Formulation containing high-concentration VEGF receptor fusion protein

Abstract

This invention provides high-concentration, high-stability antibody and protein formulations with appropriate efficacy, stability, viscosity, osmotic pressure, and pH, as well as methods for preparing the same, and methods for treating intraocular neovascular disorders using high-concentration formulations. [Solution] An aqueous pharmaceutical formulation comprising, as necessary, a vascular endothelial growth factor (VEGF) receptor fusion protein, an anti-VEGF antibody, an antigen-binding fragment, or a VEGF-binding molecule at a concentration of at least about 100 mg / ml, about 5% sucrose, a histidine buffer, and about 0.03% surfactant, in association with further therapeutic agents, wherein the formulation has a pH of about 5.0 to about 6.8.

Description

Technical Field

[0001] This application claims the benefit of U.S. Provisional Patent Application No. US62 / 813,882, filed Mar. 5, 2019; U.S. Provisional Patent Application No. US62 / 769,876, filed Nov. 20, 2018; U.S. Provisional Patent Application No. US62 / 752,127, filed Oct. 29, 2018; and U.S. Provisional Patent Application No. US62 / 669,506, filed May 10, 2018, each of which is hereby incorporated by reference in its entirety.

[0002] Embodiments herein generally relate to formulations comprising high concentration VEGF receptor fusion proteins suitable for ocular administration. More specifically, embodiments herein provide a liquid pharmaceutical formulation for intravitreal administration, the formulation comprising a VEGF receptor fusion protein in excess of 40 mg / ml and exhibiting pharmaceutically acceptable potency, stability, viscosity, and pH.

[0003] Sequence Listing An official copy of the sequence listing is electronically submitted simultaneously with the specification via EFS-Web as a sequence list in ASCII format with a file name of "10430P1-US_SEQ_LIST_ST25.txt", a creation date of May 9, 2018, and a size of approximately 7 KB. The sequence listing contained in this ASCII format document is part of the specification and is hereby incorporated by reference in its entirety.

Background Art

[0004] Developing therapeutically useful liquid formulations requires combinations of different component amounts to provide a functional and stable delivery medium for the drug of interest. This is especially true when the drug is a protein, and furthermore, an antibody. Antibody formulations have long presented challenges to drug developers and manufacturers, as antibody activity and administration typically require pharmaceutically acceptable potency, osmotic pressure, protein stability, viscosity, and appropriate pH. These challenges are exacerbated when the antibody is present at higher concentrations in the formulation, for example, above the 20-40 mg / ml concentration of antibodies marketed as most drugs.

[0005] Higher concentrations of antibody formulations allow for shorter injection times, smaller injection volumes, lower antibody administration frequencies, and more efficient manufacturing and storage utilities. However, as mentioned above, the higher the concentration of antibody or protein, the more difficult it becomes to maintain the appropriate activity and delivery parameters of the formulation. In particular, high-concentration antibody and protein formulations often compete with protein aggregation and increased viscosity, resulting in reduced overall potency, decreased manufacturing efficiency, and reduced storage stability. Due to the problems associated with high-concentration protein or antibody formulations, few pharmaceutically acceptable formulations have been developed. There is a need in the art for the preparation of high-concentration, high-stability antibody and protein formulations that possess appropriate potency, stability, viscosity, osmotic pressure, and pH.

[0006] One such protein requiring high-concentration formulations is the vascular endothelial growth factor (VEGF) receptor fusion protein. VEGF receptor fusion proteins are used to block VEGF function in many ophthalmic formulations, such as EYLEA® (Regeneron Pharmaceuticals, Inc.). Formulations containing high concentrations of VEGF receptor fusion proteins may allow for shorter ophthalmic injection times, lower injection volumes, fewer possible injections per administration cycle, and more efficient manufacturing and storage.

[0007] The present invention aims to overcome one or more of the problems discussed above. [Overview of the Initiative]

[0008] The various embodiments described herein include high-concentration protein-containing formulations (e.g., those suitable for intravitreal administration), particularly high-concentration vascular endothelial growth factor (VEGF) receptor fusion protein-containing formulations. High-concentration VEGF receptor fusion protein-containing formulations offer numerous therapeutic and economic benefits, including pharmaceutically acceptable potency, long-term manufacturing and storage stability, and viscosity and pH suitable for intraocular injection. High-concentration VEGF receptor fusion protein-containing formulations also offer the advantage of reducing ocular administration volume, i.e., avoiding undesirable effects on eyes with limited volume.

[0009] Embodiments of this specification provide formulations comprising a VEGF receptor fusion protein, a buffer, a heat stabilizer, a viscosity reducer, and a surfactant. In other embodiments, the formulations do not include a viscosity reducer. The formulations of the present invention have a pH and viscosity suitable for injection, particularly for therapeutic ocular injection.

[0010] In embodiments of the present invention, a pharmaceutical formulation of the present invention is provided, comprising a single dose of at least 41 mg / ml of VEGF receptor fusion protein (discussed herein), comprising less than about 100 μl, less than about 50 μl, about 50 μl, about 57 μl, about 60 μl, about 70 μl, or about 75 μl of VEGF receptor fusion protein, a buffer, optionally a heat stabilizer and / or viscosity reducer, and a surfactant having a pH of about 5.0 to about 6.8 (e.g., 5.8).

[0011] In one embodiment of the present invention, the VEGF receptor fusion protein concentration is approximately 30 mg / ml, 60 mg / ml, 114 mg / ml, 120 mg / ml, or 140 mg / ml.

[0012] In one embodiment of the present invention, the surfactant may be a nonionic surfactant (e.g., about 0.02% to about 0.1%, or about 0.03% (w / v)). In one embodiment of the present invention, the surfactant is a nonionic surfactant having a polyoxyethylene moiety, for example, polysorbate 20 (PS20), polysorbate 80 (PS80), poloxamer 188, polyethylene glycol 3350, or a mixture thereof.

[0013] In one embodiment of the present invention, the buffer solution is a histidine-based buffer solution such as histidine, histidine HCl, or histidine acetate (e.g., 10 mM or 20 mM), a phosphate-based buffer solution such as sodium phosphate (e.g., 10 mM), an acetate-based buffer solution such as sodium acetate and acetic acid, or a citrate-based buffer solution such as sodium citrate and citric acid. In one embodiment of the present invention, when the buffer solution is a phosphate buffer solution, the pH is approximately 5.7 to approximately 8.0, approximately 5.8 to approximately 8.0, approximately 5.7 to approximately 7.0, approximately 5.8 to approximately 7.0, approximately 5.9 to approximately 7.0, or approximately 6.0 to approximately 7.0; when the buffer solution is a histidine buffer solution, the pH is approximately 5.5 to approximately 6.5; when the buffer solution is a citrate buffer solution, the pH is approximately 3.0 to approximately 6.2 or approximately 5.0 to approximately 6.0; and when the buffer solution is an acetate buffer solution, the pH is approximately 3.7 to approximately 5.6 or approximately 5.0 to approximately 6.0.

[0014] In one embodiment of the present invention, the heat stabilizer is a sugar such as sucrose (e.g., about 2.5%, 5%, or 8%, 10%, or 20% (w / v), e.g., about 2-20%), mannitol, sorbitol, or trehalose, L-proline (e.g., about 2%, 3%, or 4% (w / v)), glycine (e.g., about 50 mM), glycerol, taurine (e.g., about 50 mM), or propanesulfonic acid (e.g., about 50 mM), or any combination of the above.

[0015] In some embodiments of the present invention, the pharmaceutical formulations of the present invention include viscosity-reducing agents, such as arginine hydrochloride (e.g., L-arginine monohydrochloride) (e.g., 50 mM), lysine, sodium chloride (e.g., 40 mM or 50 mM), or magnesium chloride. Alternatively, in other embodiments, the formulations of the present invention specifically exclude, if not all, viscosity-reducing agents.

[0016] In one embodiment of the present invention, the pharmaceutical formulation of the present invention comprises, consists of, or essentially consists of any one of the formulations A to KKKK described herein.

[0017] In aspects of this specification, the pharmaceutical formulation of the present invention may contain VEGF receptor fusion protein (e.g., aflibercept or convercept) in concentrations of approximately 41 mg / ml to approximately 275 mg / ml, approximately 80 mg / ml to approximately 275 mg / ml, approximately 140 mg / ml to approximately 159 mg / ml, or approximately 150 mg / ml, or approximately 80 mg / ml to approximately 100 mg / ml, including approximately 60 mg / ml, approximately 80 mg / ml, approximately 100 mg / ml, approximately 113.3 mg / ml, approximately 114.3 mg / ml, approximately 120 mg / ml, approximately 133.3 mg / ml, approximately 140 mg / ml, approximately 150 mg / ml, approximately 200 mg / ml, or approximately 250 mg / ml. In one embodiment of the present invention, the formulation contains approximately 40 mg / ml of VEGF receptor fusion protein.

[0018] Some embodiments of the pharmaceutical formulation of the present invention include a heat stabilizer in a concentration of about 2% (w / v) to about 9% (w / v) or about 4% (w / v) to about 9%, provided that the heat stabilizer is taurine or propanesulfonic acid, the stabilizer is in a concentration of about 25 mM to about 100 mM, the surfactant is in a concentration of about 0.02% (w / v) to about 0.1% (w / v) (e.g., about 0.03%), and the buffer is in a concentration of about 5 mM to about 15 mM.

[0019] VEGF receptor fusion proteins are, for example, • May be encoded by the nucleic acid sequence of SEQ ID NO: 1 or by nucleotides 79-1374 or 79-1371 of SEQ ID NO: 1 • May contain the amino acids of SEQ ID NO: 2 or amino acids 27-457 or 27-458 of SEQ ID NO: 2 · (1) The VEGFR1 component containing amino acids 27-129 of SEQ ID NO: 2, (2) VEGFR2 component containing amino acids 130-231 of Sequence ID No. 2, (3) May contain a multimerized component ("FcΔC1(a)") including amino acids 232-457 or 458 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2, i.e., K458, may or may not be included in the VEGF receptor fusion protein). Amino acids 1-26 of SEQ ID NO: 2 are • comprising an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor (e.g., VEGFR1) and an Ig domain 3 of a second VEGF receptor (e.g., VEGFR2), and optionally comprising an Ig domain 4 of the second VEGF receptor (e.g., VEGFR2) and a polymerizing component (e.g., the Fc domain of IgG), • Conversational, or Please note that this is an aflibercept signal sequence. VEGF Trap atggtcagctactgggacaccggggtcctgctgtgcgcgctgctcagctgtctgcttctc acaggatctagttccggaagtgataccggtagacctttcgtagagatgtacagtgaaatc cccgaaattatacacatgactgaaggaagggagctcgtcattccctgccgggttacgtca cctaacatcactgttactttaaaaaagtttccacttgacactttgatccctgatggaaaa cgcataatctgggacagtagaaagggcttcatcatatcaaatgcaacgtacaaagaaata gggcttctgacctgtgaagcaacagtcaatgggcatttgtataagacaaactatctcaca catcgacaaaccaatacaatcatagatgtggttctgagtccgtctcatggaattgaacta tctgttggagaaaagcttgtcttaaattgtacagcaagaactgaactaaatgtggggatt gacttcaactgggaatacccttcttcgaagcatcagcataagaaacttgtaaaccgagac ctaaaaacccagtctgggagtgagatgaagaaatttttgagcaccttaactatagatggt gtaacccggagtgaccaaggattgtacacctgtgcagcatccagtgggctgatgaccaag aagaacagcacatttgtcagggtccatgaaaaggacaaaactcacacatgcccaccgtgc ccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggac accctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaa gaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagaca aagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctg caccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctccca gcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtac accctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtc aaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaac aactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaag ctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcat gaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga (SEQ ID NO: 1) MVSYWDTGVLLCALLSCLLLTGSSSGSDTGRPFVEMYSEIPEIIHMTEGRELVIPCRVTSPNITVTLKKFPLDTLIPDGKRIIWDSRKGFIISNATYKEIGLLTCEATVNGHLYKTNYLTHRQTNTIIDVVLSPSHGIELSVGEKLVLNCTARTELNVGIDFNWEYPSSKHQHKKLVNRDLKTQSGSEMKKFLSTLTIDGVTRSDQGLYTCAASSGLMTKKNSTFVRVHEKDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK (SEQ ID NO: 2) AA1 - 26 = Signal sequence AA27 - 129 = Flt1 - D2 (VEGFR1 - D2) AA130 - 231 = Flk1 - D3 (VEGFR2 - D3) AA232 - 458 = FcΔC1

[0020] In another embodiment of the present invention, a container is provided comprising about 5 mM to about 25 mM of a pharmaceutically acceptable buffer, about 4% (w / v) to about 9% (w / v) of a pharmaceutically acceptable heat stabilizer, about 0.02% (w / v) to about 0.1% (w / v) of a pharmaceutically acceptable surfactant, and about 41 mg / ml to about 275 mg / ml of an aqueous solution of a VEGF receptor fusion protein. If the heat stabilizer comprises either taurine or propanesulfonic acid, the concentration of taurine or propanesulfonic acid is about 25 mM to about 100 mM. The aqueous solution has a pH of about 5.0 to about 6.8, and may be about 5.5 to about 6.2 (e.g., 5.8). In some embodiments, the container is a vial or syringe. In other embodiments, the aqueous solution does not contain inorganic salts. If the heat stabilizer is a sugar, it may be sucrose, mannitol, sorbitol, or trehalose, and may be present in concentrations between approximately 4% (w / v) and 9% (w / v). The surfactant may be a nonionic surfactant, and may contain a polyoxyethylene moiety such as polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350 at concentrations of approximately 0.02% to approximately 0.1% (w) per volume, more typically 0.02% to approximately 0.04% (w / v). In one embodiment of the present invention, the VEGF receptor fusion protein is encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79-1374 or 79-1371 of SEQ ID NO: 1, and comprises the amino acids of SEQ ID NO: 2 or amino acids 27-457 or 27-458 of SEQ ID NO: 2, and includes (1) a VEGFR1 component comprising amino acids 27-129 of SEQ ID NO: 2, (2) a VEGFR2 component comprising amino acids 130-231 of SEQ ID NO: 2, and (3) amino acids 232-457 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2). The protein comprises a multimerized component ("FcΔC1(a)") containing an ano acid, i.e., K458 (which may or may not be present in the VEGF receptor fusion protein), an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor (e.g., VEGFR1), and an Ig domain 3 of a second VEGF receptor (e.g., VEGFR2), and optionally further comprising an Ig domain 4 of a second VEGF receptor (e.g., VEGFR2) and a multimerized component (e.g., an Fc domain of IgG), and is either a conbercept or aflibercept.

[0021] In yet another embodiment, a pharmaceutical formulation of the present invention is provided having a VEGF receptor fusion protein in an aqueous vehicle, the aqueous vehicle having a viscosity of about 10 cP to about 15 cP at 20°C, more typically about 10 cP to about 13 cP at 20°C, and most typically about 11 cP to 12 cP at 20°C (e.g., about 6.0, 7.3, 11.5, or 12.0 cP at 20°C). In one embodiment of the present invention, the viscosity is about 12 cP to about 15 cP at 20°C. The pH of the formulation may be about 5.8 to about 6.5 (e.g., about 5.8). In some cases, the formulation does not contain viscosity-reducing agents, for example, arginine hydrochloride, lysine, sodium chloride, or magnesium chloride. In other cases, the formulation contains 10 mM histidine hydrochloride or 10 mM histidine acetate. The sugar may be sucrose, mannitol, sorbitol, or trehalose, and may be present in concentrations between approximately 4% (w / v) and 9% (w / v) (e.g., approximately 5%). The surfactant may be a nonionic surfactant and may contain a polyoxyethylene moiety such as polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350 at concentrations of approximately 0.02% to approximately 0.1% w / v per volume, more typically 0.02% to approximately 0.04% (w / v) (e.g., 0.03%). Furthermore, the formulation may further contain a heat stabilizer selected from either taurine or propanesulfonic acid at concentrations between approximately 25 mM and approximately 100 mM, more typically approximately 50 mM to approximately 70 mM. In one embodiment of the present invention, the formulation comprises a VEGF receptor fusion protein such as aflibercept (e.g., any of the concentrations of about 41-275 mg / ml, about 50 mg / ml, about 100 mg / ml, about 115 mg / ml, about 125 mg / ml, about 150 mg / ml, about 200 mg / ml, or any of the “high” concentrations discussed herein) at a pH of about 5.8, about 10 mM histidine buffer, about 5% (w / v) sucrose, polysorbate, about 0.03% (w / v) nonionic surfactant such as polysorbate 20, and about 50 mM arginine, L-arginine, or L-arginine monohydrochloride.In one embodiment of the present invention, the VEGF receptor fusion protein is encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79-1374 or 79-1371 of SEQ ID NO: 1, and comprises the amino acids of SEQ ID NO: 2 or amino acids 27-457 or 27-458 of SEQ ID NO: 2, and includes (1) a VEGFR1 component comprising amino acids 27-129 of SEQ ID NO: 2, (2) a VEGFR2 component comprising amino acids 130-231 of SEQ ID NO: 2, and (3) amino acids 232-457 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2, i.e., K458). The protein comprises a multimerized component ("FcΔC1(a)") which may or may not be included in the VEGF receptor fusion protein, an immunoglobulin-like (Ig) domain 2 of the first VEGF receptor (e.g., VEGFR1), and an Ig domain 3 of the second VEGF receptor (e.g., VEGFR2), and optionally comprises an Ig domain 4 of the second VEGF receptor (e.g., VEGFR2) and a multimerized component (e.g., an Fc domain of IgG), and is either a conbercept or aflibercept.

