Methods for creating novel mutations in living organisms and their applications

Abstract

This invention provides a method for inducing site-directed mutations in living organisms in the absence of an artificial DNA template, and its use. [Solution] The method comprises the steps of sequentially creating two or more DNA breaks at specific sites in the genome of an organism and spontaneously repairing each of them, wherein the later DNA breaks are generated based on novel sequences generated from the previous DNA break repair. In the present invention, novel targets are designed based on sequences generated by novel repair events caused by sequential editing, and thus mutations can be sequentially created multiple times at specific sites in the genome, thereby greatly increasing the types of repair events after DNA breaks and realizing novel base substitutions, deletions, and insertion mutations that cannot be seen with single gene editing.

Description

Cross-reference to Related Applications

[0001] Priority information This application claims the benefit of Chinese Patent Application No. 201911081617.X, filed on November 7, 2019, Chinese Patent Application No. 202010821877.2, filed on August 15, 2020, and Chinese Patent Application No. 202010974151.2, filed on September 16, 2020. The entire contents of the above applications are incorporated herein by reference.

Technical Field

[0002] The present invention relates to the technical field of genetic engineering, and in particular, to a method for creating site-specific mutations in an organism in the absence of an artificial DNA template and its use.

Background Art

[0003] Genetic engineering techniques for modifying the genomes of organisms are widely used in industrial production and agricultural production, such as genetically modified microorganisms commonly used in the pharmaceutical and chemical fields, and genetically modified crops with insect resistance and herbicide resistance in the agricultural field. The emergence of site-specific nucleases has made it possible to achieve site-specific editing of the genome and more precise modification of the genome by introducing targeted fragmentation into the genome of the recipient organism and causing spontaneous repair.

[0004] Gene editing tools primarily include three types of sequence-specific nucleases (SSNs): zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) associated with the Cas system (CRISPR / Cas system). Sequence-specific nucleases are programmable nucleases that can create DNA double-strand breaks (DSBs) at specific sites in the genome. DNA double-strand breaks activate the endogenous DNA repair pathway for repairing DNA damage in cells, but this repair process easily leads to changes in the DNA sequence at the target site, thereby achieving the introduction of mutations at the site of interest. This technology allows biologists to precisely target and edit target genes. In particular, both ZFNs and TALENs require the design of specific recognition protein modules for target sequences, resulting in low throughput and complex operations. However, Cas proteins are versatile in the CRISPR / Cas system, in which the guide RNA (gRNA) can be formed by a specific CRISPR-RNA (crRNA) designed for the target site only or in combination with a transactivating RNA (tracrRNA), or a single guide RNA (sgRNA) alone may suffice. The crRNA and tracrRNA together, or a single sgRNA, assemble with the Cas protein to form a ribonucleoprotein complex (RNP), and the target sequence is identified based on protospacer-adjacent motifs (PAMs) in the genome, thereby enabling site-directed editing. Thus, it has become the dominant gene editing method due to its ease of use, broad applicability, and high throughput.

[0005] Sequence-specific nucleases create DNA double-strand breaks at specific locations in the genome. These DNA double-strand breaks can be repaired into various different types of repair, which are primarily base insertions or deletions. For example, the two most common types of CRISPR / Cas9 editing events are base insertions or deletions at the break site (Shen et al. 2018. Predictable and precise template-free CRISPR editing of pathogenic variants. Nature. DOI: 10.1038 / s41586-018-0686-x). Base insertions or deletions in coding regions cause frameshift mutations, resulting in loss of gene function. Therefore, the primary purpose of the gene editing tools mentioned above is also to perform gene knockout.

[0006] It has always been considered that simply using sequence-specific nucleases cannot achieve mutations of the type of base substitution. For this reason, three solutions have been proposed in conventional techniques: 1) adding exogenous DNA fragments as repair templates to induce homologous recombination repair pathways; 2) fusing deaminase with Cas9 to sequentially develop single base editing tools for C to T and A to G; and 3) fusing reverse transcriptase with Cas9 using pegRNA to guide the synthesis and substitution of small DNA strands. However, the editing efficiency of these three solutions is considerably lower than that of gene knockout, and the simultaneously introduced exogenous DNA fragments and reverse transcriptases can easily lead to biosafety concerns. The off-target effects of single base editing also limit their potential application in cell therapy. In particular, in long-term plant breeding projects, how to improve base substitution efficiency at target sites while mitigating regulatory concerns regarding biosafety is a problem that needs to be solved in the application of gene editing technologies.

[0007] In summary, in the fields of cell therapy and biological breeding, there is an urgent need for site-directed base substitution (SAT) editing, particularly by using only targeted knockout of sequence-specific nucleases via non-transgenic transient editing systems to efficiently perform SAT editing without introducing foreign DNA fragments. [Overview of the project]

[0008] Summary of the Invention The present invention provides a method for inducing site-directed mutations in an organism simply by creating double-strand breaks in the genome without providing an artificial DNA template, and a method for using that method.

[0009] The technical solutions employed in this invention are as follows: A method for creating a novel mutation in an organism, comprising the following steps: creating two or more DNA breaks in succession at specific locations in the genome of the organism, and spontaneously repairing each of them, wherein the subsequent DNA breaks are generated based on novel sequences produced from the repair of previous DNA breaks. Specific description of the invention

[0010] In certain embodiments, "DNA cleavage" is achieved by delivering a nuclease with targeting properties to the cells of an organism to bring it into contact with a specific site of genomic DNA.

[0011] In certain embodiments, the “nuclease having targeting properties” is a ZFN, TALEN, or CRISPR / Cas system.

[0012] In certain embodiments, "creating two or more DNA breaks sequentially at a specific site" is achieved by designing a novel ZFN or TALEN protein to re-cleave that site based on a novel sequence generated from a previous DNA break repair event caused by ZFN or TALEN editing.

[0013] In another specific embodiment, "creating two or more DNA breaks sequentially at a specific site" is achieved by designing a novel target RNA to re-cleave that site based on a novel sequence generated from a previous DNA break repair event caused by the CRISPR / Cas system. For example, a second break is performed again at that site by designing a novel target RNA based on a novel sequence generated from a first break repair event of Cas9 editing. Similarly, a third break is performed at that site by designing a novel target RNA based on a novel sequence generated from a second break repair event, as shown in Figure 1.

[0014] In certain embodiments, "two or more DNA breaks" are created by sequentially delivering different targeted nucleases to recipient cells of different generations, with the mutant cells that completed the previous edit being used as recipients to demand delivery of the targeted nuclease for the subsequent edit, thereby performing a second edit to generate site-directed mutations. This method is preferably used in ZFN and TALEN editing systems.

[0015] In another specific embodiment, "multiple DNA breaks" are produced by delivering different targeted nucleases for different targets to the same recipient cell. This method is preferably used with a CRISPR / Cas editing system.

[0016] In certain embodiments, "two or more DNA cleavage sites" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each containing a different gRNA or sgRNA, sequentially cleave the corresponding target sequences.

[0017] In another specific embodiment, "two or more DNA breaks" are created when RNP complexes, individually formed by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences. For example, the PAM sequence recognized by Cas9 from Streptococcus pyogenes is "NGG" or "NAG" (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", Science 2012, 337:816-821), the PAM sequence recognized by Cas9 from Staphylococcus aureus is "NNGRRT" or "NNGRR(N)", the PAM sequence recognized by Cas9 from Neisseria meningitidis is NNNNGATT, and the PAM sequence recognized by Cas9 from Streptococcus thermophilus is NNAGAAW. Thus, the editable frame of the DNA molecule is larger.

[0018] In certain embodiments, the targeted nuclease is any CRISPR / Cas nuclease capable of achieving genome editing.

[0019] In certain embodiments, the targeted nuclease is in the form of DNA.

[0020] In another specific embodiment, the targeted nuclease is in the form of mRNA or a protein, rather than DNA. The protein form is preferred.

[0021] In a particular embodiment, the method for delivering the targeted nuclease to cells is selected from, but is not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun shock; and 6) Agrobacterium-mediated transformation.

[0022] In this method, novel targets are designed based on novel sequences generated from previous DNA break repairs. Thus, mutations can be sequentially introduced multiple times at specific sites in the genome, exponentially increasing the types of repair events after DNA breaks and generating novel types of base substitutions, deletions, and insertions that cannot be seen with single gene editing. Therefore, this method is suitable for use as a tool for generating novel mutations. In short, this method can be described as programmed sequential break / edit or a method of sequential break / edit.

[0023] In certain embodiments, a novel target is designed based on a specific novel sequence that is predicted to be generated from previous cut repair at a particular site in the organism's genome, and then sequential editing is performed so that the possible final mutation at that site can be pre-designed to achieve the predicted editing.

[0024] In another specific embodiment, a novel target is designed based on a novel sequence predicted to be generated from previous break repair at a specific site in the biological genome, and then sequential editing is performed so that, in addition to the predicted editing event, a variety of different mutations can be generated at that site. Thus, this method can be used as a tool for generating a variety of different mutations.

[0025] In another aspect, the present invention further provides a method for creating a novel mutation in an organism, comprising the following steps: continuously creating two or more DNA cleavages at specific sites of a gene at the genomic or chromosomal level of the organism, thereby achieving accurate base substitution, deletion or insertion.

[0026] In certain embodiments, "continuously creating two or more DNA cleavages at specific sites" refers to the design of a novel target RNA based on a novel sequence generated from a previous cleavage repair event, and cleavage is performed again at the same site.

[0027] In certain embodiments, "DNA cleavage" is achieved by a nuclease having targeting properties.

[0028] The present invention further provides a novel mutation obtained by the aforementioned method.

[0029] The present invention further provides a protein having the aforementioned novel mutation or a biologically active fragment thereof.

[0030] The present invention further provides a nucleic acid comprising a nucleic acid sequence encoding a protein or a biologically active fragment thereof or a complementary sequence thereof.

[0031] The present invention further provides (a) a nucleotide sequence encoding a target RNA comprising, wherein the target RNA comprises at least two target RNAs, the first target RNA targets a certain DNA and causes cleavage in the DNA, and the latter target RNA targets a sequence generated from a previous cleavage repair event and creates a nucleic acid for cleavage again.

[0032] In certain embodiments, the nucleic acid further comprises (b) a nucleotide sequence encoding a Cas polypeptide.

[0033] In a particular embodiment, the target RNA is either sgRNA or gRNA.

[0034] In certain embodiments, the Cas polypeptide and target RNA are present in in vitro or ex vivo cells.

[0035] The present invention further provides a recombinant expression vector comprising the aforementioned nucleic acid and a promoter functionally linked thereto.

[0036] The present invention further provides an expression cassette comprising the aforementioned nucleic acid.

[0037] The present invention further provides a host cell comprising the aforementioned expression cassette.

[0038] The present invention further provides an organism that is regenerated by using the aforementioned host cells.

[0039] The present invention further comprises a method for lysing target DNA, comprising contacting the target DNA with a complex, the complex being (a) Cas polypeptide; and (b) at least two target RNAs, where the first target RNA targets the DNA and causes a cleavage in it, and the latter target RNA targets a sequence generated from the previous cleavage repair event and causes another cleavage. We provide a method that includes the following:

[0040] In a particular embodiment, the target RNA is either sgRNA or gRNA.

[0041] In certain embodiments, the target DNA is present in bacterial cells, eukaryotic cells, plant cells, or animal cells.

[0042] In certain embodiments, the target DNA is chromosomal DNA.

[0043] In certain embodiments, the Cas polypeptide and target RNA are present in in vitro or ex vivo cells.

[0044] In certain embodiments, contact comprises introducing the following into the cells: (a) a Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) a target RNA or a DNA polynucleotide encoding the target RNA.

[0045] The present invention further, (a) Cas polypeptide, or a polynucleotide encoding the Cas polypeptide; and (b) at least two target RNAs, or DNA polynucleotides encoding those target RNAs, where the first RNA targets a DNA molecule and causes a cleavage in that DNA molecule, and the latter target RNA targets a sequence generated from the previous cleavage repair event and causes another cleavage. The present invention provides a composition comprising the above.

[0046] In a particular embodiment, the target RNA is either sgRNA or gRNA.

[0047] In certain embodiments, the Cas polypeptide and target RNA are present in in vitro or ex vivo cells.

[0048] The present invention further provides the use of the composition in the manufacture of a drug for the treatment of a disease.

[0049] Diseases treatable with the compositions of the present invention include, but are not limited to, diseases caused by a single gene mutation, such as type 1 tyrosinemia, phenylketonuria, progeria, and sickle cell disease. Spontaneous cell repair is induced by delivering a Cas protein and a crRNA or sgRNA composition predicted to repair the pathogenic mutation site to cells, thereby generating normal, functional proteins, and thus a therapeutic effect is obtained.

[0050] The present invention further, (a) Cas polypeptide, or nucleic acid comprising a nucleotide sequence encoding a Cas polypeptide; and (b) A nucleic acid comprising at least two target RNAs, or nucleotide sequences encoding those target RNAs, wherein the first target RNA targets a DNA molecule and causes a cleavage in that DNA, and the latter target RNA targets a sequence generated from a previous cleavage repair event and causes another cleavage. The kit comprises (a) and (b) in the same or separate containers.

[0051] In a particular embodiment, the target RNA is either sgRNA or gRNA.

[0052] In certain embodiments, the target RNA in (b) is in the same container or a different container.

[0053] The present invention further provides a method for screening editing events that are independent of exogenous transgenic markers, comprising the following steps: 1) A process in which two or more DNA breaks are successively created at specific sites in the sequence of the first target gene in the recipient cell, each of which is spontaneously repaired, and subsequent DNA breaks are generated based on a new sequence created from the repair of the previous DNA break; 2) A process in which a specific site of a first target gene is sequentially cleaved and repaired, followed by a specific editing event that confers resistance to a particular selective pressure to the mutant cell, thereby creating a phenotypic selectable trait, and the corresponding selective pressure is applied to perform selection with respect to that trait, and the cell, tissue, organ, or whole organism containing such editing events is isolated; 3) Depending on the case, a targeted nuclease is used against at least one second target gene in addition to the first target gene to edit another target site simultaneously, the editing events of the second target gene are enriched, and the cells, tissues, organs or complete organisms are isolated, which are synchronously screened through screening for selectable traits generated by mutations in the first target gene and at least one second target gene simultaneously. We provide a method that includes the following:

[0054] In a particular embodiment, the “first target gene” is a locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth-advantageous trait.

[0055] In certain embodiments, “a specific site of the first target gene” refers to a site where, after sequential breaks and repairs, a particular type of mutation is generated that can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

[0056] In certain embodiments, “a particular type of mutation” includes single base substitutions, multiple base substitutions, or insertions or deletions of an unspecified number of bases.

[0057] In certain embodiments, “a particular selective pressure” may be ambient pressure or pressure arising from the added compound; for example, ambient pressure may be high temperature, low temperature, or low oxygen; and pressure arising from the added compound may be pressure arising from salt ion concentration, antibiotics, cytotoxins, herbicides, etc.

[0058] In certain embodiments, "DNA cleavage" is achieved by delivering a nuclease with targeting properties to the cells of an organism to bring it into contact with a specific site of genomic DNA.

[0059] In certain embodiments, the “nuclease having targeting properties” is any CRISPR / Cas nuclease capable of performing genome editing.

[0060] In certain embodiments, the characteristic of "creating two or more DNA breaks sequentially at a specific site in the sequence" means that a new target RNA is designed to re-cleave that site based on a novel sequence generated by a previous DNA break repair event produced by the CRISPR / Cas system.

[0061] In certain embodiments, the "two or more DNA cleavage sites" are created when an RNP complex formed by the same CRISPR / Cas nuclease, each having a different gRNA or sgRNA, sequentially cleaves the corresponding target sequence.

[0062] In another specific embodiment, "multiple DNA cleavage" is achieved when RNP complexes, individually formed by two or more CRISPR / Cas nucleases recognizing different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences. Thus, the editable frame of the DNA molecule is larger.

[0063] In certain embodiments, the "second target gene" refers to a different gene that has a different coding scheme from the first target gene.

[0064] In certain embodiments, the “targeting nuclease for at least one second target gene” and the CRISPR / Cas nuclease used to create a DNA break at a specific site of the first target gene are the same.

[0065] In another specific embodiment, the "targeting nuclease for at least one second target gene" and the CRISPR / Cas nuclease used to create DNA cuts at specific sites on the first target gene are different. Thus, the second target gene has a greater number of selectable editing sites.

[0066] In certain embodiments, the targeted nuclease is in the form of DNA.

[0067] In another specific embodiment, the targeted nuclease is in the form of mRNA or protein rather than DNA. Protein form is preferred.

[0068] In a particular embodiment, the method for delivering the targeted nuclease to cells may be selected from, but is not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun shock; or 6) Agrobacterium-mediated transformation.

[0069] The present invention further provides a method for non-transgenic transient editing of a biological genome, comprising the following steps: 1) A combination of at least two crRNA fragments or at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient cell, and the crRNA combination combined with tracrRNA or the sgRNA combination alone can guide the corresponding Cas protein to sequentially create two or more DNA breaks at a specific site of the first target gene in the recipient cell, and to spontaneously repair each of them, with subsequent DNA breaks being generated based on novel sequences generated from previous DNA break repairs; 2) A suitable amount of CRISPR / Cas protein or its corresponding mRNA is mixed with a combination of crRNA and tracrRNA fragments or a single sgRNA fragment combination, which has been pre-designed and synthesized above, capable of guiding site-directed editing of a first target gene to produce an endogenous selection marker, and optionally, at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene is further added, and incubation is performed in vitro to form an RNP complex; 3) The RNP complex is delivered to recipient cells and brought into contact with a specific site of genomic DNA in order to achieve gene editing; 4) A step in which, according to a phenotypic selectable trait generated by site-directed editing of a first target gene by the RNP complex, a corresponding selective pressure is applied to perform selection with respect to that trait, and cells, tissues, organs or complete organisms containing the editing event are isolated, and optionally, cells, tissues, organs or complete organisms containing the editing event of the first target gene and at least one editing event of a second, third or subsequent target gene simultaneously are isolated. We provide a method that includes the following:

[0070] In a particular embodiment, the “first target gene” is a locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth-advantageous trait.

[0071] In certain embodiments, “a specific site of the first target gene” refers to a site where, after sequential breaks and repairs, a particular type of mutation is generated that can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

[0072] In certain embodiments, “a particular type of mutation” includes single base substitutions, multiple base substitutions, or insertions or deletions of an unspecified number of bases.

[0073] In certain embodiments, “a particular selective pressure” may be an ambient pressure or a pressure arising from an added compound, for example, the ambient pressure may be high temperature, low temperature, or low oxygen, and the pressure arising from an added compound may be a pressure arising from salt ion concentration, antibiotics, cytotoxins, or herbicides.

[0074] In certain embodiments, the CRISPR / Cas protein is a human CRISPR / Cas nuclease capable of performing genome editing.

