Exon 44-targeted nucleic acid and recombinant adeno-associated virus containing said nucleic acid for the treatment of dystrophin-based myopathy

The use of rAAV to deliver U7-based snRNA for exon 44 skipping in the DMD gene addresses the limited treatment options for DMD by increasing dystrophin production and improving muscle function.

JP2026062679APending Publication Date: 2026-04-10RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-12-10
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current treatments for muscular dystrophy, particularly Duchenne muscular dystrophy (DMD), are limited, and there is a need for effective therapies that can restore the production of functional dystrophin protein, especially in cases involving mutations like exon 44 deletions or duplications in the DMD gene.

Method used

A recombinant adeno-associated virus (rAAV) is used to deliver U7-based small nuclear ribonucleic acid (snRNA) that induces exon 44 skipping in the DMD gene, allowing for the production of partially functional dystrophin protein, thereby addressing mutations such as exon 44 deletions or duplications.

Benefits of technology

The approach results in increased expression of dystrophin protein, improving muscle function and stability, and potentially slowing the progression of dystrophy pathology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026062679000012
    Figure 2026062679000012
  • Figure 2026062679000013
    Figure 2026062679000013
  • Figure 2026062679000014
    Figure 2026062679000014
Patent Text Reader

Abstract

We provide gene therapy for the treatment of muscular dystrophy, including but not limited to Duchenne muscular dystrophy (DMD). [Solution] This disclosure provides a recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule that delivers a nucleic acid encoding a U7-based snRNA, which is a nucleic acid that induces exon skipping for use in the treatment of muscular dystrophy, including but not limited to DMD, resulting from any mutation suitable for skipping exon 44 of the DMD gene (DMD exon 44), including but not limited to mutations involved in or affecting DMD exon 44.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefit of the prior U.S. Provisional Application No. 62 / 882,216, filed on 2 August 2018, the disclosure of which is incorporated in its entirety by reference.

[0002] This disclosure relates to the field of gene therapy for the treatment of muscular dystrophy. More specifically, this disclosure provides recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule that delivers a nucleic acid encoding a U7-based snRNA, which includes a U7-based nuclear small molecule ribonucleic acid (RNA) (snRNA), a nucleic acid encoding the U7-based snRNA, and any mutations that are suitable for skipping exon 44 of the DMD gene (DMD exon 44), including but not limited to mutations involved in, surrounding, or affecting DMD exon 44.

[0003] Inclusion by referencing the sequence list This application includes, as a separate part of the disclosure, a computer-readable sequence listing (filename: 54313A_Seqlisting.txt, size: 22,771 bytes, created: August 3, 2020), which is incorporated herein by reference in its entirety. [Background technology]

[0004] Muscular dystrophy (MD) is a group of hereditary degenerative diseases that primarily affect voluntary muscles. This group is characterized by progressive weakness and degeneration of the skeletal muscles that control movement. Some forms of MD develop in infancy or childhood, while others may not appear until middle age or later. The impairment varies in terms of the distribution and degree of muscle weakness (some forms of MD also affect the myocardium), age of onset, rate of progression, and mode of inheritance.

[0005] Muscular dystrophy (MD) is a group of diseases for which there is no specific cure, and it has a profound impact on individuals, families, and communities. The costs are immeasurable. Individuals suffer from emotional strain and a reduced quality of life associated with loss of self-esteem. Extreme physical difficulties resulting from loss of function in limbs make it difficult to perform daily activities. Family relationships suffer from financial losses and challenges to interpersonal relationships. Affected siblings feel trapped, and spousal disputes often lead to divorce, especially when the responsibility for muscular dystrophy can be placed on one parent partner. The burden of the search for a cure is often a lifelong, highly focused effort that undermines and tests every aspect of life. Beyond the family, communities bear the financial burden of needing additional facilities to address the handicap of the muscular dystrophy population in terms of special education, special transportation, and the costs of readmissions to treat recurrent respiratory infections and cardiac complications. Financial responsibility is shared by state and federal agencies and extended to the taxpayer community.

[0006] One form of muscular dystrophy (MD) is Duchenne muscular dystrophy (DMD). This is the most common severe childhood form of muscular dystrophy, affecting 1 in 5,000 newborn boys. DMD is caused by a mutation in the DMD gene, resulting in the absence of the dystrophin protein (427 kDa) in skeletal and cardiac muscle, as well as in the gastrointestinal tract and retina. Dystrophin not only protects the muscle sheath from eccentric contraction but also anchors numerous signaling proteins very close to the muscle sheath. Another form of MD is Becker muscular dystrophy (BMD). Like DMD, BMD is a genetic disorder that gradually weakens and shrinks the muscles of the body. BMD affects the muscles of the glutes, pelvis, thighs, and shoulders, as well as the heart, but is known to cause problems that are not as severe as those of DMD.

[0007] Many clinical cases of DMD are associated with deletion mutations in the DMD gene. In contrast to deletion mutations, DMD exon duplication accounts for approximately 5% of disease-causing mutations in an unbiased sample of dystrophinopathy patients [Dent et al., Am J [Med Genet, 134(3):295-298 (2005)], several catalogs of mutations, including those published by the United Dystrophinopathy Project by Flanigan et al. [Hum Mutat, 30(12):1657-1666 (2009)], accounted for 11%, and there is a large number of duplicates. BMD is also caused by alterations in the dystrophin gene, which cause the protein to become excessively short. Defective dystrophin puts muscle cells at risk of damage with normal use. See also U.S. Patent Application Publication No. 2012 / 0077860, published March 29, 2012, No. 2013 / 0072541, published March 21, 2013, and No. 2013 / 0045538, published February 21, 2013. While deletion of exon 45 is one of the most common deletions seen in DMD patients, deletions of exons 44 and 45 are generally associated with BMD [Anthony et al., JAMA Neurol 71:32-40 (2014)]. Therefore, if exon 44 can be bypassed by premessenger RNA (mRNA), which is a transcript in these DMD patients, this would restore the reading frame and allow for the production of partially functional BMD-like dystrophin [Aartsma-Rus et al., Nucleic Acid Ther 27(5):251-259 (2017)]. In fact, many patients with deletions adjacent to exon 45 show spontaneous skipping of exon 44, albeit at very low levels. This results in slightly elevated levels of dystrophin when compared to DMD patients with other deletions and is most likely to underlie the less severe disease progression observed in these patients compared to DMD patients with other deletions [Anthony et al., supra; Pane et al., PLoS One 9:e83400 (2014), van den Bergen et al., J Neuromuscul Dis 1:91-94 (2014)]. Despite numerous research lines following the identification of the DMD gene, treatment options remain limited. Therefore, there is a continued need in this field for treatments for MD, including DMD. The most advanced therapies include those aiming to restore the deficient protein, dystrophin, using mutation-specific gene approaches such as antisense oligonucleotide (AON)-mediated exon skipping. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] U.S. Patent Application Publication No. 2012 / 0077860 [Patent Document 2] U.S. Patent Application Publication No. 2013 / 0072541

Patent Document 3

Non-Patent Document

[0009]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Summary of the Invention

[0010] The present disclosure provides products, methods, and uses for a novel gene therapy for treating, ameliorating, delaying the progression of, and / or preventing muscular dystrophy, including but not limited to mutations involving, surrounding, or affecting DMD exon 44, suitable for skipping exon 44 of the DMD gene (DMD exon 44). More specifically, the present disclosure provides nucleic acids, U7-based small nuclear ribonucleic acid (RNA) (snRNA), and modified forms of dystrophin protein for use in the treatment of muscular dystrophy resulting from duplication of DMD exon 44, deletion of exon 43 or 45, or deletion of exons 45-56, and provides recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule that delivers a U7-based snRNA encoding an exon skipping-inducing U7-based snRNA.

[0011] The present disclosure provides a nucleic acid molecule that binds to or is complementary to a polynucleotide encoding exon 44 of the DMD gene, wherein the polynucleotide encoding DMD exon 44 comprises or consists of the nucleotide sequence shown in SEQ ID NO: 1 or 2, or encodes the amino acid sequence shown in SEQ ID NO: 3.

[0012] The present disclosure provides a nucleic acid molecule that binds to or is complementary to at least one of the nucleotide sequences shown in SEQ ID NO: 4, 5, 6, 7, 32, 33, 34, or 35.

[0013] The present disclosure provides a nucleic acid molecule comprising or consisting of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleotide sequences shown in SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 32, 33, 34, or 35. The present disclosure provides a nucleic acid molecule comprising or consisting of the nucleotide sequences shown in SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 32, 33, 34, or 35.

[0014] The present disclosure provides a nucleic acid molecule comprising or consisting of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleotide sequence set forth in SEQ ID NO: 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27. The present disclosure provides a nucleic acid molecule comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27.

[0015] The present disclosure provides a recombinant adeno-associated virus (rAAV) comprising a genome comprising at least one of the nucleic acid molecules disclosed or described herein. In some embodiments, the present disclosure provides an rAAV, wherein the genome of the rAAV is a self-complementary genome or a single-stranded genome. In some embodiments, the rAAV is rAAV-1, rAAV-2, rAAV-3, rAAV-4, rAAV-5, rAAV-6, rAAV-7, rAAV-8, rAAV-9, rAAV-10, rAAV-11, rAAV-12, rAAV-13, rAAV-rh74, or rAAV-anc80. In some embodiments, the present disclosure provides an rAAV, wherein the genome of the rAAV lacks AAV rep and cap DNA. In some embodiments, the present disclosure provides an rAAV, wherein the rAAV further comprises an AAV-1 capsid, an AAV-2 capsid, an AAV-3 capsid, an AAV-4 capsid, an AAV-5 capsid, an AAV-6 capsid, an AAV-7 capsid, an AAV-8 capsid, an AAV-9 capsid, an AAV-10 capsid, an AAV-11 capsid, an AAV-12 capsid, an AAV-13 capsid, an AAV-rh74 capsid, or an AAV-anc80 capsid.

[0016] This disclosure provides methods for inducing exon 44 skipping of the DMD gene in cells. In some embodiments, the method includes providing cells with at least one of the nucleic acid molecules disclosed or described herein. In some embodiments, the method includes providing cells with two or more of the nucleic acid molecules disclosed or described herein. In some embodiments, the method includes providing cells with rAAV containing at least one of the nucleic acid molecules disclosed or described herein. In some embodiments, the method includes providing cells with rAAV containing two or more of the nucleic acid molecules disclosed or described herein.

[0017] This disclosure provides methods for treating, improving, and / or preventing muscular dystrophy in subjects having any mutation suitable for DMD exon 44 skipping, comprising administering at least one of the nucleic acid molecules disclosed or described herein to the subject. In some embodiments, the method comprises administering an rAAV containing at least one of the nucleic acid molecules disclosed or described herein to the subject. In some embodiments, the method comprises administering an rAAV containing two or more of the nucleic acid molecules disclosed or described herein to the subject. In some embodiments, a mutation suitable for DMD exon 44 skipping is a mutation in the DMD gene sequence that is involved in, surrounding, or affecting DMD exon 44. In some forms, the mutation occurs in exons 1-43, 2-43, 3-43, 4-43, 5-43, 6-43, 7-43, 8-43, 9-43, 10-43, 11-43, 12-43, 13-43, 14-43, 15-43, 16-43, 17-43, 18-43, 19-43, 20-43, 21-43, 22-43, 23-43, 24-43, 25-43, 26-43, 27-43, 28-43, 29-43, 30-43, 31-43, 32-43, 33-43, 34-43, 35-43, 36-43, 37-43, 38-43, 39-43, 40 This includes deletions of -43, 41-43, 42-43, 43-45, 45-46, 45-47, 45-48, 45-49, 45-50, 45-51, 45-52, 45-53, 45-54, 45-55, 45-56, 45-57, 45-58, 45-59, 45-60, 45-61, 45-62, 45-63, 45-64, 45-65, 45-66, 45-67, 45-68, 45-69, 45-70, 45-71, 45-72, 45-73, 45-74, 45-75, 45-76, 45-77, and 45-78, as well as / or duplication of exon 44. In some embodiments, the mutation is a duplication of DMD exon 44, a deletion of exon 43 or 45, or a deletion of exons 45-56.In some embodiments, administration results in increased expression of dystrophin protein, including but not limited to increased expression of a modified form of dystrophin protein or a functionally active modified form or fragment of dystrophin protein in the subject. In some embodiments, administration inhibits the progression of dystrophy pathology in the subject. In some embodiments, administration improves muscle function in the subject. In some embodiments, such improvement in muscle function is an improvement in muscle strength. In some embodiments, such improvement in muscle function is an improvement in stability during standing and walking.