[0022] In yet another embodiment, the pharmaceutical formulation of the present invention is provided, comprising a VEGF receptor fusion protein in a pharmaceutically acceptable buffer at a concentration of about 80 mg / ml to about 275 mg / ml. In some cases, the stable pharmaceutical formulation may also contain taurine or propanesulfonic acid. The formulation may be stable for about 24 to 36 months at a temperature of about 2°C to about 8°C. In some cases, the VEGF receptor fusion protein may show an increase of less than about 5% in high molecular weight species when stored at these temperatures for this time, and more typically, an increase of less than about 4.5% in high molecular weight species. In other cases, the VEGF receptor fusion protein shows an increase of less than 4.0% in high molecular weight species, less than 3.5% in high molecular weight species, less than 3.0% in high molecular weight species, less than 2.5% in high molecular weight species, less than 2.0% in high molecular weight species, and / or less than 1.5% in high molecular weight species.

[0023] Embodiments of this specification may also include pharmaceutical formulations of the present invention comprising aflibercept, pH buffer, sugar, and surfactant, wherein the aflibercept is concentrated at a concentration of 41 mg / ml to about 275 mg / ml. Alternatively, embodiments may be stable liquid pharmaceutical formulations comprising convercept, pH buffer, sugar, and surfactant, wherein the convercept is concentrated at a concentration of 41 mg / ml to about 275 mg / ml. The stable liquid pharmaceutical formulations may also contain taurine or propanesulfonic acid. In some embodiments, aflibercept or convercept is concentrated at either 80 mg / ml or 150 mg / ml. In other embodiments, the formulation does not contain inorganic salts, such as sodium chloride.

[0024] Some embodiments relate to sterile syringes that are pre-filled with an aqueous solution containing 80 mg / ml aflibercept, convercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 5% (w / v) sucrose, mannitol sorbitol, or trehalose, 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, and 40 mM sodium chloride. Embodiments of this specification include further additions of either taurine or propanesulfonic acid in concentrations of about 25 mM to about 100 mM, more typically about 50 mM to about 70 mM. In some embodiments, the syringe is pre-filled with an aqueous solution containing 80 mg / ml of aflibercept, convercept, 10 mM histidine HCl, histidine acetate, or sodium phosphate, 8% (w / v) sucrose, mannitol, sorbitol, or trehalose, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350. Embodiments of this specification include further additions of either taurine or propanesulfonic acid in concentrations of about 25 mM to about 100 mM, more typically about 50 mM to about 70 mM. In yet another embodiment, the syringe is pre-filled with an aqueous solution having a pH of approximately 6.2, containing 150 mg / ml of aflibercept, convercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 5% (w / v) sucrose, mannitol, sorbitol, or trehalose, 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, and 40 mM sodium chloride. Embodiments of this specification may include further additions of either taurine or propanesulfonic acid.In yet another embodiment, the syringe is pre-filled with an aqueous solution having a pH of approximately 6.2, containing 150 mg / ml of aflibercept, convercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 8% (w / v) sucrose, mannitol, sorbitol, or trehalose, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, the aqueous solution being free of inorganic salts. The embodiment may further contain approximately 25 mM to approximately 100 mM, more typically, approximately 50 mM to approximately 70 mM of either taurine or propanesulfonic acid. In yet another embodiment, the syringe is pre-filled with an aqueous solution containing 150 mg / ml of aflibercept or convercept, 10 mM sodium acetate or acetic acid, 5% (w / v) glycerol and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350 and 40 mM sodium chloride, at a pH of approximately 6.2. In yet another embodiment, the syringe contains 150 mg / ml of aflibercept or convercept, 10 mM sodium acetate or acetic acid, 8% (w / v) glycerol and 0.03% (w / v) polysorbate 20, polysorbate 188, or polyethylene glycol 3350, at a pH of approximately 6.2. It is a pre-filled product containing an aqueous solution of Rubate 80, Poloxamer 188, or polyethylene glycol 3350 and 40 mM sodium chloride.

[0025] The present invention also provides a method for preparing any of the formulations described herein, comprising the step of combining the components of the formulation into a single composition. Such a method may include the step of adding the resulting formulation to a vial or injection device. Any composition that is a product of such a method also forms part of the present invention. For example, embodiments herein also include a method for preparing a formulation by combining a histidine-based, citrate-based, acetate-based, or phosphate-based buffer with sucrose, polysorbate 20, and VEGF receptor fusion protein, and optionally, one or more additional components, such as those discussed herein. In some cases, the formulation is prepared to also contain taurine or propanesulfonic acid, but if it does not contain taurine or propanesulfonic acid, it may also not contain inorganic salts. In embodiments herein, the sucrose is present in a weight of about 4% to about 10% per volume, the polysorbate 20 is present in a weight of about 0.02% to about 0.1% per volume, and the receptor fusion protein is present in a concentration of about 41 mg / ml to about 275 mg / ml. If the formulation contains taurine or propanesulfonic acid, it may be present in concentrations of, for example, about 25 mM to about 100 mM, but also in concentrations of 50 mM to 70 mM. This method may involve loading a sterile syringe with a predetermined volume of the prepared formulation so that its volume contains a dose of VEGF receptor fusion protein of 0.1 mg to 10 mg.

[0026] The present invention also provides a method for administering the formulation of the present invention to a subject (e.g., a human), comprising intraocular injection (e.g., intravitreal injection) of the formulation into the eye of the subject. The present invention also provides a method for administering the formulation of the present invention to a subject (e.g., a human), comprising implanting an intravitreal implant containing the formulation of the present invention into the vitreous humor of the subject.

[0027] Embodiments of this specification also include methods for treating intraocular neovascular disorders, such as age-related macular degeneration (wet), macular edema after retinal vein occlusion, retinal vein occlusion (RVO), central retinal vein occlusion (CRVO), branch retinal vein occlusion (BRVO), diabetic macular edema (DME), choroidal neovascularization (CNV), iris neovascularization, neovascular glaucoma, postoperative fibrosis of glaucoma, proliferative vitreoretinopathy (PVR), optic neovascularization, corneal neovascularization, retinal neovascularization, vitreous neovascularization, panangiogenesis, vascular retinopathy, or diabetic retinopathy (e.g., nonproliferative diabetic retinopathy and / or proliferative diabetic retinopathy), in subjects requiring it by intraocular injection of at least about 2 mg (e.g., 4 mg, 6 mg, or 8 mg) of a VEGF receptor fusion protein (e.g., aflibercept or convercept), for example, any of the formulations described herein, into the eye of a subject requiring it. In one embodiment of the present invention, the injection volume is 100 microliters or less (e.g., 100 microliters, 50 microliters, or 57 microliters). The method comprises intravitreal injection of a premixed aqueous solution having a concentration of VEGF receptor fusion protein from 41 mg / ml to about 275 mg / ml, a pharmaceutically acceptable sugar, a pharmaceutically acceptable buffer, and a pharmaceutically acceptable surfactant. In the therapeutic method using the premixed aqueous solution, dilution is not required. In the embodiments herein, the premixed aqueous solution has a pH of about 6.0 to about 6.5 and a viscosity of about 10 cP to 13 cP.

[0028] In a therapeutic embodiment, the VEGF receptor fusion protein comprises VEGFR1R2-FcΔC1(a) encoded by the nucleic acid sequence of SEQ ID NO: 1, amino acids 27-129 of SEQ ID NO: 2, amino acids 130-231 of SEQ ID NO: 2, or a polymerized component comprising amino acids 232-457 of SEQ ID NO: 2, or any combination thereof. In one embodiment of the present invention, the VEGF receptor fusion protein is aflibercept or convercept.

[0029] Other embodiments of this disclosure will become apparent from a closer examination of the detailed description below.

[0030] The above and other aspects, features, and advantages of the embodiments disclosed herein will become more apparent to those skilled in the art by reference to the accompanying drawings. [Brief explanation of the drawing]

[0031] [Figure 1A] This graph shows the stability of VEGF receptor fusion protein (aflibercept) in four different formulations (B, H, D, and G) over a 36-month period at 2°C to 8°C. Size exclusion ultrahigh performance liquid chromatography (SE-UPLC) was used to test the stability of VEGF receptor fusion protein and identify the formation of high molecular weight (HMW) species (an indicator of proteolysis). [Figure 1B] This graph shows the stability of VEGF receptor fusion protein (aflibercept) in four formulations (B, H, D, and G) over a 36-month period at 2°C to 8°C. The stability of VEGF receptor fusion protein was tested using SE-UPLC to identify the proportion of the dominant species in each formulation. [Figure 1C] This bar graph shows the formation of VEGF receptor fusion protein charge variants in four formulations (B, H, D, and G) over a 36-month period at 2°C to 8°C. Acidic species levels were tested at time of manufacture (0.0), 12 months, 24 months, and 36 months using imaged capillary isoelectric focusing (iCIEF). [Figure 1D] This bar graph shows the formation of VEGF receptor fusion protein charge variants in four formulations (B, H, D, and G) over a 36-month period at 2°C to 8°C. For identification of the main species, iCIEF was used to test at manufacturing (0.0), 12 months, 24 months, and 36 months. [Figure 2A]This graph shows the stability of 150 mg / ml VEGF receptor fusion protein (aflibercept) in a 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% polysorbate 20 (w / v) preparation at pH 6.2, with and without L-arginine monohydrochloride, over a 28-day period at 37°C. The stability of the VEGF receptor fusion protein was tested using SE-UPLC to identify HMW species formation. [Figure 2B] This graph shows the stability of 150 mg / ml VEGF receptor fusion protein in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% polysorbate 20 (w / v) formulations at pH 6.2, with and without L-arginine monohydrochloride, over a 28-day course at 37°C. The stability of VEGF receptor fusion protein was tested using SE-UPLC to identify the proportion of the major species in each formulation. [Figure 3A] This bar graph shows the viscosity of 10 mM sodium phosphate buffered preparations containing 155 mg / ml of VEGF receptor fusion protein and without salt, 100 mM arginine, 200 mM arginine, 50 mM lysine, 200 mM lysine, 50 mM sodium chloride, or 100 mM sodium chloride. Viscosity was measured in cP at 20°C. [Figure 3B] This bar graph shows the viscosity of 10 mM histidine buffered preparations containing 155 mg / ml of VEGF receptor fusion protein and without salt, 100 mM arginine, 200 mM arginine, 50 mM lysine, 200 mM lysine, 50 mM sodium chloride, or 100 mM sodium chloride. Viscosity was measured in cP at 20°C. [Figure 3C] This graph shows the viscosity of VEGF receptor fusion protein at various concentrations under different formulation conditions (with or without 50 mM arginine hydrochloride). Viscosity was measured in cP at 20°C. [Figure 4A]This graph shows the stability of a 150 mg / ml VEGF receptor fusion protein at pH 6.2, in the presence or absence of 50 mM L-arginine monohydrochloride, in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, over 12 months at 5°C. The VEGF receptor fusion protein concentration was 150 mg / ml. The stability of the VEGF receptor fusion protein was tested using SE-UPLC to identify HMW species formation. [Figure 4B] This graph shows the stability of 150 mg / ml of VEGF receptor fusion protein in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20 at pH 6.2, with and without 50 mM L-arginine monohydrochloride, over 12 months at 5°C. The VEGF receptor fusion protein concentration was 150 mg / ml. The stability of the VEGF receptor fusion protein was tested using SE-UPLC to identify the proportion of the major species in each formulation. [Figure 5] This graph shows the viscosity of the formulation under two buffer conditions at 20°C: 10 mM phosphate buffer or 10 mM histidine buffer. The concentration of VEGF receptor fusion protein varies from 10 mg / ml to 170 mg / ml. Viscosity was measured in mPa-S. [Figure 6] The dynamic light scattering screens for many different formulation conditions, each containing 2–10 mg / ml of protein, are shown. Diffusion interaction parameters indicated that taurine and PSA (propanesulfonic acid) improved Kd. [Figure 7] This graph monitors the proportion of high molecular weight (HMW) species in formulations F1-F9 (formulations WW-EEE) over time, as measured by size exclusion ultra-high performance liquid chromatography (SE-UPLC) after storage at 5°C for 6 months. Formulations F1-F9 are listed in Table 7-1 of this specification. [Figure 8A]SE-UPLC shows the percentage of high molecular weight species after storage at 5°C for 3 months (A) or incubation at 37°C for 28 days (B). Formulations F1-F4 (EEE, SSS, CCC (140 mg / ml), and TTT) are shown in Table 8-1 below. [Figure 8B] SE-UPLC shows the percentage of high molecular weight species after storage at 5°C for 3 months (A) or incubation at 37°C for 28 days (B). Formulations F1-F4 (EEE, SSS, CCC (140 mg / ml), and TTT) are shown in Table 8-1 below. [Figure 9] The viscosity (cp) of formulations F1 to F12 at 20°C in the initial stage is shown. Formulations F1 to F12 are shown in Table A below. [Table 1] [Figure 10] The osmotic pressures (mmol / kg) of formulations F1 to F12 (listed in Table A of this specification) are shown. [Figure 11A] This shows the proportion of high molecular weight species in formulations F1-F6 (formulations GGG, HHH, III, JJJ, LLL, and KKK) over time, measured by SE-UPLC after storage at 37°C for up to 28 days (A) or at 5°C for up to 3 months (B). [Figure 11B] This shows the proportion of high molecular weight species in formulations F1-F6 (formulations GGG, HHH, III, JJJ, LLL, and KKK) over time, measured by SE-UPLC after storage at 37°C for up to 28 days (A) or at 5°C for up to 3 months (B). [Figure 12] Table 9-3 (GGG~RRR) shows the dynamic light scattering (diffusion coefficient (cm2 / sec), radius (nm), and %Pd) of the formulations at the initial stage. [Figure 13A]Baseline FA images and OCT (30-degree lens) images of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13B] Baseline FA images and OCT (30-degree lens) images of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13C] Baseline FA images and OCT (30-degree lens) images of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13D] Baseline FA images and OCT (30-degree lens) images of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 14A] The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 14B]The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 14C] The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 14D] The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 14E] The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 14F] The images show rabbit FA images on day 1 (A), day 7 (B), and day 14 (C) and OCT time progression on day 1 (D), day 7 (E), and day 14 (F) for one rabbit (326-OS) administered histidine buffer solution (30-degree lens) (7 mg / eye). [Figure 15A] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15B]The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15C] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15D] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15E] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15F] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15G] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 15H]The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (326-OS) administered histidine buffer solution (55-degree lens) (7 mg / eye), as well as the temporal progression of OCT images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 16A] The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 16B] The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 16C] The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 16D] The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 16E] The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 16F]The images show rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) of one rabbit (329-OS) administered phosphate buffer (30-degree lens) (7 mg / eye), as well as the temporal progression of OCT images on day 1 (D), week 1 (E), and week 2 (F). [Figure 17A] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17B] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17C] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17D] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17E] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17F]The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17G] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 17H] The images show rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) of one rabbit (329-OS) administered phosphate buffer (55-degree lens) (7 mg / eye), as well as OCT time progression images at weeks 3 (E), 4 (F), 7 (G), and 8 (H). [Figure 18A] The purity (proportion of conventional species) (A) and the proportion of high molecular weight (HMW) species (B) of formulations UUU~BBBB, analyzed by SE-UPLC at 37°C (up to 1 month), are shown over time (see Table 11-1). [Figure 18B] The purity (proportion of conventional species) (A) and the proportion of high molecular weight (HMW) species (B) of formulations UUU~BBBB, analyzed by SE-UPLC at 37°C (up to 1 month), are shown over time (see Table 11-1). [Figure 19A]The stability and purity analysis of a formulation containing a 114.3 mg / mL VEGF trap (aflibercept) formulated with 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride is shown by size exclusion chromatography measurement of the proportion of high molecular weight species (HMW) (A) and (ii) the proportion of main species (main peak) (B) after incubation at 5 °C or 37 °C for up to 2 months, and by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by particle light obscuration analysis (D) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by microscopic measurement of subvisible particulate matter after incubation at 37 °C for up to 28 days (E). [Figure 19B] The stability and purity analysis of a formulation containing a 114.3 mg / mL VEGF trap (aflibercept) formulated with 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride is shown by size exclusion chromatography measurement of the proportion of high molecular weight species (HMW) (A) and (ii) the proportion of main species (main peak) (B) after incubation at 5 °C or 37 °C for up to 2 months, and by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by particle light obscuration analysis (D) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by microscopic measurement of subvisible particulate matter after incubation at 37 °C for up to 28 days (E). [Figure 19C]The stability and purity analysis of a formulation containing a 114.3 mg / mL VEGF trap (aflibercept) formulated with 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride is shown by size exclusion chromatography measurement of the proportion of high molecular weight species (HMW) (A) and (ii) the proportion of main species (main peak) (B) after incubation at 5 °C or 37 °C for up to 2 months, and by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by particle light obscuration analysis (D) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by microscopic measurement of subvisible particulate matter after incubation at 37 °C for up to 28 days (E). [Figure 19D] The stability and purity analysis of a formulation containing a 114.3 mg / mL VEGF trap (aflibercept) formulated with 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride is shown by size exclusion chromatography measurement of the proportion of high molecular weight species (HMW) (A) and (ii) the proportion of main species (main peak) (B) after incubation at 5 °C or 37 °C for up to 2 months, and by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by particle light obscuration analysis (D) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by microscopic measurement of subvisible particulate matter after incubation at 37 °C for up to 28 days (E). [Figure 19E]The stability and purity analysis of a formulation containing a 114.3 mg / mL VEGF trap (aflibercept) formulated with 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride is shown by size exclusion chromatography measurement of the proportion of high molecular weight species (HMW) (A) and (ii) the proportion of main species (main peak) (B) after incubation at 5 °C or 37 °C for up to 2 months, and by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by particle light obscuration analysis (D) to determine the presence of subvisible particulate matter after incubation at 37 °C for up to 28 days, and by microscopic measurement of subvisible particulate matter after incubation at 37 °C for up to 28 days (E). [Figure 20A] This shows the stability and purity analysis of formulations containing 80, 100, 120, or 140 mg / ml of aflibercept, measured by SE-UPLC of the percentage of high molecular weight species (HMW) after incubation at 2–8°C (A) for up to 6 months or at 37°C (B) for up to 28 days. [Figure 20B] This shows the stability and purity analysis of formulations containing 80, 100, 120, or 140 mg / ml of aflibercept, measured by SE-UPLC of the percentage of high molecular weight species (HMW) after incubation at 2–8°C (A) for up to 6 months or at 37°C (B) for up to 28 days. [Figure 21] The percentage of tested rabbit eyes with complete leak suppression over time after administration of 500 micrograms or 2 mg of aflibercept is shown (Gehan-Breslow-Wilcoxon trial (P0.0453)). [Modes for carrying out the invention]

