Dried powder formulation for messenger RNA

A polymer-stabilized dry powder formulation of mRNA in lipid nanoparticles addresses the challenges of instability and administration methods in current therapies, enabling stable and efficient mRNA delivery through inhalation.

JP2026057570APending Publication Date: 2026-04-02TRANSLATE BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-11-28
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current mRNA therapies in liquid form require invasive administration methods like injection or atomization, and lyophilized preparations suffer from instability and non-uniform particle formation, making them difficult to handle and store.

Method used

A dry powder formulation of mRNA encapsulated in lipid nanoparticles is developed, stabilized by adding a polymer, which prevents aggregation during spray drying and maintains mRNA integrity and encapsulation efficiency.

Benefits of technology

The formulation allows for stable, easy-to-handle mRNA delivery via inhalation, maintaining high mRNA integrity and encapsulation efficiency even after long-term storage, eliminating the need for freeze-thaw cycles and liquid aliquots.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026057570000087
    Figure 2026057570000087
  • Figure 2026057570000088
    Figure 2026057570000088
  • Figure 2026057570000089
    Figure 2026057570000089
Patent Text Reader

Abstract

This invention provides a dried powder formulation of mRNA encapsulated in lipid-based nanoparticles for efficient mRNA delivery and effective mRNA therapy, as well as a method for preparing and using the same. [Solution] A dry powder formulation for delivering cystic fibrosis conductance regulatory factor (CFTR) messenger RNA (mRNA) is provided, comprising a plurality of spray-dried particles each containing mRNA encoding the CFTR protein, one or more lipids, and one or more polymers.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Application No. 62 / 702,193, filed on 23 July 2018, which is incorporated herein by reference in its entirety.

[0002] Array List This application includes a sequence listing filed electronically in ASCII format, the entirety of which is incorporated herein by reference. The ASCII copy, created on July 19, 2019, is named MRT_2008WO_SeqListing.txt and has a size of 1137 bytes. [Background technology]

[0003] Messenger RNA therapy (MRT) is becoming an increasingly important approach to treating a variety of diseases. Lipid-encapsulated mRNA preparations, such as lipid nanoparticle (LNP) compositions, exhibit high cellular uptake and protein expression. However, currently, these preparations are typically in liquid form and usually need to be administered by injection or via atomizer. These modes of administration are undesirable to patients compared to some less invasive routes, such as metered-dose inhalers. Lyophilized preparations sometimes do not provide reliable particle uniformity in their dry state or are not easy to handle and distribute. Lyophilized powders must be dissolved in a suitable solvent before dispensing to patients and can degrade within a few hours. Due to the potential instability of mRNA and / or LNPs, repeated freeze-thaw cycles of mRNA preparations are not recommended. [Overview of the project] [Means for solving the problem]

[0004] The present invention provides a dry powder (i.e., spray-dried) formulation of mRNA encapsulated in lipid nanoparticles for more efficient mRNA delivery and more effective mRNA therapy. Prior to the present invention, one of the challenges of spray-dried lipid nanoparticle-encapsulated mRNA arose from the fact that both mRNA and lipid nanoparticle components are structurally unstable at the high temperatures and / or high pressures required for proper spray drying. For example, the inlet temperature of a spray dryer is in the range of 80°C to 98°C. Lipids tend to melt and / or aggregate at or near the spray nozzle at high inlet temperatures. This hinders the flow of the formulation through the nozzle into the drying chamber, disrupting the uniform dispersion of the spray and resulting in undesirable particle properties and poor yield. The present invention unexpectedly solves this problem by adding a polymer to the mRNA and lipid nanoparticle mixture before subjecting the mixture to the spray-drying process. As described herein, the inventors have observed that by adding a polymer to the mRNA and lipid mixture, aggregation of lipid nanoparticles is effectively prevented and the formation of a dry powder of fine particles containing mRNA-supported lipid nanoparticles suitable for inhalation is promoted.

[0005] Even more remarkably, despite the extremely unstable nature of mRNA, the dried powder formulations prepared according to the present invention remain stable even under the high temperatures and / or high pressures associated with spray drying, and can maintain a high degree of mRNA integrity even after long-term storage at various temperatures. Furthermore, the dried powder formulations prepared according to the present invention are also characterized by high LNP encapsulation efficiency of mRNA, resulting in high mRNA cell delivery. Thus, the present invention meets the long-standing need in the field of mRNA therapy for mRNA therapeutic agents in a stable dried powder form, which can be easily stored, transported, and dispensed. Moreover, the dried powder formulation of mRNA according to the present invention eliminates the need to freeze single-use liquid aliquots. For example, it can be administered to the patient as a dry powder, either quantitatively or after being weighed and reconstituted into single-dose doses.

[0006] In one embodiment, the present invention provides a dry powder formulation for messenger RNA (mRNA) delivery comprising a plurality of spray-dried particles containing mRNA encoding a protein or peptide, one or more lipids, and one or more polymers.

[0007] In another embodiment, the present invention provides a dry powder formulation for messenger RNA (mRNA) delivery comprising one or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a peptide or polypeptide, and a plurality of spray-dried particles comprising one or more polymers.

[0008] In yet another aspect, the present invention provides a dry powder formulation for messenger RNA (mRNA) delivery comprising one or more nanoparticles encapsulating mRNA encoding a peptide or polypeptide, one or more nanoparticles containing lipids, and one or more spray-dried particles containing polymers.

[0009] In yet another embodiment, the present invention provides a dry powder formulation for the delivery of cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA), comprising a plurality of spray-dried particles comprising mRNA encoding the CFTR protein, one or more lipids, and one or more polymers. In some embodiments, one or more lipids form one or more nanoparticles (LNPs) that encapsulate mRNA encoding the CFTR protein. In some embodiments, one or more lipids and one or more polymers form one or more nanoparticles that encapsulate mRNA encoding the CFTR protein.

[0010] As used in this application, lipid nanoparticles (LNPs) encompass nanoparticles formed from lipids, as well as nanoparticles formed from both lipids and polymers. In some embodiments, nanoparticles formed from both lipids and polymers are referred to as lipid polymer nanoparticles.

[0011] In some embodiments, the mRNA (e.g., CFTR mRNA) has a integrity of 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. In some embodiments, the mRNA (e.g., CFTR mRNA) has a integrity of 90% or more. In some embodiments, the mRNA (e.g., CFTR mRNA) has a integrity of 95% or more. In some embodiments, the mRNA (e.g., CFTR mRNA) has a integrity of 98% or more.

[0012] In some embodiments, mRNA maintains 90% or more integrity when stored at room temperature or below for 6 months or more. In some embodiments, mRNA maintains 95% or more integrity when stored at room temperature or below for 6 months or more. In some embodiments, mRNA maintains 98% or more integrity when stored at room temperature or below for 6 months or more.

[0013] In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at room temperature or below for 3 months or more. In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at room temperature or below for 6 months or more. In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at room temperature or below for 9 months or more. In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at room temperature or below for 12 months or more. In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at 4°C or below for 3 months or more. In some embodiments, mRNA maintains 90% or more integrity after being spray-dried and stored at 4°C or below for 6 months or more. In some embodiments, mRNA is spray-dried Afterward, the mRNA maintains 90% or more integrity after being stored at 4°C or below for 9 months or more. In some embodiments, the mRNA maintains 90% or more integrity after being stored at 4°C or below for 12 months or more after spray drying. In some embodiments, the mRNA maintains 95% or more integrity after being stored at room temperature or below for 3 months, 6 months, 9 months or more, or 12 months or more. In some embodiments, the mRNA maintains 95% or more integrity after being stored at 4°C or below for 3 months, 6 months or more, 9 months or more, or 12 months or more.

[0014] In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the spray-dried particles constitute a fine particulate fraction. In some embodiments, at least 20% of the spray-dried particles constitute a fine particulate fraction.

[0015] In some embodiments, the fine particles have a volume median diameter of 5 micrometers or less. In some embodiments, the fine particles have a volume median diameter of 4 micrometers or less. In some embodiments, the fine particles have a volume median diameter of 3 micrometers or less. In some embodiments, the fine particles have a volume median diameter of 2 micrometers or less. In some embodiments, the fine particles have a volume median diameter of 1 micrometer or less.

[0016] In some embodiments, the spray-dried particles have an average sphericity greater than 0.6, greater than 0.7, greater than 0.8, or greater than 0.9. In some embodiments, the spray-dried particles have a Z-average size of 3,000 nm, 2,500 nm, 2,000 nm, 1,500 nm, 1,000 nm, or less than 500 nm.

[0017] In some embodiments, the spray-dried particles contain a residual moisture content of less than 20%, less than 18%, less than 16%, less than 14%, less than 12%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1%.

[0018] In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is inhaled as dry powder using a metered-dose inhaler. In some embodiments, the dry powder formulation is reconstituted with a diluent and administered by atomization.

[0019] In some embodiments, one or more polymers constitute at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of lipids and polymers. In some embodiments, one or more polymers constitute about 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, or 15-90% of the total weight of lipids and polymers. In some embodiments, one or more polymers constitute 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% or less of the total weight of lipids and polymers.

[0020] In some embodiments, one or more polymers constitute at least 50% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 40% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 30% of the total weight of the dry powder. In some embodiments, one or more polymers In some embodiments, one or more polymers constitute at least 20% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 15% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 12% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 10% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 9% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 8% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 7% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 6% of the total weight of the dry powder. In some embodiments, one or more polymers constitute at least 5% of the total weight of the dry powder.

[0021] In some embodiments, one or more polymers are selected from the group consisting of chitosan, poly(lactic acid) (PLA), poly(lactic acid-coglycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and polymethacrylate polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethylmethyl acrylate) (pDMAEMA).

[0022] In some embodiments, one or more polymers include polymethacrylate polymers. In some embodiments, one or more polymers include Eudragit EPO.

[0023] In some embodiments, one or more LNPs encapsulating mRNA (also called mRNA-supported LNPs) have a lipid:mRNA(N / P) ratio in the range of 1–20, 1–15, 1–10, 2–8, 2–6, or 2–4. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1–20. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1–18. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1–16. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1–14. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1–12. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1 to 10. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1 to 8. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 1 to 6. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 20. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 16. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 12. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 8. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 6. In some embodiments, one or more mRNA-carrying lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 2 to 4. In some embodiments, one or more mRNA-carrying lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 4 to 20. In some embodiments, one or more mRNA-carrying lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 4 to 16. ) has a ratio. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 4 to 14. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 4 to 12. In some embodiments, one or more mRNA-supported lipid nanoparticles have a lipid:mRNA(N / P) ratio in the range of 4 to 10. In some embodiments, one or more mRNA-supported LNPs have a lipid:mRNA(N / P) ratio of 2 or 4. In some embodiments, one or more mRNA-supported LNPs have a lipid:mRNA(N / P) ratio of 2. In some embodiments, one or more mRNA-supported LNPs have a lipid:mRNA(N / P) ratio of 4.

[0024] In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 70% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 75% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 80% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 85% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 90% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 92% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 94% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 95% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 96% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 97% or more. In some embodiments, one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 98% or more.

[0025] In some embodiments, one or more lipids include cationic lipids. In some embodiments, the cationic lipids are selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethitaammoniumpropane), DODAP (1,2-dioleyl-3-dimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.

[0026] In some embodiments, one or more mRNA-supported lipid nanoparticles contain one or more cationic lipids. In some embodiments, one or more cationic lipids contain ionizable cationic lipids. In some embodiments, one or more cationic lipids contain cationic lipid C12-200. In some embodiments, one or more cationic lipids contain cationic lipid DOTAP (1,2-dioleyl-3-trimethitamonium propane). In some embodiments, one or more cationic lipids contain cationic lipid DODAP (1,2-dioleyl-3-dimethylammonium propane). In some embodiments, one or more cationic lipids contain cationic lipid DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane). In some embodiments, one or more cationic lipids contain cationic lipid DLinDMA. In some embodiments, one or more cationic lipids contain cationic lipid DLin-KC2-DMA. In some embodiments, one or more cationic lipids contain cationic lipid HGT-5000. In some embodiments, one or more cationic lipids include cationic lipid HGT-5001. In some embodiments, one or more cationic lipids include cationic lipid HGT-5002. In some embodiments, one or more cationic lipids include cationic lipid cKK-E12. In some embodiments, one or more cationic lipids include cationic lipid OF-02. In some embodiments, one or more cationic lipids include cationic lipid target 23. In some embodiments, one or more cationic lipids include cationic lipid compound 1. In some embodiments, One or more cationic lipids include cationic lipid compound 2. In some embodiments, one or more cationic lipids include cationic lipid compound 3. In some embodiments, one or more cationic lipids include cationic lipid HGT4001. In some embodiments, one or more cationic lipids include cationic lipid HGT4002. In some embodiments, one or more cationic lipids include cationic lipid HGT4003. In some embodiments, one or more cationic lipids include cationic lipid HGT4004. In some embodiments, one or more cationic lipids include cationic lipid HGT4005. In some embodiments, one or more cationic lipids include cationic lipid 18:1 carbon tail ribose lipid. In some embodiments, one or more cationic lipids include cationic lipid ICE.

[0027] In some embodiments, cationic lipids constitute approximately 25–50% of the moles of total lipids in the LNP.

[0028] In some embodiments, one or more lipids comprise PEG-modified lipids. In some embodiments, one or more mRNA-supported lipid nanoparticles comprise one or more PEG-modified lipids. In some embodiments, one or more PEG-modified lipids comprise poly(ethylene) glycol chains up to 5 kDa in length, covalently bonded to a lipid containing one or more alkyl chains of C6-C20 length. In some embodiments, one or more PEG-modified lipids constitute up to 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the moles of total lipids in the LNP. In some embodiments, PEG-modified lipids constitute about 1-15% of the moles of total lipids in the LNP. In some embodiments, PEG-modified lipids constitute at least 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, or 12% of the moles of total lipids in the LNP.

[0029] In some embodiments, the preferred LNP according to the present invention is a two-lipid component LNP.

[0030] In some embodiments, one or more lipids do not include neutral lipids or cholesterol-based lipids.

[0031] In some embodiments, one or more lipids further comprise neutral lipids and / or cholesterol lipids.

[0032] In some embodiments, the preferred LNP according to the present invention is a trilipid component LNP.