[0075] In certain embodiments, the characteristic of "sequentially creating two or more DNA breaks at a specific site" refers to the design in which a new target RNA is created to re-cleave that site based on a novel sequence generated by a previous DNA break repair event produced by the CRISPR / Cas system.

[0076] In certain embodiments, "two or more DNA cleavage sites" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each containing a different gRNA or sgRNA, sequentially cleave the corresponding target sequences.

[0077] In another specific embodiment, "multiple DNA cleavage" is achieved when RNP complexes, individually formed by two or more CRISPR / Cas nucleases recognizing different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences. Thus, the editable frame of the DNA molecule is larger.

[0078] In certain embodiments, “second, third, or subsequent target genes” refer to other genes that have a different coding scheme from the first target gene.

[0079] In a particular embodiment, "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment that targets a second, third, or subsequent target gene" has the same Cas protein as the crRNA or sgRNA that targets the first target gene.

[0080] In another specific embodiment, "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment targeting a second, third, or subsequent target gene," as well as the crRNA or sgRNA targeting the first target gene, utilizes a Cas protein that recognizes different PAM sequences. Thus, the second target gene has more selectable editing sites.

[0081] In a particular embodiment, the method for delivering the RNP complex to cells may be selected from, but is not limited to, 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; or 5) gene gun strike.

[0082] The present invention further provides a method for non-transgenic transient editing of a plant genome, comprising the following steps: 1) A combination of at least two crRNA fragments or at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient plant cell or tissue, and the crRNA combination combined with tracrRNA or the sgRNA combination alone can guide the corresponding Cas protein to sequentially create two or more DNA breaks at a specific site of the first target gene in the recipient cell, and to spontaneously repair each of them, with subsequent DNA breaks being generated based on novel sequences generated from previous DNA break repairs; 2) A suitable amount of CRISPR / Cas protein or its corresponding mRNA is mixed with a combination of crRNA and tracrRNA fragments or a single sgRNA fragment combination, which has been pre-designed and synthesized above, capable of guiding site-directed editing of a first target gene to produce an endogenous selection marker; optionally, at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene is further added, and the mixture is incubated in vitro to form an RNP complex; 3) The process by which the above-mentioned RNP complex is delivered to recipient plant cells or tissues and comes into contact with a specific site of genomic DNA in order to achieve gene editing; 4) A method is provided comprising the steps of: applying a corresponding selective pressure to select for a phenotypic selectable trait generated by site-directed editing of a first target gene by an RNP complex; isolating cells, tissues, intercellular matrix, or a complete plant containing the editing event; and optionally isolating cells, tissues, organs, or a complete plant containing simultaneously the editing event of the first target gene and at least one editing event of a second, third, or subsequent target gene.

[0083] In a particular embodiment, the “first target gene” is a locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a trait advantageous for growth.

[0084] In certain embodiments, “a specific site of the first target gene” refers to a site where, after sequential breaks and repairs, a particular type of mutation is generated that can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

[0085] In certain embodiments, “a particular type of mutation” includes single base substitutions, multiple base substitutions, or insertions or deletions of an unspecified number of bases.

[0086] In certain embodiments, the “certain selective pressure” may be ambient pressure or pressure arising from the added compound, for example, ambient pressure may preferably be high temperature, low temperature, or low oxygen, and pressure arising from the added compound may be pressure arising from salt ion concentration, antibiotics, cytotoxins, or herbicides.

[0087] In certain embodiments, “recipient plant cells or tissues” are any cells or tissues that can act as recipients of transient expression and can be redifferentiated into a complete plant by tissue culture. In particular, the cells are protoplast cells or suspension cells, and the tissues are preferably callus, immature embryo, mature embryo, leaf, shoot apex, young panicle, hypocotyl, etc.

[0088] In certain embodiments, the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of performing genome editing.

[0089] In certain embodiments, the feature of "sequentially generating two or more DNA breaks at a specific site" refers to the design in which a new target RNA is designed to re-cleave that site based on a novel sequence generated by a previous DNA break repair event produced by the CRISPR / Cas system.

[0090] In certain embodiments, "two or more DNA cleavage sites" are created when RNP complexes formed by the same CRISPR / Cas nuclease, each containing a different gRNA or sgRNA, sequentially cleave the corresponding target sequences.

[0091] In another specific embodiment, "multiple DNA cleavage" is achieved when RNP complexes, individually formed by two or more CRISPR / Cas nucleases recognizing different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences. Thus, the editable frame of the DNA molecule is larger.

[0092] In certain embodiments, “second, third, or subsequent target genes” refer to other genes that have a different coding scheme from the first target gene.

[0093] In a particular embodiment, "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment that targets a second, third, or subsequent target gene" has the same Cas protein as the crRNA or sgRNA that targets the first target gene.

[0094] In another specific embodiment, "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment targeting a second, third, or subsequent target gene," as well as the crRNA or sgRNA targeting the first target gene, utilizes a Cas protein that recognizes different PAM sequences. Thus, the second target gene has more selectable editing sites.

[0095] In certain embodiments, the method for delivering the RNP complex to plant cells is selected from, but is not limited to, 1) PEG-mediated cell protoplast transformation; 2) microinjection; 3) gene gun shock; 4) silicon carbide fiber-mediated method; or 5) vacuum infiltration method, or any other transient introduction method. Gene gun shock is preferred.

[0096] In a particular embodiment, the “first target gene” is at least one endogenous gene encoding at least one phenotypic selectable trait selected from herbicide resistance / tolerance, wherein the herbicide resistance / tolerance includes resistance / tolerance to EPSPS inhibitors (including glyphosate), resistance / tolerance to glutamine synthesis inhibitors (including glufosinate), resistance / tolerance to ALS or AHAS inhibitors (including imidazoline or sulfonylurea), resistance / tolerance to ACCase inhibitors (including aryloxyphenoxypropionic acid (FOP)), and carotenoid biosynthesis inhibitors (carotenoid biosynthesis inhibitors at the phytoendesaturase (PDS) step, 4 - Resistance / tolerance to hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors or other carotenoid biosynthesis target inhibitors is selected from the group consisting of resistance / tolerance to cellulose inhibitors, resistance / tolerance to lipid synthesis inhibitors, resistance / tolerance to long-chain fatty acid inhibitors, resistance / tolerance to microtubule polymerization inhibitors, resistance / tolerance to photosystem I electron shunt agents, resistance / tolerance to photosystem II inhibitors (including carbamates, triazines, and triazones), resistance / tolerance to PPO inhibitors, and resistance / tolerance to synthetic growth hormones (including dicamba and 2,4-D (i.e., 2,4-dichlorophenoxyacetic acid)). Here, the first target gene is selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, TIR1, and AFB5, and several types of mutations produced after sequential breaks and repairs at specific sites of these herbicide target genes may confer resistance / tolerance to the corresponding herbicide to recipient plant cells.

[0097] In a particular embodiment, the “first target gene” is ALS, and the “specific site of the gene” refers to sites A122, P197, R198, D204, A205, D376, R377, W574, S653, or G654 in the amino acid sequence of the Arabidopsis AtALS protein (for example, as shown in SEQ ID NO: 1), and an amino acid site in another plant's ALS protein that corresponds to the above amino acid site by using the AtALS amino acid sequence as a reference standard. The target sequences include a crRNA or sgRNA comprising a sequence encoding an amino acid sequence site of the AtALS protein selected from the group consisting of A122, P197, R198, D204, A205, D376, R377, W574, S653, G654, or any combination thereof, and a target sequence comprising a sequence encoding amino acid sites corresponding to the above amino acid sites and any combination thereof, using the AtALS amino acid sequence in an ALS protein of another plant as a reference standard. The ALS W574 site is preferred. The selective pressure is preferably pyroxyslam or nicosulfuron treatment.

[0098] In a particular embodiment, the “first target gene” is ACCase, and the “specific site of the gene” refers to sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, or G2096 in the amino acid sequence of the Alopecurus myosuroides AmACCase protein (e.g., as shown in SEQ ID NO: 3, the gene sequence as shown in SEQ ID NO: 4), and an amino acid site of an ACCase protein of another monocotyledonous plant that corresponds to the above amino acid site by using the AmACCase amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an AmACCase amino acid sequence site selected from the group consisting of I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, G2096, or any combination thereof, as well as a target sequence comprising a sequence encoding amino acid sites corresponding to the above amino acid sites and any combination thereof, using an AmACCase amino acid sequence in an ACCase protein of another monocotyledonous plant as a reference standard. The ACCase W2027 site is preferred. The selective pressure is preferably quizalopop-p-ethyl treatment.

[0099] In a particular embodiment, the “first target gene” is HPPD, and the “specific site of the gene” refers to sites H141, L276, P277, N338, G342, R346, D370, P386, K418, or G419 in the amino acid sequence of the rice (Oryza sativa) OsHPPD protein (as shown in SEQ ID NO: 5, the genome sequence as shown in SEQ ID NO: 6), and an amino acid site in the HPPD protein of another plant that corresponds to the above amino acid site by using the OsHPPD amino acid sequence as a reference standard. The target sequences include crRNA or sgRNA comprising a sequence encoding an OsHPPD amino acid sequence site selected from the group consisting of H141, L276, P277, N338, G342, R346, D370, P386, K418, G419 or any combination thereof, and a target sequence comprising a sequence encoding amino acid sites corresponding to the above amino acid sites and any combination thereof, using the OsHPPD amino acid sequence in HPPD protein of another plant as a reference standard. The selective pressure is preferably biscarfentrazone treatment.

[0100] In a particular embodiment, the “first target gene” is PPO, and the “specific site of the gene” refers to sites S128, V217, S223, V364, K373, L423, Y425, or W470 in the amino acid sequence of the rice OsPPO1 protein (as shown in SEQ ID NO: 7, the genome sequence as shown in SEQ ID NO: 8), and amino acid sites in a PPO protein of another plant that correspond to the above amino acid sites by using the amino acid sequence of OsPPO1 as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an OsPPO1 amino acid sequence site selected from the group consisting of S128, V217, S223, V364, K373, L423, Y425, W470, or any combination thereof, and a target sequence comprising sequences of the above amino acid sites and combinations thereof corresponding to a PPO protein of another plant, using the OsPPO1 amino acid sequence as a reference standard. The selective pressure is preferably safluphenacil treatment.

[0101] In a particular embodiment, the “first target gene” is TIR1, and the “specific site of the gene” refers to sites F93, F357, C413, or S448 in the amino acid sequence of the rice OsTIR1 protein (as shown in SEQ ID NO: 9, the genome sequence as shown in SEQ ID NO: 10), and the amino acid site in the TIR1 protein of another plant that corresponds to the above amino acid site by using the OsTIR1 amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising a sequence encoding an OsTIR1 amino acid sequence site selected from the group consisting of F93, F357, C413, S448, or any combination thereof, as well as a target sequence comprising a sequence encoding the above amino acid site and any combination thereof, using the OsTIR1 amino acid sequence in another plant's TIR1 protein as a reference standard. The selective pressure is preferably 2,4-D treatment.

[0102] The present invention further provides a non-transgenic transient editing system using the method described above.

[0103] The present invention further provides the use of the aforementioned non-transgenic transient editing system as a selection marker.

[0104] The present invention further provides the use of the aforementioned non-transgenic transient editing system in the treatment of diseases.

[0105] The present invention further provides the use of the aforementioned non-transgenic transient editing system in biological breeding.

[0106] The present invention further provides a genetically modified plant obtained by the aforementioned method, in which the genome contains an editing event of a first target gene, and the genetically modified plant is obtained in a non-transgenic manner.

[0107] The present invention further provides a genetically modified plant obtained by the aforementioned method, comprising an editing event of a first target gene in the genome and further comprising at least one second target gene editing event, wherein the genetically modified plant is obtained in a non-transgenic manner.

[0108] The present invention further provides a genetically modified plant obtained by the aforementioned method, wherein the genome contains at least one second target gene editing event, the genetically modified plant is obtained in a non-transgenic manner, and the first target gene editing event is removed by genetic segregation.

[0109] The present invention further provides a genome of a genetically modified plant obtained by the aforementioned method, which comprises in the genome 1) an editing event of a first target gene; 2) an editing event of a first target gene and an editing event of at least one second target gene; or 3) an editing event of at least one second target gene, in which case the editing event of the first target gene is removed by genetic segregation, and is obtained in a non-transgenic manner.

[0110] Another aspect of the present invention is to provide novel plant gene mutations obtained by the method described above.

[0111] This invention also includes the following types: The present invention provides novel mutations produced in plants, comprising one or more combinations of the following: substitution of aspartic acid with any other amino acid at the site corresponding to Arabidopsis ALS376; substitution of tryptophan with any other amino acid at the site corresponding to Arabidopsis ALS574; substitution of serine with any other amino acid at the site corresponding to Arabidopsis ALS653; or substitution of serine with any other amino acid at the site corresponding to Arabidopsis ALS654; or substitution of tryptophan with any other amino acid at the site corresponding to ACCase2027 of Aristolochia japonica.

[0112] In certain embodiments, aspartic acid in the site corresponding to Arabidopsis ALS376 is replaced with glutamic acid (D376E), tryptophan in the site corresponding to Arabidopsis ALS574 is replaced with leucine or methionine (W574L or W574M), serine in the site corresponding to Arabidopsis ALS653 is replaced with asparagine or arginine (S653N or S653R), or the site corresponding to Arabidopsis ALS654 Glycine in is substituted with aspartic acid (G654D), where these amino acid sites are described by reference to the corresponding amino acid sites in Arabidopsis thaliana; or tryptophan in the site corresponding to ACCase2027 in *Arabidopsis thaliana* is substituted with leucine or cysteine ​​(W2027L or W2027C), where these amino acid sites are described by reference to the corresponding amino acid sites in *Arabidopsis thaliana*.

[0113] In another specific embodiment, the mutation type is S653R / G654D, and these amino acid sites are described by using the corresponding amino acid sites of Arabidopsis thaliana as a reference.

[0114] In certain embodiments, aspartic acid at site 350 of rice ALS is substituted with any other amino acid, tryptophan at site 548 of rice ALS is substituted with any other amino acid, or tryptophan at site 561 of potato (Solanum tuberosum L.) ALS2 is substituted with any other amino acid, or tryptophan at site 2038 of rice ACCase2 is substituted with any other amino acid.

[0115] In another specific embodiment, aspartic acid at site 350 of rice ALS is substituted with glutamic acid (D350E), tryptophan at site 548 of rice ALS is substituted with leucine or methionine (W548L or W548M), or tryptophan at site 561 of potato ALS2 is substituted with leucine or methionine (W561L or W561M); or tryptophan at site 2038 of rice ACCase2 is substituted with leucine or cysteine ​​(W2038L or W2038C), where the amino acid sequence of the rice ALS protein is shown in SEQ ID NO: 11, the amino acid sequence of the potato StALS2 protein is shown in SEQ ID NO: 19, and the amino acid sequence of the rice ACCase2 protein is shown in SEQ ID NO: 13.

[0116] The present invention further provides a protein having the aforementioned novel mutation or a biologically active fragment thereof.

[0117] The present invention also provides nucleic acids comprising a nucleic acid sequence or complementary sequence encoding the protein or a biologically active fragment thereof.

[0118] The present invention further provides a recombinant expression vector comprising a nucleic acid and a promoter functionally linked thereto.

[0119] The present invention further provides an expression cassette comprising nucleic acid.

[0120] The present invention further provides plant cells comprising an expression cassette.

[0121] The present invention further provides plants that have been re-differentiated by using the aforementioned plant cells.

[0122] Another aspect of the present invention is a method for producing plants with improved resistance or tolerance to herbicides, comprising redifferentiating the plant cells into a plant body.

[0123] Another aspect of the present invention provides a method for controlling weeds in a plant cultivation area, wherein the plants include the aforementioned plants or plants produced by the aforementioned method, and the method comprises applying one or more herbicides to the cultivation area in an amount effective for controlling weeds.

[0124] Another aspect of the present invention also provides the use of novel mutations, proteins or their biologically active fragments, nucleic acids, recombinant expression vectors or expression cassettes in improving the resistance or tolerance of plant cells, plant tissues, plant parts or plant bodies to herbicides.

[0125] The present invention has the following excellent technical effects: Novel targets can be designed based on sequences generated from novel repair events resulting from sequential editing. This allows for the formation of numerous sequential mutations at specific sites in the genome, exponentially increasing the types of repair events after DNA breaks and enabling novel types of base substitutions, deletions, and insertions that cannot be seen with single gene editing. In other words, the programmed sequential cut / edit method employed in this invention, which uses sequences generated from previous gene editing repairs as subsequent gene editing targets, provides a CRISPR / Cas with novel functions such as single-base editing via simple knockout and precise deletions and insertions at specific sites.

[0126] This invention enables screening of gene editing events in the absence of exogenous markers and further enables non-transgenic gene editing, thereby significantly reducing concerns about the biological safety of methods in cell therapy and biological breeding.

[0127] In particular, the plant non-transgenic transient editing method provided by the present invention involves only Cas proteins and artificially synthesized gRNA or sgRNA fragments, with no involvement of exogenous DNA anywhere in the process. It creates an endogenous resistance selection marker by editing the first target gene via sequential cleavage / editing. Thus, the editing event can be effectively screened without virtually any genetic modification operation. Therefore, this method is equivalent to chemical mutagenesis or radiation-induced breeding, and eliminates the need for continuous isolation and detection of exogenous transgenic components over many generations. This shortens the breeding cycle, ensures biological safety, saves management and approval costs, and offers significant application prospects for rigorous plant breeding. [Modes for carrying out the invention]

[0128] Detailed description of the invention In this invention, unless otherwise specified, the scientific and technical terms used herein have meanings commonly understood by those skilled in the art. Furthermore, all terms and research procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology are commonly used in their respective fields. At the same time, for a better understanding of this invention, definitions and explanations of the relevant terms are provided below.

[0129] As used herein, the term "genome" refers to all the complements of the genetic material (genes and non-coding sequences) present in each cell, virus, or organelle of an organism, and / or the complete genome inherited from parents as a single unit (haploid).

[0130] The term "gene editing" refers to strategies and techniques for making targeted, specific modifications to the genetic information or genome of living organisms. Therefore, it includes not only editing of the gene-coding region, but also editing of non-gene-coding regions of the genome. The term also includes editing or modification of other genetic information in the nucleus (if present) and cells.

[0131] The term "CRISPR / Cas nuclease" is not limited to, but may include: 1) Cas9 including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9 (VQR); 2) Cas12 including LbCpf1, FnCpf1, AsCpf1, MAD7, or any variant or derivative of the above CRISPR nucleases, or a nucleic acid sequence encoding such a CRISPR nuclease, preferably containing a mutation such that at least one CRISPR nuclease recognizes a different PAM sequence compared to the corresponding wild-type sequence. As used herein, “CRISPR nuclease” refers to any nuclease identified in the natural CRISPR system, subsequently isolated from its natural background, and preferably modified or combined to form a recombinant construct suitable as a tool for targeted genome engineering. Any CRISPR nuclease is usable as long as the original wild-type CRISPR nuclease provides DNA recognition, i.e., binding properties, and may optionally be reprogrammed or otherwise mutated to suit various embodiments of the present invention.