[0032] The present invention provides a formulation having a high concentration of VEGF receptor fusion protein (e.g., aflibercept) that exhibits excellent functional and storage properties developed despite significant technical hurdles. For example, (e.g., a polypeptide such as VEGF receptor fusion protein) A common method for identifying suitable excipients for drug-containing formulations is to assess the stability of polypeptides under accelerated stress conditions, such as high temperatures (e.g., 37°C). Excipients unsuitable under non-stress conditions (e.g., low temperatures such as 5°C) will typically cause undesirable effects in a short time under stress, such as protein aggregation. This approach is common in the biotechnology and pharmaceutical industries, insofar as it facilitates the removal of excipients that are unlikely to stabilize the drug. See, for example, Magari, Assessing Shelf Life Using Real-Time and Accelerated Stability Tests, Biopharm Intl. 16(11):36-48 (2003). In some cases, products may be released based on accelerated stability data, but this should be done in parallel with real-time (non-accelerated) shelf life analysis. See Magari (2003) and FDA, Guidelines for Submitting Documentation for the stability of Human Drugs and Biologics, Rockville, MD (1987). However, here, while the presence of arginine in the histidine formulation was stable at 5°C, arginine appeared to tend to lose stability under temperature stress (37°C). See Figure 8 (A and B). This property of the formulation described herein would have presented a technical difficulty that would deter practitioners from selecting arginine. Therefore, the likelihood of practitioners selecting arginine as an excipient would have been low. Nevertheless, the formulation described herein was obtained by overcoming such technical hurdles and achieved a formulation with high stability. The formulation of VEGF trap in histidine buffer also led to a beneficial reduction in viscosity compared to that observed in the phosphate buffer formulation. Relatively low viscosity is desirable because a small needle hole is preferred for intravitreal injection (to reduce patient discomfort and eye trauma). Low viscosity formulations require less force to push the formulation through the needle, making injection of the formulation through the needle easier for the treating physician. Furthermore, the histidine and arginine-containing formulations were well tolerated in the eyes of rabbits.

[0033] Herein, we refer in detail to representative embodiments. It should be understood that the following description is not intended to limit embodiments to one preferred embodiment. Rather, they are intended to cover alternatives, modifications, and equivalents that may fall within the spirit and scope of the embodiments described, as set forth in the appended claims.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in which this disclosure relates. Where used herein, the term “about” means that, when used in relation to a particular enumerated number, the value may vary by no more than 1% from the enumerated value. For example, as used in this invention, the expression “about 100” includes 99 and 101, as well as all values ​​in between (e.g., 99.1%, 99.2%, 99.3%, 99.4%, etc.).

[0035] In embodiments of the present invention, the pharmaceutical formulation of the present invention is a USP for small-volume injection (SVP) of ophthalmic solutions. <789> It meets the following criteria, for example, containing fewer than approximately 50 particles with a diameter greater than 10 μm per 1 ml, fewer than approximately 5 particles with a diameter greater than 25 μm per 1 ml, or fewer than approximately 2 particles with a diameter greater than 50 μm per 1 ml.

[0036] For the purposes of this specification, it should be noted that “intravitreal injection” refers to injection into the vitreous humor of the eye (near the retina at the back of the eye). Expressions such as “suitable for intravitreal administration” or “suitable for intravitreal injection” mean that the formulation in question can be safely injected into the vitreous humor of the target eye without causing any side effects beyond those known to occur with intravitreal injection of EYLEA.

[0037] In this specification, the term “pharmaceutical preparation” refers to a preparation comprising a pharmaceutically acceptable carrier used, for example, to administer a VEGF receptor fusion protein (e.g., aflibercept or convercept) to a subject for therapeutic / medical use.

[0038] The term "pharmaceutically acceptable" refers to a formulation that is suitable for administration to the eye, within the bounds of sound medical judgment.

[0039] In this specification, the term "subject" means any mammalian subject (e.g., rabbit, mouse, rat, or monkey), in particular a human being for whom diagnosis, prognosis, or treatment is desired with, for example, the formulations described herein.

[0040] The term "aqueous" refers to a formulation that contains water.

[0041] The terms “to treat” or “to cure” refer to therapeutic means that reverse, stabilize, or eliminate an undesirable disease or disorder (e.g., intraocular neovascularization disorder or cancer), for example, in the case of intraocular neovascularization disorder, by causing regression, stabilization, or elimination of one or more symptoms or signs of such disease or disorder to a clinically measurable degree; by causing a decrease or maintenance of the Diabetic Retinopathy Severity Score (DRSS); by improving or maintaining visual acuity (e.g., best corrected visual acuity, measured by an increase in ETDRS letters); by increasing or maintaining the visual field; and / or decreasing or maintaining the thickness of the central retina; and in the case of cancer, by stopping or reversing the growth, survival, and / or metastasis of the cancer cells of the subject. Typically, therapeutic means are the administration of one or more doses of a therapeutically effective amount of VEGF receptor fusion protein to a subject having the disease or disorder.

[0042] "Preventing" or "prevention" refers to preventive measures taken to stop the development of an undesirable disease or disorder (e.g., neovascularization).

[0043] SE-UPLC can be used in the present invention to quantify the presence of high molecular weight species in a formulation. SE stands for size exclusion chromatography. UPLC stands for ultrahigh performance liquid chromatography. A suitable SE column that can be used in a UPLC system to characterize such HMW species of VEGF receptor fusion proteins (e.g., aflibercept or convercept) in a formulation can degrade molecules in the molecular weight range of about 10,000 to 450,000 daltons. See, for example, the ACQUITY UPLC Protein BEH SEC 200 Å column. In embodiments of the present invention, two such columns are connected in tandem when quantifying HMW species in a formulation. UPLC is improved over HPLC (high-performance liquid chromatography) in terms of sensitivity and resolution. UPLC operates at high pressure and uses instruments that use finer particles (typically less than about 2.5 μm) than those used in HPLC. Furthermore, the UPLC mobile phase operates at a higher linear velocity than HPLC.

[0044] Embodiments of this specification include formulations comprising high concentrations (e.g., about 60 mg / ml, about 80 mg / ml, about 90 mg / ml, about 100 mg / ml, about 113.3 mg / ml, about 114.3 mg / ml, about 120 mg / ml, about 133.3 mg / ml, about 140 mg / ml, about 150 mg / ml, about 200 mg / ml, or about 250 mg / ml) of VEGF receptor fusion protein (e.g., aflibercept or convercept). Suitable formulations included herein comprise high concentrations of VEGF receptor fusion protein, buffer, heat stabilizer, and surfactant. In some embodiments, suitable formulations further comprise viscosity-reducing agents. In other embodiments, suitable formulations substantially exclude all viscosity-reducing agents. Typical formulations include: It has a pH of approximately 5.0 to 6.8 (for example, 5.8), but may include any pH that is useful for administering the VEGF receptor fusion protein to the target eye.

[0045] The present invention includes a formulation comprising a VEGF receptor fusion protein (e.g., aflibercept or convercept) associated with one or more additional therapeutic agents (e.g., Ang-2 inhibitors (e.g., anti-ANG2 antibodies or their antigen-binding fragments or nesbukumab), Tie-2 receptor activator, anti-PDGF, PDGF receptor or PDGF receptor beta antibodies or their antigen-binding fragments, and / or additional VEGF antagonists such as bevacizumab, ranibizumab, pegaptanib, or soluble forms of human vascular endothelial growth factor receptor-3 (VEGFR-3) containing extracellular domains 1-3 represented as an Fc fusion protein), as well as a method of prevention or treatment comprising the administration of such formulation as discussed herein. In embodiments of the present invention, the formulation of the present invention comprises a VEGF receptor fusion protein such as aflibercept, but excludes additional therapeutic agents (e.g., antibodies or their antigen-binding fragments).

[0046] The term “related” indicates that the formulation and further therapeutic agents may be formulated, for example, into a single composition for simultaneous delivery, or into two or more compositions (e.g., a kit) separately. Further therapeutic agents may be formulated by themselves into their own pharmaceutical formulation. Each may be administered to the subject simultaneously with or at a different time than when the others are administered, for example, each administration may be given non-simultaneously (e.g., separately or sequentially) at intervals over a given period. Furthermore, the formulation and further therapeutic agents may be administered to the subject by the same or different routes.

[0047] In embodiments of the present invention, the formulation comprises any one or more of the following: sodium sulfate (e.g., 50 mM), sodium thiocyanate (e.g., 50 mM), sodium citrate (e.g., 40 mM), glycine (e.g., 50 mM), sodium chloride (e.g., 50 mM), lysine (e.g., 50 mM), sodium aspartate (e.g., 50 mM), and / or sodium glutamate (e.g., 50 mM). For example, in embodiments, the formulation comprises a combination of sodium citrate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), glycine (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), sodium aspartate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), or sodium glutamate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM).

[0048] VEGF receptor fusion proteins and other VEGF inhibitors For the purposes of this specification, “VEGF receptor fusion protein” refers to a molecule comprising one or more VEGF receptors or their domains fused to another polypeptide that interferes with the interaction between VEGF and the native VEGF receptor, for example, two of such fusion polypeptides binding together to form a homodimer or other multimer. Such VEGF receptor fusion proteins may also be referred to as “VEGF traps” or “VEGF traps.” VEGF receptor fusion proteins in the context of this disclosure as included in this definition include chimeric polypeptides comprising two or more immunoglobulin (Ig)-like domains of VEGF receptors such as VEGFR1 (also known as Flt1) and / or VEGFR2 (also known as Flk1 or KDR), and may also include a multimerizing domain (e.g., an Fc domain).

[0049] An exemplary VEGF receptor fusion protein is a molecule called VEGF1R2-FcΔC1(a), encoded by the nucleic acid sequence of SEQ ID NO: 1 or by nucleotides 79-1374 or 79-1371.

[0050] VEGF1R2-FcΔC1(a) has three components, namely, (1) The VEGFR1 component containing amino acids 27-129 of SEQ ID NO: 2, (2) The VEGFR2 component containing amino acids 130-231 of SEQ ID NO: 2, and (3) A polymerized component containing amino acids 232-457 of SEQ ID NO: 2 ("FcΔC1(a)") (the C-terminal amino acid of SEQ ID NO: 2, i.e., K458, may or may not be present in the VEGF receptor fusion protein; see U.S. Patent No. 7,396,664 or 7,354,579 incorporated herein for all purposes). Note that amino acids 1-26 of SEQ ID NO: 2 constitute the signal sequence. In embodiments of the present invention, the VEGF receptor fusion protein comprises amino acids 27-458 or 27-457 of SEQ ID NO: 2.

[0051] In embodiments of the present invention, the VEGF receptor fusion protein is (1) The immunoglobulin-like (Ig) domain 2 of the first VEGF receptor (e.g., VEGFR1), and (2) Ig domain 3 of the second VEGF receptor (e.g., VEGFR2), (3) and, if necessary, further comprising the Ig domain 4 of a second VEGF receptor (e.g., VEGFR2), (4) Contains a polymerizing component (e.g., the Fc domain of IgG). For example, in an embodiment of the present invention, the VEGF receptor fusion protein has the following arrangement of the domains: • [VEGFR1 Ig domain 2]-[VEGFR2 Ig domain 3]-[MC] (e.g., its homodimer) or • [VEGFR1 Ig domain 2]-[VEGFR2 Ig domain 3]-[VEGFR2 Ig domain 4]-[MC] (for example, its homodimer).

[0052] In embodiments of the present invention, the VEGF receptor fusion protein is, for example, a VEGF minitrap, which is a VEGF trap molecule having a truncated multimerized component (e.g., Fc), where the minitrap still includes an Fc hinge region. See, for example, WO2005 / 00895 or U.S. Patent No. 7,396,664.

[0053] This disclosure also, to the extent of its scope, provides VEGF-binding molecules and anti-VEGF antibodies, as well as their antigen-binding fragments, instead of VEGF receptor fusion proteins, • Bevacizumab (for example, at concentrations of approximately 80-90 or 88 mg / ml), • Ranibizumab (for example, at concentrations of approximately 20-40 mg / ml, e.g., 21-35, 21 or 35 mg / ml), • Anti-VEGF aptamers such as pegaptanib (e.g., pegaptanib sodium), • Single-stranded drugs such as brolucizumab (for example, V L -V H ) Anti-VEGF antibody (e.g., concentrations of approximately 200-400 or 200, 210, 400 or 420 mg / ml), • Anti-VEGF darpin such as abisiperpegol DARPin (e.g., at concentrations of approximately 70-140, 70 or 140 mg / ml), or Please note that this product includes high-concentration formulations containing bispecific anti-VEGF antibodies that also bind to ANG2, such as RG7716 (for example, at concentrations of approximately 100-400, 100, 105, 400, or 420 mg / ml). To minimize the repetition of the embodiments discussed herein, the scope of the present invention is intended to include embodiments in which any of the formulations discussed herein includes, instead of a VEGF receptor fusion protein, an anti-VEGF antibody or antibody fragment or another VEGF-binding molecule discussed herein (e.g., substituted with anti-VEGF DARPin) at any of the concentrations discussed herein. For example, the present invention includes formulations having 35 or 80 mg / ml of ranibizumab, a buffer, a heat stabilizer, a viscosity reducer, and a surfactant. .

[0054] DARPin is a designed ankyrin repeat protein. DARPin typically contains 3-4 densely packed repeats of about 33 amino acid residues, each repeat containing a β-turn and two antiparallel α-helices. This robust framework provides protein stability while also allowing for the presentation of a variable region, usually containing 6 amino acid residues per repeat, for target recognition.

[0055] An "anti-VEGF" antibody or antigen-binding fragment of an antibody refers to an antibody or fragment that specifically binds to VEGF.

[0056] Exemplary VEGF receptor fusion proteins include aflibercept (EYLEA®, Regeneron Pharmaceuticals, Inc.) or convercept (commercially marketed by Chengdu Kanghong Biotechnology Co., Ltd.). See International Patent Application Publication Nos. WO2005 / 121176 or WO2007 / 112675. The terms “Aflibercept” and “Convercept” include their biosimilar versions. A biosimilar version of a reference product (e.g., aflibercept) generally refers to a product containing the same amino acid sequence but includes products that are biosimilars under the U.S. Biologics Price Competition and Innovation Act.