[0033] In some embodiments, the dried powder formulation according to the present invention further comprises at least one sugar. In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, mannitol, and combinations thereof. In some embodiments, the sugar is mannitol. In some embodiments, the sugar constitutes 30%, 25%, 20%, 15%, 10%, or less than 5% of the total weight.

[0034] In some embodiments, the dry powder formulation according to the present invention further comprises a pharmaceutically acceptable excipient selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

[0035] In some embodiments, preferred surfactants are selected from the group consisting of CHAPS (3-[(3-collamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers (e.g., poloxamer 407). In some embodiments, a preferred surfactant is a poloxamer.

[0036] In some embodiments, the dry powder formulation according to the present invention further comprises a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutically acceptable excipient is selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

[0037] In some embodiments, the dry powder formulation according to the present invention contains a surfactant. In some embodiments, the surfactant is selected from the group consisting of CHAPS (3-[(3-collamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and copolymers. In some embodiments, the surfactant is a poloxamer. In some embodiments, the surfactant is a poloxamer, which is a triblock copolymer consisting of a central hydrophobic block of polypropylene glycol adjacent to two hydrophilic blocks of polyethylene glycol (PEG). In some embodiments, the surfactant is poloxamer 407.

[0038] In some embodiments, mRNA constitutes up to 10% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 9% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 8% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 7% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 6% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 5% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 4% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 3% of the total weight of the dry powder. In some embodiments, mRNA constitutes up to 2% of the total weight of the dry powder. In some embodiments, mRNA constitutes 1-10% of the total weight of the dry powder. In some embodiments, mRNA constitutes 1-6% of the total weight of the dry powder. In some embodiments, mRNA constitutes 1-5% of the total weight of the dry powder. In some embodiments, mRNA constitutes 1-4% of the total weight of the dry powder. In some embodiments, mRNA constitutes 1-3% of the total weight of the dry powder. In some embodiments, mRNA constitutes 2-10% of the total weight of the dry powder. In some embodiments, mRNA constitutes 2-9% of the total weight of the dry powder. In some embodiments, mRNA constitutes 2-8% of the total weight of the dry powder. In some embodiments, mRNA constitutes 2-7% of the total weight of the dry powder. In some embodiments, mRNA constitutes 2-6% of the total weight of the dry powder. It constitutes the following. In some embodiments, mRNA constitutes 2-5% of the total weight of the dry powder. In some embodiments, the mRNA is unmodified. In some embodiments, the mRNA contains one or more modified nucleotides.

[0039] In some embodiments, the mRNA encodes a peptide. In some embodiments, the mRNA encodes a therapeutic protein. In some embodiments, the therapeutic protein is CFTR.

[0040] In some embodiments, CFTR mRNA constitutes approximately 1-20%, 1-15%, 1-10%, 1-8%, 1-6%, 1-5%, 5-15%, or 5-10% of the total weight of the spray-dried particles. In some embodiments, CFTR mRNA constitutes approximately 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5%, or 15% of the total weight of the spray-dried particles.

[0041] In another embodiment, the present invention provides a method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising the step of administering the dry powder formulation described herein to a subject requiring it. In some embodiments, the dry powder formulation described herein is administered by pulmonary delivery. In some embodiments, the dry powder formulation is administered by inhalation.

[0042] In further embodiments, the present invention provides a method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising the steps of reconstituting a dry powder formulation described herein into a liquid solution, and administering the reconstituted liquid solution to a subject requiring it. In some embodiments, the reconstituted liquid solution is administered by atomization. In some embodiments, the subject suffers from cystic fibrosis.

[0043] In another embodiment, the present invention provides a mixture comprising mRNA, one or more lipids, and a polymer, and a method for producing a dried powder formulation comprising spray-drying the mixture to form a plurality of particles.

[0044] In some embodiments, before adding the polymer, one or more lipids are first mixed with mRNA to form mRNA-supported lipid nanoparticles.

[0045] In some embodiments, the method according to the present invention further includes adding one or more excipients to the mixture before spray drying.

[0046] In some embodiments, multiple spray-dried particles are characterized by one or more of the following: a) a moisture content of less than 10%, b) a fraction of fine particles having a volume median diameter of less than 5 micrometers, c) a Z-average size range of 10 to 3000 nm, d) an N / P ratio range of 1 to 20, e) an mRNA encapsulation efficiency of more than 80%, and f) an mRNA integrity of more than 95%.

[0047] In yet another embodiment, the present invention provides a method for delivering mRNA in vivo, comprising administering a dry powder formulation described herein to a subject requiring it. In some embodiments, the dry powder formulation is administered orally, nasally, tracheally, pulmonaryly, or rectally. In some embodiments, the dry powder formulation is administered by inhalation. In some embodiments, the dry powder formulation is administered by intranasal spray. In some embodiments, the formulation is administered by a metered-dose inhaler. In some embodiments, the formulation is administered by an atomizer.

[0048] In yet another aspect, the present invention provides a method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising the step of administering a dried powder formulation described herein to a subject requiring such expression.

[0049] In yet another embodiment, the present invention provides a method for treating a disease or disorder in a patient by administering to the patient an effective dose of mRNA in the dried powder formulation described herein. In some embodiments, the disease or disorder is selected from cystic fibrosis; asthma; COPD; emphysema; primary ciliary dyskinesia with or without situs inversus (CILD1); or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Duvet syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-ray); cytochrome b-positive granulomatous disease, autosomal recessive; surfactant deficiencies, pulmonary surfactant metabolic disorder 1, pulmonary surfactant metabolic disorder 2, pulmonary surfactant metabolic disorder 3; respiratory distress syndrome of premature infants; tuberculosis, pulmonary viral diseases including influenza, and respiratory syncytial virus (RSV).

[0050] Additional objects and advantages of the present invention are partially described below, partially evident from the description, or can be learned through practice of the present invention. The objects and advantages of the present invention are realized and achieved by the elements and combinations particularly pointed out in the appended claims.

[0051] It should be understood that both the general description above and the detailed description below are illustrative and descriptive, and do not limit the invention as defined in the claims.

[0052] The accompanying drawings incorporated herein, and which constitute part thereof, illustrate several embodiments of the present invention and, together with the description, serve to illustrate the principles of the present invention.

[0053] The drawings are for illustrative purposes only and are not intended to be restrictive. [Brief explanation of the drawing]

[0054] [Figure 1] This diagram illustrates an example of spray drying technology for mRNA preparations. [Figure 2]This shows the recovery percentage of LNP-encapsulated mRNA material after spray drying, with or without polymer in the formulation. [Figure 3] Spectrophotometric analysis of mRNA references for integrity assessment is shown. [Figure 4] Exemplary data demonstrating the integrity of mRNA extracted from lipid nanoparticles is shown. [Figure 5] Exemplary data demonstrating the integrity of mRNA encapsulated in LNPs in polymer-containing formulations after spray drying and storage at 4°C for two weeks are shown. [Figure 6] Exemplary data demonstrating the integrity of mRNA encapsulated in LNPs in polymer-containing formulations after spray drying and storage at -20°C for two weeks are shown. [Figure 7] Exemplary data is presented demonstrating that storage temperature does not affect the integrity of mRNA encapsulated in LNPs within polymer-containing formulations and stored for two weeks after spray drying. [Figure 8] Exemplary data demonstrating the integrity of mRNA encapsulated in LNPs in polymer-containing formulations after spray drying and storage at 4°C for 4 weeks are shown. [Figure 9] Exemplary data demonstrating the integrity of mRNA encapsulated in LNPs in polymer-containing formulations after spray drying and storage at -20°C for 4 weeks are shown. [Figure 10] Exemplary data demonstrating mRNA integrity in polymer-containing formulations (without LNPs) stored at 4°C for 3 weeks after spray drying is shown. [Figure 11] Exemplary data demonstrating mRNA integrity in polymer-containing formulations (without LNPs) stored at -20°C for 3 weeks after spray drying is shown. [Figure 12] Exemplary data is presented demonstrating that storage temperature does not affect the integrity of mRNA formulated with polymer (without LNPs) and stored for 3 weeks after spray drying. [Figure 13] Exemplary data demonstrating mRNA integrity in polymer-containing formulations (without LNPs) stored at 4°C for 5 weeks after spray drying is shown. [Figure 14]Exemplary data demonstrating mRNA integrity in polymer-containing formulations (without LNPs) stored at -20°C for 5 weeks after spray drying is shown. [Figure 15] Figures 15A and 15B show exemplary in vivo mRNA expression, measured by bioluminescence, after administration of a spray-dried mRNA preparation to mice. Luciferase mRNA was administered using 1 mg. For Figure 15A, mRNA was administered as a dry powder. For Figure 15B, mRNA was administered as a liquid after dissolving the dry powder in water. [Figure 16] (Figure 16A1-A6) Exemplary capillary electrophoresis chromatography showing the integrity of CFTR mRNA after spray drying. (Figure 16A1-A3) Control CFTR mRNA that was neither spray-dried nor mounted is shown, while Figure 16A4-A6 shows CFTR mRNA extracted from the spray-dried formulation. [Modes for carrying out the invention]

[0055] definition To facilitate understanding of the present invention, certain terms are first defined below. Further definitions of these terms, and other terms, are provided throughout the specification.

[0056] Animals: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human at any developmental stage. In some embodiments, “animal” refers to a non-human animal at any developmental stage. In certain embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, animals may be transgenic animals, genetically modified animals, and / or clones.

[0057] Approximately or about: As used herein, the terms “approximately” or “about” applied to one or more values ​​of interest refer to values ​​similar to the reference values ​​presented. In certain embodiments, unless otherwise specified or it is clear from the context that such numbers do not exceed 100% of the possible values, the terms “approximately” or “about” refer to a range of values ​​of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the described reference value.

[0058] Delivery: As used herein, the term “delivery” encompasses both local and systemic delivery. For example, mRNA delivery includes situations where mRNA is delivered to a target tissue, its encoded protein is expressed, and retained within that target tissue (also referred to as “local distribution” or “local delivery”), and situations where mRNA is delivered to a target tissue, its encoded protein is expressed, and it is secreted into the patient’s circulatory system (e.g., serum), and then distributed throughout the body and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery”).

[0059] Encapsulation: As used herein, the term “encapsulation” or its grammatical equivalent refers to the process of confining individual mRNA molecules within nanoparticles.

[0060] Expression: As used herein, “expression” of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or post-translational modification of polypeptides or a fully assembled protein (e.g., an enzyme). In this application, the terms “expression” and “production,” as well as grammatical synonyms, are used interchangeably.

[0061] To improve, increase, or decrease: As used herein, “improve,” “increase,” or “decrease,” or grammatical synonyms, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual before the initiation of the treatment described herein, or a measurement in a control subject (or control subjects) in the absence of the treatment described herein. A “control subject” is a subject suffering from the same disease form as the subject being treated and of approximately the same age as the subject being treated.

[0062] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, or under cell culture conditions, rather than within a multicellular organism.

[0063] In vivo: As used herein, the term “in vivo” refers to events occurring within multicellular organisms such as humans and non-human animals. In the context of cell systems, the term may be used to mean events occurring within living cells (for example, as the opposite of “in vitro systems”).

[0064] Local distribution or local delivery: As used herein, the terms “local distribution,” “local delivery,” or their grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires mRNA-encoded proteins (e.g., enzymes) that are translated and expressed within a cell, or secreted in a limited manner to avoid entering the patient’s circulatory system.

[0065] Messenger RNA (mRNA): As used herein, the term “messenger RNA (mRNA)” means a polynucleotide that codes for at least one polypeptide. As used herein, mRNA includes both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA may be purified from natural sources, produced using recombinant expression systems, or optionally purified, chemically synthesized, etc. If necessary, for example, in the case of chemically synthesized molecules, mRNA may contain nucleoside analogs, such as analogs with chemically modified bases or sugars, or skeletal modifications. mRNA sequences are presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, mRNA is a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine), a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine) The compounds are or include dins, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite bonds).

[0066] N / P ratio: As used herein, the term "N / P ratio" refers to the lipid nanoparticles. This refers to the molar ratio of positively charged molecular units in the cationic lipids within the lipid nanoparticle to the negatively charged molecular units in the encapsulated mRNA. Thus, the N / P ratio is typically calculated as the ratio of moles of amine groups in the cationic lipids within the lipid nanoparticle to moles of phosphate groups in the encapsulated mRNA within that lipid nanoparticle.

[0067] Patient: As used herein, the terms “patient” or “subject” refer to any organism to which the composition provided may be administered, for example, for experimental, diagnostic, preventive, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is human. Humans include prenatal and postnatal forms.

[0068] Pharmacologically acceptable: As used herein, the term “pharmaceutically acceptable” means a substance that, within reasonable medical judgment, is suitable for use in contact with human and animal tissues in proportion to a reasonable benefit / risk ratio, without excessive toxicity, irritation, allergic response, or other problems or complications.

[0069] Subcutaneous administration: As used herein, the terms “subcutaneous administration” or “subcutaneous injection” refer to a bolus injection into the subcutaneous tissue, which is the tissue layer between the skin and muscle.

[0070] Subject: As used herein, the term “subject” means a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, pig, sheep, horse, or primate). Humans include prenatal and postnatal forms. In many embodiments, the subject is a human. The subject may be a patient. This refers to a human being who visits a healthcare provider for the diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” The subject may have or be susceptible to a disease or disorder, and may or may not exhibit symptoms of the disease or disorder.

[0071] Therapeutic dose: As used herein, the term “therapeutic dose” of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of any symptoms of a disease, disorder, and / or condition when administered to a subject who is suffering from or susceptible to such disease, disorder, and / or condition. Those skilled in the art will understand that a therapeutic dose is typically administered in a dosing regimen comprising at least one unit dose.

[0072] Treatment: As used herein, the terms “treatment,” “medication,” or “to treat” mean any method used to partially or completely alleviate, improve, reduce, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be performed on subjects who show no signs of the disease and / or only early signs of the disease, with the aim of reducing the risk of developing a condition associated with that disease.