[0018] This disclosure provides the use of at least one of the nucleic acid molecules disclosed or described herein to induce skipping of exon 44 of the DMD gene in cells. In some embodiments, cells are isolated from a subject having mutations found within or around DMD exon 44, or mutations affecting it. In some embodiments, the nucleic acid molecules are provided in rAAV. In some embodiments, two or more of the various nucleic acid molecules disclosed or described herein, or combinations of the various nucleic acid molecules disclosed or described herein, are provided in rAAV.

[0019] This disclosure provides the use of at least one of the nucleic acid molecules disclosed or described herein in the treatment, improvement, and / or prevention of muscular dystrophy in subjects having mutations related to, surrounding to, or affecting DMD exon 44. This disclosure includes the use of at least one of the nucleic acid molecules disclosed or described herein in the preparation of a pharmaceutical for the treatment, improvement, and / or prevention of muscular dystrophy in subjects having mutations related to, surrounding to, or affecting DMD exon 44. In some embodiments, the nucleic acid molecules are provided in rAAV. In some embodiments, two or more of the various nucleic acid molecules disclosed or described herein, or combinations of the various nucleic acid molecules disclosed or described herein, are provided in rAAV. In some embodiments, the mutation is a mutation in a sequence related to, surrounding to, or affecting DMD exon 44. In some embodiments, the mutation is a duplication of DMD exon 44, a deletion of exon 43 or 45, or a deletion of exons 45-56. In some embodiments, use results in increased expression of dystrophin protein or increased expression of a modified form of dystrophin protein having functional activity. In some embodiments, use inhibits the progression of dystrophy pathology. In some embodiments, use improves muscle function. In some embodiments, improved muscle function is improved muscle strength. In some embodiments, improved muscle function is improved stability in standing and walking.

[0020] Other features and advantages of this disclosure will become apparent from the following description of the drawings and detailed description. However, it should be understood that the drawings, detailed description and specific examples are given only as examples, although they illustrate embodiments of the subject matter disclosed, as various changes and modifications that are in the spirit and scope of this disclosure will become apparent to those skilled in the art from this detailed description. [Brief explanation of the drawing]