[0057] The pharmaceutical formulations of the present invention are "high concentration." The high concentration pharmaceutical formulations of the present invention contain VEGF receptor fusion protein at concentrations of at least 41 mg / ml, at least 80 mg / ml, at least 100 mg / ml, at least 125 mg / ml, at least 140 mg / ml, at least 150 mg / ml, at least 175 mg / ml, at least 200 mg / ml, at least 225 mg / ml, at least 250 mg / ml, or at least 275 mg / ml. Alternatively, "high concentration" may refer to formulations containing VEGF receptor fusion protein at concentrations of about 140 mg / ml to about 160 mg / ml, at least about 140 mg / ml but less than 160 mg / ml, 41 mg / ml to about 275 mg / ml, about 70 mg / ml to about 75 mg / ml, or about 80 mg / ml to about 250 mg / ml.In some embodiments, the concentration of the VEGF receptor fusion protein in the formulation is 41 mg / ml, 42 mg / ml, 43 mg / ml, 44 mg / ml, 45 mg / ml, 46 mg / ml, 47 mg / ml, 48 mg / ml, 49 mg / ml, 50 mg / ml, 51 mg / ml, 52 mg / ml, 53 mg / ml, 54 mg / ml, 55 mg / ml, 56 mg / ml, 57 mg / ml, 58 mg / ml, 59 mg / ml, 60 mg / ml, 61 mg / ml, 62 mg / ml, 63 mg / ml, 64 mg / ml, 65 mg / ml, 66 mg / ml, 67 mg / ml, 68 mg / ml, 69 mg / ml, 70 mg / ml, 71 mg / ml, 72 mg / ml, 73 mg / ml, 74 mg / ml, 75 mg / ml, 76 mg / ml, 77 mg / ml, 78 mg / ml, 79 mg / ml, 80 mg / ml, 81 mg / ml, 82 mg / ml, 83 mg / ml, 84 mg / ml, 85 mg / ml, 86 mg / ml, 87 mg / ml, 88 mg / ml, 89 mg / ml, 90 mg / ml, 91 mg / ml, 92 mg / ml, 93 mg / ml, 94 mg / ml, 95 mg / ml, 96 mg / ml, 97 mg / ml, 98 mg / ml, 99 mg / ml, 100 mg / ml, 101 mg / ml, 102 mg / ml, 103 mg / ml, 104 mg / ml, 105 mg / ml, 106 mg / ml, 107 mg / ml, 108 mg / ml, 109 mg / ml, 110 mg / ml, 111 mg / ml, 112 mg / ml, 113 mg / ml, 113.3 mg / ml, 114 mg / ml, 114.1 mg / ml, 114.2 mg / ml, 114.3 mg / ml, 114.4 mg / ml, 114.5 mg / ml, 114.6 mg / ml, 114.7 mg / ml, 114.8 mg / ml, 114.9 mg / ml, 115 mg / ml, 116 mg / ml, 117 mg / ml, 118 mg / ml, 119 mg / ml, 120 mg / ml. 、121mg / ml、122mg / ml、123mg / ml、124mg / ml、125mg / ml、126mg / ml、127mg / ml、128mg / ml、129mg / ml、130mg / ml、131mg / ml、132mg / ml、133mg / ml、133mg / ml、133.3mg / ml、133.4mg / ml、134mg / ml、135mg / ml、136mg / ml、137mg / ml、138mg / ml、139mg / ml、140mg / ml、141mg / ml、142mg / ml、143mg / ml、144mg / ml、145mg / ml、146mg / ml、147mg / ml、148mg / ml、149mg / ml、150mg / ml、151mg / ml、152mg / ml、153mg / ml、154mg / ml、155mg / ml、156mg / ml、157mg / ml、158mg / ml、159mg / ml、160mg / ml、161mg / ml、162mg / ml、163mg / ml、164mg / ml、165mg / ml、166mg / ml、167mg / ml、168mg / ml、169mg / ml、170mg / ml、171mg / ml、172mg / ml、173mg / ml、174mg / ml、175mg / ml、176mg / ml、177mg / ml、178mg / ml、179mg / ml、180mg / ml、181mg / ml、182mg / ml、183mg / ml、184mg / ml、185mg / ml、186mg / ml、187mg / ml、188mg / ml、189mg / ml、190mg / ml、191mg / ml、192mg / ml、193mg / ml、194mg / ml、195mg / ml、196mg / ml、197mg / ml、198mg / ml、199mg / ml、200mg / ml、201mg / ml、202mg / ml、203mg / ml、204mg / ml、205mg / ml、206mg / ml、207mg / ml、208mg / ml、209mg / ml、210mg / ml、211mg / ml、212mg / ml、213mg / ml、214mg / ml、215mg / ml、216mg / ml、217mg / ml、218mg / ml、219mg / ml、220mg / ml、221mg / ml、222mg / ml、223mg / ml、224mg / ml、225mg / ml、226mg / ml、227mg / ml、228mg / ml, 229mg / ml, 230mg / ml, 231mg / ml, 232mg / ml, 233mg / ml, 234mg / ml, 235mg / ml, 236mg / ml, 237mg / ml, 238mg / ml, 239mg / ml, 240m g / ml, 241mg / ml, 242mg / ml, 243mg / ml, 244mg / ml, 245mg / ml, 246mg / ml, 247mg / ml, 248mg / ml, 249mg / ml, 250mg / ml, 251mg / ml, 252mg / ml, This refers to any of the following concentrations: 253 mg / ml, 254 mg / ml, 255 mg / ml, 256 mg / ml, 257 mg / ml, 258 mg / ml, 259 mg / ml, 260 mg / ml, 261 mg / ml, 262 mg / ml, 263 mg / ml, 264 mg / ml, 265 mg / ml, 266 mg / ml, 267 mg / ml, 268 mg / ml, 269 mg / ml, 270 mg / ml, 271 mg / ml, 272 mg / ml, 273 mg / ml, 274 mg / ml, or 275 mg / ml. Other VEGF receptor fusion protein concentrations are intended herein, as long as the concentration functions according to the embodiments described herein.

[0058] In embodiments of the present invention, the pharmaceutical formulation of the present invention is in a concentration containing about 4, 6, 8, 10, 12, 14, 16, 18, or 20 mg of VEGF receptor fusion protein (e.g., aflibercept), or in a quantity of about 100 μl or less, about 75 μl or less, or about 70 μl or less, for example, about 50 μl, 51 μl, 52 μl, 53 μl, 54 μl, 55 μl, 56 μl, 57 μl, 58 μl, 59 μl, 60 μl, 61 μl, 62 μl, 63 μl, 64 μl, 65 μl, 66 μl, This is the amount of such protein in any of the acceptable doses discussed herein, which is 67 μl, 68 μl, 69 μl, 70 μl, 71 μl, 72 μl, 73 μl, 74 μl, 75 μl, 76 μl, 77 μl, 78 μl, 79 μl, 80 μl, 81 μl, 82 μl, 83 μl, 84 μl, 85 μl, 86 μl, 87 μl, 88 μl, 89 μl, 90 μl, 91 μl, 92 μl, 93 μl, 94 μl, 95 μl, 96 μl, 97 μl, 98 μl, 99 μl, or 100 μl.

[0059] The present invention includes any of the formulations described in the “Exemplary Formulations” herein, wherein the concentration of the VEGF receptor fusion protein (e.g., aflibercept) is substituted with the concentrations described in this section ("VEGF Receptor Fusion Protein and Other VEGF Inhibitors").

[0060] buffer solution Buffers for use herein refer to solutions that resist pH changes due to the use of acid-base conjugates. Buffers can maintain a pH in the range of about 5.0 to about 6.8, more typically about 5.8 to about 6.5, and most typically about 6.0 to about 6.5. In some cases, the pH of the formulations of the present invention is about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, or about 6.8. Exemplary buffers for inclusion in the formulations herein include histidine-based buffers, e.g., histidine, histidine hydrochloride, and histidine acetate. The buffers to be included in the formulations herein may alternatively be phosphate-based buffers, e.g., sodium phosphate; acetate-based buffers, e.g., sodium acetate or acetic acid; or citrate-based buffers, e.g., sodium citrate or citric acid. It is also recognized that the buffers may be mixtures thereof, as long as the buffers function to buffer the formulations within the above pH range. In some cases, the buffers are about 5 mM to about 25 mM, or more typically about 5 mM to about 15 mM. The buffers may be about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, or about 25 mM.

[0061] In one embodiment of the present invention, a histidine-based buffer is prepared using histidine and histidine monohydrochloride.

[0062] surfactants For use herein, surfactants refer to components that protect high-concentration VEGF receptor fusion proteins from stress induced by various surfaces and interfaces. Therefore, surfactants may be used to limit or minimize aggregation of VEGF receptor fusion proteins and to promote protein solubility. Suitable surfactants herein are shown to be nonionic and may include surfactants having a polyoxyethylene moiety. Exemplary surfactants in this category include polysorbate 20, polysorbate 80, poloxamer 188, polyethylene glycol 3350, and mixtures thereof. Surfactants in formulations may be present at approximately 0.02% to approximately 0.1% by weight (w / v), more typically, approximately 0.02% to approximately 0.04% (w / v), per volume. In some cases, the surfactant content is approximately 0.02% (w / v), 0.03% (w / v), 0.04% (w / v), 0.05% (w / v), 0.06% (w / v), 0.07% (w / v), 0.08% (w / v), 0.09% (w / v), or 0.1% (w / v).

[0063] Heat stabilizer For use herein, a heat stabilizer refers to a component that provides heat stability against thermal denaturation of VEGF receptor fusion proteins and protects them from loss of potency or activity. Suitable heat stabilizers may include sugars, such as sucrose, trehalose, sorbitol, or mannitol, or amino acids, such as L-proline, L-arginine (e.g., L-arginine monohydrochloride), or taurine. Furthermore, heat stabilizers may also include substituted acrylamides or propanesulfonic acid, or compounds such as glycerol.

[0064] In some cases, the formulations described herein include sugars and taurine, sugars and amino acids, sugars and propanesulfonic acid, sugars and taurine, glycerol and taurine, glycerol and propanesulfonic acid, amino acids and taurine, or both amino acids and propanesulfonic acid. Furthermore, the formulations may include sugars, taurine and propanesulfonic acid, glycerol, taurine and propanesulfonic acid, and L-proline, taurine and propanesulfonic acid.

[0065] Embodiments of this specification typically have a heat stabilizer present alone, each independently present in concentrations of about 2% to about 10% (w / v) or 4% to about 10% (w / v), or about 4% to about 9% (w / v), or about 5% to about 8% (w / v). The heat stabilizer in the formulation may be present in concentrations of about 2% (w / v), about 2.5% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), about 10% (w / v), or about 20% (w / v).

[0066] With respect to taurine and propanesulfonic acid, in one embodiment of the present invention, these heat stabilizers may be present in the formulation at a concentration of about 25 mM to about 100 mM, more typically about 50 mM to about 75 mM (compared to other heat stabilizers).

[0067] Viscosity reducer Viscosity-reducing agents are typically used to reduce or prevent protein aggregation. Viscosity-reducing agents for inclusion herein include sodium chloride, magnesium chloride, D- or L-arginine (e.g., L-arginine monohydrochloride), lysine, or mixtures thereof. Where present herein, viscosity-reducing agents may be present at concentrations of about 10 mM to about 100 mM, more typically about 30 mM to about 75 mM, and even more typically about 40 mM to about 70 mM. In some cases, viscosity-reducing agents may be present at concentrations of about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, or about 100 mM.

[0068] Viscosity of the formulation The formulations according to the embodiments herein may also have a pharmaceutically acceptable viscosity for intraocular administration, such as intravitreal injection. Viscosity generally refers to a measure of the resistance of a fluid being deformed by either shear stress or tensile stress (typically measured, for example, by the art known, a viscometer or rheometer). Typical viscosities of the formulations according to the embodiments herein are about 5.0 cP (centipoise) to about 15 cP, about 11 cP to about 14 cP, about 12 cP to about 15 cP, or about 11 cP to about 12 cP. Therefore, the viscosity of the formulations described herein may be about 5.0 cP, about 6.0, about 7.1 cP, about 7.2 cP, about 7.3 cP, about 7.4 cP, about 7.5 cP, about 7.6 cP, about 10 cP, about 10.5 cP, about 11.0 cP, about 11.5 cP, about 12.0, about 12.5 cP, about 13.0 cP, about 13.5 cP, about 14.0 cP, about 14.5 cP, or about 15.0 cP (for example, when measured at 20°C).

[0069] Various embodiments of this specification do not require the inclusion of inorganic salts or other viscosity-reducing agents to maintain these highly useful viscosities. Typically, high-concentration protein solutions require viscosity-reducing agents to avoid protein aggregation and high viscosity, making intravitreal injection difficult and reducing the potency of VEGF receptor fusion proteins. Therefore, embodiments of this specification are substantially free of sodium chloride (NaCl), magnesium chloride (MgCl2), D- or L-arginine hydrochloride, lysine, or other viscosity-reducing agents. This includes formulations that contain no additives at all.

[0070] Osmotic pressure of the formulation Osmotic pressure is an important attribute of injectable formulations. It is desirable that the product matches physiological osmotic conditions. Furthermore, osmotic pressure provides confirmation of the soluble content in the solution. In embodiments of the present invention, the osmotic pressure of the formulation of the present invention is about 506 mmol / Kg or less or about 250 to about 506 mmol / Kg, for example, about 250, 260, 270, 280, 290, 299, 300, 310, 314, 315, 316, 324, 343, 346, 349, 369, 384, 403, 426, 430, or 506 mmol / Kg. In one embodiment of the present invention, the osmotic pressure is lower than about 250 mmol / Kg.

[0071] Purity and stability of the formulation The formulations containing high concentrations of VEGF receptor fusion proteins described herein are stable during manufacturing and storage. The term “stable” as used herein refers to formulations containing VEGF receptor proteins that maintain both chemical and physical stability over the manufacturing and storage period of the formulation, e.g., maintaining integrity and minimizing degradation, denaturation, or unfolding. The stability of VEGF receptor proteins can be determined using analytical techniques available in the art over different temperatures and periods. In particular, the chemical stability (potency) of VEGF receptors can be determined using various bioassays (e.g., VEGF receptor fusion proteins as described herein). 165Binding can be determined using the BAF / 3VEGFR1 / EPOR cell line, and physical stability can be determined by size exclusion (SE) chromatography analysis, ULC (Ultra-Performance Liquid Chromatography) size exclusion (SE) chromatography, appearance, OD, pH, charge variant formation, and high molecular weight (HMW). This can be determined by the molecular weight (MMOW) species formation rate. Stable VEGF receptor fusion proteins show limited changes in their OD, pH, charge variant formation, and HMW species formation.

[0072] As used herein, “high molecular weight” (HMW) species refers to any species of polypeptide or polypeptide complex in a formulation that elutes from a size exclusion column (e.g., SE-UPLC) beyond the VEGF Trap polypeptide and / or its homodimer, with respect to a given formulation containing VEGF Trap (e.g., aflibercept). The proportion of HMW species refers to the proportion of such species to the total amount of polypeptide in the formulation, for example, by SE-UPLC analysis.

[0073] In embodiments of the present invention, as will be discussed more fully in the following examples, the stable formulation exhibits significant VEGF receptor fusion protein potency and physical stability over periods of up to 12 months, up to 24 months, and / or up to 36 months when stored at approximately 2°C to approximately 8°C.

[0074] In embodiments of the present invention, the formulation of the present invention is as follows: • After approximately 28 days at approximately 37°C, high molecular weight species show an increase of approximately 3, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 30, 35, or 37% (or 10-15%, 15-20%, or 10-20%) (e.g., when measured by SE-UPLC or SEC). • After approximately 28 days at approximately 37°C, the major species show a decrease of approximately 5, 6, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22% (or 5-20%, 5-10%, 10-15%, or 15-20%) (e.g., when measured by SE-UPLC or SEC). • After approximately 28 days at approximately 37°C, the major species will have approximately 80, 81, 82, 83, 84, 85, 86, or 87% (or 80-85%) or more protein (for example, when measured by SE-UPLC or SEC). • After approximately 28 days at approximately 37°C, low molecular weight species show an increase of approximately 1, 1.5, or 2% (or 1-2%) (e.g., when measured by SE-UPLC or SEC). • After approximately 1 month at approximately 37°C, there is an increase of approximately 16% in high molecular weight species and / or a decrease of approximately 17% in major species and / or an increase of approximately 0.5% or <1% in low molecular weight species, and / or after approximately 2 months at approximately 5°C, there is a decrease of approximately 1% in major species and / or an increase of approximately 1% in high molecular weight species and / or no significant or detectable amount in low molecular weight (LMW) species, and / or after approximately 2 months at approximately 5°C, there is approximately 97% major species (when measured, e.g., by SE-UPLC or SEC). • After approximately 12 months at approximately 2-8°C, high molecular weight species show an increase of approximately 3-3.5% (e.g., when measured by SE-UPLC or SEC). • After approximately 12 months at approximately 2-8°C, major species show a decrease of approximately 1% or 1, 2, 3, or 4% (e.g., 1-4% or 3-4%) (e.g., when measured by SE-UPLC or SEC). • After approximately 12 months at approximately 2-8°C, the protein content is approximately 94% or 95% or higher as the major species (e.g., measured by SE-UPLC or SEC). • After approximately 3 months at approximately 2-8°C, high molecular weight species show an increase of approximately 1 or 2% (e.g., when measured by SE-UPLC or SEC). • After approximately 6 months at approximately 2-8°C, high molecular weight species show an increase of approximately <1, 1, or 2% (e.g., when measured by SE-UPLC or SEC). • At approximately 5℃ 1 After 2 or 6 months, it has approximately 2.5, 3.0, or 3.5 (or 2.5-3.5%) total high molecular weight species (e.g., measured by SE-UPLC or SEC). • After approximately 6 months at approximately 2-8°C, major species show a decrease of approximately 1% or 1-2% (or approximately 0.5-2% or 1-2%) (e.g., when measured by SE-UPLC or SEC). • After approximately 6 months at approximately 2-8°C, the major species will have approximately 96, 97%, or 98% (or 96-98%) or more protein (for example, when measured by SE-UPLC or SEC). • After approximately 24 or 36 months at approximately 2-8°C, there is an increase of approximately 5, 6, or 7% (e.g., approximately 1.5, 2, 3, 4, or 5%) (or 1.5-5% or 1.5-2.5%) in high molecular weight species, and / or a total of approximately 3.0, 3.25, 4.0, 4.5, or 5% in high molecular weight species, and / or a decrease of approximately 2 or 3% (or 2-3%) in major species, and / or a total amount of approximately 95 or 96% or more (or 95-96%) of major species (e.g., measured by SE-UPLC or SEC). • After approximately one month at approximately 37°C, the formulation contains approximately 97, 98, 99, or 100% (or 97-100%) of aflibercept that can be recovered by RP-HPLC. • Immediately after manufacturing and purification, it contains high molecular weight species of approximately 1.5%, 2%, 2.5%, 3.0%, or less than 3.5% (e.g., as measured by SE-UPLC or SEC). • After approximately 6 months at approximately 37°C, at least approximately 70% or 75% (e.g., 70-75%) of aflibercept is present as the major species / main peak (e.g., when measured by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing) (non-acidic and non-basic species). • After approximately 36 months at approximately 2-8°C, there is an increase of approximately 1% or 2% (or 1-2%) in acidic species (for example, when measured by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing). • After approximately 36 months at approximately 2-8°C, there is a decrease of less than 1% in the major species / main peak (e.g., capillary isoelectric focusing (clEF) or imaged capillary isoelectric focusing). (When measured by motion) • After approximately 36 months at approximately 2-8°C, approximately 78-79% of the major species / main peaks are present (e.g., when measured by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing). and / or When administered intravitreally to humans or mammals such as rabbits or mice (e.g., those with intraocular neovascular disorders such as wet AMD), EYLEA does not cause any clinically different adverse events from those observed with EYLEA (e.g., when EYLEA is administered intravitreally at 0.5 or 2.0 mg), nor does it cause clinically significant inflammation of the eye, a prolonged increase in intraocular pressure (IOP), a prolonged increase or decrease in blood pressure, and / or retinal detachment.