[0073] The present invention provides a stable dried powder formulation containing mRNA-supported lipid nanoparticles (mRNA-LNPs) for therapeutic use. In particular, the present invention provides a dried powder formulation for delivering mRNA, comprising multiple spray-dried particles, each spray-dried particle containing one or more mRNA-supported lipid nanoparticles and polymers, as well as methods for preparing and using them.

[0074] Various aspects of the present invention are described in detail in the following sections. The use of these sections is not intended to limit the present invention. Each section may be applied to any aspect of the present invention. In this application, the use of “or” means “and / ” unless otherwise stated. It means "or".

[0075] Spray drying process Various spray drying processes can be used to carry out the present invention. The process generally involves removing moisture from a composition by passing the liquid form of the composition through an apparatus, a simplified schematic representation of which is provided as Figure 1. Briefly, a liquid formulation containing the composition of interest is passed through a “atomizer” nozzle of narrow inlet spray into a first chamber, which is a drying chamber. Typically, the liquid formulation passes through in a steady flow. The liquid formulation is sprayed into the drying chamber as small droplets. A flow of heated air or gas is also introduced into the drying chamber to form an airflow. The passage of the formulation through this heated flow disperses the incoming droplets and dries them into solid particle form. This product is guided into a second chamber by flowing through a connector or pipe. The second chamber is a cyclone powder collector, where air circulation generates a cyclone and the powder particles are collected in a collection container attached to the outlet end via a vortex flow. The cyclone chamber is attached to an exhaust fan to help cool the components. The inlet and outlet temperatures are adjustable by the operator. The respective inlet and outlet temperatures, chamber temperature, liquid supply flow rate (suction %), pressure, heating airflow characteristics, and most importantly, the composition of the liquid supply are suitably adjusted for optimal drying of any particulate matter.

[0076] In some embodiments, the inlet temperature is adjustable within the range of 40°C to 200°C. In some embodiments, the outlet temperature is in the range of 20°C to 70°C. The relative pressure of the pump and suction device is also adjustable by the operator. In some embodiments, the inlet temperature is adjusted between 70°C and 200°C for spray-drying mRNA lipid nanoparticles. In some embodiments, the inlet temperature is adjusted between 80°C and 200°C. In some embodiments, the inlet temperature is adjusted between 90°C and 200°C. In some embodiments, the inlet temperature is adjusted between 95°C and 180°C. In some embodiments, the inlet temperature is adjusted between 95°C and 160°C. In some embodiments, the inlet temperature is adjusted between 90°C and 150°C. In some embodiments, the inlet temperature is adjusted between 90°C and 120°C. In some embodiments, the inlet temperature is adjusted between 90°C and 100°C. In some embodiments, the inlet temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, or 100°C.

[0077] The proportion of suction devices to the drying chamber is typically adjusted between 50% and 100%. In some embodiments, the proportion of suction devices to the drying chamber is adjusted between 50% and 100%. In some embodiments, the proportion of suction devices to the drying chamber is adjusted between 60% and 100%. In some embodiments, the proportion of suction devices to the drying chamber is adjusted between 70% and 100%. In some embodiments, the proportion of suction devices to the drying chamber is adjusted between 80% and 100%. In certain embodiments, the proportion of suction devices is adjusted between 80% and 90%. In some embodiments, the proportion of suction devices is less than 100%, less than 95%, less than 90%, less than 85%, or less than 80%.

[0078] In some embodiments, the liquid flow through the inlet to the drying chamber is regulated by a pump set to a range of 10% to 50%. In some embodiments, the pump is set to a range of 20% to 40%. In some embodiments, the pump is set to a range of 10% to 30%. In some embodiments, the pump is set to a range of 20% to 30%. In some embodiments, the pump is set to a range of 30% to 50%. In some embodiments, the pump is set to 25%.

[0079] In some embodiments, the outlet temperature is in the range of 20°C to 70°C. In some embodiments, the outlet temperature is in the range of 30°C to 60°C. In some embodiments, the outlet temperature is The temperature range is 20°C to 50°C. In some embodiments, the outlet temperature is 30°C to 50°C. In some embodiments, the outlet temperature is 40°C to 50°C. In some embodiments, the outlet temperature is 45°C to 50°C.

[0080] The spray drying of mRNA-LNPs can be carried out using any suitable spray drying apparatus. As is known to those skilled in the art, a variety of spray drying apparatuses are commercially available and can be used to carry out the present invention. Suitable exemplary commercially available apparatuses for the present invention include, but are not limited to, the Anhydro MicraSpray Dryer. B-290; Anhydro MicraSpray Dryer B-90 (Buchi), Anhydro MicraSpray Dryer GMP; Anhydro MicraSpray Dryer Aseptic series (SPX FLOW), MDL-50 and MDL-015 (Fujisaki Electric); Versatile Mini Sprayer Dryer GAS410 (Yamato Scientific America); LSD-1500 Mini spray dryer, MSD-8 Multi-functional laboratory spray dryer; PSD-12 Precision pharmacy Spray dryers (manufactured by Changzhou Xiandao Drying Equipment Co. Ltd.); TALL FORM DRYER (trademark); Multi-Stage Dryer; COMPACT DRYER (trademark); FILTERMAT Spray Dryer; VERSATILE-SD (trademark); Fluidized Spray Dryer; MOBILE MINOR (trademark); SDMICRO (trademark); PRODUCTION MINOR (manufactured by GEA Process Engineering), and many others. Convenient scaling from laboratory scale to industrial manufacturing scale is also available from some of these manufacturers.

[0081] Spray-dried mRNA-supported nanoparticles According to the present invention, spray-drying mRNA-supported nanoparticles involves adding a polymer to an mRNA-lipid mixture. In some embodiments, the lipids and mRNA are first mixed to pre-form mRNA-supported lipid nanoparticles before adding the polymer. In some embodiments, the lipids, mRNA, and polymer are mixed simultaneously before spray-drying. In some embodiments, the method according to the present invention further includes adding one or more excipients to the mixture before spray-drying.

[0082] mRNA-supported lipid nanoparticles Any desired lipids can be mixed in any ratio suitable for mRNA encapsulation. In some embodiments, a suitable lipid solution includes cationic lipids, non-cationic lipids, and / or PEGylated lipids. In some embodiments, the suitable lipid mixture also includes cholesterol-based lipids. In some embodiments, mRNA-LNPs are initially formed by mixing mRNA and lipids before mixing with polymers or other excipients, and then spray-drying the mixture.

[0083] In some embodiments, mRNA-LNPs are formed by mixing an mRNA solution with a lipid solution, and the mRNA solution and / or lipid solution are heated to a predetermined temperature higher than ambient temperature before mixing (see U.S. Patent No. 9,668,980, titled “Encapsulation of messenger RNA,” the disclosure of which is incorporated herein in its entirety).

[0084] In some embodiments, mRNA-LNPs are formed by mixing pre-formed lipid nanoparticles with mRNA (see U.S. Patent Application Publication No. 2018 / 0153822, the disclosure of which is incorporated herein by reference).

[0085] In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 70% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 75% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 80% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 85% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 86% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 87% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 88% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 89% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 90% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 91% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 92% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 93% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 94% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 95% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 96% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 97% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 98% or higher. In some embodiments, the encapsulation efficiency of mRNA by lipid nanoparticles before spray drying is 99% or higher.

[0086] In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 70% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 75% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 80% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 85% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 86% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 87% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 88% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 89% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 90% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 91% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 92% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 93% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 94% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 95% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray-drying of the polymer and LNP-encapsulated mRNA formulations is 96% or higher.In some embodiments, the polymer and LNP-encapsulated mRNA formulations are spray-dried and then mRN is encapsulated by LNPs. The encapsulation efficiency of A is 97% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 98% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNP after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 99% or higher.

[0087] In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 70% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 75% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 80% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 85% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 86% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 87% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 88% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 89% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 90% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 91% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 92% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 93% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs, both before and after spray-drying the polymer and LNP-encapsulated mRNA formulations, is 94% or higher.In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 95% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 96% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 97% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 98% or higher. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray-drying of the polymer and LNP-encapsulated mRNA formulation is 99% or higher.

[0088] In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 10% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 15% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 20% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 25% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 30% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 25% or more of the mass of the formulation before the spray-drying process. The mass of the NA formulation is 35% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 40% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 41% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 42% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 43% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 44% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 45% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 46% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 47% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 48% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 49% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 50% or more of the mass of the formulation before the spray-drying process.

[0089] In some embodiments, mRNA and lipids are mixed using a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and facilitates mass production. In some embodiments, the N / P ratio is in the range of 1 to 20. In some embodiments, the N / P ratio is greater than 2, or greater than 3, or greater than 4, or greater than 5, or greater than 6, or greater than 7, or greater than 8, or greater than 9, or greater than 10, or greater than 11, or greater than 12, or greater than 13, or greater than 14, or greater than 15. In some embodiments, the N / P ratio is 17, or 18, or 19, or 20.

[0090] Suitable mRNA-supported lipid nanoparticles may be fabricated in a variety of sizes. In some embodiments, the size of the mRNA-supported lipid nanoparticles before spray drying is determined by the length of the maximum diameter of the lipid nanoparticles. In some embodiments, the mRNA-supported lipid nanoparticles have a size of about 250 nm or less before spray drying (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less). In some embodiments, suitable liposomes have a size in the range of about 10 to 250 nm (e.g., in the range of about 10 to 225 nm, 10 to 200 nm, 10 to 175 nm, 10 to 150 nm, 10 to 125 nm, 10 to 100 nm, 10 to 75 nm, or 10 to 50 nm). In some embodiments, the mRNA-supported lipid nanoparticles have a pre-spray-dry size in the range of approximately 100–250 nm (e.g., in the ranges of approximately 100–225 nm, 100–200 nm, 100–175 nm, or 100–150 nm). In some embodiments, the mRNA-supported lipid nanoparticles have a pre-spray-dry size in the range of approximately 10–100 nm (e.g., in the ranges of approximately 10–90 nm, 10–80 nm, 10–70 nm, 10–60 nm, or 10–50 nm). In certain embodiments, the mRNA-supported lipid nanoparticles have a pre-spray-dry size of less than approximately 100 nm.

[0091] Various other methods known in the art can be used to determine the dimensions of liposome populations. One such dimensional determination method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. By sonication of the liposome suspension by either bath sonication or probe sonication, the diameter can be determined. The size gradually decreases to small ULVs of less than approximately 0.05 micrometers. Homogenization is another method that utilizes shear energy to fragment larger liposomes into smaller ones. In a typical homogenization procedure, MLVs are recycled using a standard emulsion homogenizer until a size of selected liposomes, typically about 0.1–0.5 micrometers, is observed. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421–150 (1981) (incorporated herein by reference). The average liposome diameter can be reduced by sonication of the formed liposomes. Intermittent sonication cycles can be alternating with QELS evaluation to lead to efficient liposome synthesis.

[0092] Suitable mRNA-supported lipid nanoparticles include one or more of the following: cationic lipids, PEGylated lipids, non-cationic lipids, and cholesterol-based lipids.

[0093] Cationic lipids As used herein, the term “cationic lipid” refers to any of the numerous lipid and lipidoid species that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids are documented in the literature, and many are commercially available.

[0094] Suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids described in International Patent Publication WO2010 / 144740, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention use a cationic lipid having the following compound structure: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate: [ka] and its pharmaceutically acceptable salts.

[0095] Other suitable cationic lipids for use in the compositions and methods of the present invention include ionizable cationic lipids described in International Patent Publication WO2013 / 149140, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use a cationic lipid of one of the following formulas: [ka] or a pharmaceutically acceptable salt thereof, wherein R1 and R2 are each independently of water Element, optionally substituted, variable saturated or unsaturated C1-C 20 Alkyl, and optionally substituted, variable saturated or unsaturated C6-C 20 Selected from the group consisting of acyls, in the formula L1 and L2 are each independently hydrogen, optionally substituted with C1-C 30 Alkyl, optionally substituted variable unsaturated C1-C 30 Alkenyl and optionally substituted C1-C 30Selected from the group consisting of alkynyls, where m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and where n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-l-yl)tetracosa-15,18-dien-1-amine ("HGT5000") having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-triene-l-amine ("HGT5001"): [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002") having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0096] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids described as amino alcohol lipidoids in International Patent Publication WO2010 / 053572, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention utilize cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0097] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2016 / 118725, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention utilize cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0098] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2016 / 118724, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention utilize cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0099] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl15,18,21,24-tetraaza-octatriacontane and pharmaceutically acceptable salts thereof.

[0100] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publications WO2013 / 063468 and WO2016 / 205691, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] or comprising a pharmaceutically acceptable salt thereof, where RL Each of these cases is independently and arbitrarily substituted C6-C 40 It is an alkenyl. In certain embodiments, the compositions and methods of the present invention are cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0101] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2015 / 184256, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; each R Ais independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclic, optionally substituted 3- to 14-member heterocyclic, optionally substituted C6-14 aryl, optionally substituted 5- to 14-member heteroaryl or halogen, and each R B is independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclic, optionally substituted 3- to 14-member heterocyclic, optionally substituted C6-14 aryl, optionally substituted 5- to 14-member heteroaryl or halogen. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "Target 23" having the following compound structure:

Chemical formula

[0102] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure:

Chemical formula

Chemical formula

Chemical formula

[0103] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in U.S. Provisional Patent Application No. 62 / 758,179, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] or comprising a pharmaceutically acceptable salt thereof, wherein each R 1 and R 2 H or C 1- C6 aliphatic, where each m is an integer with a value between 1 and 4, each A is a covalent bond or arrine, and each L 1 These are independently ester, thioester, disulfide, or anhydride groups, and each L 2 C 2- C 10 It is aliphatic, and each X 1 Each R is independently either H or OH, and each R 3 It is independent, C6-C 20 It is aliphatic. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof.

[0104] Other suitable cationic lipids for use in the compositions and methods of the present invention include, as incorporated herein by reference, J. McClellan, MCKing, Cell This includes cationic lipids as described in 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277. In certain embodiments, the cationic lipids of the compositions and methods of the present invention are cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0105] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2015 / 199952, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0106] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 004143, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0107] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 075531, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] or comprising a pharmaceutically acceptable salt thereof, in the formula, L 1 or L 2 One of them is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NRa C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O- Yes; another L 1 or L 2 -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O- or direct bond; G 1 and G 2 These are each independently unsubstituted C1-C 12 Alkylene or C1-C 12 It is an alkenylene; G 3 is C1-C 24 Alkylene, C1-C 24 Alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 It is alkyl; R 1 and R 2 Each is independently C6-C 24 Alkyl or C6-C 24 It is an alkenil; R 3 H, OR 5 , CN, -C(=O)OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 And R 4 is C1-C 12 It is alkyl; R 5 x is H or C1-C6 alkyl; x is 0, 1, or 2.

