Treatment and diagnosis of melanoma

Abstract

Providing pharmaceutical compositions for the treatment of melanoma. [Solution] A pharmaceutical composition comprising (a) an LXRβ agonist selected from the following compounds 1, 2, 12, and 25, and / or a salt thereof, and (b) an antiproliferative compound selected from immunomodulators, topoisomerase inhibitors, antimetabolites, angiogenesis inhibitors, tyrosine kinase inhibitors, alkylating agents, and mitotic inhibitors. TIFF2026062949000078.tif110166

Description

Cross-reference of related applications

[0001] This application claims priority to U.S. Provisional Patent Application No. 61 / 682,339 (filed August 13, 2012) and U.S. Provisional Patent Application No. 61 / 784,057 (filed March 14, 2013). The contents of these applications are incorporated herein by reference in their entirety. [Technical Field]

[0002] This invention relates to the diagnosis and treatment of migratory cancers and melanoma. [Background technology]

[0003] Melanoma is a malignant tumor that develops from abnormal melanocytes in the lower epidermis and can metastasize to distal parts of the body via the blood and lymphatic systems. Although melanoma accounts for less than 5% of skin cancer cases, it is far more dangerous and is responsible for the majority of deaths associated with skin cancer. The incidence of melanoma continues to increase at an alarming rate worldwide, with the lifetime risk of developing melanoma being as high as 1 / 58 for men in the United States (Non-Patent Literature 1). The mortality rate from malignant melanoma is also rising dramatically worldwide. According to a 2006 WHO report, there were approximately 48,000 melanoma-related deaths worldwide each year (Non-Patent Literature 2). In the United States, it was estimated that nearly 70,000 people would be diagnosed with melanoma during 2010, and approximately 9,000 would die from the disease (Non-Patent Literature 3).

[0004] Despite the use of several conventional cancer treatments to treat metastatic melanoma, they are ineffective. Therefore, metastatic melanoma remains one of the most difficult cancers to treat and one of the most feared neoplasms. Consequently, novel drugs and methods for the diagnosis and treatment of melanoma are needed. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Jemal et al., 2008, CA: Cancer J. Clin., 58:71~96 [Non-Patent Document 2] Lucas et al. (2006), Environmental Burden of Disease Series.13.World Health Organization.ISBN92-4-159440-3 [Non-Patent Document 3] American Cancer Society; www.cancer.org [Overview of the project] [Means for solving the problem]

[0006] The present invention addresses the aforementioned need by providing agents and methods for the diagnosis and treatment of melanoma. The present invention is based, at least in part, on the unexpected discovery of a cooperative miRNA-protein network that is deregulated in metastatic melanoma. This network includes many metastasis inhibitors and metastasis promoters.

[0007] In one aspect, the present invention provides a method for treating cancer, comprising administering an LXR agonist to a subject in need thereof, wherein the LXR agonist increases the expression or activity level of ApoE to a level sufficient to slow the spread of metastatic cancer. It is characterized by being administered in an amount sufficient to cause the desired effect.

[0008] In another aspect, the present invention is characterized by a method for treating cancer, comprising administering an ApoE polypeptide to a subject in need thereof in an amount sufficient to treat the cancer.

[0009] In another aspect, the present invention is characterized by a method for slowing the propagation of migratory cancer, comprising administering an LXR agonist or an ApoE polypeptide to a subject in need thereof.

[0010] In some embodiments of any of the methods described above, the LXR agonist is an LXRβ agonist. In certain embodiments, the LXR agonist increases the expression level of ApoE by at least 2.5 times in vitro. In certain embodiments, the LXRβ agonist is selective for LXRβ to LXRα. In other embodiments, the LXRβ agonist has activity for LXRβ that is at least 2.5 times greater than the activity of the agonist for LXRα. In some embodiments, the LXRβ agonist has activity for LXRβ that is at least 10 times greater than the activity of the agonist for LXRα. In further embodiments, the LXRβ agonist has activity for LXRβ that is at least 100 times greater than the activity of the agonist for LXRα. In certain embodiments, the LXR agonist has activity for LXRβ that is at least 2.5 times or less than the activity of the agonist for LXRα.

[0011] In some embodiments, migratory cancer is metastatic cancer. Metastatic cancer may include cells that exhibit migration and / or invasion of migratory cells, as well as cells that exhibit endothelial mobilization and / or angiogenesis. In other embodiments, migratory cancer is cell migratory cancer. In yet another embodiment, cell migratory cancer is non-metastatic cell migratory cancer.

[0012] Migratory cancers can be cancers that spread by disseminating to the surface of the peritoneal cavity, pleural cavity, pericardial cavity, or subarachnoid space. Alternatively, migratory cancers can be cancers that spread via the lymphatic system or via the bloodstream.

[0013] In certain embodiments, migratory cancer is a non-metastatic cell-migrating cancer, such as ovarian cancer, mesothelioma, or primary lung cancer.

[0014] In a related context, the present invention provides a method for inhibiting or mitigating cancer metastasis, comprising administering an LXR agonist or an ApoE polypeptide.

[0015] In another aspect, the present invention provides a method for inhibiting the proliferation or growth of cancer stem cells or progenitor cancer cells, comprising contacting the cells with an LXR agonist or ApoE polypeptide in an amount sufficient to inhibit the proliferation or growth of the cells.

[0016] In yet another aspect, the present invention provides a method for reducing the rate of tumor dissemination of cancer, comprising administering an LXR agonist or ApoE polypeptide to a subject in need thereof in an amount sufficient to reduce tumor dissemination.

[0017] In a further context, the present invention relates to a method for reducing or treating the formation of metastatic nodules of cancer, wherein the method applies to subjects who require such treatment. The present invention provides a method comprising administering an LXR agonist or ApoE polypeptide in an amount sufficient to achieve the desired result.

[0018] In other embodiments, cancer is breast cancer, colon cancer, renal cell carcinoma, non-small cell lung cancer, hepatocellular carcinoma, gastric cancer, ovarian cancer, pancreatic cancer, esophageal cancer, prostate cancer, sarcoma, or melanoma. In some embodiments, cancer is melanoma. In other embodiments, cancer is breast cancer. In certain embodiments, cancer is renal cell carcinoma. In further embodiments, cancer is pancreatic cancer. In other embodiments, cancer is non-small cell lung cancer. In some embodiments, cancer is colon cancer. In further embodiments, cancer is ovarian cancer.

[0019] In other embodiments, the cancer is drug-resistant. In further embodiments, the cancer is resistant to vemurafenib, dacarbazine, CTLA4 inhibitors, PD1 inhibitors, or PDL1 inhibitors.

[0020] In some embodiments, the method includes administering an LXR agonist selected from a list consisting of one compound from formulas I to IV, one of the compounds numbered 1 to 39, or pharmaceutically acceptable salts thereof. In some embodiments, the LXR agonist is compound 1 or a pharmaceutically acceptable salt thereof. In other embodiments, the LXR agonist is compound 2 or a pharmaceutically acceptable salt thereof. In certain embodiments, the LXR agonist is compound 3 or a pharmaceutically acceptable salt thereof. In further embodiments, the LXR agonist is compound 12 or a pharmaceutically acceptable salt thereof. In some embodiments, the LXR agonist is compound 25 or a pharmaceutically acceptable salt thereof. In other embodiments, the LXR agonist is compound 38 or a pharmaceutically acceptable salt thereof. In further embodiments, the LXR agonist is compound 39 or a pharmaceutically acceptable salt thereof.

[0021] The above method may further include administering an antiproliferative agent, in which case the LXR agonist and the antiproliferative agent are administered in amounts sufficient to together slow the progression of migratory cancer. For example, the antiproliferative agent and the LXR agonist may be administered in amounts effective together to treat the subject within 28 days of each other (e.g., within 21 days, 14 days, 10 days, 7 days, 5 days, 4 days, 3 days, 2 days, or 1 day), or within 24 hours of each other (e.g., within 12 hours, 6 hours, 3 hours, 2 hours, or 1 hour, or simultaneously).

[0022] In some embodiments, the above method includes administering an ApoE polypeptide. The ApoE polypeptide fragment can increase the activity or expression level of LRP1 or LRP8, and / or the ApoE polypeptide can bind to LRP1 or LRP8, and the ApoE polypeptide can be the receptor-binding region (RBR) of ApoE. The above method may further include administering an antiproliferative agent, in which case the ApoE polypeptide and the antiproliferative agent are administered in amounts sufficient to together slow the progression of migratory cancer. For example, the antiproliferative agent and the ApoE polypeptide may be administered in amounts effective to together treat the subject within 28 days each (e.g., within 21 days, 14 days, 10 days, 7 days, 5 days, 4 days, 3 days, 2 days, or 1 day), or within 24 hours of each other (e.g., within 12 hours, 6 hours, 3 hours, 2 hours, or 1 hour, or simultaneously).

[0023] In some embodiments, the pharmaceutical composition may further include additional compounds having antiproliferative activity. These additional compounds having antiproliferative activity are selected from a variety of compounds, for example. For example, selections can be made from chemotherapeutic agents and cytotoxic agents, differentiation-inducing agents (e.g., retinoic acid, vitamin D, cytokines), hormonal agents, immunological agents, and anti-angiogenic agents. Chemotherapeutic agents and cytotoxic agents include, but are not limited to, alkylating agents, cytotoxic antibiotics, antimetabolites, vinca alkaloids, etoposides, and others (e.g., paclitaxel, taxol, docetaxel, taxotere, cisplatin). A further list of compounds with antiproliferative activity can be found in L. Brunton, B. Chabner, and B. Knollman (eds.), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 12th edition, 2011, McGraw Hill Companies, New York, NY.

[0024] The above methods further include alkylating agents, platinum compounds, antimetabolites, topoisomerase inhibitors, antitumor antibiotics, mitotic inhibitors, aromatase inhibitors, thymidylate synthase inhibitors, DNA antagonists, farnesyltransferase inhibitors, pump inhibitors, histone acetyltransferase inhibitors, metalloproteinase inhibitors, ribonucleoside reductase inhibitors, TNF-alpha agonists / antagonists, endothelin A receptor antagonists, retinoic acid receptor agonists, immunomodulators, hormones and antihormones, photodynamic agents, and tyrosine kinases. This may include administering an antiproliferative compound selected from the group consisting of histone deacetylase inhibitors, antisense compounds, corticosteroids, HSP90 inhibitors, proteosome inhibitors (e.g., NPI-0052), CD40 inhibitors, anti-CSI antibodies, FGFR3 inhibitors, VEGF inhibitors, MEK inhibitors, cyclin D1 inhibitors, NF-κB inhibitors, anthracyclines, histone deacetylase, kinesin inhibitors, phosphatase inhibitors, COX2 inhibitors, mTOR inhibitors, calcineurin antagonists, IMiD, or other agents used to treat proliferative disorders. Examples of such compounds are provided in Table 1.

[0025] In another aspect, the present invention features a method for treating melanoma (e.g., metastatic melanoma) in a subject requiring such treatment. This method includes (a) increasing the expression or activity level of a metastasis inhibitor selected from the group consisting of DNAJA4, apolipoprotein E (ApoE), LRP1, LRP8, liver X receptor (LXR, e.g., both LXR-alpha and LXR-beta) and miR-7 in the subject, or (b) decreasing the expression or activity level of a metastasis promoter selected from the group consisting of miR-199a-3p, miR-199a-5p, miR-1908 and CTGF in the subject.

[0026] In this method, the amplification step can be performed by administering one or more of the following (i) to (iv) to the subject: (i) a polypeptide having a sequence of DNAJA4, ApoE or ApoE fragment, LRP1, LRP8, or LXR; (ii) a nucleic acid having a sequence encoding DNAJA4, ApoE, LRP1, LRP8, or LXR; (iii) a ligand for LRP1, LRP8, or LXR; and (iv) an RNAi agent encoding miR-7. Examples of LRP1 ligands or LRP8 ligands include the receptor binding portion of ApoE, anti-LRP1 antibodies or anti-LRP8 antibodies, and small molecule ligands. In one example, the expression level of ApoE can be increased by increasing the activity level or expression level of LXR. The expression level of DNAJA4 can also be increased by increasing the activity level or expression level of LXR. The activity level of LXR can be increased by administering LXR ligands, such as compounds of formulas I to IV disclosed below, to the subject. This increase can also be achieved by decreasing the expression or activity level of a microRNA selected from the group consisting of miR-199a-3p, miR-199a-5p, and miR-1908. To achieve this objective, many techniques known in the art can be used, including, but not limited to, the miR-Zip technique, locked nucleic acid (LNA) technique, and antagomir technique, as described in the following examples.

[0027] In another aspect, the present invention provides a method for determining whether a subject has metastatic melanoma or is at risk of having metastatic melanoma. The method comprises: obtaining a sample from the subject; measuring in the sample the expression level of (i) a first metastasis-promoting factor selected from the group consisting of miR-199a-3p, miR-199a-5p, miR-1908 and CTGF, or (ii) a second metastasis-suppressing factor selected from the group consisting of DNAJA4, ApoE, LRP1, LRP8, LXR and miR-7; and comparing the first expression level to a first predetermined reference value, or the second expression level to a second predetermined reference value. The subject is determined to have metastatic melanoma or be at risk of having metastatic melanoma if (a) the first expression level exceeds the first predetermined reference value, or (b) the second expression level falls below the second predetermined reference value. A first predetermined reference value and a second predetermined reference value can be obtained from a control subject that does not have metastatic melanoma. In one embodiment, the measurement step includes measuring both the first expression level and the second expression level. The sample can be a body fluid sample, a tumor sample, a nevus sample, or a human skin sample.

[0028] In another aspect, the present invention provides an array comprising a support having a plurality of specific positions and (i) at least one nucleic acid having a sequence complementary to a nucleic acid or its complement encoding a metastasis-promoting factor selected from the group consisting of miR-199a-3p, miR-199a-5p, miR-1908, and CTGF, or (ii) any combination of at least one nucleic acid having a sequence complementary to a nucleic acid or its complement encoding a metastasis-suppressing factor selected from the group consisting of DNAJA4, ApoE, LRP1, LRP8, LXR, and miR-7. Preferably, each nucleic acid is immobilized at a specific position on the support. This array can be used for the diagnosis and prognosis of metastatic melanoma.

[0029] Accordingly, the present invention also provides a kit for diagnosing the metastatic potential of melanoma in a subject. The kit comprises a first reagent that specifically binds to the expression product of a metastasis suppressor gene selected from the group consisting of DNAJA4, ApoE, LRP1, LRP8, LXR, and miR-7, or a second reagent that specifically binds to the expression product of a metastasis pro-metastasis gene selected from the group consisting of miR-199a-3p, miR-199a-5p, miR-1908, and CTGF. The second reagent can be a probe having a sequence complementary to the suppressor gene or pro-metastasis gene or its complement. The kit may further include reagents for performing an immunoassay, hybridization assay, or PCR assay. In one embodiment, the kit contained the above-described array.

[0030] In another aspect, the present invention provides a method for identifying compounds useful for treating melanoma or for inhibiting endothelial recruitment, cell invasion, or metastatic angiogenesis. The method comprises (i) obtaining test cells expressing a reporter gene encoded by a nucleic acid operably linked to the promoter of a marker gene selected from the group consisting of miR-199a-3p, miR-199a-5p, miR-1908, and CTGF; (ii) exposing the test cells to a test compound; (iii) measuring the expression level of the reporter gene in the test cells; (iv) comparing the expression level to a control level; and (v) selecting the test compound as a candidate useful for treating melanoma or for inhibiting endothelial recruitment, cancer cell invasion, or metastatic angiogenesis if the comparison shows that the expression level is lower than the control level.

[0031] The present invention provides an alternative method for identifying compounds useful for treating melanoma or for inhibiting endothelial recruitment, cell invasion, or metastatic angiogenesis. The method comprises (i) obtaining test cells expressing a reporter gene encoded by a nucleic acid operably linked to the promoter of a marker gene selected from the group consisting of DNAJA4, ApoE, LRP1, LRP8, LXR, and miR-7; (ii) exposing the test cells to a test compound; (iii) measuring the expression level of the reporter gene in the test cells; (iv) comparing the expression level to a control level; and (v) selecting the test compound as a candidate useful for treating melanoma or for inhibiting endothelial recruitment, cancer cell invasion, or metastatic angiogenesis if the comparison shows that the expression level is greater than the control level.

[0032] In the identification methods described above, the reporter gene can be a standard reporter gene known in the art (e.g., the LaxZ gene, the GFP gene, or the luciferase gene), or one of the transmetabolism suppressor or transmetabolism promoter genes described above. In these methods, the control level can be obtained from control cells that are identical to the test cells except that they have not been exposed to the test compound.

[0033] In another aspect, the present invention provides a method for inhibiting endothelial mobilization in a subject where its inhibition is required, or a method for inhibiting tumor cell infiltration in a subject where its inhibition is required, or a method for treating metastatic cancer in a subject where treatment is required, the method comprising administering to the subject an agent that inhibits the expression or activity of CTGF. The subject may have a disorder characterized by pathological angiogenesis, including (but not limited to) cancer (e.g., metastatic melanoma), ocular disorders and inflammatory disorders. An example of tumor cells is metastatic melanoma cells. Examples of agents include antibodies, nucleic acids, polypeptides and small molecule compounds. In a preferred embodiment, the antibody is a monoclonal antibody.

[0034] In another aspect, the present invention provides a method for inhibiting endothelial mobilization in a subject where its inhibition is required, or a method for inhibiting tumor cell invasion in a subject where its inhibition is required, or a method for treating metastatic cancer in a subject where treatment is required, the method comprising administering to the subject an agent that increases the expression or activity of miR-7. An example of tumor cells is metastatic melanoma cells. Examples of agents include antibodies, nucleic acids, polypeptides, or small molecule compounds. In one example, the agent has miR-7 activity. The nucleic acid can be an oligonucleotide. The oligonucleotide may contain a sequence selected from the group consisting of SEQ ID NOs: 36-38.

[0035] As used herein, “migrating carcinoma” refers to cancer in which tumor-forming cancer cells migrate and subsequently grow as malignant grafts in other sites different from the site of the initial tumor. Cancer cells migrate by infiltration into the lymphatic system by lymphoid cell infiltration, as well as by transport to local and distal lymph nodes and subsequently to other parts of the body by dissemination to the surface of the peritoneal cavity, pleural cavity, pericardial cavity or subarachnoid cavity to spread into body cavities, by transport to local and distal lymph nodes and subsequently to other parts of the body, by hematogenous propagation by blood cell infiltration, or by infiltration into surrounding tissues. Migratory carcinomas include metastatic tumors and cell-migrating carcinomas (e.g., ovarian cancer, mesothelioma and primary lung cancer, each of which is characterized by cell migration).

[0036] As used herein, “slowing the propagation of migratory cancer” means reducing or stopping the formation of new lesions, or reducing, stopping, or reversing the tumor burden.

[0037] As used herein, “metastatic tumor” refers to a tumor or cancer in which tumor-forming cancer cells metastasize via the lymphatic system or hematogenous propagation, or have a great ability to spread from one location to another location within the subject's body, or initiate metastasis via the lymphatic system or hematogenous propagation, or spread from one location to another location within the subject's body, for example, generating secondary tumors within the subject's body. Such metastatic behavior may indicate a malignant tumor. In some cases, metastatic behavior may be accompanied by increased cell migration and / or invasive behavior of tumor cells.

[0038] As used herein, “slowing metastatic propagation” means reducing or stopping the formation of new lesions, or reducing, stopping, or reversing the tumor burden.

[0039] The term "cancer" refers to any cancer caused by the proliferation of malignant neoplastic cells, such as tumors, neoplasms, carcinomas, sarcomas, leukemias, and lymphomas.

[0040] As used herein, “drug-resistant cancer” refers to any cancer that is resistant to the antiproliferative agents listed in Table 2.

[0041] Examples of cancers that may be defined as metastatic include, but are not limited to, non-small cell lung cancer, breast cancer, ovarian cancer, colorectal cancer, biliary tract cancer, bladder cancer, brain cancer (including glioblastoma and medulloblastoma), cervical cancer, choriocarcinoma, endometrial cancer, esophageal cancer, gastric cancer, hematological neoplasms, multiple myeloma, leukemia, carcinoma in situ, liver cancer, lymphoma, neuroblastoma, oral cancer, pancreatic cancer, prostate cancer, sarcoma, skin cancer (including melanoma, basal cell carcinoma, and squamous cell carcinoma), testicular cancer, stromal tumors, germ cell tumors, thyroid cancer, and kidney cancer.

[0042] As used in this application, "proliferation" involves the replication or increase of similar forms of (cells) resulting from the formation of (cellular) elements.

[0043] When used in this application, "cell migration" refers to the invasion of surrounding tissue by cancer cells and the traverse of blood vessel walls to exit vascular structures in distal organs.

[0044] "Cell migratory cancer" refers to cancer that migrates by invading surrounding tissues and by crossing blood vessel walls to exit vascular structures in distal organs.

[0045] When used herein, "non-metastatic cell-migrating cancer" refers to cancer that does not migrate via the lymphatic system or hematogenous propagation.

[0046] As used herein, “cell-cell adhesion” refers to adhesion between at least two cells via an interaction between a selectin molecule and a selectin-specific ligand. Cell-cell adhesion includes cell migration.

[0047] "Cell adhesion-related disorders" are those that arise from cell-cell adhesion or migration, or from cells -As defined herein, a disease or disorder relating to cell adhesion or migration. Cell adhesion disorders also include any disease or disorder resulting from inappropriate, abnormal, or abnormal activation of the immune or inflammatory system. Such diseases include, but are not limited to, myocardial infarction, bacterial or viral infections, and metastatic conditions (e.g., cancer). The present invention further features a method for treating cell adhesion disorders by administering an LXR agonist or ApoE polypeptide.

[0048] As used herein, “cancer stem cells” or “cancer progenitor cells” refer to cancer cells that possess characteristics associated with normal stem cells, specifically, cancer cells capable of giving rise to all cell types found in a given cancer sample. Thus, cancer stem cells are likely to be tumorigenic, i.e., tumor-forming, as opposed to other non-tumorogenic cancer cells. Cancer stem cells may persist in a tumor as a distinct population and can cause cancer recurrence and metastasis by giving rise to new tumors.

[0049] As used herein, “tumor dissemination” refers to the outflow of tumor cell clusters and their subsequent growth as malignant grafts in a site different from the site of the initial tumor.

[0050] As used herein, “metastatic nodule” refers to an aggregate of tumor cells in the body at a site different from the site of the original tumor.

[0051] Details of one or more embodiments of the present invention are shown in the following description. Other features, purposes, and advantages of the present invention will be apparent from the description and from the claims. [Brief explanation of the drawing]