[0075] Furthermore, in embodiments of the present invention, the high-concentration VEGF receptor fusion protein exhibits little to no formation of acidic charge variants throughout the manufacturing and storage process, and is therefore stable, as it exhibits little to no formation of charge variants, as can be tested, for example, by imaging capillary isoelectric focusing.

[0076] In embodiments of the present invention, the formulation of the present invention exhibits low molecular weight (LMW) species of about 8% or less.

[0077] In embodiments of the present invention, the formulation of the present invention has an endotoxin content of less than about 0.2, 0.4, or 0.5 EU (endotoxin units) / ml.

[0078] In embodiments of the present invention, the formulations of the present invention are essentially free of particulate matter or particulate matter having a size of about 1, 2, 5, 10, 25, or 50 micrometers (or more).

[0079] In embodiments of the present invention, when the formulation of the present invention is analyzed by non-reducing CE-SDS (SDS capillary gel electrophoresis), at least 97% of the total peak area is the main peak.

[0080] In embodiments of the present invention, when the formulation of the present invention is analyzed by size exclusion UPLC (SE-UPLC), at least 93, 94, or 95% of the total peak area consists of major peaks, and 3.5, 4, 5, or 6% or less consists of aggregates.

[0081] In embodiments of the present invention, the formulation of the present invention is prepared at 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, or 8°C, 2-8°C (for example, with an average temperature of 5°C), 23°C, 25°C, 30°C, or 37°C.

[0082] Exemplary formulations Examples of high-concentration VEGF receptor fusion protein-containing formulations include: Formulation A: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation B: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation C: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation D: pH 6.2, containing 80 mg / ml aflibercept, 10 mM histidine buffer, 5% (w / v) sucrose, and 0.03% (w / v) polysorbate 8 0 and 40 mM sodium chloride Formulation E: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation F: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation G: A pH 5.8-6.2 solution containing 80 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. Formulation H: A solution with a pH of 5.8-6.2 containing 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and which, if necessary, does not contain viscosity-reducing agents. Formulation I: A solution with a pH of 5.8-6.2 containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. Formulation J: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation K: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation L: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation M: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation N: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation O: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation P: pH 6.2, containing 150 mg / ml aflibercept, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation Q: A solution with a pH of 5.8-6.2 containing 150 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation R: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation S: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, without viscosity-reducing agents. Formulation T: 150 mg / ml of aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, having a pH of 5.8-6.2 (e.g., 6.2), and optionally free of viscosity-reducing agents. Formulation U: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. Formulation V: A pH 5.8-6.2 formulation containing 150 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, free of viscosity-reducing agents. Formulation W: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation X: pH 5.8-6.2, containing 150 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation Y: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation Z: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation AA: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation BB: pH 6.2, containing 80 mg / ml of Convercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation CC: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation DD: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation EE: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. Formulation FF: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, without viscosity-reducing agents. Formulation GG: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. The formulation has a pH of 5.8-6.2 and contains 80 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and may be free of viscosity-reducing agents as needed. Formulation II: A solution with a pH of 5.8-6.2 containing 80 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, free of viscosity-reducing agents. Formulation JJ: pH 5.8-6.2, containing 80 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, free of viscosity-reducing agents. Formulation KK: pH 5.8-6.2, 150 mg / ml Convercept, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate Rubate 20 and 40 mM sodium chloride, Formulation LL: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation MM: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride. Formulation NN: pH 6.2, containing 150 mg / ml of Convercept, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation OO: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation PP: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride. Formulation QQ: pH 5.8-6.2, consisting of 150 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, free of viscosity-reducing agents. Formulation RR: 150 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8-6.2, and without viscosity-reducing agents as needed. Formulation SS: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, and, if necessary, without viscosity-reducing agents. Formulation TT: pH 5.8-6.2, consisting of 150 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation UU: pH 5.8-6.2, consisting of 150 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, without viscosity-reducing agents. Formulation VV: pH 5.8-6.2, containing 150 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, and, if necessary, free of viscosity-reducing agents. Formulation WW: pH 5.8, 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM taurine. Formulation XX: pH 5.8, 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride. Formulation YY: pH 5.8, containing 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM taurine. Formulation ZZ: pH 5.8, containing 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride. Formulation AAA: pH 5.8, 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) solution Roast, 0.03% (w / v) polysorbate 20, and 50 mM PSA, The formulation contains 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) with a BBB pH of 5.8, 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA. Formulation CCC: pH 5.8, containing 80, 100, 120, or 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride. Formulation DDD: pH 5.8, 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA. Formulation EEE: pH 5.8, 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, without heat stabilizers as needed. Formulation FFF: pH 6.2, containing 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 10 mM sodium phosphate, 5% (w / v) sucrose, and 0.03% polysorbate 20. Preparation GGG: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium sulfate. Formulation HHH: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium thiocyanate. Formulation III: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 40 mM sodium citrate, Formulation JJJ: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM glycine. Formulation KKK: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium chloride. Formulation LLL: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM lysine. Preparation MMM: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium aspartate. Preparation NNN: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM monosodium glutamate. Preparation OOO: 140 mg / ml VEGF receptor fusion protein, 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium citrate, 50 mM arginine hydrochloride, Formulation PPP: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM glycine, 50 mM arginine hydrochloride. Formulation QQQ: 140 mg / ml of VEGF receptor fusion protein (e.g., Afliber) Sept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium aspartate, 50 mM arginine hydrochloride, Formulation RRR: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM monosodium glutamate, 50 mM arginine hydrochloride. Formulation SSS: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM His at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 10 mM L-arginine hydrochloride. Formulation TTT: 140 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM His at pH 5.8, 5% sucrose, 0.03% polysorbate 20, 100 mM L-arginine hydrochloride. Formulation UUU: pH 6.2, 30 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation VVV: pH 6.2, 30 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation WWW: pH 6.2, 60 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation XXX: pH 6.2, 60 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation YYY: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation ZZZ: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20. Formulation AAAA: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl, Formulation BBBB: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl. Formulation CCCC: pH 6.2, 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM sodium phosphate, 5% sucrose, 40 mM sodium chloride, 0.03% PS20. Formulation DDDD: pH 5.8, containing 80 mg / ml of VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride. Formulation EEEE: pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1), 120.0 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) (e.g., +12 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM). Formulation FFFF: 113.3 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1) (e.g., 102-125 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM), Formulation GGGG: pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1), 114.3 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) (e.g., 103-126 mg / ml), 10 mM histidine-based buffer (e.g., +1 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM). Formulation HHHH: pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1), 100.0 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) (e.g., +10 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM). Formulation IIII: pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1), 133.3 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) (e.g., +13 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM). Formulation JJJJ: pH 6.2 (e.g., 6.0-6.4 or 5.9-6.5), containing 150 mg / ml of aflibercept (e.g., aflibercept) (e.g., +15 mg / ml), 10 mM sodium phosphate, 8% (w / v) sucrose (e.g., +0.8%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine hydrochloride. Formulation KKKK: pH 5.8 (e.g., 5.6-6.0 or 5.5-6.1), 114.3 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) (e.g., +14 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM). or any of the formulations described herein.

[0083] In embodiments of the present invention, the concentration of any formulation component listed above or discussed herein (e.g., all components) (e.g., any one of formulations A to KKKK) is about 3%, 5%, or 10% above the concentration specifically mentioned.

[0084] Manufacturing method Embodiments herein include methods for producing pharmaceutical formulations of the present invention comprising a VEGF receptor fusion protein (e.g., any of formulations A to KKKK described herein), comprising combining the components of the formulation into a single composition and, if necessary, introducing the formulation into a container or device, e.g., a vial, or a delivery device, e.g., a pre-filled syringe. The formulation, vial, or device that is a product of such a method is part of the present invention.

[0085] In embodiments of the present invention, a method for producing a VEGF receptor fusion protein comprising the pharmaceutical formulation of the present invention (e.g., any formulation A to KKKK described herein) is provided, in a culture medium and under conditions in which the protein is expressed, a host cell (e.g., Chinese) containing one or more polynucleotides encoding the VEGF receptor fusion protein (e.g., aflibercept) The method includes the steps of culturing hamster ovary cells and purifying proteins from the host cells and / or culture medium, and combining a portion of the proteins with excipients of the pharmaceutical formulation described herein. In this case as well, the formulation, vial, or apparatus that is a product of such a method is part of the present invention.

[0086] In embodiments of the present invention, a determination is made regarding the amount and type of VEGF receptor fusion protein required in the formulation for its end use and to achieve a high concentration. The same determination is made regarding the amount and type of buffer, the amount and type of surfactant, the amount and type of heat stabilizer, and the inclusion or specific exclusion of viscosity reducers. These components are combined and mixed to ensure that the pH of the formulation is at a desired value, e.g., about 5.0 to about 6.8 (e.g., 5.8), and / or the viscosity is at a desired value, e.g., about 6.0, 7.3, 11.5, or 12.0 cP at 20°C. In embodiments of the present invention, formulations containing a high concentration of VEGF receptor fusion protein can be sterilized and stored in a stable state for up to 24 or 36 months at, for example, 2 to 8°C (5°C).

[0087] For example, Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, NY, Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, NY, Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parental Medications, Marcel Dekker, NY, Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY, Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY, Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New Please refer to York, NY.

[0088] Intraocular neovascularization and cancer A pharmaceutical formulation of the present invention containing a VEGF receptor fusion protein (e.g., any of pharmaceutical formulations A to KKKK) may be used to treat or prevent any intraocular neovascular disorder by administering a therapeutically effective amount of the VEGF receptor fusion protein in the formulation to a subject in need, for example, by intravitreal injection. Intraocular neovascular disorder as used herein refers to any disease of the eye caused by or related to the growth or proliferation of blood vessels and / or vascular leakage. Non-limiting examples of intraocular neovascular disorders treatable or preventable using the formulations and methods of this specification include: • Age-related macular degeneration (wet type) • Macular edema, Macular edema after retinal vein occlusion, Retinal vein occlusion (RVO), • Central retinal vein occlusion (CRVO) • Retinal vein branch occlusion (BRVO), ·Diabetic macular edema (DME), ·Choroidal neovascularization (CNV), ·iris angiogenesis, Neovascular glaucoma, Postoperative fibrosis in glaucoma • Proliferative vitreoretinopathy (PVR) ·Optic disc neovascularization, ·Corneal neovascularization, ·Retinal neovascularization, Vitreous angiogenesis, Pannus, ·Pterygium, ·Vascular retinopathy, • Diabetic retinopathy (e.g., non-proliferative diabetic retinopathy (e.g., characterized by a Diabetic Retinopathy Severity Scale (DRSS) level of approximately 47 or 53) or proliferative diabetic retinopathy, e.g., subjects not affected by DME), and • Diabetic retinopathy in patients with diabetic macular edema (DME).

[0089] A pharmaceutical formulation of the present invention (e.g., any of pharmaceutical formulations A to KKKK) containing a VEGF receptor fusion protein may be used to treat or prevent any cancer by administering a therapeutically effective amount of the VEGF receptor fusion protein in the formulation of the present invention to a subject requiring it, for example, by intramuscular, intratumor, subcutaneous, or intravenous injection. Cancers include cancers whose growth, proliferation, survival, and / or metastasis depend to some extent on angiogenesis. In embodiments of the present invention, cancers are colorectal cancer, lung cancer, skin cancer, breast cancer, brain cancer, gastric cancer, kidney cancer, prostate cancer, liver cancer, or pancreatic cancer.

[0090] Accordingly, the present invention provides a method for treating or preventing intraocular neovascular disorders in a subject requiring such treatment, comprising administering a therapeutically effective dose of VEGF receptor fusion protein (e.g., aflibercept) (e.g., about 4, 6, or 8.0, 8.1, 8.4, or 8.5 mg) intraocularly, for example, into the vitreous humor of the subject eye, in a pharmaceutical formulation according to the present invention. In embodiments of the present invention, the VEGF receptor fusion protein is administered to both eyes. In embodiments of the present invention, the therapeutically effective dose of VEGF receptor fusion protein is administered every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks. In embodiments of the present invention, such a treatment or preventive method is performed in a state where there is no significant increase in blood pressure (systolic and / or diastolic) and / or hypertension (e.g., grade 1, grade 2, or grade 3) and / or abnormally high intraocular pressure in the subject. In embodiments of the present invention, the method includes the step of monitoring the subject for significant increase in blood pressure (systolic and / or diastolic) and / or hypertension (e.g., grade 1, grade 2, or grade 3) and / or abnormally high intraocular pressure following the administration.

[0091] Mode of administration The pharmaceutical formulations of the present invention, comprising a VEGF receptor fusion protein, may be administered according to known, medically approved delivery systems. In embodiments herein, these delivery systems may include administering the formulation to a patient by ocular, intraocular, choroidal, intravitreal, or subconjunctival injection. Alternatively, the pharmaceutical formulations of the present invention may also be administered to a patient by topical routes, such as eye drops, eye gels, or eye ointments. Other possible delivery routes of the formulations herein include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral.

[0092] In embodiments of the present invention, intravitreal injection of the pharmaceutical formulation of the present invention involves pricking the eye with a syringe and needle (e.g., a 30-gauge injection needle) containing the formulation and injecting the formulation (e.g., about 100 microliters (about 40, 50, 55, 56, 57, 57.1, 58, 60, 70, or 75 microliters) or less) into the vitreous humor of the eye (e.g., a therapeutically effective amount of VEGF receptors). The method includes a step of administering a fusion protein (for example, in a volume sufficient to deliver about 4, 5, 6, 7, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8 or 8.9, 9, 10, 12, 14, 16, 18 or 20 mg of VEGF receptor fusion protein). Optionally, the method includes a step of administering a local anesthetic (e.g., propalacaine, lidocaine or tetracaine), an antibiotic (e.g., a fluoroquinolone), a disinfectant (e.g., povidone-iodine) and / or a pupillary dilator to the eye to be injected. In embodiments of the present invention, a sterile area around the eye to be injected is established prior to the injection. In embodiments of the present invention, following the intravitreal injection, the subject is monitored for increases in intraocular pressure and / or blood pressure. In embodiments of the present invention, the other eye is injected by the same procedure.

[0093] Amount of VEGF receptor fusion protein administered Each dose of high-concentration VEGF receptor fusion protein administered to a subject throughout the course of treatment may contain the same or substantially the same amount of fusion protein. Alternatively, any single dose may differ or vary throughout the course of treatment.