[0021] [Figure 1A]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 1B]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 1C]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 1D]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 1E]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 1F]Figures 1A–1F show exon skipping of human DMD exon 44 after transduction in various viral constructs of Del45-56 FibroMyoD, Del45 FibroMyoD, and Dup44 FibroMyoD. Figure 1A shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, LESE44, or SESE44 constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with SD44 shows exon skipping, as indicated by the strong band in Del44-56. Del45-56 FibroMyoD treated with LESE44 or SESE44 shows partial exon skipping, as indicated by the bands in Del45-56 and Del44-56. Figure 1B shows RT-PCR of Del45 FibroMyoD treated with LESE44, SESE44, SD44, and BP43AS44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 shows the maximum amount of exon skipping. Figure 1C shows RT-PCR of Dup44 FibroMyoD treated with SD44, BP43AS44, and LESE44 constructs [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoDs show exon skipping, but SD44 appears to show the maximum amount of exon skipping. Figure 1D shows the RT-PCR results of Del45-56 FibroMyoD treated with SD44, 4X-SD44, or SD44-stuffed constructs [Del45-56 (untreated) and Del 44-56 (treated)]. Del45-56 FibroMyoD treated with all constructs showed strong exon skipping in all three constructs, as indicated by strong banding in Del44-56, with the strongest banding observed in FibroMyoD treated with 4X-SD44 and SD44-stuffed constructs.Figure 1E shows RT-PCR of Del45 FibroMyoD treated with 4X-SD44, SD44-stuffer, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon 44 skipping in Del45 FibroMyoD. Figure 1E shows RT-PCR of Dup44 FibroMyoD treated with SD44-stuffer, 4X-SD44, and SD44 construct [Del45 (untreated) and Del 44-45 (treated)]. All treated FibroMyoD samples show strong exon skipping, with both SD44-stuffer and 4X-SD44 showing the greatest amount of exon skipping in these experiments. [Figure 2] This study demonstrates efficient exon skipping of human DMD exon 44 in the anterior tibial (TA) muscle of 3-month-old hDMDdel45 / mdx mice one month after injection with three different rAAV viral vectors. Experiments were performed in the TA of each of two mice (n=4 TA muscle per construct). These RT-PCR results showed the absence of exon skipping in mice #57 and #58 (untreated hDMDdel45 / mdx mice), efficient exon skipping in mice #60 and #61 (hDMDdel45 / mdx mice injected with U7-SD44-Stuffer (SEQ ID NO: 27)), efficient exon skipping in mice #66 and #72 (hDMDdel45 / mdx mice injected with U7-SD44 (SEQ ID NO: 23)), and efficient exon skipping in mouse #84 (hDMDdel45 / mdx mouse injected with U7-4xSD44 (SEQ ID NO: 26)). Black 6 (Bl6) mice are wild-type mice that do not contain the human DMD gene and are therefore negative controls for human DMD. [Figure 3A]Figures 3A–3E show immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 3-month-old hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). These immunofluorescence results were obtained from mouse #58 (untreated mouse), mouse #72 (mouse injected with U7-SD44 (sequence number 23), Figure 3C), mouse #60 (mouse injected with U7-SD44-Stuffer (sequence number 27), Figure 3D), and mouse #84 (mouse injected with U7-4xSD44 (sequence number 26), Figure 3E). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this immunofluorescence experiment recognize both human and mouse dystrophin. After one month of treatment, immunohistochemistry shows that dystrophin is expressed after infection with all three rAAV virus vectors, and that the SD44-Stuffer vector (Figure 3D) and 4X-SD44 vector (Figure 3E) appear to yield the highest levels of dystrophin expression in muscle. Figure 3A shows the absence of dystrophin expression in untreated hDMDdel45 / mdx mice. Figure 3B shows dystrophin expression in the Bl6 model, as the antibody reacts with mouse dystrophin. [Figure 3B]Figures 3A–3E show immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 3-month-old hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). These immunofluorescence results were obtained from mouse #58 (untreated mouse), mouse #72 (mouse injected with U7-SD44 (sequence number 23), Figure 3C), mouse #60 (mouse injected with U7-SD44-Stuffer (sequence number 27), Figure 3D), and mouse #84 (mouse injected with U7-4xSD44 (sequence number 26), Figure 3E). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this immunofluorescence experiment recognize both human and mouse dystrophin. After one month of treatment, immunohistochemistry shows that dystrophin is expressed after infection with all three rAAV virus vectors, and that the SD44-Stuffer vector (Figure 3D) and 4X-SD44 vector (Figure 3E) appear to yield the highest levels of dystrophin expression in muscle. Figure 3A shows the absence of dystrophin expression in untreated hDMDdel45 / mdx mice. Figure 3B shows dystrophin expression in the Bl6 model, as the antibody reacts with mouse dystrophin. [Figure 3C]Figures 3A–3E show immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 3-month-old hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). These immunofluorescence results were obtained from mouse #58 (untreated mouse), mouse #72 (mouse injected with U7-SD44 (sequence number 23), Figure 3C), mouse #60 (mouse injected with U7-SD44-Stuffer (sequence number 27), Figure 3D), and mouse #84 (mouse injected with U7-4xSD44 (sequence number 26), Figure 3E). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this immunofluorescence experiment recognize both human and mouse dystrophin. After one month of treatment, immunohistochemistry shows that dystrophin is expressed after infection with all three rAAV virus vectors, and that the SD44-Stuffer vector (Figure 3D) and 4X-SD44 vector (Figure 3E) appear to yield the highest levels of dystrophin expression in muscle. Figure 3A shows the absence of dystrophin expression in untreated hDMDdel45 / mdx mice. Figure 3B shows dystrophin expression in the Bl6 model, as the antibody reacts with mouse dystrophin. [Figure 3D]Figures 3A–3E show immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 3-month-old hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). These immunofluorescence results were obtained from mouse #58 (untreated mouse), mouse #72 (mouse injected with U7-SD44 (sequence number 23), Figure 3C), mouse #60 (mouse injected with U7-SD44-Stuffer (sequence number 27), Figure 3D), and mouse #84 (mouse injected with U7-4xSD44 (sequence number 26), Figure 3E). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this immunofluorescence experiment recognize both human and mouse dystrophin. After one month of treatment, immunohistochemistry shows that dystrophin is expressed after infection with all three rAAV virus vectors, and that the SD44-Stuffer vector (Figure 3D) and 4X-SD44 vector (Figure 3E) appear to yield the highest levels of dystrophin expression in muscle. Figure 3A shows the absence of dystrophin expression in untreated hDMDdel45 / mdx mice. Figure 3B shows dystrophin expression in the Bl6 model, as the antibody reacts with mouse dystrophin. [Figure 3E]Figures 3A–3E show immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 3-month-old hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). These immunofluorescence results were obtained from mouse #58 (untreated mouse), mouse #72 (mouse injected with U7-SD44 (sequence number 23), Figure 3C), mouse #60 (mouse injected with U7-SD44-Stuffer (sequence number 27), Figure 3D), and mouse #84 (mouse injected with U7-4xSD44 (sequence number 26), Figure 3E). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this immunofluorescence experiment recognize both human and mouse dystrophin. After one month of treatment, immunohistochemistry shows that dystrophin is expressed after infection with all three rAAV virus vectors, and that the SD44-Stuffer vector (Figure 3D) and 4X-SD44 vector (Figure 3E) appear to yield the highest levels of dystrophin expression in muscle. Figure 3A shows the absence of dystrophin expression in untreated hDMDdel45 / mdx mice. Figure 3B shows dystrophin expression in the Bl6 model, as the antibody reacts with mouse dystrophin. [Figure 4]This study shows Western blot expression of human dystrophin in the tibial anterior (TA) muscle of hDMD / mdx del45 mice one month after injection with three different rAAV viral vectors. Experiments were performed in the TA of each of two mice (n=4 TA muscle per construct). After one month, the Western blot results show that dystrophin was expressed after infection with all three rAAV viral vectors, and the SD44 stuffer vector appears to result in the highest levels of dystrophin expression in the muscle. These Western blot results were obtained from mice #57 and #58 (untreated hDMD / mdx del45 mice), mice #60 and #61 (hDMD / mdx del45 mice injected with U7-SD44-Stuffer (SEQ ID NO: 27)), mice #66 and #72 (hDMD / mdx del45 mice injected with U7-SD44 (SEQ ID NO: 23)), and mouse #84 (hDMD / mdx del45 mouse injected with U7-4x-SD44 (SEQ ID NO: 26)). Bl6 is a wild-type mouse that does not contain the human DMD gene, but the antibodies used in this Western blot recognize both human and mouse dystrophin. Actinin was used as a control. [Figure 5A]Figures 5A–5E show efficient exon skipping of human DMD exon 44, protein restoration, and muscle strength improvement after transduction in hDMD / mdx del45 mice 3 months post-injection. Figure 5A shows the RT-PCR results for hDMD / mdx del45 mice. Figure 5A shows efficient skipping of human DMD exon 44 in the tibial anterior (TA) muscle of 3-month-old hDMDdel45 / mdx mice 3 months after injection of the rAAV.U7_SD44 stuffer virus vector. The experiment was performed in each tibial anterior (TA) of two mice (n=6 TA muscles). These RT-PCR results showed very rare exon skipping in mice (TA muscle of n=6 untreated hDMDdel45 / mdx mice) and efficient exon skipping in mice (TA muscle of n=6 hDMDdel45 / mdx mice injected with rAAV.U7_SD44 stuffer, SEQ ID NO: 27). WT mice are wild-type mice that do not contain the human DMD gene but do contain the mouse DMD gene; therefore, these WT mice are positive controls. Figure 5B shows the results of hDMD / mdx mice 3 months after injection of rAAV.U7_SD44 stuffer. Western blot expression of human dystrophin in TA muscle of del45 mice is shown. The experiment was performed in each TA of three mice (n=6 TA muscles). After 3 months, the Western blot results showed that dystrophin was expressed after infection with rAAV.U7_SD44 stuffer (SEQ ID NO: 27). These Western blot results were obtained from mice, i.e., 3 of the 6 injected TAs. WT is a wild-type mouse that does not contain the human DMD gene, but the antibody used in this Western blot recognizes both human and mouse dystrophin. Actinin was used as a control. Figures 5C-E show the improvement in muscle strength 3 months after injection of rAAV.U7_SD44 stuffer (SEQ ID NO: 27). Figure 5C shows improvement in hang wire, Figure 5D shows specific force, and Figure 5E shows eccentric contraction 3 months after injection. [Figure 5B]Figures 5A–5E show efficient exon skipping of human DMD exon 44, protein restoration, and muscle strength improvement after transduction in hDMD / mdx del45 mice 3 months post-injection. Figure 5A shows the RT-PCR results for hDMD / mdx del45 mice. Figure 5A shows efficient skipping of human DMD exon 44 in the tibial anterior (TA) muscle of 3-month-old hDMDdel45 / mdx mice 3 months after injection of the rAAV.U7_SD44 stuffer virus vector. The experiment was performed in each tibial anterior (TA) of two mice (n=6 TA muscles). These RT-PCR results showed very rare exon skipping in mice (TA muscle of n=6 untreated hDMDdel45 / mdx mice) and efficient exon skipping in mice (TA muscle of n=6 hDMDdel45 / mdx mice injected with rAAV.U7_SD44 stuffer, SEQ ID NO: 27). WT mice are wild-type mice that do not contain the human DMD gene but do contain the mouse DMD gene; therefore, these WT mice are positive controls. Figure 5B shows the results of hDMD / mdx mice 3 months after injection of rAAV.U7_SD44 stuffer. Western blot expression of human dystrophin in TA muscle of del45 mice is shown. The experiment was performed in each TA of three mice (n=6 TA muscles). After 3 months, the Western blot results showed that dystrophin was expressed after infection with rAAV.U7_SD44 stuffer (SEQ ID NO: 27). These Western blot results were obtained from mice, i.e., 3 of the 6 injected TAs. WT is a wild-type mouse that does not contain the human DMD gene, but the antibody used in this Western blot recognizes both human and mouse dystrophin. Actinin was used as a control. Figures 5C-E show the improvement in muscle strength 3 months after injection of rAAV.U7_SD44 stuffer (SEQ ID NO: 27). Figure 5C shows improvement in hang wire, Figure 5D shows specific force, and Figure 5E shows eccentric contraction 3 months after injection. [Figure 5C]Figures 5A–5E show efficient exon skipping of human DMD exon 44, protein restoration, and muscle strength improvement after transduction in hDMD / mdx del45 mice 3 months post-injection. Figure 5A shows the RT-PCR results for hDMD / mdx del45 mice. Figure 5A shows efficient skipping of human DMD exon 44 in the tibial anterior (TA) muscle of 3-month-old hDMDdel45 / mdx mice 3 months after injection of the rAAV.U7_SD44 stuffer virus vector. The experiment was performed in each tibial anterior (TA) of two mice (n=6 TA muscles). These RT-PCR results showed very rare exon skipping in mice (TA muscle of n=6 untreated hDMDdel45 / mdx mice) and efficient exon skipping in mice (TA muscle of n=6 hDMDdel45 / mdx mice injected with rAAV.U7_SD44 stuffer, SEQ ID NO: 27). WT mice are wild-type mice that do not contain the human DMD gene but do contain the mouse DMD gene; therefore, these WT mice are positive controls. Figure 5B shows the results of hDMD / mdx mice 3 months after injection of rAAV.U7_SD44 stuffer. Western blot expression of human dystrophin in TA muscle of del45 mice is shown. The experiment was performed in each TA of three mice (n=6 TA muscles). After 3 months, the Western blot results showed that dystrophin was expressed after infection with rAAV.U7_SD44 stuffer (SEQ ID NO: 27). These Western blot results were obtained from mice, i.e., 3 of the 6 injected TAs. WT is a wild-type mouse that does not contain the human DMD gene, but the antibody used in this Western blot recognizes both human and mouse dystrophin. Actinin was used as a control. Figures 5C-E show the improvement in muscle strength 3 months after injection of rAAV.U7_SD44 stuffer (SEQ ID NO: 27). Figure 5C shows improvement in hang wire, Figure 5D shows specific force, and Figure 5E shows eccentric contraction 3 months after injection. [Figure 5D]Figures 5A–5E show efficient exon skipping of human DMD exon 44, protein restoration, and muscle strength improvement after transduction in hDMD / mdx del45 mice 3 months post-injection. Figure 5A shows the RT-PCR results for hDMD / mdx del45 mice. Figure 5A shows efficient skipping of human DMD exon 44 in the tibial anterior (TA) muscle of 3-month-old hDMDdel45 / mdx mice 3 months after injection of the rAAV.U7_SD44 stuffer virus vector. The experiment was performed in each tibial anterior (TA) of two mice (n=6 TA muscles). These RT-PCR results showed very rare exon skipping in mice (TA muscle of n=6 untreated hDMDdel45 / mdx mice) and efficient exon skipping in mice (TA muscle of n=6 hDMDdel45 / mdx mice injected with rAAV.U7_SD44 stuffer, SEQ ID NO: 27). WT mice are wild-type mice that do not contain the human DMD gene but do contain the mouse DMD gene; therefore, these WT mice are positive controls. Figure 5B shows the results of hDMD / mdx mice 3 months after injection of rAAV.U7_SD44 stuffer. Western blot expression of human dystrophin in TA muscle of del45 mice is shown. The experiment was performed in each TA of three mice (n=6 TA muscles). After 3 months, the Western blot results showed that dystrophin was expressed after infection with rAAV.U7_SD44 stuffer (SEQ ID NO: 27). These Western blot results were obtained from mice, i.e., 3 of the 6 injected TAs. WT is a wild-type mouse that does not contain the human DMD gene, but the antibody used in this Western blot recognizes both human and mouse dystrophin. Actinin was used as a control. Figures 5C-E show the improvement in muscle strength 3 months after injection of rAAV.U7_SD44 stuffer (SEQ ID NO: 27). Figure 5C shows improvement in hang wire, Figure 5D shows specific force, and Figure 5E shows eccentric contraction 3 months after injection. [Figure 5E]Figures 5A–5E show efficient exon skipping of human DMD exon 44, protein restoration, and muscle strength improvement after transduction in hDMD / mdx del45 mice 3 months post-injection. Figure 5A shows the RT-PCR results for hDMD / mdx del45 mice. Figure 5A shows efficient skipping of human DMD exon 44 in the tibial anterior (TA) muscle of 3-month-old hDMDdel45 / mdx mice 3 months after injection of the rAAV.U7_SD44 stuffer virus vector. The experiment was performed in each tibial anterior (TA) of two mice (n=6 TA muscles). These RT-PCR results showed very rare exon skipping in mice (TA muscle of n=6 untreated hDMDdel45 / mdx mice) and efficient exon skipping in mice (TA muscle of n=6 hDMDdel45 / mdx mice injected with rAAV.U7_SD44 stuffer, SEQ ID NO: 27). WT mice are wild-type mice that do not contain the human DMD gene but do contain the mouse DMD gene; therefore, these WT mice are positive controls. Figure 5B shows the results of hDMD / mdx mice 3 months after injection of rAAV.U7_SD44 stuffer. Western blot expression of human dystrophin in TA muscle of del45 mice is shown. The experiment was performed in each TA of three mice (n=6 TA muscles). After 3 months, the Western blot results showed that dystrophin was expressed after infection with rAAV.U7_SD44 stuffer (SEQ ID NO: 27). These Western blot results were obtained from mice, i.e., 3 of the 6 injected TAs. WT is a wild-type mouse that does not contain the human DMD gene, but the antibody used in this Western blot recognizes both human and mouse dystrophin. Actinin was used as a control. Figures 5C-E show the improvement in muscle strength 3 months after injection of rAAV.U7_SD44 stuffer (SEQ ID NO: 27). Figure 5C shows improvement in hang wire, Figure 5D shows specific force, and Figure 5E shows eccentric contraction 3 months after injection. [Modes for carrying out the invention]

[0022] This disclosure provides products, methods, and uses for treating, improving, delaying the progression, and / or preventing muscular dystrophy involving mutations related to, surrounding, or affecting DMD exon 44, including but not limited to duplication of DMD exon 44, deletion of exon 43 or 45, or deletion of exons 45-56. DMD, the largest known human gene, provides instructions for producing a protein called dystrophin. Dystrophin is primarily found in muscles used for movement (skeletal muscle) and cardiac muscle.

[0023] More specifically, the Disclosure provides nucleic acids containing a sequence or surrounding intron sequence of DMD exon 44 designed to bind to DMD exon 44, or DMD exon 44, for use in the treatment of muscular dystrophy resulting from mutations involving, surrounding, or affecting DMD exon 44. The Disclosure provides a vector, such as recombinant adeno-associated virus (rAAV), containing a nucleic acid comprising a nucleotide sequence encoding and including U7-based nuclear small ribonucleic acid (snRNA) (U7 snRNA), and a nucleic acid that delivers the nucleic acid encoding the U7-based snRNA that induces exon skipping of DMD exon 44, for use in the treatment of muscular dystrophy resulting from mutations involving, surrounding, or affecting DMD exon 44. Exon skipping is a therapeutic approach to correct and restore dystofin production. For a particular gene mutation, it allows the body to produce a shorter, usable dystofin. To date, exon skipping is not a treatment for DMD, but it may reduce the severity of its effects in some cases.

[0024] Accordingly, this disclosure provides nucleic acids for treating any mutation suitable for exon 44 skipping. In some embodiments, such mutations suitable for exon 44 skipping are mutations involved in, surrounding, or affecting DMD exon 44. Examples of such mutations suitable for exon 44 skipping include, but are not limited to, those provided at https: / / colon-slash-slash-www.cureduchenne.org-slash-wp-content-slash-uploads-slash-2016-slash-11-slash-Duchenne-Population-Potentially-Amenable-to-Exon-Skipping-11.10.16.pdf. Such mutations suitable for exon 44 skipping include exons 1-43, 2-43, 3-43, 4-43, 5-43, 6-43, 7-43, 8-43, 9-43, 10-43, 11-43, 12-43, 13-43, 14-43, 15-43, 16-43, 17-43, 18-43, 19-43, 20-43, 21-43, 22-43, 23-43, 24-43, 25-43, 26-43, 27-43, 28-43, 29-43, 30-43, 31-43, 32-43, 33-43, 34-43, 35-43, 36-43, 37-43, 38-43, 39-43, 40 This includes deletions of -43, 41-43, 42-43, 43-45, 45-46, 45-47, 45-48, 45-49, 45-50, 45-51, 45-52, 45-53, 45-54, 45-55, 45-56, 45-57, 45-58, 45-59, 45-60, 45-61, 45-62, 45-63, 45-64, 45-65, 45-66, 45-67, 45-68, 45-69, 45-70, 45-71, 45-72, 45-73, 45-74, 45-75, 45-76, 45-77, and 45-78, as well as duplicates of exon 44, but these are linear. In some embodiments, such mutations include duplication of DMD exon 44, deletion of exon 43 or 45, or deletion of exons 45-56. The disclosure also provides vectors for delivering the nucleic acids described herein to targets requiring them.

