mildew. The screening method of the present disclosure is a method for screening for a downy mildew-resistant Brassica plant, and includes a selection step of selecting, from test Brassica plants, a Brassica plant that contains a downy mildew resistance locus on chromosome 6 as a downy mildew-resistant Brassica plant. The screening method of the present disclosure can be used to screen for Brassica plants that may be resistant to downy mildew. Furthermore, the screening method of the present disclosure can be used to screen for parents for producing a downy mildew-resistant Brassica plant by hybridization.

[0136] In the selection step, for example, a test Brassica plant having the downy mildew resistance locus is selected as a downy mildew-resistant Brassica plant. For example, the explanation for step (x) in the method for producing a downy mildew-resistant Brassica plant of the present disclosure can be applied to the selection step.

[0137] In the screening method of the present disclosure, the selection step can be performed using the explanation for the indirect selection (selection using indirect evaluation) in the step (x) or the step (x1).

[0138] <Method for detecting resistance to downy mildew in Brassica plants> In another aspect, the present disclosure provides a method for detecting resistance to downy mildew in a Brassica plant. The detection method of the present disclosure is a method for detecting downy mildew resistance in a Brassica plant, and includes a detection step of detecting a downy mildew resistance locus on chromosome 6 of a test Brassica plant. The detection method of the present disclosure can detect whether a target Brassica plant exhibits resistance to downy mildew. The method for detecting downy mildew resistance in a Brassica plant of the present disclosure can also be referred to as a method for screening for downy mildew resistance in a Brassica plant, for example.

[0139] The detection of the downy mildew-resistant Brassica plant can be carried out by using, for example, the indirect selection in step (x) in the method for producing a downy mildew-resistant Brassica plant of the present disclosure, i.e., the explanation for step (x1).

[0140] <Method for imparting downy mildew resistance to Brassica plants> In another aspect, the present disclosure provides a method for conferring downy mildew resistance to a Brassica plant. The method of the present disclosure for conferring downy mildew resistance to a Brassica plant includes an introduction step of introducing a downy mildew resistance locus on chromosome 6 into a Brassica plant. According to the conferring method of the present disclosure, downy mildew resistance can be conferred to a Brassica plant by introducing the downy mildew resistance locus on chromosome 6, i.e., the resistance locus using the downy mildew resistance marker of the present disclosure.

[0141] In the introduction step, the method for introducing the downy mildew resistance locus on chromosome 6 is not particularly limited. Examples of the introduction method include crossing with the resistant Brassica plant, embryo culture, and conventionally known genetic engineering techniques. The resistance locus to be introduced can be, for example, the resistance locus described above. When the resistance locus is introduced by crossing with the resistant Brassica plant, the resistant Brassica plant preferably contains the resistance locus in a homozygous form.

[0142] When introducing a downy mildew resistance locus, the introduction step may be carried out by introducing an expression vector and / or artificial chromosome containing the locus. The expression vector and artificial chromosome can be introduced into the target Brassica plant by, for example, the polyethylene glycol method, electroporation, Agrobacterium-mediated method, particle gun method, etc. The target Brassica plant may be, for example, a plant cell, callus, plant tissue, or an individual plant.

[0143] When introducing a downy mildew resistance locus, the introduction step may be carried out by introducing a nucleic acid (donor nucleic acid) containing these and a genome editing unit. In this case, a 5' homology arm is arranged at the 5' end of the nucleic acid, which is homologous to the nucleotide sequence at the 5' end of the introduction site in the chromosome into which the nucleic acid is introduced, and a 3' homology arm is arranged at the 3' end of the nucleic acid, which is homologous to the nucleotide sequence at the 3' end of the introduction site in the chromosome into which the nucleic acid is introduced. Furthermore, the genome editing unit system is configured to be able to cleave the introduction site. As a result, after the introduction step, in the Brassica plant into which the nucleic acid has been introduced, genomic DNA is cleaved at the introduction site, allowing the nucleic acid to be integrated into the chromosome by homologous recombination. The introduction site may be two. In this case, the introduction sites can be designed at the upstream and downstream ends of the chromosome into which the nucleic acid is introduced, where the nucleotide sequence exchange occurs. The 5' homology arm can be designed to have homology to the 5'-end base sequence of the upstream introduction site, and the 3' homology arm can be designed to have homology to the 3'-end base sequence of the downstream introduction site. By providing two introduction sites, the region between the two introduction sites on the chromosome is excised, and the nucleic acid can be introduced in place of this excised region.