[0108] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication 2017 / 117528, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention utilize cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0109] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2017 / 049245, which are incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the present invention is a compound of one of the following formulas: [ka] and its pharmaceutically acceptable salts. For any one of these four formulas, R4 is -(CH2) n Q and -(CH2) n Selected independently from CHQR, Q is -OR, -OH, -O(CH2) nSelected from the group consisting of N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), and heterocycles, where n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention are cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0110] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publications WO2017 / 173054 and WO2015 / 095340, respectively, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention utilize cationic lipids having the following compound structures: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0111] Other suitable cationic lipids for use in the compositions and methods of the present invention include cholesterol-based cationic lipids. In certain embodiments, the compositions and methods of the present invention include imidazole cholesterol esters or "ICE" having the following compound structures: [ka] and its pharmaceutically acceptable salts.

[0112] Other suitable cationic lipids for use in the compositions and methods of the present invention include cleavable cationic lipids described in International Patent Publication WO2012 / 170889, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention use cationic lipids of the following formula: [ka] The formula includes, where R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl, and where R2 is selected from the group consisting of one of the following two formulas: [ka] In the formula, R3 and R4 are each independently of a variable saturated or unsaturated C6-C which can be optionally substituted. 20 Alkyl and optionally substituted variable saturated or unsaturated C6-C 20 Selected from the group consisting of acyls, where n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the composition and method of the present invention is a cationic lipid "HGT4001" having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and its pharmaceutically acceptable salts. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and its pharmaceutically acceptable salts.

[0113] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cleavable cationic lipids described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having one of the general formulas or one of the structures (1a)-(21a), (1b)-(21b), and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the structure of formula (I'): [ka] During the ceremony, RX is independently -H, -L1-R1, or -L5A-L5B-B', Each of L1, L2, and L3 is independently a covalent bond, -C(O)-, -C(O)O-, -C(O)S-, or -C(O)NRL-, Each L4A and L5A is independently -C(O)-, -C(O)O-, or -C(O)NRL-, Each L4B and L5B is independently a C1-C20 alkylene, a C2-C20 alkenylene, or a C2-C20 alkynylene. Each of B and B' is an NR4R5 or 5-10 member nitrogen-containing heteroaryl. Each of R1, R2, and R3 is independently a C6-C30 alkyl, C6-C30 alkenyl, or C6-C30 alkynyl. Each R4 and R5 is independently hydrogen, C1-C10 alkyl, C2-C10 alkenyl, or C2-C10 alkynyl, each RL is independently hydrogen, C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl.

[0114] In certain embodiments, the compositions and methods of the invention have the following compound structure 6 contain a cationic lipid that is compound (139) of 2 / 672,194: [Chemical formula] .

[0115] In some embodiments, the compositions and methods of the invention include a cationic lipid, N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (“DOTMA”). (Feigner et al. (Proc. Nat’l Acad. Sci. 84,7413(1987); U.S. Patent No. 4,897,355, which is incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the invention include, for example, 5-carboxyspermylglycine dioctadecylamide (“DOGS”), 2,3-dioleyloxy-N-[2(spermine-carboxamide)ethyl]-N,N-dimethyl-l-propanaminium (“DOSPA”) (Behr et al. Proc. Nat.’l Acad. Sci. 86,6982(1989); U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), l,2-dioleoyl-3-dimethylammonium-propane (“DODAP”), l,2-dioleoyl-3-trimethylammonium-propane (“DOTAP”).

[0116] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include l,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"), 1,2-dilinoleyloxyoxy-N,N-dimethyl-3-aminopropane ("DLinDMA"), l,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"), N- Dioleyl-N,N-dimethylammonium chloride ("DODAC"), N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimillitylyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutane-4-oxy)-l-(cis,cis-9,12-octadecadieneoxy)pro Pan ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethicone (cis,cis-9',l-2'-octadecadieneoxy)propane ("CpLinDMA"); N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy- N,N-dimethylpropylamine ("DLinDAP"), l,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP"), l,2-dilinoleylcarbamyl-3-dimethylaminopropane ("DLinCDAP"), 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"), 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)- N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA”); (2R)-2-((8-[(3β)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA(2R)”); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (“octyl-CLinDMA(2S)”); 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (“DLin-K-XTC2-DMA”), and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethyl ethanamine (“DLin-KC2-DMA”) (see International Publication No. WO 2010 / 042877, which is incorporated herein by reference; Semple et al., Nature Biotech. 28:172-176 (2010)). (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, D.V., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Publication No. WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0117] In some embodiments, one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100"); and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").

[0118] In some embodiments, the compositions of the present invention contain one or more cationic lipids constituting at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, for example, measured by the weight of lipid nanoparticles. In some embodiments, the compositions of the present invention contain one or more cationic lipids constituting at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 80% of the total lipid content in the composition, for example, measured by the mol% of lipid nanoparticles. In some embodiments, the compositions of the present invention contain one or more cationic lipids constituting about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, measured by weight of lipid nanoparticles.

[0119] In some embodiments, sterol-based cationic lipids may be used instead of, or in addition to, the cationic lipids described herein. Suitable sterol-based cationic lipids include dialkylamino-containing sterol-based cationic lipids, imidazole-containing sterol-based cationic lipids, and guanidinium-containing sterol-based cationic lipids. For example, in certain embodiments, imidazole-containing sterol-based cationic lipids may be used as shown by structure (I) below. The target is a composition containing one or more sterol-based cationic lipids, such as zoles, imidazole cholesterol ester, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3-yl 3-(1H-imidazole-4-yl)propanoate. In certain embodiments, lipid nanoparticles for the delivery of functional protein-encoding RNA (e.g., mRNA) may comprise one or more imidazole-based cationic lipids, such as imidazole cholesterol esters, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3-yl 3-(1H-imidazole-4-yl)propanoate, as shown by the following structure. [ka]

[0120] In some embodiments, the proportion of cationic lipids in liposomes may be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, cationic lipids constitute about 30–50% by weight of liposomes (e.g., about 30–45% by weight, about 30–40% by weight, about 35–50% by weight, about 35–45% by weight, or about 35–40% by weight). In some embodiments, cationic lipids (e.g., ICE lipids) constitute about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, or about 80% by molar ratio of liposomes.

[0121] PEGylated lipids In some embodiments, a preferred lipid solution comprises one or more PEGylated lipids. For example, the use of derivatized lipids such as polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides (PEG-CER) including N-octanoyl-sphingosine-l-[succinyl(methoxypolyethylene glycol)-2000](C8 PEG-2000 ceramide) is also intended by the present invention. The intended PEGylated lipids have a length of C6-C 20 This includes, but is not limited to, polyethylene glycol chains up to 5 kDa in length covalently bonded to lipids having alkyl chains. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, certain useful interchangeable lipids are those with shorter acyl chains (e.g., C 14 or C 18 It is a PEG ceramide that has ).

[0122] PEG-modified phospholipids and derivatized lipids may constitute at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, or at least 20% of the total lipids within the liposome.

[0123] Noncationic / Helper Lipids As used herein, the term "noncationic lipid" means any neutral lipid, zwitterionic lipid, or anionic lipid. "Noncationic lipids" refer to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Examples of noncationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine. Examples include oil-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, l-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), or mixtures thereof.

[0124] In some embodiments, noncationic lipids may constitute at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% by weight or mole of the total lipids in a suitable lipid solution. In some embodiments, noncationic lipids may constitute about 20–50% (e.g., about 20–45%, about 20–40%, about 25–50%, about 25–45%, or about 25–40%) by weight or mole of the total lipids in a suitable lipid solution.

[0125] Cholesterol-based lipids In some embodiments, a preferred lipid solution comprises one or more cholesterol-based lipids. For example, preferred cholesterol-based cationic lipids include, for example, DC-Choi(N,N-dimethyl-N-ethylcarboxamide cholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179,280 (1991); Wolf et al. BioTechniques 23,139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid(s) constitute at least about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or moles of the total lipids in the preferred lipid solution. In some embodiments, cholesterol lipids(s) constitute about 20–50% (e.g., about 20–45%, about 20–40%, about 25–50%, about 25–45%, or about 25–40%) of the total lipids in a suitable lipid solution, by weight or moles.

[0126] Exemplary combinations of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids are described in the Examples section. For example, suitable lipid solutions may include cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; or HGT5001, DPPC, cholesterol, and DMG-PEG2K. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids in the lipid mixture, as well as the relative molar ratios of these lipids, are based on the characteristics of the selected lipids, as well as the properties and characteristics of the mRNA to be encapsulated. Further considerations include, for example, the saturation of the alkyl chain of the selected lipid(s), as well as its size, charge, pH, pKa, fusionability, and toxicity. Therefore, the molar ratio can be adjusted as appropriate.

[0127] Typically, mRNA-supported lipid nanoparticles account for 0.1% to 30% of the total solid content of the spray-dried mixture. In some embodiments, the total solid content of the spray-dried mRNA-supported nanoparticle composition is 0.5% to 20%. In some embodiments, the total solid content of the spray-dried mRNA-supported nanoparticle composition is 2% to 20%. In some embodiments, the total solid content of the spray-dried mRNA-supported nanoparticle composition is 2% to 15%. In some embodiments, the total solid content of the spray-dried mRNA-supported nanoparticle composition is 2% to 10%.

[0128] polymer Various polymers can be used in the spray-dried mRNA-LNP according to the present invention. Typically, preferred polymers have low toxicity and are well tolerable over a wide range of concentrations. In some embodiments, preferred polymers are positively charged. Exemplary polymers, but not limited to these, include chitosan, polyester, polyurethane, polycarbonate, poly(lactic acid) (PLA), poly(lactic acid-coglycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamine, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and methacrylate polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethylmethyl acrylate) (pDMAEMA).

[0129] In some embodiments, a suitable polymer is a polymethacrylate derivative comprising repeating units of monomers having the following structure: [ka] In the formula, R 1 They are independently C1-C6 alkyl groups, and L 1 These are independently C2-C6 alkylenes, and R 1A and R 1B Each of them is independently a C1-C6 alkyl group, and a is an integer between 1 and 500; R 2 They are independently C1-C6 alkyl groups, and R 2A R is independently a C1-C6 alkyl group, and b is an integer between 1 and 500; R 3 They are independently C1-C6 alkyl groups, and R 3A The elements are independently C1-C6 alkyl groups, and c is an integer between 1 and 500.

[0130] In some embodiments, the repeating unit may be represented by the following: [Chemical formula] In the formula, each R 4 is independently R 2 or R 3 and each R 4A is independently R 2A or R 3A and d is an integer from 1 to 500. In the above structure, L 1 may be -CH2CH2, each R 1A and R 1B are methyl, and / or each R 1 , R 2 , and R 3 are methyl, and / or R 2A is butyl, R 3A is methyl.

[0131] In some embodiments, exemplary members of the polymer are represented by the following formula. [Chemical formula]

[0132] Exemplary members of the group are known by the trade name Eudragit. In some embodiments of the present invention, the polymers contained in spray-dried mRNA-LNP formulations are Eudragit polymers. Eudragit is derived from esters of acrylic and methacrylic acids, forming a class of amorphous polymers or copolymers whose properties are determined by their functional groups. Individual grades of Eudragit differ in the proportion of neutral, alkaline, or acidic groups, and therefore in their physicochemical properties. Some of the available forms are anionic, some cationic, and some neutral. In some embodiments, this type of polymer used with mRNA-LNP complexes for spray drying has tertiary amine groups positively charged on the methacrylic acid backbone. They may form complexes with mRNA and encapsulate it. They have a higher Tg and excellent thermoplastic properties that aid in spray drying. These polymers are insoluble at higher pH and therefore can help protect mRNA from degradation in surfactants. Eudragit polymers are approved for oral use by the U.S. Food and Drug Administration (FDA) and have been used in commercially available oral products for decades. These polymers are low in toxicity and well tolerable across a wide range of concentrations.

[0133] In some embodiments, the polymers used include the Eudragit class, which is insoluble at pH 5 or higher. In some embodiments, this property of the polymer is used for oral delivery of the active mRNA component so that the mRNA is not released into the saliva. One advantage of these polymers is that because the functional polymer is insoluble in the mouth, the active component and other The objective is to strongly block the taste and odor of the excipients.

[0134] Therefore, in some embodiments, these methacrylic acid derivative polymers described above are used to prepare formulations for stable spray-dried mRNA-LNP dry powder. In some embodiments, these methacrylic acid derivative polymers are used for sustained release of mRNA. In some embodiments, methacrylic acid derivative polymers insoluble at pH ≥ 5 are used for delivery of suitable mRNA to the gastrointestinal tract (GI). In some embodiments, methacrylic acid derivative polymers are used for delivery of suitable mRNA to the colon.

[0135] In some embodiments, the polymer constitutes 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, or less than 5% of the total weight of the dry powder. In some embodiments, the polymer constitutes 1% to 60% of the total weight of the dry powder. In some embodiments, the polymer constitutes about 1-90%, 10-90%, 20-90%, 10-50%, 1-20%, 2-15%, 3-12%, 1-10%, 2-9%, 3-8%, 1-7%, 2-6%, or 3-5% of the total weight of the dry powder.

[0136] Other excipients In some embodiments, sugars and other excipients are added to the mRNA-supported nanoparticles and polymer mixture before spray drying.

[0137] sugar Various sugars may be added to the mixture before spray drying. The sugars are intended to provide stabilization during dehydration. Exemplary sugars suitable for the formulation are monosaccharides, disaccharides, and polysaccharides selected from the group consisting of glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inphosphate, xylitol, sorbitol, lactitol, and mannitol.