[0052] [Figure 1]Systematic identification of miR-1908, miR-199a-3p, and miR-199a-5p as endogenous promoters of human melanoma metastasis. (A) Heatmap illustrating variance-normalized microarray expression values ​​of miRNAs upregulated for their respective parental cells in independent MeWo metastatic derivatives and A375 metastatic derivatives. The change in standard deviation from the mean of each heatmap column is shown by a colormap. (B) miRNAs found to be upregulated by microarray hybridization were confirmed by qRT-PCR in MeWo-LM2 metastatic derivatives. n=3. (C) Bioluminescence imaging plot of metastatic colony formation in the lung after intravenous injection of 4 × 10⁴ parental MeWo cells overexpressing precursors to miR-199a, miR-1908, miR-214, or control hairpins. Lungs were removed 63 days post-injection and stained with H&E. n=5. (D) Bioluminescence imaging plots and H&E-stained lungs corresponding to lung metastases after intravenous injection of 4 × 10⁴ LM2 cells expressing a short hairpin (miR-Zip) or control sequence (shCTRL) that inhibits miR-1908 (m1908 KD), miR-199a-3p (m199a3p KD), or miR-199a-5p (m199a5p KD). Lungs were removed 49 days post-injection and stained with H&E. n=5~8. (E) Colony formation in the lungs by 2 × 10⁵ A375-LM3 metastatic derivatives with miR-Zip-induced silencing of miR-1908, miR-199a-3p, miR-199a-5p, or control sequence was quantified by bioluminescence imaging at day 42. n=5~8. (F) Expression levels of miR-199a-3p, miR-199a-5p, and miR-1908 were determined by qRT-PCR in a blinded manner in cohorts of non-metastatic primary melanoma skin lesions (n=38) and metastatic primary melanoma skin lesions (n=33) from MSKCC patients. n=71. All data are expressed as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001. See also Figure 12. [Figure 2]miR-1908, miR-199a-3p, and miR-199a-5p exhibit dual cell-autonomous / cell-non-autonomous roles in regulating melanoma metastatic progression. (A) 1 × 10⁶ pedestrian MeWo cells overexpressing miR-199a, miR-1908, or control hairpins were subcutaneously injected into immunodeficient mice, and primary tumor volume was monitored over time. n=4-6. (B) 1 × 10⁵ pedestrian MeWo cells overexpressing miR-199a, miR-1908, or control hairpins were infiltrated through Transwell's Matrigel-coated inserts over 24 hours, and the number of cells infiltrating the basal side of each insert was quantified. n=7. (C~D) 1 × 10⁵ highly metastatic MeWo-LM2 cells (C) and A375-LM3 cells (D) with miR-Zip induction inhibition of miR-199a-3p, miR-199a-5p, miR-1908, or a control sequence were subjected to a cell invasion assay. n=6~8. (E) 5 × 10⁴ MeWo cells overexpressing miR-199a, miR-1908, or a control hairpin were seeded at the bottom of a well, and 1 × 10⁵ human umbilical vein endothelial cells (HUVECs) were allowed to migrate toward cancer cells through the inserts in the transwell for 16 hours. Endothelial recruitment ability was measured by quantifying the number of HUVECs that migrated toward the basal side of each insert. n=7. (F~G) Endothelial mobilization by 5 × 10⁴ MeWo-LM2 cells (F) and A375-LM3 cells (G) inhibited for miR-199a-3p, miR-199a-5p, miR-1908 or control sequence. n=6~10. (H) Cumulative percentage plot of percentage vascular density distribution for metastatic nodules formed after intravenous infusion of 2 × 10⁵ highly metastatic MeWo-LM2 cells depleted for miR-199-3p, miR-199a-5p, miR-1908 or control sequence. Lung sections were double-stained immunohistochemically for human vimentin (blue) and MECA-32 (red), and the percentage MECA-32 positive area within each metastatic nodule, distinguished based on vimentin staining, was quantified.n=211 nodules (control KD); n=60 nodules (m199a3p KD); n=138 nodules (m199a5p KD); n=39 nodules (m1908 KD). All data are expressed as mean ± SEM. Scale bar, 100 μm. See also Figure 13. [Figure 3]Identification of ApoE and DNAJA4 as common target genes for miR-199a and miR-1908. (A) Heatmap showing mRNA levels of ApoE and DNAJA4 as measured by qRT-PCR in low-metastatic MeWo cells and high-metastatic MeWo-LM2 cells overexpressing miR-199a, miR-1908, or control hairpins. The color map illustrates the change in standard deviation from the mean for each heatmap column. (B) Heterogeneous luciferase reporter assay measuring the stability of wild-type ApoE 3'UTR / CDS luciferase fusions and DNAJA4 3'UTR / CDS luciferase fusions, or miRNA target site mutant ApoE 3'UTR / CDS luciferase fusions and DNAJA4 3'UTR / CDS luciferase fusions, in pediatric MeWo cells overexpressing miR-199a, miR-1908, or control hairpins. n=3~4. (C) Stability of wild-type ApoE 3'UTR / CDS luciferase fusions and DNAJA4 3'UTR / CDS luciferase fusions in MeWo-LM2 cells in which expression of miR-199a-3p, miR-199a-5p, miR-1908 or control sequence was silenced. n=4. (D) Outline of experimentally derived models of ApoE 3'UTR / CDS targeting and DNAJA4 3'UTR / CDS targeting by miR-199a-3p, miR-199a-5p and miR-1908. (E) Luciferase activity of wild-type and miRNA target site mutant ApoE 3'UTR / CDS luciferase fusions and DNAJA4 3'UTR / CDS luciferase fusions in highly metastatic MeWo-LM2 derivatives and their less metastatic parental cell lines. n=4. (F) Matrigel infiltration ability of 1 × 10⁵ MeWo-LM2 cells expressing a control vector or overexpressing ApoE or DNAJA4. n=4. (G) Endothelial recruitment ability of 5 × 10⁴ MeWo-LM2 cells transduced with a control vector or an overexpression vector for ApoE or DNAJA4. n=6.(H~I) Low-metastatic pediatric MeWo cells transduced by short lentiviral hairpins targeting ApoE, DNAJA4, or control sequences were evaluated for their Matrigel invasiveness (H) and endothelial cell recruitment ability (I). n=6–8. All data are expressed as mean ± SEM. Scale bar, 100 μm. See also Figure 14. [Figure 4]Direct targeting of ApoE and DNAJA4 by miR-199a and miR-1908 promotes metastatic invasion, endothelial recruitment, and colony formation. (A-D) Highly metastatic LM2 cells expressing control shRNAs or shRNAs that target ApoE or DNAJA4 under miR-1908 inhibition (m1908 KD; A, B) or miR-199a-5p inhibition (m199a5p KD; C, D) were subjected to cell invasion assays (A, C) and endothelial recruitment assays (B, D). n=6-8. (E-F) Bioluminescence imaging plots and H&E-stained lungs representing lung metastases after intravenous infusion of 1 × 10⁵ LM2 cells expressing a control hairpin, or a hairpin targeting ApoE, DNAJA4, or a control sequence in a miR-1908 silencing situation (E) or a miR-199a-5a silencing situation (F). n=5. (G-H) Parental MeWo cells overexpressing ApoE or DNAJA4, or expressing a control vector in a miR-1908 overexpression situation, were analyzed for Matrigel infiltration phenotype (G) and endothelial recruitment phenotype (H). (I-J) A375-LM3 derivatives expressing control shRNA or shRNAs targeting ApoE and DNAJA4 were transduced with a cocktail of LNAs targeting miR-199a-3p, miR-199a-5p, and miR-1908, or with control LNA, and analyzed in Matrigel infiltration assay (I) and endothelial recruitment assay (J). n=4. (K) Vascular density distribution shown as a cumulative percentage plot for metastatic nodules formed by MeWo-LM2 cells that are inhibited for miR-1908 and transduced with shRNAs targeting ApoE, DNAJA4, or the control sequence. Lung sections from Figure 4E were double-stained immunocytochemically for human vimentin (blue) and the endothelial marker MECA-32 (red). Percentage MECA-32 positive area within each vimentin-positive nodule was quantified. n=39 nodes (shCTRL); n=97 (shAPOE1); n=38 (shAPOE2); n=200 (shDNAJA41); n=19 (shDNAJA42).All data are expressed as mean ± SEM. Scale bar, 100 μm. See also Figure 15. [Figure 5]ApoE secreted by melanoma cells inhibits melanoma invasion and endothelial recruitment, while genetic deletion of ApoE accelerates metastasis. (A-B) Extracellular ApoE levels quantified by ELISA in conditioned media obtained from MeWo-LM2 metastatic derivatives and their parental cells (A), as well as LM2 cells silenced for miR-199a-5p, miR-1908, or a control sequence (B). n=3. (C) Matrigel invasion by parental MeWo cells was evaluated by adding ApoE neutralizing antibody 1D7 (10-40 μg / mL) or IgG (40 μg / mL) to the cell medium. n=4-6. (D) Endothelial recruitment by parental MeWo cells in the presence of 1D7 antibody (40 μg / mL) or control IgG antibody (40 μg / mL). n=4. (E) Phenotypes of Matrigel infiltration and endothelial recruitment were evaluated in LM2 cells in the presence of bovine serum albumin (BSA) (100 μM) or recombinant ApoE3 (100 μM) added to the cell culture medium. n=7~10. (F~G) LM2 cells in which the expression of miR-199a-3p, miR-199a-5p, miR-1908 or control sequences was silenced were examined for Matrigel infiltration ability (F) and endothelial recruitment ability (G) in the presence of IgG antibody or ApoE neutralizing 1D7 antibody (40 μg / mL). n=5~6. (H) ApoE levels quantified by ELISA in conditioned medium obtained from parental MeWo cells transduced with DNAJA4 or shRNA targeting the control sequence. n=3. (I-J) Parental MeWo cells with shRNA-induced silencing of DNAJA4 were analyzed for Matrigel infiltration phenotype (I) and endothelial recruitment phenotype (J) in the presence of either BSA (100 μM) or recombinant ApoE3 (100 μM). n=4. (K) Array-based ApoE expression levels in nevus samples (n=9), primary melanoma samples (n=6), and distal melanoma metastasis samples (n=19). (L) Highly metastatic MeWo-LM2 cells were incubated in the presence of recombinant ApoE3 or BSA at 100 μg / mL. After 24 hours, 4 × 10⁴ cells were intravenously injected into NOD-SCID mice, and colony formation in the lungs was monitored by bioluminescence imaging. n=6.Lung metastases by 5 × 10⁴ B16F10 mouse melanoma cells intravenously injected into genetically null C57BL / 6 mice with (M)ApoE or their wild-type control littermates. Lung bioluminescence quantification and representative H&E-stained lungs correspond to 19 days post-injection. n=8–18. All data are expressed as mean ± SEM. Scale bar, 100 μm. [Figure 6]Identification of different melanoma cell receptors and endothelial cell receptors that mediate the effects of ApoE on melanoma invasion and endothelial recruitment. (A) Matrigel invasion ability was examined in 1 × 10⁵ LM2 cells transduced with siRNA targeting LDLR, VLDLR, LRP8, LRP1, or a control sequence in the presence of either BSA (100 μM) or recombinant ApoE3 (100 μM). n=4-7. (B) 1 × 10⁵ MeWo-LM2 cells transduced with a short hairpin targeting miR-1908 or a control sequence were transfected with siRNA targeting LRP1 or a control siRNA and subjected to a Matrigel invasion assay. n=4. (C) Bioluminescence imaging of colony formation in the lungs by 1 × 10⁵ LM2 cells transduced with siRNA targeting LRP1 or a control sequence under miR-1908 inhibition. n=5. (D) 1 × 10⁵ endothelial cells pre-incubated for 24 hours with BSA (100 μM) or recombinant ApoE3 (100 μM) were analyzed for endothelial recruitment phenotype by 5 × 10⁵ LM2 cells. n=3-4. (E) 1 × 10⁵ endothelial cells were transduced with siRNA targeting LDLR, VLDLR, LRP1, LRP8, or a control sequence, and migrated in a transwell system towards LM2 cells inhibited for miR-1908 or a control sequence. n=4-12. (F) Transwell migration by 1 × 10⁵ endothelial cells in the presence of IgG antibody (40 μg / mL) or 1D7 antibody (40 μg / mL) added to cell culture medium. n=6-8. (G) Transwell migration of 1 × 10⁵ endothelial cells transduced by siRNA targeting LRP8 or a control sequence in the presence of BSA (100 μM) or recombinant ApoE3 (100 μM). n=6-7. (H) Transwell chemotactic migration of 1 × 10⁵ endothelial cells transduced by siRNA targeting LRP8 or a control sequence was evaluated along the ApoE gradient. n=6-8.(I) Endothelial mobilization into Matrigel plugs subcutaneously implanted in the superior ventral flank of mice, containing BSA (10 μg / mL), VEGF (400 ng / mL) + BSA (10 μg / mL), or VEGF (400 ng / mL) + recombinant ApoE3 (10 μg / mL). n=3-6. (J) Vascular density within pulmonary metastatic nodules formed after intravenous injection of 5 × 10⁴ B16F10 mouse melanoma cells into wild-type mice or ApoE genetic null mice. Lung sections from Figure 5M were immunohistochemically stained for MECA-32, and the percentage MECA-32 positive area within each metastatic nodule, outlined based on pigment deposition in cells, was quantified. n=17-20. All data are expressed as mean ± SEM. Scale bar, 100 μm. [Figure 7]Clinical and therapeutic synergies (A-D) between miR-199a-3p, miR-199a-5p, and miR-1908 in melanoma metastasis. Kaplan-Meier curves for the MSKCC cohort (n=71) representing metastasis-free survival in patients as a function of miR-199a-3p expression levels (A), miR-199a-5p expression levels (B), miR-1908 expression levels (C), or total expression levels of the three miRNAs (D) in the patient's primary melanoma lesion. Patients whose primary tumor miRNA expression level or total miRNA expression level (sum of miR-199a-3p, miR-199a-5p, and miR-1908 expression) exceeded the median for the population were classified as miRNA expression positive (red), while patients whose primary tumor expressed these nominate miRNAs at levels lower than this median were classified as miRNA expression negative (blue). (E) Lung metastases by highly metastatic LM2 cells transfected with LNAs that individually target miR-1908, miR-199a-3p, or miR-199a-5p, a combination of LNAs that target all three miRNAs, or a control LNA. 1 × 10⁵ cells were intravenously injected into immunodeficient mice 48 hours after transfection. n=5~6. (F) Systemic metastasis by 1 × 10⁵ LM2 cells transfected 48 hours prior to intracardiac infusion into athymic nude mice with control LNA (LNA-CTRL) or a cocktail of LNAs targeting miR-1908, miR-199a-3p, and miR-199a-5p (LNA-3miRNAs). n=5. (G) Number of systemic metastatic lesions arising from LM2 cells of LNA-CTRL and LM2 cells of LNA-3miRNAs at 28 days post-intracardiac infusion. n=5. (H~I) Quantification of bioluminescence signals of bone metastases (H) and brain metastases (I) of LM2 cells of LNA-CTRL and LM2 cells of LNA-3miRNAs at 28 days post-intracardiac infusion. n=5.(J) 4 × 10⁴ highly metastatic MeWo-LM2 cells were injected via tail vein into immunosuppressed mice. These mice were treated intravenously twice weekly for 4 weeks with a cocktail of in vivo-optimized LNAs targeting miR-1908, miR-199a-3p, and miR-199a-5p at a total dose of 12.5 mg / kg, or with a simulated PBS control. Colony formation in the lungs was evaluated by bioluminescence imaging. Representative H&E-stained lungs removed on day 56 are shown. n=5-6. (K) A model of miRNA-dependent regulation of metastatic invasion, endothelial recruitment, and colony formation in melanoma via targeting ApoE-mediated melanoma cell LRP1 receptor signaling and endothelial cell LRP8 receptor signaling. [Figure 8]miRNA-dependent targeting of ApoE / LRP1 signaling promotes cancer cell invasion and endothelial recruitment via CTGF induction. (A) Heatmap of dispersion-normalized CTGF expression levels in the following cells, as determined by qRT-PCR analysis: (1) MeWo parental cells and MeWo-LM2 cells, (2) MeWo parental cells overexpressing miR-199a, miR-1908 or control hairpins, and (3) MeWo parental cells transduced by short hairpins targeting ApoE or control sequences. Color maps show the change in standard deviation from the mean. (B) CTGF levels in conditioned medium from MeWo parental cells with ApoE knockdown, as determined by ELISA. n=6; p-values ​​are based on a one-sided Student's t-test. (C) CTGF levels quantified by ELISA in conditioned medium from highly metastatic MeWo-LM2 cells treated with recombinant ApoE in LRP1 knockdown or control knockdown situations. n=3-4; p-values ​​are based on a one-sided Student's t-test. (D-E) Parental MeWo cells with shRNA-induced ApoE knockdown were (1) transfected with unrelated siRNA targeting CTGF or a control sequence, or (2) incubated in the presence of CTGF neutralizing antibody (20 μg / mL) or IgG control antibody (20 μg / mL), and the cells were subjected to cell invasion assay (D) and endothelial recruitment assay (E). n=6-8; p-values ​​are based on a one-sided Student's t-test. Scale bars represent 100 μM. All data are expressed as mean ± SEM. [Figure 9]CTGF mediates miRNA-dependent metastatic invasion, endothelial recruitment, and colony formation. (A) 1 × 10⁵ pediatric MeWo cells expressing control hairpins or overexpressing miR-199a or miR-1908 were subjected to a Transwell cell invasion assay in the presence of a CTGF-targeting inhibitory antibody (20 μg / mL) or a control IgG antibody (20 μg / mL), as shown in the figure. n=4~10; p-values ​​are based on a one-sided Student's t-test. All data are expressed as mean ± SEM. (B) Endothelial recruitment by pediatric MeWo cells expressing control hairpins or overexpressing miR-199a or miR-1908. At the start of the assay, endothelial cells were infused with either a CTGF-targeting neutralizing antibody (20 μg / mL) or a control IgG antibody (20 μg / mL), and 1 × 10⁵ endothelial cells were migrated towards 5 × 10⁴ cancer cells in a transwell migration assay. n=3–8; p-values ​​were based on a one-sided Student's t-test. (C) Bioluminescence imaging of lung metastases by 5 × 10⁴ parental MeWo cells knocked down for CTGF in the context of miR-199a or miR-1908 overexpression. n=5–6; p-values ​​were determined using a one-sided Mann-Whitney t-test. All data are expressed as mean ± SEM. [Figure 10]Treatment with the LXR agonist GW3965 increases ApoE levels in melanoma cells and suppresses cancer cell invasion, endothelial recruitment, and metastatic colony formation. (A-B) Parental MeWo cells were incubated in the presence of DMSO or GW3965 at the indicated concentrations. After 48 hours, total RNA was extracted and ApoE levels (A) and DNAJA4 levels (B) were determined by qRT-PCR. n=3. (C) Cell invasion by 1 × 10⁵ parental MeWo cells pretreated with GW3965 or DMSO for 48 hours. n=6-7; p-values ​​are based on one-sided Student's t-test. All data are expressed as mean ± SEM. (D) Endothelial recruitment by 5 × 10⁴ parental MeWo cells pretreated with GW3965 or DMSO for 48 hours. n=6-7; p-values ​​are based on one-sided Student's t-test. (E) Mice were fed a grain-based solid diet containing GW3965 (20 mg / kg) or a control diet. After 10 days, 4 × 10⁴ parental MeWo cells were injected into the tail vein of the mice, and these mice were continuously fed either the GW3965-containing solid diet or the control diet throughout the experimental period. Colony formation in the lungs was evaluated by bioluminescence imaging. n=5~6; p-values ​​were obtained using a one-sided Mann-Whitney t-test. All data are expressed as mean ± SEM. [Figure 11] Identification of miR-7 as an endogenous inhibitor of melanoma metastasis. (A) Bioluminescence imaging plots of metastatic colony formation in the lungs after intravenous infusion of 4 × 10⁴ parental MeWo cells (miR-7 KD) expressing a short hairpin (miR-Zip) that inhibits miR-7. Lungs were removed 63 days post-infusion and stained with H&E. n=5. (B) Lung metastases by 4 × 10⁴ LM2 cells overexpressing a precursor or control hairpin for miR-7. Colony formation in the lungs was monitored weekly by bioluminescence imaging, and lungs were removed 77 days post-infusion. n=5. All data are expressed as mean ± SEM; p-values ​​were determined using a one-sided Mann-Whitney t-test. *p<0.05, **p<0.01. [Figure 12]In vivo selection of highly metastatic human melanoma cell line derivatives, and identification of miR-199a-3p, miR-199a-5p, and miR-1908 as metastasis-promoting miRNAs. (A~B) Bioluminescence imaging of lung metastases of MeWo-LM2 metastatic derivatives (A) and A375-LM3 metastatic derivatives (B), and representative H&E-stained lungs corresponding to their respective parent cell lines. 4 × 10⁴ MeWo-Par / MeWo-LM2 cells and 1 × 10⁵ A375-Par / A375-LM3 cells were intravenously injected into NOD-SCID mice, and the lungs were removed on days 72 and 49, respectively, and stained with H&E. n=4~5. (C) Expression levels of miR-199a-5p, miR-199a-3p, miR-1908, and miR-214 were determined by qRT-PCR in A375-LM3 metastatic derivatives and their parental cells. n=3. (D) Parental MeWo cells were transduced with retroviruses expressing either a control hairpin or a pre-miRNA hairpin construct that produces miR-199a (both miR-199a-3p and miR-199a-5p), miR-1908, or miR-214. Expression levels of target miRNAs were determined by qRT-PCR. n=3. (E) H&E-stained lung sections from Figure 1C were analyzed for the number of metastatic nodules arising from parental MeWo cells overexpressing miR-199a, miR-1908, or the control hairpin. n=3. (F) The number of metastatic nodules formed by LM2 cells in which the expression of miR-199a-3p, miR-199a-5p, miR-1908, or control sequence was silenced was analyzed in H&E-stained lung sections from Figure 1D. n=3. All data are expressed as mean ± SEM. [Figure 13]miR-199a and miR-1908 inhibit proliferation in vitro and selectively promote cell invasion and endothelial recruitment. (A) 2.5 × 10⁴ MeWo cells overexpressing miR-199a, miR-1908, or control hairpins were seeded in triplicates, and viable cells were counted after 5 days. n=3. (B) 1 × 10⁵ low-metastatic parental MeWo cells and highly metastatic LM2 cells were compared for their Matrigel penetration ability in a transwell assay. n=3-4. (C) 1 × 10⁵ endothelial cells were seeded in a 6-well plate to form a monolayer. 2 × 10⁵ parental MeWo cells overexpressing miR-199a, miR-1908, or control hairpins were seeded on top of the endothelial monolayer and incubated for 30 minutes. Each monolayer was then imaged, and the number of cancer cells adhering to endothelial cells was quantified. n=3. (D) 1 × 10⁶ pedestrian MeWo cells overexpressing miR-199a, miR-1908, or control hairpin were seeded in a low-adhesion plate containing cell medium supplemented with 0.2% methylcellulose. After 48 hours in suspension, the number of dead and live cells was quantified. n=3. (E) 5 × 10⁵ pedestrian MeWo cells overexpressing miR-199a, miR-1908, or control hairpin were seeded in a 6-well plate and incubated in low-serum medium for 48 hours, after which the number of live cells was quantified. n=4. (F) Colony formation by pedestrian MeWo cells overexpressing miR-199a, miR-1908, or control hairpin. 50 cells were seeded in a 6 cm plate, and the number of formed colonies was quantified after 2 weeks. n=4. (G) 5 × 10⁴ parental MeWo cells and LM2 cells were seeded at the bottom of the wells, and their endothelial cell recruitment ability was evaluated. n=6~8. (H) Percentage vascular density shown as a cumulative percentage plot for metastatic nodules formed by parental MeWo cells overexpressing miR-199a, miR-1908, or control hairpin. Lung sections from Figure 1C were double-stained immunohistochemically for human vimentin and MECA-32, and the MECA-32 positive area relative to the total nodule area given by human vimentin staining was quantified using ImageJ.n=43 nodules (control); n=117 nodules (miR-199a OE); n=55 nodules (miR-1908 OE). All data are expressed as mean ± SEM. Scale bar, 100 μm. [Figure 14]miR-199a and miR-1908 convergently and cooperatively target ApoE and DNAJA4. (A) A Venn diagram showing an integrated experimental approach that leads to the identification of presumed target genes common to miR-199a-3p, miR-199a-5p, and miR-1908. Transcriptome profiling of genes downregulated by more than 1.5-fold when each miRNA is overexpressed was superimposed on genes upregulated by more than 1.5-fold when each miRNA is silenced, and also on genes downregulated by more than 1.5-fold in metastatic LM2 cells relative to their parental cell lines. (B~D) Expression levels of ApoE and DNAJA4 as measured by qRT-PCR in pediatric MeWo cells overexpressing miR-199a, miR-1908, or a control hairpin (B), pediatric MeWo cells and their highly metastatic LM2-derived cell lines (C), and MeWo-LM2 cells with miR-Zip mediated silencing of miR-199a-3p, miR-199a-5p, miR-1908, or a control sequence (D). n=3. (E) A heterologous luciferase reporter assay to measure the stability of ApoE 3'UTR / CDS luciferase fusions and DNAJA4 3'UTR / CDS luciferase fusions of target site mutants of miR-199a-3p, miR-199a-5p, or miR-1908 in highly metastatic LM2 cells with inhibition of miR-199a-3p, miR-199a-5p, miR-1908, or the control sequence. n=3~4. (F) MeWo-LM2 cells were transduced with a retrovirus expressing a control vector, or a retrovirus expressing an overexpression vector that produces ApoE or DNAJA4. The expression levels of the target genes were determined by qRT-PCR. (G) Expression levels of ApoE and DNAJA4 determined by qRT-PCR in parental MeWo cells transduced with lentiviral shRNA targeting ApoE, DNAJA4, or the control sequence. All data is expressed as mean ± SEM. [Figure 15]Epitasis interactions between miR-199a / miR-1908 and ApoE / DNAJA4 (A-D). MeWo-LM2 cells were transduced with lentiviral shRNA targeting ApoE (A, C), lentiviral shRNA targeting DNAJA4 (B, D), or control shRNA under conditions of miR-Zip induced silencing of miR-1908 (A, B), miR-Zip induced silencing of miR-199a-5p (C, D), or miR-Zip induced silencing of the control sequence. Target gene levels were analyzed by qRT-PCR. (E) Bioluminescence imaging of lung metastases by 1 × 10⁵ LM2 cells expressing a control hairpin or shRNA (unrelated to the shRNA used in Figure 4E) that targets ApoE, DNAJA4, or the control sequence under miR-1908 inhibition. Representative bioluminescence images and H&E-stained lungs correspond to day 42 post-infusion. n=5. (F~G) Expression levels of ApoE and DNAJA4 were analyzed by qRT-PCR in pediatric MeWo cells transduced by retroviruses expressing a control vector or an overexpression vector for ApoE or DNAJA4 in a miR-1908 overexpression (F) or miR-199a overexpression (G). (H~I) Pediatric MeWo cells overexpressing ApoE or DNAJA4 in a miR-199a overexpression setting, or expressing a control vector, were examined for invasive phenotype (H) and endothelial recruitment phenotype (I). n=7~8. (J) Bioluminescence imaging of lung metastases from 4 × 10⁴ pediatric MeWo cells overexpressing ApoE or DNAJA4 in a miR-1908 overexpression setting, or expressing a control vector. Representative bioluminescence images and H&E-stained lungs correspond to 56 days post-infusion. n=4-8. (K) ApoE and DNAJA4 expression levels determined by qRT-PCR in highly transmissible A375-LM3 derivatives transduced by lentiviruses expressing ApoE and DNAJA4 or shRNA constructs targeting the control sequence. All data are expressed as mean ± SEM. Scale bar, 100 μm. [Figure 16] Extracellular ApoE inhibits the phenotype of melanoma invasion and endothelial recruitment, independently of any effect on the proliferation and survival of cancer cells or endothelial cells. (A) Extracellular ApoE levels were measured by ELISA in conditioned medium from MeWo cells overexpressing miR-199a, miR-1908, or control hairpin. n=3. (B-C) 3 × 10⁴ MeWo-LM2 cells (B) or endothelial cells (C) were cultured in the presence of BSA (100 μM) or APOE (100 μM), and cell proliferation was monitored over time by counting the number of viable cells at each indicated time point. n=3. (D-E) Survival of MeWo-LM2 cells (D) or endothelial cells (E) under serum starvation conditions in the presence of BSA (100 μM) or APOE (100 μM). n=3. (F~G) ApoE mRNA expression levels were evaluated in parental MeWo cells (F) transduced by lentivirus expressing a control hairpin or a short hairpin construct targeting DNAJA4, and in LM2 cells (G) transduced by retrovirus expressing a control vector or an overexpression vector for DNAJA4. n=3. (H~I) LM2 cells transduced by retrovirus expressing a control vector or an overexpression vector for DNAJA4 were evaluated for their Matrigel penetration ability (H; n=6~8) and endothelial cell recruitment ability (I; n=4) in a transwell assay in the presence of IgG antibody (40 μg / mL) or 1D7 antibody (40 μg / mL) (ApoE neutralizing antibody). All data are expressed as mean ± SEM. [Figure 17]ApoE inhibits cell invasion and endothelial recruitment by targeting the LRP1 receptor on melanoma cells and the LRP8 receptor on endothelial cells. (A) 1 × 10⁵ LM2 cells transduced with siRNA against LRP1 or a control sequence were analyzed for their ability to penetrate Matrigel. n=9-12. (B) 1 × 10⁵ MeWo-LM2 cells inhibited against miR-199a-5p or a control sequence were transfected with LRP1-targeted siRNA or control siRNA, and their ability to penetrate Matrigel was examined. n=4. (C) Representative H&E-stained lungs (see Figure 6C) taken at day 56 from NOD-SCID mice injected with MeWo-LM2 miR-1908 KD cells transduced with control siRNA or LRP1-targeted siRNA. (D~E) 1 × 10⁵ endothelial cells were transfected with LRP8-targeted siRNA or a control sequence and transwell-migrated to 5 × 10⁴ MeWo-LM2 cells expressing a short control hairpin (D; n=8), or to 5 × 10⁴ MeWo-LM2 cells inhibited for miR-199a-5p or the control sequence (E; n=4). All data are expressed as mean ± SEM. Scale bar, 100 μm. [Figure 18]LNA-type inhibition of miR-199a and miR-1908 suppresses melanoma metastasis. (A) In vitro cell proliferation of 2.5 × 10⁴ MeWo-LM2 cells transfected with control LNA or a cocktail of LNAs targeting miR-199a-3p, miR199a-5p, and miR-1908. The number of viable cells was quantified after 5 days. n=3. (B) Colony formation in the lungs of highly metastatic A375-LM3 derivatives transfected with control LNA or a cocktail of LNAs targeting miR-199a-3p, miR199a-5p, and miR-1908. 5 × 10⁵ cells were intravenously injected into NOD-SCID mice 48 hours after transfection, and lung colony formation was determined by measuring bioluminescence after 35 days. n=5-6. (C) The weight of mice treated with a cocktail of LNAs targeting these three miRNAs, or with a simulated PBS control treatment (Figure 7J), was monitored twice a week. n=5-6. All data are expressed as mean ± SEM. [Figure 19]Activation of LXRβ signaling suppresses melanoma cell invasion and endothelial recruitment. (A) Heatmap showing microarray-based expression levels of LXR and RXR isotypes in the NCI-60 melanoma cell line collection. Heatmaps for these genes are extracted from a larger heatmap of the nuclear hormone receptor family (Figure 20). The color map legend shows the change in the standard deviation of the expression level of each receptor relative to the mean expression level of all microarray-profiled genes (over 39,000 transcription variants) in each cell line. (B) Cell invasion by 1 × 10⁵ MeWo human melanoma cells, 5 × 10⁴ HT-144 human melanoma cells, 5 × 10⁵ SK-Mel-2 human melanoma cells, and 5 × 10⁴ SK-Mel-334.2 human melanoma cells. Cells were treated with 1 μM DMSO, GW3965, T0901317, or bexarotene for 72 hours and subjected to a Matrigel infiltration assay in Transwell. n=48. (C) 5 × 10⁴ MeWo human melanoma cells, HT-144 human melanoma cells, SK-Mel-2 human melanoma cells, and SK-Mel-334.2 human melanoma cells were treated with 1 μM DMSO, GW3965, T0901317, or bexarotene for 72 hours and then tested for their ability to recruit 1 × 10⁵ endothelial cells in a Transwell migration assay. n=4-8. (D~E) 1 × 10⁵ MeWo human melanoma cells (D) and 1 × 10⁵ HT-144 human melanoma cells (E) expressing control shRNA or shRNA targeting LXRα or LXRβ were treated with 1 μM DMSO, GW3965, or T0901317 for 72 hours and then subjected to a cell invasion assay. n=4~12.(F~G) 5 × 10⁴ MeWo cells (F) and 5 × 10⁴ HT-144 cells (G), transduced with lentiviral shRNA targeting LXRα or LXRβ, or with control shRNA, were treated with 1 μM DMSO, GW3965, or T0901317 for 72 hours and tested for their ability to recruit 1 × 10⁵ endothelial cells by transwell migration assay. n=7~8. All data are expressed as mean ± SEM. Scale bar, 50 μm. *p<0.05; **p<0.01; ***p<0.001, ****p<0.0001. [Figure 20]Analysis of nuclear hormone receptor expression in melanoma and the effects of LXR and RXR agonists on in vitro cell growth (these are related to Figure 19(A-G)). (A) Heatmap showing microarray-based expression levels of all nuclear hormone receptor family members across a diverse NCI-60 collection of melanoma strains. The expression level of each receptor is shown as a number of standard deviations below or above the mean expression level of all genes (over 39,000 transcriptional variants) detected by the microarray in each cell line. (B) 2.5 × 10⁴ MeWo human melanoma cells, HT-144 human melanoma cells, or SK-Mel-334.2 human melanoma cells were seeded in 6-well plates and cultured in the presence of 1 μM DMSO, GW3965, T0901317, or bexarotene. Live cells were counted 5 days after seeding. n=3-6. (C) 2.5 × 10⁴ MeWo cells, HT-144 cells, or SK-Mel-334.2 cells were placed in triplicates and incubated for 5 days in a medium containing 1 μM DMSO, GW3965, T0901317, or bexarotene. The number of dead cells was then quantified using trypan blue dead cell staining. n=3. (D~G) Relative expression of LXRα and LXRβ as determined by qRT-PCR in MeWo human melanoma cells (D, E) and HT-144 human melanoma cells (F, G) expressing control shRNA or shRNA targeting LXRα or LXRβ. All data are expressed as mean ± SEM. [Figure 21]Therapeutic LXR activation inhibits melanoma tumor growth. (A-B) Primary tumor growth by 5 × 10⁴ B16F10 mouse melanoma cells subcutaneously injected into C57BL / 6-WT mice. After tumor growth reached 5 mm³–10 mm³ in volume, mice were successively fed control solid feed, solid feed supplemented with GW3965 (20 mg / kg / day or 100 mg / kg / day) (A), or solid feed supplemented with T0901317 (20 mg / kg / day) (B). Representative tumor images shown correspond to tumors removed on the final day (d12). n=10–18 (A), 8–10 (B). (C~E) Primary tumor growth by subcutaneous injection of 1 × 10⁶ MeWo human melanoma cells (C), 7.5 × 10⁵ SK-Mel-334.2 human melanoma cells (D), and 2 × 10⁶ SK-Mel-2 human melanoma cells (E) into immunosuppressed mice. After tumor growth reached 5 mm³–10 mm³ in volume, mice were randomly assigned to either a control diet or a diet supplemented with GW3965 (20 mg / kg or 100 mg / kg as shown). The tumor images shown correspond to the last day of measurement. n=6–34(C), 8(D), 5(E). (F) 5 × 10⁴ B16F10 cells were subcutaneously injected into C57BL / 6-WT mice. When tumor growth reached 150 mm³, mice were continuously fed either a control solid diet or a solid diet containing GW3965 (150 mg / kg), and tumor growth was measured daily. n=6~13. (G~I) Overall survival of mice after subcutaneous transplantation of 5 × 10⁴ B16F10 cells (G), 1 × 10⁶ MeWo cells (H), and 7.5 × 10⁵ SK-Mel-334.2 cells (I) into mice that had formed tumors of 5 mm³ to 10 mm³ in volume, fed either a normal solid diet or a solid diet supplemented with GW3965 (100 mg / kg). n=6~9 (F), 4~7 (H), 3~6 (I).(J~L) Tumor endothelial cell density (J) determined by immunohistochemical staining for mouse endothelial cell antigen MECA-32, tumor cell proliferation (K) determined by staining for the proliferation marker Ki-67, and tumor cell apoptosis (L) determined by staining for cleavage caspase-3 in subcutaneous melanoma tumors formed by 1 × 10⁶ MeWo human melanoma cells in response to 35 days of mouse treatment with control diet or GW3965 supplement diet (20 mg / kg). n=5. Tumor volume was calculated as (minimum diameter) 2 × (maximum diameter) / 2. All data are expressed as mean ± SEM. Scale bars: 5 mm (A~D), 50 μm (J, K), 25 μm (L). [Figure 22] LXRβ agonism suppresses melanoma tumor growth (this is related to Figure 21 (A-E)). (A) Weight measurements of mice fed control diet, or diet supplemented with GW3965 (20 mg / kg / day or 100 mg / kg / day) or T0901317 (20 mg / kg) for 65 days. n=5-6. [Figure 23]LXR agonism suppresses melanoma metastasis to the lungs and brain. (A) MeWo cells were pretreated with DMSO or GW3965 (1 μM) for 48 hours, and 4 × 10⁴ cells were intravenously injected into NOD Scid mice via the tail vein. Colony formation in the lungs was monitored weekly by bioluminescence imaging. Representative H&E-stained lungs corresponding to the final day (d70) are shown. n=4-5. (B-C) Bioluminescence imaging of lung metastases by 4 × 10⁴ MeWo cells intravenously injected into NOD Scid mice that were given either a control solid diet or a solid diet containing GW3965 (20 mg / kg) or T0901317 (20 mg / kg) starting 10 days before cancer cell injection. Representative H&E-stained lungs correspond to the final day of imaging. n=5-6. (B-C) Bioluminescence imaging of lung metastases by 4 × 10⁴ MeWo cells intravenously injected into NOD Scid mice that were fed either a control solid diet or a solid diet containing GW3965 (20 mg / kg) or T0901317 (20 mg / kg) starting 10 days before cancer cell injection. Representative H&E-stained lungs correspond to the last day of imaging. n=5-6. (F) Whole-body and brain photon flux after intracardiac injection of 1 × 10⁵ MeWo brain metastatic derivative cells into athymic nude mice that were fed either a control diet or a GW3965 supplement diet (100 mg / kg) starting day 0 after injection. n=7. (G) Schematic of an experimental orthotopic metastasis model used to evaluate whether GW3965 treatment can suppress lung metastases after tumor resection. (H) Ex vivo lung photon flux determined by bioluminescence imaging in NOD Scid mice that were fed either a control diet or a diet containing GW3965 (100 mg / kg) for one month after excision of a subcutaneous melanoma tumor of size match (approximately 300 mm³ in volume) formed by 1 × 10⁶ MeWo melanoma cells. Representative lungs stained for human vimentin are also shown. n=7~9. (I) 4 × 10⁴ MeWo cells were intravenously injected into NOD Scid mice.After metastasis began (which was detected by bioluminescence imaging on d42), mice were fed either a control diet or a GW3965 diet (100 mg / kg) as shown, and the progression of colony formation in the lungs was measured weekly. n=6. (J) Number of macroscopic metastatic nodules in the H&E-stained lungs removed on the final day (d77) from NOD-Scid mice fed either a control diet or a diet supplemented with GW3965 (100 mg / kg) as shown in (I). n=4-5. (K) Overall mouse survival after intravenous infusion of 4 × 10⁴ MeWo cells into NOD-Scid mice that were continuously fed either a control solid diet or a GW3965-supplemented solid diet (20 mg / kg) starting 10 days prior to cancer cell infusion. n=5-6. All data are expressed as mean ± SEM. [Figure 24]Suppression of genetically driven melanoma progression by LXR activation therapy. (A) Overall survival of Tyr::CreER;BrafV600E / +;Ptenlox / +C57BL / 6 mice after systemic melanoma induction by intraperitoneal administration of 4-HT (25 mg / kg) for 3 consecutive days. After the first 4-HT injection, mice were randomly assigned to either a control diet or a diet supplemented with GW3965 (100 mg / kg). n=10-11. (B) Melanoma tumor loading, expressed as a percentage of dorsal skin area measured on day 35 in Tyr::CreER;BrafV600E / +;Ptenlox / lox mice given either a control solid diet or a solid diet supplemented with GW3965 (100 mg / kg) during melanoma induction as described in (A). n=4-5. (C) Number of macroscopic metastatic nodules to salivary lymph nodes detected postmortem in Tyr::CreER;BrafV600E / +;Ptenlox / lox mice given control solid feed or solid feed containing GW3965 (100 mg / kg) after overall induction of melanoma progression as described in (A). n=7~8. (D) Tumor growth after subcutaneous injection of 1 × 10⁵ BrafV600E / +;Pten- / -;CDKN2A- / - primary melanoma cells into syngeneic C57BL / 6-WT mice. When tumor growth reached 5 mm³ to 10 mm³ in volume, mice were given control solid feed or solid feed supplemented with GW3965 (100 mg / kg). n=16~18. (E) Overall survival of C57BL / 6-WT mice that were subcutaneously injected with 1 × 10⁵ BrafV600E / +;Pten- / -;CDKN2A- / - melanoma cells and treated with GW3965 diet (100 mg / kg) or control diet after tumor growth reached 5 mm³ to 10 mm³ in volume. n=7-8. (F) Colony formation in the lungs of C57BL / 6-WT mice by intravenous injection of 1 × 10⁵ BrafV600E / +;Pten- / -;CDKN2A- / - primary melanoma cells. Immediately after cancer cell injection, mice were randomly assigned to either control diet or GW3965 supplement diet (100 mg / kg) for the remainder of the experiment. n=14-15.All data are expressed as mean ± SEM. Scale bars: 2mm (B), 5mm (D). [Figure 25] LXR-mediated suppression of melanoma progression in a genetically driven melanoma mouse model (this is related to Figure 24 (A-C)). (A) Overall survival of Tyr::CreER;BrafV600E / +;Ptenlox / loxC57BL / 6 mice after systemic melanoma induction by intraperitoneal administration of 4-HT (25 mg / kg) for 3 consecutive days. After the first 4-HT injection, mice were randomly assigned to either a control diet or a diet supplemented with GW3965 (100 mg / kg). n=7. (B) Representative images of Tyr::CreER;BrafV600E / +;Ptenlox / loxC57BL / 6 mice fed either a control diet or a GW3965 supplement (100 mg / kg), taken 43 days after melanoma induction by intraperitoneal 4-HT administration. [Figure 26] A list of the 50 most upregulated genes in MeWo human melanoma cells in response to GW3965 treatment. [Figure 27]LXRβ activation induces ApoE expression in melanoma cells; ApoE mediates LXRβ-dependent suppression of the melanoma progression phenotype in vitro. (A-C) MeWo human melanoma cells (A), HT-144 human melanoma cells (B), and WM-266-4 human melanoma cells (C) were treated with GW3965 or T0901317 at the indicated concentrations for 48 hours, and ApoE expression levels were analyzed by qRT-PCR. n=3. (D) Extracellular ApoE protein levels quantified by ELISA in serum-free conditioned medium collected from HT-144 human melanoma cells treated with 1 μM DMSO, GW3965, or T0901317 for 72 hours. n=3-4. (E~F) 5 × 10⁴ HT-144 cells treated with 1 μM DMSO, GW3965, or T0901317 for 72 hours were tested for cell invasion phenotype (E) and endothelial recruitment phenotype (F) in the presence of ApoE neutralizing antibody (1D7) or IgG control antibody added to each transwell at 40 μg / mL at the start of the assay. n=4. (G~H) Cell invasion (G) and endothelial recruitment (F) induced by 1 × 10⁵ and 5 × 10⁴ MeWo cells expressing control shRNA or ApoE-targeting shRNA and treated with 1 μM DMSO or GW3965 for 72 hours prior to each assay. n=7~8. (I-J) Relative ApoE expression, quantified by qRT-PCR, in MeWo cells (I) and HT-144 cells (J) transduced with control shRNA or shRNA targeting LXRα or LXRβ, followed by treatment with 1 μM DMSO, GW3965, or T0901317 for 48 hours. n=3-9. (K) Extracellular ApoE protein levels, measured by ELISA, in serum-free conditioned medium collected from HT-144 cells transduced with control shRNA or shRNA targeting LXRα or LXRβ, followed by treatment with 1 μM DMSO or GW3965 for 72 hours. n=3. All data are expressed as mean ± SEM. Scale bar, 50 μm. [Figure 28]LXRβ activation suppresses melanoma invasion and endothelial recruitment by transcriptionally enhancing ApoE expression in melanoma cells. (A) Luciferase activity of MeWo cells transfected with 1 μM DMSO, GW3965, or T0901317 for 24 hours, driven by an ApoE promoter fused downstream of a multi-enhancer element 1 (ME.1) sequence or a multi-enhancer element 2 (ME.2) sequence. n=4-8. (B) Extracellular ApoE protein levels quantified by ELISA in serum-free conditioned medium collected from MeWo cells treated with 1 μM DMSO, GW3965, or T0901317 for 72 hours. n=3-4. (C) Cell invasion by 1 × 10⁵ MeWo cells pretreated with 1 μM DMSO, GW3965, or T0901317 for 72 hours. At the start of the assay, ApoE neutralizing antibody (1D7) or IgG control antibody was added to each transwell at 40 μg / mL as shown. n=7-8. (D) 5 × 10⁴ MeWo cells pretreated with 1 μM DMSO, GW3965 or T0901317 for 72 hours were tested for their ability to recruit 1 × 10⁵ endothelial cells in the presence of 40 μg / mL 1D7 antibody or IgG antibody. n=6-8. (E) Extracellular ApoE protein levels quantified by ELISA in serum-free conditioned medium from SK-Mel-334.2 primary human melanoma cells treated with 1 μM DMSO or GW3965 for 72 hours. n=4. (F~G) 5 × 10⁴ SK-Mel-334.2 cells pretreated with 1 μM GW3965 for 72 hours were subjected to cell invasion assays (F) and endothelial recruitment assays (G) in the presence of 40 μg / mL 1D7 antibody or IgG antibody. n=7~8. (H) The activity of the ApoE promoter fused to the ME.1 or ME.2 enhancer element was determined by measuring the luciferase reporter activity in MeWo cells expressing control shRNA or shRNA targeting LXRα or LXRβ in the presence of DMSO or GW3965 (1 μM) for 24 hours. n=3~8.(I) Extracellular ApoE protein levels, quantified by ELISA, were evaluated in serum-free conditioned medium collected from human MeWo melanoma cells expressing control shRNA or shRNA targeting LXRα or LXRβ, in response to 72 hours of treatment with GW3965 or T0901317 (1 μM). n=3-8. All data are expressed as mean ± SEM. Scale bar, 50 μm. [Figure 29]Therapeutic delivery of LXR agonists upregulates melanoma-derived ApoE expression and systemic ApoE expression. (A-B) ApoE expression levels quantified by qRT-PCR in subcutaneous tumors formed by B16F10 mouse melanoma cells injected into C57BL / 6 mice. After 5 mm3 tumors were formed, mice were fed a control diet, or a diet containing GW3965 (20 mg / kg) (A), or a diet containing T0901317 (20 mg / kg) (B) for 7 days. n=3-4. (C-E) ApoE transcript expression in primary tumors (C), lung metastases (D), and brain metastases (E) formed by MeWo human melanoma cells transplanted into NOD Scid mice fed a control solid diet, or a solid diet supplemented with GW3965 (20 mg / kg). ApoE levels were assessed on days 35 (C), 153 (D), and 34 (E) after cancer cell injection. n=3-5. (F) Relative expression levels of LXRα, LXRβ, and ApoE were determined by qRT-PCR in control hairpins or B16F10 mouse melanoma cells expressing mouse LXRα-targeting shRNA (sh_mLXRα), mouse LXRβ-targeting shRNA (sh_mLXRβ), or mouse ApoE-targeting shRNA (sh_mApoE). (G-H) mRNA levels of ApoE (G) and ABCA1 (H) as measured by qRT-PCR in B16F10 cells expressing control shRNA or mouse LXRβ-targeting shRNA or mouse ApoE-targeting shRNA. Cells were treated with 5 μM DMSO or GW3965 for 48 hours. n=3. (I) mRNA levels of ABCA1 as measured by qRT-PCR in whole-body leukocytes isolated from LXRα- / - mice or LXRβ- / - mice fed control diet or GW3965 supplement diet (20 mg / kg) for 10 days. n=3~4(J) The relative expression of ApoE mRNA, expressed as the frequency of SAGE tags, in mouse skin and lung tissue was determined using the publicly available mSAGE Expression Matrix database, which is available from the NCI-funded Cancer Genome Anatomy Project (CGAP). (K) Relative expression of ApoE mRNA, as determined by qRT-PCR, in MeWo melanoma cells (LM2) isolated from lung metastatic nodules or in primary tumors, relative to unselected control MeWo parent cells. n=3. [Figure 30]LXRβ agonism suppresses melanoma tumor growth and metastasis by inducing melanoma-derived ApoE expression and systemic ApoE expression. (A) Western blot measurement of ApoE protein levels in lysates of adipose tissue, lung tissue, and brain tissue isolated from wild-type mice fed a control solid diet or a solid diet supplemented with GW3965 (20 mg / kg) or T0901317 (20 mg / kg) for 10 days. (B) Quantification of ApoE protein expression based on the Western blot shown in (A). Total tubulin was used as an endogenous control for normalization. n=3-5. (C) ApoE expression levels determined by qRT-PCR in systemic leukocytes obtained from mice fed a control diet or a diet supplemented with GW3965 or T0901317 at 20 mg / kg for 10 days. n=3-6. (D) B16F10 control cells, or B16F10 cells expressing shRNA targeting mouse LXRα (sh_mLXRα), or shRNA targeting mouse LXRβ (sh_mLXRβ), were subcutaneously injected into C57BL / 6-WT mice, LXRα- / - mice, or LXRβ- / - mice. When the tumor reached a volume of 5 mm³ to 10 mm³, the mice were fed either a control diet or a diet supplemented with GW3965 (20 mg / kg) for 7 days, after which the final tumor volume was measured. Representative tumor images taken at the endpoint are shown in the right panel. n=6-18. (E) ApoE transcript levels quantified by qRT-PCR in whole-body leukocytes taken from LXRα- / - mice or LXRβ- / - mice fed either a control diet or a GW3965 supplement diet (20 mg / kg) for 10 days. n=3-5. (F) Subcutaneous tumor growth using 5 × 10⁴ B16F10 control cells, or B16F10 cells expressing shRNA (sh_mApoE) that targets mouse ApoE in C57BL / 6-WT mice or ApoE- / - mice. After tumors of 5 mm³ to 10 mm³ in volume were formed, mice were fed either a control diet or a diet supplemented with GW3965 (20 mg / kg) for 7 days, and the final tumor volume was quantified.Representative images of tumors removed on the final day of measurement (d12) are shown on the right. n=8-18. (G) Colony formation in the lungs by 5 × 10⁴ B16F10 cells transduced with control shRNA or sh_mApoE and intravenously injected into C57BL / 6-WT mice or ApoE- / - mice. Mice were assigned to be treated with either a control diet or a GW3965 supplement diet (20 mg / kg), starting 10 days before cancer cell injection. Lung metastases were quantified by bioluminescence imaging on d22. Representative lungs removed at the end point (d22) are shown in the right panel. n=5-10. (H) ApoE protein expression determined by blinded immunohistochemical analysis in non-metastatic (n=39) and metastatic (n=34) primary melanoma skin lesion samples obtained from patients in MSKCC. The percentage of ApoE-positive stained cell area was quantified as a percentage of the total tumor area. (I) Kaplan-Meier curves for the MSKCC cohort (n=71) showing patient metastasis-free survival as a function of ApoE protein expression in the patient's primary melanoma lesion. Melanomas with ApoE levels above the population median were classified as ApoE-positive (pos), while tumors with ApoE expression below this median were classified as ApoE-negative (neg). All data are expressed as mean ± SEM. Scale bars: 5 mm (D and F), 100 μm (H). [Figure 31]LXRβ activation suppresses in vivo growth of melanoma strains resistant to dacarbazine and vemurafenib. (A) In vitro cell growth by 2.5 × 10⁴ B16F10 parent cells and in vitro-derived B16F10 DTIC-resistant cells in response to various doses of dacarbazine (DTIC) added to cell culture for 4 days. n=3. (B~D) Tumor growth by subcutaneous injection of 5 × 10⁴ DTIC-sensitive B16F10 parent cells (B) or 5 × 10⁴ DTIC-resistant B16F10 cells (C) into C57BL / 6-WT mice. After tumor growth reached 5 mm³–10 mm³ in volume, mice were treated with dacarbazine (50 mg / kg, ip, daily) or a control vehicle and randomly assigned to either a normal solid diet or a solid diet supplemented with GW3965 (100 mg / kg). The results of tumor volume measurements on the final day are shown in (D). n=8-16 (B), 7-8 (C). (E-F) Tumor growth by DTIC-sensitive MeWo parental cells and in vivo-derived DTIC-resistant MeWo human melanoma cells in response to DTIC treatment or GW3965 treatment. 5 × 10⁵ cells were subcutaneously injected into NOD Scid gamma mice. After tumors of 5 mm³–10 mm³ in volume were formed, the mice were blinded and assigned to control treatment, DTIC treatment (50 mg / kg, ip, administered daily in a 5-day cycle with a 2-day rest period), or GW3965 supplemental diet treatment (100 mg / kg). The results of tumor measurements on the final day are shown in (F). n=6-8. (G) Tumor growth by subcutaneous injection of 2 × 10⁶ SK-Mel-239 vemurafenib-resistant clonal cells into NOD Scid gamma mice that were assigned to either a control diet or a diet supplemented with GW3965 (100 mg / kg) after the tumor had grown to a volume of 5 mm³ to 10 mm³. n=7-8. (H) Overall mouse survival after transplantation of 2 × 10⁶ SK-Mel-239 vemurafenib-resistant cells. When the tumor grew to a volume of 5 mm³ to 10 mm³, the mice were successively fed either a control diet or a diet supplemented with GW3965 (100 mg / kg). n=7.(I) An experimentally derived model demonstrating the involvement of systemic and melanoma-autonomous ApoE in mediating the suppression of the melanoma progression phenotype by LXRβ activation therapy. Extracellular ApoE suppresses melanoma metastasis by synergistically inhibiting melanoma cell invasion and non-cellular endothelial recruitment, respectively, through targeting the LRP1 receptor on melanoma cells and the LRP8 receptor on endothelial cells. All data are expressed as mean ± SEM. Scale bar, 5 mm. [Figure 32] Suppression of dacarbazine induction of tumor growth by human melanoma cells. (A) Tumor growth induced by 5 × 10⁵ DTIC-sensitive MeWo parent cells subcutaneously injected into Nod SCID gamma mice. When the tumor reached a volume of 5 mm³–10 mm³, the mice were treated with a control vehicle or DTIC (50 mg / kg, ip, administered daily in a 5-day cycle with a 2-day rest period), and tumor volume was measured twice a week. n=6. [Figure 33] ApoE-mediated suppression of cell invasion across multiple cancer types. (A-B) 5 × 10⁴ MUM2B and OCM1 human uveal melanoma cells, (C-E) 5 × 10⁴ MDA-231, MDA-468, and BT549 human triple-negative breast cancer cells, (F-G) 5 × 10⁴ PANC1 and BXPC-3 human pancreatic cancer cells, and (H-I) 5 × 10⁴ 786-00 and RCC4 human renal cancer cells were tested in vitro for their ability to invade through Matrigel-coated Transwell inserts. BSA and recombinant ApoE were added to cell culture at 100 μg / mL at the start of the assay. n=4. All data are expressed as mean ± SEM; *p<0.05, **p<0.01, ***p<0.001. [Figure 34]Effects of LXR agonists (LXR-623, WO-2007-002563 (Ex.19), WO-2010-0138598 (Ex.9), and SB742881) on ApoE expression in human melanoma cells. (A-D) MeWo human melanoma cells were treated with DMSO or the LXR agonist LXR-623 (A), WO-2007-002563 (B), WO-2010-0138598 (C), or SB742881 (D) at 500 nM, 1 μM, or 2 μM for 48 hours. Subsequently, ApoE expression levels were quantified by qRT-PCR. n=3. All data are expressed as mean ± SEM. *p<0.05, **p<0.01. [Figure 35] Treatment with the LXR agonist GW3965 inhibits in vitro tumor cell invasion of kidney, pancreatic, and lung cancer. (A-C) Matrigel invasion in transwells by 5 × 10⁴ RCC human kidney cancer cells (A), 5 × 10⁴ PANC1 human pancreatic cancer cells (B), and 5 × 10⁴ H460 human lung cancer cells (C) treated with DMSO or GW3965 at 1 μM over 72 hours prior to assay. n=4. All data are expressed as mean ± SEM. *p<0.05, **p<0.01. [Figure 36] Treatment with the LXR agonist GW3965 inhibits breast cancer tumor growth in vivo. Primary tumor growth by 2 × 10⁶ MDA-468 human breast cancer cells injected into the mammary fat pads of NOD Scid gamma mice. Two days prior to cancer cell injection, mice were assigned to either a control diet or a diet supplemented with GW3965 (75 mg / kg) and maintained on the corresponding diet throughout the experimental period. n=8. All data are expressed as mean ± SEM. ***p<0.001. [Figure 37]Effects of LXR agonists (LXR-623, WO-2007-002563 (Ex.19), WO-2010-0138598 (Ex.9), and SB742881) on the melanoma progression phenotype in vitro. (A) Cell infiltration by 1 × 10⁵ MeWo human melanoma cells pretreated with DMSO, LXR-623, WO-2007-002563 (Ex.19), WO-2010-0138598 (Ex.9), or SB742881 at 1 μM for 72 hours. The number of cells infiltrating the basal side of a Matrigel-coated transwell insert was quantified. n=5. (B) Endothelial recruitment by 5 × 10⁴ MeWo cells pretreated with DMSO, LXR-623, WO-2007-002563 (Ex. 19), WO-2010-0138598 (Ex. 9), or SB742881 at 1 μM for 72 hours. Cancer cells were seeded at the bottom of a 24-well plate. Endothelial cells were seeded into transwell inserts attached to each well and allowed to migrate toward the cancer cells. The number of endothelial cells migrating toward the base of each transwell insert was quantified. n = 4 ~ 5. All data are expressed as mean ± SEM. *p < 0.05, **p < 0.01. [Figure 38] Effects of LXR agonists (LXR-623, WO-2007-002563 (Ex.19), WO-2010-0138598 (Ex.9), and SB742881) on in vivo tumor growth. (A-D) Tumor growth induced by subcutaneous injection of 5 × 10⁴ B16F10 mouse melanoma cells into 7-week-old C57BL / 6 mice. After the tumors reached a volume of 5 mm³–10 mm³, mice were randomly assigned to one of the following diets: control diet, LXR-623 supplementation diet at 20 mg / kg / day (A), WO-2007-002563 (Ex.19) supplementation diet at 100 mg / kg / day (B), WO-2010-0138598 (Ex.19) supplementation diet at 10 mg / kg / day or 100 mg / kg / day (C), or SB742881 supplementation diet at 100 mg / kg / day (D). n=8–10. All data are expressed as mean ± SEM. Detailed description of the invention