[0144] Examples of the genome editing unit include ZFN (Zinc Finger Nuclease), TALEN (Transcription Activator-Like Effector Nuclease), and CRISPR-CAS system. The CRISPR-CAS system includes, for example, a guide strand and a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) enzyme. Examples of the CRISPR enzyme include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4. The nucleic acid may be, for example, a crRNA or tracrRNA, or a single-stranded nucleic acid formed by linking these together via a linker. In this case, the nucleic acid is designed such that the base sequence that anneals to the target sequence in the crRNA is complementary to the base sequence encoding the target sequence.

[0145] The nucleic acid (donor nucleic acid) and genome editing unit can be introduced into a target Brassica plant by, for example, the polyethylene glycol method, electroporation, Agrobacterium-mediated method, particle gun method, etc. The target Brassica plant may be, for example, a plant cell, callus, plant tissue, or an individual plant.

[0146] When the expression vector, the artificial chromosome, or the nucleic acid is introduced in the introduction step, the method of the present disclosure may further include a selection step of selecting a Brassica plant into which the expression vector, the artificial chromosome, or the nucleic acid has been introduced. In this case, the selection can be carried out, for example, by detecting the introduced expression vector, the artificial chromosome, or the nucleic acid, and selecting a Brassica plant in which the expression vector, the artificial chromosome, or the nucleic acid has been detected.

[0147] <Brassica downy mildew resistance marker> In one aspect, the present disclosure provides a marker that can be used as an indicator of downy mildew resistance in Brassica plants. The marker of the present disclosure is a downy mildew resistance marker for Brassica plants, and comprises a downy mildew resistance locus on chromosome 6. The marker of the present disclosure can detect the presence or absence of downy mildew resistance. [Example]

[0148] The present disclosure will be described in detail below using examples, but the present invention is not limited to the embodiments described in the examples.

[0149] [Example 1] We confirmed that a new mildew-resistant Chinese cabbage plant exhibits resistance to downy mildew fungi, and identified a new mildew resistance locus in a Brassica plant.

[0150] In Chinese cabbage plants, downy mildew fungus ( Hyaloperonospora brassicae In order to select plants resistant to the downy mildew fungus, an inoculation test was conducted on Chinese cabbage plants owned by Takii Seed Co., Ltd. Specifically, the inoculation test with the downy mildew fungus was carried out as follows.

[0151] (1) Test plant Chinese cabbage plants to be used for inoculation were sown in 128-well cell trays filled with Takii Tanemaki soil and raised for two weeks.

[0152] (2) Inoculation test Downy mildew fungus ( Hyaloperonospora brassicae The downy mildew fungus was derived from a naturally infected Chinese cabbage plant in a Chinese cabbage cultivation field in Nagasaki Prefecture. The downy mildew fungus was confirmed to be a pathogen capable of infecting the susceptible Chinese cabbage plants by the inoculation test described below.

[0153] The downy mildew fungus strain was grown on the diseased Chinese cabbage plants. After the growth, the conidia were filtered through double gauze to obtain a conidial concentration of 1 x 10 4 The concentration was adjusted to 1 / ml to obtain a preparation. The preparation was then used as an inoculum for an inoculation test. The Chinese cabbage plants used in the inoculation test were the Chinese cabbage plants obtained in Example 1(1). In the inoculation test, cotyledons were excised from the Chinese cabbage plants obtained in Example 1(1) and inserted into an agar medium prepared under sterile conditions. 5 μl of the inoculum was then dropped per plant, and the plants were cultured at 15°C for 10 days. After the culture, the severity of disease development was evaluated.