[0138] In some embodiments, the preferred sugar is lactose and / or mannitol. In some embodiments, the preferred sugar is mannitol. In some embodiments, mannitol is added at a concentration of about 1-10%. In some embodiments, mannitol is added at a concentration of about 2-10%. In some embodiments, mannitol is added at a concentration of about 3-10%. In some embodiments, mannitol is added at a concentration of about 4-10%. In some embodiments, mannitol is added at a concentration of about 5-10%.

[0139] In some embodiments, the preferred sugar is trehalose. In some embodiments, both mannitol and trehalose are added.

[0140] surfactant In some embodiments, surfactants are used as excipients. Surfactants increase the surface tension of the composition. In some embodiments, surfactants used in spray-dried mRNA lipid compositions include CHAPS (3-[(3-coramidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tw The surfactant is selected from the group consisting of een 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers. In some embodiments, the surfactant is a poloxamer.

[0141] Various other excipients may be included in the spray-dried formulation. These include, but are not limited to, various polyesters, polyurethanes, poly(ester amides), poly(orthoesters), polyanhydrides, poly(anhydride-co-imides), polyphosphoesters, polyphosphazenes, amino acids, collagen, chitosan, cyclodextrin, polysaccharides, maltodextrin, albumin, various sugars, surfactants, buffering agents, and salts.

[0142] Dry powder The dry powder prepared according to the present invention comprises a plurality of spray-dried particles. Residual moisture content, aerosol performance, and physicochemical stability are important parameters of spray-dried pharmaceuticals. This is determined by the weight loss of the sample after heating and drying using the following formula: Moisture content % = [(SW b - SW a ) / SW b × 100% where SW b is the weight of the sample before heating and SW a is the weight of the sample after heating. Perkin Elmer TGA 7 (Perkin Elmer) is an example of a commercially available instrument equipped with relevant software for measuring residual moisture in nanoparticles.

[0143] Generally, a range of acceptable particle size distributions is maintained for the uniformity of the dosage of the active pharmaceutical ingredient of the formulation. Particularly for pulmonary delivery, the particles of the dry powder formulation affect the distribution and deposition of the aerosol within the respiratory system. In many cases, particle deposition in the large conducting airways is preferred for the effective absorption and distribution of the therapeutic component. Aerosols of very fine particles, for example, particles having a diameter of less than 1 micrometer, can be deposited peripherally for effective absorption by specific cells of the lung such as smooth muscle for an active pharmaceutical ingredient that functions as a bronchodilator.

[0144] The primary particle size distribution of the spray-dried particles is measured by dynamic light scattering represented by the Z-average. The Z-average is an average calculated from the intensity-weighted distribution of the particle diameters, also known as the cumulative size, and is expressed by the formula, D z =ΣS i / Σ(S i / D i ), where S i is the scattering intensity from particle "i" and D i is the diameter of the particle. In addition to these parameters, a fine and coarse fraction of the particles is defined.

[0145] On the other hand, the polydispersity index (PDI) is a measure of the distribution of the molecular weights of a given particle sample.

[0146] The zeta potential is a measure of the magnitude of the electrostatic or charge repulsion / attraction between particles and is one of the fundamental parameters known to affect stability. The scale provides detailed insights into the causes of dispersion, aggregation, or flocculation and can be applied to improve the formulation of dispersants, emulsions, and suspensions. ZP indicates the degree of repulsion between neighboring and similarly charged particles in a dispersion. A high ZP indicates highly charged particles. Generally, a high ZP (negative or positive) prevents the aggregation of particles due to electrical repulsion and electrically stabilizes the nanoparticle dispersion. On the other hand, when the ZP is low, the attractive force exceeds the repulsive force and the dispersion coagulates or aggregates. The zeta potential can be measured by photon correlation spectroscopy using an available instrument system such as the Zetasizer Nano (Malvern Instruments).

[0147] The sphericity of the nanoparticles is a measure of how closely the particles reassemble into a sphere. This can be measured by Waddell's formula and is represented by Ψ determined as follows.

Chemical formula

[0148] Finally, the mRNA content and / or integrity are assessed by HPLC or Northern blot analysis. In some embodiments, mass spectrometry and other relevant spectrophotochemical analyses are performed to assess the stability, integrity, and quality of the mRNA nanoparticle formulation.

[0149] The spray-dried mRNA lipid nanoparticles of the present invention contain less than 10% moisture (w / w). In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 9% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 8% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 7% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 6% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 5% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 4% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 3% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 2% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 1% moisture. In some embodiments, the moisture content of the spray-dried mRNA-LNP formulation is less than 5%.

[0150] A spray-dried mRNA LNP formulation is provided herein, wherein the mRNA lipid nanoparticles are heterogeneous in size, having a fine fraction (fnfr) of less than 10 μm. In some embodiments, the fnfr of the mRNA-LNP dried powder particles of the present invention is in the range of 1 to 10 μm. The optimal Z-mean for the mRNA-LNP spray-dried sample may be ≤10 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample is ≤8 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample is ≤5 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample should be in the range of 0.01 to 10 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample should be in the range of 0.1 to 10 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample should be in the range of 0.1 to 5 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample should be in the range of 0.1 to 3 μm. In some embodiments, the Z-mean of the mRNA-LNP spray-dried sample should be in the range of 0.1–5 μm.

[0151] In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 200 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 180 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 150 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 120 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 100 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles have a Z-average of less than 50 nm before spray drying.

[0152] In some embodiments, mRNA lipid nanoparticles are less than 5000 nm after spray drying. The mRNA lipid nanoparticles include a Z-average of less than 4000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 3000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 2000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 1000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 500 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 500 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 300 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 200 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 100 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles include a Z-average of less than 50 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles contain a Z-average of less than 10 nm after spray drying.

[0153] Dried powder formulations of mRNA-LNPs are provided herein, the average sphericity of mRNA-LNP particles being in the range of 0.7 to 1. In some embodiments, the average sphericity of mRNA lipid nanoparticles is greater than 0.7, greater than 0.8, or greater than 0.9.

[0154] In some embodiments, the zeta potential of the nanoparticles for this application is +30mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is +20mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is +10mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is 0mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is -10mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is -20mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is +20mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is -20mV to -30mV. In some embodiments, the zeta potential of the nanoparticles is approximately -30mV, and the polydispersity index is less than approximately 0.3.

[0155] In some embodiments, the provided mRNA-LNP dry powder formulation contains up to 30%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% mRNA by the total weight of the dry powder. In some embodiments, the mRNA constitutes 1-6%, 1-5%, 1-4%, 1-3%, 2-10%, 2-9%, 2-8%, 2-7%, 2-6%, 2-5%, 2-10%, 2-15%, 2-20%, or 2-30% of the total weight of the dry powder.

[0156] stability Spray-dried mRNA-LNP formulations that are stable when stored under various conditions are provided. As used herein, the term “stable” refers to mRNA that retains more than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% integrity after storage. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing temperatures (-20°C), 4°C, or room temperature for more than one year. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing temperatures (-20°C), 4°C, or room temperature for more than 11 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing temperatures (-20°C), 4°C, or room temperature for more than 10 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at freezing temperatures (-20°C), 4°C, or room temperature for more than 9 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein can be stored frozen (-20°C), at 4°C, or at room temperature for more than 8 months. It is stable when stored at the specified temperature. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at the frozen temperature (-20°C), 4°C, or room temperature for more than 7 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at the frozen temperature (-20°C), 4°C, or room temperature for more than 6 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at the frozen temperature (-20°C), 4°C, or room temperature for more than 5 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at the frozen temperature (-20°C), 4°C, or room temperature for more than 4 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored at the frozen temperature (-20°C), 4°C, or room temperature for more than 3 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than two months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than one month.

[0157] In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 8 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 7 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 6 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 5 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 4 weeks.

[0158] Messenger RNA The present invention can be used to formulate any mRNA. As used herein, mRNA is a type of RNA that transmits information from DNA to ribosomes in order to translate the encoded protein. mRNA can be synthesized by any of a variety of known methods. For example, mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system which may include DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitors. The exact conditions will vary depending on the specific application.

[0159] The present invention can be used to formulate mRNA of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNA of lengths of approximately 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNA in the range of lengths of approximately 1–20 kb, approximately 1–15 kb, approximately 1–10 kb, approximately 5–20 kb, approximately 5–15 kb, approximately 5–12 kb, approximately 5–10 kb, approximately 8–20 kb, or approximately 8–15 kb.

[0160] The present invention can be used to formulate unmodified mRNA or mRNA containing one or more modifications that generally enhance stability. In some embodiments, the modifications are: Selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions (UTRs).

[0161] In some embodiments, mRNA modification may include nucleotide modification of the RNA. Modified mRNA according to the present invention may include, for example, skeletal modification, sugar modification, or base modification. In some embodiments, mRNA may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl Nyl-adenine, 2-thiocytosine, 3-methylcytosine, 4-acetylcytosine, 5-methylcytosine, 2,6-diaminopurine, 1-methylguanine, 2-methylguanine, 2,2-dimethylguanine, 7-methylguanine, inosine, 1-methylinosine, pseudouracil (5-uracil), dihydrouracil, 2-thiouracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thio Uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyluracil, 5-methyl-2-thiouracil, 5-methyluracil, N-uracil-5-oxyacetate methyl ester, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, uracil-5-oxyacetate methyl ester They may be synthesized as ruesters, uracil-5-oxyacetic acid(v), 1-methyl-pseuduracil, quosin, beta-D-mannosyl-quosin, wybutoxosine, and modified nucleotide analogs or derivatives of purines such as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine, as well as pyrimidines.The preparation of such analogues is known to those skilled in the art, for example, from U.S. Patents 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642 (their disclosures are included herein in their entirety by reference).

[0162] In some embodiments, mRNA may include RNA backbone modifications. Typically, backbone modifications are modifications in which the phosphates of the nucleotide backbone contained in RNA are chemically modified. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methylphosphonates, methylphosphoramidites, phosphoramidites, phosphorothioates (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphates, and positively charged guanidium groups, meaning that the phosphodiester bond is replaced with other anionic, cationic, or neutral groups.

[0163] In some embodiments, mRNA may include sugar modifications. Typical sugar modifications are chemical modifications of sugars in nucleotides, and as sugar modifications, they include, but are not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotides, and 2'-deoxy-2'-C-alkyloligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate). Examples of sugar modifications include those selected from the group consisting of 2'-C-alkyl oligoribonucleotides and their isomers (2'-aracithidine 5'-triphosphate, 2'-arauridine 5'-triphosphate), or azido triphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0164] In some embodiments, mRNA may include base modifications (base modifications) of nucleotides. Modified nucleotides that include base modifications are also called base-modified nucleotides. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azashi Examples include thidine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0165] mRNA synthesis typically involves the addition of a "cap" to the 5' end and a "tail" to the 3' end. The presence of the cap is important for conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" protects the mRNA from exonuclease degradation.

[0166] Therefore, in some embodiments, mRNA contains a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase to produce a 5'-5' reverse triphosphate bond; and then, the 7-nitrogen of guanine is methylated by methyltransferase. 2'-O-methylation can also occur at the first and / or second bases following the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (where m represents a 2'-O-methyl residue).

[0167] In some embodiments, the mRNA includes a 3' tail structure. The tail structure typically includes a poly(A) tail and / or a poly(C) tail. The polyA or polyC tail on the 3' end of the mRNA typically contains at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, and at least 600 adenosine nucleotides. Each comprises an adenosine nucleotide or cytosine nucleotide, at least 650 adenosine nucleotides or cytosine nucleotides, at least 700 adenosine nucleotides or cytosine nucleotides, at least 750 adenosine nucleotides or cytosine nucleotides, at least 800 adenosine nucleotides or cytosine nucleotides, at least 850 adenosine nucleotides or cytosine nucleotides, at least 900 adenosine nucleotides or cytosine nucleotides, at least 950 adenosine nucleotides or cytosine nucleotides, or at least 1 kb of adenosine nucleotide or cytosine nucleotide.In some embodiments, the poly-A tail or poly-C tail each contains approximately 10 to 800 adenosine nucleotides or cytosine nucleotides (for example, approximately 10 to 200 adenosine nucleotides or cytosine nucleotides, approximately 10 to 300 adenosine nucleotides or cytosine nucleotides, approximately 10 to 400 adenosine nucleotides or cytosine nucleotides, approximately 10 to 500 adenosine nucleotides or cytosine nucleotides, approximately 10 to 550 adenosine nucleotides or cytosine nucleotides, approximately 10 to 600 adenosine nucleotides or cytosine nucleotides, approximately 50 to 600 adenosine nucleotides or cytosine nucleotides, approximately 100 to 600 adenosine nucleotides or cytosine nucleotides, approximately 150 to 600 adenosine nucleotides or cytosine nucleotides, approximately 200 to This could be 600 adenosine nucleotides or cytosine nucleotides, about 250-600 adenosine nucleotides or cytosine nucleotides, about 300-600 adenosine nucleotides or cytosine nucleotides, about 350-600 adenosine nucleotides or cytosine nucleotides, about 400-600 adenosine nucleotides or cytosine nucleotides, about 450-600 adenosine nucleotides or cytosine nucleotides, about 500-600 adenosine nucleotides or cytosine nucleotides, about 10-150 adenosine nucleotides or cytosine nucleotides, about 10-100 adenosine nucleotides or cytosine nucleotides, about 20-70 adenosine nucleotides or cytosine nucleotides, or about 20-60 adenosine nucleotides or cytosine nucleotides). In some embodiments, the tail structure includes combinations of poly(A) tails and poly(C) tails having various lengths as described herein. In some embodiments, the tail structure contains at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.In some embodiments, the tail structure contains at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0168] In some embodiments, the mRNA includes a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region includes one or more elements that affect the stability or translation of the mRNA, such as iron-responsive elements.

[0169] In some embodiments, the 3' untranslated region includes one or more of the following: a polyadenylation signal, a protein binding site that affects the positional stability of mRNA in a cell, or one or more miRNA binding sites.

[0170] Exemplary 5' and / or 3' untranslated sequences can be obtained from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citrate cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' untranslated sequence may include a portion or fragment of the CMV pre-early 1 (IE1) gene to improve nuclease resistance and / or improve the half-life of the polynucleotide. To further stabilize the polynucleotide, it may encode human growth hormone (hGH). Inclusion of the sequence or fragment of a polynucleotide (e.g., mRNA) at its 3' end or in its untranslated region is also considered. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, and include modifications made, for example, to improve the resistance of such polynucleotides to in vivonuclease digestion.