[0053] The present invention features methods for preventing or mitigating abnormal cell proliferation, differentiation, or survival. For example, the compounds of the present invention may be useful in reducing the risk of tumors growing in size or becoming metastatic, or in preventing tumors from growing in size or becoming metastatic. The subject compounds of the present invention may be administered to halt the progression or development of cancer. In addition, the present invention may use the subject compounds of the present invention to reduce the risk of cancer recurrence. This includes using it for the purpose of treating cancer or preventing its recurrence.

[0054] Metastatic progression requires the consistent expression of a diverse range of effector proteins involved in a common cellular phenotype (Gupta and Massague, 2006, Cell, 127, 679-695; Hanahan and Weinberg, 2011, Cell, 144, 646-674; Talmadge and Fidler, 2010, Cancer Res., 70, 5649-5669; Hynes, 2003, Cell, 113, 821-823). Such coordinated expression states are evident in the gene expression profiles of metastatic primary breast cancer (Wang et al., 2005, Lancet, 365, 671-679), and similarly in the profiles of various human cancer cell clones exhibiting enhanced metastatic activity (Kang et al., 2003, Cancer Cell, 3, 537-549; Minn et al., 2005, Nature, 436, 518-524). In recent years, post-transcriptional regulation has emerged as a broad and robust mode of control over coordinated expression states and phenotypic levels. The most studied class of post-transcriptional regulators with metastasis-regulating activity are small non-coding RNAs (miRNAs) (Bartel, 2009, Cell, 136, 215-233; Fabian et al., 2010, Annu. Rev. Biochem., 79, 351-379; Filipowicz et al., 2008, Nat. Rev. Genet., 9, 102-114). Metastasis-promoting miRNAs (Ma et al., 2007, Nature, 449, 682-688; Huang et al., 2008, Nat. Cell Biol., 10, 202-210) and metastasis-suppressing miRNAs (Tavazoie et al., 2008, Nature, 451, 147-152) were first discovered in breast cancer. Subsequent studies have identified even more miRNAs that play regulatory roles in tumorigenesis and metastasis of other cancer types (Hatziapostolou et al., 2011, Cell, 147, 1233-1247; Hurst et al., 2009, Cancer Res., 69, 7495-7498; Olson et al., 2009, Genes Dev., 23, 2152-2165; Zhang et al., 2010, Oncogene, 29, 937-948).In many cases, the expression levels of these miRNAs in human cancer samples support their experimental role in metastasis. Therefore, dysregulated miRNA expression (Garzon et al., 2010, Nat. Rev. Drug Discov., 9, 775-789; Lujambio and Lowe, 2012, Nature, 482, 347-355), and more recently, dysregulated expression of long non-coding RNAs (Calin et al., 2007, Nat. Rev. Cancer, 6, 857-866; Gupta et al., 2010, Nature, 464, 1071-1076; Guttman et al., 2009, Nature, 45) are relevant. 8, 223-227; Huarte et al., 2010, Cell, 142, 409-419; Loewer et al., 2010, Nat. Genet., 42, 1113-1117), and similarly, the deregulated expression of non-coding pseudogenes competing for binding to endogenous miRNAs (Poliseno et al., 2010, Nature, 465, 1033-1038) appears to be a widespread feature of human cancer. Various clues regarding the robust regulation of metastatic progression by specific miRNAs have been provided by early studies showing that coordinated targeting of numerous metastatic genes by a single metastasis repressor miRNA was involved in a dramatic metastasis repression effect (Tavazoie et al., 2008, Nature, 451, 147-152). Such diverse gene targeting by various miRNAs is becoming clear as a characteristic feature of these regulators.

[0055] At a conceptual level, the need for diverse regulation of gene expression in cancer is easily understood. miRNAs may exert robust metastasis suppression due to their ability to target numerous genes required for metastasis. Silencing of miRNAs via genetic or epigenetic mechanisms would likely facilitate cancer progression by desuppressing numerous metastasis-promoting factors (Png et al., 2011, Nature). 481, 190-194). The role of multiple metastasis-regulating miRNAs in the convergent regulation of a single gene is more strongly suggested. This scenario would arise if there were a key gene that acted as a robust suppressor of metastatic progression. Convergent and cooperative targeting of this gene by multiple miRNAs may achieve maximum silencing of such a key metastasis suppressor gene. This scenario may occur when the complete loss of the target gene may not be tolerable by the cell, as opposed to genetic deletion, and this gene would likely be required at a low level, for example, to mediate metabolic processes. Given this possibility, the search for cooperative metastasis-promoting miRNAs may lead to the discovery of novel genes crucial for metastasis suppression and may also provide therapeutic insights into more effective treatments for preventing metastasis.

[0056] As disclosed herein, through a systematic in vivo selection-based approach, a set of miRNAs was identified as being deregulated in numerous unrelated metastatic lines derived from numerous patients with melanoma, i.e., a highly widespread cancer with increasing incidence (Garbe and Leiter, 2009, Clin. Dermatol., 27, 3-9). As disclosed herein, miR-1908, miR-199a-3p, and miR-199a-5p act as robust endogenous promoters of melanoma metastasis through convergent targeting of the metabolic gene ApoE and the heat shock protein DNAJA4. Loss-of-function analysis, gain-of-function analysis, and epistasis analysis reveal the contours of a cooperative miRNA network that maximally silences ApoE signaling. ApoE secreted by cancer cells inhibits metastatic invasion and endothelial recruitment, which is mediated through its action on different receptors in melanoma and endothelial cells. These miRNAs have shown remarkable prognostic ability in identifying patients who will develop metastatic recurrence of melanoma, while therapeutic delivery of LNAs targeting these miRNAs significantly inhibits melanoma metastasis. The current lack of effective treatments to prevent melanoma metastasis after surgical resection (Garbe et al., 2011, Oncologist, 16, 5-24) necessitates a better molecular and mechanistic understanding of melanoma metastatic progression. To achieve this objective, the findings disclosed herein reveal several key novel non-coding and coding genes involved in melanoma progression and provide novel means for both identifying patients at high risk of melanoma metastasis and treating such patients.

[0057] Below are the nucleic acid and amino acid sequences of the members of the aforementioned network, as well as some other sequences.

[0058] APOE-RNA sequence (SEQ ID NO: 1) TIFF2026062949000002.tif72158 APOE-amino acid sequence (SEQ ID NO: 2) TIFF2026062949000003.tif20158 (Underlined residues 136-150 represent the LRP-binding domain of ApoE) DNAJA4 isotype 1-RNA sequence (SEQ ID NO: 3) TIFF2026062949000004.tif29158TIFF2026062949000005.tif175158 DNAJA4 isotype 1-amino acid sequence (SEQ ID NO: 4) TIFF2026062949000006.tif35158 DNAJA4 isotype 2-RNA sequence (SEQ ID NO: 5) TIFF2026062949000007.tif225158 DNAJA4 isotype 2-amino acid sequence (SEQ ID NO: 6) TIFF2026062949000008.tif30158 DNAJA4 isotype 3-RNA sequence (SEQ ID NO: 7) TIFF2026062949000009.tif177158TIFF2026062949000010.tif9158 DNAJA4 isotype 3-amino acid sequence (SEQ ID NO: 8) TIFF2026062949000011.tif26158 LRP1-RNA sequence (SEQ ID NO: 9) TIFF2026062949000012.tif176158TIFF2026062949000013.tif230158TIFF2026062949000014.tif231158TIFF2026062949000015.tif230158TIFF2026062949000016.tif73158LRP1-amino acid sequence (SEQ ID NO: 10) TIFF2026062949000017.tif147158TIFF2026062949000018.tif152158 LRP8 isotype 1-RNA sequence (SEQ ID NO: 11) TIFF2026062949000019.tif69158TIFF2026062949000020.tif229158TIFF2026062949000021.tif195158 LRP8 isotype 1-amino acid sequence (SEQ ID NO: 12) TIFF2026062949000022.tif64158 LRP8 isotype 2-RNA sequence (SEQ ID NO: 13) TIFF2026062949000023.tif152158TIFF2026062949000024.tif231158TIFF2026062949000025.tif78158 LRP8 isotype 2-amino acid sequence (SEQ ID NO: 14) TIFF2026062949000026.tif55158 LRP8 isotype 3-RNA sequence (SEQ ID NO: 15) TIFF2026062949000027.tif79158TIFF2026062949000028.tif229158TIFF2026062949000029.tif136158 LRP8 isotype 3-amino acid sequence (SEQ ID NO: 16) TIFF2026062949000030.tif49158 LRP8 isotype 4-RNA sequence (SEQ ID NO: 17) TIFF2026062949000031.tif25158TIFF2026062949000032.tif230158TIFF2026062949000033.tif225158 LRP8 isotype 4-amino acid sequence (SEQ ID NO: 18) TIFF2026062949000034.tif59158 CTGF-RNA sequence (SEQ ID NO: 19) TIFF2026062949000035.tif152158 CTGF amino acid sequence (SEQ ID NO: 20) TIFF2026062949000036.tif25158LXR-a isotype 1: RNA sequence (SEQ ID NO: 21) TIFF2026062949000037.tif122158 LXR-a(NR1H3) Isotype 1: Amino acid sequence (SEQ ID NO: 22) TIFF2026062949000038.tif30158 LXR-a(NR1H3) isotype 2: RNA sequence (SEQ ID NO: 23) TIFF2026062949000039.tif20158TIFF2026062949000040.tif93158 LXR-a(NR1H3) Isotype 2: Amino acid sequence (SEQ ID NO: 24) TIFF2026062949000041.tif29158 LXR-a(NR1H3) isotype 3: RNA sequence (SEQ ID NO: 25) TIFF2026062949000042.tif88158TIFF2026062949000043.tif24158LXR-a(NR1H3) Isotype 3: Amino acid sequence (SEQ ID NO: 26) TIFF2026062949000044.tif29158 LXR-a(NR1H3) isotype 4: RNA sequence (SEQ ID NO: 27) TIFF2026062949000045.tif122158 LXR-a(NR1H3) Isotype 4: Amino acid sequence (SEQ ID NO: 28) TIFF2026062949000046.tif20158TIFF2026062949000047.tif11158 LXR-b(NR1H2) isotype 1: RNA sequence (SEQ ID NO: 29) TIFF2026062949000048.tif131158 LXR-b(NR1H2) Isotype 1: Amino acid sequence (SEQ ID NO: 30) TIFF2026062949000049.tif33158 LXR-b(NR1H2) isotype 2: RNA sequence (SEQ ID NO: 31) TIFF2026062949000050.tif24158TIFF2026062949000051.tif93158 LXR-b(NR1H2) isotype 2: Amino acid sequence (SEQ ID NO: 32) TIFF2026062949000052.tif25158 has-miR-199a-1 sequence (sequence number 33) GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC has-miR-199a-2 sequence (sequence number 34) AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA has-miR-1908 sequence (sequence number 35) CGGGAAUGCCGCGGCGGGGACGGCGAUUGGUCCGUAUGUGUGGUGCCACCGGCCGCCGGCUCCGCCCCGGCCCCCGCCCC has-miR-7-1 sequence (sequence number 36) UUGGAUGUUGGCCUAGUUCUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG has-miR-7-2 sequence (sequence number 37) CUGGAUACAGAGUGGACCGGCUGGCCCCAUCUGGAAGACUAGUGAUUUUGUUGUUGUCUUACUGCGCUCAACAACAAAUCCCAGUCUACCUAAUGGUGCCAGCCAUCGCA has-miR-7-3 sequence (sequence number 38) AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUUUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCAUAGCGCAGACUCCCUUCGAC miR-Zip 199a-3p sequence (sequence number 39) GATCCGACAGTAGCCTGCACATTAGTCACTTCCTGTCAGTAACCAATGTGCAGACTACTGTTTTTTGAATT miR-Zip 199a-5p sequence (sequence number 40) GATCCGCCCAGTGCTCAGACTACCCGTGCCTTCCTGTCAGGAACAGGTAGTCTGAACACTGGGTTTTTGAATT miR-Zip 1908 sequence (sequence number 41) GATCCGCGGCGGGAACGGCGATCGGCCCTTCCTGTCAGGACCAATCGCCGTCCCCGCCGTTTTTGAATT miR-Zip 7 sequence (sequence number 42) GATCCGTGGAAGATTAGTGAGTTTATTATCTTCCTGTCAGACAACAAAATCACTAGTCTTCCATTTTTGAATT Members of this network can be used as targets for treating metastatic melanoma. In addition, these members can be used as biomarkers to determine whether a subject has metastatic melanoma or is at risk of having metastatic melanoma, or as biomarkers to clarify the prognosis of patients with such a disorder or to monitor patients with such a disorder. Accordingly, the present invention encompasses methods for treating metastatic melanoma by targeting one or more of these members, methods for clarifying the efficacy of therapeutic therapies to inhibit the cancer, and methods for identifying anticancer drugs. The present invention also provides methods for diagnosing whether a subject has metastatic melanoma or is at risk of having metastatic melanoma, and methods for screening subjects who are considered to be at risk of developing such a disorder. The present invention also encompasses a variety of kits suitable for carrying out the methods described above.

[0059] ApoE polypeptide The term “polypeptide or peptide,” as used herein, includes fusions or chimeric forms produced by recombination or synthesis of any of the translocation repressors described herein, having specific domains or portions involved in the network. These terms also encompass analogs, fragments, extensions, or derivatives of peptides (e.g., those having added amino-terminal methionines useful for expression in prokaryotic cells).

[0060] "Apolipoprotein polypeptide or ApoE polypeptide," as used herein, means a peptide, drug, or compound that mimics the function of an innate apolipoprotein, either in vivo or in vitro, including analogs, fragments, elongations, or derivatives of apolipoproteins, which are peptides between 10 and 200 amino acid residues in length. Such peptides may contain either native or non-native amino acids containing amide bonds. Apolipoprotein peptide fragments may be modified, as known in the art, to improve their stability or bioavailability in vivo, and may contain organic compounds linked to the amino acid side chains via various bonds.

[0061] In one aspect, the present inventors' invention is a method for using an isolated apoEp1.B peptide having the amino acid sequence TQQIRLQAEIFQAR(mouse) (SEQ ID NO: 43) or AQQIRLQAEAFQAR(human) (SEQ ID NO: 44), or an analog, fragment, extension, or derivative of said peptide. The present invention also includes nucleic acid molecules encoding the apoEp1.B peptide or its analog, fragment, extension, or derivative.

[0062] The term "analog" includes any peptide having an amino acid sequence that is substantially identical to that of an original peptide, in which one or more residues are conservedly substituted with functionally similar residues, and exhibiting the ability to mimic an original peptide. Examples of conservative substitutions include using one nonpolar (hydrophobic) residue (e.g., alanine, isoleucine, valine, leucine, or methionine) in place of another nonpolar (hydrophobic) residue; using one polar (hydrophilic) residue in place of another polar (hydrophilic) residue, such as between arginine and lysine, glutamine and asparagine, or glycine and serine; using one basic residue (e.g., lysine, arginine, or histidine) in place of another basic residue; or using one acidic group (e.g., aspartic acid or glutamic acid) in place of another acidic residue.

[0063] The expression “conservative substitution” also includes the use of a chemically derivatized residue in place of a non-derivatized residue, provided that such polypeptide exhibits essential activity. Analogues of the above peptides include peptides having the following sequences: TAQIRLQAEIFQAR (SEQ ID NO: 45), TQAIRLQAEIFQAR (SEQ ID NO: 46), TQQARLQAEIFQAR (SEQ ID NO: 47), and TQQIALQAEIFQAR (SEQ ID NO: 48).

[0064] "Derivative" refers to a peptide in which one or more residues are chemically derivatized by the reaction of a functional side chain. Such derivatized molecules include, for example, molecules in which a free amino group is derivatized to form an amine hydrochloride, a p-toluenesulfonyl group, a carbobenzoxy group, a t-butyloxycarbonyl group, a chloroacetyl group, or a formyl group. A free carboxyl group may be derivatized to form a salt, a methyl ester, an ethyl ester or other type of ester or hydrazide. A free hydroxyl group may be derivatized to form an O-acyl derivative or an O-alkyl derivative. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Such peptides also include those containing one or more naturally occurring amino acid derivatives of 20 standard amino acids. For example, 4-hydroxyproline may be used in place of proline; 5-hydroxylysine may be used in place of lysine; 3-methylhistidine may be used in place of histidine; homoserine may be used in place of serine; and ornithine may be used in place of lysine. The polypeptides of the present invention also include any polypeptide whose sequence has one or more additions and / or deletions of residues compared to the polypeptide sequence shown herein, as long as essential activity is maintained.

[0065] The term "fragment" refers to any subject peptide having an amino acid sequence shorter than the amino acid sequence of the peptides shown herein.

[0066] The term "extended product" refers to any subject peptide having an amino acid sequence that is longer than the amino acid sequence of the peptide of the present invention by one or two amino acids (either at the carboxyl terminus or the amino terminus). Preferably, the extension occurs at the amino terminus. The above peptide fragments and extended products include peptides having the following sequences: QTQQIRLQAEIFQAR (SEQ ID NO: 49) and QQIRLQAEIFQAR (SEQ ID NO: 50).

[0067] Various ApoE polypeptides and methods for preparing them are described in U.S. Patent No. 6,652,860 (which is incorporated herein by reference).

[0068] LXR Agonist The present invention includes administering an LXR agonist for the prevention and treatment of metastasis. It is possible. The LXR agonist can be a compound that conforms to formula I, formula II, formula III, or formula IV shown below.

[0069] Formula I is provided below:

[0070] [ka] or a pharmaceutically acceptable salt thereof, provided that in formula I, Ar is an aryl group; R 1 This is selected from the group consisting of -OH, -CO2H, -O-(C1~C7)alkyl, -OC(O)-, -(C1~C7)alkyl, -O-(C1~C7)heteroalkyl, -OC(O)-(C1~C7)heteroalkyl, -NH2, -NH(C1~C7)alkyl, -N((C1~C7)alkyl)2, and -NH-S(O)2(C1~C5)alkyl; R 2 This is selected from the group consisting of (C1-C7) alkyl, (C1-C7) heteroalkyl, aryl, and aryl(C1-C7)alkyl; X 1 、 X 2 、 X 3 、 X 4 、 X 5 and X 6 each independently is selected from the group consisting of H, (C 1 ~ C 5 ) alkyl, (C 1 ~ C 5 ) heteroalkyl, F and Cl, provided that at most 3 of X 1 ~ X 6 are H, (C 1 ~ C 5 ) alkyl, (C 1 ~ C 5 ) heteroalkyl; and Y is a divalent linking group selected from the group consisting of -N(R 12 )S(O) m -, -N(R 12 )S(O) m N(R 13 )-, -N(R 12 )C(O)-, -N(R 12 )C(O)N(R 13 )-, -N(R 12 )C(S)- and -N(R 12 )C(O)O-, provided that R 12 and R 13 each independently is selected from the group consisting of H, (C1~C7) alkyl, (C1~C7) heteroalkyl, aryl and aryl(C1~C7) alkyl, and optionally, when Y is -N(R 12 )S(O) m - or -N(R 12 )S(O) m N(R 13 )-, R 12 forms a 5-membered or 6-membered ring fused to Ar or R 2 respectively through a covalent bond to Ar or R 2 , in which case, the subscript m is an integer from 1 to 2; provided that R 1 is OH, and -Y-R 2 is -N(R12 )S(O) m -R 2 or -N(R 12 )C(O)N(R 13 )-R 2 And when bonded to the quaternary carbon bonded to Ar, and R 2 However, when it is phenyl, benzyl, or benzoyl, i)R 12 or R 13 At least one of them is not hydrogen and contains an electron-withdrawing substituent, or ii)R 2 However, it may be substituted with a component other than amino, acetamide, di(C1~C7)alkylamino, (C1~C7)alkylamino, halogen, hydroxy, nitro or (C1~C7)alkyl, or iii)R 2 The benzene ring portion is replaced by at least three independently selected groups in addition to the Y group, or in addition to the bond to Y.

[0071] In some embodiments, Y is -N(R 12 )S(O)2- and R 1 teeth It is OH.

[0072] Therefore, compounds of formula I include, but are not limited to, compounds having the structure shown below: [ka] Compounds of formula I can be synthesized as described by U.S. Patent No. 6,316,503 (which is incorporated herein by reference).