[0154] The disease severity was evaluated according to the following four-level scale: Representative examples of each disease severity index are shown in FIG. Severity 1: Asymptomatic Severity 2: A few conidia formed on part of the leaf surface Severity 3: Clear conidia formation on part of the leaf surface Incidence level 4: Conidia formation on the entire leaf surface

[0155] (3) Establishment of deposited strains As a result of the inoculation test, a new downy mildew-resistant Chinese cabbage line exhibiting high resistance to downy mildew was obtained. Hereinafter, this downy mildew-resistant Chinese cabbage plant will be referred to as the parent line. The parent line was deposited under accession number FERM BP-22496. Hereinafter, the parent line will also be referred to as the deposited line.

[0156] (4) Identification of resistance loci The deposited line (hereinafter also referred to as the "DR line") having resistance to downy mildew was crossed with a Chinese cabbage plant susceptible to downy mildew (Takii Seed Co., Ltd., hereinafter also referred to as the "DS line") to obtain an F1 generation. Next, the F1 generation was self-pollinated to obtain F2 generation seeds. Furthermore, 126 F2 generation plants were self-pollinated to obtain F3 generation seeds.

[0157] Genomic DNA was extracted from the 126 individuals using a PureGene DNA extraction kit (Qiagen). The extracted genomic DNA was analyzed using an EP1 System (Fruidigm) to obtain 109 SNPs that were polymorphic between DR and DS. Single nucleotide polymorphism (hereinafter, SNP) information was obtained using the 109 SNPs.

[0158] Furthermore, an inoculation test was conducted on 91 lines of the F3 generation. Specifically, the inoculation test was conducted in the same manner as in Example 1(2) above, except that the 91 lines were used as test plants for the inoculation test. After the inoculation test, QTL analysis was performed based on the inoculation results of the obtained lines and the obtained SNP information. R / qtl was used in the QTL analysis. These results are shown in Figure 2.

[0159] Figure 2 is a graph showing LOD values ​​on chromosomes. In Figure 2, the horizontal axis shows the chromosomal position and SNP marker, and the vertical axis shows the LOD value. As shown in Figure 2, one QTL region was detected in the vicinity of 0-3.93 Mb on chromosome 6, with a peak LOD value of 16.8 calculated by composite interval mapping (CIM).

[0160] To obtain SNP information for the DR and DS lines, the DR and DS lines were resequenced. SNP markers were constructed based on the SNP information obtained by resequencing and the QTL region.

[0161] Next, an inoculation test was conducted on the F2 generation and the F3 generation. Specifically, the inoculation test was conducted in the same manner as in Example 1(2) above, except that the F2 generation and the F3 generation were used as test plants for the inoculation test. Then, the resistance of each individual plant to the downy mildew fungus was evaluated based on the disease index (phenotype). In addition, DNA was extracted from each test plant, and SNP analysis was performed using the SNP markers. The results are shown in Table 1 below.

[0162] [Table 1]

[0163] Table 1 shows the genotype, disease severity, and mean disease severity of Chinese cabbage plants. In Table 1, V indicates that each SNP is present in a resistant homozygous form, F indicates that each SNP is present in a susceptible homozygous form, and H indicates that each SNP is present in a heterozygous form. As shown in Table 1, when the SNP markers A06_1818542 (SNP2), A06_1831338 (SNP4), and A06_1844155 (SNP1) are homozygous (V) or heterozygous (H) for resistance, the F2 and F3 generations showed a mean disease severity of 2.0 or less, indicating resistance to downy mildew. From the above, it was found that the downy mildew resistance gene is located between 1,796,083 bp and 1,896,789 bp on chromosome 6. In other words, this region is the location of the downy mildew resistance locus. The inheritance patterns of the F2 and F3 generations strongly suggested that the downy mildew resistance gene is incompletely dominant.

[0164] Next, the genetic distance of each SNP was analyzed for the resistance locus possessed by the novel downy mildew-resistant Chinese cabbage plant. Specifically, the genetic distance between each SNP was calculated from the analysis results of the F3 generation of 938 individuals. The calculated results are shown in Table 2 below. As shown in Table 2 below, on chromosome 6, the genetic distance between A06_1844155 and A06_1818542 was found to be approximately 0.32 cM, and the genetic distance between A06_1796083 and A06_1896789 was found to be approximately 0.96 cM.