[0094] Effective or therapeutically effective amounts of VEGF receptor fusion protein for treating or preventing cancer (e.g., at least partially mediated by angiogenesis) or intraocular neovascularization include, for example, regressing, stabilizing, or eliminating one or more symptoms or signs of cancer or intraocular neovascularization to any clinically measurable degree; for example, with respect to intraocular neovascularization, improving or maintaining visual acuity (e.g., in best corrected visual acuity, as measured by an increase in ETDRS characters), expanding or maintaining the visual field, and / or reducing or maintaining the thickness of the central retina; and with respect to cancer, sufficient amounts of VEGF receptor fusion protein to cause regression, stabilization, or elimination of cancer or intraocular neovascularization by causing a decrease or maintenance of the Diabetic Retinopathy Severity Score (DRSS), and, with respect to cancer, by stopping or reversing the growth, survival, and / or metastasis of the cancer cells of interest.In embodiments of the present invention, the effective or therapeutically effective amount of VEGF receptor fusion protein for treating or preventing intraocular neovascularization is about 0.5 mg to about 10 mg or 0.5 mg to about 20 mg per dose, and includes: about 0.5 mg or more, or about 2 mg or more, for example, about 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3.0 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4.0 mg g, 4.1mg, 4.2mg, 4.3mg, 4.4mg, 4.5mg, 4.6mg, 4.7mg, 4.8mg, 4.9mg, 5.0mg, 5.1mg, 5.2mg, 5.3mg, 5.4mg, 5.5mg, 5.6mg, 5.7mg, 5.8mg, 5.9mg, 6.0mg, 6 .1mg, 6.2mg, 6.3mg, 6.4mg, 6.5mg, 6.6mg, 6.7mg, 6.8mg, 6.9mg, 7.0mg, 7.1mg, 7.2mg, 7.3mg, 7.4mg, 7.5mg, 7.6mg, 7.7mg, 7.8mg, 7.9mg, 8.0mg, 8.1mg , 8.2mg, 8.3mg, 8.4mg, 8.5mg, 8.6mg, 8.7mg, 8.8mg, 8.9mg, 9mg, 9.1mg, 9.2mg, 9.3mg, 9.4mg, 9.5mg, 9.6mg, 9.7mg, 9.8mg, 9.9mg, 10.0mg, 10.1mg, 10 .2mg, 10.3mg, 10.4mg, 10.5mg, 10.6mg, 10.7mg, 10.8mg, 10.9mg, 11mg, 11.1mg, 11.2mg, 11.3mg, 11.4mg, 11.5mg, 11.6mg, 11.7mg, 11.8mg, 11.9mg, 12 mg, 12.1mg, 12.2mg, 12.3mg, 12.4mg, 12.5mg, 12.6mg, 12.7mg, 12.8mg, 12.9mg, 13mg, 13.1mg, 13.2mg, 13.3mg, 13.4mg, 13.5mg, 13.6mg, 13.7mg, 13. 8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4mg, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, 15mg, 15.1mg, 15.2mg, 15.3mg, 15.4mg, 15.5mg, 15.6. mg, 15.7mg, 15.8mg, 15.9mg, 16mg, 16.1mg, 16.2mg, 16.3mg, 16.4mg, 16.5mg, 16.6mg, 16.7m g, 16.8mg, 16.9mg, 17mg, 17.1mg, 17.2mg, 17.3mg, 17.4mg, 17.5mg, 17.6mg, 17.7mg, 17.8mg 17.9 mg, 18 mg, 18.1 mg, 18.2 mg, 18.3 mg, 18.4 mg, 18.5 mg, 18.6 mg, 18.7 mg, 18.8 mg, 18.9 mg, 19 mg, 19.1 mg, 19.2 mg, 19.3 mg, 19.4 mg, 19.5 mg, 19.6 mg, 19.7 mg, 19.8 mg, 19.9 mg, or 20 mg. In embodiments of the present invention, an effective or therapeutically effective amount of VEGF receptor fusion protein for treating or preventing cancer is about 4 mg / kg (e.g., intravenously). This dose may be administered, for example, every two weeks.

[0095] In embodiments of the present invention, the VEGF receptor fusion protein is administered in a volume sufficient to deliver a desired dose of the fusion protein, for example, as described above. In embodiments of the present invention, the volume delivered (for example, for the treatment or prevention of intraocular neovascularization by intravitreal injection) is about 100 microliters or less (for example, approximately any of the following volumes: 25 microliters, 26 microliters, 27 microliters, 28 microliters, 29 microliters, 30 microliters, 31 microliters, 32 microliters, 33 microliters, 34 microliters, 35 microliters, 36 microliters, 37 microliters, 38 microliters, 39 microliters, 40 microliters, 41 microliters, 42 microliters, 43 microliters, 44 microliters, 45 microliters, 46 microliters, 47 microliters, 48 ​​microliters, 49 microliters, 50 microliters, 51 microliters, 52 microliters, 53 microliters, 54 microliters, 55 microliters, 56 microliters, 57 microliters, 58 microliters) (Tor, 59 microliters, 60 microliters, 61 microliters, 62 microliters, 63 microliters, 64 microliters, 65 microliters, 66 microliters, 67 microliters, 68 microliters, 69 microliters, 70 microliters, 71 microliters, 72 microliters, 73 microliters, 74 microliters, 75 microliters, 76 microliters, 77 microliters, 78 microliters, 79 microliters, 80 microliters, 81 microliters, 82 microliters, 83 microliters, 84 microliters, 85 microliters, 86 microliters, 87 microliters, 88 microliters, 89 microliters, 90 microliters, 91 microliters, 92 microliters, 93 microliters, 94 microliters, 95 microliters, 96 microliters, 97 microliters, 98 microliters, or 99 microliters).

[0096] In embodiments of the present invention, the formulation is administered in volumes of approximately 60 microliters or less, approximately 70 microliters or less, approximately 75 microliters or less, or approximately 100 microliters or less (for example, for the treatment or prevention of intraocular neovascularization by intravitreal injection). For example, in embodiments of the present invention, approximately 2, 4, 6, 8.0, 8.1, 8.0-8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8 or 8.9, 9.0 or 10 mg of VEGF receptor fusion protein is administered in approximately 50, 60, 70 or 75 microliters.

[0097] The scope of the present invention also includes methods for delivering 0.5 or 2 mg of VEGF receptor fusion protein in a pharmaceutical formulation of the present invention in low volumes such as less than 50 μl (e.g., about 1, 5, 10, 17, 17.5, 18, 18.5, 20, 30, 40, or 45 μl) (e.g., by intravitreal injection to treat or prevent intraocular neovascularization). ru.

[0098] The present invention also includes a “single-dose volume” of the pharmaceutical formulation of the present invention, i.e., a volume containing a single dose of VEGF receptor fusion protein (e.g., aflibercept) in the pharmaceutical formulation of the present invention (e.g., about 50 μl or 60 μl, 70 μl or 75 μl, or any volume containing about 4, 6, 8, or 10 mg of VEGF receptor fusion protein), or a composition comprising such a volume, or essentially comprising such a volume. As discussed below, a container (e.g., a vial or injection device) containing the single-dose volume and optionally a small amount of excess volume of the formulation is also part of the present invention.

[0099] Containers and syringes The high-concentration VEGF receptor fusion protein formulations according to the embodiments herein (e.g., any of formulations A to KKKK) can be pre-packaged or pre-loaded into a variety of useful containers and injection devices. Accordingly, the present invention includes containers and injection devices for such formulations. In one embodiment herein, the container is a vial that may be sterile. In another embodiment herein, the container is a test tube that may be sterile. In embodiments of the present invention, the injection device (which may be sterile) is a syringe (e.g., a pre-filled syringe or an autoinjector). In embodiments of the present invention, the injection device is an intravitreous implant, e.g., a refillable intravitreous implant.

[0100] A "pre-filled" syringe is a syringe that has been filled with the formulation of the present invention before it is sold or used by a physician or patient.

[0101] In this specification, “sterile” means sterile or substantially free of all or any living microorganisms and their spores.

[0102] Syringes used herein include, for example, barrels, plungers, and needles made of glass or polymer, such as a cycloolefin as described in U.S. Patent Publication No. 2017 / 0232199, which is incorporated herein for any purpose.

[0103] The container and injection device may be coated with silicone (for example, silicone oil or calcined silicone (e.g., <40 μg or <100 μg)).

[0104] In embodiments of the present invention, the container or injection device is substantially metal-free, substantially tungsten-free, or low in tungsten.

[0105] In embodiments of the present invention, the syringe includes one or more dose line markings and / or is a dose measurement system.

[0106] The containers according to the embodiments of this specification may hold high-concentration VEGF receptor fusion protein formulations. In some embodiments, the container or injector may include a label indicating the use. In some cases, the container or injector according to this specification may include a package insert containing instructions for use as described throughout this specification.

[0107] In other embodiments, as described above, a volume containing a single dose or multiple doses (e.g., two or more) of a high concentration of VEGF receptor fusion protein (e.g., when the dose is 2 mg, 4 mg, 6 mg, 8 mg, or 10 mg of VEGF receptor fusion protein) may be pre-packaged in a container or injection device, such as a sterile syringe, for storage until use. In one example, the volume in the container may contain a single dose of VEGF receptor fusion protein, further containing a small amount of excess volume as needed. A filled syringe can be maintained under storage conditions (e.g., 2°C to 8°C) for, for example, up to 12, 24, or 36 months. Overfilling is an overfill volume that is sufficient to allow for the recovery and / or administration of an appropriate volume. In embodiments of the present invention, the container has a single-dose volume or a multi-dose volume, and an overfill volume of about 5% to 10%.

[0108] Syringe sizes can be, for example, 0.3cc, 0.5cc, or 1cc. Sterile syringes typically contain needles useful for ocular injections, which are typically about 1 / 2 inch, or 12.5mm to 16mm in length, and can be 29 gauge, 30 gauge, 31 gauge, 32 gauge, or 33 gauge, based on patient and healthcare professional preference. Other needle lengths and gauges may be used, as long as the needle is effective in achieving intravitreal injection.

[0109] While the present invention has been shown and described in particular with reference to several embodiments, those skilled in the art will understand that modifications of form and detail may be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention, and that the various embodiments disclosed herein are not intended to serve as limitations on the claims.

[0110] Further formulations The present invention includes the following formulations comprising a VEGF receptor fusion protein (e.g., aflibercept or convercept) in a concentration exceeding 40 mg / ml and the following:

[0111] (a) A buffer containing a histidine salt (e.g., histidine-HCl or histidine acetate, e.g., 10 mM to 50 mM) and having a pH in the range of 5.7 to 6.2; a sugar such as sucrose, trehalose, mannitol, or glucose (e.g., 6% to 10%); a surfactant selected from the group consisting of polysorbate 20 and polysorbate 80 (e.g., 0% to 0.1%);

[0112] (b) Histidine-containing buffer such as L-histidine / histidine hydrochloride (e.g., 10 mM); for example, pH 6.0-6.5 (e.g., 6.2 or 6.5), containing a nonionic surfactant such as polysorbate 20 (e.g., 0.03%), an inorganic salt such as NaCl (e.g., 40 mM), and a carbohydrate such as sucrose (e.g., 5%);

[0113] (c) Citric acid (e.g., 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, or 30 mM), sucrose (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%), arginine (e.g., 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM, or 100 mM), and polysorbate 20 (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.10%);

[0114] (d) Buffers such as phosphates, histidine, acetates, succinates, citrates, glutamates, and / or lactates (e.g., 5-20 or 5-50 mM); isotonic agents such as polysorbates (e.g., PS20 or PS80), polyethylene glycol dodecyl ethers, poloxamers, 4-(l,l,3,3-tetramethylbutyl)phenyl polyethylene glycol, alkyl saccharides or alkyl glycosides, polyols, or amino acids, e.g., sucrose, trehalose, sorbitol, mannitol, glycerol, proline, arginine, methionine, glycine, or lysine, where nonionic surfactants are also used as tonics, and the formulation has a final osmotic pressure of about 300 mOsm / kg, a chloride anion concentration of less than about 10 mM, and a pH of 5.0-6.5. ;or

[0115] (e) pH 6.2, 10 mM sodium phosphate, 40 mM sodium chloride, 0.03% polysorbate 20, and 5% sucrose. [Examples]

[0116] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention. While efforts have been made to ensure accuracy with respect to the numerical values ​​used, some experimental errors and deviations should be taken into consideration. Any formulations described in these examples are part of the invention.

[0117] In these embodiments, when the experiment is conducted at 2–8°C, the target temperature is 5°C, with a tolerance of +3°C variation.

[0118] Example 1: The VEGF receptor fusion protein formulation at 80 mg / ml maintained its potency, physical stability, and charge over a period of 36 months. A series of four different formulations containing 80 mg / ml of VEGF receptor fusion protein (aflibercept) were tested for long-term potency, physical stability, and charge variant generation. Table 1-1 shows the component lists for each of the four formulations. For each formulation, the formation of VEGF receptor fusion protein HMW species and the proportion of major species by SE-UPLC were evaluated over a 36-month storage period at 2°C–8°C. Each formulation containing VEGF receptor fusion protein was also evaluated using imaging capillary isoelectric focusing over the same time and temperature periods. Finally, the potency of each formulation was tested by bioassay over the same time and temperature periods. [Table 2] [Table 3] [Table 4] [Table 5] [Table 6]

[0119] The data are shown in Figures 1A, 1B, 1C, and 1D. Figure 1A shows the percentage of HMW species of VEGF receptor fusion protein formed for each of the four formulations. The VEGF TRAP shows that the rate of HMW species formation is slightly slower when the formulation is histidine-based compared to sodium phosphate. As shown in Figure 1A, the percentage of HMW species after 36 months of storage at 2–8°C increased by only 2.6% in the sodium phosphate formulations (formulations 1 and 2) compared to an increase of 1.6–1.9% in the histidine buffer (formulations 3 and 4). As shown in Figure 1B, the data were confirmed, and the percentage of major species of VEGF receptor fusion protein present over the same timeframe and temperature range was identified using SE-UPLC. As a point of comparison, the assay was performed with the current EYLEA® formulation (40 mg / ml) with 10 mM sodium phosphate, and it was shown that the percentage of HMW species increased by 1.2% after 36 months of storage at 2–8°C. Furthermore, each of the four 80 mg / ml VEGF TRAP formulations was tested for potency and compared to EYLEA® activity (not shown). Potency was maintained by bioassays for all four formulations and EYLEA®. These data demonstrate that the formulations described herein can maintain VEGF receptor fusion protein stability comparable to EYLEA®.

[0120] Referring to Figures 1C and 1D, the proportion of VEGF TRAP charge variants formed after storage at 2–8°C for 36 months was also tested. Figure 1C shows that VEGF TRAP formulations 1–4 did not show significant changes in the proportion of acidic species over the 36-month period, and Figure 1D shows the same results for the proportion of major species over the 36-month period. The result that VEGF TRAP maintained its charge variants during storage indicates that the quality of VEGF TRAP was maintained and that processes such as deamination, N-terminal pyroglutamic acid formation, isomerization, and aggregation did not occur during the storage parameters.

[0121] The data from Example 1 demonstrate that formulations with twice the VEGF TRAP concentration found in EYLEA® can maintain physical stability, quality, and potency over a 36-month period at 2–8°C. Furthermore, while all four formulations showed similar potency over this period, the histidine-containing formulations resulted in a slightly smaller increase in HMW seed formation (an indication of proteolysis), suggesting that histidine may be a buffer option in certain situations. However, the results for both histidine and phosphate-based buffers showed excellent stability throughout the testing process.

[0122] Example 2: Stability of VEGF TRAP at 150 mg / ml in sodium phosphate buffer / sucrose formulation. The physical stability of 150 mg / ml VEGF Trap (aflibercept) was tested for two sodium phosphate formulations at 37°C for 28 days. The component lists for each of the two formulations are shown in Table 2-1. For each formulation, the HM (Heat Management) was tested during the 28-day storage period at 37°C. The formation of W species and the proportion of major species were evaluated using SE-UPLC. [Table 7] [Table 8] [Table 9]

[0123] Figure 2A shows the percentage of HMW species formed between two formulations during storage at 37°C for 28 days. There was no significant difference between the two formulations, which was confirmed by the proportion of major species measured by SE-UPLC (Figure 2B). Over the 28-day period, there were no changes in the appearance, turbidity, or pH of the two formulations (not shown).

[0124] Next, the results were compared with a formulation containing 40 mg / ml of EYLEA® and formulation 1 of Example 1 (80 mg / ml of VEGF TRAP in sodium phosphate buffer). As expected, the 150 mg / ml VEGF TRAP formulation had a higher rate of HMW seed formation compared to the EYLEA® formulation, and a slightly higher rate of HMW seed formation compared to formulation 1 of Example 1.

[0125] Further testing of formulations containing high concentrations of VEGF TRAP revealed that histidine-containing formulations provided better protection of these molecules than sodium phosphate-based formulations. Furthermore, the inclusion of sodium chloride in each of the tested formulations actually resulted in destabilization of VEGF TRAP at 37°C. The data from Example 2 demonstrate that the formulations herein provide superior protection against physical stability, even with high concentrations of 150 mg / ml of VEGF receptor fusion protein and under fairly extreme temperature storage conditions.

[0126] Example 3: A pharmaceutically acceptable formulation viscosity can be achieved with a VEGF TRAP of 150 mg / ml. The viscosity behavior of formulations containing multiple VEGF traps (aflibercept) was tested. Formulations with VEGF traps ranging from 10 mg / ml to 160 mg / ml were tested in and without various viscosity-reducing agents.

[0127] Figure 3A shows formulations containing 155 mg / ml of VEGF Trap, 5% sucrose, and pH 6.2 in 10 mM sodium phosphate buffer, with combinations of inorganic salts, arginine, lysine, sodium chloride, and magnesium chloride showing little difference in viscosity. In each case, viscosity was measured in cP at 20°C. A viscosity range of approximately 17 cP (without inorganic salt) to 15 cP (with 100 mM magnesium chloride) was observed, with little change depending on which viscosity-reducing agent was used, or no viscosity-reducing agent was present at all. Figure 3B shows a similar series of formulations, except that the basic buffer is 10 mM histidine and pH 5.8. Here, formulations with no inorganic salt were provided, resulting in a viscosity of 11.5 cP, and formulations with 50 mM lysine were provided, resulting in a viscosity of 14 cP. The histidine-containing buffer provided excellent viscosity, consistent with other low-concentration biological injectables.