[0073] Equation II is provided below: [ka] (In the formula, R 1 H is; X 1 These are bonds, C1-C5 alkyl, -C(O)-, -C(=CR8 R 9 )-, -O-, -S(O) t -, -NR 8 -, -CR 8 R 9 -, -CHR 23 ,-CR 8 (CR 9 )-,-C(CR 8 )2-,-CR8(OC(O)R 9 )-, -C=NOR 9 -, -C(O)NR 8 -, -CH2O-, -CH2S-, -CH2NR 8 -, -OCH2-, -SCH2-, -NR 8 CH2- or [ka] is; R 2 These are H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, -CH2OH, C7-C 11 Arylalkyl, phenyl, na Phthyl, C1-C3 perfluoroalkyl, CN, C(O)NH2, CO2R 12 , or C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C1-C3 alkoxy, C1-C3 perfluoroalkyl, halogen, -NO2, -NR 8 R 9 A phenyl molecule independently substituted with -CN, -OH, and one or more molecules from the group independently selected from C1-C3 alkyl groups substituted with 1 to 5 fluorines, or R 2 This is a heterocycle selected from the group consisting of pyridine, thiophene, benzoisoxazole, benzothiophene, oxadiazole, pyrrole, pyrazole, imidazole, and furan, in which case each of them may be a C1-C3 alkyl, C1-C3 alkoxy, C1-C3 perfluoroalkyl, halogen, -NO2, -NR 8 R 9may be substituted by one to three groups independently selected from -CN and C1-C3 alkyl substituted by one to five fluorines; X 2 is a bond or -CH2-; R 3 is phenyl, naphthyl, or C1-C3 alkyl, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1-C3 alkoxy, C1-C3 perfluoroalkyl, C1-C3 alkyl substituted by one to five fluorines, NR 14 R 15 -C(O)R 10 , -C(O)NR 10 R 11 -C(O)NR 11 A, -C≡CR 8 -CH=CHR 8 -WA, -C≡CA, -CH=CHA, -WYA, -WYNR 11 -A, -WYR 10 -WY(CH2) j A, -WCHR 11 (CH2) j A, -W(CH2) j A, -W(CH2) j R 10 -CHR 11 W(CH2) j R 10 , -CHR 11 W(CH2) j A, -CHR 11 NR 12 YA, -CHR 11 NR 12 YR 10 , pyrrole, -W(CH2) j A(CH2) k D(CH2) p Z, -W(CR 18 R 19 )A(CH2) k D(CH2) p Z, -(CH2) j WA(CH2) k D(CH2) pZ, -CH=CHA(CH2) k D(CH2)pZ, -C≡CA(CH2) k D(CH2) p Z, -W(CH2) j C≡CA(CH2) k D(CH2) p Z and -W(CH2) j A phenyl or naphthyl group independently substituted by one to four groups independently selected from Z. Alternatively, R 3 The heterocycle is selected from pyrimidine, thiophene, furan, benzothiophene, indole, benzofuran, benzimidazole, benzothiazole, benzoxazole, and quinoline, in which case each of them may be a C1-C3 alkyl, C1-C3 alkoxy, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1-C3 perfluoroalkyl, C1-C3 alkyl substituted with 1-5 fluorines, or -C(O)R 10 -C(O)NR 10 R 11 -C(O)NR 11 A, -C≡CR 8 -CH=CHR 8 , -WA, -C≡CA, -CH=CHA, -WYA, -WYR 10 , -WY(CH2) j A, -W(CH2) j A, -W(CH2) j R 10 ,-CHR 11 W(CH2) j R 10 ,-CHR 11 W(CH2) j A, -CHR 11 NR 12 YA, -CHR 11 NR 12 YR 10 , -WCHR 11 (CH2) j A, -W(CH2) j A(CH2) k D(CH2) p Z, -W(CR 18R 19 )A(CH2) k D(CH2) p Z, -(CH2) j WA(CH2) k D(CH2) p Z, -CH=CHA(CH2) k D(CH2) p Z, -C≡CA(CH2) k D(CH2) p Z, -W(CH2) j C≡CA(CH2) k D(CH2) p Z and -W(CH2) j Z It may be replaced by one to three elements selected independently; W represents bonds, -O-, -S-, -S(O)-, -S(O)2-, -NR 11 -or -N(COR 12 )-is; Y is -CO-, -S(O) 2 -, -CONR 13 ,-CONR 13 CO-, -CONR 13 SO2-, -C(NCN)-, -CSNR 13 -C(NH)NR 13 or -C(O)O-; j is between 0 and 3; k is between 0 and 3; t is between 0 and 2; D represents a bond, -CH=CH-, -C≡C-, -C=, -C(O)-, phenyl, -O-, -NH-, -S-, -CHR 14 -, -CR 14 R 15 -, -OCHR 14 ,-OCR 14 R 15 - or -CH(OH)CH(OH)-; p is between 0 and 3; Z is -CO2R 11 ,-CONR 10 R 11 -C(NR 10 )NR 11 R 12, -CONH2NH2, -CN, -CH2OH, -NR 16 R 17 , phenyl, CONHCH(R 20 )COR 12 , phthalimide, pyrrolidine-2,5-dione, thiazolidin-2,4-dione, tetrazolyl, pyrrole, indole, oxazole, 2-thioxo-1,3-thiazolinin-4-one, C1-C7 amines, C3-C7 cyclic amines, or C1-C3 alkyls substituted with one or two OH groups, wherein the pyrrole may be substituted with one or two substituents independently selected from the group consisting of -CO2CH3, -CO2H, -COCH3, -CONH2, and -CN. The C1-C7 amines may optionally be substituted with one or two substituents independently selected from the group consisting of -OH, halogens, -OCH3, and -C≡CH. The aforementioned phenyl may, in some cases, be CO2R 11 The C3-C7 cyclic amine is optionally substituted with one or two substituents independently selected from the group consisting of -OH, -CH2OH, C1-C3 alkyl, -CH2OCH3, -CO2CH3, and -CONH2, and the oxazole is optionally substituted with CH2CO2R 11 Replaced by; A is phenyl, naphthyl, tetrahydronaphthyl, indane, or biphenyl, in which case each of them may be a halogen, C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, acyl, hydroxy, halogen, -CN, -NO2, or -CO2R. 11 , -CH2CO2R 11 phenyl, C1-C3 perfluoroalkoxy, C1-C3 perfluoroalkyl, -NR 10 R 11 -CH2NR 10 R 11 , -SR 11, may be substituted with one to four groups independently selected from C1-C6 alkyl groups substituted with one to five fluorine groups, C1-C3 alkyl groups substituted with one to two OH groups, C1-C6 alkoxy groups optionally substituted with one to five fluorine groups, or phenoxy groups optionally substituted with one to two CF3 groups; or A is a heterocycle selected from pyrrole, pyridine, pyridine-N-oxide, pyrimidine, pyrazole, thiophene, furan, quinoline, oxazole, thiazole, imidazole, isoxazole, indole, benzo[1,3]-dioxol, benzo[1,2,5]-oxodiazole, isochromen-1-one, benzothiophene, benzofuran, 2,3-di-5-hydrobenzo[1,4]-dioxin, viteinyl, quinazoline-2,4-9[3H]dione and 3-H-isobenzofuran-1-one, in which case each of them may be halogen, C1-C3 alkyl, acyl, hydroxy, -CN, -NO2, C1-C3 perfluoroalkyl, -NR 10 R 11 -CH2NR 10 R 11 , -SR 11 They may be substituted with one to three groups independently selected from C1-C3 alkyl groups substituted with one to five fluorine atoms, and C1-C3 alkoxy groups optionally substituted with one to five fluorine atoms; R 4 , R 5 and R 6 Each of them is independently either -H or -F; R 7 This is a phenyl molecule substituted with a C1-C4 alkyl group, a C1-C4 perfluoroalkyl group, a halogen group, -NO2, -CN, a phenyl group, or one or two groups independently selected from halogens, C1-C2 alkyl groups, and OH groups; However, X1R 2 If hydrogen is formed, then R 3 teeth, (a)-W(CH2) j A(CH2) k D(CH2) pZ, -W(CR 18 R 19 )A(CH2) k D(CH2) p Z, -(CH2) j WA(CH2) k D(CH2) p Z, -CH=CHA(CH2) k D(CH2) p Z, -C≡CA(CH2) k D(CH2) p Z taha-W(CH2) j C≡CA(CH2) k D(CH2) p Phenyl substituted with Z (wherein the phenyl component may be further substituted with one or two groups independently selected from C1-C2 alkyl, C1-C2 perfluoroalkyl, halogen, and CN); and (b) A heterocycle selected from pyrimidines, thiophenes, and furans (where each of these is -W(CH2) j A(CH2) k D(CH2) p Z, -W(CR 18 R 19 )A(CH2) k D(CH2) p Z, -(CH2) j WA(CH2) k D(CH2) p Z, -CH=CHA(CH2) k D(CH2) p Z, -C≡CA(CH2) k D(CH2) p Z or -W(CH2) j C≡CA(CH2) k D(CH2) p (Substituted by one of the Zs) Selected from; Each R 8 These are independently -H or C1-C3 alkyl groups; Each R 9 These are independently -H or C1-C3 alkyl groups; Each R 10phenyl is optionally substituted with one or two C1-C3 alkoxy groups, wherein the C1-C7 alkyl group is optionally substituted with one, two or three groups that are independently substituted with C1-C3 alkoxy groups, C1-C3 thioalkoxy groups, and CN; Each R 11 These are independently -H, C1-C3 alkyl or R 22 And, or, R 10 and R 11 When bonding with the same atom, it becomes together with the aforementioned atom, A 5- to 7-membered saturated ring optionally substituted with one or two groups independently selected from C1-C3 alkyl, OH, and C1-C3 alkoxy groups, or a 5- to 7-membered ring containing one or two heteroatoms and optionally substituted with one or two groups independently selected from C1-C3 alkyl, OH, and C1-C3 alkoxy groups. To form: Each R 12 These are independently -H or C1-C3 alkyl groups; Each R 13 These are independently -H or C1-C3 alkyl groups; Each R 14 and R 15 These are independently C1-C7 alkyl, C3-C8 cycloalkyl, C2-C7 alkenyl, C2-C7 alkynyl, -CH, -F, C7-C 14 It is an arylalkyl, however, the arylalkyl may be NO2, C1-C6 alkyl, C1-C3 perhaloalkyl, halogen, CH2CO2R 11 , substituted with one to three groups independently selected from phenyl and C1-C3 alkoxy groups, or R 12 and R 15These atoms, together with the atoms they bond to, can form saturated rings of 3 to 7 members; Each R 16 and R 17 R is independently hydrogen, C1-C3 alkyl, C1-C3 alkenyl, C1-C3 alkynyl, phenyl, benzyl, or C3-C8 cycloalkyl, wherein the C1-C3 alkyl is optionally substituted with one OH group, and the benzyl is optionally substituted with one to three groups selected from C1-C3 alkyl and C1-C3 alkoxy, or R 16 and R 17 These atoms, together with the atoms to which they are bonded, can optionally be substituted with one or two substituents independently selected from the group consisting of C1-C3 alkyl, -OH, CH2OH, -CH2OCH3, -CO2CH3, and -CONH2, forming a 3- to 8-membered heterocycle; Each R 18 and R 19 These are independently C1-C3 alkyl groups; Each R 20 These are independently H, phenyl, or the side chain of a naturally occurring alpha-amino acid; Each R 22 is independently an arylalkyl which is optionally substituted with CH2COOH; and Each R 23 (It is phenyl.) or a pharmaceutically acceptable salt thereof.

[0074] Compounds of formula II can be synthesized as described in U.S. Patent No. 7,576,215 (which is incorporated herein by reference). Compounds of formula II can be any of compounds 26 to 32 or any pharmaceutically acceptable salt thereof. [ka] Equation III is provided below: [ka] (In the formula, X is hydrogen, C1-C8 alkyl, halo, -OR 10 , -NR 10 R 11 , nitro, cyano, -COOR 10 or -COR 10 Selected from; Z is CH, CR 3 or N, where Z is CH or CR 3 When this is the case, k is between 0 and 4, and t is 0 or 1; and when Z is N, k is between 0 and 3, and t is 0; Y is -O-, -S-, -N(R 12 )- and -C(R 4 )(R 5 )- Selected from; W 1 The C1-C6 alkyl, C0-C6 alkyl, C3-C6 cycloalkyl, aryl, and Het are selected, however, the C1-C8 alkyl, C3-C8 cycloalkyl, Ar, and Het may be unsubstituted, or halo, cyano, nitro, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-CO2R 12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkyl-CONR 13 R 14 -C0~C6 alkyl-COR 15 -C0~C6 alkyl-NR 13 R 14 -C0~C6 alkyl-SR 12 -C0~C6 alkyl-OR 12 -C0~C6 alkyl-SO3H, -C0~C6 alkyl-SO2NR 13 R 14 -C0~C6 alkyl-SO2R 12 -C0~C6 alkyl-SOR 15 -C0~C6 alkyl OCR 15 -C0~C6 alkyl-OC(O)NR 13 R 14 -C0~C6 alkyl-OC(O)OR 15-C0~C6 alkyl-NR 13 C(O)OR 15 -C0~C6 alkyl-NR 13 C(O)NR 13 R 14 and -C0~C6 alkyl-NR 13 COR 15 Substituted by one or more groups independently selected from the C1-C6 alkyl group, in which case the C1-C6 alkyl group may be unsubstituted or substituted by one or more halo substituents; W 2 These are H, halo, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, -C0-C6 alkyl-NR 13 R 14 -C0~C6 alkyl-SR 12 -C0~C6 alkyl-OR 12 -C0~C6 alkylCO2R 12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkylCONR 13 R 14 -C0~C6 alkyl-COR 15 -C0~C6 alkyl OCR 15 -C0~C6 alkyl-OCONR 13 R 14 -C0~C6 alkyl-NR 13 CONR 13 R 14 -C0~C6 alkyl-NR 13 COR 15 Selected from -C0~C6 alkyl-Het, -C0~C6 alkyl-Ar, and -C0~C6 alkyl-C3~C7 cycloalkyl, wherein the C1~C6 alkyl may be unsubstituted or substituted with one or more halo substituents, and the C3~C7 cycloalkyl portion, Ar portion, and Het portion of the -C0~C6 alkyl-Het, -C0~C6 alkyl-Ar, and -C0~C6 alkyl-C3~C7 cycloalkyl may be unsubstituted or halo, cyano, nitro, C1~C6 alkyl, C3~C6 alkenyl, C3~C6 alkynyl, -C0 ~C6 alkyl-CO2R12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkyl-CONR 13 R 14 -C0~C6 alkyl-COR 15 -C0~C6 alkyl-NR 13 R 14 -C0~C6 alkyl-SR 12 -C0~C6 alkyl-OR 12 -C0~C6 alkyl-SO3H, -C0~C6 alkyl-SO2NR 13 R 14 -C0~C6 alkyl-SO2R 12 -C0~C6 alkyl-SOR 15 -C0~C6 alkyl-OCOR 15 -C0~C6 alkyl-OC(O)NR 13 R 14 -C0~C6 alkyl-OC(O)OR 15 -C0~C6 alkyl-NR 13 C(O)OR 15 -C0~C6 alkyl-NR 13 C(O)NR 13 R 14 and -C0~C6 alkyl-NR 13 COR 15 Substituted by one or more groups independently selected from the C1-C6 alkyl group, in which case the C1-C6 alkyl group may be unsubstituted or substituted by one or more halo substituents; W 3 H, halo, C1-C6 alkyl, -C0-C6 alkyl-NR 13 R 14 -C0~C6 alkyl SR 12 -C0~C6 alkyl-OR 12 -C0~C6 alkyl-CO2R 12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkyl-CONR 13 R 14 , -C0~C6 alkyl-COR 15 -C0~C6 alkyl-OCOR 15 -C0~C6 alkyl-OCONR13 R 14 -C0~C6 alkyl NR 13 CONR 13 R 14 , -C0~C6 alkyl-NR 13 COR 15 Selected from the group consisting of -C0~C6 alkyl-Het, -C1~C6 alkyl-Ar, and -C1~C6 alkyl-C3~C7 cycloalkyl, However, the C1-C6 alkyl groups may be unsubstituted or substituted with one or more halo substituents; Q is selected from C3-C8 cycloalkyl, Ar, and Het, where the C3-C8 cycloalkyl, Ar, and Het may be unsubstituted, or halo, cyano, nitro, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkylCO2R 12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkylCONR 13 R 14 -C0~C6 alkyl-COR 15 -C0~C6 alkyl NR 13 R 14 -C0~C6 alkyl-SR 12 -C0~C6 alkyl-OR 12 -C0~C6 alkyl-SO3H, -C0~C6 alkyl-SO2NR 13 R 14 -C0~C6 alkyl-SO2R 12 -C0~C6 alkyl-SOR 15 -C0~C6 alkyl-OCOR 15 -C0~C6 alkyl-OC(O)NR 13 R 14 -C0~C6 alkyl-OC(O)OR 15 -C0~C6 alkyl NR 13 C(O)OR 15 -C0~C6 alkyl-NR 13 C(O)NR 13 R 14 and -C0~C6 alkyl-NR 13 COR 15The C1C6 alkyl group is substituted with one or more groups independently selected from the C1C6 alkyl group, in which case the C1C6 alkyl group may be unsubstituted or substituted with one or more halo substituents; p is between 0 and 8; n is between 2 and 8; m is either 0 or 1; q is either 0 or 1; t is either 0 or 1; Each R 1 and R 2 These are independently H, halo, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-NR 13 R 14 -C0~C6 alkyl-OR 12 -C0~C6 alkyl-SR 12 , selected from -C1~C6 alkyl-Het, -C1~C6 alkyl-Ar and -C1~C6 alkyl-C3~C7 cycloalkyl, or R 1 and R 2 These atoms, together with the carbon atoms to which they are bonded, form a 3- to 5-membered carbocyclic or heterocyclic ring, in which case the heterocyclic ring contains one or more heteroatoms selected from N, O, and S, wherein any of the C1-C6 alkyl groups may be unsubstituted or substituted with one or more halo substituents; Each R 3 These are the same or different, and independently include halo, cyano, nitro, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-Ar, -C0-C6 alkyl-Het, -C0-C6 alkyl-C3-C7 cycloalkyl, and -C0-C6 alkyl-CO2R. 12 -C0~C6 alkyl-C(O)SR 12 -C0~C6 alkyl-CONR 13 R 14 -C0~C6 alkyl-COR 15 -C0~C6 alkyl-NR 13 R 14 -C0~C6 alkyl-SR 12 -C0~C6 alkyl-OR12 -C0~C6 alkyl-SO3H, -C0~C6 alkylSO2NR 13 R 14 -C0~C6 alkyl-SO2R 12 -C0~C6 alkyl SOR 15 -C0~C6 alkyl-OCOR 15 -C0~C6 alkyl-OC(O)NR 13 R 14 -C0~C6 alkyl-OC(O)OR 15 -C0~C6 alkyl-NR 13 C(O)OR 15 -C0~C6 alkyl-NR 13 C(O)NR 13 R 14 and -C0~C6 alkyl-NR 13 COR 15 Selected from the above, wherein the C1-C6 alkyl group may be unsubstituted or substituted with one or more halo substituents; Each R 4 and R 5 These are independently selected from H, halo, C1-C6 alkyl, -C0-C6 alkyl-Het, -C0-C6 alkyl-Ar, and -C0-C6 alkyl-C3-C7 cycloalkyl; R 6 and R 7 Each of these is independently selected from H, halo, C1-C6 alkyl, -C0-C6 alkyl-Het, -C0-C6 alkyl-Ar, and -C0-C6 alkyl-C3-C7 cycloalkyl; R 8 and R 9 Each of these is independently selected from H, halo, C1-C6 alkyl, -C0-C6 alkyl-Het, -C0-C6 alkyl-Ar, and -C0-C6 alkyl-C3-C7 cycloalkyl; R 10 and R 11 Each of these is independent of H, C1~C 12 Alkyl, C3~C 12 Alkenil, C3~C 12 Alkinil, -C0~C8 alkyl-Ar, -C0~C8 alkyl-Het, -C0~C8 alkyl-C3~C7 cycloalkyl, -C0~C8 alkyl-O-Ar, -C0~C8 alkyl-O-Het, -C0~C8 alkyl-O-C3~C7 cycloalkyl, -C0~C8 alkyl-S(O) x -C0~C6 alkyl, -C0~C8 alkyl-S(O) x -Ar, -C0~C8 alkyl-S(O) x -Het, -C0~C8 alkyl-S(O) x Selected from -C3~C7 cycloalkyl, -C0~C8 alkyl-NH-Ar, -C0~C8 alkyl-NH-Het, -C0~C8 alkyl-NH-C3~C7 cycloalkyl, -C0~C8 alkyl-N(C1~C4 alkyl)-Ar, -C0~C8 alkyl-N(C1~C4 alkyl)-Het, -C0~C8 alkyl-N(C1~C4 alkyl-C3~C7 cycloalkyl, -C0~C8 alkyl-Ar, -C0~C8 alkyl-Het, and -C0~C8 alkyl-C3~C7 cycloalkyl, in which case x is 0, 1, or 2. Alternatively, R 10 and R 11 These, together with the nitrogen atoms to which they are bonded, form a 4- to 7-membered heterocyclic ring optionally containing one or more further heteroatoms selected from N, O, and S, provided that the C1-C 12 Alkyl, C3~C 12 Alkenyl or C3-C 12 Alkynnyls may be substituted by one or more substituents independently selected from the group consisting of halo, -OH, -SH, -NH2, -NH (unsubstituted C1-C6 alkyl), -N (unsubstituted C1-C6 alkyl) (unsubstituted C1-C6 alkyl), unsubstituted -OC1-C6 alkyl, -CO2H, -CO2 (unsubstituted C1-C6 alkyl), -CONH2, -CONH (unsubstituted C1-C6 alkyl), -CON (unsubstituted C1-C6 alkyl) (unsubstituted C1-C6 alkyl), -SO3H, -SO2NH2, -SO2NH (unsubstituted C1-C6 alkyl), and -SO2N (unsubstituted C1-C6 alkyl) (unsubstituted C1-C6 alkyl); R12 This is selected from H, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-Ar, -C0-C6 alkyl-Het, and -C0-C6 alkyl-C3-C7 cycloalkyl; Each R 13 and each R 14 The elements are independently selected from H, C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-Ar, -C0-C6 alkyl-Het, and -C0-C6 alkyl-C3-C7 cycloalkyl, or R 13 and R 14 These atoms, together with the nitrogen atoms to which they are bonded, form a 4- to 7-membered heterocyclic ring, optionally containing one or more further heteroatoms selected from N, O, and S; R 15 (Selected from C1-C6 alkyl, C3-C6 alkenyl, C3-C6 alkynyl, -C0-C6 alkyl-Ar, -C0-C6 alkyl-Het, and -C0-C6 alkyl-C3-C7 cycloalkyl) or a pharmaceutically acceptable salt thereof.

[0075] In some embodiments, X is hydrogen, p is 0, t is 0, Z is CH, and Y is -O-.

[0076] In a further embodiment, X is hydrogen, p is 0, t is 0, Z is CH, and Y is -O-, W 1 and W 2 It is phenyl, and W 3 is hydrogen, q is 1, and R 8 and R 9 It is hydrogen.

[0077] In other embodiments, X is hydrogen, p is 0, t is 0, Z is CH, and Y is -O-, W 1 and W 2 It is phenyl, and W 3 is hydrogen, q is 1, and R8 and R 9 Q is hydrogen, and Q is Ar.

[0078] Therefore, compounds of formula III include, but are not limited to, compounds having the structures shown below, GW3965[2] and SB742881

[25] : [ka] Compounds of formula III can be synthesized as described in U.S. Patent Nos. 7,365,085 and 7,560,586 (which are incorporated herein by reference). Equation IV is shown below: [ka] or a pharmaceutically acceptable salt thereof, provided that in formula IV, J 11 is -N= and J 21 -CR 300 - and, or J 11 -CR 200 - and J21 is = N-; R 00 G 1 , G 21 or R N is; R 200 G 1 , G 21 or R C is; R 300 and R 400 R is independent of R C or Q, however R 300 , R 400 and R 500 Only one of them is Q; Q is C 3~6 They are cycloalkyl, heteroaryl, or heterocyclyl, each having 1 to 4 R groups depending on the case. Q It is replaced by, or Q is -XYZ, where each R QThese independently include aryloxy, aralkyloxy, aryloxyalkyl, arylC0-C6 alkylcarboxy, and C(R 110 )=C(R 110 )-COOH, oxo, =S, -Z, -Y'-Z or -XYZ, and each R Q Depending on the case, there may be 1 to 4 R's. 80 Replaced by; R 500 G 1 , G 21 , Q or R C And, however, in this case, R 00 , R 200 and R 500 Only one of them is G 1 And, R 00 , N= and R 500 Only one of them is G 21 is; G 21 ha-J 0 -K 0 And in the formula, J 0 and K 0 These are independently aryl or heteroaryl, each having 1 to 4 R depending on the case. K Substituted by the group, each R K These independently produced hydrogen, halogen, and CR. 110 =CR 110 COOR 110 , nitro, -Z, -YZ or -XYZ; G 1 ha-L 10 -R, however L 10 is a bond, L 50 , L 60 , -L 50 -L 60 -L 50 - or -L 60 -L 50 -L 50 - and in these equations, Each L 50 -[C(R 150 )2] m -and, Each L 60These are independently -CS-, -CO-, -SO2-, -O-, -CON(R 110 )-,-CONR 110 N(R 110 )-, -C(=NR 110 )-,-C(NOR 11 )-, -C(=NN(R 110 )2) -, -C3~C8 cycloalkyl- or -heterocyclyl-, wherein the cycloalkyl or heterocyclyl may have 1 to 4 R 140 Substituted by the group, or each L 60 These are independently C2-C6 alidicates, and the alidicate chain may be -C(R 100 )2-, -C(R 110 )2C(R 110 ) z -, -C(R 11 )C(R 110 )-,-C(R 110 )2O-, -C(R 110 ) z NR 110 -, -C C-, -O-, -S-, -N(RO)CO-, -N(R 100 )CO2-, -CON(R 110 )-, -CO-, -CO2-, -OC(=O)-, -OC(=O)N(R 100 )-, -SO2-, -N(R 100 )SO2- or -SO2N(R 100 ) was interrupted by, R is an aryl, heterocyclyl, heteroaryl, or -(C3~C6)cycloalkyl, where R may be one to four R A It is replaced by, in this case, each R A These independently include halogens, nitros, heterocyclyls, C1-C6 alkyls, C2-C6 alkenyls, C2-C6 alkynyls, C3-C8 cycloalkyls, (C3-C8 cycloalkyls) (Cloalkyl)-C1~C6 alkyl-, (C3~C8 cycloalkenyl)-C1~C6 alkyl-, (C3~C8 cycloalkyl)-C1~C6 alkenyl-, arylalkyl, aryloxy, aryl C 1~6 Alkoxy, C1-C6 haloalkyl, SO2R110 , OR 110 , SR 110 N3, SOR 110 COR 110 SO2N(R 110 )2, SO2NR 110 COR 110 , C≡N, C(O)OR 110 CON(R 110 )2, -CON(R 110 )OR 110 OCON(R 110 )2, -NR 110 COR 110 , NR 110 CON(R 110 )2, NR 110 COOR 110 -C(=N-OH)R 110 -C(=S)N(R 110 )2, -S(=O)N(R 110 )2, -S(=O)OR 110 , -N(R 110 )S(=O)2R 110 -C(=O)N(R 110 )N(R 110 )2, -OC(=O)-R 110 , -OC(=O)-OR 110 or N(R 11 )2, Furthermore, each R A Depending on the case, they may independently be -halogens, -C1~C6 alkyls, aryloxys, C 0~6 Alkyl SO2R 110 , C 0~6 Alkyl COOR 110 , C 1~6 Alkoxyaryl, C1-C6 haloalkyl, -SO2R 110 , -OR 110 , -SR 110 -N3, -SO2R 110 , -COR 110 , -SO2N(R 110 )2, -SO2NR 110 COR 110 -C≡N, -C(O)OR 110 , -CON(R110 )2, -CON(R 110 )OR 110 ,-OCON(R 110 )2, -NR 110 COR 110 , -NR 110 CON(R 110 )2, -NR 110 COOR 110 or -N(R 110 ) Substituted by 1 to 4 groups; R N ha-L 31 -R 60 However, L 31 is a combination, -X 3 (CH z ) n -X 3 -,-(CH2) m -X3-(CH2) n -or-(CH2) 1+w, -Y 3 -(CH2) w - and in these equations, each w is independently between 0 and 5, and each X 3 Independently, bonded, -C(R 110 )2-, -C(R 110 )2C(R 110 )2-, -C(R 110 )=C(R 110 )-, -C≡C-, -CO-, -CS-, -CONR 100 -, -C(=N)(R 100 )-, -C(=N-OR 110 )-,-C[=NN(R 110 )2], -CO2-, -SO2- or -SO2N(R 110 )- and Y 3 However, -O-, -S-, -NR 70 -, -N(R 100 )CO-, -N(R 110 )CO2-, -OCO-, -OC(=O)N(R 100 )-, -NR 100 CONR 100 -, -N(R 110 )SO2- or -NR 100 CSNR 100-and, Or, L 31 The C2-C6 alidicyl chain is, however, the alidicyl chain may be -C(R 110 )2-, -C(R 110 )2C(R 110 )2-, -C(R 110 )=C(R 110 )-,-C(R 110 )2O-, -C(R 110 )2NR 110 -, -C≡C-, -O-, -S-, -N(R 100 )CO-, -N(R 100 )CO2-, -CON(R 100 )-, -CO-, -CO2-, -O(C=O)-, -O(C=O)N(R 110 )-, -SO2-, -N(R 100 )SO2- or -SO2N(R 100 )- Interrupted by, R 60 However, C1-C6 alkyl, C1-C6 haloalkyl, aryl, C3-C8 cycloalkyl, heteroaryl, heterocyclyl, -CN, -C(=O)R 110 , -C(=O)OR 110 -C(=O)N(R 110 )2, -N(R 110 )2, -SO2R 110 -S(=O)2N(R 110 )2, -C(=O)N(R 110 )N(R 110 )2 or -C(=O)N(R 11 )(OR 110 ) However, the aryl, heteroaryl, cycloalkyl or heterocyclyl may have 1 to 4 R 60a It is replaced by, in this case, Each R 60a These are independently -Z, -Y'-Z, or -XYZ; Each R C -L 30 -R 70 However, Each L30 They can be independent, bonded, or -(CH2) m -V 10 -(CH2) n - and in the formula, V 10 -C(R 110 )2-, -C(R 110 )2C(R 110 )2, -C(R 110 )=C(R 110 )-,-C(R 110 )2O-, -C(R 110 )2NR 110 -, -C≡C-, -O-, -S-, -NR 10 -, -N(R 100 )CO-, -N(R 100 )CO2-, -OCO-, -CO-, -CS-, -CONR 100 -, -C(=NR 110 )-, -C(=N-OR 110 )-, -C[=NN(R 110 )2], -CO2-, -OC(=O)-, -OC(=O)N(R 100 )-, SO2-, -N(R 100 )SO2-, -SO2N(R 100 )-, -NR 100 CONR 100 -, -NR 100 CSNR 100 - C3-C6 cycloalkyl or C3-C6 cyclohaloalkyl, Or, each L 30 These are independently C2-C6 alidicates, however, the alidic chain may be -C(R 110 )2-, -C(R 110 )2C(R 110 )2-, -C(R 110 )C(R 110 )-,-C(R 110 )2O-, -C(R 110 )2NR 110 -, -C≡C-, -O-, -S-, -N(R 100 )CO-, -N(R 100 )CO2-, -NR 110 -, -CON(R100 )-, -CO-, -CO2-, -O(C=O)-, -O(C=O)N(R 100 )-, -SO2-, -N(R 100 )SO2- or -SO2N(R 100 )- Interrupted by, Each R 70 These are independently hydrogen, halogen, nitro, aryl, heteroaryl, heterocyclyl, -Z, -YZ, or -X-YZ, In this case, the aryl, heteroaryl, and heterocyclyl each have, depending on the case, 1 to 4 R 70a Substituted by, however each R 70a These are independently aryloxy, aralkyloxy, aryloxyalkyl, arylC0-C6 alkylcarboxy, C(R 110 )=C(R 110 )COOH, oxo, -Z, -Y'-Z or -XYZ, and each R 70a Depending on the case, 1 to 4 R 80 Substituted by, however each R 80 These independently include halogens, C1-C6 alkyls, C1-C6 alkoxys, C1-C8 haloalkyls, and C1-C8 haloalkyls (OR 110 ), C0~C6 alkyl OR 110 , C0~C6alkylCON(R 110 )2, C0~C6 alkyl COR 110 C0-C6 alkyl COOR 110 or C0-C6 alkylSO2R 110 is; Each R 100 -R is independent. 110 -C(=O)R 110 , -CO2R 110 or -SO2R 110 is; Each R 110 These are independently -hydrogen, -C1~C6 alkyl, C2~C6 alkenyl, -C1~C6 alkynyl, -C1~C6 haloalkyl or -N(R 12 )2, however, R 110 In any case, R 120It is replaced by one to four groups: Each R 120 These are independently halogen, cyano, nitro, oxo, -B(OR 130 ), C0~C6 alkylN(R 13 )2, C1-C6 haloalkyl, C1-C6 alkyl, C1-C6 alkoxy, (C0-C6 alkyl)C=O(OR 130 ), C0~C6 alkyl OR 130 C0-C6 alkyl COR 130 , C0-C6 alkylSO2R 130 , C0~C6alkylCON(R 13 )2, C0~C6 alkyl CONR 130 Ure 130 , C0~C6 alkylSO2N(R 130 )2, C0-C6 alkyl SR 130 , C0~C6 haloalkyl OR 130 , C0~C6 alkyl CN, -C0~C6 alkyl N(R 13 )2, -NR 13 SO2R 13 or -OC 0~6 Alkyl COOR 130 is; Each R 130 These are independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl; Each R 140 These are independently C1-C6 alkyl, C1-C6 alkoxy, halogen, C1-C6 haloalkyl, and C0-C6 alkylCON(R) 110 ) o C0-C6 alkylCONR 110 R 10 , C0~C6 alkyl OR 110 or C0-C6 alkyl COOR 110 is; and Each R 150 These are independently hydrogen, halogen, OR 130 , (C1~C6) alkyl or (C1~C6) haloalkyl, however, Each alkyl group can, depending on the case, independently be a halogen, cyano, nitro, azide, or OR130 , C(O)R 130 , C(O)OR 13 C(O)N(R 130 )2, N(R 130 )2, N(R 130 )C(O)R 130 , N(R 130 )S(O)2R 130 , -OC(O)OR 130 , OCN(R) 130 )2, N(R 130 )C(O)OR 130 , N(R 130 )C(O)N(R 130 ), SR 130 S(O)R 130 , S(O)2R' or S(O)2N(R 130 Substituted by at least one group which is 2, or two R groups which are bonded to the same or different atoms. 150 These can combine to form C3-C6 cycloalkyl groups; Each X is independently -O-, -S-, or -N(R 100 )-is; Each Y is independent, -[C(R 150 )2] p - or -C2~C6 alkenyl, where p is 1, 2, 3, 4, 5, or 6; Each Y' is independent of -[C(R 150 )2] p -, -C2~C6 alkenyl C3~C8 cycloalkyl or heterocyclyl, wherein the cycloalkyl or heterocyclyl may be substituted with one to three Z groups: Each Z independently represents -H, halogen, and -OR. 110 , -SR 110 -C(=O)R 110 , -C(=O)OR 110 -C(=O)N(R 110 )2, -N(R 100 )2, -N3, -NO2, -C(=N-OH)R 110 -C(=S)N(R 110 )2, -CN, -S(=O)R 110, -S(=O)N(R 110 )2, -S(=O)OR 110 , -S(=O)2R 110 , S(=O)2N(R 110 )2, -NR 110 COR 110 , -N(R 110 )C(=O)N(R 110 )2, -N(R 110 )COOR 110 , -N(R 110 )S(=O)2R 110 -C(=O)N(R 110 )N(R 110 )2, -C(=O)N(R 110 )(OR 110 ), -OC(=O)-R 110 , -OC(=O)-OR 110 or -OC(=O)-N(R 110 )2; and Each of m and n is independently 0, 1, 2, 3, 4, 5, or 6.