[0132] The term "CRISPR" refers to a sequence-specific gene manipulation technique that relies on clustered, regularly interspaced short palindromic repeats, unlike RNA interference which regulates gene expression at the transcriptional level.

[0133] "Cas9 nuclease" and "Cas9" are used interchangeably herein and refer to an RNA guide nuclease comprising the Cas9 protein or a fragment thereof (e.g., a protein containing the active Cas9 DNA cleavage domain and / or the Cas9 gRNA binding domain). Cas9 is a component of the CRISPR / Cas (Clustered, regularly spaced short palindromic repeats and related systems) genome editing system. Under the guidance of guide RNA, it can cleave a target DNA sequence to form a DNA double-strand break (DSB).

[0134] "Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by the Cas (CRISPR-related) gene. Cas proteins include Cas endonucleases. Cas proteins can be bacterial or archaeal proteins. For example, the type I-III CRISPR Cas proteins used herein generally originate from prokaryotes, type I and type III Cas proteins originate from bacterial or archaeal species, and type II Cas protein (i.e., Cas9) may originate from bacterial species. "Cas protein" includes Cas9 protein, Cpf1 protein, C2c1 protein, C2c2 protein, C2c3 protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or combinations or complexes thereof.

[0135] A "Cas9 variant" or "Cas9 endonuclease variant" refers to a variant of the parent Cas9 endonuclease that, when associated with crRNA and tracRNA or sgRNA, retains the ability to recognize and bind to all or part of a DNA target sequence, and, if applicable, unwind all or part of the DNA target sequence, introduce a nick into all or part of the DNA target sequence, or cleave all or part of the DNA target sequence. Cas9 endonuclease variants include the Cas9 endonuclease variants described herein, which differ from the parent Cas9 endonuclease as follows: Cas9 endonuclease variants (when complexed with a gRNA to form a polynucleotide-specific endonuclease complex capable of modifying target sites) have at least one improved property compared to the parent Cas9 endonuclease (when complexed with the same gRNA to form a polynucleotide-guided endonuclease complex capable of modifying the same target sites), including, but not limited to, increased transformation efficiency, increased DNA editing efficiency, reduced off-target cleavage, or any combination thereof.

[0136] The Cas9 endonuclease variants described herein include variants that can bind to double-stranded DNA target sites and introduce nicks when associated with crRNA and tracrRNA, or with sgRNA, whereas the parental Cas endonuclease can bind to target sites and cause double-strand breaks (cleavage) when associated with crRNA and tracrRNA, or with sgRNA.

[0137] In this specification, “guide RNA” and “gRNA” are used interchangeably and typically consist of partially complementary crRNA and tracrRNA molecules to form a complex, where crRNA refers to a guide RNA sequence used to target a specific gene for correction using CRISPR technology, containing a sequence that hybridizes with the target sequence and has sufficient complementarity to the target sequence to instruct the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is also known in the art that single guide RNAs (sgRNAs) possessing the characteristics of both crRNA and tracrRNA can be designed.

[0138] The terms “single guide RNA” and “sgRNA” are used interchangeably herein and refer to the synthetic fusion of two RNA molecules comprising a fusion of a crRNA (CRISPR RNA) and a tracrRNA (trans-activated CRISPR RNA) with a variable targeting domain (linked to a tracer-pairing sequence hybridized to tracrRNA). The sgRNA may comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of a type II CRISPR / Cas system capable of forming a complex with a type II Cas endonuclease, the guide RNA / Cas endonuclease complex capable of guiding the Cas endonuclease to a DNA target site so that the Cas endonuclease can recognize the DNA target site, optionally bind to the DNA target site, optionally nick into the DNA target site, or cleave the DNA target site (introduce a single-strand or double-strand break).

[0139] In certain embodiments, guide RNA and Cas9 can be delivered to cells as a ribonucleoprotein (RNP) complex. The RNP consists of purified Cas9 protein complexed with gRNA, and it is well known in the art that RNPs can be efficiently delivered to many types of cells, including, but not limited to, stem cells and immune cells (Addgene, Cambridge, MA, Mirus Bio LLC, Madison, WI).

[0140] In this specification, a protospacer adjacent motif (PAM) refers to a short nucleotide sequence adjacent to a target sequence (prespacer) recognized (targeted) by the gRNA / Cas endonuclease system. If this target DNA sequence is not adjacent to a suitable PAM sequence, the Cas endonuclease may not be able to properly recognize the target DNA sequence. The sequence and length of the PAM in this specification may vary depending on the Cas protein or Cas protein complex used. The PAM sequence may be of any length, but is generally 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long.

[0141] As used herein, the terms “living organism” or “biological organism” include animals, plants, fungi, bacteria, and the like.

[0142] As used herein, the term "host cell" includes plant cells, animal cells, fungal cells, bacterial cells, and the like.

[0143] In the present invention, "animals" are not limited to vertebrates, such as humans, non-human mammals, birds, fish, reptiles, amphibians, and invertebrates, such as insects.

[0144] In this invention, "plant" should be understood to mean any differentiated multicellular organism capable of photosynthesis, and in particular monocots or dicots, for example: (1) Food crops: species of the genus Oryza, e.g., rice (Oryza sativa), wild rice (Oryza latifolia), rice (Oryza sativa), African rice (Oryza glaberrima); species of the genus Triticum, e.g., wheat (Triticum aestivum), durum wheat (T. Turgidum ssp. Durum); species of the genus Hordeum, e.g., barley (Hordeum vulgare), Hordeum arizonicum; rye (Secale cereale); species of the genus Avena, e.g., oats (Avena Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena hybrida; Echinochloa spp., e.g., pearl millet (Pennisetum glaucum), sorghum, sorghum bicolor, sorghum vulgare, rye wheat, Zea mays, or maize, foxtail millet, sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setaria italica, wild rice (Zizania) (2) Leguminous crops: Glycine spp.), for example, soybeans (Glycine max), soybean hispida, soybean max, species of Vicia spp., species of Vigna spp., species of Pisum spp., broad bean, species of Lupinus spp., Vicia genus, tamarind (Tamarindus indica), lentil (Lens culinaris), species of Lathyrus spp., hyacinth bean, broad bean, mung bean, adzuki bean, chickpea; (3) Oil crops: peanuts (Arachis hypogaea), species of Arachis spp., species of Sesamum spp., species of Helianthus (4) Fiber crops: sisal (Agave sisalana), species of the genus Elaeis, e.g., oil palm (Eiaeis guineensis), American oil palm (Elaeis oleifera), soybean, rapeseed (Brassicanapus), Brassica oleracea, sesame (Sesamum orientale), mustard (Brassica juncea), rapeseed, camellia (Camellia oleifera), oil palm, olive, castor oil plants, rapeseed (Brassica napus L.), canola; (4) Fiber crops: sisal (Agave sisalana), species of the genus Gossypium (Gossypium spp.), e.g., cotton (Gossypium), Gossypium barbadense (Gossypium (barbadense), Gossypium hirsutum, Kenaf (Hibiscus cannabinus), Sisal hemp (Agave sisalana), Manila hemp (Musa textilis Nee), Flax (Linum usitatissimum), Corchorus capsularis L, Boehmeria nivea (L.), Cannabis sativa, Cannabis sativa; (5) Fruit crops: Ziziphus spp.), cucumber (Cucumis spp.), passion fruit (Passiflora edulis), grape (Vitis spp.), vine (Vaccinium spp.), European pear (Pyrus communis), cherry (Prunus spp.), bundling (Psidium spp.), pomegranate (Punica granatum), apple (Malus spp.), watermelon (Citrullus lanatus), citrus (Citrus spp.), fig (Ficus carica), fortunella (Fortunella spp.), strawberry (Fragaria spp.), hawthorn (Crataegus spp.), persimmon (Diospyros spp.), pitanga (Eugenia) (Unifora), loquat (Eriobotrya japonica), longan (Dimocarpus longan), papaya (Carica papaya), palm species (Cocos spp.), star fruit (Averrhoa carambola), silver vine species (Actinidia spp.), almond (Prunus amygdalus), banana species (Musa spp.) (Malayan mountain banana (Musa acuminate)), crocodile species (Persea spp.) (avocado (Persea Americana)), guava (Psidium guajava), mame apple (Mammea Americana), mango (Mangifera indica), olive (Canarium album) (Oleaeuropaea)), papaya (Caricapapaya), coconut (Cocos Nucifera), Acerola (Malpighia emarginata), Sapodilla (Manilkara zapota), Pineapple (Ananas comosus), Bromeliad species (Annona spp.), Ponkan (Citrus reticulate) (Citrus genus), Breadfruit species (Artocarpus spp.), Lychee (Litchi chinensis), Gooseberry species (Ribes spp.), Rubus species (Rubus spp.)(6) Rhizome crops: Cassava species (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), tuberous mustard, Allium cepa (onion), eleocharis tuberose (white water chestnut), nutsedge (Cyperus rotundus), yam (Rhizoma dioscoreae); (7) Vegetable crops: Spinach species (Spinacia spp.), kidney bean species (Phaseolus spp.), lettuce (Lactuca sativa), bitter melon species (Momordica) spp.) Parsley (Petroselinum crispum), Capsicum species (Capsicum spp.), Solanum species (Solanum spp.) (e.g., potato (Solanum tuberosum), flat eggplant (Solanum integrifolium), tomato (Solanum lycopersicum)), Lycopersicon species (Lycopersicon spp.) (e.g., tomato (Lycopersicon esculentum), tomato (Lycopersicon lycopersicum), Lycopersicon pyriforme)), Macrotyloma species (Macrotyloma spp.), Kale, Luffa acutangular, Lentil, Okra, Onion, Potato, Artichoke, Asparagus, Broccoli, Brussels sprouts Sprouts), cabbage, carrots, cauliflower, celery, collard greens, pumpkin, winter melon (Benincasa hispida), asparagus (Asparagus officinalis), celery (Apium graveolens), Amaranthus spp., Allium spp., Abelmoschus spp.), endive (Cichorium endivia), pumpkin species (Cucurbita spp.), coriander (Coriandrum sativum), apisinian mustard (B. carinata), radish (Rapbanus sativus), Brassica species (Brassica spp.) (for example, rapeseed (Brassica napus), turnip species (Brassica rapa ssp.), canola, rapeseed, rapeseed, rapeseed, mustard, cabbage, black mustard, canola (rapeseed), Brussels sprouts, Solanaceae (eggplant), sweet pepper (Capsicum annuum) (bell pepper), cucumber, loofah, Chinese cabbage, rapeseed, cabbage, gourd, chives, lotus, lotus root, lettuce; (8) Flower crops: trumpet lily (Tropaeolum) (minus), nasturtium (Tropaeolum majus), canna indica, prickly pear cactus species (Opuntia spp.), Tagetes spp., Cymbidium (orchid), Crinum asiaticum L., Clivia, Amaryllis (Hippeastrum rutilum), Rosa rugosa, Rosa Chinensis, Jasminum sambac, tulip (Tulipa gesneriana L.), Cerasus sp., Pharbitis nil (L.) morning glory, Calendula officinalis L., Nelumbo sp., daisy (Bellis perennis) L.), Carnation (Dianthus caryophyllus), Petunia (Petunia hybrida), Tulip (Tulipa gesneriana L.), Lilium brownie, Plum (Prunus mume), Daffodil (Narcissus tazetta L.), Forsythia (Jasminum nudiflorum Lindl.)), Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniate, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica, Weigela Florida, Forsythia (Fructus forsythyae), Forsythia mesnyi, Blue clover (Parochetus communis), Cyclamen (Cyclamen persicum Mill.), Phalaenophsis hybrid, Dendrobium nobile, Hyacinth (Hyacinthus orientalis), Iris tectorum Maxim, Calla lily (Zantedeschia aethiopica), Calendula officinalis, Hippeastrum rutilum, Begonia semperflorens hybrid, Fuchsia hybrida, Begonia maculata Raddi, Geranium, Pothos (Epipremnum) aureum); (9) Medicinal crops: safflower (Carthamus tinctorius), mint species (Mentha spp.), rhubarb (Rheum rhabarbarum), saffron (Crocus sativus), goji berry (Lycium chinense), Polygonatum odoratum, Polygonatum kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng ginseng), Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana), Para rubber tree (Hevea brasiliensis) (wild species), purple alfalfa (Medicago sativa Linn), pepper (Piper Nigrum L.)(10) Raw material crops: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) Pasture crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea), Panicum virgatum, Prairie grass, Indian grass, Big blue stem grass, Oriental grass (Phleum pratense), Zoysia japonica, Cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Oriental grass (Phleum pratense L.), Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Sun hemp (Crotalaria juncea), Sesbania Cannabina), Red duckweed (Azolla imbircata), Water hyacinth (Eichhornia crassipes), Black-flowered pagoda tree (Amorpha fruticose), Lupine (Lupinus micranthus), Trifolium, Purple duckweed (Astragalus adsugens pall), Button duckweed (. (12) Sugar crops: Saccharum spp., Beta vulgaris; (13) Beverage crops: Camellia sinensis, Camellia sinensis, tea, coffee (coffea spp.), Theobroma cacao, hops (Humulus lupulus Linn.); (14) Lawn plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass)), Agrostis spp. (Agrostis Matsumurae), Agrostis palustris, Lolium spp. (grass), Festuca spp. (grass), Zoysia spp. (Zoysia japonica), Cynodon spp. (Cynodon dactylon / Bermuda grass), Stenotaphrum secundatum, Paspalum spp., Eremochloa ophiuroides (centipede grass), Axonopus spp.) (carpet grass), Bouteloua dactyloides (buffalo grass), Bouteloua var. spp.)(Bluegrass (Bouteloua gracilis)), Digitaria sanguinalis, Cyperus rotundus, Kyllingabrevifolia, Cyperus amuricus, Erigeron canadensis, Hydrocotyles ibthorpioides, Kummerowia striata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex hetelostachya, Zoysia grass; (15) Tree crops: Pinus spp., Salix spp., Acer spp.) , species of Hibiscus, species of Eucalyptus, Ginkgo biloba, species of Bambusa sp., species of Populus, species of Prosopis, species of Quercus, species of Phoenix, species of Fagus, species of Bombyx, species of Ceiba pentandra, species of Cinnamomum, species of Corchorus, Phragmites australis, species of Physalis, species of Desmodium (spp.), Poplar, Hedera helix, White hibiscus (Populus tomentosa Carr), Viburnum odoratissinum, Ginkgo biloba L.), Quercus, Ailanthus altissima, Schima superba, Ilex purpurea, Platanus acerifolia, Ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans Nigra, lemon (Citrus limon), London plane tree (Platanus acerifolia), myrtle (Syzygium jambos), handkerchief tree (Davidia involucrate), kapok (Bombax malabarica L.), blobberry tree (Ceiba pentandra (L.)), Bauhinia blakeana, American silk tree (Albizia saman), silk tree (Albizzia julibrissin), coral tree (Erythrina corallodendron), deyco (Erythrina indica), southern magnolia (Magnolia grandiflora), cycad (Cycas revolute), crape myrtle (Lagerstroemia) (indica), coniferous trees, tall trees, shrubs; (16) Nut crops: Brazil nut tree (Bertholletia excelsea), Castanea spp., Corylus spp., Carya spp., Juglans spp.), pistachio (Pistacia vera), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), pecan (Carya illinoensis Koch), macadamia, pistachio, almond, other plants that produce nuts; (17) Others: Arabidopsis thaliana (arabidopsis thaliana), barnyard grass (Brachiaria eruciformis), cinquefoil moth (Cenchrus echinatus), foxtail grass (Setaria faberi), goosegrass (eleusine indica), Cadaba farinose, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., carrot (Daucus Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sinapis This includes species such as *Syzygium sp.*, *Tripsacum dactyloides*, *Triticosecale rimpaui*, and *Viola odorata*.

[0145] In certain embodiments, the plants are selected from rice, corn, wheat, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, potatoes, sweet potatoes, Chinese cabbage, cabbage, cucumbers, hibiscus, pothos (Scindapsus aureus), watermelons, melons, strawberries, blueberries, grapes, apples, oranges, peaches, pears, bananas, and the like.

[0146] As used herein, the term “plant” includes the whole plant and any progeny, cells, tissues, or parts of a plant. The term “plant part” includes, for example, but not limited to, seeds (including mature seeds, immature embryos without seed coats, and immature seeds); cuttings; plant cells; plant cell cultures; and plant organs (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and associated explants). Plant tissue or plant organ may be a seed, callus tissue, or any other population of plant cells organized into structural or functional units. Plant cells or tissue cultures can regenerate plants having the physiological and morphological characteristics of the plant from which they are derived, and can regenerate plants having substantially the same genotype as that plant. In contrast, some plant cells cannot regenerate plants. Regenerative cells in plant cells or tissue cultures may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silks, flowers, kernels, spikes, rachis, sheaths, or stems.

[0147] The plant part comprises harvestable parts and parts that can be used to propagate subsequent plants. Plant parts that can be used for propagation include, but are not limited to, seeds; fruits; scions; seedlings; tubers; and rhizomes. Harvestable plant parts may include, but are not limited to, flowers; pollen; seedlings; tubers; leaves; stems; fruits; seeds; and roots.

[0148] Plant cells are the structural and physiological units of plants. As used herein, plant cells include protoplasts and protoplasts with partially formed cell walls. Plant cells may be in the form of isolated single cells or cell aggregates (e.g., loose callus and cultured cells), or they may be part of higher tissue units (e.g., plant tissues, plant organs, and plant bodies). Thus, plant cells can be protoplasts, gamete-producing cells, or cells or cell aggregates capable of regenerating a complete plant. Accordingly, in embodiments herein, a seed containing multiple plant cells and capable of regenerating a complete plant is considered a “plant part”.

[0149] As used herein, the term “protoplast” refers to plant cells from which the cell wall has been completely or partially removed, exposing the lipid bilayer. Generally, a protoplast is an isolated plant cell without a cell wall that has the ability to regenerate a cell culture or a complete plant.

[0150] The term "post-plant generation" includes any subsequent generation of a plant.

[0151] The term "bacteria" refers to all prokaryotes, including all organisms in the prokaryote kingdom. The term "bacteria" includes all microorganisms considered to be bacteria, including the genera Mycoplasma, Chlamydia, Actinomyces, Streptomyces, and Rickettsia. This definition includes all forms of bacteria, including cocci, bacilli, spiral bacteria, spheroplasts, protoplasts, etc. The term also includes Gram-negative and Gram-positive prokaryotes. "Gram-negative" and "Gram-positive" refer to staining patterns using Gram staining methods well known in the art (see, for example, Finegold and Martin, Diagnostic Microbiology, 6th Ed., CV Mosby St. Louis, pp. 13-15

[1982] ). "Gram-positive bacteria" are bacteria that can retain the protochromoid dyes used in Gram staining, and stained cells appear dark blue to purple under a microscope. Gram-negative bacteria do not retain the primary dye used in Gram staining, but they stain with counter dyes. Therefore, Gram-negative bacteria appear red after the Gram staining reaction.