[0025] This disclosure provides a method for delivering a nucleic acid (or nucleic acid molecule) containing an antisense sequence or the reverse complement of an antisense sequence designed to target exon 44 or the intron region surrounding exon 44. This disclosure provides a method for delivering a nucleic acid molecule encoding a U7 snRNA containing an exon 44-targeted antisense sequence, an "exon 44-targeted U7 snRNA polynucleotide construct." In some embodiments, the polynucleotide construct is inserted into the genome of a viral vector for delivery. In some embodiments, the vector used to deliver the exon 44-targeted U7 snRNA polynucleotide construct is rAAV.

[0026] This disclosure therefore provides an rAAV for delivering a U7 small RNA promoter that expresses the desired antisense and thus mediates exon skipping. The advantage of this approach is that the rAAV virus efficiently targets the affected muscle and delivers the exon skipping system.

[0027] The DMD gene is the largest known gene in humans. It measures 2.4 million base pairs, contains 79 exons, and takes over 16 hours to transcribe and co-transcribe splice. In some embodiments, this disclosure relates to nucleic acid molecules containing a polynucleotide sequence targeting exon 44 of the DMD gene, and vectors containing such nucleic acid molecules that induce exon 44 skipping. The rationale for antisense-mediated exon skipping is to induce skipping of a target exon to restore the reading frame. The polynucleotide sequence of exon 44 of the DMD gene and its surrounding intron sequence are shown in Sequence ID No. 1. Uppercase nucleotides indicate the exon sequence, and lowercase nucleotides indicate the intron sequence. The polynucleotide sequence of exon 44 of the DMD gene is shown in Sequence ID No. 2, consisting of 148 base pairs (U.S. Patent Publication No. 2012 / 0059042), and the amino acid sequence of exon 44 is shown in Sequence ID No. 3. The first "G" in Sequence ID No. 2 is the terminal nucleotide encoding the last C-terminal amino acid of exon 43. Therefore, although "G" is the first nucleotide of SEQ ID NO: 2, exon 44 begins to be coded by "CGA," which codes for the N-terminus "R" (arginine) of SEQ ID NO: 3.

[0028] This disclosure provides nucleic acids (or nucleic acid molecules) or nucleic acids (or multiple nucleic acids) comprising, or consisting of, an antisense nucleotide sequence designed to target exon 44 of the DMD gene. Exon 44 of the DMD gene, having a surrounding intron sequence, comprises the nucleotide sequence shown in SEQ ID NO: 1. Exon 44 of the DMD gene comprises the nucleotide sequence described in SEQ ID NO: 2, or encodes the amino acid sequence described in SEQ ID NO: 3.

[0029] In various embodiments, the methods of this disclosure also target isoforms and variants of the nucleotide sequence described in SEQ ID NO: 1 or 2, or the amino acid sequence described in SEQ ID NO: 3. In some embodiments, the variants include 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity with the nucleotide sequence encoding the nucleotide sequence described in SEQ ID NO: 1 or 2, or the amino acid sequence described in SEQ ID NO: 3. Table 1 provides sequences of human DMD exon 44 and its surrounding intron region. [Table 1]

[0030] This disclosure includes various nucleic acid molecules containing target sequences in and around exon 44, including sense and antisense sequences shown in Table 2, as well as their use in methods for inducing exon 44 skipping of the DMD gene in cells. Accordingly, this disclosure includes methods and uses for inducing exon 44 skipping of the DMD gene in cells, including providing cells with nucleic acid molecules that target exon 44, i.e., “exon 44-targeted U7snRNA polynucleotide constructs”. This disclosure therefore provides nucleic acid molecules containing antisense sequences that target various regions of exon 44 and reverse complements of these sequences. The target sequences, i.e., the native sequences of exon 44 targeted by the antisense sequences, include, but are not limited to, the sequences shown in SEQ ID NO: 4 [BP43AS44 (branch point 43 acceptor site 44) target sequence], SEQ ID NO: 5 [LESE44 (long exon splicing enhancer 44) target sequence], SEQ ID NO: 6 [SESE44 (short exon splicing enhancer 44) target sequence], or SEQ ID NO: 7 [SD44 (splice donor) target sequence], or their variants. In some embodiments, these target sequences are inserted into the U7 coding sequence, i.e., SEQ ID NO: 29. In some embodiments, these antisense sequences are inserted into the U7 coding sequence, i.e., SEQ ID NO: 28. In some embodiments, multiple copies of these sequences are inserted into the U7 coding sequence. This disclosure also provides nucleic acid molecules containing sequences that target various regions of exon 44, reverse complements of target sequences, and mRNA sequences shown in SEQ ID NO: 32 [mRNA of BP43AS44 target sequence], SEQ ID NO: 33 [mRNA of LESE44 target sequence], SEQ ID NO: 34 [mRNA of SESE44 target sequence], or SEQ ID NO: 35 [mRNA of SD44 target sequence], or variants thereof. See Table 2. Uppercase letters in the sequences represent exon sequences (i.e., sequences of exon 44), and lowercase letters represent intron sequences surrounding exon 44. These sequences are present in the DMD gene found in SEQ ID NO: 1 or 2. [Table 2]

[0031] This disclosure includes, or comprises, an antisense sequence (and a sequence that is the reverse complement of an antisense sequence) and a nucleic acid molecule that interferes with the expression of exon 44 of the DMD gene by interfering with the spliceosome, resulting in skipping of exon 44 of the DMD gene, in order to restore the reading frame of the mRNA resulting in the expression of truncated dystrophin protein in order to treat, improve, and / or prevent muscular dystrophy caused by mutations in the DMD gene and modified versions of the resulting mRNA. Thus, as used herein, “increased expression of dystrophin” includes “increased expression of truncated dystrophin protein, a modified form of the dystrophin protein, or a functional fragment of the dystrophin protein.” In some embodiments, this disclosure includes an antisense sequence that targets exon 44 and its surrounding intron sequences. In some embodiments, the antisense sequence includes a sequence described in any of SEQ ID NOs: 8-11, or a variant thereof. In some embodiments, this disclosure includes an antisense mRNA sequence that targets exon 44 and its surrounding intron sequences. In some embodiments, the mRNA sequences of these antisense sequences include the sequences described in SEQ ID NOs. 12-15, or variants thereof. See Table 3. In some embodiments, these antisense sequences or their reverse complements are inserted into a U7 coding sequence, e.g., SEQ ID NOs. 28 or 29. In some embodiments, multiple copies of these sequences are inserted into the U7 coding sequence. [Table 3]

[0032] This disclosure relates to nucleic acids that, under the control of the U7 promoter, contain one or more sequences from either SEQ ID NOs: 4-15 or 32-35, or are inserted into sequences encoding U7 nuclear small RNA (U7 snRNA). Such sequences encoding U7 snRNA are shown in SEQ ID NOs: 28 and 29, and can be seen in Table 5. U7 snRNA has been found to be an important tool in exon skipping and splicing modulation [Goyenvalle et al., Mol Ther 17(7):1234-40 (2009)]. Furthermore, splicing modulation using antisense oligonucleotides (AONs) has been developed over the past 20 years as a potential treatment for many diseases, most notably Duchenne muscular dystrophy (DMD). This includes preclinical and clinical trials [Mendell et al., Ann Neurol 74:637-47 (2013)]. However, such AONs have only been shown to penetrate weakly into the heart and diaphragm (i.e., the most affected muscles in boys with DMD) and are unstable, meaning they only mediate weak exon skipping, requiring reinjection in DMD patients. Therefore, this specification describes that an AAV-based U7 snRNA gene therapy approach may help circumvent the aforementioned potential delivery problems of AONs.

[0033] This disclosure includes nucleic acid molecules comprising or consisting of nucleotide sequences encoding U7 snRNA (U7 snRNA antisense sequences, i.e., SEQ ID NOs: 16-19, 24, and 25, and reverse complement U7 snRNA antisense sequences, i.e., SEQ ID NOs: 20-23, 26, and 27), which interfere with the expression of exon 44 of the DMD gene by interfering with the spliceosome, resulting in skipping of exon 44 of the DMD gene, in order to restore the mRNA reading frame resulting in the expression of truncated dystrophin protein in order to treat, improve, and / or prevent muscular dystrophy caused by mutations in the DMD gene and modified versions of the resulting mRNA. See Table 4. [Table 4-1] [Table 4-2] [Table 4-3]

[0034] The Disclosure therefore includes nucleic acids (i.e., nucleic acid molecules or nucleic acid constructs) that include one or more nucleotide sequences represented in any of SEQ ID NOs: 4-27 and 32-35, or one or more nucleotide sequences that have at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any of the nucleotide sequences represented in any of SEQ ID NOs: 4-27 and 32-35.

[0035] In some embodiments, the disclosure utilizes a U7 snRNA molecule containing a nucleotide sequence described herein that inhibits or interferes with splicing. U7 snRNAs are typically involved in histone pre-mRNA 3'-terminus processing, but in some embodiments, they are converted into variability tools for splicing regulation or into antisense RNAs that are continuously expressed in cells [Goyenvalle et al., Science 306(5702):1796-9(2004)]. By replacing the wild-type U7 Sm binding site with a consensus sequence derived from spliceosome snRNA, the resulting RNA associates with the seven Sm proteins found in spliceosome snRNA. As a result, this U7 Sm OPT RNA can accumulate more efficiently in the nucleoplasm and, while no longer mediating histone pre-mRNA cleavage, still bind to histone pre-mRNA and function as a competitive inhibitor of wild-type U7 nuclear small ribonucleoprotein (snRNP). By further replacing the histone downstream factor-binding sequence with a sequence complementary to a specific target in the splicing substrate, it is possible to generate U7 snRNAs that can modulate specific splicing phenomena. One advantage of using U7 derivatives is that the antisense sequence is embedded within a nuclear small ribonucleoprotein (snRNP) complex. Furthermore, when embedded in gene therapy vectors, these small RNAs can be permanently expressed within target cells after a single injection, and their use with the AAV approach has been investigated in vivo [Levy et al., Eur J Hum Genet 18(9):969-70 (2010), Wein et al., Hum Mutat 31(2):136-42 (2010), Wein et al., Nat Med 20(9):992-1000 (2014)].

[0036] The U7-snRNA system has three main functions: (1) the U7 promoter that drives the expression of modified snRNA in target cells; (2) an antisense sequence inserted into the snRNA backbone, designed to form base pairs with splice junctions, branching points, or splicing enhancers; and (3) a modified sequence (called smOPT) that recruits a separate ring of RNA-binding protein to form a complex with the U7 snRNA for greater stability. [Schumperli et al., Cell and Mol Life Sciences 61:2560-70 (2004)]. It is noteworthy that the antisense sequence and U7 nuclear small RNA (snRNA) (U7 snRNA) have been proven safe for in vivo use in large animal models of muscular dystrophy [LeGuiner et al., Mol Ther 22:1923-35 (2014)].

[0037] This disclosure includes nucleic acid molecules comprising or comprising nucleotide sequences having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with any of the nucleotide sequences shown in SEQ ID NOs: 4-27 and 32-35.