[0128] Figure 3C shows the viscosity of VEGF traps at concentrations of 10 mg / ml to 160 mg / ml with 10 mM sodium phosphate, 5% sucrose, pH 6.2, without arginine, and with 50 mM arginine hydrochloride. Similar viscosities were obtained at all VEGF trap concentrations tested, even with viscosity reducers. As shown in Figures 3A and 3B, viscosity reducers had little positive effect on the viscosity of the formulations, even at high protein concentrations. This is a surprising result, given that arginine and other viscosity reducers have been previously shown to have beneficial properties for the viscosity of high-concentration proteins. [Table 10] [Table 11]

[0129] Example 4: Arginine hydrochloride improves the stability of VEGF TRAP at 150 mg / ml in a sodium phosphate buffer / sucrose formulation. The physical stability of 150 mg / ml VEGF Trap (aflibercept) was tested for two sodium phosphate formulations at 2–8°C for 12 days. The component lists for each of the two formulations are shown in Table 4-1. Formulation 2 also contains 50 mM arginine hydrochloride. For each formulation, the formation of HMW species and the proportion of major species by SE-UPLC were evaluated during storage at 37°C for 12 months. [Table 12]

[0130] Figure 4A shows that the physical stability of VEGF TRAP was improved by including 50 mM arginine hydrochloride in the formulation. This stabilizing attribute of VEGF TRAP is confirmed in Figure 4B, where the proportion of major species in VEGF TRAP remains high in the presence of 50 mM arginine hydrochloride. This data indicates that the addition of arginine hydrochloride provides a stabilizing effect on preserved VEGF TRAP in certain circumstances. Tabular size exclusion chromatography data are shown in Tables 4-2 and 4-3. [Table 13] [Table 14]

[0131] Example 5: Viscosity of VEGF TRAP at concentrations of 10 mg / ml to 170 mg / ml in histidine and phosphate buffer. Figure 5 shows that both 10 mM phosphate buffer and 10 mM histidine buffer have high useful viscosity for a range of VEGF TRAP (aflibercept) concentrations. At higher VEGF TRAP concentrations, the histidine buffer showed improved viscosity (compared to phosphate). Viscosity was measured at 20°C.

[0132] Example 6: Taurine and propanesulfonic acid provide improved stability to high-concentration VEGF TRAP (aflibercept) formulations. Experiments were conducted to determine the effect of combinations of multiple formulations on protein stability. Figure 6 shows dynamic light scattering plots for formulations containing any of the proteins from 2 mg / ml to 10 mg / ml (aflibercept). Formulations containing 70 mM taurine or 70 mM PSA showed reduced self-interaction at high concentrations. These data suggest that taurine and PSA are responsible for the problem in this case. This indicates that it can be a useful component in high-concentration protein preparations.

[0133] Example 7: Long-term stability testing of various histidine-containing formulations. A total of nine different aflibercept formulations were tested using various buffer concentrations, heat stabilizers, and hydrophobic salts. The nine formulations, F1-F9, are summarized in Table 7-1 below. [Table 15]

[0134] Each formulation was mixed in a 14 mM solution into 15 mL Falcon tubes. Next, the formulations were sterile filtered using a 0.22 μM syringe filter and filled into sterile 2 mL Type 1 glass vials. In a laminar flow hood, 0.4 mL of each formulation was filled into eight vials.

[0135] SE-UPLC (molecular weight species) was performed on all samples to determine the chemical stability of each formulation.

[0136] Figure 7 shows the proportion of HMW species for each of formulations F1 to F9 over time (see also Table 7-2). Formulations F4 and F7 showed the lowest proportion of HMW species after 4 months at 5°C. The addition of excipients such as arginine and proline significantly reduced the rate of HMW species (%) formation in VEGF trap formulations. [Table 16] [Table 17] [Table 18]

[0137] Example 8: Stability test of VEGF Trap at 140 mg / mL with varying arginine concentrations. The effect of changes in arginine-HCl concentration on the stability of four 140 mg / ml VEGF Trap (aflibercept) eye pharmaceutical formulations was tested. Stability was evaluated under storage conditions of 2–8°C. The pharmaceuticals (DP, Drug Product) were also incubated under stress conditions (37°C). The four formulations evaluated in this stability test ( F1 to F4) are described in Table 8-1 below. [Table 19]

[0138] Approximately 145 mL of VEGF Trap histidine preparation containing 187 mg / mL was thawed. 36 mL of each preparation except F3 was mixed, and 39 mL of bulk F3 was added. Each preparation was filter-sterilized in a Laminar Flow Hood (LFH) using a 0.22 μm Durapore PVDF sterile filter before filling. Stability testing was performed using clean, depyrogenic 2 mL Type I Schott glass vials stoppered with a 13 mm serum stopper (S2-F451 4432 / 50B2-40).

[0139] SE-UPLC analysis of the formulations was performed as described above. Using SE-UPLC, the HMW measurement values ​​(%) for each formulation are shown over time in Figure 8 (A and B). Tables 8-2 and 8- See also 3.

[0140] When stored at 5 °C, these formulations showed a decrease in the rate of formation of HMW species (%) proportional to the concentration of arginine-HCl. However, under stress, this effect was reversed . The formulations showed a clear increase in HMW species (%) proportional to the concentration of arginine-HCl at 37 °C . Due to this property, it was almost impossible to discover the beneficial effect of arginine on aflibercept in the presence of histidine buffer. Typically, in pharmaceutical formulation development in the biotechnology industry, the effects of various excipients on a drug are first screened briefly under stress (e.g., high temperature such as 37 °C). The aim of this approach is to quickly eliminate excipients that may not function well over a long period in the absence of stress (e.g., low temperature such as 5 °C). Here, arginine was identified as a useful excipient despite affecting stability at 37 °C. Formulated pharmaceuticals are typically stored at 4 - 5 °C for several months after manufacture, so aflibercept in arginine and histidine buffer is a valuable formulation for storing long-term stable pharmaceuticals

Table 20

Table 21

Table 22

Table 23

[0141] Example 9: Stability of VEGF Trap in the presence of counterions from the Hofmeister series and other excipients The effects of various counterions and other excipients on the stability of several formulations were determined

[0142] A. Counterion screening Counterions (e.g., sulfates, thiocyanates, and citrates) were tested in the form of sodium salts with a high concentration of VEGF Trap (aflibercept) formulation (140 mg / ml). Furthermore, other amino acid excipients (e.g., glycine and lysine) were also tested.

[0143] Approximately 42 ml of VEGF Trap eye drug substance containing 187 mg / ml was thawed. A 50 ml intermediate formulation of the drug substance (155.56 mg / ml) was prepared, having a concentration of 110% of the 140 mg / ml formulation and the target excipient concentration (excluding counterions, glycine, and lysine).

[0144] The intermediate formulations of the drug substance were further diluted with 0.5 M excipient solution (counterion, glycine, or lysine) to produce 140 mg / ml drug substance formulations as listed in Table 9-1 below. Each final formulation was sterilized by filtration using a 0.22 μm PVDF syringe filter in a laminar flow hood and then filled into clean, depyrogenic 2 mL I-Schott glass vials stoppered with a 13 mm serum stopper S2-F451 4432 / 50 82-40 (ELN item number 19700004 Wash number 0000078949). Sixty vials were filled with 0.5 ml of each formulation. Six vials were filled with 1.5 ml. [Table 24]

[0145] B. Screening for glutamate and aspartate The stability of a high-concentration VEGF Trap (aflibercept) formulation (140 mg / ml) in the presence of an organic counterion combined with arginine hydrochloride was tested. Furthermore, the compatibility of two novel counterions (glutamate and aspartate) with high-concentration VEGF Trap (both combined with and without arginine hydrochloride) was tested. The tested formulations are summarized in Table 9-2 below.

[0146] Approximately 50 ml of VEGF Trap drug substance containing 187 mg / ml was thawed. 60 ml of intermediate formulation drug substance (155.56 mg / ml) was prepared, containing 110% of the 140 mg / ml formulation drug substance and the target excipient concentrations (excluding counterions, citrate, glycine, glutamate, and aspartate). The intermediate formulations were further diluted with 1M stock excipient solutions (arginine hydrochloride, sodium citrate, glycine, sodium glutamate, and sodium aspartate) to produce 140 mg / ml formulations of the drug substances listed in the table below. Each final formulation was sterilized by filtration using a 0.22 μm PVDF syringe filter in a laminar flow hood and then filled into clean, depyrogenic 2 mL I-Schott glass vials stoppered with a 13 mm serum stopper S2-F451 4432 / 50 B2-40 (ELN item number 19700004 Wash number 0000078949). Sixty vials were filled with 0.5 ml of each formulation. Six vials were filled with 1.5 ml. [Table 25]

[0147] Viscosity tests were performed using a RHEOSENSEm-VROC® viscometer. Approximately 0.5 mL of undiluted sample was filled into a glass syringe. The sample was equilibrated to the desired temperature and loaded into a tip or measuring cell. Viscosity was calculated by measuring the pressure drop from the inlet to the outlet, which correlates with the shear stress in the tip wall. The results are expressed as mPas-1 or cp. See Figure 9 and Table 9-3.

[0148] Osmotic pressure tests were performed using a VAPRO vapor pressure osmometer. Approximately 10 μL of undiluted sample was inoculated onto a paper disc. The decrease in dew point temperature, a function of the solution's vapor pressure, was measured via a highly sensitive thermocouple and reported as the osmotic pressure of the solution. Results are expressed as mmol / kg or mOsm. See Figure 10 and Table 9-3.

[0149] The high molecular weight species in a specific formulation after storage at 37°C or 5°C were evaluated over time by SE-UPLC. See Figures 11 (A and B) and Tables 9-4 and 9-5.

[0150] Dynamic light scattering experiments were performed using a DynaPro® Plate Reader II. Approximately 100 μL of undiluted sample was loaded into a 96-well plate. 35 acquisitions were made for each well at 25°C. Analysis of the autocorrelation function using regularization was performed on DYNAMICS v7.1 software. Radius (nm) vs. % intensity plots and % mass vs. radius (nm) plots were generated to derive the average molecular radius and % polydispersity value (%Pd) for each sample. See Figure 12. [Table 26] [Table 27] [Table 28] [Table 29]

[0151] Example 10: Tolerance of Intravitreal Delivery of High-Dose VEGF Trap (140 mg / ml) in Normal Rabbits. Anti-VEGF therapeutic agents administered via intravitreal injection are currently the standard treatment for the treatment of neovascular age-related macular degeneration, diabetic macular edema, and retinal vascular occlusive diseases. However, monthly or bi-monthly intravitreal injections impose a significant treatment burden on patients, caregivers, and physicians. In clinical practice, there is an urgent need for more effective and durable treatment methods. This study is to investigate the tolerance of a highly formulated high-dose VEGF Trap (140 mg / ml, equivalent to 14 times the clinical dose) in the eyes of normal New Zealand White rabbits.

[0152] Two formulations of high-dose VEGF Trap (aflibercept) in histidine buffer or phosphate buffer were tested. Three rabbits per cohort received 7 mg of VEGF Trap in 50 μL of each formulation via univitreal injection. Signs of ocular inflammation were monitored by slit-lamp, optical coherence tomography (OCT), and fundus angiography at 1 day, 4 days, 1 week, and then weekly until 12 weeks after intravitreal administration. Intraocular pressure was measured using Tonopen before intravitreal injection, 10 and 30 minutes after, and then at all follow-up times. Animals were euthanized at 12 weeks.

[0153] The rabbits were given one of the following to their eyes: (1) 140 mg / ml aflibercept, 20 mM histidine, 5% sucrose, 50 mM arginine HCl, 0.03% PS20, pH 5.8, or (2) 140 mg / ml aflibercept, 10 mM sodium phosphate, 5% sucrose, 40 mM sodium chloride, 0.03% PS20, pH 6.2.

[0154] In two of the six eyes in the histidine buffer group, a dark shadow was observed in the vitreous humor up to eight weeks after IVT, and slit-lamp examination confirmed that it was a focal cataract due to posterior lens damage (procedure-related). In one of the six eyes in the phosphate buffer group, a dark shadow was observed in the vitreous humor up to eight weeks after IVT, and slit-lamp examination confirmed that it was a focal cataract due to posterior lens damage (procedure-related).

[0155] The tested high-dose VEGF Trap (140 mg / ml) formulation was well tolerated in the eyes of normal New Zealand white rabbits within 12 weeks after a single intravitreal injection. No abnormalities or signs of inflammation were observed in the fundus after a single intravitreal injection of 7 mg of VEGF Trap. The vitreous humor was clear, and the retinal vascular pattern appeared normal. No retinal detachment, hemorrhage, or optic disc changes were observed. There was no change in intraocular pressure compared to baseline. Baseline fluorescein angiography (FA) and OCT images of rabbit eyes are shown in Figure 13 (A-D). Time-course changes in FA and OCT images of rabbit eyes in each treatment group over 8 weeks are shown in Figures 14, 15, 16, and 17. Data from the left eye (OS) or right eye (OD) of rabbits 326 and 329 are shown.

[0156] Example 11: Evaluation of the stability of formulations UUU~BBBB This study investigated the stability of VEGF Trap (aflibercept) at 60 mg / ml and 120 mg / ml concentrations in 10 mM phosphate, 10% or 20% sucrose (Suc), 0 or 50 mM NaCl, 0.03% polysorbate 20, and pH 6.2 after incubation at 37°C for up to 6 months. The formulations used in this stability test are shown in Table 11-1 below. [Table 30]

[0157] The formulation was filtration-sterilized using a PVDF 0.2 μm filter in a laminar flow hood before dispensing.

[0158] The vials containing each formulation were stored at 37°C for one month. [Table 31] [Table 32]

[0159] All formulations were essentially particle-free, as determined by visual inspection and optical density measurement. RP-HPLC recovery at 37°C for one month showed no significant protein loss (Table 11-2), and this trend continued up to six months.

[0160] The primary degradation pathway for VEGF Traps was aggregation under these conditions (Figure 18(A and B), Table 11-3). The stability of VEGF Traps is determined by protein and sucrose. The stability was dependent on the sucrose concentration. Formulations with lower concentrations of VEGF Trap and higher concentrations of sucrose were more stable. Maintaining the same protein-to-sucrose ratio did not result in the same degradation rate. For example, although F1 and F4 had the same protein-to-sucrose ratio of 3:1, F4 was less stable than F1 due to its higher protein concentration. A similar trend was observed up to 6 months.

[0161] Example 12: Repeated-dose intravitreal toxicity study in monkeys using different aflibercept formulations. This example evaluates the safety of various formulations in cynomolgus monkeys. A total of seven intravitreous doses were administered to groups 1-3 bilaterally approximately every four weeks, and a total of three intravitreous doses were administered to groups 4-9 bilaterally approximately every four weeks. The final autopsy was performed approximately one week after the final dose (N=3 / sex / group), and a recovery autopsy (2 / sex / group) was performed approximately 12 weeks after the last weekly dose.

[0162] The next evaluation will be conducted: • Safety assessment based on clinical signs, body weight, vital signs, electrocardiogram data (at the end of treatment and recovery before administration), blood pressure measurement (via tail cuff), and clinical and anatomical pathology. • Regular comprehensive ophthalmological examinations during the administration and recovery period, including slit-lamp microscopy, indirect ophthalmoscopic examination, and intraocular pressure measurement. • Fundus photography, fluorescein angiography, and electroretinography were performed during pretreatment, at week 9 of the trial (all groups), at week 26 (groups 1-3 only), and at the end of the recovery period. • Blood and vitreous samples for biological analysis, ADA analysis, and toxicokinetic assessment (at completion) [Table 33]

[0163] Formulations tested in one or more of groups 1, 2, 3, 4, 5, 6, 7, 8, and / or 9 are expected to be judged to have a safety profile comparable to EYLEA in cynomolgus monkeys, as measured in the evaluation above.

[0164] Example 13: Stability test using VEGF trap product. A formulation containing 114.3 mg / mL of VEGF Trap (aflibercept), 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride was prepared in a laminar flow hood (LFH) using a 0.22 μm Durapore PVDF sterile filter before filling. 0.3 mL of the drug was filled into a clean, depyrogenic 3 mL Ischott glass vial and stoppered with a 13 mm serum stopper (S2-F4514432 / 50B2-40). Samples were analyzed at various time points after storage at 37°C or 5°C by size exclusion chromatography (SEC) to determine the presence of high molecular weight species (HMW), low molecular weight species (LMW), and dominant peaks, as well as the presence of particles of various sizes by microflow imaging, HIAC liquid particle counting (by light occlusion), and microscopy.

[0165] Figure 19(A-E) shows the stability and purity data after storage at 37°C, 25°C, and 2-8°C. See also Tables 13-1 to 13-4. [Table 34] [Table 35] [Table 36] [Table 37]

[0166] Example 14: Stability tests using various VEGF trap concentrations. The effect of variations in VEGF Trap concentration on the stability of four VEGF Trap (aflibercept) eye pharmaceutical formulations was tested. The concentrations ranged from 80 to 140 mg / mL. Stability was evaluated under storage conditions of 2–8°C. The pharmaceuticals (DP) were also incubated under stress conditions (37°C). The four formulations evaluated in this stability test (each of which is referred to herein as "CCC") are listed in Table 14-1 below.

[0167] Approximately 27 mL of each formulation was prepared in a Laminar Flow Hood (LFH) using a 0.22 μm Durapore PVDF sterile filter before filling. These were filled into clean, depyrogenated 2 mL I-Schott glass vials and stoppered with 13 mm serum stoppers (S2-F4514432 / 50B2-40). Samples were analyzed at various time points after storage at 37°C or 2–8°C by size exclusion ultrahigh performance liquid chromatography (SE-UPLC) to determine the presence (%) of high molecular weight species (HMW) and other relevant parameters. The primary peak was identified.