[0152] As used herein, the term "fungus" refers to eukaryotes such as molds and yeasts, including biphasic fungi.

[0153] The terms "herbicide tolerance" and "herbicide resistance" are interchangeable and both refer to herbicide tolerance and herbicide resistance. "Improved herbicide tolerance" and "improved herbicide resistance" mean that tolerance or resistance to herbicides has been improved compared to plants containing the wild-type gene.

[0154] The term "wild type" refers to nucleic acid molecules or proteins that can be found in nature.

[0155] In the present invention, the term "cultivation area" includes the soil and other locations where the plants of the present invention are cultivated, and also includes, for example, plant seeds, plant seedlings, and growing plants. The term "effective amount for weed control" refers to an amount of herbicide sufficient to affect the growth or development of a target weed, for example, to hinder or inhibit the growth or development of the target weed, or to kill the weed. Advantageously, the effective amount for weed control does not have a significant effect on the growth and / or development of the plant seeds, plant seedlings, or plants of the present invention. Those skilled in the art can determine such an effective amount for weed control from conventional experiments.

[0156] As used herein, the term "target DNA" refers to a DNA polynucleotide comprising a "target site" or "target sequence."

[0157] The term "lysis" refers to the cleavage of the covalent backbone of a DNA molecule. Dissolution can be induced by various methods, including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-stranded and double-stranded DNA can be lysed, and double-stranded lysis can result from two distinct single-stranded lysis events. DNA lysis can produce blunt or overhanging ends. In certain embodiments, a complex comprising DNA-targeting RNA and site-specifically modified polypeptides is used for targeted double-stranded DNA lysis.

[0158] The term "gene" comprises a nucleic acid fragment that expresses a functional molecule (e.g., a specific protein, but not limited to one) that includes regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) a coding sequence.

[0159] A DNA sequence that "codes" a specific RNA is a DNA nucleic acid sequence that can be transcribed into RNA. A DNA polynucleotide can code for RNA that can be translated into a protein (mRNA), or it can code for RNA that cannot be translated into a protein (e.g., tRNA, rRNA, or DNA-targeted RNA; these are also known as "non-coding" RNA or "ncRNA").

[0160] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention and refer to polymers of amino acid residues. These terms apply to amino acid polymers, as well as natural amino acid polymers, in which one or more amino acid residues are artificial chemical analogs of corresponding and natural amino acids. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include, but are not limited to, their modified forms, including glycosylation, lipid linking, sulfated, γ-carboxylated, hydroxylated, and ADP-ribosylated glutamate residues.

[0161] The term "biologically effective fragment" refers to a fragment of a protein that lacks one or more amino acid residues from its N-terminus and / or C-terminus, but still retains its functional activity.

[0162] In the terminology used herein regarding amino acid substitutions, the first letter represents the native amino acid at a specific position in a given sequence, the following number represents the corresponding position in the sequence, and the second letter represents the different amino acid used to substitute for the native amino acid. For example, W574L means that tryptophan at position 574 is substituted with leucine. For double or multiple mutations, each mutation is separated by a " / ".

[0163] The terms "polynucleotide" and "nucleic acid" are used interchangeably and consist of DNA, RNA, or hybrids thereof, which may be double-stranded or single-stranded.

[0164] The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the sequence of bases in DNA or RNA.

[0165] In the present invention, "expression cassette," "expression vector," and "expression construct" refer to vectors, such as recombinant vectors, that are suitable for the expression of a target nucleotide sequence in plants. The term "expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence may refer to the transcription of a nucleotide sequence (e.g., transcription to produce mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein.

[0166] The “expression construct” of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, a translatable RNA (e.g., mRNA).

[0167] The “expression construct” of the present invention may comprise a target regulatory sequence and nucleotide sequence from different sources, or from the same source, but arranged in a manner different from those normally found in nature.

[0168] The terms “recombinant expression vector” or “DNA construct” are used interchangeably herein and refer to a DNA molecule comprising a vector and at least one insert sequence. Recombinant expression vectors are typically constructed for the purpose of expressing and / or amplifying an insert sequence, or for constructing other recombinant nucleotide sequences. This insert sequence may be operably or inoperably ligated to a promoter sequence, or operably or inoperably ligated to a DNA regulatory sequence.

[0169] The terms “regulatory sequence” and “regulatory element” are used interchangeably and refer to nucleotide sequences located upstream (5' non-coding sequence), midstream, or downstream (3' non-coding sequence) of a coding sequence that affect the transcription, RNA processing, stability, or translation of the associated coding sequence. Plant expression regulators refer to nucleotide sequences in plants that can control the transcription, RNA processing, stability, or translation of a target nucleotide sequence.

[0170] Regulatory sequences, though not limited to them, include promoters, translation reader sequences, introns, and polyA recognition sequences.

[0171] The term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling the transcription of a gene in a plant cell, whether or not it originates from a plant cell. This promoter may be a constituent promoter, a tissue-specific promoter, a promoter regulated by a developmental stage, or an inducible promoter.

[0172] The term "constitutive promoter" generally refers to a promoter that, in most cases, produces gene expression in most cell tumors. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to promoters that are primarily expressed in a particular tissue or organ, and also expressed in specific cells or cell types, though not always without exception. "Developmental-moderated promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoter" selectively expresses DNA sequences that are operable in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0173] As used herein, the term “operatably linked” refers to the linkage of a nucleotide sequence to a nucleic acid sequence (e.g., a coding sequence or open reading frame) and a regulatory element (e.g., a promoter sequence, a transcription termination sequence, etc.) such that the transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operatably linking a regulatory element region to a nucleic acid molecule are known in the art.

[0174] "Introducing" a nucleic acid molecule (e.g., plasmid, linear nucleic acid fragment, RNA, etc.) or protein into a plant means transforming the plant cell with that nucleic acid or protein so that the nucleic acid or protein can function within the plant cell. As used in this invention, the term "transformation" includes stable transformation and transient transformation.

[0175] The term "stable transformation" refers to the process by which the introduction of an exogenous nucleotide sequence into a plant genome results in the stable inheritance of that exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably incorporated into the plant genome and any of its offspring.

[0176] The term "transient transformation" refers to the process where the introduction of a nucleic acid molecule or protein into a plant cell to perform a function does not result in the stable inheritance of the foreign gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the plant genome.

[0177] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this invention pertains. Any methods and materials similar or equivalent to those described herein may be used in carrying out or testing the invention, but preferred methods and materials are described below.

[0178] All publications and patents referenced herein are incorporated by reference, just as each individual publication and patent is incorporated by accurate and individual reference, and by reference to disclose and describe methods and / or materials relating to a cited publication. No prior reference of any publication published up to the filing date should be construed as an acknowledgment that the present invention is not eligible to precede the disclosure of an existing invention. Furthermore, the cited publication date may differ from the actual publication date, and the actual publication date may require independent verification.

[0179] Unless otherwise stated or implied, in this specification, “a,” “a / an,” and “the” mean “at least one.” All patents, patent applications, and publications described or cited herein are incorporated herein by reference in their entirety to the same degree of reference as they are individually cited. [Brief explanation of the drawing]

[0180] [Figure 1] Figure 1 shows a schematic diagram of a method for generating novel mutations in organisms according to the present invention. In this figure, only Cas9 with NGG as the PAM is given as an example, but other Cas9 mutants with different PAMs (e.g., NG) can be used in a similar manner. [Figure 2] Figure 2 shows a schematic diagram of the gRNA design at ALS gene sites W574 and S653 in Arabidopsis thaliana. [Figure 3] Figure 3 shows Arabidopsis thaliana T2 generation herbicide-resistant lines transformed with two different programmed sequential cut / edit vectors. pQY743 and pQY745 are vector numbers. The resistant lines were able to root normally, whereas the wild-type Col-0 and non-resistant lines were not. [Figure 4]Figure 4 shows the sequencing peaks of the ALS gene in imazapick-resistant T2 generation Arabidopsis thaliana lines, where the T indicated by the arrow is a mutation from G, resulting in the W574L mutation. [Figure 5] Figure 5 shows the design of a programmed sequential cleavage / editing scheme at the W574 site of the Arabidopsis thaliana ALS gene. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Of these, sgRNA1 and Cas9 formed a complex, which was thought to cleave the W574 codon of ALS in the genome, forming the -G genotype via cellular spontaneous repair. This novel sequence was recognizable and cleavable by the complex formed by sgRNA2 and Cas9, forming the +T genotype via cellular spontaneous repair, resulting in W574L. [Figure 6] Figure 6 shows the sequencing results for resistant Arabidopsis thaliana seedlings and the ALS W574 site screened with imazapick. [Figure 7] Figure 7 shows the design of a programmed sequential cleavage / editing scheme at the S653 site of the Arabidopsis thaliana ALS gene. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Of these, sgRNA1 and Cas9 formed a complex that cleaved the S653 codon of ALS in the genome. After spontaneous cell repair, the -G genotype was formed. This sequence was recognizable and cleavable by the complex formed by sgRNA2 and Cas9. After spontaneous cell repair, the +A genotype was formed, resulting in S653N. [Figure 8] Figure 8 shows the results of screening Arabidopsis thaliana seedlings with imazapick and sequencing of the ALS S653 site. The left panel shows the screening results and the percentage of resistant seedlings, while the right panel shows the sequencing peaks and the types of mutations at the S653 site. [Figure 9]Figure 9 shows the design of a programmed sequential cleavage / editing scheme at the W574 site of the Arabidopsis thaliana ALS gene. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Of these, sgRNA1 and Cas9 formed a complex that cleaved the W574 codon of ALS in the genome. After spontaneous cell repair, the +A genotype was formed. This sequence was recognizable and cleavable by the complex formed by sgRNA2 and Cas9. After spontaneous cell repair, the -G genotype was formed, resulting in W574M. These two cleavages utilized different PAM sites. [Figure 10] Figure 10 shows the design of a programmed sequential cleavage / editing scheme at the W2038 site of the rice ACCase2 gene. This site corresponds to site W2027 of the ACCase2 gene in *Epipactis thunbergii*. The T-DNA sequence expressed four genes: sgRNA1, sgRNA2, Cas9, and HygR. Of these, sgRNA1 and Cas9 formed a complex that cleaved the W2038 codon of ACCase in the genome. After spontaneous cell repair, the -G genotype was formed. This sequence was recognizable and cleavable by the complex formed by sgRNA2 and Cas9. After spontaneous cell repair, the +T genotype was formed, resulting in W2038L. [Figure 11] Figure 11 shows the sequencing results of resistant callus and W2038 site in rice simultaneously screened with hygromycin (50 ug / L) and quizalopop-p (50 ug / L). [Figure 12] Figure 12 shows the polyacrylamide gel electrophoresis of SpCas9 and NGA-Cas9 proteins produced and purified by prokaryotic expression. The bands indicated by arrows are Cas9 protein bands. [Figure 13]Figure 13 shows the in vitro cleavage activity of purified Cas9 protein against DNA fragments containing the OsALS W548 target site and the OsACCase2 W2038 target site, as detected by agarose gel electrophoresis. It can be seen that the DNA fragments can only be cleaved to the predicted size when the Cas9 protein and sgRNA fragment are added simultaneously. [Figure 14] Figure 14 shows the sequencing peaks of the OsALS W548 target site in RNP-transformed rice protoplasts, which corresponds to the ALS W574 site in Arabidopsis thaliana. In addition to the original G base signal peak, a T base signal peak obtained by mutation was present at the location indicated by the arrow, leading to the W548L mutation. [Figure 15] Figure 15 shows rice callus resistant to iodine, edited with RNP at the OsACCase2 W2038 site and screened with 50 ug / L quizalopop-p. Arrows indicate resistant callus. [Figure 16] Figure 16 shows the sequencing peaks of the OsACCase2 W2038 target site in rice seedlings differentiated from resistant callus. The T indicated by the arrow was mutated from G, resulting in the W2038L mutation. [Figure 17] Figure 17 shows the resistance test of T1 generation OsACCase2 W2038L edited seedlings to haloxyhop-p. From left to right, seedling 1 shows the result of the water-treated control of wild-type Huaidao No. 5 (rice variety), and seedlings 2-4 show the results of T1 generation W2038L edited lines QY367-7-12 and QY367-7-18 transformed by gene gun with wild-type Huaidao No. 5 and two RNPs. All of these were treated with 5 g / mu (mu is a unit of area, 1 mu = 1 / 15 hectare) of the haloxyhop-p active ingredient. It is clear that the edited lines developed resistance to haloxyhop-p. [Figure 18]Figure 18 shows the resistance test of T1 generation OsACCase2 W2038L edited seedlings to qizalofop-p. From left to right, seedling 1 shows the result of the water-treated control of wild-type Huaidao No. 5, and seedlings 2-4 show the results of T1 generation W2038L edited lines QY367-5-10 and QY367-5-21 transformed by gene gun with wild-type Huaidao No. 5 and two RNPs, all of which were treated with 5 g / mu of the haloxyfop-p active ingredient. It is clear that the edited lines developed resistance to haloxyfop-p. [Figure 19] Figure 19 shows resistant callus from rice that was simultaneously edited with RNP at the OsACCase2 W2038 site and the OsBADH2 gene, and screened with 50 ug / L qizalofop-p. Arrows indicate resistant callus. [Figure 20] Figure 20 shows the sequencing peaks of the OsACCase2 W2038 target site in T0 generation two-site edited seedlings. The T indicated by the arrow mutated from G, resulting in the W2038L mutation. [Figure 21] Figure 21 shows the sequencing peaks of the OsBADH2 target site in T0 generation two-site edited seedlings. A +A isozygous mutation occurred at the position indicated by the arrow. [Figure 22] Figure 22 shows resistant callus from rice that was simultaneously edited with RNP at the OsALS W548 site and the OsSWEET14 gene, and screened with 5 mg / L piroxislam. Arrows indicate resistant callus. [Figure 23] Figure 23 shows the sequencing peaks of the OsALS W548 target site in T0 generation two-site edited seedlings. Signal peaks for both G and T bases were present at the positions indicated by the arrows, indicating the W548L mutation. [Figure 24] Figure 24 shows the sequencing peaks of the OsSWEET14 target site in T0 generation two-site edited seedlings. A -C isozygous mutation occurred at the site indicated by the arrow. [Figure 25]Figure 25 shows the resistance tests of T1 generation OsALS W548 and OsSWEET142 site edited seedlings to nicosulfuron. From left to right, seedling 1 shows the results for the water-treated control of wild-type Huaidao No. 5, and seedlings 2 and 3 show the results for wild-type Huaidao No. 5 and T1 generation W548L edited line QY360-7-11 transformed with a gene gun in RNP. Both were treated with 4 g / mu of the nicosulfuron active ingredient. It is clear that the edited lines developed resistance to nicosulfuron. [Figure 26] Figure 26 shows the resistance tests of T1 generation OsALS W548 and OsSWEET142 site edited seedlings to flucarbazone-Na. From left to right, seedling 1 shows the results for the water-treated control of wild-type Huaidao No. 5, and seedlings 2-3 show the results for wild-type Huaidao No. 5 and T1 generation W548L edited line QY360-7-9 transformed with a gene gun in RNP. Both were treated with 2 g / mu of the active ingredient flucarbazone-Na. It is clear that these edited lines developed resistance to flucarbazone-Na. [Figure 27] Figure 27 shows the resistance tests of T1 generation OsALS W548 and OsSWEET142 site edited seedlings to imazapick. From left to right, seedling 1 shows the results for a water-treated control of wild-type Huaidao No. 5, and seedlings 2 and 3 show the results for wild-type Huaidao No. 5 and T1 generation W548L edited line QY360-7-11 transformed with a gene gun in RNP. Both were treated with 7 g / mu of imazapick active ingredient. It is clear that these edited lines developed resistance to imazapick. [Figure 28]Figure 28 shows the resistance tests of T1 generation OsALS W548 and OsSWEET142 site edited seedlings to pyroxisram. From left to right, seedling 1 shows the results for the water-treated control of wild-type Huaidao No. 5, and seedlings 243 show the results for T1 generation W548L edited lines QY360-7-2 and QY360-7-11 transformed with a gene gun at wild-type Huaidao No. 5 and RNP RNP, all of which were treated with 2 g / mu pyroxisram active ingredient. It is clear that these edited lines developed resistance to pyroxisram. [Figure 29] Figure 29 shows a programmed serial cut / edit scheme for the HBB gene in 293T cells. A. Design of the HBB gene site for programmed serial cut / edit in 293T cells; B. Conversion efficiency of programmed serial cut / edit of the HBB gene in 293T cells after 48 hours of transformation for each editing vector; C. Ratio of gene editing types produced from programmed serial cut / edit of the HBB gene and single-site cut / edit of the HBB gene in 293T cells; WT: wild type, indel: deletion or insertion genotype, C->T SNP: genotype with a C-to-T base substitution at the cleavage site.

[0181] Explanation of the sequence list The main sequences included in this invention are summarized as follows, and related sequences are shown in the sequence listing.

[0182] [Table 1] [Examples]

[0183] Embodiments for carrying out the invention The present invention will be further described below in conjunction with examples. The following examples are provided as examples only, and the scope of protection of the present invention is not limited to these examples. Unless otherwise specified, the experimental methods in the following examples were those described in commonly used molecular biology, tissue culture techniques, and agricultural manuals. For example, specific steps can be found in "Molecular Cloning: A Laboratory Manual (3rd Edition)" (Sambrook, J., Russell, David W., 2001, Cold Spring Harbor) and "Plant Propagation by Tissue Culture" (Edwin F. George, Michael A. Hall, Geert-Jan De Klerk, 2008, Springer). Unless otherwise specified, the materials, reagents, equipment, etc. used in the following examples can be obtained from commercial sources.

[0184] Example 1: Design of predictable base substitutions introduced by programmed sequential cleavage / editing of the W574 and S653 sites of the Arabidopsis thaliana ALS gene. A. Experimental materials 1. Arabidopsis thaliana material Wild-type Arabidopsis thaliana Col-0 is a model variety of dicotyledonous plants. Its original seeds were provided by the Department of Weeds, College of Plant Protection, China Agricultural University, and its propagation and preservation were carried out in the inventors' laboratory in accordance with standard methods in this field.