[0038] Accordingly, the present disclosure provides nucleic acids comprising nucleic acids encoding a target sequence, an antisense sequence and a nucleic acid encoding the reverse complement of the antisense sequence, U7-based nuclear small ribonucleic acid (snRNA), i.e., nucleic acids encoding U7-based snRNA and nucleic acids encoding the reverse complement of U7-based snRNA, as well as recombinant adeno-associated virus (rAAV) comprising nucleic acid molecules for delivering nucleic acids encoding U7-based snRNA that induce exon skipping for use in the treatment of muscular dystrophy.

[0039] In some embodiments, the Disclosure includes complete constructs (referred herein to as exon 44 U7 snRNA polynucleotide constructs, or exon 44-targeted U7 snRNAs) that inhibit or interfere with the expression and / or incorporation of exon 44 into the mRNA of the DMD gene. Accordingly, the Disclosure provides nucleic acid sequences encoding (1) exon 44-targeted U7 snRNA coding polynucleotides (e.g., SEQ ID NOs: 16-19, 24, and 25) and (2) exon 44-targeted reverse complementary U7 snRNA coding polynucleotides (e.g., SEQ ID NOs: 20-23, 26, and 27).

[0040] Accordingly, this disclosure includes nucleic acids comprising or consisting thereof a nucleotide sequence that binds to any of the target sequences shown in SEQ ID NOs: 1-7, nucleic acids comprising or consisting thereof a nucleotide sequence that is an antisense sequence (reverse complement of the target sequence at the DNA level) designed to target exon 44 and its surrounding intron sequences (i.e., SEQ ID NOs: 8-11), nucleic acids comprising or consisting thereof a nucleotide sequence that is a reverse complementary sequence (reverse complement of the target sequence at the RNA level) designed to target exon 44 and its surrounding intron sequences (i.e., SEQ ID NOs: 12-15), nucleic acids comprising or consisting thereof a nucleotide sequence that comprises or consists thereof at least one of the nucleotide sequences shown in SEQ ID NOs: 4-15 and 32-35, and nucleic acids comprising or consisting thereof at least one of the nucleotide sequences shown in SEQ ID NOs: 16-27. This disclosure intends that these nucleic acids encoding inhibitory splicing RNAs are involved in sequence-specific gene exon skipping. In some embodiments, the nucleic acids or nucleic acid molecules or constructs described herein are inserted into a vector.

[0041] Accordingly, this disclosure includes vectors comprising nucleic acids described herein. In some embodiments, two or more of these nucleic acids are combined into a single vector. Thus, in some embodiments, a combination of exon 44-targeted nucleic acids or exon 44-targeted U7 snRNA constructs resides in a single vector. This disclosure therefore includes vectors comprising one or more nucleotide sequences having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleotide sequences shown in any of the nucleotide sequences 4-27 and 32-35. In some embodiments, the vector is a viral vector such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, poliovirus, Sindbisvirus, and vacciniavirus, which delivers a polynucleotide encoding an antisense sequence that mediates DMD exon 44 skipping as disclosed herein. In some embodiments, adeno-associated virus (AAV) is used. In some embodiments, recombinant adeno-associated virus (rAAV) is used.

[0042] In some embodiments, the rAAV genome of this disclosure comprises, for example, one or more AAV ITRs flanked by polynucleotides encoding one or more DMD exon 44 U7-based snRNAs (i.e., snRNAs that bind to or around exon 44 gene sequences and are expressed from U7 snRNAs). The polynucleotides are operably ligated to transcriptional regulatory DNA, in particular promoter DNA that is functional in target cells.

[0043] Adeno-associated virus (AAV) is a replication-deficient parvovirus. Its single-stranded DNA genome is approximately 4.7 kb long and contains two 145-nucleotide inverted terminal repeats (ITRs), while its double-stranded DNA genome is approximately 2.3 kb long and also contains two 145-nucleotide ITRs. There are multiple serotypes of AAV. The nucleotide sequences of the AAV serotype genomes are known. For example, the complete genome of AAV-1 is available under GenBank acceptance number NC_002077, the complete genome of AAV-2 is available under GenBank acceptance number NC_001401 and Srivastava et al., J Virol, 45:555-64 (1983), the complete genome of AAV-3 is available under GenBank acceptance number NC_1829, the complete genome of AAV-4 is available under GenBank acceptance number NC_001829, the genome of AAV-5 is available under GenBank acceptance number AF085716, the complete genome of AAV-6 is available under GenBank acceptance number NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are available under GenBank acceptance numbers AX753246 and AX753249, respectively, and the genomes of AAVrh74 and AAV-9 are available under Gao et al., J The genome for AAV-10 is available in Virol, 78:6381-8 (2004), the genome for AAV-11 is available in Mol Ther 13(1):67-76 (2006), the genome for AAV-11 is available in Virology, 330(2):375-83 (2004), the genome for AAV-12 is available under GenBank acceptance number DQ813647.1, and the genome for AAV-13 is available under GenBank acceptance number EU285562.1. The Cis action sequence, which directs viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration, is contained within the AAV ITR. Three AAV promoters (named p5, p19, and p40 relative to their relative map locations) promote the expression of two AAV internal open reading frames encoding the rep and cap genes.Coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), two rep promoters (p5 and p19) produce four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single-consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are outlined in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0044] AAV possesses unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is non-cellular, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV can infect many mammalian cells, enabling the potential to target many different tissues in vivo. Additionally, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in a plasmid, enabling the construction of a recombinant genome. Furthermore, since signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, some or all of the internal approximately 4.3 kb of genome (rep-cap, encoding replication and structural capsid proteins) may be replaced with foreign DNA. To generate an AAV vector, the rep and cap proteins can be supplied trans. Another important characteristic of AAV is that it is an extremely stable and robust virus. This makes it easy to withstand the conditions used to inactivate adenoviruses (56°C to 65°C for several hours), reducing the importance of chilling AAV. AAV can be freeze-dried. Finally, AAV-infected cells do not show resistance to co-infection.

[0045] The recombinant AAV genomes of this disclosure comprise one or more AAV ITRs adjacent to at least one exon 44-targeted U7 snRNA polynucleotide construct. Specifically, genomes having exon 44-targeted U7 snRNA polynucleotide constructs comprising each of the exon 44-targeted antisense sequences described herein, and genomes having exon 44-targeted U7 snRNA polynucleotide constructs comprising two or more possible combinations of the exon 44-targeted antisense sequences described herein, are contemplated. In some embodiments, including exemplary embodiments, the U7 snRNA polynucleotide comprises its own promoter.

[0046] The AAV DNA in the rAAV genome may be derived from any AAV serotype from which recombinant viruses may originate, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13, AAV-rh74, and AAV-anc80. The nucleotide sequences of the genomes of these various AAV serotypes are known in the art. In some embodiments of this disclosure, promoter DNA may be derived from actin and myosin gene families, e.g., the myoD gene family [see Weintraub et al., Science, 251:761-766 (1991)], muscle cell-specific enhancer-binding factor MEF-2 [Cserjesi and Olson, Mol. Cell. Biol., 11:4854-4862 (1991)], regulatory elements derived from human skeletal actin genes [Muscat et al., Mol. Cell. Biol., 7:4089-4099 (1987)], cardiac actin genes, muscle creatine kinase sequence elements [Johnson et al.] These are muscle-specific regulatory elements, including, but not limited to, those derived from the mouse creatine kinase enhancer (MCK) element, the desmin promoter, the skeletal fast-twitch muscle troponin C gene, the slow-twitch muscle cardiac troponin C gene, and the slow-twitch muscle troponin I gene, hypoxia-inducible nuclear factor [Semenza et al., Proc. Natl. Acad. Sci. USA, 88:5680-5684 (1991)], promoters containing steroid-inducible elements and glucocorticoid response elements (GRE) [see Mader and White, Proc. Natl. Acad. Sci. USA, 90:5603-5607 (1993)], and other regulatory elements.

[0047] The DNA plasmid of this disclosure comprises the rAAV genome of this disclosure. The DNA plasmid is transferred to a cell tolerant of infection with an AAV helper virus (e.g., adenovirus, E1 deletion adenovirus, or herpesvirus) for assembly of the rAAV genome into infectious viral particles. Techniques for producing rAAV particles, in which the AAV genome, rep and cap genes, and helper virus function are provided to the cell, are standard in the art. The production of rAAV requires that the following components, the rAAV genome, the AAVrep and cap genes isolated from (i.e., not present in) the rAAV genome, and the helper virus function, be present in a single cell (referred to herein as the packaging cell). The AAV rep gene may be derived from any AAV serotype from which the recombinant virus may originate, and may be derived from an AAV serotype different from the rAAV genome ITR, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13, AAV-rh74, and AAV-anc80. The use of congeneral components is particularly intended. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated in its entirety herein by reference.

[0048] In some embodiments of this disclosure, the viral genome is a single-stranded genome or a self-complementary genome. In some embodiments of the method, the rAAV genome lacks AAV rep and cap DNA.

[0049] The method for generating packaging cells involves creating a cell line that stably expresses all the components necessary for AAV particle production. For example, a plasmid (or multiple plasmids) containing an rAAV genome lacking the AAVrep and cap genes, the AAVrep and cap genes isolated from the rAAV genome, and selectable markers such as the neomycin resistance gene, is incorporated into the cell genome. The AAV genome is introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., Proc Natl Acad Sci USA, 79:2077-81 (1982)], addition of a synthetic linker containing restriction endonuclease cleavage sites [Laughlin et al., Gene, 23:65-73 (1983)], or direct blunt-end ligation [Senapathy et al., J Biol Chem 259:4661-6 (1984)]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and it is suitable for large-scale production of rAAV. Another example of a suitable method is to use adenovirus or baculovirus rather than plasmids to introduce the rAAV genome and / or rep and cap genes into packaging cells.

[0050] The general principles of rAAV production are outlined, for example, in Carter, Current Opinions in Biotechnology, 1533-539 (1992), and Muzyczka, Curr Topics in Microbial and Immunol, 158:97-129 (1992). Various approaches are described in Ratschin et al., Mol.Cell.Biol.4:2072(1984), Hermonat et al., Proc.Natl.Acad.Sci.USA,81:6466(1984), Tratschin et al., Mol.Cell.Biol.5:3251(1985), McLaughlin et al., J.Virol.,62:1963(1988), and Lebkowski et al., Mol.Cell.Biol.,7:349(1988), Samulski et al., J.Virol.,63:3822-8(1989), U.S. Patent No. 5,173,414, WO 95 / 13365 and the corresponding U.S. Patent No. 5,658,776, WO 95 / 13392, WO 96 / 17947, PCT / US98 / 18600, WO 97 / 09441(PCT / US96 / 14423), WO 97 / 08298(PCT / US96 / 13872), WO 97 / 21825(PCT / US96 / 20777), WO 97 / 06243(PCT / FR96 / 01064), WO 99 / 11764, Perrin et al., Vaccine 13:1244-50(1995), Paul et al., Human Gene Therapy 4:609-615(1993), Clark et al., Gene Therapy This is described in U.S. Patents 3:1124-32 (1996), 5,786,211, 5,871,982, and 6,258,595. The aforementioned documents are incorporated herein by reference in their entirety, with particular emphasis on the portions relating to rAAV production.

[0051] Accordingly, this disclosure provides packaging cells that produce infectious rAAV. In one embodiment, the packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (allogeneic 293 strain). In another embodiment, the packaging cells may be non-transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus macaque fetal lung cells).

[0052] The cell transduction efficiencies of the methods of this disclosure described above and below may be at least about 60, 65, 70, 75, 80, 85, 90, or 95 percent efficiencies.