[0171] mRNA construct design can be specified as X-coding sequence-Y. Exemplary X and Y nucleotide sequences are as follows: X(5' untranslated sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y(3' untranslated sequence) = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0172] While mRNA derived from in vitro transcription reactions is preferred in some embodiments, other sources of mRNA, including mRNA produced from bacteria, fungi, plants, and / or animals, are intended to be within the scope of the present invention.

[0173] In some embodiments, the preferred mRNA sequence is an mRNA sequence encoding the cystic fibrosis transmembrane conductance regulator CFTR (hCFTR) protein, which is a human cystic fibrosis transmembrane receptor. In some embodiments, the preferred mRNA sequence is a codon optimized for efficient expression in human cells. A detailed description of the preparation and optimization of CFTR mRNA for therapeutic delivery is found in U.S. Patent Application No. 15 / 981,757, filed May 16, 2018, and its disclosure is incorporated herein by reference in its entirety.

[0174] Pharmaceutical preparations and therapeutic use The pharmaceutical compositions of the dried powder formulations of the present invention can be used in a variety of therapeutic applications. To facilitate in vivo delivery, the dried powder formulations described herein may be combined with one or more additional pharmaceutical carriers, targeted ligands, or stabilizing reagents. In some embodiments, one or more additional pharmaceutical carriers may be added to the formulation before spray drying. In some embodiments, one or more additional pharmaceutical carriers may be added to the formulation using post-insertion techniques (i.e., after spray drying). Formulation techniques and drug administration can be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., (latest edition).

[0175] The dried powder formulations described herein may be administered in powder form or, alternatively, in vivo after reconstitution. Preferred routes of administration for the formulations described herein include oral administration, rectal administration, vaginal administration, transmucosal administration, pulmonary administration including intratracheal or inhalation administration, or intestinal administration, parenteral delivery including intradermal injection, transdermal (local) injection, intramuscular injection, subcutaneous injection, and intrathecal injection, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, or nasal administration. In certain embodiments, intramuscular administration is performed in muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, this administration results in the delivery of nucleic acids to muscle cells. In some embodiments, this administration results in the delivery of nucleic acids to hepatocytes (i.e., liver cells).

[0176] The pharmaceutical formulations of the present invention may be administered topically rather than systemically, for example, by direct injection of the pharmaceutical formulation into the targeted tissue, preferably in a sustained-release formulation. Topical delivery may be achieved in various ways depending on the targeted tissue. Examples of tissues where the delivered mRNA may be delivered and / or expressed include, but are not limited to, the lungs, liver, kidneys, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In some embodiments, the targeted tissue is the liver. For example, an aerosol containing the composition of the present invention may be inhaled (for nasal, tracheal, or bronchial delivery). In some embodiments, the composition of the present invention may be delivered using a metered-dose inhaler. In some embodiments, the composition of the present invention may be reconstituted and atomized for delivery. In some embodiments, the composition of the present invention may be injected into the site of injury, disease onset, or pain. In some embodiments, the composition of the present invention may be provided in lozenge form for oral, tracheal, or esophageal application. In some embodiments, the composition of the present invention may be supplied in liquid, tablet, or capsule form for administration into the stomach or intestines. In some embodiments, the compositions of the present invention may be supplied in the form of suppositories for rectal or vaginal application. In some embodiments, the compositions of the present invention may be delivered to the eyes by use as a cream, drops, or even by injection.

[0177] In some embodiments, the dry powder formulation of the present invention is reconstituted into a liquid solution and atomized for delivery. Atomization can be achieved by any atomizer known in the art. The atomizer converts the liquid into a mist, which can then be more easily inhaled into the lungs. Atomizers are effective for infants, children, and adults. Atomizers can atomize high doses of inhaled medication. Typically, the atomizer used in the present invention includes a removable mouthpiece.

[0178] In some embodiments, the dried powder formulations described herein may be used to deliver therapeutically effective amounts of mRNA for the treatment of various diseases or disorders. For example, the dried powder formulations prepared by spray drying according to the present invention may be administered orally, nasally, tracheally, or via the lungs or routes for the treatment of lung-related disorders such as cystic fibrosis. In some embodiments, the dried powder formulations are administered by inhalation. In some embodiments, the formulations are administered by a metered-dose inhaler. In some embodiments, the dried powder formulations are administered by intranasal spray. In some embodiments, the dried powder formulations are rehydrated and administered as intravenous infusion, injection, oral infusion, nasal infusion, and any other application readily conceivable by those skilled in the art.

[0179] The present invention can be used to treat a variety of other lung-related diseases, disorders, and symptoms. In some embodiments, the stable dried powder formulation of the present invention is useful for treating one or more of the following diseases or disorders: asthma; COPD; emphysema; primary ciliary dyskinesia with or without situs inversus (CILD1); Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Duvet syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-ray); cytochrome b-positive granulomatous disease, autosomal recessive; surfactant deficiency, pulmonary surfactant metabolic disorder 1, pulmonary surfactant metabolic disorder 2, pulmonary surfactant metabolic disorder 3; respiratory distress syndrome in premature infants; tuberculosis, lung viral diseases including influenza, and respiratory syncytial virus (RSV).

[0180] Therefore, in certain embodiments, the present invention enables delivery to the target lung or lung cells or The present invention provides a method for producing a dry powder composition containing full-length mRNA encoding a peptide or polypeptide for use in the treatment. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a cystic fibrosis membrane conductance regulator (CFTR) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an ATP-binding cassette subfamily A member 3 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a dynein axonemal intermediate chain 1 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a dynein axonemal heavy chain 5 (DNAH5) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an alpha-1-antitrypsin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a forkhead box P3 (FOXP3) protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding one or more surfactant proteins, for example, surfactant A protein, surfactant B protein, surfactant C protein, and surfactant D protein.

[0181] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target liver or hepatocyte. Such peptides and polypeptides may include those related to urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrosis disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery to or treatment with concentrated full-length mRNA of the liver or hepatocytes would provide the benefits of the dry powder.

[0182] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein related to urea cycle disorders. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an ornithine transcarbamylase (OTC) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an argininosuccinate synthetase 1 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a carbamoyl phosphate synthetase I protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an argininosuccinate lyase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an arginase protein.

[0183] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein associated with lysosome storage dysfunction. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an alpha-galactosidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a glucocerebrosidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an iduronate-2-sulfatase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an iduronidase protein. The present invention provides a method for producing a dry powder composition having full-length mRNA encoding an N-acetyl-alpha-D-glucosaminidase protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a heparan N-sulfatase protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a galactosamine-6-sulfatase protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a beta-galactosidase protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a lysosomal lipase protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a transcription factor EB (TFEB).

[0184] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein related to glycogen storage impairment. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an acid alpha-glucosidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a glucose-6-phosphatase (G6PC) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a liver glycogen phosphorylase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a muscle phosphoglycerate mutase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a glycogen debranching enzyme.

[0185] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein related to amino acid metabolism. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a phenylalanine hydroxylase enzyme. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a glutaryl-CoA dehydrogenase enzyme. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a propionyl-CoA carboxylase enzyme. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an oxalase alanine-glyoxylaminotransferase enzyme.

[0186] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein related to lipid metabolism or fibrous disorders. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an mTOR inhibitor. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the ATPase phospholipid transporter 8B1 (ATP8B1) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding one or more NF-kappa B inhibitors, such as I-kappa B alpha, interferon-associated developmental regulator 1 (IFRD1), and sirtuin 1 (SIRT1). In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a PPAR-gamma protein or This invention provides a method for producing a dried powder composition having a full-length mRNA encoding an active variant.

[0187] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein associated with methylmalonic acidemia. For example, in certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a methylmalonyl-CoA mutase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a methylmalonyl-CoA epimerase protein.

[0188] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA that can be delivered to or used to treat the liver and provide the benefits of the dry powder. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the ATP7B protein, also known as Wilson's disease protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the porphobilinogen deaminase enzyme. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding one of the coagulation enzymes such as factor VIII, factor IX, factor VII, and factor X. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the human hemochromatosis (HFE) protein.

[0189] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target cardiovascular structure or cardiovascular cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding vascular endothelial growth factor A protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding relaxin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding osteomorphic protein-9 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding osteomorphic protein-2 receptor protein.

[0190] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target muscle or muscle cell. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a dystrophin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a frataxin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target cardiac muscle or cardiomyocyte. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein that modulates one or both of potassium channels and sodium channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein that modulates the Kv7.1 channel in muscle tissue or muscle cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a protein that modulates the Nav1.5 channel in muscle tissue or muscle cells.

[0191] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target nervous system or nervous system cells. For example, in certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the survival motor neuron 1 protein. For example, in certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the survival motor neuron 2 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the frataxin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the ATP-binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding the CLN3 protein.

[0192] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of target blood or bone marrow or blood or bone marrow cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a beta-globin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a Bruton's tyrosine kinase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding one of the following, such as factor VIII, factor IX, factor VII, and factor X, or a coagulation enzyme.

[0193] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target kidney or kidney cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding type IV collagen alpha 5 chain (COL4A5) protein.

[0194] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of a target eye or eye cells. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an ATP-binding cassette subfamily A member 4 (ABCA4) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a retinosuxin protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a retinosuxin-specific 65kDa (RPE65) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a 290kDa centrosome protein (CEP290).

[0195] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a peptide or polypeptide for use in the delivery or treatment of a vaccine for a target or target cells. For example, in certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from an infectious agent such as a virus. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from an influenza virus. In certain embodiments, the present invention produces a dry powder composition having full-length mRNA encoding an antigen derived from a respiratory syncytial virus. The present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from rabies virus. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from cytomegalovirus. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from rotavirus. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from hepatitis virus, such as hepatitis A virus, hepatitis B virus, or hepatitis C virus. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from human papillomavirus. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from herpes simplex virus, such as herpes simplex virus type 1 or herpes simplex virus type 2. In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from human immunodeficiency virus, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from human metapneumovirus. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from human parainfluenza virus, such as human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from malaria virus. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from Zika virus.In a particular embodiment, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen derived from the chikungunya virus.

[0196] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen associated with a target cancer or an antigen identified from a target cancer cell. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen determined from the target's own cancer cells, i.e., for providing a personalized cancer vaccine. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antigen expressed from a mutant KRAS gene.

[0197] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody. In certain embodiments, the antibody may be a bispecific antibody. In certain embodiments, the antibody may be part of a fusion protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody against OX40. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody against VEGF. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody against tissue necrosis factor alpha. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody against CD3. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an antibody against CD19.

[0198] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an immunomodulatory factor. The present invention provides a method for producing a dry powder composition having full-length mRNA encoding interleukin 12. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding interleukin 23. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding interleukin 36 gamma. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding one or more constitutively active variants of interferon gene-stimulating factor (STING) proteins.

[0199] In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an endonuclease. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding an RNA-inducible DNA endonuclease protein such as Cas9 protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a meganuclease protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a transcription activator-like effector nuclease protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having full-length mRNA encoding a zinc finger nuclease protein.

[0200] The present invention may be used to treat a variety of other diseases, disorders, and conditions requiring sustained release of mRNA formulations. Examples of these include diseases in which mRNA delivery in the gastrointestinal tract is beneficial. Such diseases include, but are not limited to, apolipoprotein E deficiency, inflammatory bowel disease, or Crohn's disease; adherent G protein-coupled receptor VI deficiency; von Willebrand disease type 2; nephrolithiasis, calcium oxalate CAON-associated; and early-onset adult-onset diabetes mellitus type 8.

[0201] The present invention may be used to treat various other diseases, disorders, or conditions in which targeted delivery of mRNA preparations to tissues or organs may be beneficial. These may be modified by the association of polymers suitable for the purpose, with or without the association of specific targeted moieties. [Examples]

[0202] While certain compounds, compositions, and methods of the present invention have been described in detail according to certain embodiments, the following examples serve merely to illustrate the invention and are not intended to limit it.

[0203] Example 1. mRNA-LNP dried powder formulation recovered by spray drying In this example, LNP-encapsulated mRNA formulations were prepared with and without polymer, and then spray-dried. The results show that the LNP-encapsulated mRNA formulation prepared with polymer yielded an unexpectedly high recovery rate from the spray-drying process compared to the same mRNA-LNP formulation prepared without polymer.

[0204] In particular, two of the LNP-encapsulated mRNA preparations (mRNA encoding firefly luciferase (FFL), and preparations designated FFL-F1 and FFL-F2, respectively) were prepared, with or without polymer, using the respective individual compositions listed in Table 1. To prepare these preparations for spray drying, the FFL mRNA was first mixed with lipid nanoparticles (LNPs) using a gear pump to encapsulate the mRNA within the LNPs. Then, for the "using polymer" samples, the polymer solution was mixed with the mRNA-LNPs using a gear pump. The solutions were then spray-dried as shown in the graphical representation of the apparatus in Figure 1. The following conditions were used for spray drying: Inlet temperature 9 0°C, suction percentage 85%, pump percentage 25%, and outlet temperature 46-50°C. [Table 1]

[0205] result The spray-drying process on each LNP-mRNA formulation without polymer was unsuccessful. In all cases, as described in Table 1 (bottom) and shown in Figure 2, the material aggregated in the spray dryer, clogging various compartments of the spray dryer, resulting in little to no material recovery. However, the same two LNP-mRNA formulations prepared with polymer were successfully spray-dried, as described in Table 1 (bottom) and shown in Figure 2, yielding a recovery rate of over 40% from the spray-drying process.

[0206] The effects of spray drying on encapsulation efficiency and nanoparticle size (Z-mean) were measured before and after the spray drying process, and the values ​​are shown in Table 1 (bottom). For LNP-mRNA preparations prepared using polymers, there was no significant change in encapsulation efficiency before and after spray drying, and nanoparticle size was found to increase from before to after spray drying. For LNP-mRNA preparations prepared without polymers, these measurements could not be determined due to the failure of the spray drying process to produce any substantial material.