[0185] 2. Vector Vector plasmids pCBC-dT1T2 (Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov 29;14(1):327; see https: / / www.addgene.org / 50590 / for details), pHEE401E (Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ Genome Biol. 2015 Jul 21; 16:144. doi: 10.1186 / s13059-015-0715-0. See https: / / www.addgene.org / 71287 / for specific information), and pHEE401E-NG (Nishimasu et al. We constructed the vector pHEE401E-NG, which can recognize NG PAM, by introducing a mutation into pHEE401E as reported in 2018 Engineered CRISPR-Cas9 nuclease with expanded Targeting space. Science 361(6408):1259-1262. doi: 10.1126 / science.aas9129. The vector was purchased from the Addgene website or constructed and maintained in our laboratory according to conventional molecular biological methods.

[0186] 3. Main equipment Pipette gun, water bath, PCR machine (Bio-rad T100), electrophoresis apparatus (WIX-EP600), gel imager, electric blast dryer, centrifuge (Eppendorf 5424R), high-throughput tissue layer, shaker, electronic balance, pH meter, etc.

[0187] 4. Main Reagents High-fidelity DNA polymerase (purchased from Tsingke Bio), agarose gel recovery kit and plasmid extraction kit (purchased from Sparkjade), BsaI and T4 DNA ligase (purchased from NEB), Trans5α-competent cells and EHA105-competent cells (purchased from TransGen Biotech, Beijing, China), GV3101 Agrobacterium-competent cells (purchased from Shanghai AngyuBio), Tris, EDTA, kanamycin, cephalosporin, hygromycin, agarose, yeast powder, tryptone, NaCl (purchased from Sangon Biotech), MS powder, sucrose, Silwet-77, hygromycin (purchased from Solarbio), nucleic acid dye (Dured), anhydrous ethanol (purchased from Sinopharm), etc.

[0188] 5. Preparation of the main solutions 1) Seed fungicide: Add 4 mL of 10% SDS, 20 mL of NaClO, and water to make a total volume of 200 mL. 2) SDS extraction buffer: Add 40 mL of 1 M Tris·HCl (pH 8.0), 50 mL of 0.1 M EDTA, 10 mL of 5 M NaCl, 10 mL of 10% SDS, and water to make a total volume of 200 mL. 3) Infection solution: Add 1.5 g of sucrose, 9 μL of Silwet-77, and 30 mL of ultrapure water. 4) LB solid medium: Add 5g yeast powder, 10g tryptone, 10g NaCl, 15g agar, and water to make 1L, sterilize at 121°C for 15 minutes, and pour into a plate for later use. 5) 50×TAE preservation solution: Add 242g of Tris, 37.2g of Na2EDTA·2H2O, and 800mL of ultrapure water, stir well to dissolve, add 57.1mL of acetic acid, stir well, and finally dilute to 1L with deionized water and store at room temperature. 6) MS solid medium: Weigh 4.42 g of MS powder and 10 g of sucrose, add 800 mL of ultrapure water, adjust to pH 5.8, add water to make 1 L, add 10 g of phytagel, sterilize at 121°C for 15 minutes, and pour into a plate for later use.

[0189] B. Experimental Method 1. Design and construction of a CRISPR / Cas9 dual target vector 1.1 Target design The Arabidopsis thaliana ALS gene is shown in Sequence ID No. 2. A 19-base target sequence gRNA1 (5'-GCATGGTTATGCAATGGGA-3') was designed using AGA near the Arabidopsis thaliana ALS574 site as the PAM. After editing, a deletion of one G base was predicted between the first 3-4 positions of the PAM. Subsequently, a second target sequence gRNA2 (5'-GGCATGGTTATGCAATGGA-3') was designed based on the sequence generated from this deletion. As shown in Figure 2, it was predicted that a single T base would be inserted by the second edit, thereby achieving the TGG-TTG conversion.

[0190] Similarly, a 19-base target sequence gRNA3 (5'-TGCCGATGATCCCGAGTGG-3') was designed using TGG near the Arabidopsis thaliana ALS653 site as the PAM. After editing, a deletion of one G base between positions 3 and 4 of the first PAM was predicted. Subsequently, a second target sequence gRNA4 (5'-TTGCCGATGATCCCGATGG-3') was designed based on the sequence generated from this deletion. As shown in Figure 2, it was predicted that a single A base would be inserted after the second editing, thereby achieving AGT-AAT conversion.

[0191] 1.2 Vector Construction We followed the method described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov 29;14(1): 327. Specifically, we constructed sgRNA expression cassettes using dT1T2 plasmids as templates for amplifying dual target fragments at ALS574 and 653 sites, respectively. The pHEE401E and pHEE401E-NG vector skeletons were digested with BsaI, and these bands were excised and recovered from the gel. These target fragments were then used directly for ligation after digestion. These vector skeletons and target fragments were ligated using T4 DNA ligase, and the ligated products were transformed into Trans5α-competent cells. Different monoclones were then harvested for sequencing. After confirmation by sequencing, recombinant plasmids were obtained using the Sparkjade High Purity Plasmid Mini Extraction Kit and were designated as pQY743 and pQY745, respectively.

[0192] 2. Design of primers for target detection Primers for target detection were centered on the ALS574 and ALS653 target sites. The primer for upstream detection was approximately 100 bp from the ALS574 target site, and the primer for downstream detection was approximately 280 bp from the ALS653 target site. The primer sequences were as follows: 574 / 653checking-F: 5'ATTGACGGAGATGGAAGCTT3', and 574 / 653checking-R: 5'CCAAACTGAGCCAGTCACAA3'.

[0193] 3. Establishment of a gene transformation system for Arabidopsis thaliana 3.1 Agrobacterium transformation The constructed recombinant plasmid was transformed into Agrobacterium GV3101 competent cells to obtain recombinant Agrobacterium cells.

[0194] 3.2 Preparation of Agrobacterium Infection Solution 1) Activated Agrobacterium were collected, inoculated into 30 ml of YEP liquid medium (containing 25 mg / L Rif and 50 mg / L Kan), and cultured overnight at 200 rpm at 28°C until the OD600 value reached approximately 1.0 to 1.5. 2) After centrifugation at 6000 rpm for 10 minutes, Agrobacterium was recovered and the supernatant was discarded. 3) The Agrobacterium was resuspended in the infection solution (no adjustment of H was necessary) to an OD600 of 0.8 for later use.

[0195] 3.3 Transformation of Arabidopsis thaliana 1) Before plant transformation, attention was paid to whether the plants were sufficiently grown, whether the inflorescences were abundant, and whether there was any stress response. The first transformation was performed when the plants reached a height of approximately 20 cm. Watering can be done as needed when the soil is dry. On the day before transformation, the mature siliques were cut off with scissors. 2) Immerse the inflorescence of the plant to be transformed in the above solution for 30 seconds to 1 minute while gently stirring, and ensure that a layer of liquid film forms on the immersed plant. 3) After transformation was complete, the plants were cultured in the dark for 24 hours, then removed and placed in a normal light environment for growth. 4) After one week, a second transformation can be performed in the same manner.

[0196] 3.4 Seed collection After the seeds matured, they were harvested. After harvesting, the seeds were dried in an oven at 37°C for about a week.

[0197] 4. Selection of transgenic plants The seeds are treated with a fungicide for 5 minutes, washed 5 times with deionized water, and spread uniformly on MS selective medium (containing 30 μg / mL hygromycin and 100 μg / mL cephalosporin). This medium is then placed in a light-field incubator (temperature 22°C, 16 hours light, 8 hours dark, light intensity 100-150 μmol / m²). 2 The seedlings were placed at 75% humidity and, after one week, selected seedlings that showed positive results were transplanted into soil.

[0198] 5. Detection of T1 mutant plants 5.1 Extraction of genomic DNA 1) Leaves of Arabidopsis thaliana were cut and placed in a 2 mL centrifuge tube, steel balls were added, and these leaves were ground using a high-throughput tissue riser. 2) After grinding was complete, 400 μL of SDS extraction buffer was added, mixed by inversion, incubated in a 65°C water bath for 15 minutes, and mixed by inversion every 5 minutes. 3) Centrifugation was performed at 13,000 rpm for 5 minutes. 4) Pipette 300 μL of supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol pre-cooled to -20°C, and leave the centrifuge tube at -20°C for 1 hour or overnight. 5) The mixture was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was discarded. 6) Add 500 μL of 70% ethanol to the centrifuge tube to wash the pellet, discard the washing solution after centrifugation (taking care not to discard the pellet), dry at room temperature, add 30 μL of ultrapure water to dissolve the DNA, and store the DNA at -20°C.

[0199] 5.2 PCR Amplification Using the extracted T1 plant genome as a template, the target fragment was amplified using detection primers. 5 μL of the amplified product was pipetteed and detected by 1% agarose gel electrophoresis, and an image was obtained using a gel imager. The remaining product was sent to a sequencing company for direct sequencing.

[0200] 6. Detection of T2 mutant plants After collecting T1 strain seeds from a single plant, seeds from two different vector strains were selected and spread on imazapick selective medium (MS medium + 0.24 μg / mL imazapick) for selection. After one week, positive seedlings were transplanted into soil and molecular detection was performed. This method was the same as in step 5.

[0201] Primers used and their sequences:

[0202] [Table 2]

[0203] C. Experimental Results 1. Genotype detection of T1 plants T1 seeds were selected using MS hygromycin-resistant medium. A total of 32 positive seedlings were obtained for the pQY743 vector, and a total of 18 positive seedlings were obtained for the pQY745 vector. Ten seedlings were selected for each vector, and genomic DNA was extracted from their leaves to detect target sites. In the T1 generation, no editing occurred at the ALS574 site, but an editing event consistent with the design prediction was found at the ALS653 site. The detection results are shown in Table 1.

[0204] [Table 3]

[0205] 2. Selection results of T2 generation seeds After collecting T2 generation seeds from a single plant, they were spread on imazapick-resistant medium and selected. As shown in Figure 3, wild-type Col-0 could not grow in this resistant medium, but mutant-positive plants could grow normally in this resistant medium.

[0206] Ten seedlings were selected for each vector, and their genomic DNA was extracted from the leaves for molecular detection. As shown in Figure 4, the pQY743 vector revealed six lines with isozygous mutations, i.e., mutations from TGG to TTG, as predicted. Furthermore, one line had heterozygous mutations, and three lines had chimeric mutations. The detection results are shown in Table 2.

[0207] [Table 4]

[0208] The results above demonstrate that by using the programmed sequential cleavage / editing technical solution of the present invention, it is possible to design and realize predicted mutations at target sites, and that base substitution mutations can only be realized when sequential sgRNA combinations are designed using the Cas9 protein.

[0209] Example 2: Achievement of multiple mutation types by programmed sequential cuts / edits at the W574 and S653 sites of the Arabidopsis thaliana ALS gene. The vector design, construction, and operational steps for transformation and selection of Arabidopsis thaliana were carried out with reference to Example 1. For the AtALS W574 site, the vector design was the same as in Example 1. A schematic diagram of the vector is shown in Figure 5, and it was predicted that the W574L mutation should be realized at the specific site first by -G and then by +T. No editing events were detected in the T1 generation of Arabidopsis thaliana transformed with the vector. Selection of the T2 generation of transgenic Arabidopsis thaliana with 0.24 mg / L imazapick yielded a large number of herbicide-resistant plants, as shown in the left panel of Figure 6. Molecular detection of these resistant plants, and PCR product sequencing results, as shown in the right panel of Figure 6, showed not only the predicted W574L mutation at the W574 site but also another resistance mutation, W574M.

[0210] The vector design for the AtALS S653 site was the same as in Example 1. The vector diagram is shown in Figure 7, and it was predicted that the S653N mutation should be realized first by -G and then by +A at the specific site. The predicted S653N editing event was not detected in the T1 generation of vector-transformed Arabidopsis thaliana. Continuous selection of the T2 generation of transgenic Arabidopsis thaliana with 0.24 mg / L imazapick yielded a large number of herbicide-resistant plants, as shown in the left panel of Figure 8. Molecular detection of these resistant plants, and PCR product sequencing results, as shown in the right panel of Figure 8, showed that not only was the predicted S653N mutation occurring at the S653 site, but also two other resistance mutations, S653R and S653R / G654D.

[0211] The results above also demonstrate that, by using the programmed sequential cleavage / editing technical solution of the present invention, multiple functional mutation types can be generated not only with respect to the target site, but also when sequential sgRNA combinations are designed using the corresponding Cas9 protein.

[0212] Example 3: Generation of W574M resistance mutations by using different PAMs to perform programmed sequential cuts / edits near the W574 region of the Arabidopsis thaliana ALS gene. AtALS W574 area sequence [ka] Regarding this, the design, construction, and transformation and selection of Arabidopsis thaliana were carried out in reference to Example 1, except that sgRNA1:5'CTTGGCATGGTTATGCAATG3' was designed using GG closer to the W574 site as the PAM (where the W574 site is underlined and the NG PAM is italicized). After cleavage and repair, the novel sequence was created by +A. [ka] It was predicted that the following would be generated. Using AG as a novel PAM site, sgRNA2:5'CTTGGCATGGTTATGCAAATGGGA3' was designed, and after spontaneous cell repair, the -G genotype was generated, resulting in W574M. In other words, in this scheme, different PAM sites were used for the two cleavages. The vector diagram is shown in Figure 9. Arabidopsis thaliana was transformed using the vector, and genotyping was performed on T1 generation transgenic lines, from which the predicted W574M editing event was detected, and the plants showed resistance to imazapick treatment.

[0213] These results demonstrate that by using the technical solutions of the present invention to perform programmed sequential cutting / editing and by using different PAMs, editing can be performed over a wider sequence range to obtain amino acid substitutions.

[0214] Example 4: Design of predictable base substitutions for the D350 and W548 sites of the rice ALS gene We constructed the pHUE411-NG vector, capable of recognizing NG PAM, by introducing a mutation similar to that reported in Nishimasu et al. 2018 Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361(6408):1259-1262. doi: 10.1126 / science.aas9129 into pHUE411 (A CRISPR / Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186 / s12870-014-0327-y, see details in https: / / www.addgene.org / 71287 / ).

[0215] The rice ALS gene sequence is shown in Sequence ID No. 12. 5'GGCGTGCGGTTTGAT GATBy targeting CG3' (the underlined portion was the OsALS-D350 site corresponding to Arabidopsis thaliana ALS-D376) and the novel sequence 5'GGCGTGCGGTTTGATGACG3' predicted to be generated from editing, a dual-target vector was constructed according to the method described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014, which was predicted to acquire GAT-GAA conversion and produce the OsALS D350E mutation.

[0216] 5'GGTATGGTTGTGCAA TGG By using GA3' (the underlined portion was the OsALS-W548 site corresponding to Arabidopsis thaliana ALS-W574) and the novel sequence 5'GGTATGGTTGTGCAATGGA3' predicted to be generated from editing as targets, a dual-target vector was constructed, which was predicted to acquire TGG-TTG conversion and produce the OsALS W548L mutation.

[0217] Next, these two vectors were introduced into rice plants to obtain transgenic plants, which were then identified. The results showed that the plants had the predicted substitutions D350E and W548L. Field herbicide resistance bioassays showed that the D350E and W548L mutants acquired resistance to ALS inhibitor herbicides.

[0218] Example 5: Design of predictable base substitutions and selection of multiple mutation types for the W2038 site of the rice ACCase2 gene The rice ACCase2 gene sequence is shown in Sequence ID No. 14. In the sequence, the OsACCase2 W2038 site corresponds to the ACCase W2027 site in *Epipactis thunbergii*. Using an AGG adjacent to this site as the PAM, sgRNA1: 5'TTCATCCTCGCTAAC-TGAG3' was designed, and it was predicted that a new sequence would be formed by -G after cleavage and repair. Using this AGG as the PAM again, sgRNA2: 5'CTTC-ATCCTCGCTAACTGAG3' was designed, and again, after cleavage and repair, the +T genotype was formed, resulting in the W2038L mutation. sgRNA1 and sgRNA2 were constructed on a pHUE411 vector to form an edited vector, and a diagram of this vector is shown in Figure 10.

[0219] Using this editing vector, callus from Huaidao No. 5 (rice variety) was transformed, and after 3 weeks of simultaneous selection with 50 μg / L hygromycin and 50 μg / L quizalop-p, numerous resistant calluses were obtained, as shown in the left panel of Figure 11. The resistant calluses were collected for genotyping, and it was found that not only the predicted W2038L mutation but also the W2038C mutation had occurred, as shown in the right panel of Figure 11.

[0220] The above results of programmed sequential cutting / editing of rice genes demonstrate that the technical solutions of the present invention are applicable to both monocotyledonous and dicotyledonous plants.

[0221] Example 6: Expression and purification of SpCas9 and NGA-Cas9 proteins 1. Laboratory equipment and reagents

[0222] [Table 5]

[0223] [Table 6]

[0224] 2. Experimental Method 2.1 Construction of pET15b-Cas9 expression vector The DNA sequences of the SpCas9 and NGA-Cas9 proteins obtained after optimization of plant codons are shown as SEQ ID NOs. 15 and 16, respectively, and these sequences were synthesized as template DNA using GenScript.

[0225] After amplifying the NG-Cas9 and NGA-Cas9 sequences respectively, the two fragments were ligated into a pET15b expression vector using the infusion method, transformed into DH5a, and then sequenced after confirmation.

[0226] [Table 7]

[0227] 2.2 Protein Expression and Purification The constructed expression vector was used to transform Escherichia coli Rosetta (DE3), and its expression was induced by IPTG. These bacteria were then isolated, lysed, and purified using a Ni-NTA column. The specific procedure was as follows: a) Recombinant expression vectors were transformed into Rosetta (DE3) strains, and single colonies were collected in 10 ml of LB medium, resistant to CmR+Amp (pET15b) or CmR+Kana (pET28a). The colonies were incubated overnight at 37°C at 200 rpm, transferred to a 2 L shaking flask containing 1 L of LB medium, incubated at 37°C at 200 rpm until the OD600 reached 0.6-0.8, cooled to 18°C, and expression was induced overnight with 0.5 mM IPTG. These bacteria were collected by centrifugation at 4000 g. b) The collected bacteria were resuspended in Ni-buffer A: 50 mM HEPES, pH 7.4, 500 mM NaCl, 20 mM imidazole, and 5 mM β-mercaptoethanol. A final concentration of 1 mM PMSF and 250 μl of a cocktail inhibitor were added, and the mixture was thoroughly mixed. c) The resuspended cells were disrupted using an ultrasonic disrupter and then centrifuged at 40,000 g for 30 minutes at 4 • C. The supernatant was collected and passed through a Ni-NTA column. d) Purification by Ni-NTA column: The lysate supernatant was combined with the resin for 20 minutes and eluted with buffer A containing 50 mM imidazole to remove impurities, and finally eluted with an elution buffer containing 400 mM imidazole. e) The purification effect of the protein was detected using an SDS-PAGE gel electrophoresis system. f) Dialysis was performed by changing this buffer to 50 mM HEPES pH 7.5, 150 mM KCl, 1 mM DTT, 3% glycerol. h) The final sample was subjected to SDS-PAGE gel electrophoresis to detect the purification effect of the protein. After concentration by ultrafiltration, the protein was frozen at -80 • C for later use.