[0053] rAAV can be purified by methods standard in the art, for example, by column chromatography or a cesium chloride gradient. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, the methods disclosed in Clark et al., Hum. Gene Ther. 10(6):1031-9 (1999), Schenpp et al., Methods Mol. Med. 69:427-43 (2002), U.S. Patent No. 6,566,118, and WO 98 / 09657.

[0054] In another embodiment, the Disclosure envisions a composition comprising rAAV containing any of the nucleic acid molecules or constructs described herein. In one embodiment, the Disclosure comprises a composition comprising rAAV for delivering snRNA described herein. The compositions of the Disclosure comprise rAAV in a pharmaceutically acceptable carrier. The compositions may also comprise other components, such as diluents. Acceptable carriers and diluents are nontoxic to the recipient and preferably inactive at the dosage and concentration used, and include buffers such as phosphates, citrates, or other organic acid salts; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween®, Pluronic®, or polyethylene glycol (PEG).

[0055] Sterile injectable solutions are prepared by combining the required amount of rAAV in a suitable solvent, along with various other components listed above as needed, and then sterilizing by filtration. Generally, dispersions are prepared by mixing the sterilized active ingredient into a sterile vehicle containing a basic dispersion medium and other required components from those listed above. For sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired components from those solutions that have been previously sterilized and filtered.

[0056] The titer of rAAV administered by the method of this disclosure will vary depending, for example, on the specific rAAV, mode of administration, therapeutic target, targeted individual, and cell type, and may be determined by standard methods in the art. The titer of rAAV is approximately 1 × 10⁶ per mL. 6, about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~about 1×10 14 , or can be in the range of more than DNase resistant particles (DRP). The dosage can also be expressed in units of viral genome (vg) (i.e., 1x10 7 vg, 1x10 8 vg, 1x10 9 vg, 1x10 10 vg, 1x10 11 vg, 1x10 12 vg, 1x10 13 vg, 1x10 14 vg).

[0057] In some embodiments, the present disclosure provides a method of delivering DNA encoding an snRNA shown in any of SEQ ID NOs: 4-27 and 32-35, including administering an rAAV encoding an exon 44-targeted snRNA, to a subject that needs it. In some embodiments, the present disclosure provides AAV transduced cells for delivery of exon 44-targeted snRNA.

[0058] The present invention envisions a method for transducing target cells (e.g., skeletal muscle) with rAAV in vivo or in vitro. The method comprises the step of administering an effective dose, or an effective multiple dose, of a composition comprising rAAV of the present disclosure to an animal (including a human) in need thereof. If the dose is administered before the onset of muscular dystrophy, e.g., DMD, the administration is prophylactic. If the dose is administered after the onset of muscular dystrophy, the administration is therapeutic. In embodiments of the present disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the muscular dystrophy being treated, delays or prevents the progression of muscular dystrophy, e.g., DMD, delays or prevents the progression of muscular dystrophy disorder / disease state, reduces the severity of the disease, results in remission (partial or complete) of the disease, and / or extends the survival of an object suffering from the disease or disorder.

[0059] The effective dose of the composition is administered by standard routes in the art, including but not limited to intramuscular, parenteral, intravenous, intrathecal, oral, oral cavity, nasal cavity, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal. The routes of administration and serotypes of the AAV components of the rAAV of this disclosure (in particular, AAV ITR and capsid protein) may be selected and / or adapted by those skilled in the art, taking into account the infection and / or disease state being treated, as well as the target cells / tissues. In some embodiments, the route of administration is intramuscular. In some embodiments, the route of administration is intravenous.

[0060] Combination therapies are also contemplated in this disclosure. Combinations used herein include concurrent or sequential therapies. Combinations of the methods disclosed herein with standard medical treatments (e.g., corticosteroids and / or immunosuppressants) are specifically contemplated, as are combinations with other therapies, such as those disclosed in International Publication No. 2013 / 016352, which is incorporated herein in whole by reference.

[0061] The effective dose of the composition is administered by standard routes in the art, including but not limited to intramuscular, parenteral, intravenous, intrathecal, oral, oral cavity, nasal cavity, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal. The routes of administration and serotypes of the AAV components of the rAAV of this disclosure (in particular, AAV ITR and capsid protein) may be selected and / or adapted by those skilled in the art, taking into account the infection and / or disease state being treated, as well as the target cells / tissues expressing exon 44-targeted U7-based snRNA.

[0062] In particular, the actual administration of rAAV according to this disclosure is achieved in several embodiments by using any physical method to deliver the rAAV vector to the target tissue of interest. Administration according to this disclosure includes, but is not limited to, injection into muscle, liver, cerebrospinal fluid, or bloodstream. Simply resuspending rAAV in phosphate-buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known limitations on the carrier or other components that can be co-administered with rAAV (however, compositions that degrade DNA should be avoided in conventional methods with rAAV). In several embodiments, the capsid protein of rAAV is modified so that rAAV is targeted to a specific target tissue of interest, such as muscle. See, for example, WO02 / 053703, which is incorporated herein by reference. In several embodiments, the composition or pharmaceutical composition is prepared as an injectable formulation or as a topical formulation delivered to muscle by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been developed prior to and may be used when carrying out this disclosure. In some embodiments, rAAV is used with any pharmaceutically acceptable carrier or excipient to facilitate administration and handling.

[0063] In some embodiments, solutions are used for intramuscular injection in an adjuvant such as sesame or peanut oil, or in aqueous propylene glycol, and sterile aqueous solutions. Such aqueous solutions are, in various embodiments, buffered as desired, and the liquid diluent is made isotonic with physiological saline or glucose. In some embodiments, solutions of rAAV as a free acid (DNA contains acidic phosphate bases) or a pharmacokinetically acceptable salt are prepared in water, which is appropriately mixed with a surfactant such as hydroxypropyl cellulose. In various embodiments, dispersions of rAAV are prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oil. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth. In this regard, all sterile aqueous media used are readily available by standard techniques in the art.

[0064] Pharmaceutical formulations, including those suitable for injectable use, include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, these formulations must be sterile and fluid enough to allow for easy syringe injection. They must be stable under manufacturing and storage conditions and protected against microbial contamination, such as bacteria and fungi. In some embodiments, the carrier is a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Adequate fluidity is maintained in some embodiments by the use of coatings such as lecithin, in the case of dispersions by maintaining the required particle size, and by the use of surfactants. Prevention of microbial action can be provided by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In some embodiments, it is preferable to include isotonic agents, such as sugars or sodium chloride. In some embodiments, the long-term absorption of injectable compositions is achieved by the use of absorption-delaying agents, such as aluminum monostearate and gelatin.

[0065] In some embodiments, sterile injectable solutions are prepared by incorporating the required amount of rAAV into a suitable solvent, along with various other components as listed above as needed, followed by filtration sterilization. Generally, dispersions are prepared by mixing sterile active ingredients into a sterile vehicle containing a basic dispersion medium and other required components from those listed above. For sterile powders for the preparation of sterile injectable solutions, various preparation methods are vacuum drying and freeze-drying techniques, resulting in a powder of the active ingredients plus any additional desired components from their pre-sterilized filtered solutions.

[0066] Transduction with rAAV can be performed in vitro in some embodiments. In one embodiment, for example, desired target muscle cells are removed from the subject, transduced with rAAV, and reintroduced into the subject. Alternatively, syngeneic or heterogeneic muscle cells are used in some embodiments if they do not produce an inappropriate immune response in the subject.

[0067] Preferred methods for transduction into a target and reintroduction of transduced cells are known in the art. In one embodiment, cells are transduced in vitro, for example, by combining rAAV with muscle cells in a suitable medium and screening for cells having the DNA of interest using conventional techniques such as Southern blotting and / or PCR, or by using a selectable marker. The transduced cells are then, in some embodiments, formulated into a composition comprising a pharmaceutical composition, which is introduced into a target by various techniques, such as intramuscular, intravenous, subcutaneous, and / or intraperitoneal injection, or by injection into smooth muscle and cardiac muscle, for example, using a catheter.

[0068] This disclosure provides a method for administering to a subject in need an rAAV encoding an effective dose (or a dose that is essentially administered simultaneously or at intervals) of inhibitory RNA, as well as an rAAV encoding a combination of inhibitory RNAs, including exon 44 and snRNA that targets exon 44 skipping.

[0069] Transduction of cells by rAAV according to the present invention results in sustained expression of exon 44 U7-based snRNA. The term "transduction" is used to refer to the administration / delivery of one or more exon 44-targeted U7-snRNA polynucleotide constructs to recipient cells, either in vivo or in vitro, via replication-deficient rAAV according to the present invention, resulting in the expression of one or more exon 44-targeted U7-snRNA polynucleotide constructs by the recipient cells. Accordingly, this disclosure provides a method for targeting / delivering rAAV expressing exon 44 U7-based snRNA. In some embodiments, the subject is human.

[0070] These methods involve transducing the blood and vascular system, the central nervous system, and tissues (including, but not limited to, tissues such as muscle, organs such as the liver and brain, and glands such as salivary glands) with one or more rAAVs of this disclosure. Transduction is carried out in some embodiments using gene cassettes containing tissue-specific regulatory elements. For example, one embodiment of the present disclosure includes regulatory elements derived from the actin and myosin gene families, e.g., the myoD gene family [see Weintraub et al., Science, 251:761-6 (1991)], muscle cell-specific enhancer-binding factor MEF-2 [Cserjesi et al., Mol Cell Biol 11:4854-62 (1991)], regulatory elements derived from the human skeletal actin gene [Muscat et al., Mol Cell Biol, 7:4089-99 (1987)], cardiac actin gene, muscle creatine kinase sequence elements [see Johnson et al., Mol Cell Biol, 9:3393-9 (1989)], and mouse creatine kinase enhancer (mCK) elements, skeletal fast-twitch muscle troponin C gene, slow-twitch muscle cardiac troponin C gene, and slow-twitch muscle troponin I gene: hypoxia-inducible nuclear factor [Semenza et al., Proc Natl The present invention provides a method for transducing muscle cells and muscle tissue induced by muscle-specific regulatory elements, including, but not limited to, steroid-inducible elements and promoters, including glucocorticoid response elements (GREs) [see Mader et al., Proc Natl Acad Sci USA 90:5603-7 (1993)], as well as other regulatory elements.

[0071] Because AAV targets all dystrophin-affected organs, this disclosure includes the delivery of DNA encoding inhibitory RNA to all target cells, tissues, and organs. In some embodiments, the vascular system, central nervous system, muscle tissue, heart, and brain are attractive targets for in vivo DNA delivery. This disclosure includes the sustained expression of snRNA from transduced cells that affect DMD exon 44 expression (e.g., by skipping, knocking down, or inhibiting expression) and modify the expression of the DMD protein. In some embodiments, muscle tissue is targeted for the delivery of the nucleic acid molecules and vectors of this disclosure. Muscle tissue is an attractive target for in vivo DNA delivery because it is not an organ essential for survival and is easily accessible. In some embodiments, this disclosure intends for the sustained expression of one or more exon 44 U7-based snRNAs from transduced muscle fibers. "Muscle cells" or "muscle tissue" means cells or groups of cells derived from any type of muscle (e.g., skeletal muscle and smooth muscle derived from gastrointestinal, bladder, vascular, or cardiac tissue). These muscle cells may or may not be distinguished in some aspects as myofibrillators, myocytes, myotubes, cardiomyocytes, and cardiomyogenous cells.

[0072] In yet another aspect, the disclosure provides a method for restoring the open reading frame of the DMD gene in a cell, comprising contacting the cell with an rAAV encoding an exon 44-targeted U7 snRNA, the RNA being encoded by a nucleotide sequence shown in at least one of any one of SEQ ID NOs: 4-27 and 32-35. In some aspects, skipping exon 44 results in at least about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or 100 percent exclusion or inhibition of exon 44.