[0207] Example 2. Integrity and stability of mRNA dry powder formulation In this example, two mRNA preparations encoding argininosuccinate synthetase or ASS1 mRNA were prepared and their long-term stability was evaluated. In particular, one mRNA preparation was prepared that did not contain LNPs but contained a polymer (ASS1-F1). A second mRNA formulation containing a P+ polymer (ASS-F2) was prepared. Each formulation is further described in Table 2.

[0208] For the ASS1-F1 formulation, mRNA was directly mixed with the polymer using a gear pump. For the ASS1-F2 formulation, in order to encapsulate mRNA within LNPs, mRNA was first mixed with lipid nanoparticles (LNPs) using a gear pump, and then the polymer solution was mixed with the mRNA-LNPs using a gear pump. The final formulations were concentrated, and mannitol was added to each formulation. The solutions were then spray-dried as shown in the graphical representation of the apparatus in Figure 1. The following conditions were used for spray drying: inlet temperature 90°C, aspirator percentage 85%, pump percentage 25%, and outlet temperature 46-50°C. [Table 2]

[0209] Encapsulation efficiency and nanoparticle size. The effect of spray drying on encapsulation efficiency was measured before and after drying. In this example, the encapsulation efficiency of LNP-encapsulated mRNA in polymer-containing formulations was 75.28±1.43 before the process and 81.85±0.44 afterward, indicating that the spray drying process did not negatively affect encapsulation efficiency. The average nanoparticle sizes before and after spray drying were 99.4±1.3 and 426±12, respectively.

[0210] Integrity and stability of mRNA dry powder. LNP-encapsulated mRNA in polymer-containing formulations. This resulted in unexpectedly high integrity and stability of the mRNA after spray drying, even when stored at refrigeration temperatures (4°C) or frozen at -20°C for varying periods of time. The integrity and stability of the mRNAs described below were evaluated by spectrophotometric analysis, e.g., capillary electrophoresis (CE), and gel electrophoresis, e.g., Northern blotting.

[0211] Figures 3 and 4 serve as exemplary controls for the analysis of mRNA integrity. In particular, Figure 3 shows intact mRNA evaluated by CE (left panel) and gel electrophoresis (right panel). In the left panel of the figure, intact mRNA appears as a single spectrophotometric peak (shaded), and in the right panel of the figure, intact mRNA appears as a single band corresponding to the expected molecular size of the mRNA, with the single peak and single band indicating intact mRNA and the absence of degradation products, respectively. Similarly, Figure 4 shows mRNA before spray drying and extracted from LNPs (i.e., extracted for the purpose of performing CE and gel electrophoresis analysis on mRNA), confirming that the extraction of mRNA from LNPs does not produce significant mRNA degradation products. A comparison of the CE peak and gel band in Figure 4 with the CE peak and gel band in Figure 3 demonstrates that the process used to extract mRNA from LNPs does not produce significant mRNA degradation products.

[0212] Aliquots of spray-dried ASS1-F1 or spray-dried ASS1-F2 formulations were stored at either 4°C or -20°C. Samples were removed and reconstituted at various time points, and mRNA integrity was evaluated by CE and gel electrophoresis. Specifically, mRNA integrity of dried powder ASS1 mRNA-LNP formulated with polymer (ASS1-F2) was evaluated at weeks 2 and 4 after spray drying and storage at either 4°C or -20°C, while mRNA integrity of dried powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1) was evaluated at weeks 3 and 5 after spray drying and storage at either 4°C or -20°C.

[0213] Figures 5 and 6 show the mRNA integrity of dried powder ASS1 mRNA-LNPs formulated with polymer (ASS1-F2) and stored for two weeks at 4°C or -20°C, respectively. Each of Figures 5 and 6 shows a single CE peak (left panel) and a single gel band (right panel), indicating that the ASS1 mRNA remained intact without degradation under both temperature conditions. Figure 7 further shows a superposition of the two peaks of ASS1 mRNA (from Figures 5 and 6), indicating that the mRNA remained intact regardless of the storage temperature. These data demonstrate that spray-dried formulations of mRNA lipid nanoparticles containing polymer remain stable for at least two weeks over storage temperatures ranging, for example, approximately -20°C or up to approximately -20°C, or approximately 4°C or up to approximately 4°C.

[0214] Figures 8 and 9 show the mRNA integrity of dried powder ASS1 mRNA-LNPs formulated with polymer (ASS1-F2) and stored for 4 weeks at 4°C or -20°C, respectively. Both Figures 8 and 9 show a single CE peak (left panel) and a single gel band (right panel), indicating that the ASS1 mRNA remained intact without degradation under both temperature conditions. These data demonstrate that spray-dried formulations of mRNA lipid nanoparticles containing polymers remain stable for at least 4 weeks over a wide range of storage temperatures, such as approximately -20°C or up to approximately -20°C, or approximately 4°C or up to approximately 4°C.

[0215] Figures 10 and 11 show the mRNA of dried powder ASS1 mRNA (without LNPs) formulated with polymer (ASS1-F1) and stored at 4°C or -20°C for 3 weeks, respectively. Integrity is demonstrated. As shown in Figures 10 and 11, the ASS1-F1 mRNA remained intact without degradation under both temperature conditions. Figure 12 shows the superposition of CE peaks of the ASS1 mRNA (from Figures 10 and 11), and the perfect alignment of the CE peaks indicates the absence of mRNA degradation. This demonstrates that the spray-dried mRNA formulation containing polymer (without LNP encapsulation) remains stable for at least 3 weeks over a wide range of storage temperatures, such as approximately -20°C or up to approximately -20°C, or approximately 4°C or up to approximately 4°C.

[0216] Figures 13 and 14 show the mRNA integrity of dried powder ASS1 mRNA (without LNPs) formulated with polymer (ASS1-F1) and stored for 5 weeks at 4°C or -20°C, respectively. As shown in Figures 13 and 14, the ASS1-F1 mRNA remained intact without degradation under both temperature conditions. This indicates that spray-dried formulations of mRNA containing polymer (without LNP encapsulation) remain stable for at least 5 weeks over a wide range of storage temperatures, such as approximately -20°C or up to approximately -20°C, or approximately 4°C or up to approximately 4°C.

[0217] Remarkably, mRNA integrity was maintained for long periods at high storage temperatures, such as refrigeration (approximately 4°C), for both dried powder ASS1 mRNA-LNP formulated with polymer (ASS1-F2) and dried powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1).

[0218] Example 3. One-step method for mRNA encapsulation in lipid polymer nanoparticles. In this example, lipids, mRNA, and polymers were prepared in a single step to produce lipid polymer-encapsulated mRNA nanoparticles (formulations ASS1-F3 and ASS1-F4, which include the polymer). This is in contrast to Examples 1 and 2, in which LNP-encapsulated mRNA nanoparticles were prepared first, and then the polymer was added to the formulation. Furthermore, the reference formulation was prepared by the same process, but without the polymer in the nanoparticles or formulation (formulations ASS1-F3 and ASS1-F4, which do not include the polymer).

[0219] In particular, lipids and polymers (or just lipids in the control formulation) were dissolved in ethanol and mixed with the mRNA solution using a gear pump. Four different formulations were prepared. The first and second formulations (ASS1-F3 without polymer and ASS1-F3 with polymer) were prepared with cKK-E12 as the cationic lipid, either with or without polymer. The third and fourth formulations (ASS1-F4 without polymer and ASS1-F4 with polymer) were prepared with ICE (imidazole cholesterol ester) as the cationic lipid, either with or without polymer. ASS1-F3 and ASS1-F4 with polymer contained Eudragit as the polymer. All four formulations contained mRNA encoding ASS1 as nanoparticle-encapsulated mRNA. Each formulation was concentrated and mannitol was added. All formulations are further described in Table 3. Each formulation was spray-dried using the conditions described in Example 1. [Table 3]

[0220] result The spray-drying process for the polymer-free formulations (polymer-free ASS1-F3 and polymer-free ASS-F4) was unsuccessful. In both cases, the material aggregated in the spray dryer, clogging various compartments, resulting in little to no material recovery, as shown in Table 3 (bottom), which shows a recovery of 1 ± 2% for each polymer-free formulation. However, these same two formulations prepared with polymers in nanoparticles (polymer-containing ASS1-F3 and polymer-containing ASS-F4) were successfully spray-dried, as shown in Table 3, yielding recovery rates of over 35% and nearly 40% from the spray-drying process, respectively.

[0221] The effects of spray drying on encapsulation efficiency and nanoparticle size (Z-mean) of formulations prepared with polymers in nanoparticles were measured before and after the spray drying process, and the values ​​are shown in Table 3 (bottom). For each lipid-polymer-mRNA nanoparticle, the encapsulation efficiency did not change significantly before and after spray drying, and the nanoparticle size was found to increase from before to after spray drying. For formulations prepared without polymer, these measurements could not be determined due to the failure of the spray drying process to produce any substantial substance.

[0222] These results, in particular, demonstrate that the addition of polymers to the mRNA-encapsulating lipid nanoparticles enables successful spray drying of the mRNA-encapsulated lipid nanoparticles. This is in contrast to the same lipid nanoparticles without mRNA, which were not successfully spray-dried.

[0223] Example 4. One-step method for mRNA encapsulation in lipid polymer nanoparticles. In this example, the polymer PLGA was mixed with lipids and mRNA in a single step to produce lipid-PLGA-encapsulated mRNA nanoparticles.

[0224] Specifically, lipids and PLGA (or simply lipids from the control formulation) were dissolved in a mixture of ethanol and acetonitrile (1:2) and mixed with the ASS1 mRNA solution using a gear pump. The final formulation was concentrated in 5% mannitol and then spray-dried. The following conditions were used for spray-drying: inlet temperature 90°C, aspirator percentage 85%, pump percentage 25%, and outlet temperature 46-50°C. The formulations are further described in Table 4. [Table 4]

[0225] result The spray-drying process of formulations prepared with PLGA polymer in nanoparticles was successful, resulting in the recovery of the material from the spray-drying process.

[0226] Example 5. In vivo delivery of spray-dried mRNA formulation. In this example, FFL-F1 (described in Example 1), a spray-dried formulation containing a polymer, was administered to mice both as a dry powder and dissolved in liquid, and mRNA expression in the administered formulation was detected using both approaches.

[0227] In particular, one approach involved administering a 1 mg dose of a dry powder formulation of FFL-F1 containing a polymer to mice using a dry powder aeration device, Model DP-4M. 24 hours after administration of the dry powder, luciferin, an FFL substrate, was administered using a microspray, and in vivo luciferase expression was detected by a bioluminescence assay. The results are shown in Figure 15A.

[0228] In the second approach, FFL-F1 containing the polymer was dissolved in water at a concentration of 20 mg / ml, and 50 microliters were administered per mouse using a microspray for a 1 mg dose. 24 hours after administration, luciferin, an FFL substrate, was administered using a microspray, and in vivo luciferase expression was detected by a bioluminescence assay. The results are shown in Figure 15B.

[0229] These results indicate that mRNA encapsulated within LNPs in polymer-containing formulations retains its activity after spray drying. These results also demonstrate that spray-dried LNP-encapsulated mRNA can be administered directly as a dry powder to provide in vivo protein expression.

[0230] Example 6. CFTR mRNA lipid polymer nanoparticle dry powder formulation In this example, we successfully encapsulated cystic fibrosis conductance regulatory protein (CFTR) or mRNA encoding CFTR mRNA within lipid polymer nanoparticles and spray-dried it onto a stable, dry powder.

[0231] In particular, to prepare lipid polymer nanoparticles for encapsulating CFTR-mRNA, the PEG-modified lipids, cationic lipids, and polymers listed in Table 5 below were dissolved in 150 mL of ethanol and mixed with CFTR-mRNA (0.05 g in 600 mL, pH 4.5, 1 mM citrate buffer, 150 mM sodium chloride) using a gear pump. Next, 37.5 g of mannitol was dissolved at 5% by weight / volume, and the resulting 750 mL of CFTR-mRNA solution (20% ethanol) was encapsulated within the lipid polymer nanoparticles. The resulting mixture was then spray-dried in a Buchi spray dryer under the following spray-drying conditions: inlet temperature of 90°C, 90% aspirator ratio, 25% pump ratio, and outlet temperature of 46–50°C. [Table 5]

[0232] To quantitatively determine the integrity of CFTR-mRNA in lipid polymer nanoparticles after spray drying, CFTR-mRNA was precipitated from the nanoparticles by mixing and dissolving the nanoparticles in ethanol with RNA precipitation buffer containing guanidine thiocyanate, N-lauroyl sarcosine, and sodium citrate, pH 6.5. The precipitated mRNA was further separated, purified using an RNeasy silica membrane (Qiagen), and then redissolved in RNAse-free water. The purified mRNA was evaluated by capillary electrophoresis using a Fragment Analyzer (Agilent) according to the manufacturer's published instructions. Briefly, the appropriate volume of intercalating dye and RNA isolation gel were mixed and packed into the instrument. The capillary preparation buffer was diluted to the required concentration and packed onto the preparation fluid line. Inlet buffer, rinse buffer, and storage buffer were placed in the well plates. The mRNA was added to the designated location. The extracted mRNA and control mRNA were denatured by diluting them to 150 ng / μL using formamide-packed buffer, then heating at 70°C for 5 minutes and immediately cooling. The samples were further diluted using dilution markers according to the manufacturer's instructions and performed on a fragment analyzer by the relevant separation method.

[0233] As described in the above examples, LNP-mRNA formulations without additional polymers in the formulation failed to successfully spray-dry. In particular, the LNP-mRNA material aggregated in the spray dryer, clogging various compartments of the spray dryer, resulting in little to no recovery of the LNP-mRNA material. As shown in the above examples, this failure of the LNP-mRNA material to be successfully spray-dried can be overcome by adding a polymer to the LNP formulation, either by incorporating the polymer into the lipids so that the polymer is present during the process of preparing nanoparticles and encapsulating the mRNA, or alternatively, by adding the polymer to the formulation after the process of preparing lipid nanoparticles and encapsulating the mRNA. Here, CFTR-mRNA encapsulated in lipid nanoparticles was successfully spray-dried by adding a polymer, particularly the Eudragit polymer. Specifically, the Eudragit polymer was incorporated into the lipid mixture before the process of preparing nanoparticles and encapsulating the mRNA so that CFTR-mRNA encapsulated in lipid polymer nanoparticles was produced. CFTR-mRNA lipid polymer nanoparticles that were successfully spray-dried were also evaluated for integrity using capillary electrophoresis (CE) analysis. Figures 16A1-A6 show exemplary CE chromatographs of the integrity of the CFTR-mRNA peaks before and after spray-drying, demonstrating that the integrity of CFTR-mRNA remained intact after spray-drying in the lipid polymer. Figures 16A1-A3 show control CFTR mRNA that was neither spray-dried nor encapsulated, while Figures 16A4-A6 show CFTR mRNA extracted from the spray-dried formulation.