[0228] 2.3 Expression and purification of Cas9 fusion protein The purification results of SpCas9 and NGA-Cas9 proteins are shown in Fig. 12. The arrow indicates the Cas9 protein band, indicating that higher purity was achieved.

[0229] Example 7: In vitro enzymatic cleavage activity of SpCas9 protein and NGA Cas9 protein detected at the OsACCase2 W2038 target site and the OsALS W548 target site, respectively. 1. The DNA sequences of the OsALS gene and the OsACCase2 gene were input into the CRISPOR online tool (http: / / crispor.tefor.net / ), and the following sgRNAs were designed for W548 of OsALS (corresponding to amino acid site 574 of the Arabidopsis thaliana ALS protein, the amino acid sequence of the rice ALS protein is shown in SEQ ID NO: 11) and W2038 of OsACCase2 (corresponding to amino acid site 2027 of the rice weevil, the amino acid sequence of the rice ACCase2 protein is shown in SEQ ID NO: 13). These sgRNAs were synthesized by GenScript.

[0230]

Chemical formula

[0231] 2. When the fragment containing the OsALS W548 target site was amplified using specific detection primers, OsALS265AA-F:5'ggtcttgcgtctggttggc3' and OsALS-end-R:5'ccatgccaagcacatcaaacaag3', the resulting PCR product was 1200 bp in length.

[0232] When fragments containing the OsACCase W2038 target site were amplified using specific detection primers, OsACC1750AA-F:5'gcgaagaagactatgctcgtattgg3' and OsACC2196AA-R:5'cttaatcacacctttcgcagcc3', the resulting PCR product was 1500 bp in length.

[0233] The PCR system is shown in the table below.

[0234] [Table 8]

[0235] 3. The PCR reaction was established, and the reaction conditions are shown in the table below.

[0236] [Table 9]

[0237] 4. The PCR products were detected by agarose gel electrophoresis, and sequencing was performed for further confirmation. After proper confirmation, the gel was excised and the DNA fragments were recovered. The recovered DNA fragments were dissolved by adding 30 µl of RNase-free ultrapure water, and their concentrations were measured.

[0238] 5. Cas9 protein activity was detected using the following detection system, and after the system was prepared, it was incubated at 37°C for 1 hour.

[0239] [Table 10]

[0240] 6. After the reaction was complete, the system was treated at 65°C for 10 minutes, 4 µl of 6× DNA loading buffer was added, and the mixture was flowed onto a 2% agarose gel to detect the band size.

[0241] The results are shown in Figure 13, and it can be seen that the purified Cas9 protein was only able to cleave the DNA double strand at the designed target site in the presence of sgRNA.

[0242] Example 8: Achievement of W548L mutation at the OsALS548 site by transforming rice protoplasts with two different targeted RNP complexes. 1. The preparation of rice protoplasts and PEG-mediated transformation were carried out based on a publicly available method (Bart et al., 2006), with some modifications. The specific preparation steps were as follows: (1) First, rice seedlings for protoplasts were prepared. The rice variety was Nipponbare. First, the rice seeds were threshed, rinsed with 75% ethanol for 1 minute, treated with 5% (v / v) sodium hypochlorite for 20 minutes, then washed five times with sterile water, placed on an ultraclean table and blow-dried, and then placed into tissue culture flasks containing 1 / 2 MS medium, with 20 seeds in each flask. Protoplasts were prepared by incubating the seeds at 26°C with 12 hours of light for approximately 10 days. (2) Select the leaf sheaths of seedlings, cut them into pieces about 1 mm long with a sharp Gillette razor blade, and place them in 0.6 M mannitol and MES culture medium (composition: 0.6 M mannitol, 0.4 M MES, pH 5.7) for later use. After cutting all the materials, transfer them to 20 mL of enzyme lysis solution (composition: 1.5% cellulase R10 / RS (YaKult Honsha), 0.5% macerozyme R10 (YaKult Honsha), 0.5 M mannitol, 20 mM KCl, 20 mM MES, pH 5.7, 10 mM CaCl2, 0.1% BSA, 5 mM β-mercaptoethanol), wrap them with aluminum foil, and place them on a shaker at 28 °C. Enzyme lysis was carried out in the dark at 50 rpm for about 4 hours, and the speed was increased to 100 rpm for the last 2 minutes. (3) After enzyme lysis, add an equal volume of W5 solution (composition: 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 15 mM MES), and shake horizontally for 10 seconds to release the protoplasts. Filter the cells obtained from enzyme lysis through a 300-mesh sieve, and centrifuge at 150 g for 5 minutes to recover the protoplasts. (4) Rinse these cells twice with W5 solution, and centrifuge at 150 g for 5 minutes to recover the protoplasts. (5) Resuspend the protoplasts in an appropriate amount of MMG solution (composition: 3.05 g / L MgCl2, 1 g / L MES, 91.2 g / L mannitol), and the protoplast concentration was about 2×10 6 cells / mL.

[0243] 2. Preparation of RNP complex: OsALS548 target site sequence [Chemical formula] (Underlined at the OsALS W548 site, corresponding to the Arabidopsis thaliana ALS W574, and the PAM site recognized by the Cas9 protein is shown in italic lowercase letters), the purified NGA-Cas9 protein was selected to prepare the RNP complex. Using GGA as the PAM, >CrRNA1-548-G: 5'-GGGUAUGGUUGUGCAA UGG GAguuuuagagcuaugcu-3' was designed, and it was predicted that after editing, one G base would be deleted between the first 3-4 positions of the PAM. Then, using the sequence resulting from the above deletion, a second >CrRNA2-548+T:5'-UGGGUAUGGUUGUGCAAUGGAguuuuagagcuaugcu-3' was designed, and it was predicted that after the second editing, one T base would be inserted to obtain the TGG-TTG conversion.

[0244] >CrRNA1-548-G and >CrRNA1-548+T were synthesized by GenScript Biotechnology Company, and the sgRNA was also synthesized by them.

[0245] [ka]

[0246] Following the instructions, the synthesized crRNA and GenCRISPR tracrRNA (GenScript SC1933) were mixed in equimolar amounts, crRNA & tracrRNA annealing buffer (GenScript SC1957-B) was added, and gRNA was prepared by annealing. The tracrRNA sequence was 5'-agcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuu-3'.

[0247] The RNP reaction system was prepared according to the table below, and after the system was prepared, it was incubated at 25°C for 10 minutes.

[0248] [Table 11]

[0249] 3. Transformation of protoplasts (1) Take 200 μl of the protoplast resuspended in MMG prepared above, add the RNP complex (20 μg Cas9 protein, 20 μg sgRNA) generated after incubation, and mix well by gently tapping. (2) Add an equal volume of 40% (w / v) PEG solution (composition: 40% (w / v) PEG, 0.5 M mannitol, 100 mM CaCl2), gently tap to mix well, and let stand at 28°C in the dark for 15 minutes. (3) After induction and transformation, 1.5 mL of W5 solution was slowly added, and the cells were thoroughly mixed by gently tapping. These cells were then collected by centrifugation at 150 g for 3 minutes. This process was repeated once. (4) These cells were resuspended by adding 1.5 mL of W5 solution and incubated in a 28°C incubator in the dark for 12–16 hours. If these cells are to be used for protoplast genomic DNA extraction, they must be incubated for 48–60 hours.

[0250] 4. Detection of genome target editing events (1) Protoplast DNA was extracted using a modified CTAB method, which is described in detail below: The protoplasts were centrifuged, the supernatant was discarded, 500 μL of DNA extraction solution was added, shaken and mixed well, and incubated in a 65°C water bath for 1 hour; after incubation in the water bath, the sample was cooled, an equal volume of chloroform was added, the mixture was inverted several times and mixed well, and the sample was centrifuged at 10,000 rpm for 10 minutes; 400 μL of supernatant was taken and transferred to a new 1.5 mL centrifuge tube, 1 mL of 70% (v / v) ethanol was added, and the mixture was allowed to stand at -20°C for 20 minutes to settle; the DNA was allowed to settle by centrifugation at 12,000 rpm for 15 minutes, the precipitate was dried in air, and then dissolved by adding 50 μL of ultrapure water, and stored at -20°C for later use.

[0251] (2) Using gene-specific primers, the fragment containing the W548 target site was amplified, and the following detection primers were designed for the target site. [ka]

[0252] The PCR reaction system is shown in the table below.

[0253] [Table 12]

[0254] (3) The PCR reaction was established, and the general reaction conditions are shown below.

[0255] [Table 13]

[0256] (4) Detection was performed by agarose gel electrophoresis, PCR fragments were recovered, and sequences were determined.

[0257] 5. Experimental results: Active RNP complexes with purified NGA-Cas9 protein were formed using gRNA prepared by annealing with synthetic crRNA and tracrRNA, or by directly using synthetic sgRNA. Sequencing of the OsALS548 targeting site detected a TGG to TTG mutation, demonstrating that site-specific mutations at the target site could be achieved in cells by programmed sequential cleavage / editing generated from RNP complexes combined with crRNA or sgRNA in a specific sequence. In the protoplast OsALS548 target sequencing peak diagram in Figure 14, as indicated by the arrows, a T base signal peak generated from this mutation was also present in addition to the initial G base signal peak, indicating a W548L mutation at the OsALS548 site.

[0258] Example 9: Achievement of W2038L mutation at the OsACCase2 W2038 site by rice callus impact using two different targeted RNP complexes 1. Preparation of RNP complex: OsACCase2 W2038 target site sequence [ka] Following the instructions (where the OsACCase2 W2038 region corresponding to the rhinoceros accus W2027 is underlined and the PAM region recognized by the Cas9 protein is shown in italicized lowercase), purified SpCas9 protein was selected to prepare the RNP complex. Using GGA as the PAM, >CrRNA1-2038-G:5'-GUUCAUCCUCGCUAACUGGAGguuuuagagcuaugcu-3' was designed, with the expectation that one G base would be deleted between the first 3-4 positions of the PAM after editing. Then, using the sequence resulting from this deletion, a second >CrRNA2-2038+T:5'-UGUUCAUCCUCGCUAACUGAGguuuuagagcuaugcu-3' was designed, with the expectation that one T base would be inserted after the second editing to obtain the TGG-TTG conversion.

[0259] >CrRNA1-2038-G and >CrRNA2-2038+T were synthesized by GenScript Biotechnology Company, and sgRNA was also synthesized. [ka]

[0260] Following the instructions, the synthesized crRNA and GenCRISPR tracrRNA (GenScript SC1933) were mixed in equimolar amounts, crRNA & tracrRNA annealing buffer (GenScript SC1957-B) was added, and gRNA was prepared by annealing.

[0261] The RNP complex was prepared by incubation in the same reaction system as in Example 8. For example, the amount of 10 gene gun strikes for transformation is: 20 μg of Cas9 protein, 20 μg of gRNA or sgRNA, and 10 μl of 10×Cas9 reaction buffer are added to a total of 100 μl of RNase-free ultrapure water, incubated at 25°C for 10 minutes, and gently mixed.

[0262] 2. Induction of rice callus Mature and well-developed rice seeds were selected, threshed, and disinfected according to the following process. (1) The rice seeds were threshed, and the rice variety was Huaidao No. 5, which was purchased from the seed market. (2) The seeds were washed with sterile water, as many times as necessary, until the water ran clear. (3) After sterilizing with 70% alcohol for 1 minute, the seeds were placed in 10% sodium hypochlorite on a horizontal shaker and incubated under shaking for 25 minutes. (4) After disinfection with sodium hypochlorite, the seeds were washed five times with sterile water. These seeds were sown in callus induction medium (composition: MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + phytagel (4 g / L)) and cultured in the dark at 28°C to induce callus.

[0263] 3. Genetic Gun RNP Impact: (1) Hypertonic culture Callus with good embryogenesis potential was transferred to hypertonic medium (composition: MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + D-mannitol (0.4 M)) + phytagel (4 g / L)), sterile procedures were performed in an ultraclean bench, and incubation was carried out in the dark at 25°C for 4 to 6 hours. (2) Preparation of gold powder suspension: Using an imported 1.5 mL EP tube, 30 mg of gold powder (0.6 μm in diameter) was weighed; 1 mL of 70% ethanol was added, and the mixture was thoroughly mixed by vortexing and left to stand on ice for 10 minutes. After centrifugation for 1 minute, the supernatant was discarded; 1 mL of sterile water was added, the mixture was thoroughly mixed by vortexing, and the mixture was centrifuged for 1 minute, the supernatant was discarded, and the above procedure was repeated three times. 500 μL of sterile glycerol (50%) was added, and the mixture was thoroughly mixed by vortexing to prepare a gold powder suspension at a concentration of 60 μg / μl, which was stored at -20°C. (3) Take 50 μl of gold powder suspension (60 μg / ml), add 100 μl of the prepared RNP complex, and mix gently. (4) Take 15 μl of the RNP / gold powder mixture and place it in the center of the cleavable membrane of the PDS-1000 benchtop gene gun (Bio-Rad), blow dry it, and then shock it according to the instrument's instructions. Impact parameters: The vacuum level was 26-28, the distance was 6 cm, and the air pressure was 1100 psi or 1350 psi. (5) After the shock treatment was complete, the callus was cultured in hypertonic medium at 25°C overnight in the dark (16 hours).

[0264] 4. Selection, differentiation, and rooting: (1) After the impacted callus was cultured overnight, it was transferred to induction medium and cultured at 28°C for one week. (2) After 1 week of regeneration, the callus was transferred to a selective medium (composition: 4.1 g / L N6 powder + 0.3 g / L casein hydrolysate + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 50 ug / L quizalopop-p + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% phytagel, pH 5.8) and selected for 3-4 weeks; 50 ug / L quizalopop-p was used for selection for predictive editing of OsACCase2 W2038, as shown in Figure 15. (3) Selected resistant calluses with good growth status were transferred to differentiation medium (composition: MS powder (4.42 g / L) + KT (1 mg / L) + sucrose (30 g / L) + phytagel (4.5 g / L) + 50 ug / L quizalopop-p, pH 5.8) and cultured under illumination at 28°C for 2 to 4 weeks to induce differentiation. (4) Differentiated seedlings were transferred to a rooting medium (composition: 1 / 2 MS powder (2.3 g / L) + sucrose (30 g / L) + phytagel (4.5 g / L)) for rooting, and after rooting was complete the seedlings were strengthened, then transplanted into pots filled with soil and moved to a greenhouse for cultivation.

[0265] 5. Detection of targeted editing events in resistant callus and T0 tissue culture seedlings: A total of 11 resistant calluses were obtained from the selection, and their DNA was extracted by CTAB. Detection primers for the target site were designed as follows: OsACC2038test-F: 5'CTGTAGGCATTTGAAACTGCAGTG3', OsACC2038test-R: 5'GCAATCCTGGAGTTCCT-CTGACC3'. PCR fragments containing the OsACCase2 W2038 site were amplified, recovered, and sequenced. Sequencing detection showed that 10 of them had a TGG-to-TTG mutation at the OsACCase2 W2038 site, and 3 samples were isozygous mutants.

[0266] Regarding T0 generation tissue culture seedlings obtained by resistant callus differentiation, their DNA was extracted to detect editing target site sequences, and as shown in Figure 16, a type-matching mutation from TGG to TTG was also present at the OsACCase2 W2038 site.

[0267] 6. Resistance testing of T1 generation seedlings to ACCase inhibitor herbicides After propagating the T0 line containing the W2038L mutation, T1 generation mutant seedlings were tested for herbicide resistance using field concentrations of quizalopop-p and haloxyhop-p. As shown in Figures 17-18, the OsACCase2 W2038L mutant line was found to be significantly resistant to these two ACCase inhibitor herbicides.

[0268] In summary, an active RNP complex with purified SpCas9 protein can be formed using gRNA prepared by annealing with synthetic crRNA and tracrRNA, or by directly using synthetic sgRNA; callus that has undergone gene gun shock can be selected by using kizarohop-p during the tissue culture stage; isozygous mutations from TGG to TTG can be detected by sequencing of the OsACCase2 W2038 target site in T0 generation tissue culture seedlings; this mutation is inheritable to the T1 generation and exhibits resistance to ACCase inhibitor herbicides; this further demonstrates that programmed sequential cleavage / editing generated from RNP complexes combined with sequentially targeted crRNA or sgRNA can achieve site-specific mutations at target sites in cells, induce the production of intracellular selection markers for tissue culture selection, and thereby create herbicide-resistant crops.

[0269] Example 10: Different targeted RNP complexes simultaneously edit the OsACCase2 W2038 site and the OsBADH2 gene in rice callus. The RNP complex was prepared according to the method described in Example 8, and the gene gun strike and tissue culture procedures were the same as those in Example 9. In addition to a crRNA or sgRNA targeting the OsACCase2 W2038 site, a crRNA or sgRNA targeting the OsBADH2 gene was added simultaneously, and these were incubated with the SpCas9 protein to form a targeted RNP complex for the second target gene, OsBADH2. After gene gun strike, regeneration culture, screening, differentiation, and rooting, T0 generation tissue culture seedlings were obtained, and after propagation, the T1 generation was obtained.

[0270] The rice OsBADH2 genome sequence is shown in Sequence ID No. 17. The target site sequence was determined using the CRISPOR online tool (http: / / crispor.tefor.net / ). [ka] (Here, the PAM site recognized by the Cas9 protein is shown in lowercase italics.) We selected the purified SpCas9 protein and prepared the RNP complex. Using CGG as the PAM, we designed >CrRNA1-OsBADH2:5'-CCAAGUACCUCCGCGCAAUCGguuuuagagcuaugcu-3' and predicted that OsACCase2 W2038L resistance mutations and OsBADH2 knockout mutation events could be simultaneously detected in the resistant callus obtained by selecting kizarophop-p.

[0271] CrRNA1-OsBADH2 was synthesized by GenScript Biotechnology Company, and the sgRNA was also synthesized by them. [ka]

[0272] As shown in Figure 19, resistant calluses were selected according to the transformation process of Example 9, and the sequences of OsACCase2 and OsBADH2 target sites in the callus and T0 generation tissue culture seedlings were determined after differentiation and seedling emergence. The OsBADH2 target detection primers were as follows: [ka]

[0273] As a result, a total of 13 resistant calluses were obtained by selection, of which OsACCase2 W2038L mutation events were detected in 11 calluses. Detection of OsBADH2 target sequences in these 11 callus samples indicated that 8 of them simultaneously contained editing events at the OsBADH2 target site. In the T0 generation tissue culture seedlings obtained by differentiation, the presence of OsACCase2 W2038L mutations and OsBADH2+A isozygous mutations was detected, as shown in Figures 20-21.