[0073] Accordingly, this disclosure provides a method for administering an effective dose (or essentially a dose administered simultaneously or at intervals) of an rAAV comprising an exon 44-targeted U7snRNA polynucleotide construct or a genome encoding one or more exon 44-targeted U7snRNA polynucleotide constructs to a subject in need of it (e.g., a subject or patient suffering from a muscular dystrophy such as DMD).

[0074] In some embodiments, methods for treating muscular dystrophy in a patient are provided. In some embodiments, “treating” includes improving, inhibiting, or further preventing one or more symptoms of muscular dystrophy, including Duchenne muscular dystrophy, including but not limited to muscle wasting, muscle weakness, skeletal muscle problems, cardiac dysfunction, dyspnea, speech and swallowing problems (dysarthria and dysphagia), or cognitive impairment. In some embodiments, the treatment method results in increased expression of dystrophin protein or increased expression of a modified form or fragment of dystrophin protein that is physiologically or functionally active in the subject. In certain embodiments, the treatment method inhibits the progression of dystrophic pathology in the subject. In some embodiments, the treatment method improves muscle function in the subject. In some embodiments, the improvement of muscle function is an improvement in muscle strength. In some embodiments, the improvement of muscle function is an improvement in stability in standing and walking. The improvement in muscle strength is determined by techniques known in the art, such as the maximal voluntary isometric contraction test (MVICT). In some cases, improvement in muscle function translates to improved stability in standing and walking. In some embodiments, improvements in stability or strength are determined by techniques known in the art, such as the 6-minute walk test (6MWT), the 100-meter run / walk test, or timed stair climbing.

[0075] In some embodiments, the therapeutic method includes the step of administering one or more exon 44 U7-based snRNA polynucleotide constructs without the use of a vector. In some embodiments, the therapeutic method includes the step of administering to rAAV, where the rAAV genome comprises one or more exon 44 U7-based snRNA polynucleotide constructs.

[0076] In yet another embodiment, the disclosure provides a method for inhibiting the progression of dystrophic pathologies associated with muscular dystrophy, such as DMD. In some embodiments, the method comprises the step of administering one or more exon 44 U7-based snRNA polynucleotide constructs without the use of a vector. In some embodiments, the method comprises the step of administering rAAV to a patient, wherein the rAAV genome comprises an exon 44-targeted U7 snRNA polynucleotide construct.

[0077] Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it does not conflict with this disclosure.

[0078] Unless otherwise specified herein, the enumeration of value ranges herein is intended solely as a way of referring individually to each distinct value and each endpoint that falls within the range, and each distinct value and endpoint is incorporated herein as if it were individually enumerated herein.

[0079] All methods described herein are to be performed in any preferred order, unless otherwise specified herein or unless the context clearly contradicts it. Unless otherwise specifically claimed, any and all examples or exemplary language provided herein (e.g., "etc.") are intended solely to better illustrate the invention and do not limit its scope. The language herein should not be construed as indicating that any unclaimed element is essential for the practice of the invention.

[0080] The examples and embodiments described herein are for illustrative purposes only, and it will be understood that various modifications or changes in light thereof are suggested to those skilled in the art and fall within the spirit and scope of this application and the scope of the appended claims. [Examples]

[0081] Further aspects and details of this disclosure will be apparent from the following examples, which are intended to be illustrative rather than restrictive.

[0082] Example 1 Design and generation of sequences targeting exon 44 To test the ability of the U7snRNA system to induce exon 44 skipping, six AAV1-U7snRNAs were constructed. Antisense sequences (i.e., SEQ ID NOs. 8-27) were designed to bind to “exon definitions” (branching points, splice donors or acceptors, and exon splicing enhancers) to exclude an exon (e.g., exon 44) from mRNA. These “exon definitions” can be predicted using the online software Human Splicing Finder (HSF, http: / / www.umd.be / slash-HSF / slash-HSF.shtml). The inventors used this software to design various target sequences and various targeting sequences with varying lengths and different binding sites. The sequences were commercially synthesized (GenScript).

[0083] The following table (i.e., Table 5 below) provides the sequence of exon 44 of the DMD gene (nucleotides and amino acids) (and the intron sequence around exon 44), the target sequence on the DMD gene (exon 44 sequence (uppercase SEQ ID NO: 1) and the intron sequence around exon 44 (lowercase SEQ ID NO: 1)), an antisense sequence used to target the sequence on the DMD gene (exon 44 and the intron sequence around exon 44), the reverse complement of the antisense sequence used to target the sequence on the DMD gene (exon 44 and the intron sequence around exon 44), a U7 sequence containing the antisense sequence used to target the sequence on the DMD gene (exon 44 and the intron sequence around exon 44), and the reverse complement of the U7 sequence containing the antisense sequence used to target the sequence on the DMD gene (exon 44 and the intron sequence around exon 44).

[0084] Plasmids containing each of the constructs shown in Sequence IDs 16–27 were amplified, rearranged, and sent to the Viral Vector Core (VVC) at Nationwide Children's Hospital for insertion into recombinant adeno-associated virus (rAAV) vectors (i.e., between ITRS). For in vitro transduction studies, constructs were produced using the AAV1 capsid. For in vivo studies, constructs were produced using any AAV capsid as described herein. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5]

[0085] Example 2 Materials and methods used in the experiment cell line creation Skin biopsies were obtained from three patients with either exon 45 deletion, exon 44 duplication, or exon 45-56 deletion. These skin biopsies were developed into three cell lines by infection with lentiviral vectors for both hTERT (cell immortalization) and MyoD (transdifferentiation of cells into myotubes) delivery to fibroblasts, generating dystrophin-expressing myoplastic fibroblasts (FibroMyoD). FibroMyoD were infected with various rAAV preparations as described herein. 2.5e11 viral genomes were used per 10 cm dish. After 4–8 days, cells were collected and RNA and protein extractions were performed.

[0086] hDMD / mdx del45 mouse model The hDMD / mdx del45 mouse model (also referred to herein as the “hDMDdel45 mdx” model or “hDMD / del45 mdx” model) was obtained from Dr. Melissa Spencer [Young et al., J. Neuromuscul. Dis. 2017;4(2):139-145 (2017)]. This mouse contains the human version of the DMD gene but includes a deletion of exon 45 of the human DMD gene in the hDMD mouse, resulting in an out-of-frame transcript. This mouse also contains a stop mutation in the mouse DMD gene. Overall, these two mutations do not cause human or mouse dystrophin expression in this mouse model. Because the hDMD / mdx del45 mouse lacks both mouse and human dystrophin, the mouse exhibits dystrophy muscle pathology in multiple muscles throughout the body. This mouse model is used in the various experiments described herein.

[0087] RNA extraction RNA extraction was performed on the cell pellet after centrifugation of the cells. The pellet was rinsed and 1 ml of TRIzol (Life Technologies) was added. The cell lysates were homogenized by pipetting and then incubated at RT for 5 minutes. The cell lysates were transferred to a 1.5 ml tube and 0.2 ml of chloroform per ml of TRIzol was added. The lysates / TRIzol / chloroform mixture was shaken manually for 15 seconds. The mixture was then incubated at RT for 2-3 minutes and centrifuged at 12,000 g (+4°C) for 15 minutes. The aqueous phase (i.e., the top layer) was collected and transferred to a new tube. 0.5 ml of isopropanol (per ml of TRIzol) was added and allowed to stand at RT for 10 minutes. The supernatant was then removed after centrifugation at 12,000 g at 4°C for 10 minutes, and the pellet was washed with 1 ml of 75% EtOH (per ml of TRIzol). After centrifugation (7,500g, 4°C for 5 minutes), the pellet was air-dried, and the RNA was resuspended in RNAse-free water at 60°C for 10 minutes.

[0088] Reverse transcription and PCR amplification This protocol is based on the manufacturer's optimized protocol (Maxima Reverse Transcriptase, Thermo Fisher Scientific). 1 μg of RNA was converted to cDNA. Two PCR primers were used for amplification (i.e., Fw: CTCCTGACCTCTGTGCTAAG (SEQ ID NO: 30), Rv: ATCTGCTTCCTCCAACCATAAAAC (SEQ ID NO: 31)). PCR amplification was performed using the PCR Master Mix system (Thermo Fisher Scientific) at an annealing temperature of 60°C.

[0089] Protein extraction and Western blotting Mouse muscle lysates were prepared using a lysis buffer (150 mM Tris-NaCl, 1% NP-40, digitonin (Sigma), and protease and phosphatase inhibitors (1860932, Thermo Inc.)). The lysates in the buffer were incubated on ice for 1 hour. The lysates in the buffer were then centrifuged at 14000 g for 20 minutes. The supernatant was collected. Protein quantification was performed using the BCA protein assay kit (Pierce®). The supernatant was then mixed with conventional SDS-Page buffer and boiled at 100°C for 5 minutes. 150 μg of each protein sample was run on a precast 3-8% Tris-acetate gel (NuPage, Life Science) at 80 V (4°C) for 16 hours. The gel was transferred to a nitrocellulose membrane overnight at 300 mA.

[0090] Rabbit polyclonal antibodies against the C-terminus of dystrophin were used (1:250, PA1-21011, Thermo Fisher Scientific, or 1:400, 15277, Abcam). Alpha-actinin (1:5000, A-7811, Sigma) was used as a loading control. After 1 hour incubation at RT, the membranes were washed (0.1% Tween® in TBS, 5 × 5 mins at TBST) and exposed to a 1:1000 dilution of secondary antibody (60 mins at RT). All antibodies were diluted with 1 / 2 Odyssey Blocking Buffer (Licor®) and 1 / 2 TBST. Anti-mouse IgG(H+L) (IRDye® 680CW conjugate) and anti-rabbit IgG(H+L) (IRDye® 800CW conjugate) (Licor®) were used at a 1:1000 dilution. TBS was performed with 0.1% Tween® for 5x5 minutes, followed by ddH2O immersion. Two simultaneous IRDye® signals were scanned using LI-COR Odyssey® NIR. Immunoblotting was performed on each muscle for the muscle sections.

[0091] immunohistochemistry Frozen muscle was cut into 8-10 micron sections and air-dried for 30 minutes before staining. Sections were rehydrated with PBS and incubated with normal goat serum (1:20) for 1 hour, followed by incubation with anti-mouse IgG unbound fab fragments at room temperature for 2 hours (mouse sections only). Primary antibodies were left overnight on dystrophin (1:250, PA1-21011, Thermo Fisher Scientific). After washing, sections were incubated with appropriate secondary antibodies, i.e., Alexa Fluor 488 or 568 bound, for 1 hour (LifeScience). Slides were prepared using Fluoromount Plus The area was covered by DAPI (Vector Labs). Observations were performed using an Olympus BX61. Data acquisition was performed using a DP controller (Olympus).

[0092] Example 3 In vitro transfection and expression of rAAV constructs targeting exon 44 (AAV1.U7△ex44). Skin biopsies were obtained from three patients suffering from either exon 45 deletion, exon 44 duplication, or exon 45-56 deletion. These skin biopsies were developed into three cell lines by infection with lentiviral vectors for both hTERT (cell immortalization) and MyoD (cell differentiation into myotubes) delivery to fibroblasts, generating dystrophin-expressing myoplastic fibroblasts (FibroMyoD). FibroMyoD were then infected with four different rAAV preparations.

[0093] Four different sequences [i.e., sequence numbers 4-7 (see Table 2), located in exon 44 or in the intronic sequences surrounding exon 44 and exon 4] were selected for targeting. U7snRNA constructs were designed to include each of sequence numbers 8-11, which were designed to bind to the target sequences. To evaluate the exon skipping efficiency in myoblasts generated from the above FibroMyoD, each of the U7snRNA constructs (i.e., sequence numbers 16-25) was cloned into AAV1.