[0168] Figure 20 (A and B) shows data illustrating the percentage of HMWs after incubation at 2–8°C or 37°C for up to 6 months. See also Tables 14-2 and 14-3. When stored at 37°C and 5°C, these formulations showed a positive correlation between HMW formation rate and VEGF trap concentration. The 140 mg / mL formulation showed the highest HMW species formation rate (%). did. [Table 38] [Table 39] [Table 40]

[0169] Example 15: High doses of Eylea were used in the D, L~AAA models of persistent neovascular leakage. The duration of action in the drug was extended. In this example, it was determined that aflibercept showed a four-fold increase in the dose-to-duration effect of inhibiting chronic retinal vascular leakage in the D, L-AAA models.

[0170] The animals used were New Zealand white rabbits three months after DL-AAA (DL-α-aminoadipic acid) disease induction. The treatment groups were as follows: • Placebo (pharmaceutical buffer) 50 mcl / eye, n=6 eyes • 500 mcg of aflibercept in 50 mcl, n=7 eyes • In 50 mcl, aflibercept 2 mg was administered to 8 eyes.

[0171] The formulation used in each treatment group was 10 mM histidine, 8% sucrose, and 0.03% PS20 at pH 5.8. Ocular examinations performed at baseline and at weeks 1, 2, 4, 6, 7, 9, 10, 11, 13, and 18 included intraocular pressure (IOP), red-free (RF) imaging (to assess vascular morphology), fluorescein angiography (FA; to assess vascular leakage), and optical coherence tomography (OCT; to identify vitreous inflammation). Serum (ADA) and plasma (drug levels) were collected at baseline and at weeks 1, 2, 4, 6, and 9.

[0172] The data from the FA trial for each group are shown in Figure 21. These data indicate that the suppression of retinal vascular leakage in animals treated with high doses of aflibercept lasted longer than that in animals treated with low doses. The number of treated eyes with completely inhibited vascular permeability was significantly higher in the 2 mg dose group at all sampling times up to 18 weeks post-administration.

Claims

1. A water-based pharmaceutical preparation, A VEGF receptor fusion protein, anti-VEGF antibody, antigen-binding fragment, or VEGF-binding molecule at a concentration of at least approximately 100 mg / ml, Approximately 5% sucrose, Histidine buffer and, Approximately 0.03% surfactant and If necessary, include in conjunction with further therapeutic agents, A formulation having a pH of approximately 5.0 to approximately 6.

8.

2. The formulation according to claim 1, suitable for intravitreal administration.

3. The formulation according to claim 1 or 2, further comprising sodium sulfate, sodium thiocyanate, glycine, NaCl, sodium aspartate, L-arginine and / or sodium glutamate.

4. The VEGF receptor fusion protein or anti-VEGF antibody or antibody fragment or VEGF-binding molecule (i) A VEGF receptor fusion protein comprising two polypeptides: (1) a VEGFR1 component containing amino acids 27-129 of SEQ ID NO: 2, (2) a VEGFR2 component containing amino acids 130-231 of SEQ ID NO: 2, and (3) a polymerizing component containing amino acids 232-457 of SEQ ID NO:

2. (ii) A VEGF receptor fusion protein comprising the immunoglobulin-like (lg) domain 2 of the first VEGF receptor and the lg domain 3 of the second VEGF receptor, as well as two polypeptides containing a polymerizing component, (iii) A VEGF receptor fusion protein comprising an immunoglobulin-like (lg) domain 2 of a first VEGF receptor, an lg domain 3 of a second VEGF receptor, an lg domain 4 of the second VEGF receptor, and two polypeptides comprising a polymerizing component, (iv) A VEGF receptor fusion protein comprising the immunoglobulin-like (lg) domain 2 of VEGFR1, the lg domain 3 of VEGFR2, and two polypeptides containing a polymerizing component, (v) A VEGF receptor fusion protein comprising the immunoglobulin-like (lg) domain 2 of VEGFR1, the lg domain 3 of VEGFR2, the lg domain 4 of VEGFR2, and two polypeptides containing a polymerizing component, (vi) A VEGF receptor fusion protein comprising two VEGFFR1R2-Fc△C1(a) polypeptides encoded by the nucleic acid sequence of SEQ ID NO: 1, or (vii) Bevacizumab, ranibizumab, pegaptanib, brolucizumab, anti-VEGF A formulation according to any one of claims 1 to 3, selected from the group consisting of DARPin and a bispecific anti-VEGF / ANG2 antibody.

5. The formulation according to any one of claims 1 to 4, wherein the VEGF receptor fusion protein or anti-VEGF antibody or antibody fragment or VEGF-binding molecule is a VEGF receptor fusion protein selected from the group consisting of aflibercept and convercept.

6. The formulation according to any one of claims 1 to 5, wherein the VEGF receptor fusion protein or anti-VEGF antibody or antibody fragment or VEGF-binding molecule is a VEGF receptor fusion protein having a concentration of about 41 to about 275 mg / ml.

7. The VEGF receptor fusion protein or anti-VEGF antibody or antibody fragment or VEGF-binding molecule • A concentration of approximately 100 mg / ml, • A concentration of approximately 111.5 mg / ml, • A concentration of approximately 112.0 mg / ml, • A concentration of approximately 113.3 mg / ml, • A concentration of approximately 114.3 mg / ml, • A concentration of approximately 115.6 mg / ml, • A concentration of approximately 116.3 mg / ml, • A concentration of approximately 120 mg / ml, • A concentration of approximately 133 mg / ml, • A concentration of approximately 140 mg / ml, • A concentration of approximately 150 mg / ml, • A concentration of approximately 200 mg / ml, • A concentration of approximately 250 mg / ml, • A concentration containing approximately 4 mg of VEGF receptor fusion protein in approximately 100 μl or less, approximately 70 μl or less, approximately 75 μl or less, approximately 50 μl or less, or approximately 60 μl or less. • A concentration containing approximately 6 mg of VEGF receptor fusion protein in approximately 100 μl or less, approximately 70 μl or less, approximately 75 μl or less, approximately 50 μl or less, or approximately 60 μl or less. - A concentration containing approximately 8 mg of VEGF receptor fusion protein in approximately 100 μl or less, approximately 70 μl or less, approximately 75 μl or less, approximately 50 μl or less, or approximately 60 μl or less, or A formulation according to any one of claims 1 to 6, wherein the VEGF receptor fusion protein is a VEGF receptor fusion protein in a concentration containing approximately 10 mg of VEGF receptor fusion protein in approximately 100 μl or less, approximately 70 μl or less, approximately 75 μl or less, approximately 50 μl or less, or approximately 60 μl or less.

8. (i) The osmolality by weight is approximately 299 to approximately 506 mmol / kg, and / or (ii) The formulation according to any one of claims 1 to 7, wherein the viscosity is about 6 to 15 cP at 20°C.

9. The formulation according to any one of claims 1 to 8, wherein the pH is 5.8 to 6.

5.

10. The formulation according to claim 9, wherein the pH is approximately 5.

8.

11. The formulation according to any one of claims 1 to 10, wherein the surfactant is a nonionic surfactant.

12. The formulation according to claim 11, wherein the nonionic surfactant is selected from the group consisting of polysorbate 20, polysorbate 80, poloxamer 188, polyethylene glycol 3350, and mixtures thereof.

13. The formulation according to any one of claims 1 to 12, wherein the histidine is histidine hydrochloride.

14. The formulation according to claim 13, comprising approximately 10 mM to 20 mM histidine hydrochloride.

15. A formulation according to any one of claims 1 to 14, comprising a heat stabilizer which is a sugar.

16. The formulation according to claim 15, wherein the sugar is sucrose, mannitol, sorbitol, or trehalose.

17. The formulation according to claim 15 or 16, comprising approximately 2.5% (w / v), approximately 5% (w / v), approximately 8% (w / v), approximately 10% (w / v), or approximately 20% (w / v) of sucrose.

18. A formulation according to any one of claims 1 to 17, comprising a surfactant at a concentration of approximately 0.03% (w / v).

19. A preparation according to any one of claims 1 to 18, comprising L-arginine monohydrochloride.

20. The formulation according to any one of claims 1 to 19, wherein the VEGF receptor fusion protein or anti-VEGF antibody or antibody fragment or VEGF-binding molecule is a VEGF receptor fusion protein having less than 3.5% high molecular weight species immediately after manufacturing and purification and / or less than 6% high molecular weight species after being stored at about 2 to 8°C for about 24 months.

21. A pharmaceutical product, Formulation A: 80 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride; Formulation B: 80 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride; Formulation C: 80 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation D: pH 6.2, containing 80 mg / ml aflibercept, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation E: 80 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation F: pH 5.8–6.2, containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation G: 80 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20; Formulation H: 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation I: 80 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation J: 80 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80; Formulation K: 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation L: pH 5.8-6.2, containing 80 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) poly Solvate 80; Formulation M: 150 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride; Formulation N: 150 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation O: 150 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation P: 150 mg / ml aflibercept with pH 6.2, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation Q: 150 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation R: 150 mg / ml aflibercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation S: 150 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20; Formulation T: 150 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation U: 150 mg / ml aflibercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation V: 150 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80; Formulation W: 150 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation X: 150 mg / ml aflibercept with a pH of 5.8–6.2, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80; Formulation Y: 80 mg / ml of Convercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation Z: 80 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation AA: 80 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation BB: pH 6.2, 80 mg / ml of Convercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation CC: Convercept 80 mg / ml, 10 mM, with a pH of 5.8-6.2 A phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation DD: 80 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation EE: 80 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation FF: 80 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation GG: 80 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation HH: 80 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation II: 80 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation JJ: 80 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation KK: 150 mg / ml of Convercept with a pH of 5.8–6.2, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride; Formulation LL: 150 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation MM: 150 mg / ml of Convercept, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation NN: 150 mg / ml of Convercept with pH 6.2, 10 mM histidine buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation OO: 150 mg / ml of Convercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8–6.2; Formulation PP: 150 mg / ml of Convercept with a pH of 5.8–6.2, 10 mM citrate-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride; Formulation QQ: 150 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation RR: 150 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation SS: 150 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8–6.2; Formulation TT: 150 mg / ml of Convercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation UU: 150 mg / ml of Convercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation VV: 150 mg / ml of Convercept, 10 mM citrate-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8–6.2; Formulation WW: pH 5.8, 140 mg / ml VEGF receptor fusion protein, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM taurine; Formulation XX: 140 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride; Formulation YY: 140 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM taurine; Formulation ZZ: pH 5.8, 140 mg / ml VEGF receptor fusion protein, 10 mM histidine buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride; Formulation AAA: 140 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM PSA; Formulation BBB: pH 5.8, 140 mg / ml VEGF receptor fusion protein, 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA; Formulation CCC: VEGF receptor fusion protein at pH 5.8, 80, 100, 120 or 140 mg / ml, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride; Formulation DDD: 140 mg / ml of VEGF receptor fusion protein with pH 5.8, 10 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA; Formulation EEE: pH 5.8, 140 mg / ml VEGF receptor fusion protein, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and no heat stabilizers; Formulation FFF: pH 6.2, 140 mg / ml VEGF receptor fusion protein, 10 mM sodium phosphate, 5% (w / v) sucrose, and 0.03% polysorbate 20; Preparation GGG: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM sodium sulfate; Formulation HHH: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM sodium thiocyanate; Formulation III: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 40 mM sodium citrate; Formulation JJJ: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose, 0.03% polysorbate 20; 50 mM glycine; Formulation KKK: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose, 0.03% polysorbate 20; 50 mM sodium chloride; Formulation LLL: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM lysine; Formulation MMM: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM sodium aspartate; Formulation NNN: 140 mg / ml VEGF receptor fusion protein; pH 5.8, 20 mM histidine; 5% sucrose; 0.03% polysorbate 20; 50 mM monosodium glutamate; Formulation OOO: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM sodium citrate; 50 mM arginine hydrochloride; Formulation PPP: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM glycine; 50 mM arginine hydrochloride; Formulation QQQ: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM sodium aspartate; 50 mM arginine hydrochloride; Formulation RRR: 140 mg / ml VEGF receptor fusion protein; 20 mM histidine at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 50 mM monosodium glutamate; 50 mM arginine hydrochloride; Preparation SSS: 140 mg / ml VEGF receptor fusion protein; 20 mM His at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 10 mM L-arginine hydrochloride; Formulation TTT: 140 mg / ml VEGF receptor fusion protein; 20 mM His at pH 5.8; 5% sucrose; 0.03% polysorbate 20; 100 mM L-arginine hydrochloride; Formulation UUU: pH 6.2, 30 mg / ml VEGF receptor fusion protein, 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation VVV: pH 6.2, 30 mg / ml VEGF receptor fusion protein, 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation WWW: pH 6.2, 60 mg / ml VEGF receptor fusion protein, 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation XXX: pH 6.2, 60 mg / ml VEGF receptor fusion protein, 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation YYY: pH 6.2, 120 mg / ml VEGF receptor fusion protein, 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation ZZZ: pH 6.2, 120 mg / ml VEGF receptor fusion protein, 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20; Formulation AAAA: pH 6.2, 120 mg / ml VEGF receptor fusion protein, 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl; Formulation BBBB: pH 6.2, 120 mg / ml VEGF receptor fusion protein, 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl; Formulation CCCC: pH 6.2, 140 mg / ml VEGF receptor fusion protein, 10 mM sodium phosphate, 5% sucrose, 40 mM sodium chloride, 0.03% PS20; Formulation DDDD: 80.0 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation EEEE: 120.0 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation FFFF: pH 5.8, 113.3 mg / ml VEGF receptor fusion protein, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation GGGG: 114.3 mg / ml of VEGF receptor fusion protein with pH 5.8, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation HHHH: 100.0 mg / ml of VEGF receptor fusion protein having pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; and Formulation III: 133.3 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation JJJJ: pH 6.2, 150 mg / ml aflibercept, 10 mM sodium phosphate, 8% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride; Formulation KKKK: 114.3 mg / ml of VEGF receptor fusion protein with pH 5.8, 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride; Formulation LLLL: pH 5.75, 90 mg / ml VEGF receptor fusion protein, 10 mM histidine, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20; and Formulation MMMM: A formulation containing components selected from the group consisting of 90 mg / ml of VEGF receptor fusion protein, 10 mM histidine, 7% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.

75.

22. The formulation according to claim 21, wherein the VEGF receptor fusion protein is aflibercept or convercept.

23. The formulation according to claim 21 or 22, wherein the VEGF receptor fusion protein has high molecular weight species of less than about 3.5% immediately after production and purification and / or high molecular weight species of less than about 6% after being stored at about 2 to 8°C for about 24 months.

24. A container or injection device comprising a preparation according to any one of claims 1 to 23.

25. The container or injection device according to claim 24, which is a vial, syringe, auto-injector or pre-filled syringe.

26. A method for preparing a formulation according to any one of claims 1 to 23, comprising combining the components of the formulation into a single composition.

27. The method according to claim 26, further comprising loading a certain volume of the preparation into a syringe.

28. A formulation which is a product of the method according to claim 26 or 27.

29. A method for administering a formulation according to any one of claims 1 to 22 and 27, comprising intraocular injection of the formulation into the eye of the subject.

30. A method for treating intraocular neovascularization in a subject requiring treatment for intraocular neovascularization, comprising administering an intraocular injection of more than 2 mg of a VEGF receptor fusion protein into the eye of the subject.

31. The method according to claim 30, comprising administering approximately 4 mg, approximately 6 mg, approximately 8 mg, or approximately 10 mg of the VEGF receptor fusion protein to the target eye.

32. A method for treating intraocular neovascularization in a subject requiring treatment for intraocular neovascularization, comprising intraocular injection into the eye of the subject of a formulation according to any one of claims 1 to 23 and 28, comprising the injection of more than 2 mg of a VEGF receptor fusion protein from the formulation according to any one of claims 1 to 23 and 28.

33. The method according to claim 32, comprising injecting approximately 4 mg, approximately 6 mg, approximately 8 mg, or approximately 10 mg of the VEGF receptor fusion protein into the eye of the subject.

34. The method according to any one of claims 30 to 33, wherein the intraocular injection is an intravitreous injection.

35. The method according to any one of claims 30 to 34, wherein the intraocular neovascular disorder is age-related macular degeneration (wet), macular edema, macular edema after retinal vein occlusion, retinal vein occlusion (RVO), central retinal vein occlusion (CRVO), branch retinal vein occlusion (BRVO), diabetic macular edema (DME), choroidal neovascularization (CNV), iris neovascularization, neovascular glaucoma, postoperative fibrosis of glaucoma, proliferative vitreoretinopathy (PVR), optic neovascularization, corneal neovascularization, retinal neovascularization, vitreous neovascularization, pannus, pterygium, vascular retinopathy, diabetic retinopathy, non-proliferative diabetic retinopathy, and / or proliferative diabetic retinopathy.

36. The method according to any one of claims 30 to 35, wherein the VEGF receptor fusion protein is administered in an amount of about 100 microliters or less, about 90 microliters, about 80 microliters, about 75 microliters, about 70 microliters, about 60 microliters, or about 50 microliters.

37. The method according to any one of claims 30 to 36, wherein the VEGF receptor fusion protein is contained in a formulation comprising about 5% sucrose, histidine buffer, and about 0.03% surfactant.

38. The method according to any one of claims 30 to 37, wherein more than approximately 2.0 mg of the VEGF receptor fusion protein is injected once every 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks.

Images