[0079] In some embodiments, the compound of formula IV has the structure of formula V or formula VI as follows: [ka] In other embodiments, the compound of formula VI has the structure of formula VII as follows: [ka] In yet another embodiment, the compound of formula VI has the structure of formula VIII shown below: [ka] In further embodiments, the compound of formula VI has the structure of formula IX as follows: [ka] Therefore, compounds of formula IV that may be useful in the method of the present invention include, but are not limited to, compounds having the structure shown below and their pharmaceutically acceptable salts: [ka] TIFF2026062949000066.tif142103TIFF2026062949000067.tif188106 Furthermore, compounds of formula IV that may be useful in the method of the present invention are selected from the list of compounds including the following: 33, 2-(1-(3-chloro-3'-fluoro-4'-(hydroxymethyl)-5'-(methylsulfonyl)biphenyl-4-yl)-2-(2-(2,6-dichlorophenyl)propan-2-yl)-1H-imidazole-4-yl)propan-2-ol; 34, 2-(2-(2(2-chloro-3-fluorophenyl)propan-2-yl)-1-(3'-fluoro-4'-(hydroxymethyl)-5'(methylsulfonyl)biphenyl-4-yl)-1H-imidazole-4-yl)propan-2-ol; 35, 2-(2-(2(2,6-dichlorophenyl)propan-2-yl)-1-(3'-fluoro-4'-(Hydazole 36, 2-(2-(2(2,6-dichlorophenyl)propan-2-yl)-1-(3,3'-difluoro-4'-(hydroxymethyl)-5'(methylsulfonyl)biphenyl-4-yl)-1H-imidazole-4-yl)propan-2-ol; and 37, 2-(2-[1(2,6-dichlorophenyl)ethyl]-1-[3,3'-difluoro-4'-(hydroxymethyl)-5'(methylsulfonyl)biphenyl-4-yl]-1H-imidazole-4-yl)propan-2-ol. Compound 12 is also known as Ex.9 of WO2010 0138598. Compound 38 is also known as Ex.19 of WO2007 002563. Compound 39 is also known as WO2012 0135082.

[0080] Compounds of formula IV can be synthesized as described in PCT publication number US2010 / 0069367 and international publication WO2010 / 138598 (these are incorporated herein by reference).

[0081] LXR agonists that can be used to treat and / or prevent metastasis include compound 24 or its pharmaceutically acceptable salts: [ka] In further embodiments, compounds that can be used to treat and / or prevent the transition may be found in the following PCT publications: WO2006 / 094034, WO2008 / 049047, WO2009 / 020683, WO2009 / 086138, WO2009 / 086123, WO2009 / 086130, WO200 9 / 086129, WO2007 / 002559, WO2007 / 002563, WO2007 / 081335, WO2006 / 017055, WO2006 / 102067, WO20 09 / 024550, US2006 / 0074115, US2006 / 0135601, WO2009 / 021868, WO2009 / 040289, WO2007 / 047991, WO 2007 / 050425, WO2006 / 073363, WO2006 / 073364, WO2006 / 073365, WO2006 / 073366, WO2006 / 073367, U S2009 / 0030082, WO2008 / 065754, JP2008 / 179562, WO2007 / 092065, US2010 / 0069367, US7998995, US7 247748, WO2010 / 138598, US7365085, US75776215, US63136503, US2004 / 0072868, US2005 / 0107444, US2005 / 0113580, US2005 / 0131014, US2005 / 0282908, US2009 / 0286780 (these are incorporated herein by reference).

[0082] LXRα and LXRβ were initially discovered by numerous groups at roughly the same time (Apfel et al., 1994; Willy et al., 1995; Song et al., 1994; Shinar et al., 1994; Teboul et al., 1995), and belong to a family of nuclear hormone receptors that are endogenously activated by cholesterol and its oxidized derivatives to mediate the transcription of genes involved in glucose, cholesterol, and fatty acid metabolism (Janowski et al., 1996; Calkin and Tontonoz, 2012). Given the intricate link between lipid metabolism and cancer cell growth (Cairns et al., 2011), the ubiquitous expression of LXRβ in melanoma is unlikely to be a coincidence, as it allows melanoma cells to synthesize lipid and lipoprotein particles to sustain their growth. However, at the same time, such stable basal expression levels make LXRβ an ideal therapeutic target, as exemplified by the widespread responsiveness of melanoma cells to LXRβ activation therapy.

[0083] Various compounds have been shown to exhibit selectivity for LXRβ or LXRα. This selectivity may enable increased activity and / or reduced out-of-target effects. Examples of compounds with selectivity for LXRβ or LXRα are shown in Table 1.

[0084] [Table 1] As used herein, references to the activity of LXR agonists in LXRα and LXRβ refer to the activity measured using the ligand sensing assay (LiSA) described in Spencer et al., Journal of Medicinal Chemistry, 2001, 44, 886-897 (which is incorporated herein by reference). In some embodiments, the LXR agonist has an EC50 of less than 1 μM (e.g., 0.5 nm to 500 nM, 10 nM to 100 nM) in the ligand sensing assay. For example, the method of the present invention can be carried out using an LXRβ agonist having activity against LXRβ at least three times greater than the activity of the agonist against LXRα, or an LXRβ agonist having activity against LXRβ at least ten times greater than the activity of the agonist against LXRα, or an LXRβ agonist having activity against LXRβ at least 100 times greater than the activity of the agonist against LXRα, or an LXRβ agonist having activity against LXRβ at least three times or less than the activity of the agonist against LXRα. In LiSA assays, the term "greater activity" means lower EC 50 This shows that, for example, GW3965[2] is LXRα(EC 50 LXRβ(EC) =190) 50 It has approximately 6 times greater activity than (=30).

[0085] As used herein, the term "increases ApoE expression levels in vitro" means that a particular LXR agonist can increase ApoE expression levels 2.5-fold in the qPCR assay of Example 21 at concentrations less than 5 μM (e.g., concentrations between 100 nM and 2 μM, or less than 1 μM). LXR agonists exhibiting this in vitro effect may be highly useful for use in the methods of the present invention.

[0086] As used in this application, the term "alkyl" refers to saturated branched or unbranched aliphatic monovalent substituents. Alkyl substituents have 1 to 100 carbon atoms (e.g., 1 to 22 carbon atoms, 1 to 10 carbon atoms, 1 to 6 carbon atoms, 1 to 3 carbon atoms). Thus, examples of alkyl substituents include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, and n-hexyl.

[0087] The term "alkoxy" represents a chemical substituent of the formula -OR, where R is a optionally substituted C1-C6 alkyl group unless otherwise specified. In some embodiments, the alkyl group can be substituted; for example, the alkoxy group is It may have one, two, three, four, five, or six substituents as defined in the specification.

[0088] The term "alkoxyalkyl" refers to a heteroalkyl group (as defined herein) described as an alkyl group substituted with an alkoxy group. Exemplary unsubstituted alkoxyalkyl groups contain between 2 and 12 carbon atoms. In some embodiments, the alkyl and alkoxy groups may each be further substituted with one, two, three, or four substituents as defined herein for each group.

[0089] As used herein, the term "cycloalkyl" refers to monocyclic, bicyclic, or tricyclic substituents, which may be saturated or partially saturated, i.e., having one or more double bonds. Monocyclic substituents are exemplified by saturated cyclic hydrocarbon groups containing 3 to 8 carbon atoms. Examples of monocyclic cycloalkyl substituents include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl. Bicyclic condensed cycloalkyl substituents are exemplified by cycloalkyl rings that condense to another cycloalkyl ring. Examples of bicyclic cycloalkyl substituents include, but are not limited to, decalin and 1,2,3,7,8,8a-hexahydro-naphthalene. Tricyclic cycloalkyl substituents are exemplified by cycloalkyl bicyclic condensed rings that condense to further cycloalkyl substituents.

[0090] As used in this application, the term "alkylene" refers to saturated branched or unbranched aliphatic divalent substituents (for example, alkylene substituents have 1 to 6 carbon atoms and 1 to 3 carbon atoms). Therefore, examples of alkylene substituents include methylene, ethylene, trimethylene, propylene, tetramethylene, isopropylidene, pentamethylene, and hexamethylene.

[0091] The term "alkenylene or alkenyl," as used in this application, refers to an unsaturated, branched or unbranched aliphatic divalent substituent having a double bond between two adjacent carbon atoms (for example, alkenylene substituents have 2 to 6 carbon atoms and 2 to 4 carbon atoms). Thus, examples of alkenylene substituents include, but are not limited to, vinylene, 1-propenylene, 2-propenylene, methylvinylene, 1-butenylene, 2-butenylene, 3-butenylene, 2-methyl-1-propenylene, 2-methyl-2-propenylene, 2-pentenylene, and 2-hexenylene.

[0092] The term "alkynylene or alkynyl," as used in this application, refers to an unsaturated, branched or unbranched aliphatic divalent substituent having a triple bond between two adjacent carbon atoms (for example, an alkynylene substituent has 2 to 6 carbon atoms and 2 to 4 carbon atoms). Examples of alkynylene substituents include, but are not limited to, ethynylene, 1-propynylene, 1-butynylene, 2-butynylene, 1-pentynylene, 2-pentynylene, 3-pentynylene, and 2-hexynylene.

[0093] As used in this application, the term "alkadienylene" refers to an unsaturated, branched or unbranched aliphatic divalent substituent having two double bonds between two adjacent carbon atoms (for example, an alkadienylene substituent has 4 to 10 carbon atoms). Therefore, examples of alkadierine substituents include, but are not limited to, the substituents 2,4-pentadienylene, 2,4-hexadienylene, 4-methyl-2,4-pentadienylene, 2,4-heptadienylene, 2,6-heptadienylene, 3-methyl-2,4-hexadienylene, 2,6-octadierine, 3-methyl-2,6-heptadienylene, 2-methyl-2,4-heptadienylene, 2,8-nonadienylene, 3-methyl-2,6-octadierine, 2,6-decadienylene, 2,9-decadienylene, and 3,7-dimethyl-2,6-octadierine.

[0094] The term “heteroaliphatic substituent or heteroalkyl,” as used herein, refers to a monovalent or divalent substituent in which one or more carbon atoms are substituted by a heteroatom, for example, an oxygen atom, a sulfur atom, a nitrogen atom, a phosphorus atom, or a silicon atom, wherein the nitrogen atom and the sulfur atom may be oxidized, and the nitrogen heteroatom may be quaternized. The O, N, and S atoms of the heteroatom may be located at any internal position of the heteroaliphatic substituent. Examples include -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -CH2-CH=N-OCH3, and -CH=CH-N(CH3)-CH3. Heteroaliphatic substituents may be linear or branched and saturated or unsaturated.

[0095] In one embodiment, the heteroaliphatic substituent has 1 to 100 carbon atoms (e.g., 1 to 42 carbon atoms). In yet another embodiment, the heteroaliphatic substituent is a polyethylene glycol residue.

[0096] As used herein, “aromatic substituent or aryl” is intended to mean any stable monocyclic, bicyclic, or polycyclic carbon ring having up to 10 atoms in each ring, where at least one ring is aromatic and may be unsubstituted or substituted. Examples of such aromatic substituents include phenyl, p-truenyl(4-methylphenyl), naphthyl, tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl, or acenaphthyl. If the aromatic substituent is bicyclic and one ring is non-aromatic, it is understood that the bond is via the aromatic ring.

[0097] The term “alkylaryl substituent or arylalkyl” refers to an alkyl substituent as described above in which one or more bonds to contained hydrogen are replaced by a bond to any of the aryl substituents described above. It is understood that the arylalkyl substituent leads to the carbonyl group in the compound of the present invention via a bond from the alkyl substituent. Examples of arylalkyl substituents include, but are not limited to, benzyl(phenylmethyl), p-trifluoromethylbenzyl(4-trifluoromethylphenylmethyl), 1-phenylethyl, 2-phenylethyl, 3-phenylpropyl, and 2-phenylpropyl.

[0098] The term "heteroaromatic substituent or heteroaryl," as used herein, refers to a stable monocyclic, bicyclic, or polycyclic ring having up to 10 atoms in each ring, wherein at least one ring is aromatic and contains 1 to 4 heteroatoms selected from the group consisting of O, N, and S. Bicyclic heteroaromatic substituents include: a) It condenses into a 6-membered aromatic (unsaturated) heterocyclic ring having one nitrogen atom, b) Condensing into a 5-membered or 6-membered aromatic (unsaturated) heterocyclic ring having two nitrogen atoms, c) Condensing into a 5-membered aromatic (unsaturated) heterocyclic ring having one nitrogen atom together with either one oxygen atom or one sulfur atom, or d) Condensation into a 5-membered aromatic (unsaturated) heterocyclic ring having one heteroatom selected from O, N, and S. It contains a phenyl ring, a pyridine ring, a pyrimidine ring, or a pyrididine ring.

[0099] Heteroaryl groups within the scope of this definition include, but are not limited to, the following groups: benzimidazolyl, benzofuranil, benzofuranil, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbonyl, cinnolinyl, furanil, indolinyl, indolyl, indazinyl, indazolyl, isobenzofuranil, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthopyridinyl, oxadiazo Ryl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranil, pyrazinyl, pyrazolyl, pyridadinyl, pyridopyridinyl, pyridadinyl, pyridyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrazolyl, tetrazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, azetidinyl, aziridinyl, 1,4-dioxanyl, hexahydroazepinyl, dihydrobenzimidazolyl, dihydrobenzofuranyl, dihydrobenzothio Phenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisoxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, dihydroxazolyl, dihydropyrazine, dihydropyrazine, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiozolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, meth Didioxybenzoyl, tetrahydrofuranyl, tetrahydrothienyl, acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrazolyl, indolyl, benzotriazolyl, benzothiazolyl, benzoxazolyl, isoxazolyl, isothiazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, quinolinyl, isoquinolinyl, oxazolyl, isoxazolyl, indolyl, pyrazinyl, pyridadinyl, pyridinyl, pyrimidinyl, pyrrolyl, tetrahydroquinoline. When the heteroaryl substituent is bicyclic and one ring is non-aromatic or does not contain a heteroatom, the bond is understood to be either via an aromatic ring or via a heteroatom-containing ring, respectively.If a heteroaryl contains a nitrogen atom, it is understood that its corresponding N-oxide is also included by the present invention.

[0100] Aliphatic substituents, heteroaliphatic substituents, aromatic substituents, and heteroaromatic substituents may be substituted, once or more times, in the same or different manner, with one or more substituents, including (but not limited to) the following groups: aliphatic substituents, heteroaliphatic substituents, aromatic substituents, and heteroaromatic substituents, aryl, heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio; heteroarylthio; F; Cl; Br; I; -OH; -NO2; -CN; -CF3; -CH2CF3; -CHCl2; -CH2OH; -CH2CH2OH; -CH2NH2; -CH2SO2CH3; -C(O)R x ;-CO2(R x );-CON(R x )2;-OC(O)R x ;-OCO2R x ;-OCON(R x )2;-N(R X )2;-S(O)R x ;-S(O)2R x ;-NR x (CO)R x However, in these formulas, R xEach of these entities independently includes, but is not limited to, aliphatic, alicyclic, heteroaliphatic, heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl, or heteroalkylheteroaryl substituents, in which any of the aliphatic substituents, alicyclic substituents, heteroaliphatic substituents, heterocyclic substituents, alkylaryl substituents, or alkylheteroaryl substituents described above and herein may be substituted or unsubstituted, branched or unbranched, saturated or unsaturated, and any of the aromatic substituents, heteroaromatic substituents, aryl substituents, heteroaryl substituents, (alkyl)aryl substituents, or (alkyl)heteroaryl substituents described above and herein may be substituted or unsubstituted. In addition, it will be understood that any two adjacent substituents together may represent a substituted or unsubstituted 4-membered, 5-membered, 6-membered, or 7-membered alicyclic or heterocyclic substituent. Further examples of generally applicable substituents are illustrated by the specific embodiments shown below.

[0101] The terms "halo" and "halogen" refer to halogen atoms selected from the group consisting of F, Cl, Br, and I.

[0102] The terms "alkyl halogenated substituent" and "haloalkyl" refer to alkyl substituents as defined above that are substituted with at least one halogen atom. In one embodiment, the alkyl halogenated substituent is perhaled. In another embodiment, the perfluoroalkyl is a compound of the formula C n F 2n+1 This shows a monovalent perfluorinated alkyl halide substituent. For example, an alkyl halide substituent may have 1 to 6 carbon atoms (e.g., 1 to 3 carbon atoms). Therefore, examples of alkyl groups include trifluoromethyl, 2,2,2-trifluoroethyl, n-perfluoropropyl, n-perfluorobutyl, and n-perfluoropentyl.

[0103] The term "amino" as used herein is -N(R N1 ) represents 2, however, in the formula, each R N1 These independently produce H, OH, NO2, and N(R) N2 )2, SO2OR N2 SO2R N2 SOR N2 , N-protecting group, alkyl, alkenyl, alkynyl, alkoxy, aryl, alkalyl, cycloalkyl, alkcycloalkyl, heterocyclyl (e.g., heteroaryl), alkheterocyclyl (e.g., alkheteroaryl), or two R N1 Together, they form a heterocycline or an N-protecting group, and each R N2 These are independently H, alkyl, or aryl. In preferred embodiments, the amino is -NH2 or -NHR N1 And, however, in the formula, R N1 These are independently OH, NO2, NH2, and NR N2 2. SO2OR N2 SO2R N2 SOR N2 , alkyl or aryl, and each R N2 The group may be H, alkyl, or aryl. The term “aminoalkyl” as used herein refers to a heteroalkyl group (as defined herein) described as an alkyl group (as defined herein) substituted with an amino group (as defined herein). Each alkyl and amino group may be further substituted with one, two, three, or four substituents, as described herein for each group. For example, the alkyl group may contain an oxo (=O) substituent.

[0104] As used herein, the term “aryloxy” refers to an aromatic or heteroaromatic system linked to another residue via an oxygen atom. A typical example of an O-aryl is phenoxy. Similarly, “arylalkyl” refers to an aromatic or heteroaromatic system linked to another residue via a carbon chain (saturated or unsaturated) (including its heteroforms), typically via a C1-C8 carbon chain, a C1-C6 carbon chain, or more specifically via a C1-C4 or C1-C3 carbon chain (including their heteroforms) when saturated, or via a C2-C8 carbon chain, a C2-C6 carbon chain, a C2-C4 carbon chain, or a C2-C3 carbon chain (including their heteroforms) when unsaturated. More certainly, therefore, arylalkyls include an aryl or heteroaryl group as defined above, linked to an alkyl component, a heteroalkyl component, an alkenyl component, a heteroalkenyl component, an alkynyl component, or a heteroalkynyl component, as similarly defined above. Typical arylalkyls include aryl(C6-C12)alkyl(C1-C8), aryl(C6-C12)alkenyl(C2-C8), or aryl(C6-C12)alkynyl(C2-C8), as well as their heteromorphs. A typical example is phenylmethyl, which is commonly known as benzyl.

[0105] Typical substituents on aromatic or heteroaromatic groups, as needed, include independently halo, CN, NO2, CF3, OCF3, COOR', CONR'2, OR', SR', SOR', SO2R', NR'2, NR'(CO)R', NR'C(O)OR', NR'C(O)NR'2, NR'SO2NR'2, or NR'SO2R', where each R' is independently substituted with H, or a group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, heteroaryl, and aryl (all as defined above); or the substituent is a group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, aryl, heteroaryl, O-aryl, O-heteroaryl, and arylalkyl.

[0106] Substitutions as needed on non-aromatic groups (e.g., alkyl, alkenyl, and alkynyl groups) are typically selected from the same list of preferred substituents for aromatic or heteroaromatic groups, unless otherwise noted herein. Non-aromatic groups may also include substituents selected from =O and =NOR' (wherein R' is a group substituted with H, or a group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, heteroaryl, and aryl (all as defined above)).

[0107] In general, substituents (e.g., alkyl, alkenyl, alkynyl, or aryl (including all heteroforms defined above)) may be substituted by further substituents. The properties of these substituents are similar to those enumerated for substituents in the basic structures above. Thus, if one embodiment of a substituent is alkyl, this alkyl may be substituted by other substituents listed as substituents whose substitution has chemical significance and whose substitution does not impair the size limit of the alkyl itself; for example, alkyls substituted by alkyl or by alkenyl are not included for these embodiments, as they would simply extend the upper limit of carbon atoms. However, alkyls substituted by aryl, amino, and halo, etc., would be included. For example, if a group is substituted, that group may be substituted by one, two, three, four, five, or six substituents. Substituents as needed include, but are not limited to, the following groups: C1-C6 alkyl or heteroaryl, C2-C6 alkenyl or heteroalkenyl, C2-C6 alkynyl or heteroalkynyl, halogen; aryl, heteroaryl, azide (-N3), nitro (-NO2), cyano (-CN), acyloxy (-OC(=O)R'), acyl (-C(=O)R'), alkoxy (-OR'), amide (-NR'C(=O)R'' or -C(=O)NRR'), amino (-NRR'), carboxylic acid (-CO2H), carboxylic acid ester (- CO2R'), carbamoyl (-OC(=O)NR'R'' or -NRC(=O)OR'), hydroxy(-OH), isocyano(-NC), sulfonate(-S(=O)2OR), sulfonamide(-S(=O)2NRR' or -NRS(=O)2R') or sulfonyl(-S(=O)2R), where in these formulas, each R or R' is independently selected from H, C1-C6 alkyl or heteroaryl, C2-C6 alkenyl or heteroalkenyl, 2C-6C alkynyl or heteroalkynyl, aryl or heteroaryl. The substituted group may have, for example, one, two, three, four, five, six, seven, eight or nine substituents.

[0108] The term "heterocyclyl, heterocyclic, or Het" as used herein, unless otherwise specified, refers to a compound independently selected from the group consisting of nitrogen, oxygen, and sulfur. The term "heterocyclyl" also refers to a heteroalkyl or heteroalkenyl cyclic ring containing one, two, three, or four heteroatoms, for example, a 3-membered, 4-membered, 5-membered, 6-membered, or 7-membered ring. A 5-membered ring has 0 to 2 double bonds, and 6-membered and 7-membered rings have 0 to 3 double bonds. The term "heterocyclyl" also refers to a heterocyclic compound having a bridged polycyclic structure in which one or more carbons and / or heteroatoms bridge two non-adjacent members of a monocyclic ring, for example, a quinuclidinyl group. The term "heterocyclyl" includes bicyclic, tricyclic, and tetracyclic groups in which any of the above heterocyclic rings condense with one, two, or three carbocyclic rings (e.g., aryl rings, cyclohexane rings, cyclohexene rings, cyclopentane rings, cyclopentene rings) or another monocyclic heterocyclic ring (e.g., indolyl, quinolyl, isoquinolyl, tetrahydroquinolyl, benzofuryl, and benzothienyl).

[0109] Some of the compounds of the present invention may contain one or more stereogenic centers and therefore may exist in various isomeric forms, for example, as stereoisomers and / or diastereomers. Accordingly, the compounds of the present invention and their pharmaceutical compositions may be in the form of individual enantiomers, diastereomers or geometric isomers, or in the form of mixtures of stereoisomers. In certain embodiments, the compounds of the present invention are enantiopurine compounds. In certain other embodiments, mixtures of stereoisomers or diastereomers are provided. Furthermore, when the compounds of the present invention exist in tautomeric forms, each tautomer is encompassed herein.

[0110] Furthermore, certain compounds may have one or more double bonds that can exist as either a Z isomer or an E isomer, unless otherwise specified herein. The present invention further encompasses compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers, for example, as a racemic mixture of stereoisomers. In addition to the compounds themselves as described above, the present invention also encompasses pharmaceutically acceptable derivatives of these compounds, and compositions comprising one or more compounds of the present invention and one or more pharmaceutically acceptable excipients or additives.

[0111] Treatment method As disclosed herein, miR-1908, miR-199a-3p, miR-199a-5p, and CTGF have been identified as endogenous metastasis promoters of metastatic invasion, endothelial recruitment, and colony formation in melanoma, while DNAJA4, ApoE, LRP1, LRP8, LXR, and miR7 function as metastasis inhibitors or metastasis inhibitors in the same processes. In addition, these miRNAs have been found to convergently target ApoE and the heat shock factor DNAJA4. ApoE secreted by cancer suppresses invasion and endothelial recruitment by activating the LRP1 receptor on melanoma cells and the LRP8 receptor on endothelial cells, respectively. DNAJA4 consequently induces ApoE expression. These miRNAs strongly predict the outcome of metastasis in humans. Pretreatment with locked nucleic acids (LNAs) targeting miR-199a-3p, miR-199a-5p, and miR-1908 inhibits metastasis to numerous organs, while therapeutic delivery of these LNAs significantly suppresses metastasis of human melanoma cells in a mouse model.

[0112] Accordingly, the present invention provides a method for treating melanoma by increasing the expression level or activity level of one of the metastasis inhibitors in a target. This increase can be achieved, in particular, by the forced expression of one or more of the metastasis inhibitors DNAJA4, ApoE, LRP1, and LRP8, or by decreasing the expression level or activity level of one or more of miR-199a-3p, miR-199a-5p, and miR-1908. In addition, treatment can be achieved by decreasing the expression level or activity level of one or more metastasis promoters.

[0113] The present invention also provides methods for treating angiogenic disorders or disorders of angiogenesis in a subject. The terms “angiogenic disorders,” “disorders of angiogenesis,” and “disorders of angiogenesis” are used interchangeably herein and refer to disorders characterized by pathological angiogenesis. Disorders characterized by pathological angiogenesis refer to disorders in which abnormal or deviant angiogenesis, alone or in combination with others, is a cause, initiation, or symptom of the disorder. Examples of such disorders include various cancers (e.g., angiogenic tumors), eye disorders, and inflammatory disorders.

[0114] Typical angioplasty tumors that can be treated by the above methods include solid tumors (especially carcinomas) that require vascular components to provide oxygen and nutrients. Exemplary solid tumors include, but are not limited to, carcinomas of the lungs, breasts, bones, ovaries, stomach, pancreas, pharynx, esophagus, testes, liver, parotid gland, biliary tract, colon, rectum, cervix, uterus, endometrium, kidneys, bladder, prostate, thyroid, squamous cell carcinoma, adenocarcinoma, small cell carcinoma, melanoma, glioma, glioblastoma, neuroblastoma, Kaposi's sarcoma, and sarcoma.

[0115] Many disorders or conditions other than cancer can also be treated in the manner described above. Examples include arthritis, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic retinopathy, age-related macular degeneration, Graves' disease, vascular restenosis (including restenosis after angioplasty), arteriovenous malformations (AVMs), meningiomas, hemangiomas, neovascular glaucoma, chronic kidney disease, diabetic nephropathy, polycystic kidney disease, interstitial lung disease, pulmonary hypertension, chronic obstructive pulmonary disease (COPD), emphysema, autoimmune hepatitis, chronic inflammatory liver disease, cirrhosis, cutaneous T-cell lymphoma, rosacea, and basal cell carcinoma.

[0116] Other treatment targets include, for example, those described in U.S. Patent Publication Nos. 2009004297, 20090175791, and 20070161553, and include, for example, angiofibromas, atheromas, corneal transplant angiogenesis, hemophilic arthritis, hypertrophic scars, Osler-Weber syndrome, pyogenic granulomas, post-lens fibroplasia, scleroderma, trachoma, vascular adhesions, synovitis, dermatitis, various other inflammatory diseases and disorders, as well as endometriosis.

[0117] Forced expression of metastasis inhibitors Both the polypeptides of the translocation inhibitors described above (e.g., DNAJA4, ApoE, LRP1, LRP8, and LXR) and the nucleic acids encoding these polypeptides can be used to carry out the present invention. Many polypeptide preparations can be used, but highly purified or isolated polypeptides are preferred. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to describe the sequence of amino acid residues in a polymer. Peptides, polypeptides, or proteins may consist of 20 standard naturally occurring amino acids, in addition to rare amino acids and synthetic amino acid analogs. Peptides, polypeptides, or proteins can be any chain of amino acids, regardless of length or post-translational modifications (e.g., glycosylation or phosphorylation).

[0118] The polypeptides of the "present invention" include fusions or chimeric forms produced by the recombination or synthesis of any of the translocation inhibitors described above, having specific domains or portions involved in the network. The term also encompasses polypeptides having an added amino-terminal methionine (useful for expression in prokaryotic cells).

[0119] The scope of this invention includes fusion proteins containing one or more of the sequences described above and heterologous sequences. “Chimera” or “fusion” indicates that amino acid sequences of different origins are combined in a single polypeptide chain by a combination of the reading frames of the nucleotide sequences they encode. This term explicitly includes internal fusions, i.e., insertions of sequences of different origins within a polypeptide chain, in addition to fusions to one of its ends. Heterologous polypeptides, nucleic acids, or genes are of different species, or, if of the same species, are substantially modified from their original form. Two fused domains or sequences are heterologous if they are not adjacent to each other in naturally occurring proteins or nucleic acids.

[0120] "Isolated" or "purified" polypeptides refer to polypeptides isolated from other proteins, lipids, and nucleic acids that associate in nature. Polypeptides can constitute at least 10% by dry weight of the purified preparation (i.e., any percentage between 10% and 100%, for example, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 99%). Purity can be measured by any appropriate standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC. The isolated polypeptides described in this invention can be purified from natural sources and can be produced by recombinant DNA technology or by chemical methods.

[0121] "Recombinant" polypeptides refer to polypeptides produced by recombinant DNA technology, i.e., polypeptides produced from cells transformed with an exogenous DNA construct encoding the desired polypeptide. "Synthetic" polypeptides refer to polypeptides prepared by chemical synthesis. The term "recombinant," when used, for example, in relation to cells, nucleic acids, proteins, or vectors, indicates that the cells, nucleic acids, proteins, or vectors have been modified by the introduction of heterologous nucleic acids or proteins, or by alterations of inherent nucleic acids or proteins, or that the cells originate from such modified cells.

[0122] "Overexpression" refers to the expression of RNA or polypeptide encoded by nucleic acids introduced into a host cell, where either such RNA or polypeptide or protein is not normally present in the host cell, or such RNA or polypeptide is present in the host cell at a level higher than that normally expressed from the endogenous gene encoding the RNA or polypeptide.

[0123] The amino acid composition of each of the polypeptides described above may be altered without interfering with their function, that is, without interfering with upregulating the aforementioned network (e.g., increasing the activation level of the ApoE / LRP signaling pathway) and thereby inhibiting translocation to multiple organs. For example, the amino acid composition may contain one or more conservative amino acid substitutions. A “conservative amino acid substitution” is an amino acid substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Various sets of amino acid residues having similar side chains are defined in this art. These groups include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and amino acids with β-branched side chains (e.g., threonine). The amino acids include ammonium compounds (e.g., valine, isoleucine) and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, a predicted non-essential amino acid residue in one of the above polypeptides (e.g., SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18) is preferably replaced by another amino acid residue from the same side-chain population. In the substitution, the mutation can be introduced randomly along the whole or part of the sequence, for example by saturation mutagenesis, and the resulting mutants can be screened to see if they can upregulate the network or ApoE / LRP signaling pathway described above, and whether they can induce a cellular response to identify mutants that retain activity, as described in the examples below.

[0124] A functional equivalent of the polypeptide of the present invention represents a derivative of the polypeptide, for example, a protein having one or more point mutations, insertions, deletions, shortenings, fusion proteins, or combinations thereof. The functional equivalent substantially retains the activity of the polypeptide described above. The isolated polypeptide of the present invention may contain one sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, and 18, or a functional equivalent or fragment thereof. Generally, a functional equivalent has at least 75% identity (for example, any number between 75% and 100%, including, for example, 70%, 80%, 85%, 90%, 95%, and 99%) to one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, and 18.

[0125] The polypeptides described in this invention can be obtained as recombinant polypeptides. To prepare recombinant polypeptides, the nucleic acid encoding the polypeptide can be ligated to another nucleic acid encoding a fusion partner (e.g., glutathione-s-transferase (GST), a 6×-His epitope tag, or an M13 gene 3 protein). The resulting fusion nucleic acid is used to express a fusion protein in a suitable host cell, which can be isolated by methods known in the art. The isolated fusion protein can be further processed, for example, by enzymatic digestion, to remove the fusion partner and obtain the recombinant polypeptide of the present invention. Alternatively, the polypeptide of the present invention can be chemically synthesized (see, for example, Creighton, “Proteins: Structures and Molecular Principles” (WH Freeman & Co., NY, 1983)). For further guidance, those skilled in the art should consult Ausubel et al. (Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd edition, 1987 & 1995) and Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold). You may also consult *Chemical Synthesis*, edited by Gait, MJ (Oligonucleotide Synthesis, IRL Press, Oxford, 1984).

[0126] For their function as cellular or membrane proteins, DNAJA4, LRP1, LRP8, and LXR can be linked to one or more amino acid sequences and similar sequences, including cell-permeable peptide (CPP) sequences, and can be conjugated or fused to them, for example. Thus, compositions of the present invention, such as those discussed below, may contain transport enhancers. Cell-permeable peptides (CPPs) generally consist of fewer than 30 amino acids and have a net positive charge. Various CPPs are internally transported in living animal cells in an endocytic or receptor / energy-independent manner. Several classes of CPPs exist with various origins, from entirely protein-derived CPPs to entirely synthetic CPPs via chimeric CPPs. Examples of various CPPs are known in the art. See, for example, U.S. Patent Application Publications 20090099066 and 20100279918. CPPs are known to be able to deliver exogenous proteins into various cells.

[0127] All of the naturally occurring, genetically modified, and chemically synthesized forms of the polypeptides described above may be used to carry out the inventions disclosed therein. Polypeptides obtained by recombinant DNA technology may have the same amino acid sequence as naturally occurring forms (e.g., one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, and 18) or their functional equivalents. These also include chemically modified forms. Examples of chemically modified polypeptides include polypeptides that undergo conformational changes, addition or deletion of side chains, and polypeptides to which compounds such as polyethylene glycol are attached. Once purified and tested by standard methods, or by methods described in the examples below, or by other methods known in the art, polypeptides can be incorporated into suitable compositions.

[0128] To express the factors described above, the present invention provides nucleic acids encoding any of the polypeptides described above. Preferably, the nucleotide sequence is isolated and / or purified. The nucleic acid represents a DNA molecule (e.g., cDNA or genomic DNA, but not limited thereto), an RNA molecule (e.g., mRNA, but not limited thereto), or a DNA analog or RNA analog. DNA analogs or RNA analogs can be synthesized from nucleotide analogs. Nucleic acid molecules can be single-stranded or double-stranded. “Isolated nucleic acid” is a nucleic acid whose structure is not identical to the structure of any naturally occurring nucleic acid or the structure of any fragment of a naturally occurring genomic nucleic acid. Therefore, this term encompasses, for example, the following: (a) DNA having a sequence of a portion of a naturally occurring genomic DNA molecule, but in which the molecule does not have both of the coding sequences located on either side of such portion of the molecule in the genome of an organism in nature; (b) nucleic acids incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in such a manner that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) distinct molecules such as cDNA, genomic fragments, fragments resulting from polymerase chain reaction (PCR), or restriction fragments; and (d) hybrid genes, i.e., recombinant nucleotide sequences that are part of a gene encoding a fusion protein.