[0274] In summary, we performed site-directed editing of OsACCase2 W2038 by genetic gun shock to rice calluses with a series of targeted crRNA-targeted or sgRNA-targeted RNP complexes, while simultaneously adding a targeted RNP complex targeting a second target gene, OsBADH2. Callus selection was performed using kizarohop-p during the tissue culture stage; 61% of resistant calluses simultaneously induced OsACCase2 W2038 mutations and targeted knockout of OsBADH2, and lines containing isozygous mutations of OsBADH2 were detected in T0 generation tissue culture seedlings. These findings demonstrate that combining sequential cleavage / editing with RNP transformation for site-directed editing of resistance genes can generate endogenous selection markers, enrich the corresponding selection pressures to simultaneously screen for editing events of the second target gene, thereby achieving site-directed genome editing by non-transgenic means.

[0275] Example 11: Different targeted RNP complexes simultaneously edit the OsALS548 site and the OsSWEET14 gene in rice callus. The targeted RNP complex for the OsALS548 site was prepared according to the method described in Example 8, and the crRNA and sgRNA sequences were the same as those in Example 8. [ka]

[0276] Referring to Example 8, gRNA or sgRNA was incubated with NGA-Cas9 to prepare an RNP complex targeting the OsALS548 site.

[0277] In addition to a targeted RNP complex for the OsALS548 site, crRNA or sgRNA for the OsSWEET14 gene was simultaneously added and incubated with the SpCas9 protein to form a targeted RNP complex for a second target gene, OsSWEET14. T0 generation tissue culture seedlings were obtained by gene gun shock, regeneration culture, selection, differentiation, and rooting, and the T1 generation was obtained by propagation. The selective pressure was 5 mg / L piroxisram.

[0278] The genome sequence of rice OsSWEET14 is shown in Sequence ID No. 18. The target site sequence was determined using the CRISPOR online tool (http: / / crispor.tefor.net / ). [ka] (Here, the PAM site recognized by the SpCas9 protein is shown in lowercase italics) was selected, and the purified SpCas9 protein was selected for the preparation of the RNP complex. Using GGG as the PAM, the following was designed: [ka] It was predicted that resistance mutations of OsALS W548L and knockout mutations of OsSWEET14 could be simultaneously detected in resistant callus obtained by selecting pyroxislam.

[0279] >CrRNA1-Os SWEET14 was synthesized by GenScript Biotechnology Company, and the sgRNA was also synthesized by them. [ka]

[0280] Resistant calluses were selected according to the gene gun shock and tissue culture procedure described in Example 9, as shown in Figure 22. The resistant calluses were then selected for differentiation and seedling emergence. The selection medium consisted of 4.1 g / L N6 powder + 0.3 g / L casein hydrolysate + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 5 mg / L piroxislam + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% phytagel, pH 5.8.

[0281] The sequences of the OsALS548 site and the OsSWEET14 target site in callus and T0 generation tissue culture seedlings were determined. The OsSWEET14 target site detection primers were as follows: [ka]

[0282] As a result, a total of nine resistant calluses were obtained by selection, of which OsALS W548L mutation events were detected in eight calluses. Detection of the OsSWEET14 target sequence in these eight callus samples indicated that five of the calluses contained editing events at the OsSWEET14 target site. In the T0 generation tissue culture seedlings obtained by differentiation, both OsALS W548L mutations and OsSWEET14-C isozygous mutations were detected, as shown in Figures 23-24.

[0283] After propagating the T0 line in which the OsALS W548L mutation was detected, herbicide resistance was tested on the T1 generation mutant seedling lines using field concentrations of pyroxislam, imazapic, nicosulfuron, and flucarbazone-Na. As shown in Figures 25-28, the OsALS W548L mutant lines showed significant resistance to all four of these ALS inhibitor herbicides.

[0284] In summary, an active RNP complex with purified SpCas9 protein can be formed using gRNA prepared by annealing with synthetic crRNA and tracrRNA, or by directly using synthetic sgRNA; site-directed mutations at target sites in cells can be achieved by programmed sequential cleavage / editing generated from a combination of the RNP complex and a series of targeted crRNAs or sgRNAs; selection of callus with gene gun shock can be performed using pyroxislam at the tissue culture stage; sequencing of the OsALS548 target site in T0 generation tissue culture seedlings detected a TGG to TTG mutation, which is inheritable to the T1 generation and exhibits resistance to ALS inhibitor herbicides.

[0285] After rice callus was subjected to gene gun shock, callus selection was performed using pyroxislum during the tissue culture stage by simultaneously adding a targeted RNP complex targeting the second target gene OsSWEET14 and using the SpCas9 protein that recognizes NGG PAM. 55% of resistant callus simultaneously showed the OsALS W548L mutation and targeted knockout of OsSWEET14. The presence of isozygous mutations of OsSWEET14 could be detected in T0 generation tissue culture seedlings. This further demonstrated that endogenous selection markers can be generated by a combination of programmed sequential cleavage / editing and site-specific editing of the resistance gene generated from PNP transformation. The editing event of the second target gene can be simultaneously selected by using Cas9 proteins that recognize different PAM sites and adding corresponding selection pressures, thereby demonstrating that site-specific editing of the genome can be achieved by non-transgenic means.

[0286] Example 12: Generation of W561L mutation at the StALS561 site by impacting potato (Solanum tuberosum L.) explants with two different targeted RNP complexes. The amino acid sequence of the potato StALS2 protein is shown in SEQ ID NO: 19, and the sequence of the potato StALS2 gene is shown in SEQ ID NO: 20. For methods of preparing the RNP complex and for gene gun strike, refer to Examples 8-9. The sgRNAs for the original sequence and the designed edited sequence of the StALS2W561 site of potato StALS2, corresponding to the Arabidopsis thaliana ALS574 site, were as follows. [ka]

[0287] The RNP complex was then prepared according to the method described in Example 8.

[0288] The recipient potato varieties were Atlantic or Favorita, with leaves, stems, and axillary buds used as explants, respectively. The methods for gene gun impact, selection, and differentiation were as follows: (1) Leaves: Whole leaves were cut off and spread flat on hypertonic M6 medium (composition: 4.42 g / L MS powder + 1 ml / L vitamin B5 (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 0.2 M mannitol + 250 mg / L Cef), with approximately 5-6 leaves used per impact shot. After 24 hours of pre-incubation, impact with gold powder was performed. After shock, they were cultured in hypertonic M6 medium in the dark for 2 days, then transferred to M6 medium (4.42 g / L MS powder + 1 ml / L B5 vitamin (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 250 mg / L Cef), cultured for 1 week, then transferred to M6 medium under selective pressure after 1 week, and 20 μg / L chlorsulfuron (composition: 4.42 g / L MS powder + 1 ml / L B5 vitamin (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin riboside + 250 mg / L Resistant calluses were selected using a selective pressure of Cef (20 μg / L chlorsulfuron), and after 4 weeks, these were transferred to seedling induction medium R4 containing the selective pressure (composition: 4.42 g / L MS powder + 1 ml / L B5 vitamin (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L GA3 + 0.8 mg / L zeatin riboside + 250 mg / L Cef (20 μg / L chlorsulfuron) until seedlings appeared.

[0289] (2) Stems: Potato stems (excluding axillary buds) were collected, cut lengthwise with the cut end facing upwards, and placed in CIMI medium (4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L zeatin nucleoside + 2 mg / L 2,4-D + 250 mg / L Cef + 20 μg / L chlorsulfuron). Gene gun shock was then performed, and the stems were cultured in the dark for 1 day after the shock. These stems were then transferred to fresh CIMI medium and cultured for 1 week. After that, these stems were transferred to CIMI medium containing selective pressure (composition: 4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 1 mg / L zeatin riboside + 0.1 mg / L GA3 + 250 mg / L Cef + 20 μg / L chlorsulfuron), and selection was performed for resistant seedlings until seedlings appeared.

[0290] (3) Axillary buds: Axillary buds are collected from potato stems, cut lengthwise, and transferred to CIMI medium. The seedlings were placed in CIMI medium with the cut end facing upwards, then subjected to gene gun shock, cultured in the dark for one day after shock, transferred to fresh CIMI medium, cultured for one week, and then transferred to CIMI medium containing selective pressure, where selection was performed for resistant seedlings until seedlings appeared.

[0291] The detection primers for the StALS2 W561 site were as follows: [ka]

[0292] Following detection, a W561L editing event was observed at the StALS2 W561 site in resistance screening T0 generation potato tissue culture seedlings, demonstrating that the non-transgenic transient gene editing method provided by the present invention is suitable for crops such as potatoes, where it may be difficult to isolate and remove exogenous transgenic elements by self-pollination or crossbreeding.

[0293] Example 13: Successful use of a programmed sequential cleavage / editing scheme for base substitution in human 293T cells The HBB (hemoglobin subunit β) gene from human fetal kidney cell 293T (its DNA sequence is shown in SEQ ID NO: 21, its CDS sequence in SEQ ID NO: 22, and its amino acid sequence in SEQ ID NO: 23) was selected, and a target site for sequential cleavage / editing of the sgRNA was designed within the region of the first exon, with this first target being catggtgcaCctgactcctg AGG This was the case. The sgRNA that recognizes this target was called sgHBB, and it was predicted that a deletion of one C base could be generated at the sgRNA cleavage site at this location. The second target is ccatggtgcatctgactctg that recognizes a sequence having a deletion of one C base generated from the cleavage / editing of the first target. AGG This target sgRNA was named sgHBB-c. An sgRNA without a target site was designed in 293T cells, named sgNOTAR, and used as the complementary plasmid for transfection in this experiment.

[0294] Following the design described above, complementary single-stranded DNA fragments were synthesized. After annealing, they were ligated to the px458 (addgene:48138) plasmid digested with BbsI enzyme and transformed into E. coli DH5a competent cells. After sequencing the resulting single E. coli colonies, the plasmids were extracted and purified using an endotoxin-free plasmid extraction kit (Tiangen Bio).

[0295] Vigorous 293T cells were digested, isolated with 0.05% trypsin (Gibico), diluted in DMEM medium (10% fetal bovine serum; penicillin + streptomycin biresistant), seeded in 24-well culture plates, and incubated overnight in a carbon dioxide incubator. The following day, these were mixed separately according to serial cleavage / editing: 0.5 ug each of sgHBB and sgHBB-c plasmids; single-target cleavage / editing: 0.5 ug each of sgHBB and sgNOTAR plasmids; and untargeted control: 1 μg of pEGFP-c1 plasmid. Transformation was performed with lipofectamine 3000 (Invitrogen). Each group consisted of 3 replicates.

[0296] 48 hours after transformation, the transformation efficiency was recorded by taking photographs with a fluorescence microscope, and the total DNA in each well was extracted using a nucleic acid extraction kit (Omega).

[0297] The Hi-tom sequencing primers designed were as follows: [ka]

[0298] PCR was performed on each DNA sample using these primers. High-throughput sequencing of the PCR products was performed using the Hi-tom method (Sci China Life Sci. 2019 Jan;62(1):1-7. doi: 10.1007 / s11427-018-9402-9).

[0299] Statistical data from the sequencing results are shown in Tables 6 and 7. These data indicate that sequential cleavage / editing methods at the HBB site resulted in C-to-T editing (resulting in P6S mutations) in approximately 1.67% of cases, while single-target cleavage / editing methods were unable to produce such base substitutions.

[0300] [Table 14]

[0301] [Table 15]

[0302] Furthermore, both sickle cell anemia and β-thalassemia are hereditary anemias caused by mutations in the HBB gene, which codes for the β-subunit of hemoglobin in adults. Patients with these diseases may require blood transfusions or other therapies throughout their lives. The results of the above experiments demonstrate that, with respect to the mutation site of the HBB gene, a combination of crRNA or sgRNA can be designed by a technical solution of programmed sequential cut / editing, as provided by the present invention, to induce predicted repair of the mutation site, resulting in cells producing active hemoglobin, restoring function, and thereby achieving a therapeutic effect. In other words, the compositions provided by the present invention have applications in the treatment of diseases.

[0303] After conducting various tests simultaneously, it was found that this novel method is entirely based on the existing functions of Cas9, and therefore the method of the present invention is fully applicable to achieving novel functions of base substitution, deletion, and insertion of specific fragments in other organisms (such as plants, animals, fungi, or bacteria) in which Cas9 can function adequately.

[0304] All publications and patent applications described herein are incorporated by reference in the same manner as each publication or patent application is incorporated by specific reference.

[0305] For a clear understanding, the present invention has been described in more detail above by examples and embodiments, but it is clear that certain changes and modifications can be made within the scope of the appended claims, and all such changes and modifications are within the scope of the present invention.

Claims

1. A method for creating a novel mutation in an organism, comprising the steps of: successively creating two or more DNA breaks at specific locations in the genome of the organism; and spontaneously repairing each of them, wherein the later DNA break is generated based on a novel sequence generated from the repair of the previous DNA break.

2. The method according to claim 1, wherein the "DNA cleavage" is achieved by delivering a nuclease having targeting properties to the cells of the organism and bringing it into contact with a specific site of genomic DNA.

3. The method according to claim 2, wherein the "nuclease having targeting properties" is ZFN, TALEN, or a CRISPR / Cas system.

4. The method according to any one of claims 1 to 3, wherein the "sequential creation of two or more DNA breaks at a specific site" is configured such that a novel ZFN or TALEN protein re-cleaves the site based on a novel sequence generated by a previous DNA break repair event produced by ZFN or TALEN editing.

5. The method according to any one of claims 1 to 3, wherein the "sequential creation of two or more DNA breaks at a specific site" is configured such that a new target RNA is designed to re-cleave that site based on a novel sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system.

6. The method according to any one of claims 1 to 4, wherein the "two or more DNA breaks" are produced by successively delivering different targeted nucleases to recipient cells of different generations, and the mutant cells that have completed the previous edit are used as recipients to receive the delivery of the targeted nuclease for the later edit, thereby performing a second edit to generate a site-directed mutation.

7. The method according to any one of claims 1 to 3 and 5, wherein the "two or more DNA breaks" are produced by delivering different targeted nucleases for different targets to the same recipient cell.

8. The method according to any one of claims 1 to 3, 5, and 7, wherein the "two or more DNA cuts" are produced when an RNP complex formed by the same CRISPR / Cas nuclease having different gRNAs or sgRNAs respectively sequentially cuts the corresponding target sequence.

9. The method according to any one of claims 1 to 3, 5, and 7, wherein the "two or more DNA breaks" are produced when RNP complexes, each individually formed by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences.

10. The method according to claim 7, wherein the targeted nuclease is any CRISPR / Cas nuclease capable of performing genome editing.

11. The method according to claim 6 or 7, wherein the targeted nuclease is in the form of DNA.

12. The method according to any one of claims 7 to 9, wherein the targeted nuclease is in the form of mRNA or protein, rather than DNA.

13. The method according to claim 6 or 7, wherein the method for delivering the targeted nuclease to cells is selected from 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun shock; or 6) Agrobacterium-mediated transformation.

14. A novel mutation obtained by the method described in any one of claims 1 to 13.

15. A protein or a biologically active fragment thereof having the novel mutation described in claim 14.

16. A nucleic acid comprising a nucleic acid sequence or complementary sequence encoding the protein or a biologically active fragment thereof as described in claim 15.

17. (a) Nucleotide sequence encoding the target RNA A nucleic acid comprising, wherein the target RNA comprises at least two target RNAs, the first target RNA targeting a certain DNA and causing a cleavage in that DNA, and the latter target RNA targeting a sequence generated from the previous cleavage repair event and causing another cleavage.

18. (b) The nucleic acid according to claim 17, further comprising a nucleotide sequence encoding a Cas polypeptide.

19. The nucleic acid according to claim 17 or 18, wherein the target RNA is sgRNA or gRNA.

20. The nucleic acid according to any one of claims 17 to 19, wherein the Cas polypeptide and target RNA are present in in vitro cells or ex vivo cells.

21. A recombinant expression vector comprising a nucleic acid according to any one of claims 16 to 20 and a promoter functionally linked thereto.

22. Expression cassette comprising nucleic acid according to any one of claims 16 to 20

23. A host cell comprising the expression cassette described in claim 22.

24. An organism regenerated from a host cell according to claim 23.

25. A method for lysing target DNA, comprising contacting the target DNA with a complex, wherein the complex is (a) Cas polypeptide; and (b) at least two target RNAs, where the first target RNA targets the DNA and causes a break in that DNA, and the latter target RNA targets a sequence generated from the previous break repair event and causes another break. A method that includes the following:

26. The method according to claim 25, wherein the target RNA is sgRNA or gRNA.

27. The method according to claim 25 or 26, wherein the target DNA is present in bacterial cells, eukaryotic cells, plant cells, or animal cells.

28. The method according to any one of claims 25 to 27, wherein the target DNA is chromosomal DNA.

29. The method according to any one of claims 25 to 28, wherein the Cas polypeptide and target RNA are present in in vitro cells or ex vivo cells.

30. The method according to any one of claims 25 to 29, wherein contact comprises introducing into the cells: (a) a Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) a target RNA or a DNA polynucleotide encoding the target RNA.

31. (a) Cas polypeptide, or polynucleotides encoding the Cas polypeptide; and (b) at least two target RNAs, or DNA polynucleotides encoding those target RNAs, where the first RNA targets a DNA molecule and causes a cleavage in it, and the latter target RNA targets a sequence generated from the previous cleavage repair event and causes another cleavage. A composition comprising the following.

32. The composition according to claim 31, wherein the target RNA is sgRNA or gRNA.

33. The composition according to claim 31 or 32, wherein the Cas polypeptide and the target RNA are present in in vitro cells or ex vivo cells.

34. A composition according to any one of claims 31 to 33, for the manufacture of a drug for the treatment of a disease.

35. (a) Cas polypeptide, or nucleic acid comprising a nucleotide sequence encoding the Cas polypeptide; and (b) A nucleic acid comprising at least two target RNAs, or nucleotide sequences encoding those target RNAs, wherein the first RNA targets a DNA molecule and causes a cleavage in that DNA, and the latter target RNA targets a sequence generated from a previous cleavage repair event and causes another cleavage; A kit comprising (a) and (b) in the same or different containers.

36. The kit according to claim 35, wherein the target RNA is sgRNA or gRNA.

37. The kit according to claim 35 or 36, wherein the target RNA of (b) is in the same or a different container.

38. A method for screening editing events that are independent of exogenous transgenic markers, comprising the following steps: 1) A process in which two or more DNA breaks are successively created at specific sites in the sequence of the first target gene in the recipient cell, each of which is spontaneously repaired, and subsequent DNA breaks are generated based on a novel sequence created from the repair of the previous DNA break; 2) A process in which a specific site of a first target gene is sequentially cleaved and repaired, followed by a specific editing event that can confer resistance to a particular selective pressure to the mutant cell, thereby creating a phenotypic selectable trait, and the corresponding selective pressure is applied to perform selection with respect to that trait, and a cell, tissue, organ, or complete organism containing such editing events is isolated; 3) Depending on the case, in order to simultaneously edit another target site, a targeted nuclease is used against at least one second target gene in addition to the first target gene, the editing events of the second target gene are enriched, and the cells, tissues, organs or complete organisms are isolated, which are synchronously screened through screening of selectable traits generated by mutations in the first target gene and the editing events of at least one second target gene simultaneously. A method that includes the following:

39. The method according to claim 38, wherein the "first target gene" is a locus encoding at least one phenotypic selectable trait, and the at least one phenotypic selectable trait is a resistance / tolerance trait or a trait advantageous for growth.