[0094] 2.5e11 viral genomes were used per 10 cm dish. After 4–8 days, cells were collected and RNA and protein extraction was performed. Three types of RT-PCR experiments were performed to observe exon skipping. All four AAV1.U7 antisense strains (i.e., AAVs containing each of sequence numbers 20–23) were able to mediate nearly 100% of exon 44 skipping (Figure 1A–C). Similarly, three AAV1.U7 antisense strains (i.e., AAVs containing each of sequence numbers 23, 26, and 27) were able to mediate nearly 100% of exon 44 skipping (Figure 1D–F).

[0095] Efficient exon 4 skipping has already been demonstrated with constructs containing BP43AS44, LESE44, SESE44, and SD44, but four copies of SD44, i.e., U7.SD44, were cloned into a single self-complementary (sc)AAV1 vector (referred to as "U7-4xSD44"). In addition, since exon skipping mediated by U7.SD44 was already very efficient, constructs containing only one copy of U7.SD44 and an appended stuffer sequence, i.e., random non-coding DNA, were also constructed.

[0096] 2.5e11 viral genomes were used per 10 cm dish. After 4–8 days, cells were collected and RNA and protein extraction was performed. Three RT-PCR experiments were performed to observe exon skipping. Three AAV1.U7 antisense (i.e., AAVs containing each of SEQ ID NOs. 23, 26, and 27) were used. AAVs containing SEQ ID NOs. 26 (4xSD44) and 27 (SD44-stuffer) were able to mediate almost 100% of exon 44 skipping (Figure 1D–F). In this experiment, AAV1.U7-SD44 (AAV containing SEQ ID NO. 23) was used as a positive control.

[0097] Example 4 Intramuscular delivery of rAAV(AAV9.U7△ex44), which contains U7-snRNA that induces exon 44 skipping, results in increased dystrophin expression. Six 2-month-old hDMD / mdx del45 mice were injected into their anterior tibialis (TA) muscles with AAV1.U7-SD44 (an AAV containing SEQ ID NO: 23), AAV1.U7-SD44-Stuffer (an AAV containing SEQ ID NO: 27), and AAV1.U7-4xSD44 (an AAV containing SEQ ID NO: 26) using 2.5e11AAV1 virus particles. Experiments were performed in the TA of two mice (n=4 TA muscles per construct). One month after viral injection, muscle was extracted from 3-month-old mice, and exon skipping efficiency was determined by measuring human dystrophin expression by RT-PCR (Figure 2). Figure 2 shows efficient skipping of human DMD exon 44 in the anterior tibialis (TA) muscle one month after injection with the three different rAAV virus vectors shown above. These RT-PCR results showed the absence of exon skipping in mice #57 and #58 (untreated mice), efficient exon skipping in mice #60 and #61 (U7-SD44-stuffer, i.e., mice injected with AAV containing SEQ ID NO: 27), efficient exon skipping in mice #66 and #72 (U7-SD44, i.e., mice injected with AAV containing SEQ ID NO: 23), and efficient exon skipping in mouse #84 (U7-4xSD44, i.e., mice injected with AAV containing SEQ ID NO: 26). Black 6 (Bl6) is a wild-type mouse that does not contain the human DMD gene and is therefore a negative control for human DMD.

[0098] Dystrophin expression was confirmed by immunofluorescence (Figure 3A-E). Figure 3A-E shows the immunofluorescence expression of human dystrophin in the anterior tibial (TA) muscle of 2-month-old hDMD / mdx del45 mice, one month after injection of three different rAAV viral vectors. The experiment was performed in the TA of two mice (n=4 TA muscles per construct).

[0099] These immunofluorescence results were obtained from mouse #58 (untreated hDMD / mdx del45 mouse, Figure 3A), Black 6 (Bl6) control mouse (Figure 3B), i.e., Bl6 mouse that does not contain the human DMD gene, however the antibody used in this immunofluorescence experiment recognizes both human and mouse dystrophin, from mouse #72 (mouse injected with U7.SD44, Figure 3C), from mouse #60 (mouse injected with U7-SD44 stuffer, Figure 3D), and from mouse #84 (mouse injected with U7-4xSD44) (Figure 3E).

[0100] One month later, muscle immunostaining showed that dystrophin was expressed after viral infection with all three rAAV vectors, and that the SD44-stuffer vector (U7-SD44-stuffer, i.e., mice injected with AAV containing SEQ ID NO: 27, Figure 3D) and the 4x-SD44 vector (U7-4xSD44, i.e., mice injected with AAV containing SEQ ID NO: 26, Figure 3E) appeared to result in the highest levels of dystrophin expression in muscle.

[0101] Dystrophin expression was confirmed by Western blot analysis (Figure 4). Figure 4 shows Western blot expression of human dystrophin in the anterior tibial (TA) muscle of hDMD / mdx del45 mice one month after injection of three different rAAV viral vectors. The experiment was performed in the TA of two mice (n=4 TA muscles per construct). After one month, the Western blot results show that dystrophin was expressed after infection with all three rAAV viral vectors, and the SD44-stuffer vector appears to result in the highest levels of dystrophin expression in the muscle. These Western blot results were obtained from mice #57 and #58 (untreated mice), mice #60 and #61 (U7.SD44-stuffer, i.e., mice injected with AAV containing SEQ ID NO: 27), mice #66 and #72 (U7.SD44, i.e., mice injected with AAV containing SEQ ID NO: 23), and mouse #84 (U7.4xSD44, i.e., mouse injected with AAV containing SEQ ID NO: 26). Since the antibodies used in this Western blot recognize both human and mouse dystrophin, dystrophin is expressed by the Bl6 control.

[0102] Therefore, delivery of AAV.U7snRNA-antisense in all three rAAV vectors, including U7.SD44 (AAV containing SEQ ID NO: 23), U7.4xSD44 (AAV containing SEQ ID NO: 26), and U7.SD44-Stuffer (AAV containing SEQ ID NO: 27), involved targeting an intron sequence adjacent to exon 44, and induced dystrophin expression by targeting exon 44. All constructs mediated robust exon skipping leading to potent dystrophin expression, but rAAVs containing the SD44-Stuffer construct and the 4x-SD44 construct (Figures 3D-E and 4) appeared to be more efficient than the others in these experiments.

[0103] Example 5 Systemic delivery of rAAV(AAV9.U7△ex44), which contains U7-snRNA that induces exon 44 skipping, results in increased dystrophin expression. Ten hDMDdel45 / mdx mice (2 months old) are injected with AAV9.U7-SD4-Stuffer or AAV9.U7-4X-SD44 (cloned to AAV9, SEQ ID NOs. 27 and 26, respectively) at various doses ranging from 3e13vg / kg to 2e14vg / kg via the temporal vein (i.e., neonatal mice) or tail vein (i.e., 2 months old mice). Mice transduced with these viral vectors are collected at 1, 3, or 6 months post-injection. Exon skipping efficiency is determined by measuring dystrophin expression by RT-PCR, immunofluorescence, and Western blotting analysis using the protocols described herein above.

[0104] While this disclosure describes specific embodiments, it will be understood by those skilled in the art that changes and modifications may occur. Therefore, only such limitations as those found in the claims should be imposed on this disclosure.

[0105] All documents referenced in this application are incorporated herein by reference in their entirety, with particular attention paid to the content in which they are referenced.

Claims

1. A nucleic acid molecule that binds to or is complementary to a polynucleotide encoding exon 44 of the DMD gene, wherein the polynucleotide encoding exon 44 contains or consists of the nucleotide sequence shown in SEQ ID NO: 1 or 2, or encodes the amino acid sequence shown in SEQ ID NO:

3.

2. The nucleic acid molecule according to claim 1, which binds to or is complementary to at least one of the nucleotide sequences shown in SEQ ID NOs: 4, 5, 6, 7, 32, 33, 34, or 35.

3. A nucleic acid molecule according to claim 1 or 2, comprising or consisting of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 32, 33, 34, or 35.

4. A nucleic acid molecule according to any one of claims 1 to 3, comprising or consisting of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28.

5. A nucleic acid molecule according to any one of claims 1 to 3, comprising or consisting of the nucleotide sequence shown in SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 32, 33, 34, or 35.

6. A nucleic acid molecule according to any one of claims 1 to 4, comprising or consisting of the nucleotide sequence shown in SEQ ID NOs: 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28.

7. Recombinant adeno-associated virus (rAAV) comprising a genome containing at least one nucleic acid molecule according to any one of claims 1 to 6.

8. The rAAV according to claim 7, wherein the genome is a self-complementary genome or a single-stranded genome.

9. The rAAV according to claim 7 or 8, wherein the rAAV is rAAV-1, rAAV-2, rAAV-3, rAAV-4, rAAV-5, rAAV-6, rAAV-7, rAAV-8, rAAV-9, rAAV-10, rAAV-11, rAAV-12, rAAV-13, rAAV-rh74, or rAAV-anc80.

10. The rAAV according to any one of claims 7 to 9, wherein the genome of the rAAV lacks AAV rep and cap DNA.

11. The rAAV according to claim 10, further comprising AAV-1 capsid, AAV-2 capsid, AAV-3 capsid, AAV-4 capsid, AAV-5 capsid, AAV-6 capsid, AAV-7 capsid, AAV-8 capsid, AAV-9 capsid, AAV-10 capsid, AAV-11 capsid, AAV-12 capsid, AAV-13 capsid, AAV-rh74 capsid, or AAV-anc80 capsid.

12. A method for inducing exon 44 skipping of the DMD gene in a cell, the method comprising providing the cell with a nucleic acid molecule according to any one of claims 1 to 6.

13. A method for inducing exon 44 skipping of the DMD gene in a cell, the method comprising providing the cell with rAAV according to any one of claims 7 to 11.

14. A method for treating, improving, and / or preventing muscular dystrophy in a subject having a mutation suitable for skipping exon 44 of the DMD gene (DMD exon 44), comprising administering at least one nucleic acid molecule according to any one of claims 1 to 6 to the subject.

15. A method for treating, improving, and / or preventing muscular dystrophy in a subject having a mutation suitable for skipping exon 44 of the DMD gene (DMD exon 44), comprising administering at least one of the rAAVs described in any one of claims 7 to 11 to the subject.

16. The method according to claim 14 or 15, wherein the mutation is any mutation that is involved in, surrounding, or affecting DMD exon 44.

17. The method according to claim 16, wherein the mutation is a duplication of DMD exon 44, a deletion of exon 43 or 45, or a deletion of exons 45 to 56.

18. The method according to any one of claims 14 to 17, wherein the administration results in increased expression of dystrophin protein in the subject.

19. The method according to any one of claims 14 to 17, wherein the administration inhibits the progression of dystrophy in the subject.

20. The method according to any one of claims 14 to 17, wherein the administration improves muscle function in the subject.

21. The method according to claim 20, wherein the improvement in muscle function is an improvement in muscle strength.

22. The method according to claim 20, wherein the improvement in muscle function is an improvement in stability in standing and walking.

23. Use of at least one nucleic acid molecule according to any one of claims 1 to 6 in the treatment, improvement, and / or prevention of muscular dystrophy in subjects having a mutation suitable for skipping exon 44 of the DMD gene (DMD exon 44).

24. Use of at least one rAAV according to any one of claims 7 to 11 in the treatment, improvement, and / or prevention of muscular dystrophy in subjects having mutations suitable for skipping exon 44 of the DMD gene (DMD exon 44).

Citation Information

Patent Citations

  • Adeno-Associated Viral Vector for Exon Skipping in a Gene Encoding a Dispensable Domain Protein

    US20120077860A1

  • Modified u7 snrnas for treatment of neuromuscular diseases

    US20130045538A1

  • Adeno-associated viral vector for exon skipping in a gene encoding a dispensible-domain protein

    US20130072541A1