[0129] The terms “RNA,” “RNA molecule,” and “ribonucleic acid molecule” are used interchangeably herein and refer to polymers of ribonucleotides. The terms “DNA,” “DNA molecule,” and “deoxyribonucleic acid molecule” refer to polymers of deoxyribonucleotides. DNA and RNA can be synthesized in nature (e.g., by DNA replication or DNA transcription, respectively). RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively).

[0130] The present invention also provides recombinant constructs having one or more of the nucleotide sequences described herein. Examples of such constructs include vectors (e.g., plasmids or viral vectors) in which the nucleic acid sequences of the present invention are inserted in a forward or reverse orientation. In preferred embodiments, the construct further includes various regulatory sequences, including promoters operably ligated to the sequences. A very large number of suitable vectors and The promoter is known to those skilled in the art and is commercially available. Suitable cloning and expression vectors for use with prokaryotic and eukaryotic hosts are also described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press).

[0131] Examples of expression vectors include chromosomal DNA sequences, non-chromosomal DNA sequences, and synthetic DNA sequences, and include, for example, derivatives of Simian virus 40 (SV40), bacterial plasmids, phage DNA, baculoviruses, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral DNA (e.g., vaccinia, adenovirus, fowlpox virus, and pseudorabies). However, any other vector may be used, as long as it is replicable and viable in the host. Appropriate nucleic acid sequences may be inserted into vectors by various procedures. Generally, a nucleic acid sequence encoding one of the polypeptides described above can be inserted into an appropriate restriction endonuclease site by procedures known in the art. Such procedures and related subcloning procedures are within the scope of the art.

[0132] The nucleic acid sequences in the expression vectors described above are preferably operably linked to appropriate transcriptional regulatory sequences (promoters) to guide mRNA synthesis. Examples of such promoters include the retroviral long-terminus (LTR) or SV40 promoter, the E. coli lac promoter or trp promoter, the phage lambda PL promoter, and other promoters known to regulate gene expression in prokaryotic or eukaryotic living cells or viruses. Expression vectors may also contain ribosome binding sites for translation initiation and transcriptional terminators. Vectors may also contain appropriate sequences for amplification of expression. In addition, expression vectors preferably contain one or more selection marker genes to provide phenotypic traits for selecting transformed host cells (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell cultures, or tetracycline or ampicillin resistance in E. coli).

[0133] Vectors containing suitable nucleic acid sequences as described above, as well as suitable promoter or regulatory sequences, can be used to transform suitable host cells to enable the host to express the polypeptides described above. Such vectors can be used in gene therapy. Examples of suitable expression hosts include bacterial cells (e.g., Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (yeast), insect cells (e.g., Drosophila and Spodoptera frugiperda (Sf9)), animal cells (e.g., CHO, COS, and HEK293), adenoviruses, and plant cells. The selection of a suitable host is within the scope of the art. In some embodiments, the present invention provides a method for producing the polypeptides described above by transfecting host cells with an expression vector having a nucleotide sequence encoding one of these polypeptides. The host cells are then cultured under suitable conditions that take polypeptide expression into consideration.

[0134] To reduce the expression or activity level of metastasis-promoting factors. As described above, inhibitory agents that reduce the expression or activity levels of miR-199a-3p, miR-199a-5p, miR-1908, or CTGF can be used when treating melanoma. Inhibitory agents (i.e., inhibitors) can be nucleic acids, polypeptides, antibodies, or small molecule compounds. In one example, inhibitors can affect transcription, mRNA stability, translation, protein stability / degradation, protein modification, and It functions at the level of protein binding.

[0135] Nucleic acid inhibitors can encode small interfering RNAs (e.g., RNAi agents) that target one or more of the aforementioned genes (e.g., CTGF) and inhibit their expression or activity. The term “RNAi agent” refers to RNA or its analogues that have sufficient sequence complementarity to the target RNA to induce RNA interference. Examples also include DNA that can be used to construct such RNAs. RNA interference (RNAi) refers to a sequence-specific or sequence-selective process in which a target molecule (e.g., a targeted gene, protein, or RNA) is downregulated. Generally, interfering RNAs ("iRNAs") are double-stranded short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), or single-stranded microRNAs (miRNAs) that result in the catalytic degradation of a particular mRNA and can also be used to reduce or inhibit gene expression.

[0136] The terms “short interfering RNA” or “siRNA” (these are also known as “small interfering RNA”) refer to RNA drugs (preferably double-stranded drugs) that are about 10 to 50 nucleotides in length, preferably between about 15 to 25 nucleotides, and more preferably about 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and whose strands may contain, for example, one, two, or three overhanging nucleotides (or nucleotide analogs) at the overhanging end, and that can lead or mediate RNA interference. Naturally occurring siRNAs are produced from longer dsRNA molecules (e.g., longer than 25 nucleotides) by the cellular RNAi machinery (e.g., Dicer or its homolog).

[0137] The terms “miRNA” or “microRNA” refer to RNA agents (preferably double-stranded agents) having a length of about 10 to 50 nucleotides, preferably between about 15 to 25 nucleotides, more preferably about 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, that can induce or mediate RNA interference. Naturally occurring miRNAs are produced by dicers from stem-loop precursor RNA (i.e., pre-miRNA). The term “dicer,” as used herein, includes dicers, as well as any dicer orthologues or dicer homologs that can process dsRNA structures into siRNA, miRNA, siRNA-like molecules, or miRNA-like molecules. The term microRNA (or "miRNA") is used interchangeably with the term "small transient RNA" (or "stRNA"), based on the fact that naturally occurring microRNAs (or "miRNA") have been found to be expressed in a transient manner (e.g., during development).

[0138] The term "shRNA," as used herein, refers to an RNA drug having a stem-loop structure, comprising a first and second region of complementary sequences, wherein the degree of complementarity and orientation of these regions is sufficient for base pairing to occur between them, and the first and second regions are linked by a loop region, the loop resulting from the absence of base pairing between nucleotides (or nucleotide analogs) within the loop region.

[0139] The scope of this invention includes the use of RNAi characterized by the degradation of RNA molecules (e.g., intracellular degradation). This degradation is performed by enzymatic RNA-induced silencing complexes (RISCs). RNA drugs having a sequence that is sufficiently complementary to the target RNA sequence (e.g., the CTGF gene mentioned above) to guide RNAi means that the RNA drug has at least 50% homology to the target RNA sequence (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100% homology), and as a result these two are sufficiently complementary to each other to hybridize and induce the disruption of the target RNA by the RNAi machinery (e.g., the RISC complex) or RNAi process. RNA drugs having a “sequence sufficiently complementary to the target RNA sequence to guide RNAi” also means that the RNA drug has a sequence sufficient to induce the inhibition of translation of the target RNA by the RNAi machinery or RNAi process. RNA drugs may also have a sequence that is sufficiently complementary to the target RNA encoded by the target DNA sequence, so that the target DNA sequence is silenced by chromatin. In other words, RNA drugs have sequences that are sufficient to induce transcriptional gene silencing, for example, by inducing gene expression or structural changes in chromatin at or near the target DNA sequence, thereby downregulating the target DNA sequence or its vicinity.

[0140] The polynucleotides described above can be delivered using polymeric biodegradable microparticle delivery devices or biodegradable microcapsule delivery devices known in the art. Another method for achieving polynucleotide incorporation is to use liposomes (which are prepared by standard methods). Polynucleotides can be incorporated into these delivery vehicles alone or co-incorporated with tissue-specific antibodies. Alternatively, molecular conjugates consisting of plasmids or other vectors that bind to poly-L-lysine by electrostatic or covalent forces can be prepared. Poly-L-lysine binds to ligands that can bind to receptors on target cells (Cristiano et al., 1995, J.Mol.Med., 73:479). Alternatively, tissue-specific targeting can be achieved by using tissue-specific transcriptional regulatory elements known in the art. Delivery of naked DNA to intramuscular, intradermal, or subcutaneous sites (i.e., delivery without a delivery vehicle) is another means of achieving in vivo expression.

[0141] siRNA, miRNA, and asRNA (antisense RNA) molecules can be designed by methods widely known in the art. siRNA, miRNA, and asRNA molecules possessing sufficient homology to provide the sequence specificity required for unique RNA degradation can be designed using various programs known in the art, including (but not limited to) those maintained on the websites of AMBION, Inc. and DHARMACON, Inc. A systematic testing of several designed chemical species for optimizing such siRNA, miRNA, and asRNA sequences can be routinely performed by those skilled in the art. Considerations when designing short, coherent nucleic acid molecules include, but are not limited to, biophysical, thermodynamic, and structural considerations, base preferences at specific positions in the sense strand, and homology. These considerations are widely known in the art and provide guidance for designing the aforementioned RNA molecules.

[0142] The antisense polynucleotide (preferably DNA) of the present invention can be any antisense polynucleotide, as long as it has a nucleotide sequence that is complementary or substantially complementary to the nucleotide sequence of the gene encoding the components of the network described above. The nucleotide sequence can have at least about 70%, 80%, 90%, or 95% homology to the complement of the gene encoding the polypeptide. These antisense DNAs can be synthesized using a DNA synthesizer.

[0143] The antisense DNA of the present invention may contain altered or modified sugars, bases, or linkages. Antisense DNA, as well as the RNAi agents described above, may be provided in specialized forms, such as liposomes or microspheres, or may be applied to gene therapy, or may be provided in combination with bound components. Such bound components may include polycations that act as charge neutralizers for the phosphate backbone (e.g., polylysine), or hydrophobic components that enhance interaction with the cell membrane or increase nucleic acid uptake (e.g., lipids (e.g., phospholipids, cholesterol)). Preferred examples of bound lipids are cholesterol or its derivatives (e.g., cholesteryl chloroformate, cholic acid). These components may be bound to nucleic acids at their 3' or 5' ends, or they may be bound to nucleic acids via bases, sugars, or intermolecular nucleoside linkages. Other components may be capping groups specifically placed at the 3' or 5' end of nucleic acids to prevent degradation by nucleases (e.g., exonucleases, RNases, etc.). Such capping groups include, but are not limited to, a variety of hydroxyl protecting groups known in the art, including glycols (e.g., polyethylene glycol and tetraethylene glycol, etc.). The inhibitory effect of antisense DNA can be investigated in vivo and in vitro using the gene expression system of the present invention based on cell lines or animals.

[0144] One or more of the polypeptides described above, or the nucleic acids discussed above that encode RNAi drugs, can be cloned into vectors for delivery to cells in vitro or in vivo. For in vivo use, delivery can be targeted to a specific tissue or organ (e.g., skin). Targeted delivery involves the use of a vector (e.g., organ-homing peptide) that is targeted after systemic administration to a specific organ or tissue. For example, a vector may have a covalent conjugate of avidin and a monoclonal antibody against a liver-specific protein.

[0145] In some specific embodiments, the present invention provides a method for in vivo expression of the aforementioned metastasis inhibitors. In such a method, the therapeutic effect would be achieved by introducing a nucleic acid sequence encoding one of the above factors into cells or tissues of human or non-human animals where inhibition of endothelial recruitment, cancer cell invasion, or metastatic angiogenesis is required. Delivery of the nucleic acid sequence can be achieved using recombinant expression vectors (e.g., chimeric viruses) or colloidal dispersion systems. The use of targeted liposomes is preferred for therapeutic delivery of the nucleic acid sequence.

[0146] The various viral vectors available for use in gene therapy disclosed herein include adenoviruses, adeno-associated viruses (AAVs), herpesviruses, vaccinia, or preferably RNA viruses (e.g., retroviruses and lentiviruses). Preferably, the retroviral vector is a lentivirus or a derivative of a mouse or bird retrovirus. Examples of retroviral vectors capable of inserting only one foreign gene include, but are not limited to, Moloney's mouse leukemia virus (MoMuLV), Harvey's mouse sarcoma virus (HaMuSV), mouse mammary cancer virus (MuMTV), and Rous sarcoma virus (RSV). Numerous further retroviral vectors can incorporate multiple genes.

[0147] All of these vectors can transfer or incorporate genes for selection markers, so that transduced cells can be identified and produced. Retroviral vectors can be made target-specific by, for example, attaching sugars, glycolipids, or proteins. Preferred targeting is targeting a receptor. This is achieved by using target-specific antibodies or hormones. Those skilled in the art will recognize that specific polynucleotide sequences can be inserted into the retroviral genome or bound to the viral envelope to enable target-specific delivery of retroviral vectors.

[0148] Another targeted system for delivering nucleic acids is colloidal dispersion systems. Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system in this invention is liposomes. Liposomes are artificial membrane vesicles useful as delivery vehicles in vitro and in vivo. They can encapsulate RNA, DNA, and intact virions in a biologically active form within aqueous solutions for delivery to cells. Various methods for efficient gene transfer using liposome vehicles are known in the art. Liposome composition is typically a combination of phospholipids, usually in combination with steroids, and in particular, a combination of phospholipids, especially in combination with cholesterol. Other phospholipids or other lipids may also be used. The physical properties of liposomes depend on pH, ionic strength, and the presence of divalent cations.

[0149] Examples of lipids useful in liposome production include phosphatidyl compounds such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, and phosphatidylethanolamine, as well as sphingolipids, cerebrosides, and gangliosides. Exemplary phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine, and distearoylphosphatidylcholine. Liposome targeting is also possible, for example, based on organ specificity, cell specificity, and organelle specificity, and is known in this art.

[0150] When used in vivo, it is desirable to use a reversible delivery-expression system. To achieve such an objective, the Cre-loxP system, the FLP / FRT system, or other similar systems can be used for the reversible delivery-expression of one or more of the nucleic acids. See International Publication WO2005 / 112620, International Publication WO2005 / 039643, U.S. Patent Application Publications 20050130919, 20030022375, 20020022018, 20030027335, and 20040216178. In particular, the reversible delivery-expression system described in U.S. Patent Application Publication 20100284990 can be used to provide selective or emergency interruption.

[0151] In another example, the inhibitory agent described above can be a polypeptide or protein complex, such as an antibody. The term “antibody” refers to an immunoglobulin molecule, or its immunologically active portion, i.e., the antigen-binding portion. An example is an antibody with at least one or two heavy (H) chain variable regions (V H ) and at least one or two light (L) chain variable regions (V L This includes, but is not limited to, proteins having ) and . H Region and V LThe regions can be further subdivided into hypervariable regions (called "complementarity-determining regions" ("CDRs)") scattered with more conserved regions (called "framework regions" (FRs)). As used herein, the term "immunoglobulin" refers to a protein consisting of one or more polypeptides substantially encoded by an immunoglobulin gene. Recognized human immunoglobulin genes include kappa constant region genes, lambda constant region genes, alpha constant region genes (IgA1 and IgA2), gamma constant region genes (IgG1, IgG2, IgG3 and IgG4), delta constant region genes, epsilon constant region genes and mu constant region genes, as well as numerous immunoglobulin variable region genes.

[0152] The term “antigen-binding moiety” (or “antibody moiety”) of an antibody refers to one or more fragments of an antibody that possess the ability to specifically bind to an antigen (e.g., LRP1, LRP8, and CTGF). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments that fall within the scope of the term “antigen-binding moiety” of an antibody include (i) Fab fragments, i.e., V L Domain, V H Domain, C L Domain and C H1 (ii) A monovalent fragment consisting of domains; (ii) A bivalent fragment containing an F(ab')2 fragment, i.e., two Fab fragments linked by disulfide bridges in the hinge region; (iii) V H Domain and C H1 Fd fragment consisting of domains; (iv) V of only one arm of the antibody L Domain and V H Fv fragment consisting of domains; (v)V H It includes (vi) an isolated complementarity-determining region (CDR), as well as the two domains of the Fv fragment, namely, V L and VH Although they are encoded by separate genes, they are V L Region and V H These antibody fragments can be linked together using recombination techniques by synthetic linkers, which allow the regions to pair and be constructed as a single protein chain forming a monovalent molecule (known as a single-chain Fv (scFv)) (see, e.g., Bird et al. (1988), Science, 242:423-426, and Huston et al. (1988), Proc. Natl. Acad. Sci. USA, 85:5879-5883). Such single-chain antibodies are also intended to be included within the scope of the term "antigen-binding portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same manner as intact antibodies are screened.

[0153] Antibodies that specifically bind to one of the target proteins mentioned above (e.g., CTGF) can be produced using methods known in the art. These antibodies can be polyclonal or monoclonal antibodies. In one embodiment, the antibodies can be produced by recombination, for example, by phage display or by combinatorial methods. In another embodiment, the antibodies are complete human antibodies (e.g., antibodies produced in mice genetically engineered to produce antibodies from human immunoglobulin sequences), humanized antibodies, or non-human antibodies, for example, antibodies from rodents (mice or rats), goats, primates (e.g., monkeys, but not limited to these), rabbits, or camels (but not limited to these). Examples of various methods for producing humanized forms of antibodies include, but are not limited to, CDR grafting (Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature, 332:323 (1988)), chain shuffling (U.S. Patent No. 5,565,332), and veneering or resurfacing (European Patent Nos. 592,106; European Patent Nos. 519,596; Padlan, Molecular Immunology, 28(415):489-498 (1991); Studnicka et al., Protein Engineering, 7(6):805-814 (1994); Roguska et al., PNAS, 91:969-973 (1994)). Various methods for producing complete human antibodies include, but are not limited to, generating antibodies from mice capable of expressing human immunoglobulin genes, and using phage display technology to construct and screen human immunoglobulin gene libraries.

[0154] The term "isolated antibody" is intended to refer to an antibody that substantially contains no other antibodies with different antigen specificities (for example, an isolated antibody that specifically binds to CTGF substantially contains no antibodies that specifically bind to antigens other than that antigen). Furthermore, isolated antibodies may substantially contain no other cellular material and / or chemical substances.

[0155] The terms "monoclonal antibody" or "monoclonal antibody composition," as used herein, refer to a preparation of an antibody molecule with a single molecular composition. A monoclonal antibody composition exhibits a single binding specificity and affinity for a particular epitope.

[0156] As used herein, the term "human antibody" is intended to encompass antibodies having variable regions in which both the framework region and the CDR region are derived from human germline immunoglobulin sequences. Furthermore, if the antibody contains a constant region, this constant region is also derived from a human germline immunoglobulin sequence. The human antibodies of the present invention may contain amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by in vitro random mutagenesis or site-directed mutagenesis, or by in vivo somatic mutation). However, as used herein, the term "human antibody" is not intended to encompass antibodies in which a CDR sequence derived from the germline of another mammalian species (e.g., mouse) is grafted onto a human framework sequence.

[0157] The term "human monoclonal antibody" refers to an antibody exhibiting single binding specificity, in which both the framework region and the CDR region have variable regions derived from human germline immunoglobulin sequences. In one embodiment, the human monoclonal antibody is produced by a hybridoma containing B cells obtained from a genetically modified non-human animal (e.g., a genetically modified mouse) having a genome containing a human heavy chain transgene and a light chain transgene, fused with immortalized cells.

[0158] The term “recombinant human antibody,” as used herein, includes all human antibodies prepared, expressed, produced or isolated by recombinant means, including, for example, the following antibodies: (a) antibodies isolated from animals (e.g., mice) that are genetically or chromosomally recombinant with respect to human immunoglobulin genes, or from hybridomas prepared from such animals (as further described below); (b) antibodies isolated from host cells transformed to express human antibodies, e.g., antibodies isolated from transfectomas; (c) antibodies isolated from recombinant combinatorial human antibody libraries; and (d) antibodies prepared, expressed, produced or isolated by any other means involving splicing human immunoglobulin gene sequences with other DNA sequences. Such recombinant human antibodies have variable regions in which the framework region and CDR region are derived from human germline immunoglobulin sequences. However, in some specific embodiments, such recombinant human antibodies can be subjected to in vitro mutagenesis (or in vivo somatic mutagenesis when an animal that is genetically modified for the human Ig sequence is used), and therefore the V of recombinant antibodies H Region and V L The amino acid sequence of the region is that of the human germline V H Array and V L These are sequences that originate from or are associated with other sequences, but naturally, they may not be present in the germline repertoire of human antibodies in vivo.

[0159] As used herein, “isotype” refers to the antibody class encoded by the heavy chain constant region gene (e.g., IgM or IgG1). The expressions “antigen-recognizing antibody” and “antigen-specific antibody” are used interchangeably with the term “antigen-specific antibody” as used herein. As used herein, the term “high affinity” refers to the antibody’s affinity for the target antigen. -7 K below M D Preferably having 10 -8 K below MD Having, more preferably 10 -9 K below M D Having, even more more preferably 10 -10 K below M D This indicates that it has high affinity. However, "high affinity" binding may differ for other antibody isotypes. For example, "high affinity" binding for IgM isotypes is when the antibody is 10 -7 K below M D Having, more preferably 10 -8 K below M D To indicate that.

[0160] In one example, the composition contains a monoclonal antibody that neutralizes CTGF. In one embodiment, the antibody can be a full human antibody, a humanized antibody, or a non-human antibody, such as an antibody from a rodent (mouse or rat), a goat, a primate (e.g., monkey, but not limited to), a rabbit, or a camel (but not limited to these). In one embodiment, one or more amino acids of this monoclonal antibody may be substituted to alter various physical properties. These properties include, but are not limited to, binding specificity, binding affinity, immunogenicity, and antibody isotype. A pharmaceutical composition containing the full human or humanized form of the above antibody can be used to treat melanoma or to inhibit endothelial mobilization, cancer cell invasion, or metastatic angiogenesis.

[0161] As used herein, “subject” refers to both human and non-human animals. Examples of non-human animals include all vertebrates, e.g., mammals, e.g., non-human mammals, non-human primates (especially higher primates), dogs, rodents (e.g., mice or rats), guinea pigs, cats, and rabbits, as well as non-mammals, e.g., birds, amphibians, and reptiles. In one embodiment, the subject is a human. In another embodiment, the subject is an experimental animal or an animal suitable as a disease model. A subject to be treated for a disorder can be identified by standard diagnostic techniques for the disorder. If necessary, the subject may be examined for one or more mutations, expression levels, or activity levels of miR-199a-3p, miR-199a-5p, miR-1908, and CTGF described above before treatment by methods known in the art or described above. If a subject has a specific mutation in its genes, or if its gene expression level or activity level is higher, for example, in a sample obtained from the subject than in a sample obtained from a normal person, then the subject is a candidate for treatment according to the present invention.

[0162] To confirm inhibition or treatment, endothelial mobilization or inhibition of occurring angiogenesis can be evaluated and / or confirmed before and / or after the administration step using techniques known in the art. Exemplary techniques include angiography or arteriovenous angiography, medical imaging techniques used to visualize the inside or lumen of blood vessels and organs of the body, which can generally be carried out by injecting a radiopaque contrast agent into a blood vessel and imaging using X-ray-based techniques, such as fluoroscopy.

[0163] "To treat" or "to treat," as used herein, means administering a compound or drug to a subject with a disorder with the purpose of treating, alleviating, reducing, curing, delaying, preventing, or improving the disorder, its symptoms, a secondary disease condition, or a predisposition to the disorder. "Effective dose" or "therapeutic effective dose" refers to the amount of compound or drug that can produce a medically desirable outcome in the treated subject. Treatment can be carried out alone or in combination with other drugs or treatments, in vivo or ex vivo. A therapeutic effective dose may be administered in one or more doses, applications, or prescriptions, and the therapeutic effective dose is not intended to be limited to a specific formulation or route of administration.

[0164] The expression “effective amount,” as used herein, refers to a sufficient amount of the compound of the present invention to exhibit the desired therapeutic effect. The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, as well as the specific therapeutic agent. The compounds of the present invention are preferably formulated into a dosage unit for ease of administration and uniformity of dosing. The expression “dosing unit,” as used herein, refers to the amount to which a patient is treated. This indicates physically distinct units of the appropriate therapeutic agent. However, it will be understood that the total daily use of the compounds and compositions of the present invention will be determined by the attending physician within reasonable medical judgment. For any patient or organism, the specific therapeutically effective dose level for a particular patient or organism will depend on a variety of factors, including the disorder being treated and its severity; the anticancer activity of the specific compound used; the specific composition used; the patient's age, weight, overall health, sex, and diet; the timing, route of administration, and elimination rate of the specific compound used; the duration of treatment; drugs used in combination with or concurrently with the specific compound used; and similar factors widely known in the medical technology field.

[0165] Therapeutic agents can be administered alone in vivo or ex vivo, or in combination with other drugs or therapies, i.e., in a cocktail therapy. As used herein, the terms “co-administered” or “co-administered” indicate that at least two drugs or therapies are administered. For example, in the treatment of tumors, particularly in the treatment of angiogenic malignancies, drugs can be used alone or in combination with, for example, chemotherapeutic agents, radiotherapeutic agents, apoptotic agents, anti-angiogenic agents and / or immunotoxins or coaguligands. In some embodiments, the co-administration of two or more drugs / therapies is simultaneous. In other embodiments, the first drug / therapy is administered prior to the second drug / therapy. Those skilled in the art will understand that the formulations and / or routes of administration of the various drugs / therapies used may differ.

[0166] In in vivo efforts, the compound or drug is administered to the target. Generally, the compound is suspended in a pharmaceutically acceptable carrier (e.g., physiological saline) and administered orally or intravenously, or injected or implanted subcutaneously, intramuscularly, subarachnoidally, intraperitoneally, intrarectally, intravaginally, intranasally, intragastricly, intratracheally, or intrapulmonaryly.

[0167] The required dosage depends on the selection of the route of administration; the properties of the compound; the nature of the patient's illness; the size, weight, surface area, age, and sex of the subject; other medications being administered; and the judgment of the attending physician. Suitable dosages range from 0.01 mg / kg to 100 mg / kg. Variations in the required dosage are expected considering the various compounds available and the different efficiencies of various routes of administration. For example, oral administration may require a higher dosage than IV injection. These variations in dosage levels can be adjusted using standard empirical methods for optimization, as are well understood in this art. Encapsulation of the compound in a suitable delivery vehicle (e.g., polymer microparticles or implantable devices) can increase delivery efficiency, particularly for oral delivery.

[0168] composition The scope of the present invention includes compositions containing a suitable carrier and one or more of the therapeutic agents described above. The composition may be a pharmaceutical composition containing a pharmaceutically acceptable carrier, a dietary composition containing a suitable dietary carrier, or a cosmetic composition containing a cosmetic carrier.

[0169] The term "pharmaceutical composition" refers to a combination of an active agent and a carrier (inactive or active) that makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic use. A "pharmaceutically acceptable carrier" does not cause undesirable physiological effects after administration or application to a subject. The carrier in the pharmaceutical composition must also be "acceptable" in the sense that it is compatible with the active ingredient and can stabilize the active ingredient. One or more solubilizers deliver the active compound. It can be used as a pharmaceutical carrier for this purpose. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, auxiliaries, additives, and diluents for achieving compositions usable as drug formulations. Other examples of carriers include colloidal silicon dioxide, magnesium stearate, cellulose, sodium lauryl sulfate, and D&C Yellow #10.

[0170] As used herein, the term “pharmaceutically acceptable salt” refers to a salt that, within reasonable medical judgment, is suitable for use in contact with human and lower animal tissues without excessive toxicity, irritation, and allergic responses, and that corresponds to a reasonable benefit / risk ratio. Various pharmaceutically acceptable salts of amines, carboxylic acids, and other types of compounds are widely known in the art. For example, SMBerge et al. describe various pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977) (which is incorporated herein by reference). Such salts can be prepared in situ during the final isolation and purification of the compounds of the present invention, or they can be prepared separately by reacting a free basic functional group or a free acid functional group with a suitable reagent, as is generally described below. For example, a free basic functional group can be reacted with a suitable acid. Furthermore, if the compound of the present invention has an acidic component, suitable pharmaceutically acceptable salts may include metal salts, such as alkali metal salts (e.g., sodium or potassium salts) and alkaline earth metal salts (e.g., calcium or magnesium salts). Examples of pharmaceutically acceptable non-toxic acid addition salts include salts of amino groups formed by inorganic acids (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or organic acids (e.g., acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid), or salts of amino groups formed by using other methods used in the art (e.g., ion exchange).Other pharmaceutically acceptable salts include adipine, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, and 2-hydroxyethanesulfonate. These include lactobionates, lactates, laurates, lauryl sulfates, malates, maleates, malons, methanesulfons, 2-naphthalenesulfons, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propions, stearates, succinates, sulfates, tartrates, thiocyans, p-toluenesulfons, undecanoates, and valersates. Typical alkali salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium. Further pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium cations, quaternary ammonium cations, and amine cations formed using counterions (e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfons, and arylsulfons).

[0171] As described above, the pharmaceutical compositions of the present invention further comprise a pharmaceutically acceptable carrier, in which case the pharmaceutically acceptable carrier includes, as used herein, any solvent, diluent or other liquid vehicle, dispersing or suspending agent, surfactant, isotonic agent, thickener or emulsifier, preservative, solid binder and lubricant, etc., suitable for the specific dosage form of the desired product. Remington's Pharmaceutical Sciences, 16th edition, EW Martin (Mack Publishing Co., Easton, Pa., 1980) contains a section on pharmaceutical compositions.Various carriers used in formulating and known techniques for their preparation are disclosed. Any carrier medium is intended to be used within the scope of the invention, except insofar as conventional carrier mediums are incompatible with the compounds of the invention by, for example, causing some undesirable biological effect or, otherwise, interacting in a harmful manner with some other component of the pharmaceutical composition. Some examples of substances that may serve as pharmaceutically acceptable carriers include, but are not limited to, the following: sugars, e.g., lactose, glucose, and sucrose; starches, e.g., corn starch and potato starch; cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, e.g., cocoa butter and suppository wax; oils, e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, e.g., propylene glycol; esters, e.g., oleic acid Ethyl thyl and ethyl laurate, etc.; agar; natural and synthetic phospholipids, such as soy and egg yolk phosphatides, lecithin, hydrogenated soy lecithin, dimyristoyl lecithin, dipalmitoyl lecithin, distearoyl lecithin, dioleoyl lecithin, hydroxylated lecithin, lysophosphatidylcholine, cardiolipin, sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, diastearoyl phosphatidylethanolamine (DSPE) and its PEGylated esters (e.g., DSPE-PEG750 and DSPE-PEG2000, etc.), phosphatidic acid, phosphatidylglycerol and phosphatidylserine, etc.Preferred commercially available lecithin products include those available under the trade names Phosal® or Phospholipon®, including Phosal 53 MCT, Phosal 50 PG, Phosal 75 SA, Phospholipon 90H, Phospholipon 90G, and Phospholipon 90 NG; soy phosphatidylcholine (SoyPC) and DSPE-PEG2000 are particularly preferred; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic physiological saline; Ringer's solution; ethyl alcohol and phosphate buffer solutions; as well as other non-toxic compatible lubricants, such as sodium lauryl sulfate and magnesium stearate; as well as colorants, release agents, coatings, sweeteners, flavorings and fragrances, preservatives and antioxidants may also be present in the composition at the discretion of the formulater.

[0172] The above compositions may be used in any of the forms described above to treat melanoma or any other disease or condition described herein. The effective dose indicates the amount of active compound / agent required to impart a therapeutic effect to the treated subject. The effective dose will vary depending on the type of disease being treated, the route of administration, the use of excipients, and the possibility of co-administration with other therapeutic treatments, as will be recognized by those skilled in the art.

[0173] The pharmaceutical compositions of the present invention may be administered parenterally, orally, nasally, rectally, topically, or orally. The term "parenterally," as used herein, refers to subcutaneous injection, intradermal injection, intravenous injection, intramuscular injection, intra-articular injection, intra-arterial injection, intrabursal injection, intrasternal injection, subarachnoid injection, intrafocal injection, or intracranial injection, as well as any other suitable injection technique.

[0174] Sterile injectable compositions can be solutions or suspensions in non-toxic, parenterally permissible diluents or solvents. Such solutions include, but are not limited to, 1,3-butanediol, mannitol, water, Ringer's solution, and isotonic sodium chloride solutions. In addition, fixative oils are conventionally used as solvents or suspension media (e.g. (e.g., synthetic monoglycerides or diglycerides). Fatty acids (e.g., oleic acid, etc.) and their glyceride derivatives are useful in the preparation of injectables, as are naturally pharmaceutically acceptable oils, such as, but not limited to, olive oil or castor oil, and their polyoxyethylated forms are useful in the preparation of injectables. These oil solutions or oil suspensions may also contain long-chain alcohol diluents or dispersants (e.g., carboxymethylcellulose or similar dispersants, etc., but not limited to). Other commonly used surfactants, such as, but not limited to, various Tween or Span or other similar emulsifiers or bioavailability enhancers (which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other drug-dosing forms), may also be used for formulation purposes.

[0175] Compositions for oral administration can be in any dosage form, including capsules, tablets, emulsions, and aqueous suspensions, dispersions, and aqueous solutions, and are orally permissible dosage forms. For tablets, commonly used carriers include, but are not limited to, lactose and corn starch. Lubricants, such as, but not limited to, magnesium stearate, are also typically added. For oral administration in capsule form, useful diluents include, but are not limited to, lactose and dried corn starch. When aqueous suspensions or emulsions are administered orally, the active ingredient can be suspended or dissolved in an oil phase combined with an emulsifier or suspending agent, and certain sweeteners, flavorings, or colorants may be added, if desired.

[0176] The pharmaceutical compositions for topical administration according to the described invention may be formulated as solutions, ointments, creams, suspensions, lotions, powders, pastes, gels, sprays, aerosols, or oils. Alternatively, the topical formulation may be in the form of a patch or bandage impregnated with one or more active ingredients, which may optionally contain one or more excipients or diluents. In some preferred embodiments, the topical formulation includes a substance that will enhance the absorption or penetration of the active agent through the skin or other affected area.

[0177] Topical compositions contain a safe and effective amount of a dermatologically acceptable carrier suitable for application to the skin. A composition or component described as "cosmetically acceptable" or "dermatologically acceptable" indicates a composition or component suitable for use in contact with human skin, without excessive toxicity, incompatibility, instability, and allergic reactions. The carrier enables the delivery of active agents and, if necessary, components to the skin at appropriate concentrations. Therefore, the carrier can act as a diluent, dispersant, or solvent to ensure that the active substance is applied to a selected target at appropriate concentrations and uniformly distributed over the selected target. The carrier can be solid, semi-solid, or liquid. The carrier can be in the form of a lotion, cream, or gel, and in particular, can be in a form with sufficient thickness or yield point to prevent the active substance from settling. The carrier can be inert or have dermatological benefits. The carrier must be physically and chemically compatible with the active ingredients described herein and must not unduely impair the stability, potency, or other benefits of use associated with the composition.