40. The method according to claim 38 or 39, wherein “a specific site of the first target gene” refers to a site where a particular type of mutation is generated, which, after sequential breaks and repairs, can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

41. The method according to claim 40, wherein the "certain type of mutation" includes a single base substitution, a multi-base substitution, or an insertion or deletion of an unspecified number of bases.

42. The method according to any one of claims 38 to 41, wherein the “certain selective pressure” is an ambient pressure or a pressure arising from an added compound, the ambient pressure is preferably high temperature, low temperature or low oxygen, and the pressure arising from an added compound is preferably a pressure arising from salt ion concentration, an antibiotic, a cytotoxin or a herbicide.

43. The method according to any one of claims 38 to 42, wherein the "DNA cleavage" is achieved by delivering a nuclease having targeting properties to the cells of an organism and bringing it into contact with a specific site of genomic DNA.

44. The method according to claim 43, wherein the "nuclease having targeting properties" is any CRISPR / Cas nuclease capable of performing genome editing.

45. The method according to any one of claims 38 to 44, wherein the characteristic "two or more DNA breaks are successively created at a specific site in the sequence" means that a new target RNA is designed to re-cleave that site based on a new sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system.

46. The method according to any one of claims 38 to 45, wherein the "two or more DNA cleavages" are produced when RNP complexes formed by the same CRISPR / Cas nuclease, each having different gRNAs or sgRNAs, successively cleave the corresponding target sequences.

47. The method according to any one of claims 38 to 45, wherein the "two or more DNA breaks" are produced when RNP complexes, individually formed by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences.

48. The method according to any one of claims 38 to 47, wherein the "second target gene" refers to a different gene that has a different coding from the first target gene.

49. The method according to any one of claims 38 to 48, wherein the “targeting nuclease for at least one second target gene” and the CRISPR / Cas nuclease used to create a DNA break at a specific site of the first target gene are the same or different.

50. The method according to any one of claims 38 to 45 and 48 to 49, wherein the targeted nuclease is in the form of DNA.

51. The method according to any one of claims 38 to 49, wherein the targeted nuclease is in the form of mRNA or protein, rather than DNA.

52. The method according to any one of claims 43 to 51, wherein the method for delivering the targeted nuclease to cells is selected from 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun shock; or 6) Agrobacterium-mediated transformation.

53. A method for non-transgenic transient editing of a biological genome, comprising the following steps: 1) A combination of at least two crRNA fragments or at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient cell, and the crRNA combination combined with tracrRNA or the sgRNA combination alone can guide the corresponding Cas protein to sequentially create two or more DNA breaks at a specific site of the first target gene in the recipient cell, and to spontaneously repair each of them, wherein the subsequent DNA breaks are generated based on novel sequences generated from the previous DNA break repair; 2) A suitable amount of CRISPR / Cas protein or its corresponding mRNA is mixed with a combination of crRNA and tracrRNA fragments or a single sgRNA fragment, which have been pre-designed and synthesized above, capable of guiding site-directed editing of the first target gene to produce an endogenous selection marker, and optionally, at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene is further added, and the mixture is incubated in vitro to form an RNP complex; 3) The process of delivering the RNP complex to recipient cells and contacting specific sites of genomic DNA in order to achieve gene editing; 4) A step in which, according to a phenotypic selectable trait generated by site-directed editing of a first target gene by an RNP complex, a corresponding selective pressure is applied to select for that trait, a cell, tissue, organ or complete organism containing the editing event is isolated, and optionally, a cell, tissue, organ or complete organism containing the editing event of the first target gene and at least one editing event of a second, third or subsequent target gene simultaneously is isolated. A method that includes the following:

54. The method according to claim 53, wherein the "first target gene" is a gene locus encoding at least one phenotypic selectable trait, and the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth-advantageous trait.

55. The method according to claim 53 or 54, wherein the “specific site of the first target gene” refers to a site where, after sequential breaks and repairs, a particular type of mutation is generated that can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

56. The method according to claim 55, wherein the "certain type of mutation" includes a single base substitution, a multi-base substitution, or an insertion or deletion of an unspecified number of bases.

57. The method according to claim 55 or 56, wherein the “certain selective pressure” is an ambient pressure or a pressure arising from an added compound, the ambient pressure is preferably high temperature, low temperature or low oxygen, and the pressure arising from an added compound is preferably a pressure arising from salt ion concentration, an antibiotic, a cytotoxin or a herbicide.

58. The method according to any one of claims 53 to 57, wherein the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of performing genome editing.

59. The method according to any one of claims 53 to 58, wherein the characteristic of "sequentially creating two or more DNA breaks at a specific site" means that a new target RNA is designed to break that site again based on a new sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system.

60. The method according to any one of claims 53 to 59, wherein the "two or more DNA cuts" are produced when RNP complexes formed by the same CRISPR / Cas nuclease, each having different gRNAs or sgRNAs, successively cut the corresponding target sequences.

61. The method according to any one of claims 53 to 59, wherein the "two or more DNA cleavages" are produced when RNP complexes, each individually formed by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences.

62. The method according to any one of claims 53 to 61, wherein the "second, third, or subsequent target gene" refers to another gene that has a different coding from the first target gene.

63. The method according to any one of claims 53 to 62, wherein the "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment that targets a second, third or subsequent target gene" has the same Cas protein having a crRNA or sgRNA that targets a first target gene.

64. The method according to any one of claims 53 to 62, wherein the "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment that targets a second, third or subsequent target gene" and the crRNA or sgRNA that targets the first target gene use a Cas protein that recognizes different PAM sequences.

65. The method according to any one of claims 53 to 64, wherein the method for delivering the RNP complex to cells is selected from 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; or 5) gene gun strike.

66. A method for non-transgenic transient editing of plant genomes, comprising the following steps: 1) A combination of at least two crRNA fragments or at least two sgRNA fragments is designed and synthesized for a specific site of a first target gene in a recipient plant cell or tissue, and the combination of crRNAs combined with tracrRNA or the combination of sgRNAs alone can guide the corresponding Cas protein to sequentially create two or more DNA breaks at a specific site of the first target gene in the recipient cell, and to spontaneously repair each of them, wherein the subsequent DNA breaks are generated based on novel sequences generated from the previous DNA break repair; 2) A suitable amount of CRISPR / Cas protein or its corresponding mRNA is mixed with a combination of crRNA and tracrRNA fragments or a single sgRNA fragment combination, which has been pre-designed and synthesized above, capable of guiding site-directed editing of a first target gene to produce an endogenous selection marker, and optionally, at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third, or subsequent target gene is further added, and incubation is performed in vitro to form an RNP complex; 3) The RNP complex is delivered to a recipient plant cell or tissue and brought into contact with a specific site of genomic DNA in order to achieve gene editing; 4) A method comprising the steps of: applying a corresponding selective pressure to select for a phenotypic selectable trait generated by site-directed editing of a first target gene by an RNP complex; isolating cells, tissues, intercellular matrix, or a complete plant containing the editing event; and optionally isolating cells, tissues, organs, or a complete plant containing simultaneously the editing event of the first target gene and at least one editing event of a second, third, or subsequent target gene.

67. The method according to claim 66, wherein the "first target gene" is a gene locus encoding at least one phenotypic selectable trait, and the at least one phenotypic selectable trait is a resistance / tolerance trait or a trait advantageous for growth.

68. The method according to claim 66 or 67, wherein the “specific site of the first target gene” refers to a site where, after sequential breaks and repairs, a particular type of mutation is generated that can confer resistance to a specific selective pressure in the recipient cell, resulting in at least one phenotypic selectable resistance / tolerance trait or a growth-advantageous trait.

69. The method according to claim 68, wherein the "certain type of mutation" includes a single base substitution, a multi-base substitution, or an insertion or deletion of an unspecified number of bases.

70. The method according to claim 68 or 69, wherein the “certain selective pressure” is an ambient pressure or a pressure arising from an added compound, the ambient pressure is preferably high temperature, low temperature or low oxygen, and the pressure arising from an added compound is preferably a pressure arising from salt ion concentration, an antibiotic, a cytotoxin or a herbicide.

71. The method according to any one of claims 66 to 70, wherein the "recipient plant cells or tissues" can act as recipients of transient expression and can be redifferentiated into a complete plant by tissue culture, the cells are preferably protoplast cells or suspension cells, and the tissues are preferably callus, immature embryo, mature embryo, leaf, shoot apex, young panicle or hypocotyl.

72. The method according to any one of claims 66 to 71, wherein the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of performing genome editing.

73. The method according to any one of claims 66 to 72, wherein the characteristic of "sequentially generating two or more DNA breaks at a specific site" means that a new target RNA is designed to re-cleave that site based on a novel sequence generated by a previous DNA break repair event generated by the CRISPR / Cas system.

74. The method according to any one of claims 66 to 73, wherein the "two or more DNA cuts" are produced when an RNP complex formed by the same CRISPR / Cas nuclease having different gRNAs or sgRNAs respectively successively cuts the corresponding target sequence.

75. The method according to any one of claims 66 to 73, wherein the "two or more DNA breaks" are produced when RNP complexes, each individually formed by two or more CRISPR / Cas nucleases that recognize different PAM sequences in each gRNA or sgRNA, sequentially cleave the corresponding target sequences.

76. The method according to any one of claims 66 to 75, wherein the "second, third, or subsequent target gene" refers to another gene that has a different coding from the first target gene.

77. The method according to any one of claims 66 to 76, wherein the "at least one of artificially synthesized crRNA and tracrRNA fragments or artificially synthesized sgRNA fragments targeting a second, third or subsequent target gene" has the same Cas protein having a crRNA or sgRNA that targets a first target gene.

78. The method according to any one of claims 66 to 76, wherein the "at least one of an artificially synthesized crRNA and tracrRNA fragment or an artificially synthesized sgRNA fragment that targets a second, third or subsequent target gene" and the crRNA or sgRNA that targets the first target gene use a Cas protein that recognizes different PAM sequences.

79. The method according to any one of claims 66 to 78, wherein the method for delivering the RNP complex to plant cells is selected from 1) PEG-mediated cell protoplast transformation; 2) microinjection; 3) gene gun impact; 4) silicon carbide fiber-mediated method; or 5) vacuum infiltration method, or any other transient introduction method.

80. The "first target gene" is at least one endogenous gene encoding at least one phenotypic selectable trait from herbicide resistance / tolerance, wherein the herbicide resistance / tolerance includes resistance / tolerance to EPSPS inhibitors, resistance / tolerance to glutamine synthesis inhibitors, resistance / tolerance to ALS or AHAS inhibitors, resistance / tolerance to ACCase inhibitors, resistance / tolerance to carotenoid biosynthesis inhibitors, resistance / tolerance to cellulose inhibitors, resistance / tolerance to lipid synthesis inhibitors, and long-chain lipids. The method according to any one of claims 66 to 79, wherein the "first target gene" is selected from the group consisting of resistance / tolerance to acid inhibitors, resistance / tolerance to microtubule polymerization inhibitors, resistance / tolerance to photosystem I electron shunt agents, resistance / tolerance to photosystem II inhibitors or resistance / tolerance to PPO inhibitors, and resistance / tolerance to synthetic growth hormone; preferably, the "first target gene" is selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, TIR1, or AFB5.

81. The "first target gene" is ALS, and the "specific site of the gene" refers to sites A122, P197, R198, D204, A205, D376, R377, W574, S653, or G654 in the amino acid sequence of Arabidopsis AtALS protein, and an amino acid site in another plant's ALS protein that corresponds to the above amino acid site by using the AtALS amino acid sequence as a reference standard; or The method according to claim 80, wherein the crRNA or sgRNA includes a target sequence comprising a sequence encoding an amino acid sequence portion of an AtALS protein selected from the group consisting of A122, P197, R198, D204, A205, D376, R377, W574, S653, G654 or any combination thereof, and a target sequence comprising a sequence encoding amino acid portions corresponding to the above amino acid portions and any combination thereof by using the AtALS amino acid sequence of an ALS protein of another plant as a reference standard.

82. The “first target gene” is ACCase, and the “specific site of the gene” refers to sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088 or G2096 in the amino acid sequence of the AmACCase protein of *AmACCase*, and an amino acid site of another monocotyledonous plant corresponding to the above amino acid site by using the AmACCase amino acid sequence as a reference standard; or The target sequence comprises a crRNA or sgRNA that includes a sequence encoding an AmACCase amino acid sequence region selected from the group consisting of I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, G2096, or any combination thereof, and a target sequence that includes a sequence encoding the above amino acid region and any combination thereof, by using an AmACCase amino acid sequence in an ACCase protein of another monocotyledonous plant as a reference standard. The method according to claim 80.

83. The "first target gene" is HPPD, and the "specific site of the gene" refers to sites H141, L276, P277, N338, G342, R346, D370, P386, K418 or G419 in the amino acid sequence of the rice OsHPPD protein, and an amino acid site in the HPPD protein of another plant that corresponds to the above amino acid site by using the OsHPPD amino acid sequence as a reference standard; or The target sequence comprises a crRNA or sgRNA that includes a sequence encoding an OsHPPD amino acid sequence region selected from the group consisting of H141, L276, P277, N338, G342, R346, D370, P386, K418, G419, or any combination thereof, and a target sequence that includes a sequence encoding amino acid regions corresponding to the above amino acid regions and any combination thereof, by using the OsHPPD amino acid sequence in the HPPD protein of another plant as a reference standard. The method according to claim 80.

84. The "first target gene" is PPO, and the "specific site of the gene" refers to sites S128, V217, S223, V364, K373, L423, Y425, or W470 in the amino acid sequence of the rice OsPPO1 protein, and an amino acid site in the PPO protein of another plant that corresponds to the above amino acid site by using the amino acid sequence of OsPPO1 as a reference standard, or The target sequence comprises a crRNA or sgRNA containing a sequence encoding an OsPPO1 amino acid sequence region selected from the group consisting of S128, V217, S223, V364, K373, L423, Y425, W470, or any combination thereof, and a target sequence containing a sequence encoding the above amino acid region and any combination thereof, obtained by using the OsPPO1 amino acid sequence in a PPO protein of another plant as a reference standard. The method according to claim 80.

85. The “first target gene” is TIR1, and the “specific site of the gene” refers to sites F93, F357, C413 or S448 in the amino acid sequence of the rice OsTIR1 protein, and an amino acid site in the TIR1 protein of another plant that corresponds to the above amino acid site by using the OsTIR1 amino acid sequence as a reference standard; or The target sequence comprises a sequence encoding an OsTIR1 amino acid sequence region selected from the group consisting of F93, F357, C413, S448, or any combination thereof, and a target sequence comprising a sequence encoding the above amino acid region and any combination thereof, obtained by using the OsTIR1 amino acid sequence in the TIR1 protein of another plant as a reference standard. The method according to claim 80.

86. A non-transgenic transient editing system using the method described in any one of claims 53 to 85.

87. Use of the non-transgenic transient editing system according to claim 86 as a selection marker or in the treatment of disease or in biological breeding.

88. The genome, 1) Editing event of the first target gene; 2) an editing event of a first target gene and an editing event of at least one second target gene; or 3) at least one second target gene editing event, in which case the editing event of the first target gene has been eliminated by genetic segregation. A genetically modified plant comprising and obtained in a non-transgenic manner, obtained by the method according to any one of claims 66 to 85.

89. A novel plant gene mutation obtained by the method described in any one of claims 66 to 85.

90. The following types: A novel mutation produced in a plant comprising one or more combinations of the following: substitution of aspartic acid with any other amino acid at the site corresponding to Arabidopsis ALS376; substitution of tryptophan with any other amino acid at the site corresponding to Arabidopsis ALS574; substitution of serine with any other amino acid at the site corresponding to Arabidopsis ALS653; or substitution of serine with any other amino acid at the site corresponding to Arabidopsis ALS654; or substitution of tryptophan with any other amino acid at the site corresponding to ACCase2027 of Aristolochia.

91. The mutation according to claim 90, wherein aspartic acid in the region corresponding to Arabidopsis ALS376 is substituted with glutamic acid, tryptophan in the region corresponding to Arabidopsis ALS574 is substituted with leucine or methionine, serine in the region corresponding to Arabidopsis ALS653 is substituted with asparagine or arginine, or glycine in the region corresponding to Arabidopsis ALS654 is substituted with aspartic acid; or tryptophan in the region corresponding to ACCase2027 is substituted with leucine or cysteine.

92. The mutation according to claim 90, wherein aspartic acid at site 350 of rice ALS is replaced with any other amino acid, tryptophan at site 548 of rice ALS is replaced with any other amino acid, or tryptophan at site 561 of potato ALS2 is replaced with any other amino acid, or tryptophan at site 2038 of rice ACCase2 is replaced with any other amino acid.

93. The mutation according to any one of claims 90 to 92, wherein aspartic acid at site 350 of rice ALS is replaced with glutamic acid, tryptophan at site 548 of rice ALS is replaced with leucine or methionine, or tryptophan at site 561 of potato ALS2 is replaced with leucine or methionine, or tryptophan at site 2038 of rice ACCase2 is replaced with leucine or cysteine.

94. A protein comprising a novel mutation as described in any one of claims 89 to 93, or a biologically active fragment thereof.

95. A nucleic acid comprising a nucleic acid sequence or complementary sequence encoding the protein or a biologically active fragment thereof as described in claim 94.

96. A recombinant expression vector comprising the nucleic acid described in claim 95 and a promoter functionally linked thereto.

97. An expression cassette comprising the nucleic acid described in claim 95.

98. A plant cell comprising the expression cassette described in claim 97.

99. A plant redifferentiated by using the plant cells described in claim 98.

100. A method for producing plants with improved resistance or tolerance to herbicides, comprising transforming or transfecting plant cells with the recombinant expression vector described in claim 96 or the expression cassette described in claim 97, and redifferentiating the transformed or transfected plant cells into plants.

101. A method for controlling weeds in a plant cultivation area, wherein the plants include the plants described in claim 88 or 99 or plants produced by the method described in claim 100, and the method comprises applying one or more herbicides to the cultivation area in an amount effective for controlling weeds.

102. Use of a novel mutation according to any one of claims 89 to 93, a protein or a biologically active fragment thereof according to claim 94, a nucleic acid according to claim 95, a recombinant expression vector according to claim 96, or an expression cassette according to claim 97 in improving the resistance or tolerance of plant cells, plant tissues, plant parts or plant bodies to herbicides.

Images