[0165] [Table 2]

[0166] (5) SNP analysis of commercially available varieties It was confirmed that the resistance locus possessed by the novel downy mildew-resistant Chinese cabbage plant is not possessed by other Brassica plant lines.

[0167] DNA was extracted from the Brassica plants listed in Tables 3A and 3B below, and SNP analysis was performed using SNP markers A06_1818542 (SNP2) and A06_1844155 (SNP1), which are tightly linked to the downy mildew resistance locus. The results are shown in Tables 3A and 3B below. In Tables 3A and 3B below, V indicates that the resistance polymorphism is homozygous, and F indicates that the susceptibility polymorphism is homozygous. As shown in Tables 3A and 3B below, a comparison of SNPs between the DR line, the DS line, and 32 commercial varieties revealed that the DR line possessed a resistant genotype, whereas the DS line and the 32 commercial varieties did not. These results indicated that the SNPs were specific to the DR line.

[0168] [Table 3A]

[0169] [Table 3B]

[0170] From the above, it was found that a Brassica plant with downy mildew resistance can be obtained by crossing a DR line as the first parent with a downy mildew-susceptible Brassica plant as the second parent. Furthermore, it was found that the downy mildew-resistant Brassica plant of the present disclosure can be selected by using the SNP markers.

[0171] Although the present disclosure has been described above with reference to the embodiments and examples, the present disclosure is not limited to the above-described embodiments and examples. Various modifications that can be understood by a person skilled in the art can be made to the configuration and details of the present disclosure within the scope of the present disclosure.