[0178] Combination therapy In some embodiments, the pharmaceutical composition may further contain additional compounds having antiproliferative activity. These additional compounds can be selected from a group of antiproliferative agents, including those listed in Table 2.

[0179] It will also be understood that the compounds and pharmaceutical compositions of the present invention may be formulated and used in combination therapy, that is, the compounds and pharmaceutical compositions may be formulated with one or more other desired therapeutic agents or medical procedures, or may be administered simultaneously with, prior to, or subsequently to one or more other desired therapeutic agents or medical procedures. In a particular combination of treatments (therapeutic agents or procedures) for use in a combination regimen, the suitability of the desired therapeutic agents and / or procedures, as well as the desired therapeutic effect to be achieved, will be taken into consideration. It will also be understood that depending on the treatment used, the desired effect may be achieved for the same disorder, or a different effect (e.g., suppression of some adverse effect) may be achieved.

[0180] The term "antiproliferative agent" refers to any antiproliferative agent, including those listed in Table 2, any of which may be used in combination with an LXR agonist to treat the medical conditions listed herein. Antiproliferative agents also include organoplatinum derivatives, naphthoquinone derivatives and benzoquinone derivatives, chrysophanic acid and its anthraquinone derivatives.

[0181] [Table 2] TIFF2026062949000071.tif223170TIFF2026062949000072.tif214170TIFF20260629490 00073.tif206170TIFF2026062949000074.tif201170TIFF2026062949000075.tif247170

[0182] Methods for diagnosis and prognosis The above gene can be used to determine whether a subject has metastatic melanoma or is at risk of developing metastatic melanoma. Alternatively, the above gene can be used to determine the prognosis of such a disorder in a subject.

[0183] Diagnostic methods In one aspect, the present invention provides qualitative and quantitative information for determining whether a subject has metastatic melanoma or other disease characterized by endothelial recruitment, cancer cell invasion, or metastatic angiogenesis, or whether it is susceptible to metastatic melanoma or other disease characterized by endothelial recruitment, cancer cell invasion, or metastatic angiogenesis. Subjects having or being susceptible to such disorders can be determined based on the expression levels, expression patterns, or expression profiles of the above genes or their products (mRNA, microRNA, or polypeptides) in test samples obtained from the subject. In other words, such products can be used as markers to indicate the presence or absence of the disorder. Diagnostic and prognostic assays of the present invention include various methods for evaluating the expression levels of such products. These methods can detect the disorder. For example, a relative increase in the expression levels of one or more stimulants (i.e., miR-199a-3p, miR-199a-5p, miR-1908, and CTGF) suggests the presence of the disorder. Conversely, levels lower than expression or absence suggest the absence of a disorder.

[0184] The presence, level, or absence of mRNA, microRNA, or polypeptide products in a test sample can be evaluated by obtaining the test sample from the subject and by contacting the test sample with a compound or drug capable of detecting nucleic acids (e.g., an RNA probe or a DNA probe) or a compound or drug capable of detecting polypeptides. A "test sample" includes tissues, cells, and biological fluids isolated from the subject, as well as tissues, cells, and fluids present within the subject's body. The level of expression of a target gene can be measured in several ways, including by measuring the RNA encoded by that gene.

[0185] Expressed RNA samples can be isolated from biological samples using one of several well-known procedures. For example, a biological sample can be lysed in a guanidium-based lysis buffer (which may contain additional components to stabilize the RNA). In some embodiments, the lysis buffer may contain purified RNA as a control for monitoring the recovery and stability of RNA from cell cultures. Examples of such purified RNA templates include kanamycin-positive control RNA from PROMEGA (Madison, WI) and 7.5 kb poly(A)-tailed RNA from LIFE TECHNOLOGIES (Rockville, MD). Lysates may be used immediately or may be frozen and stored, for example, at -80°C.

[0186] In some cases, total RNA can be purified from cell lysates (or other types of samples) using silica-based isolation in a 96-well format suitable for automation, such as the RNEASY purification platform (QIAGEN, Inc., Valencia, CA). Other RNA isolation methods are intended (e.g., extraction using silica-coated beads or guanidium). Further methods for RNA isolation and preparation may be devised by those skilled in the art.

[0187] The method of the present invention can be carried out using a crude sample (e.g., blood, serum, plasma, or cell lysate), thereby eliminating the need to isolate RNA. NAse inhibitors may be added to the crude sample if necessary. When using crude cell lysates, it should be noted that genomic DNA may, depending on the sample, provide one or more copies of the target sequence (e.g., a gene). In situations where the target sequence originates from one or more highly expressed genes, the signal from the genomic DNA may not be significant. However, for genes expressed at low levels, the background can be removed by treating the sample with DNAse or by using primers that target splice junctions for subsequent priming of the cDNA product or amplified product.

[0188] The level of RNA corresponding to a gene in cells can be determined both in situ and in vitro. RNA isolated from a test sample can be used in hybridization assays or amplification assays, including Southern or Northern spectroscopy, PCR analysis, and probe arrays. A preferred diagnostic method for detecting RNA levels involves contacting the isolated RNA with a nucleic acid probe capable of hybridizing to the RNA encoded by the gene. The probe can be a full-length nucleic acid or a portion thereof (e.g., an oligonucleotide with a length of at least 10 nucleotides and sufficient to specifically hybridize to RNA under stringent conditions).

[0189] In one form, RNA (or cDNA prepared from RNA) is immobilized on a surface, and the RNA is brought into contact with the probe, for example, by electrophoresis on an agarose gel and transfer of the RNA from the gel to a membrane (e.g., nitrocellulose). In another form, the probe is immobilized on a surface, and the RNA (or cDNA) is brought into contact with the probe, for example, in a gene chip array. Those skilled in the art can adapt known RNA detection methods to detect levels of RNA.

[0190] The level of RNA (or cDNA prepared from RNA) in a sample encoded by the gene to be tested can be evaluated using nucleic acid amplification, for example, standard PCR (U.S. Patent No. 4,683,202), RT-PCR (Bustin S., J Mol Endocrinol, 25:169~93, 2000), quantitative PCR (Ong Y. et al., Hematology, 7:59~67, 2002), real-time PCR (Ginzinger D., Exp Hematol, 30:503~12, 2002), and in-situ PCR (Thaker V., Methods Mol Biol, 115:379~402, 1999), or any other nucleic acid amplification method, and then the amplified molecule can be detected using techniques known in the art. In another embodiment, the method of the present invention further includes contacting a control sample with a compound or drug capable of detecting the RNA of the gene, and comparing the presence of the RNA in the control sample with the presence of the RNA in the test sample.

[0191] The methods and markers described above can be used to assess the risk of a subject developing melanoma. Specifically, the present invention can be applied to subjects in a high-risk cohort that already have certain risks, in order to gain essential insights for early detection. Changes in the levels of melanoma-related miR gene products can be detected before the development of a transformed or neoplastic phenotype in the cells of the subject, or at an early stage of the development of a transformed or neoplastic phenotype in the cells of the subject. Accordingly, the present invention also provides a method for screening subjects at risk of developing melanoma, comprising evaluating the levels of at least one melanoma-related gene product, or a combination of melanoma-related gene products, in a biological sample obtained from the subject's skin. Thereafter, changes in the levels of the gene product or combination of gene products in the biological sample, compared to the levels of the corresponding gene product in a control sample, indicate that the subject is at risk of developing melanoma. Biological samples used for such screening may include skin tissue that is either normal or suspected to be cancerous. Subjects exhibiting changes at the level of one or more gene products associated with melanoma are candidates for further monitoring and testing. Such further testing may include histological examination of tissue samples or other techniques within the scope of the art.

[0192] As used herein, the term “diagnosis” means detecting a disease or disorder, or determining the stage or severity of a disease or disorder. Typically, the diagnosis of a disease or disorder is based on the evaluation of one or more factors and / or symptoms that suggest the disease. That is, a diagnosis can be made based on the presence, absence, or quantity of factors that suggest the presence or absence of a disease or condition. Each factor or symptom considered to suggest a particular disease does not have to be exclusively associated with that particular disease; that is, there may be differential diagnoses that can be inferred from the diagnostic factors or symptoms. Similarly, factors or symptoms that suggest a particular disease may be present in individuals who do not have that particular disease. These diagnostic methods may be used independently or in combination with other diagnostic and / or staging methods known in the medical technology field for a particular disease or disorder (e.g., melanoma).

[0193] Prognosis The diagnostic methods described above can identify individuals with melanoma or those at risk of developing melanoma. In addition, changes in the expression levels and / or expression trends of the aforementioned genes in biological samples, such as peripheral blood samples, can provide early signs of recovery or their absence. For example, further increases (or decreases) or persistently altered gene expression levels of stimulant genes (or inhibitor genes) indicate a poor prognosis, i.e., lack of improvement or decline in health. Therefore, these genes can be used to assess recovery after treatment of melanoma. Analysis of this selected group of genes or a subset thereof can indicate the outcome of the condition.

[0194] The prognostic assays described herein can be used to determine whether a subject is suitable for administration of a drug (e.g., an agonist, antagonist, peptide mimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat melanoma or other disorders involving endothelial mobilization, cancer cell invasion, or metastatic angiogenesis. For example, such assays can be used to determine whether a subject may be administered a chemotherapeutic agent.

[0195] Accordingly, the present invention also provides a method for monitoring treatment for cell proliferation disorders in a subject. For this purpose, the gene expression levels of the genes disclosed herein can be determined in test samples from the subject before treatment, during treatment, or after treatment. The magnitude of the change in those levels, such as compared to baseline levels, is then evaluated. A decrease in the expression of the aforementioned stimulant genes (miR-199a-3p, miR-199a-5p, miR-1908, and CTGF) after treatment indicates that the subject may be further treated with the same treatment. Similarly, an increase in the expression of inhibitors (DNAJA4, ApoE, LRP1, and LRP8) also indicates that the subject may be further treated with the same treatment. Conversely, a further increase or persistently high expression level of one or more stimulant genes indicates a lack of improvement or deterioration of health.

[0196] The information obtained from performing the above assay is useful in prognosing diseases and other adverse conditions that affect the health status of individual subjects, in identifying the progression of diseases and other adverse conditions that affect the health status of individual subjects, and in the clinical management of diseases and other adverse conditions that affect the health status of individual subjects. In a preferred embodiment, the aforementioned diagnostic assay provides useful information in prognosing melanoma and other conditions characterized by endothelial mobilization, cancer cell invasion, or metastatic angiogenesis, in identifying the progression of melanoma and other conditions characterized by endothelial mobilization, cancer cell invasion, or metastatic angiogenesis, and in the clinical management of melanoma and other conditions characterized by cancer cell invasion, or metastatic angiogenesis. This information more specifically assists clinicians in designing chemotherapy regimens or other treatment regimens to eradicate such conditions from the body of the affected subject, i.e., to eradicate them from the human body.

[0197] The term “prognosis,” as used herein, refers to a prediction of the likely course and outcome of a clinical condition or disease. Prognosis is usually made by evaluating disease factors or symptoms that imply a favorable or unfavorable course or outcome of the disease. The expression “determine prognosis,” as used herein, refers to a process by which a person skilled in the art can predict the course or outcome of a condition in a patient. The term “prognosis” does not imply that the course or outcome of a condition can be predicted with 100% accuracy; rather, a person skilled in the art will understand that the term “prognosis” indicates an increased probability that a particular course or outcome will occur. That is, they will understand that the course or outcome is more likely to occur in a patient exhibiting a given condition compared to such an individual not exhibiting the condition.

[0198] The terms “favorable prognosis” and “positive prognosis,” or “unfavorable prognosis” and “negative prognosis,” as used herein, are relative terms describing the likely course and / or expected outcome of a condition or disease. A favorable or positive prognosis predicts a better outcome for a condition than an unfavorable or negative prognosis. In a general sense, a “favorable prognosis” is an outcome that is relatively better than many other possible prognoses that may be associated with a particular condition, while an unfavorable prognosis predicts a relatively worse outcome than many other possible prognoses that may be associated with a particular condition. Typical examples of a favorable or positive prognosis include a better-than-average cure rate, a lower tendency for metastasis, a longer-than-expected life expectancy, and differentiation of a benign process from a cancerous process. For example, one positive prognosis is that a patient has a 50% chance of being cured of a particular cancer after treatment, while the average patient with the same cancer has only a 25% chance of being cured.

[0199] The terms “determine,” “measure,” “evaluate,” and “assay” are used interchangeably and include both quantitative and qualitative measurements, and also include determining whether or not a trait, characteristic, or feature is present. Evaluation may be relative or absolute. “Evaluating the presence of a target” includes determining the amount of the target present, and similarly, determining whether or not the target is present.

[0200] array Also provided in the present invention are biochips or arrays. A biochip / array may contain a solid or semi-solid substrate having linked probes or multiple probes as described herein. The probes may be hybridized to target sequences under stringent hybridization conditions. The probes may be linked at spatially defined addresses on the substrate. Two or more probes may be used per target sequence, however, in this case, Either multiple probes or probes targeting different parts of a specific target sequence are used. The probes may be hybridized to target sequences associated with only one defect recognized by those skilled in the art. The probes may be synthesized first and then ligated to a biochip, or they may be synthesized directly on the biochip.

[0201] When "linked" or "immobilized" is used herein to refer to nucleic acids (e.g., probes) and solid supports, it means that the bond between the probe and the solid support is sufficient to be stable under the conditions of linking, washing, analysis, and removal. The bond may be covalent or non-covalent. Covalent bonds may be formed directly between the probe and the solid support, or by a crosslinking agent, or by including specific reactive groups in either the solid support or the probe, or both molecules. Non-covalent bonds may be one or more of electrostatic, hydrophilic, and hydrophobic interactions. Non-covalent bonds include covalent linking of a molecule such as streptavidin to a support, and non-covalent linking of a biotinylated probe to this streptavidin. Immobilization may also involve a combination of covalent and non-covalent interactions.

[0202] Solid substrates can be modified to contain separate individual sites suitable for probe linking or association, and can be materials that accept at least one detection method. Examples of such substrates include glass and modified or functionalized glass, plastics (including acrylic, polystyrene, and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon J, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials (including silicon and modified silicon), carbon, metals, inorganic glass, and plastics. The substrates may enable optical detection without producing noticeable fluorescence.

[0203] The substrate can be planar, but substrates of other shapes may also be used. For example, the probe may be placed on the inner surface of a tube for flow-through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as soft foam, including closed-cell foam made from certain plastics.

[0204] Arrays / biochips and probes may be derivatized with chemical functional groups for subsequent linking of these two components. For example, a biochip may be derivatized with chemical functional groups including (but not limited to) amino, carboxyl, oxo, or thiol groups. When these functional groups are used, the probe may be linked using the functional groups on the probe, either directly or indirectly using a linker. The probe may be linked to a solid support by either a 5' terminal nucleotide, a 3' terminal nucleotide, or via an internal nucleotide. The probe may also be linked to a solid support by non-covalent bonds. For example, a biotinylated oligonucleotide can be prepared, in which case this biotinylated oligonucleotide may be covalently linked to a surface coated with streptavidin, thereby resulting in linking. Alternatively, the probe may be synthesized on a surface using techniques such as photopolymerization and photolithography. Detailed discussions of various methods for linking nucleic acids to support substrates can be found, for example, in U.S. Patents No. 5,837,832, 6087,112, 5215,882, 5707,807, 5807,522, 5958,342, 5994,076, 6004,755, 6048,695, 6060,240, 6090,556 and 6040138.

[0205] In some embodiments, expressed transcripts (e.g., transcripts of microRNA genes described herein) are represented in a nucleic acid array. In such embodiments, a set of binding sites may include probes with different nucleic acids that are complementary to different sequence segments of the expressed transcript. Examples of such nucleic acids include those with lengths of 15 to 200 nucleotides, 20 to 100 nucleotides, 25 to 50 nucleotides, and 40 to 60 nucleotides. Each probe sequence may also include one or more linker sequences in addition to the sequence complementary to its target sequence. The linker sequence is a sequence between the sequence complementary to its target sequence and the surface of the support. For example, the nucleic acid array of the present invention may have one probe that is specific to each target microRNA gene. However, if desired, the nucleic acid array may contain at least two, five, ten, 100, 200, 300, 400, 500 or more probes that are specific to any expressed transcript (e.g., transcripts of microRNA genes described herein).

[0206] kit In another aspect, the present invention provides kits that embody methods, compositions, and systems for analyzing the expression of polypeptides and microRNAs as described herein. Such kits may contain nucleic acids as described herein, together with any or all of the following: assay reagents, buffers, probes and / or primers, and sterile physiological salt or other pharmaceutically acceptable emulsion and suspension bases. In addition, the kits may include explanatory materials containing instructions (e.g., protocols) for carrying out the methods described herein. For example, a kit may be for amplification, detection, identification, or quantification of a target mRNA sequence or a target microRNA sequence. To achieve such an objective, the kit may contain suitable primers (e.g., hairpin primers), forward primers, reverse primers, and probes.

[0207] In one example, the kit of the present invention comprises one or more microarray slides (or alternatively, a microarray format) on which several different nucleic acids (each corresponding to one of the genes described above) are arranged. The kit may also include several labeled probes. Alternatively, the kit may include several polynucleotide sequences suitable as probes, and a selection of labels suitable for optimizing the included polynucleotide sequences or other polynucleotide sequences at the discretion of the implementer. Generally, at least one included polynucleotide sequence corresponds to a control sequence, for example, a normalization gene. Exemplary labels include, but are not limited to, fluorophores, dyes, radiolabels, and enzyme tags (which are linked to nucleic acid primers).

[0208] In one embodiment, a kit is provided that is suitable for amplifying nucleic acids corresponding to an expressed RNA sample. Such a kit comprises reagents and primers suitable for use in any of the amplification methods described above. Alternatively, or in addition, the kit is suitable for amplifying a signal corresponding to hybridization between a probe and a target nucleic acid sample (e.g., a target nucleic acid sample placed on a microarray).

[0209] In addition, the kit may include one or more materials and / or reagents required to prepare biological samples for gene expression analysis. Furthermore, the kit may include the necessary reaction mixtures for amplification. The solution comprises one or more enzymes suitable for amplifying nucleic acids (including various polymerases such as RT and Taq), one or more deoxynucleotides, and a buffer.

[0210] Typically, the above kits are used to analyze gene expression patterns using mRNA or microRNA as an initiation template. The RNA template may be given as either total cellular RNA or isolated RNA; both types of samples yield comparable results. In other embodiments, the methods and kits described herein enable the quantification of other products of gene expression, including tRNA, rRNA, or other transcripts.

[0211] Depending on the circumstances, the kit of the present invention may further include software for facilitating data generation, analysis, and / or storage, and for facilitating access to the database. The software includes logical instructions, instruction sets, or suitable computer programs that can be used in data collection, storage, and / or analysis. Comparative and relational analysis of data is possible using the provided software.

[0212] The kit may contain separate containers for each individual reagent and / or enzyme component. It would generally be preferable that each component be portioned into its respective container. The kit containers may include at least one vial, ampoule, or test tube. Flasks, bottles, and other container mechanisms into which reagents can be placed and / or portioned are also possible. The individual containers of the kit are preferably sealed and maintained for commercial sale. Larger, preferred containers may include injection-molded or blow-molded plastic containers that hold the desired vials. Instructions, such as documented instructions or video demonstrations detailing the use of the kit of the present invention, may be provided with the kit.

[0213] In a further aspect, the present invention provides the use of any composition or kit described herein, or the execution of any method or assay described herein, and / or the use of any apparatus or kit for executing any assay or method described herein.

[0214] Where used herein, “test sample” or “biological sample” may mean a sample of a biological tissue or fluid containing nucleic acids. Such samples include, but are not limited to, tissues or bodily fluids isolated from animals. Biological samples may also include tissue sections (e.g., biopsy samples and autopsy samples), frozen sections taken for histological purposes, blood, plasma, serum, sputum, feces, tears, mucus, urine, exudate, amniotic fluid, ascites, hair, and skin. Biological samples may also include explants derived from patient tissue as well as primary cell cultures and / or transformed cell cultures. Biological samples may be provided by taking a sample of cells from an animal; however, biological samples can also be achieved by using previously isolated cells (e.g., cells isolated by another person, at a different time, and / or for a different purpose) or by performing the methods described herein in vivo. Archived samples, such as samples with a treatment history or outcome history, may also be used.

[0215] The term "body fluid" refers to any fluid obtained from the body of an animal. Examples of body fluids include, but are not limited to, plasma, serum, blood, lymph, cerebrospinal fluid, synovial fluid, urine, saliva, mucus, phlegm, and sputum. Body fluid samples may be collected by any preferred method. Samples may be used immediately or stored for later use. Any suitable storage method known in the art may be used to store body fluid samples: for example, samples may be frozen at approximately -20°C to approximately -70°C. A suitable body fluid is cell-free fluid. A “cell-free” fluid includes fluid samples in which cells are absent or present at such low concentrations that the determined miRNA levels reflect their levels in the liquid portion of the sample rather than in the cellular portion. Such cell-free fluids are generally obtained by removing cells from cell-containing fluids, for example, by centrifugation or filtration. Typically, cell-free fluids contain no intact cells; however, some cell-free fluids may contain cell fragments or cellular debris. Examples of cell-free fluids include plasma or serum, or body fluids from which cells have been removed.

[0216] The term “gene,” as used herein, refers to a naturally occurring gene (e.g., a genomic gene) or a synthetic gene, including transcriptional regulatory sequences and / or translational regulatory sequences, as well as a coding region or untranslated sequences (e.g., introns, 5' untranslated sequences, and 3' untranslated sequences). The coding region of a gene may be an amino acid sequence or a nucleotide sequence encoding functional RNA (e.g., tRNA, rRNA, catalytic RNA, siRNA, miRNA, or antisense RNA). A gene may also be mRNA or cDNA corresponding to a coding region (e.g., exons and miRNAs) which may optionally include a 5' untranslated sequence or a 3' untranslated sequence ligated to the coding region. A gene may also be an amplified nucleic acid molecule produced in vitro, including all or part of a coding region and / or a 5' untranslated sequence or a 3' untranslated sequence ligated to the coding region. The term also includes pseudogenes, which are dysfunctional analogs of known genes that have lost their protein-coding ability or, in other cases, are no longer expressed in cells.

[0217] Where used herein, “expression profile” refers to the expression profile of a genome, for example, the expression profile of a microRNA. The profile may be obtained by any convenient means for determining the level of a nucleic acid sequence, for example, by quantitative hybridization of microRNA, cRNA, etc., quantitative PCR, ELISA for quantification, etc., and the profile may allow for differential gene expression analysis between two samples. A sample of a subject or patient, for example, cells or a population thereof, for example, a tissue, is assayed. The sample is collected by any convenient method known in the art. The nucleic acid sequence of interest is a nucleic acid sequence found to be predictive, including the nucleic acid sequences described herein, in which case the expression profile may include all of the listed nucleic acid sequences, or expression data for 5, 10, 20, 25, 50, 100 or more of the listed nucleic acid sequences. The term “expression profile” may also mean measuring the abundance of a nucleic acid sequence in a sample.

[0218] "Differential expression" refers to qualitative or quantitative differences in the temporal gene expression patterns and / or cellular gene expression patterns within and between cells and tissues. Therefore, differentially expressed genes may qualitatively have altered expression, including activation or inactivation, for example, in normal tissue compared to diseased tissue. Genes may be expressed on or off in certain states compared to other states, thus allowing comparison between two or more states. Qualitatively regulated genes will exhibit expression patterns within a state or cell type that may be detectable by standard techniques. Some genes may be expressed in one state or one cell type, rather than in both one state and one cell type. Alternatively, differences in expression may be quantitative, for example, in that expression is regulated, i.e., upregulated, resulting in an increased amount of transcript, or downregulated, resulting in a decreased amount of transcript. The degree of difference in expression only needs to be large enough to be quantified by standard characterization techniques, such as expression arrays, quantitative reverse transcriptase PCR, Northern spectroscopy, and RNase protection.

[0219] "Nucleic acid," "oligonucleotide," or "polynucleotide," as used herein, refers to at least two nucleotides linked together by a covalent bond. By indicating a single strand, the sequence of the complementary strand is also defined. Thus, nucleic acid also encompasses the complementary strand of the indicated single strand. Many variants of nucleic acid may be used for the same purpose as a given nucleic acid. Thus, nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, nucleic acid also encompasses probes that hybridize under stringent hybridization conditions.

[0220] Nucleic acids may be single-stranded or double-stranded, or may contain portions consisting of both double-stranded and single-stranded sequences. Nucleic acids may be DNA (both genomic DNA and cDNA), RNA, or hybrids in which nucleic acids may contain combinations of deoxyribonucleotides and ribonucleotides, as well as various combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids may be obtained by chemical synthesis or recombinant methods.

[0221] The term “primer” refers to a nucleic acid that can hybridize at its 3' end to any complementary nucleic acid molecule and provides a free 3' hydroxyl terminus that can be extended by a nucleic acid polymerase. As used herein, amplification primers are a pair of nucleic acid molecules that can anneal to the 5' or 3' region of a gene (plus and minus strands, respectively, or vice versa, minus and plus strands, respectively) and contain a short region in between. Under appropriate conditions and with appropriate reagents, such primers enable amplification of a nucleic acid molecule having the nucleotide sequence sandwiched by these primers. For in-situ methods, a cell or tissue sample can be prepared, immobilized on a support (e.g., a glass slide), and then brought into contact with a probe that can hybridize to RNA. Alternative methods for amplifying nucleic acids corresponding to expressed RNA samples include, for example, the method described in U.S. Patent No. 7,897,750.

[0222] The term "probe," as used herein, refers to an oligonucleotide capable of binding to a target nucleic acid of a complementary sequence via one or more types of chemical bonds, typically via complementary base pairing, and typically via hydrogen bond formation. A probe may bind to a target sequence that lacks complete complementarity with the probe sequence, depending on the stringency of the hybridization conditions. There may be numerous base pair mismatches that would prevent hybridization between the target sequence and the single-stranded nucleic acids described herein. However, if the number of mutations is so large that hybridization cannot occur even under the lowest stringency hybridization conditions, the sequence is not a complementary target sequence. A probe may be single-stranded, or partially single-stranded and partially double-stranded. The strandedness of the probe is determined by the structure, composition, and properties of the target sequence. A probe may be directly labeled, for example, with biotin to which the streptavidin complex may later bind, or... It may be indirectly labeled.

[0223] When used herein to refer to nucleic acids, “complementary” or “complementary” may mean Watson-Crick base pairing (e.g., AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules. “Fully complementary” or “completely complementary” may mean 100% complementary base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

[0224] Where described herein, “stringent hybridization conditions” refer to the conditions under which a first nucleic acid sequence (e.g., a probe) hybridizes to a second nucleic acid sequence (e.g., a target), for example, in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary from situation to situation, and can be suitably selected by those skilled in the art. Stringent conditions may be selected to be approximately 5°C to 10°C lower than the thermal melting point (Tm) of a particular sequence at a specified ionic strength and pH. Tm may be the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (under specified ionic strength, pH, and nuclear concentration) (since the target sequence is present in excess, 50% of the probe is used at equilibrium at Tm). Stringent conditions may include a sodium ion concentration of less than approximately 1.0 M at a pH of 7.0–8.3, such as approximately 0.01 M–1.0 M (or other salts), and a temperature of at least approximately 30°C for short probes (e.g., approximately 10–50 nucleotides) and at least approximately 60°C for long probes (e.g., more than approximately 50 nucleotides). Stringent conditions may also be achieved by adding a destabilizing agent (e.g., formamide). For selective or specific hybridization, a positive signal may be observed after at least 2–10 times background hybridization. Exemplary stringent hybridization conditions include: incubation at 42°C with 50% formamide, 5×SSC, and 1% SDS; or incubation at 65°C with 5×SSC and 1% SDS, accompanied by washing at 65°C with 0.2×SSC and 0.1% SDS. However, several factors other than temperature, such as salt concentration, may affect the stringency of hybridization, and those skilled in the art can suitably select various factors to achieve similar stringency.

[0225] As used herein, the term “reference value” refers to a value that, when compared to assay results, is statistically correlated with a particular outcome. In a preferred embodiment, the reference value is determined from a statistical analysis of studies comparing microRNA expression to known clinical outcomes. The reference value may be a threshold score or a cutoff score. Typically, the reference value would be a threshold to which, if exceeded (or fallen below), one outcome is more certain, and to which, if fallen below, an alternative threshold is more certain.

[0226] In one embodiment, the reference level may be one or more circulating miRNA levels expressed as the average of circulating miRNA levels obtained from a control population consisting of healthy (disease-free) subjects. In another embodiment, the reference level may be levels at different points in time, for example, in the same subject before the assay, e.g., the level required before the subject develops a disease, or the level required before initiating treatment. Generally, samples are normalized by a common factor. For example, cell-free fluid samples are normalized by fluid volume, and cell-containing samples are normalized by protein content or cell number. Nucleic acid samples may also be normalized against an internal control nucleic acid.

[0227] As disclosed herein, differences in the levels of one or more polypeptides or RNAs (mRNA or microRNA) imply a disease or a stage thereof. The expression “difference in levels” refers to a difference in the amount of a particular marker (e.g., nucleic acid) in a sample, as compared to a control level or a reference level. For example, the amount of a particular biomarker may be elevated or decreased in a sample from a patient with a neoplasm compared to a reference level. In one embodiment, “difference in levels” may be the difference between a particular biomarker present in a sample compared to a control (e.g., a reference value) of at least about 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 75%, 80%, 100%, 150%, 200%, or more. In one embodiment, “difference in levels” may be a statistically significant difference in the amount of a biomarker present in a sample compared to a control. For example, if the measured level of a biomarker deviates from approximately 1.0 standard deviation, 1.5 standard deviation, 2.0 standard deviation, or 2.5 standard deviation from the mean of either the control or reference group, the difference may be statistically significant. Regarding miRNA measurement, the level may be measured as a Ct value from real-time PCR, in which case the Ct value may be normalized to a ΔCt value as described in the examples below.

[0228] Drug screening The present invention provides a method for identifying compounds useful for treating melanoma or for inhibiting endothelial mobilization, cell invasion, or metastatic angiogenesis.

[0229] Candidate compounds for screening (e.g., proteins, peptides, peptide mimes, peptoids, antibodies, small molecules, or other drugs) can be obtained using one of numerous combinatorial library methods known in the art. Such libraries include: peptide libraries, peptoid libraries (libraries of molecules with novel non-peptide backbones that possess peptide functionality but are resistant to enzymatic degradation), spatially addressable parallel solid-phase or liquid-phase libraries, synthetic libraries obtained by deconvolution or affinity chromatography selection, and "one bead, one compound" libraries. See, for example, Zuckermann et al., 1994, J. Med. Chem., 37:2678-2685, and Lam, 1997, Anticancer Drug Des., 12:145. Examples of various methods for synthesizing molecular libraries can be found, for example, in DeWitt et al., 1993, PNAS USA, 90:6909; Erb et al., 1994, PNAS USA, 91:11422; Zuckermann et al., 1994, J. Med. Chem., 37:2678; Cho et al., 1993, Science, 261:1303; Carrell et al., 1994, Angew. Chem. Int. Ed. Engl., 33:2059; Carrell et al., 1994, Angew. Chem. Int. Ed. Engl., 33:2061; and Gallop et al., 1994, J. Med. Chem., 37:1233.Libraries of compounds may be presented in solution (e.g., Houghten, 1992, Biotechniques, 13:412-421), or as beads (Lam, 1991, Nature, 354:82-84), tips (Fodor, 1993, Nature, 364:555-556), bacteria (US Patent No. 5,223,409), spores (US Patent No. 5,223,409), plasmids (Cull et al., 1992, PNAS USA, 89:1865-1869), or phages (Scott and Smith, 1990, Science, 249:386-390; Devlin, 1990, Science, 249:404-406; Cwirla et al., 1990, PNAS USA). These may be cited in USA, 87:6378-6382; Felici, 1991, J.Mol.Biol., 222:301-310; and U.S. Patent No. 5,223,409.

[0230] To identify useful compounds, the test compound can be brought into contact with a system containing test cells expressing a reporter gene encoded by a nucleic acid operably linked to the promoter of a marker gene selected from the aforementioned transmetastatic pro-transmetastatic inhibitors. This system can be an in vitro cell line model or an in vivo animal model. The cells can express the above gene in their natural state or can be modified to express recombinant nucleic acid. The recombinant nucleic acid may contain a nucleic acid encoding a reporter polypeptide for a heterologous promoter. Subsequently, the expression levels of the miRNA, polypeptide, or reporter polypeptide are measured.

[0231] For polypeptides, expression levels can be determined at either the mRNA level or the protein level. Various methods for measuring mRNA levels in cells, tissue samples, or body fluids are widely known in this art. To measure mRNA levels, cells can be lysed, and the level of mRNA in the lysate, or in RNA purified or semi-purified from the lysate, can be determined, for example, by hybridization assays (using detectably labeled gene-specific DNA or RNA probes) and quantitative or semi-quantitative RT-PCR (using appropriate gene-specific primers). Alternatively, quantitative or semi-quantitative in-situ hybridization assays can be performed using tissue sections or unlysed cell suspensions and detectably labeled (e.g., fluorescent or enzyme) DNA or RNA probes. Further mRNA quantification methods include RNA protection assays (RPA) and SAGE. Methods for measuring protein levels in cell or tissue samples are also known in this art.

[0232] To determine the efficacy of candidate compounds for treating melanoma or inhibiting endothelial recruitment, cell invasion, or metastatic angiogenesis, the levels obtained in the manner described above can be compared to a control level (e.g., the level obtained in the absence of the candidate compound). A compound is identified as effective if (i) the level of a metastasis inhibitor is lower than the control or reference value, or (ii) the level of a metastasis promoter is higher than the control or reference value. The efficacy of compounds thus identified can be further confirmed using in vitro cell culture models or in vivo animal models as disclosed in the examples below. [Examples]

[0233] Example 1: Materials and Method This example describes the materials and methods used in Examples 2 to 11 below.

[0234] compound [Table 3]

[0235] animal research All mouse experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at Rockefeller University. Age- and sex-matched mice aged 6 to 8 weeks were used for primary tumor growth assays and metastasis assays as previously described (Minn et al., 2005; Tavazoie et al., 2008). See extended experimental procedures.

[0236] cell culture All cancer cell lines were cultured as previously described (Tavazoie et al., 2008). 293T cells and human umbilical vein endothelial cells (HUVECs) were maintained under standard conditions. miRNA studies and gene knockdown / overexpression studies in cell lines and in vitro functional assays are detailed in the expanded experimental procedures.