Claims

1. A dried powder formulation for delivering cystic fibrosis conductance regulatory factor (CFTR) messenger RNA (mRNA), mRNA encoding the CFTR protein, One or more lipids, A dry powder formulation comprising one or more polymers and multiple spray-dried particles.

2. The dried powder formulation according to claim 1, wherein one or more lipids are present in one or more lipid nanoparticles (LNPs) that encapsulate the mRNA encoding the CFTR protein.

3. The dried powder formulation according to claim 1, wherein the one or more lipids and the one or more polymers are present in one or more lipid nanoparticles (LNPs) that encapsulate the mRNA encoding the CFTR protein.

4. The dried powder formulation according to any one of claims 1 to 3, wherein the CFTR mRNA has an integrity of 90% or more.

5. The dried powder formulation according to any one of claims 1 to 4, wherein the mRNA maintains 90% or more integrity when stored at room temperature or below for six months or more.

6. The dried powder formulation according to any one of claims 1 to 5, wherein at least 20% of the plurality of spray-dried particles are fine particles.

7. The dried powder formulation according to claim 6, wherein the fine particles have a volume median diameter of less than 5 μm.

8. The dried powder formulation according to any one of claims 1 to 7, wherein the dried powder formulation is inhalable.

9. The dry powder formulation according to any one of claims 1 to 7, wherein the formulation is atomizable during reconstitution.

10. The dried powder formulation according to any one of claims 1 to 9, wherein the one or more polymers constitute at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the lipids and polymers.

11. A dried powder formulation according to any one of claims 1 to 10, wherein the one or more polymers constitute about 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, or 15-90% of the total weight of the lipids and polymers.

12. The dried powder formulation according to any one of claims 1 to 11, wherein the one or more polymers constitute 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% or less of the total weight of the lipids and polymers.

13. The one or more polymer components mentioned above include chitosan, poly(lactic acid) (PLA), and poly(lactic acid-co A dried powder formulation according to any one of claims 1 to 12, selected from the group consisting of -glycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline) acrylate, modified acrylate and polymethacrylate polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethylmethyl acrylate) (pDMAEMA).

14. The dried powder formulation according to any one of claims 1 to 13, wherein the one or more polymers include a polymethacrylate polymer.

15. The dried powder formulation according to any one of claims 1 to 14, wherein the one or more polymers comprises Eudragit EPO.

16. The dried powder formulation according to any one of claims 2 to 15, wherein one or more LNPs encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4.

17. The dried powder formulation according to claim 16, wherein one or more LNPs encapsulating the mRNA have a lipid:mRNA(N / P) ratio of 2 or 4.

18. The dried powder formulation according to any one of claims 2 to 17, wherein the LNP has an encapsulation efficiency of 80% or more.

19. The dried powder formulation according to any one of claims 1 to 18, wherein the one or more lipids include cationic lipids.

20. The dried powder formulation according to claim 19, wherein the cationic lipid is selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethitaammoniumpropane), DODAP (1,2-dioleyl-3-dimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.

21. The dried powder formulation according to claim 20, wherein the cationic lipid is cKK-E12.

22. The dried powder formulation according to claim 20, wherein the cationic lipid is ICE.

23. The dried powder formulation according to any one of claims 19 to 22, wherein the cationic lipid constitutes about 25 to 50% of the total lipids in the LNP by moles.

24. The dried powder formulation according to any one of claims 1 to 23, wherein the one or more lipids include PEG-modified lipids.

25. The dried powder formulation according to claim 24, wherein the PEG-modified lipid constitutes about 1 to 15% of the total lipids in the LNP by moles.

26. The dried powder according to claim 24, wherein the PEG-modified lipid constitutes at least 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, or 12% of the total lipids in the LNP by moles. Agent.

27. The dried powder formulation according to any one of claims 2 to 26, wherein the LNP is a dilipid component LNP.

28. The dried powder formulation according to any one of claims 1 to 27, wherein the one or more lipids mentioned above do not contain neutral lipids or cholesterol-based lipids.

29. The dried powder formulation according to any one of claims 1 to 28, wherein the one or more lipids further comprises neutral lipids or cholesterol-based lipids.

30. The dried powder formulation according to any one of claims 1 to 29, wherein the one or more lipids further comprises neutral lipids.

31. The dried powder formulation according to claim 29 or 30, wherein the LNP is a trilipid component LNP.

32. A dried powder formulation according to any one of claims 1 to 31, further comprising at least one sugar selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol.

33. The dried powder formulation according to claim 32, wherein the sugar is mannitol.

34. A dried powder formulation according to any one of claims 1 to 33, further comprising a pharmaceutically acceptable excipient selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

35. The dried powder formulation according to claim 34, wherein the surfactant is selected from the group consisting of CHAPS (3-[(3-collamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucoside, and poloxamer.

36. The dried powder formulation according to claim 35, wherein the surfactant is poloxamer.

37. The dried powder formulation according to any one of claims 1 to 36, wherein the CFTR mRNA constitutes about 1-20%, 1-15%, 1-10%, 1-8%, 1-6%, 1-5%, 5-15%, or 5-10% of the total weight of the spray-dried particles.

38. The dried powder formulation according to any one of claims 1 to 37, wherein the CFTR mRNA constitutes about 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5%, or 15% of the total weight of the spray-dried particles.

39. A method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising the step of administering a dried powder formulation according to any one of claims 1 to 38 to a subject requiring the same.

40. The method according to claim 39, wherein the dried powder formulation is administered by pulmonary delivery.

41. The method according to claim 39 or 40, wherein the dried powder formulation is administered by inhalation.

42. A method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, Reconstitute the dried powder formulation described in any one of claims 1 to 38 into a liquid solution, A method comprising administering the reconstituted liquid solution to a subject requiring it.

43. The method according to claim 42, wherein the reconstituted liquid solution is administered by atomization.

44. The method according to any one of claims 39 to 43, wherein the subject is suffering from cystic fibrosis.

45. A dried powder formulation for delivering messenger RNA (mRNA), mRNA that codes for a protein or peptide, One or more lipids, A dry powder formulation comprising one or more polymers and multiple spray-dried particles.

46. A dried powder formulation for delivering messenger RNA (mRNA), a. One or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a peptide or polypeptide, b. A dry powder formulation comprising one or more polymers and a plurality of spray-dried particles.

47. A dried powder formulation for messenger RNA (mRNA) delivery, comprising a plurality of spray-dried particles, each containing one or more nanoparticles that encapsulate mRNA encoding a peptide or polypeptide, wherein the nanoparticles a. One or more lipids, b. A dry powder formulation comprising one or more polymers.

48. The dried powder formulation according to any one of claims 45 to 47, wherein the mRNA has an integrity of 90% or more.

49. The dried powder formulation according to any one of claims 45 to 48, wherein the mRNA maintains 90% or more integrity after being stored at room temperature or below for six months or more.

50. The dried powder formulation according to any one of claims 45 to 48, wherein the mRNA maintains 90% or more integrity after being stored at 4°C or below for 6 months or more.

51. The dried powder formulation according to any one of claims 45 to 50, wherein at least 20% of the plurality of spray-dried particles are fine particles.

52. The dried powder formulation according to claim 51, wherein the fine particles have a volume median diameter of less than 5 μm.

53. The dried powder formulation according to any one of claims 45 to 52, wherein the dried powder formulation is inhalable.

54. The dry powder formulation according to any one of claims 45 to 52, wherein the formulation is atomizable during reconstitution.

55. The dried powder formulation according to any one of claims 46 to 54, wherein one or more LNPs encapsulating the mRNA have a lipid:mRNA (N / P) ratio in the range of 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4.

56. The dried powder formulation according to claim 55, wherein one or more LNPs encapsulating the mRNA have a lipid:mRNA(N / P) ratio of 2 or 4.

57. A dried powder formulation according to any one of claims 46 to 56, wherein the mRNA-supported lipid nanoparticles have an encapsulation efficiency of 80% or more.

58. The dried powder formulation according to any one of claims 46 to 57, wherein the one or more mRNA-supported lipid nanoparticles contain one or more cationic lipids.

59. The dried powder formulation according to claim 58, wherein the one or more cationic lipids are selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethitaammoniumpropane), DODAP (1,2-dioleyl-3-dimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.

60. The dried powder formulation according to any one of claims 46 to 59, wherein the one or more mRNA-supported lipid nanoparticles comprise one or more PEG-modified lipids.

61. The dried powder formulation according to any one of claims 46 to 60, wherein the LNP is a dilipid component LNP.

62. The dried powder formulation according to any one of claims 46 to 60, further comprising one or more mRNA-supported lipid nanoparticles, one or more neutral lipids or one or more cholesterol-based lipids.

63. The dried powder formulation according to claim 62, wherein the LNP is a trilipid component LNP.

64. The dried powder formulation according to any one of claims 45 to 63, wherein the one or more polymers constitute 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, or less than 5% of the total weight.

65. The dried powder formulation according to any one of claims 45 to 64, wherein the one or more polymers constitute at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the lipids and polymers.

66. The one or more polymers make up about 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, and 10-30% of the total weight of the lipids and polymers. A dried powder formulation according to any one of claims 45 to 65, comprising %, 10-20%, 15-20%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, or 15-90%.

67. The dried powder formulation according to any one of claims 45 to 66, wherein the one or more polymers constitute 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% or less of the total weight of the lipids and polymers.

68. A dried powder formulation according to any one of claims 45 to 67, wherein the one or more polymer components are selected from the group consisting of chitosan, poly(lactic acid) (PLA), poly(lactic acid-coglycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and polymethacrylate polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethylphosphorylcholine, poly(2-(methacryloyloxy)ethylphosphorylcholine), and poly(dimethylaminoethylmethyl acrylate) (pDMAEMA).

69. The dried powder formulation according to any one of claims 45 to 68, wherein the one or more polymers include a polymethacrylate polymer.

70. A dried powder formulation according to any one of claims 45 to 69, further comprising at least one sugar selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol.

71. The dried powder formulation according to claim 70, wherein the sugar is mannitol.

72. A dry powder formulation according to any one of claims 45 to 71, further comprising a pharmaceutically acceptable excipient selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

73. The dried powder formulation according to claim 72, wherein the surfactant is selected from the group consisting of CHAPS (3-[(3-collamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucoside, poloxamer, and optionally poloxamer 407.

74. The dried powder formulation according to claim 73, wherein the surfactant is poloxamer.

75. The dried powder formulation according to any one of claims 45 to 74, wherein the mRNA encodes a peptide.

76. The dried powder formulation according to any one of claims 45 to 74, wherein the mRNA encodes a therapeutic protein.

77. The dried powder formulation according to claim 76, wherein the therapeutic protein is CFTR.

78. The dried powder formulation according to claim 76, wherein the therapeutic protein is an over-the-counter (OTC) drug.

79. A method for delivering mRNA in vivo, comprising administering a dried powder formulation according to any one of claims 45 to 78 to a subject requiring the delivery thereof.

80. A method for treating a disease or disorder in a patient by administering to the patient an effective dose of mRNA in a dried powder formulation according to any one of claims 45 to 78.

81. The method according to claim 79 or 80, wherein the dried powder formulation is administered by inhalation.

82. The method according to claim 79 or 80, wherein the dried powder formulation is administered by intranasal spray.

83. The method according to claim 79 or 80, wherein the preparation is administered by a metered-dose inhaler.

84. The method according to any one of claims 80 to 83, wherein the disease or disorder is selected from cystic fibrosis; asthma; COPD; emphysema; primary ciliary dyskinesia with or without situs inversus (CILD1), or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Duvet syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, X-ray); cytochrome b-positive granulomatous disease, autosomal recessive; surfactant deficiency, pulmonary surfactant metabolism disorder 1, pulmonary surfactant metabolism disorder 2, pulmonary surfactant metabolism disorder 3; respiratory distress syndrome of premature infants; tuberculosis, pulmonary viral diseases including influenza, and respiratory syncytial virus (RSV).

85. A method for producing a dried powder formulation, To provide a mixture comprising mRNA, one or more lipids, and a polymer, A method comprising spray-drying the mixture to form a plurality of particles.

86. The method according to claim 85, wherein, before adding the polymer, one or more lipids are first mixed with the mRNA to form mRNA-supported lipid nanoparticles.

87. The method according to claim 85, wherein one or more lipids are mixed with the mRNA and the polymer in a single step to form mRNA-supported lipid polymer nanoparticles.

88. The method according to any one of claims 85 to 87, further comprising adding one or more excipients to the mixture before spray drying.

89. The aforementioned plurality of spray-dried particles are as follows: a) Moisture content of less than 10%, b) Fraction of fine particles having a volume median diameter of less than 5 μm, c) Z-average size range of 10 to 3000 nm, d) N / P ratio range of 1 to 20, e) mRNA inclusion efficiency of 80% or more, f) Characterized by one or more mRNA integrity levels of 90% or higher, claim 8 The method described in any one of items 5 to 88.

90. The method according to any one of claims 85 to 89, wherein the mRNA encodes a protein or a peptide.

91. The method according to any one of claims 85 to 90, wherein the mRNA encodes a peptide.

92. The method according to any one of claims 85 to 90, wherein the mRNA encodes a therapeutic protein.

93. The method according to claim 92, wherein the therapeutic protein is CFTR.

94. The method according to claim 92, wherein the therapeutic protein is an over-the-counter (OTC) protein.

95. A dried powder formulation manufactured according to the method described in any one of claims 85 to 94.

96. A method for treating a disease or disorder in a patient by administering an effective dose of mRNA in the dried powder formulation described in claim 95 to the patient.