[0172] <Additional Notes> <Downy mildew resistant Brassica plants> (Appendix 1) A downy mildew-resistant Brassica plant containing a downy mildew resistance locus on chromosome 6. (Appendix 2) The downy mildew resistance locus is located on the chromosome: 2. The Brassica plant of claim 1, wherein the Brassica plant is located in the region between the sites of the SNP markers SNP3 and SNP5. (Appendix 3) 3. The Brassica plant of claim 1, wherein the downy mildew resistance locus is identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7. (Appendix 4) 4. The Brassica plant of claim 3, wherein the downy mildew resistance locus is identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4. (Appendix 5) 5. The Brassica plant of claim 4, wherein the downy mildew resistance locus is identified by the SNP markers SNP1 and SNP2. (Appendix 6) 6. The Brassica plant according to any one of Appendices 1 to 5, wherein the downy mildew resistance locus is identified by at least one polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved and one or several nucleotides have been deleted, substituted, inserted and / or added in the nucleotide sequence of (a1); (a3) a polynucleotide comprising a nucleotide sequence that conserves the 99th nucleotide (A) of (a1) and has an identity of 80% or more to the nucleotide sequence of (a1); (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (T) of (b1) and has 80% or more identity to the nucleotide sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (c1) and has 80% or more identity to the nucleotide sequence of (c1); (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (d1) and has 80% or more identity to the nucleotide sequence of (d1); (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide in which the 100th base (C) of (e1) is conserved and which consists of a base sequence having 80% or more identity to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a nucleotide sequence that conserves the 68th nucleotide (A) of (f1) and has an identity of 80% or more to the nucleotide sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1). (Appendix 7) 7. The Brassica plant according to Appendix 6, wherein the downy mildew resistance locus is identified by the polynucleotides (a) and (b). (Appendix 8) 8. The Brassica plant of any one of appendices 1 to 7, wherein the plant is a Rapa species. (Appendix 9) 9. The Brassica plant according to any one of Appendices 1 to 8, wherein the downy mildew resistance locus is a downy mildew resistance locus present in the Brassica downy mildew resistance locus identified by accession number FERM BP-22496. (Appendix 10) 10. The Brassica plant of any one of Appendices 1 to 9, wherein the downy mildew-resistant Brassica plant is a Brassica plant obtained from seeds of the Brassica plant identified by accession number FERM BP-22496 or a progeny line thereof. <Downy mildew-resistant Brassica plant parts> (Appendix 11) 11. A part of a downy mildew resistant Brassica plant according to any one of appendices 1 to 10. (Appendix 12) 12. The plant part of claim 11, wherein the plant part is a seed. <Method for producing downy mildew-resistant Brassica plants> (Appendix 13) A method for producing a downy mildew-resistant Brassica plant, comprising the following steps (a) and (b): (a) crossing the downy mildew-resistant Brassica plant of any one of Supplements 1 to 10 with another Brassica plant; (b) selecting a downy mildew-resistant Brassica plant from the Brassica plants obtained in step (a) or their progeny lines. (Appendix 14) The production method described in Appendix 13, further comprising the following step (x) prior to step (a): (x) selecting a downy mildew-resistant Brassica plant according to any one of Appendices 1 to 10 from test Brassica plants. (Appendix 15) 15. The method of claim 14, wherein the selection in step (x) is selection of a downy mildew-resistant Brassica plant comprising a downy mildew resistance locus on chromosome 6. (Appendix 16) 16. The production method according to claim 14, wherein the selection in step (x) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus comprising the nucleotide sequence of a region between the sites of the SNP markers SNP3 and SNP5 on the chromosome. (Appendix 17) 17. The method of any one of Appendices 14 to 16, wherein the selection in step (x) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4. (Appendix 18) 18. The method of claim 17, wherein the selection is for a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by SNP markers SNP1 and SNP2. (Appendix 19) The method according to any one of Appendices 14 to 18, wherein the selection in the step (x) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved and one or several nucleotides have been deleted, substituted, inserted and / or added in the nucleotide sequence of (a1); (a3) a polynucleotide comprising a nucleotide sequence that conserves the 99th nucleotide (A) of (a1) and has an identity of 80% or more to the nucleotide sequence of (a1); (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (T) of (b1) and has 80% or more identity to the nucleotide sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (c1) and has 80% or more identity to the nucleotide sequence of (c1); (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (d1) and has 80% or more identity to the nucleotide sequence of (d1); (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide in which the 100th base (C) of (e1) is conserved and which consists of a base sequence having 80% or more identity to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a nucleotide sequence that conserves the 68th nucleotide (A) of (f1) and has an identity of 80% or more to the nucleotide sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1). (Appendix 20) 20. The method of claim 19, wherein the selection is a selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the polynucleotides (a) and (b). (Appendix 21) 21. The method of any one of Appendices 13 to 20, wherein the selection in step (b) is selection of a downy mildew-resistant Brassica plant comprising a downy mildew resistance locus on chromosome 6. (Appendix 22) 22. The method of any one of Appendices 13 to 21, wherein the selection in step (b) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus comprising the nucleotide sequence of a region between the sites of the SNP markers SNP3 and SNP5 on the chromosome. (Appendix 23) 23. The method of any one of Appendices 13 to 22, wherein the selection in step (b) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4. (Appendix 24) 24. The method of claim 23, wherein the selection is a selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the SNP markers SNP1 and SNP2. (Appendix 25) The method according to any one of Appendices 13 to 24, wherein the selection in the step (b) is selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved, and in which the nucleotide sequence of (a1) or several nucleotides are deleted, substituted, inserted, and / or added; (a3) a polynucleotide comprising a nucleotide sequence that conserves the 99th nucleotide (A) of (a1) and has an identity of 80% or more to the nucleotide sequence of (a1); (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (T) of (b1) and has 80% or more identity to the nucleotide sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (c1) and has 80% or more identity to the nucleotide sequence of (c1); (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (d1) and has 80% or more identity to the nucleotide sequence of (d1); (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide in which the 100th base (C) of (e1) is conserved and which consists of a base sequence having 80% or more identity to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a nucleotide sequence that conserves the 68th nucleotide (A) of (f1) and has an identity of 80% or more to the nucleotide sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1). (Appendix 26) 26. The method of claim 25, wherein the selection is a selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the polynucleotides (a) and (b). <Method for imparting downy mildew resistance to Brassica plants> (Appendix 27) A method for imparting downy mildew resistance to a Brassica plant, comprising an introduction step of introducing a downy mildew resistance locus on chromosome 6 into the Brassica plant. (Appendix 28) 28. A method of imparting a downy mildew resistance gene locus on chromosome 6 described in any one of Appendices 1 to 10 by crossing with a downy mildew resistant Brassica plant described in any one of Appendices 1 to 10. <Method for detecting downy mildew resistance> (Appendix 29) A method for detecting downy mildew resistance in a Brassica plant, comprising: A detection method comprising a detection step of detecting a downy mildew resistance locus on chromosome 6 in a test Brassica plant. (Appendix 30) 30. The detection method according to claim 29, wherein in the detection step, a downy mildew resistance locus comprising a base sequence of a region between the sites of the SNP markers SNP3 and SNP5 is detected in the test Brassica plant. (Appendix 31) 31. The detection method according to claim 29 or 30, wherein in the detection step, the downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4 is detected in the test Brassica plant. (Appendix 32) 32. The detection method according to claim 31, wherein in the detection step, a downy mildew resistance locus identified by the SNP markers SNP1 and SNP2 is detected in the test Brassica plant. (Appendix 33) The detection method according to any one of Appendices 29 to 32, wherein in the detection step, a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (g) is detected in the test Brassica plant: (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved and one or several nucleotides have been deleted, substituted, inserted and / or added in the nucleotide sequence of (a1); (a3) a polynucleotide comprising a nucleotide sequence that conserves the 99th nucleotide (A) of (a1) and has an identity of 80% or more to the nucleotide sequence of (a1); (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (T) of (b1) and has 80% or more identity to the nucleotide sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (c1) and has 80% or more identity to the nucleotide sequence of (c1); (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (d1) and has 80% or more identity to the nucleotide sequence of (d1); (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide in which the 100th base (C) of (e1) is conserved and which consists of a base sequence having 80% or more identity to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a nucleotide sequence that conserves the 68th nucleotide (A) of (f1) and has an identity of 80% or more to the nucleotide sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1). (Appendix 34) 34. The detection method according to claim 33, wherein in the detection step, a downy mildew resistance locus identified by the polynucleotides (a) and (b) is detected in the test Brassica plant. (Appendix 35) 35. The detection method according to any one of Appendices 29 to 34, wherein in the detection step, a downy mildew resistance gene locus on chromosome 6 of the test Brassica plant is detected. <Screening method for downy mildew-resistant Brassica plants> (Appendix 36) A method for screening for a downy mildew-resistant Brassica plant, comprising: A screening method comprising a selection step of selecting, from test Brassica plants, Brassica plants containing a downy mildew resistance locus on chromosome 6 as downy mildew-resistant Brassica plants. (Appendix 37) 37. The screening method according to claim 36, wherein in the selection step, a test Brassica plant having a downy mildew resistance locus including the base sequence of the region between the SNP markers SNP3 and SNP5 is selected as a downy mildew-resistant Brassica plant. (Appendix 38) 38. The screening method according to claim 36 or 37, wherein in the selection step, a test Brassica plant having a downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4 is selected as a downy mildew-resistant Brassica plant. (Appendix 39) 39. The screening method according to claim 38, wherein in the selection step, a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the SNP markers of SNP1 and SNP2 is selected as a downy mildew-resistant Brassica plant. (Appendix 40) The screening method according to any one of Appendices 36 to 39, wherein in the selection step, a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (g) is selected as a downy mildew-resistant Brassica plant: (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a nucleotide sequence in which the 99th nucleotide (A) of (a1) is conserved and one or several nucleotides have been deleted, substituted, inserted and / or added in the nucleotide sequence of (a1); (a3) a polynucleotide comprising a nucleotide sequence that conserves the 99th nucleotide (A) of (a1) and has an identity of 80% or more to the nucleotide sequence of (a1); (b) a polynucleotide (b1), (b2), or (b3) below: (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (T) of (b1) and has 80% or more identity to the nucleotide sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (c1) and has 80% or more identity to the nucleotide sequence of (c1); (d) a polynucleotide (d1), (d2), or (d3) below: (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide consisting of a nucleotide sequence that conserves the 100th nucleotide (G) of (d1) and has 80% or more identity to the nucleotide sequence of (d1); (e) a polynucleotide (e1), (e2), or (e3) below: (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide in which the 100th base (C) of (e1) is conserved and which consists of a base sequence having 80% or more identity to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a nucleotide sequence that conserves the 68th nucleotide (A) of (f1) and has an identity of 80% or more to the nucleotide sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 80% or more to the base sequence of (g1). (Appendix 41) 41. The screening method according to claim 40, wherein in the selection step, a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the polynucleotides (a) and (b) is selected as a downy mildew-resistant Brassica plant. (Appendix 42) 42. The screening method according to any one of Appendices 36 to 41, wherein in the selection step, a Brassica plant having a downy mildew resistance locus on chromosome 6 of the test Brassica plant is selected as a downy mildew-resistant Brassica plant. [Industrial Applicability]

[0173] As described above, the present disclosure provides a Brassica plant that is resistant to downy mildew, and is therefore extremely useful in, for example, the fields of agriculture and breeding.

Claims

1. A downy mildew resistant Brassica plant comprising a downy mildew resistance locus on chromosome 6.

2. The downy mildew resistance locus is located on the chromosome: The Brassica plant of claim 1 , wherein the SNP markers are located in the region between the sites of SNP3 and SNP5.

3. 3. The Brassica plant of claim 1, wherein the downy mildew resistance locus is identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7.

4. 4. The Brassica plant of claim 3, wherein the downy mildew resistance locus is identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4.

5. The Brassica plant of claim 4 , wherein the downy mildew resistance locus is identified by the SNP markers SNP1 and SNP2.

6. The Brassica plant according to claim 1 or 2, wherein the downy mildew resistance locus is identified by at least one polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a base sequence in which the 99th base (A) of (a1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (a1); (a3) a polynucleotide comprising a base sequence that conserves the 99th base (A) of (a1) and has an identity of 90% or more to the base sequence of (a1); (b) a polynucleotide selected from the group consisting of (b1), (b2), and (b3): (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and 1 to 20 bases are deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide comprising a base sequence that conserves the 100th base (T) of (b1) and has an identity of 90% or more to the base sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and 1 to 20 bases are deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a base sequence that conserves the 100th base (G) of (c1) and has an identity of 90% or more to the base sequence of (c1); (d) a polynucleotide selected from the group consisting of (d1), (d2), and (d3): (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and 1 to 20 bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide comprising a base sequence that conserves the 100th base (G) of (d1) and has an identity of 90% or more to the base sequence of (d1); (e) a polynucleotide selected from the group consisting of (e1), (e2), and (e3): (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and 1 to 20 bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide comprising a base sequence that conserves the 100th base (C) of (e1) and has an identity of 90% or more to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a base sequence that conserves the 68th base (A) of (f1) and has 90% or more identity to the base sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 90% or more to the base sequence of (g1).

7. The Brassica plant of claim 6 , wherein the downy mildew resistance locus is identified by the polynucleotides (a) and (b).

8. The Brassica plant according to claim 1 or 2, which is a Rapa species.

9. 3. The Brassica plant according to claim 1, wherein the downy mildew resistance locus is a downy mildew resistance locus present in the Brassica plant identified by accession number FERM BP-22496.

10. The Brassica plant according to claim 1 or 2, wherein the downy mildew-resistant Brassica plant is a Brassica plant obtained from seeds of a Brassica plant identified by accession number FERM BP-22496 or a progeny line thereof.

11. A part of a downy mildew resistant Brassica plant according to claim 1 or 2.

12. 12. The plant part of claim 11, wherein the plant part is a seed.

13. A method for producing a downy mildew-resistant Brassica plant, comprising the following steps (a) and (b): (a) crossing the downy mildew-resistant Brassica plant of claim 1 or 2 with another Brassica plant; (b) selecting a downy mildew-resistant Brassica plant from the Brassica plants or their progeny lines obtained in the step (a).

14. The production method according to claim 13, further comprising the following step (x) prior to step (a): (x) selecting the downy mildew-resistant Brassica plant according to claim 1 or 2 from test Brassica plants.

15. 15. The method of claim 14, wherein the selection in step (x) is selection of a downy mildew-resistant Brassica plant that contains a downy mildew resistance locus on chromosome 6.

16. 16. The production method according to claim 15, wherein the selection in step (x) is the selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus comprising the base sequence of a region between the sites of the SNP markers SNP3 and SNP5 on the chromosome.

17. 15. The production method according to claim 14, wherein the selection in step (x) is the selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one SNP marker selected from the group consisting of SNP1, SNP2, and SNP4.

18. The method according to claim 13, wherein the selection in the step (x) is a selection of a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (g): (a) a polynucleotide (a1), (a2), or (a3) ​​below: (a1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (a2) a polynucleotide consisting of a base sequence in which the 99th base (A) of (a1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (a1); (a3) a polynucleotide comprising a base sequence that conserves the 99th base (A) of (a1) and has an identity of 90% or more to the base sequence of (a1); (b) a polynucleotide selected from the group consisting of (b1), (b2), and (b3): (b1) a polynucleotide consisting of the base sequence of SEQ ID NO: 2; (b2) a polynucleotide consisting of a base sequence in which the 100th base (T) of (b1) is conserved and 1 to 20 bases are deleted, substituted, inserted and / or added in the base sequence of (b1); (b3) a polynucleotide comprising a base sequence that conserves the 100th base (T) of (b1) and has an identity of 90% or more to the base sequence of (b1); (c) a polynucleotide selected from the group consisting of (c1), (c2), and (c3): (c1) a polynucleotide consisting of the base sequence of SEQ ID NO: 3; (c2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (c1) is conserved and 1 to 20 bases are deleted, substituted, inserted and / or added in the base sequence of (c1); (c3) a polynucleotide consisting of a base sequence that conserves the 100th base (G) of (c1) and has an identity of 90% or more to the base sequence of (c1); (d) a polynucleotide selected from the group consisting of (d1), (d2), and (d3): (d1) a polynucleotide consisting of the base sequence of SEQ ID NO: 4; (d2) a polynucleotide consisting of a base sequence in which the 100th base (G) of (d1) is conserved and 1 to 20 bases have been deleted, substituted, inserted and / or added in the base sequence of (d1); (d3) a polynucleotide comprising a base sequence that conserves the 100th base (G) of (d1) and has an identity of 90% or more to the base sequence of (d1); (e) a polynucleotide selected from the group consisting of (e1), (e2), and (e3): (e1) a polynucleotide consisting of the base sequence of SEQ ID NO: 5; (e2) a polynucleotide consisting of a base sequence in which the 100th base (C) of (e1) is conserved and 1 to 20 bases have been deleted, substituted, inserted and / or added in the base sequence of (e1); (e3) a polynucleotide comprising a base sequence that conserves the 100th base (C) of (e1) and has an identity of 90% or more to the base sequence of (e1); (f) a polynucleotide selected from the group consisting of (f1), (f2), and (f3): (f1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (f2) a polynucleotide consisting of a base sequence in which the 68th base (A) of (f1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (f1); (f3) a polynucleotide comprising a base sequence that conserves the 68th base (A) of (f1) and has 90% or more identity to the base sequence of (f1); (g) a polynucleotide selected from the group consisting of (g1), (g2), and (g3): (g1) a polynucleotide consisting of the base sequence of SEQ ID NO: 1; (g2) a polynucleotide consisting of a base sequence in which the 104th base (A) of (g1) is conserved and 1 to 19 bases are deleted, substituted, inserted and / or added in the base sequence of (g1); (g3) A polynucleotide comprising a base sequence that conserves the 104th base (A) of (g1) and has an identity of 90% or more to the base sequence of (g1).

19. 19. The method of claim 18, wherein the selection is for a downy mildew-resistant Brassica plant having a downy mildew resistance locus identified by the polynucleotides (a) and (b).

20. A method for imparting downy mildew resistance to a Brassica plant, comprising an introduction step of introducing a downy mildew resistance locus on chromosome 6 into the Brassica plant.

21. 21. The method of claim 20, wherein the downy mildew resistance locus on chromosome 6 of claim 1 or 2 is introduced by crossing with the downy mildew resistant Brassica plant of claim 1 or 2.

22. A method for screening for a downy mildew-resistant Brassica plant, comprising: A screening method comprising a selection step of selecting, from test Brassica plants, a Brassica plant containing a downy mildew resistance locus on chromosome 6 as a downy mildew-resistant Brassica plant.

Images