[0237] Microarray hybridization To identify deregulated miRNAs across various highly transmissible derivatives, small RNAs were enriched from total RNA derived from MeWo and A375 cell lines and subjected to profiling by LC Sciences. To identify potential genetic targets for miR-199a-3p, miR-199a-5p, and miR-1908, total RNA obtained from MeWo cell lines was labeled by the Rockefeller University Genomics Core Facility and subjected to hybridization to Illumina HT-12 v3 Expression BeadChip arrays. Refer to the extended experimental procedure for thresholds and criteria used to reach miRNA and mRNA targets.

[0238] Analysis of miRNA expression in human melanoma skin lesions All human clinical samples used in this study were obtained, processed, and analyzed in accordance with IRB guidelines. Total RNA was extracted from paraffin-embedded cross-sectional sections of primary melanoma skin lesions previously excised from patients at MSKCC, and specific miRNA expression levels were analyzed in a blinded manner using TaqMan miRNA Assays (Applied Biosystems). Kaplan-Meier curves, representing each patient's metastasis-free survival data as a function of primary tumor miRNA expression levels, were constructed using the GraphPad Prism software package.

[0239] In vivo LNA treatment 4 x 10 4 After injecting individual MeWo-LM2 cells into the tail vein, NOD-SCID mice were treated intravenously twice a week for 4 weeks with an in vivo optimized LNA (Exiqon) antisense against miR-199a-3p, miR-199a-5p, and miR-1908 at a combined dose of 12.5 mg / kg delivered in 0.1 mL of PBS.

[0240] histology For overall macroscopic visualization of metastatic nodules, 5 μm thick lung tissue sections were stained with H&E. For in vivo endothelial content analysis, lung sections were double-stained with an antibody against MECA-32 (Developmental Studies Hybridoma Bank, The University of Iowa, IA) (which labels mouse endothelial cells) and an antibody against human vimentin (Vector Laboratories) (which labels human melanoma cells). See extended experimental procedure.

[0241] Data Analysis All data are expressed as mean ± SEM. The Kolmogorov-Smirnov test was used to determine the significance of differences in the cumulative distribution of metastatic vascular density. The prognostic power of miRNAs predicting the outcome of metastasis was tested for significance using the Mantel-Cox-LogRank test. The significance of non-Gaussian bioluminescence measurements was determined using the one-sided Mann-Whitney t-test. For all other comparisons, the one-sided Student t-test was used. A p-value less than 0.05 was considered statistically significant.

[0242] In vivo selection, experimental metastasis, and primary tumor growth assays All mouse experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at Rockefeller University. In vivo selection was performed as previously described to generate numerous metastatic derivatives from two independent human melanoma cell lines (Minn et al., 2005, Nature, 436, 518-524; Pollack and Fidler, 1982, J. Natl. Cancer Inst., 69, 137-141). Briefly, 1 × 10⁻¹⁶ 6 Pigmented MeWo melanoma parental cells or non-pigmented A375 melanoma parental cells were resuspended in 0.1 mL of PBS and intravenously injected into 6- to 8-week-old immunosuppressed NOD-SCID mice. After lung metastases formed, nodules were isolated and cells were grown in vitro to produce first-generation lung metastatic derivatives (LM1). Subsequently, LM1 cells were divided into 2 × 10⁶ cells. 5 Individual cells were subjected to another in vivo selection by injecting them into NOD-SCID mice via the tail vein, which induced metastatic nodules. Subsequent isolation yielded the second generation of pulmonary metastatic derivatives (LM2). For the A375 cell line, a third in vivo selection was performed, resulting in the highly metastatic A375-LM3 derivative.

[0243] To monitor metastasis in vivo using bioluminescence imaging, A375 parental cells and MeWo parental cells, as well as their metastatic derivatives, were transduced with retroviral constructs expressing a luciferase reporter (Ponomarev et al., 2004, Eur J Nucl Med Mol Imaging, 31, 740-751). For all metastasis experiments, colonization in the lungs or systemically was monitored and quantified over time by non-invasive bioluminescence imaging as previously described (Minn et al., 2005). To determine whether in vivo selection was achieved, 4 × 10⁶ cells were used. 4 Individual MeWo parent cells or MeWo-LM2 cells and 1 × 10⁶ 5 Individual A375 parental cells or A375-LM3 cells were resuspended in 0.1 mL of PBS and injected into 6- to 8-week-old NOD-SCID mice via the lateral tail vein. For experimental translocation assays investigating the effects of putative facilitator miRNAs on colony formation in the lungs, 4 × 10⁶ cells overexpressing miR-199a, miR-1908, miR-214, or control hairpins were injected. 4 4 × 10⁶ MeWo parent cells, miR-199a-3p, miR-199a-5p, miR-1908, or control sequences are silenced. 4 2 × 10⁶ MeWo-LM2 cells and 2 × 10⁶ cells inhibited for miR-199a-3p, miR-199a-5p, miR-1908 or control sequences. 5 A375-LM3 cells were resuspended in 0.1 mL of PBS and injected into the tail vein of 6-8 week old NOD-SCID mice. For epistasis experiments, 1 × 10⁶ cells were injected expressing shRNAs targeting ApoE, DNAJA4, or the control sequence, or siRNAs inhibiting LRP1 or the control sequence under miRNA inhibition conditions. 5 MeWo-LM2 cells were intravenously injected into 6-8 week old NOD-SCID mice. For ApoE pretreatment experiments, MeWo-LM2 cells were incubated at 37°C in the presence of 100 μg / mL of ApoE or BSA. After 24 hours, 4 × 10⁶ cells were obtained. 4Individual cells were injected into 7-week-old NOD-SCID mice via the tail vein. To clarify the effect on metastasis of pre-treatment of highly metastatic melanoma cells with LNAs targeting miR-199a-3p, miR-199a-5p, and miR-1908, MeWo-LM2 cells were transfected individually with each LNA, with a cocktail of LNAs targeting all three miRNAs, or with a control LNA. After 48 hours, 1 × 10⁶ cells were transfected. 5 5 × 10¹ cells (resuspended in 0.1 mL of PBS) were administered intravenously to 7-week-old NOD-SCID mice for studies of metastatic colonization in the lungs, or by intracardiac injection to 7-week-old athymic nude mice for systemic metastasis assays. To clarify the effect of ApoE genetic deletion on metastasis, 5 × 10¹⁶ cells were administered to 8-week-old C57BL / 6-WT mice or C57BL / 6-ApoE- / - mice. 4 Individual B16F10 mouse melanoma cells were intravenously injected. For the study of primary tumor growth, 1 × 10⁶ cells overexpressing miR-199a, miR-1908, or control hairpin were injected. 6 Several parental MeWo cells were mixed with Matrigel in a 1:1 ratio and subcutaneously injected into the lower right flank of 6-week-old immunodeficient NOD-SCID mice. Animals were palpated weekly for tumor formation, and after tumor formation, fairly large tumors were measured twice a week. Tumor volume was measured (minimum diameter). 2 The calculation was performed using the formula × (maximum diameter) / 2.

[0244] Lentiviral-mediated miRNA inhibition and gene knockdown 293T cells were seeded in 10 cm plates and 60% confluence was achieved. Prior to transfection, the cell medium was replaced with fresh antibiotic-free DMEM medium supplemented with 10% FBS. 6 μg of vector A, 12 μg of vector K, and 12 μg of appropriate miR-Zip (System Biosciences, Mountain View, CA) or shRNA plasmid construct (MSKCC HTS Core Facility, New York, NY) were co-transfected using 60 μL of TransIT-293 transfection reagent (MIR 2700, Minis Bio LLC, Madison, WI). Cells were incubated at 37°C for 48 hours, and the virus was collected by centrifugation of the cell medium at 2000 g for 10 minutes, followed by viral filtration through a 0.45 μm filter. 1 × 10 5 Cancer cells were transduced with 2 mL of appropriate virus for 6 hours in the presence of 10 μg / mL polyblen (TR-1003-G, Millipore, Billerica, MA). After 48 hours, 2 μg / mL of puromycin (P8833, Sigma-Aldrich, St Louis, MO) was added to the cell medium for lentiviral selection. Cells were kept in the puromycin-selected state for 72 hours. The following miR-Zip sequences were used: miR-Zip- 199a-3p:5'-GATCCGACAGTAGCCTGCACATTAGTCACTTCCTGTCAGTAACCAATGTGCAGACTACTGTTTTTTGAATT-3' miR-Zip- 199a-5p: 5'-GATCCGCCCAGTGCTCAGACTACCCGTGCCTTCCTGTCAGGAACAGGTAGTCTGAACACTGGGTTTTTGAATT-3' miR-Zip-1908 5'-GATCCGCGGCGGGAACGGCGATCGGCCCTTCCTGTCAGGACCAATCGCCGTCC CCGCCGTTTT TGAATT-3' The following shRNA sequence was used: shAPOE 1 : 5'CCGGGAAGGAGTTGAAGGCCTACAACTCGAGTTGTAGGCCTTCAACTCCTTCTTTTT3' shAPOE 2 : 5'CCGGGCAGACACTGTCTGAGCAGGTCTCGAGACCTGCTCAGACAGTGTCTGCTTTTT3' shDNAJA4 1 : 5'CCGGGCGAGAAGTTTAAACTCATATCTCGAGATATGAGTTTAAACTTCTCGCTTTTT3' shDNAJA4 2 : 5'CCGGCCTCGACAGAAAGTGAGGATTCTCGAGAATCCTCACTTTCTGTCGAGGT TTTT3' Overexpression of miRNAs and genes by retroviruses 6 μg of vector VSVG, 12 μg of vector Gag-Pol, and 12 μg of pBabe plasmid containing the coding sequences for human ApoE, DNAJA4, or an empty vector, or miR-Vec containing the precursor sequences of miR-199a, miR-214, miR-1908, or a control hairpin, were co-transfected into 60% confluence 293T cells using 60 μL of TransIT-293 transfection reagent. The cells were incubated at 37°C for 48 hours, after which the viruses were collected and transduced into cancer cells for 6 hours in the presence of 10 μg / mL polyblen. After 48 hours, 2 μg / mL of puromycin or 10 μg / mL of blastosidine (15205, Sigma-Aldrich, St Louis, MO) was added to the cell medium for retroviral selection. Cells were kept in a puromycin-selected state for 72 hours or in a blastosidine-selected state for 7 days. The following cloning primers were used for overexpression of the ApoE and DNAJA4 coding sequences: ApoE CDS Fwd: 5'-TCATGAGGATCCATGAAGGTTCTGTGGGCT-3' ApoE CDS Rev: 5' -T AGC AG AATTCTC AGTGATTGTCGCTGGG-3' DNAJA4 CDS Fwd: 5'-ATCCCTGGATCCATGTGGGAAAGCCTGACCC-3' DNAJA4 CDS Rev: 5'-TACCATGTCGACTCATGCCGTCTGGCACTGC-3' LNA-based miRNA knockdown Mature miR-199a-3p, mature miR-199a-5p, mature miR-1908, or LNAs complementary to the control sequence (426917-00, 426918-00, 426878-00, and 1990050, respectively; Exiqon, Vedbaek, Denmark) were transfected to 50 nM final concentrations of MeWo-LM2 cancer cells cultured in antibiotic-free medium at 50% confluence using lipofectamine® 2000 transfection reagent (11668-09, Invitrogen, Carlsbad, CA). After 8 hours, the transfection medium was replaced with fresh medium. After 48 hours, 1 × 10⁶ cells were transfected. 5 Cells were intravenously injected into NOD-SCID mice to evaluate metastatic colony formation in the lungs, or injected intracardiacly into athymic nude mice to evaluate systemic metastasis. Cells were used 96 hours post-transfection for in vitro assays of cell invasion and endothelial recruitment.

[0245] siRNA-based mRNA knockdown siRNA targeting LRP1, LRP8, VLDLR, LDLR, or a control sequence is transferred to cancer cells or HUVECs using Lipofectamine™ 2000 transfer. Cells were transfected with a final concentration of 100 nM using a transfection reagent. After 5 hours, the transfection medium was replaced with fresh medium. Cells were subjected to Matrigel infiltration assay and endothelial recruitment assay 96 hours post-transfection. Cells transduced with siRNA targeting LRP1 or a control sequence under miRNA inhibition were injected via tail vein for lung colony formation assay 72 hours post-transfection. Untargeted control siRNA was obtained from Dharmacon. The following LRP1 and LRP8 target sequences were used: siLRP1 1 : 5'-CGAGGACGAUGACUGCUUA-3'; siLRP1 2 : 5'-GCUAUGAGUUUAAGAAGUU-3'; S1LRP8 1 : 5'-CGAGGACGAUGACUGCUUA-3'; siLRP8 2 : 5'-GAACUAUUCACGCCUCAUC-3'. Cell proliferation assay To clarify the effects of overexpression of miR-199a or miR-1908 and combinatorial LNA-induced miRNA inhibition on cell proliferation, 2.5×10 4 cells were seeded in triplicate in 6-well plates and live cells were counted after 5 days. To evaluate the effect of addition of recombinant ApoE on melanoma cell proliferation or endothelial cell proliferation, 3×10 4 melanoma MeWo-LM2 cells or endothelial cells were incubated in the presence of ApoE (100 μM) or BSA (100 μM). Live cells were counted after 8 hours, 24 hours, 48 hours, 72 hours and 120 hours.

[0246] Matrigel invasion assay Cancer cells were subjected to 12-hour serum starvation in DMEM-based medium with 0.2% FBS. Transwell invasion chambers (354480, BD Biosciences, Bedford, MA) were pre-equilibrated before the start of the assay by adding 0.5 mL of starvation medium to the upper chamber and the bottom chamber. After 30 minutes, the medium in the upper chamber was removed and 1×10 50.5 mL of culture medium containing individual cancer cells was added to each Matrigel-coated transwell insert and incubated at 37°C for 24 hours. For neutralizing antibody and / or recombinant protein experiments, antibodies / recombinant proteins were added to each well at the start of the assay at the following concentrations as shown in the figure: 5 μg / mL–40 μg / mL anti-ApoE 1D7 (Heart Institute, University of Ottawa), 5 μg / mL–40 μg / mL anti-IgG (AB-108-C, R&D Systems, Minneapolis, MN), 100 μM recombinant human ApoE3 (4696, Bio Vision, Mountain View, CA), and 100 μM BSA (A2153, Sigma-Aldrich). Upon completion of the assay, the Matrigel-coated inserts were washed with PBS, cells were scraped from the top surface of each insert, and the inserts were fixed in 4% paraformaldehyde for 15 minutes. The inserts were then excised and fixed to slides using VectaShield fixation medium containing DAPI (H-1000, Vector Laboratories, Burlingame, CA). The base surface of each insert was imaged using an inverted fluorescence microscope (Zeiss Axiovert 40 CFL) at 5× magnification, thereby obtaining three representative images for each insert. The number of infiltrating cells was quantified using ImageJ (NIH).

[0247] Endothelial mobilization assay 5 x 10 41 × 10⁶ cancer cells were seeded in a 24-well plate approximately 24 hours before the start of the assay. HUVEC cells were grown to 80% confluence and subjected to 16 hours of serum starvation in EGM-2 medium supplemented with 0.2% FBS. Subsequently, HUVEC cells were pulsed with Cell Tracker Red CMTPX dye (C34552, Invitrogen) for 45 minutes. During this time, the cancer cells were washed with PBS, 0.5 mL of EGM-2 medium with 0.2% FBS was added to each well, and a 3.0 μm HTS Fluoroblock insert (351151, BD Falcon, San Jose, CA) was placed in each well. 5 Each HUVEC (resuspended in 0.5 mL of starvation medium) was seeded into each transwell insert, and the recruitment assay was carried out at 37°C for 16–18 hours. For neutralizing antibody and / or recombinant protein experiments, antibodies / proteins were then added to each well at the appropriate concentrations shown below: 40 μg / mL anti-ApoE 1D7, 40 μg / mL anti-IgG, 100 μM rhApoE3, and 100 μM BSA. Upon completion of the assay, the inserts were processed and analyzed as described for the Matrigel infiltration assay above (see Matrigel infiltration assay).

[0248] Endothelial migration assay HUVECs subjected to serum starvation were pulsed with Cell Tracker Red CMTPX dye for 45 minutes, and 1 × 10⁶ of each insert was added to 0.5 mL of starvation medium. 5 HUVEC was seeded into HTS Fluoroblock Transwell inserts at the specified HUVEC concentration. The assay was carried out at 37°C for 16–18 hours, and the inserts were treated and analyzed as described above (see Matrigel infiltration assay).

[0249] Chemotivity assay HUVECs were subjected to 16 hours of serum starvation in EGM-2 medium with 0.2% FBS and labeled with Cell Tracker Red CMTPX dye for 45 minutes. During that time, the indicated amounts (1 μg to 5 μg) of recombinant human ApoE3 or BSA were mixed with 250 μL of Matrigel (356231, BD Biosciences) and allowed to solidify at the bottom of a 24-well plate for 30 minutes. Then, 250 μL of HUVEC EGM-2 medium containing 0.2% FBS was added to each Matrigel-coated well, and a 3.0 μM HTS Fluoroblock insert was placed into each well. 1×10 5 cells of HUVEC (resuspended in 0.5 mL of starvation medium) were seeded into each insert and allowed to migrate along the Matrigel gradient at 37 °C for 16 to 18 hours. When the assay was completed, the inserts were fixed onto slides as described above and analyzed (see Matrigel invasion assay).

[0250] Endothelial adhesion assay HUVECs were seeded into 6-well plates to form a monolayer. Cancer cells were subjected to 30 minutes of serum starvation in DMEM-based medium with 0.2% FBS and pulse-treated with Cell Tracker Green CMFDA dye (C7025, Invitrogen) for 45 minutes. 2×10 5 cells of cancer (resuspended in 0.5 mL of starvation medium) were seeded onto each endothelial monolayer. The cancer cells were allowed to adhere to the HUVEC monolayer at 37 °C for 30 minutes. Then, the endothelial monolayer was gently washed with PBS and fixed with 4% paraformaldehyde for 15 minutes. Then, each well was covered with PBS, and 8 images were taken for each endothelial monolayer using an inverted fluorescence microscope (Zeiss Axiovert 40 CFL) at a magnification of 10×. The number of cancer cells adhering to HUVECs was quantified using ImageJ.

[0251] Anchorage-independent growth assay 1×10 overexpressing miR-199a, miR-1908 or control hairpin 6MeWo cells were seeded into low-adhesion plates containing cell medium supplemented with 0.2% methylcellulose. After being left in suspension for 48 hours, the number of dead and live cells was counted using trypan blue.

[0252] Serum starvation assay Effects of miR-199a and miR-1908 on the serum starvation capacity of melanoma cells To clarify this, 1 × 10⁶ cells overexpressing miR-199a, miR-1908, or a control hairpin were used. 5 MeWo parent cells were seeded in a quadruple 6-well plate and incubated for 48 hours in a starvation DMEM medium with 0.2% FBS. The number of viable cells was then counted using trypan blue. To clarify the effect of recombinant ApoE3 addition on the survival of melanoma or endothelial cells under serum starvation conditions, 3 × 10⁶ cells were used. 4 Individual MeWo-LM2 cells or endothelial cells were incubated under low serum conditions (0.2% FBS) in the presence of ApoE3 (100 μM) or BSA (100 μM). The number of viable cells was counted at 8, 16, and 24 hours.

[0253] Colony formation assay Fifty MeWo parent cells overexpressing miR-199a, miR-1908, or control hairpin were seeded in quadruple rows on a 6 cm plate. After two weeks, the cells were washed with PBS, fixed with 6% glutaraldehyde, and stained with 0.5% crystal violet. The number of positively stained colonies was counted.

[0254] miRNA microarray hybridization To identify miRNAs exhibiting disregulated expression across various highly metastatic melanoma cell line derivatives, total RNA obtained from numerous independent metastatic derivatives and their respective parental MeWo and A375 cell populations was used to enrich small RNAs, which were then labeled and hybridized on a custom microfluidic microarray platform by LC Sciences. The array was designed to detect 894 mature miRNAs corresponding to miRNA transcripts listed in Sanger miRBase Release 13.0. Of all probes analyzed, probes corresponding to 169 miRNAs garnered signals above the background threshold across the numerous cell lines analyzed. Raw signal intensities (corresponding to probe hybridization) were median-normalized for each cell line. A threshold of upregulation of more than twice the median-normalized expression value was used to identify miRNAs commonly induced in numerous metastatic derivatives for two independent human melanoma cell lines.

[0255] Microarray-based gene target prediction for miR-199a and miR-1908 To identify potential genes targeted by miR-199a-3p, miR-199a-5p, and miR-1908, total RNA was extracted from MeWo cell lines with loss-of-function or gain-of-function of each miRNA, and then processed using Illumina HT-12. The cells were sent to the Genomics Core Facility at Rockefeller University for hybridization with the v3 Expression BeadChip microarray. Raw signal intensities (corresponding to probe hybridization) were then median-normalized for each cell line sample. Three sets of microarray profile comparisons were performed: (1) MeWo control cells versus MeWo cells overexpressing miR-199a or miR-1908, (2) MeWo-LM2 control cells versus MeWo-LM2 cells expressing short hairpins (miR-Zip) targeting miR-199a-3p, miR-199a-5p, or miR-1908, and (3) MeWo parent cells versus MeWo-LM2 cells. Based on the median-normalized expression values ​​obtained from these arrays, possible common target genes for miR-199a and miR-1908 were identified using the following criteria: (1) genes downregulated by more than a 1.5-fold difference for individual overexpression of miR-199a and miR-1908, (2) genes upregulated by more than a 1.5-fold difference when either both miR-199a-3p and miR-1908 are inhibited, or both miR-199a-5p and miR-1908 are inhibited, and (3) genes downregulated by more than a 1.5-fold difference in LM2 cells that express physiologically higher levels of the above three miRNAs compared to MeWo parental cells.

[0256] Analysis of miRNA and mRNA expression in cell lines Total RNA was extracted from various cell lines using the miRvana kit (AM1560, Applied Biosystems, Austin, TX). Expression levels of mature miRNAs were quantified using the Taqman miRNA expression assay (4427975-0002228, Applied Biosystems). RNU44 was used as an endogenous control for normalization. For mRNA expression analysis, 600 ng of total RNA was reverse transcribed using the cDNA First-Strand Synthesis Kit (18080-051, Invitrogen), and approximately 200 ng of the resulting cDNA was then mixed with SYBR Green PCR Master Mix (4309155, Applied Biosystems) and appropriate primers. Each reaction was performed in quadruple runs, and mRNA expression was quantified by real-time PCR amplification using the ABI Pris 7900HT Real-Time PCR System (Applied Biosystems). GAPDH was used as an endogenous control for normalization. The following primers were used: ApoE Fwd: 5'-TGGGTCGCTTTTGGGATTAC-3' ApoE Rev: 5' -TTC AACTCCTTC ATGGTCTCG-3' DNAJA4_Fwd: 5'-CCAGCTTCTCTTCACCCATG-3' DNAJA4 Rev:5'-GCCAATTTCTTCGTGACTCC-3' GAPDH Fwd: 5'-AGCCACATCGCTCAGACAC-3' GAPDH Rev: 5'-GCCCAATACGACCAAATCC-3' LRPl Fwd: 5' -TTTAACAGC ACCGAGTACCAG-3' LRPl Rev: 5' C AGGC AGATGTC AGAGC AG-3' LRP8 Fwd: 5'-GCTACCCTGGCTACGAGATG-3' LRP8 Rev: 5' -GATT AGGG ATGGGCTCTTGC-3' ELISA A conditioned cancer cell medium was prepared by incubating cells in a serum-starved DMEM medium containing 0.2% FBS for 24 hours. The level of ApoE in the conditioned medium was measured using an APOE ELISA kit (IRAPKT031, Innovative This was determined using Research, Novi, and Michigan.

[0257] Luciferase Reporter Assay A heterologous luciferase reporter assay was performed as previously described (Tavazoie et al., 2008). Briefly, the full-length 3'UTR and CDS of ApoE and DNAJA4 were cloned downstream of the sea urchin luciferase reporter into a psiCheck2 dual luciferase reporter vector (C8021, Promega, Madison, WI). 5 × 10 4Individual parental MeWo cells, MeWo-LM2 cells, MeWo cells overexpressing miR-199a, miR-1908, or a control hairpin, and MeWo-LM2 cells expressing miR-199a-3p, miR-199a-5p, miR-1908, or a miR-Zip hairpin targeting the control sequence were transfected with 100 ng of each specific reporter construct using TransiT-293 transfection reagent. 24 hours post-transfection, the cells were lysed, and the ratio of sea urchin luciferase expression to firefly luciferase expression was determined using a dual luciferase assay (E1910, Promega). The predicted miRNA binding sites in each target construct were identified by alignment with complementary miRNA seed sequences (miR-199a-3p:5'-CAGUAGUC-3';miR-199a-5p:5'-CCAGUGUU-3';miR-1908:5'-GGCGGGGA-3'). The miRNA complementary sites in each target construct were mutated using the QuickChange Multi Site-Directed Mutagenesis Kit (200514, Agilent Technologies, Santa Clara, CA). Based on miRNA seed sequence complementarity analysis, the CDS of ApoE was mutated at position 141 (from CTG to ACT), the 3'UTR of ApoE was mutated at position 83 (from GCC to ATA) and at position 98 (from CTG to ACA), the CDS of DNAJA4 was mutated at position 373 (from CGC to TAT) and at position 917 (from CTG to AGA), and the 3'UTR of DNAJA4 was mutated at position 576 (from CTG to ACA), at position 1096 (from CTG to TCT), at position 1396 (from CGC to TGT), and at position 1596 (from CTG to TGT). The following primers were used to clone the 3'UTR and CDS of ApoE and DNAJA4: ApoE CDS Fwd: 5'-AGTACCTCGAGGGGATCCTTGAGTCCTACTC-3' APOE CDS Rev: 5'-TAATTGCGGCCGCTCAGACAGTGTCTGCACCCAG-3' DNAJA4_CDS_Fwd: 5'-TAATATCTCGAGATGTGGGAAAGCCTGACCC-3' DNAJA4 CDS Rev: 5'-CAATTGCGGCCGCTCATGCCGTCTGGCACTGC-3' APOE 3 'UTR Fwd: 5'-TTAGCCTCGAGACGCCGAAGCCTGCAGCCA-3' APOE 3'UTR Rev: 5'-TTACTGCGGCCGCTGCGTGAAACTTGGTGAATCTT-3' DNAJA4 3 'UTR Fwd: 5'-TAATATCTCGAGCGTGGTGCGGGGCAGCGT-3' DNAJA4 3 'UTR Rev: 5'-CAATTGCGGCCGCTTATCTCTCATACCAGCTCAAT-3' The following primers were used to induce mutagenesis of the miRNA binding site at each target: APOE CDS mut: 5'- GCCAGCGCTGGGAACTGGCAACTGGTCGCTTTTGGGATTACCT-3' APOE 3 'UTR mutl : 5 '- CAGCGGGAGACCCTGTCCCCATACCAGCCGTCCTCCTGGGGTG-3' APOE 3 'UTR_mut2 : 5 ' - TCCCCGCCCCAGCCGTCCTCACAGGGTGGACCCTAGTTTAATA-3' DNAJA4_CDS_mutl : 5'- GGGATCGGTGGAGAAGTGCCTATTGTGCAAGGGGCGGGGGATG-3' DNAJA4_CDS_mut2: 5'- GTAGGGGGCGGGGAACGTGTTATCCGTGAAGAGGTGGCTAGGG-3' DNAJA4 3 'UTR mutl : 5 '- CAGGGCCAACTTAGTTCCTAACATTCTGTGCCCTTCAGTGGAT-3' DNAJA4 3 'UTR_mut2 : 5 ' - ACAGTTTGTATGGACTACTATCTTAAATTATAGCTTGTTTGGA-3' DNAJA4 3 'UTR_mut3 ​​: 5 ' - TAATTATTGCTAAAGAACTATGTTTTAGTTGGTAATGGTGTAA-3' DNAJA4 3 'UTR_mut4 : 5 ' - CAGCTGCACGGACCAGGTTCCATAAAAAACATTGCCAGCTAGTGAG-3' Analysis of miRNA expression in human melanoma skin lesions All human clinical samples used in this study were obtained, processed, and analyzed in accordance with institutional IRB guidelines. Paraffin-embedded cross-sectional sections of primary melanoma skin lesions from 71 human patients were obtained from MSKCC. These samples were deparaffinized by five consecutive xylene washes (5 minutes each). After deparaffinization, malignant tumor-containing regions were identified by H&E staining, dissected, and total RNA was extracted from the dissected tissue using the RecoverAll Total Nucleic Acid Isolation Kit (AM1975, Applied Biosystems). The expression levels of mature miR-199a-3p, miR-199a-5p, and miR-1908 in each sample were quantified in a blinded manner using the Taqman miRNA assay. RNU44 was used as an endogenous control for normalization. The expression levels of each miRNA were compared between primary melanomas with a tendency to metastasize and primary melanomas that did not metastasize. Kaplan-Meier curves were plotted as a function of expression levels for each miRNA in each patient tumor, using patient metastasis-free survival data. Metastatic recurrences to sites such as the lungs, brain, bone, and soft tissues had been previously recorded, and such metastatic recurrences allowed for a retrospective analysis of the relationship between the expression levels of identified miRNAs and metastatic recurrences.

[0258] histology Animals were perfused with PBS and then fixed with 4% paraformaldehyde administered by intracardiac infusion followed by intratracheal infusion. Lungs were dissected, incubated overnight in 4% paraformaldehyde at 4°C, embedded in paraffin, and sliced ​​into 5 μm thick serial sections. Lung sections were stained with H&E for overall macroscopic visualization of metastatic nodules. For analysis of endothelial content in metastatic nodules formed in mice by human melanoma MeWo cells, representative lung sections were double-stained with a primary antibody against MECA-32 (Developmental Studies Hybridoma Bank, The University of Iowa, IA) (which labels mouse endothelial cells) and a primary antibody against human vimentin (VP-V684, Vector Laboratories) (which labels human melanoma cells). Various Alexa Fluor dye-conjugated secondary antibodies were used to detect the primary antibodies. To determine vascular density within metastatic nodules, fluorescence was measured using a Zeiss laser scanning confocal microscope (LSM510), and the MECA-32 signal within each metastatic nodule (where the contour is indicated based on co-staining with human vimentin) was quantified in a blinded manner using ImageJ (NIH). For endothelial content analysis in metastatic nodules formed in wild-type mice and ApoE genetic null mice with B16F10 mouse melanoma cells, representative lung sections were stained for MECA-32, and the MECA-32 signal within each nodule (where the boundary is determined based on cellular pigmentation) was quantified in a blinded manner. Total vascular area (given as the percentage area covered by blood vessels relative to the total area of ​​each metastatic nodule) was obtained by background removal (radius of a 1-pixel rolling ball) and the use of a predetermined threshold as a cutoff. Metastatic nodules were defined as any region with a total area of ​​2000 μm². 2 It was defined as the region exceeding a certain threshold. For larger nodules, at least four representative images were obtained, and their average vascular density was calculated.

[0259] In vivo Matrigel plug assay 10 μg / mL recombinant human ApoE3 (4696, BioVision), 10 μg / mL BSA (A2153, Sigma Aldrich), or 400 ng / mL VEGF were mixed with Matrigel (356231, BD Biosciences) as shown. 400 μL of Matrigel containing the shown recombinant protein was subcutaneously injected just above the ventral flank of immunosuppressed NOD-SCID mice. The plugs were removed 3 days post-injection and fixed in 4% paraformaldehyde for 48 hours. The plugs were then paraffin-embedded and cut into 5 μm thick serial sections. Cross-sectional sections of the plugs were immunohistochemically stained with a primary antibody against the mouse endothelial antigen MECA-32 (Developmental Studies Hybridoma Bank, The University of Iowa, IA), detected by a peroxidase-conjugated secondary antibody, and subsequently visualized by DAB oxidation. To quantify the degree of endothelial cell infiltration into each Matrigel plug, the number of endothelial cells was counted in 4 to 5 random fields of view for each plug, and the average number of endothelial cells per given plug area was calculated.

[0260] tissue culture The SK-Mel-334 primary human melanoma line was established from soft tissue metastases of Braf-mutated melanoma in one patient with MSKCC. After minimal in vitro expansion culture, cells were in vivo selected to produce the pulmonary metastatic derivative SK-Mel-334.2 (Pollack and Fidler, 1982). The vemurafenib-resistant clone (C1) of SK-Mel-239 was acquired from Poulikos Poulikakos (Mount Sinai Medical School) and B-Raf V600E / + ;Pten - / - ;CDKN2A - / - The primary mouse melanoma cell line was donated by Marcus Rosenberg (Yale University). All other cell lines used were purchased from ATCC.

[0261] Elisa from ApoE Extracellular ApoE levels in serum-free conditioned medium obtained from melanoma cells treated with DMSO, GW3965, or T0901317 (1 μM each) were quantified 72 hours after treatment using the ApoE ELISA kit (Innovative Research).

[0262] Western blotting Mouse lung and brain tissue samples were homogenized on ice in RIPA buffer (Sigma-Aldrich) supplemented with a protease inhibitor (Roche). Mouse adipose tissue was homogenized on ice in TNET buffer (1.5 mM Tris (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% Triton, protease inhibitor). Total protein lysates (2 μg) were separated by SDS-PAGE, transferred to a PVDF membrane, and blotted with anti-mouse ApoE antibody (ab20874, Abcam) and anti-tubulin α / β antibody (2148, Cell Signaling).

[0263] ApoE expression analysis in melanoma clinical samples All clinical sample acquisition, processing, and analysis were carried out strictly in accordance with IRB guidelines. Primary melanoma skin lesions were pre-excised from patients at MSKCC, fixed in formalin, embedded in paraffin, and sectioned into 5 μm thick slides. ApoE protein expression was evaluated by double-blind immunohistochemical analysis using D6E10 anti-ApoE antibody (ab1906, Abcam).

[0264] histochemistry Animals were perfused intracardiacally with PBS, followed by perfusion with 4% paraformaldehyde (PFA). Fixed lungs were embedded in paraffin and prepared as 5 μm thick serial sections. Macroscopic metastatic lung nodules were visualized by H&E staining. To analyze endothelial cell content, tumor growth, and apoptosis in the tumors, paraffin-embedded sections of primary tumors were stained with antibodies against MECA-32 (Developmental Studies Hybridoma Bank, University of Iowa), KI-67 (ab15580, Abcam), and cleaved caspase-3 (9661, Cell Signaling), respectively.

[0265] Tail vein metastasis assay For in vivo translocation assays, melanoma cells were transduced with a stably expressed retroviral construct encoding a luciferase reporter gene (Ponomarev et al., 2004). This allowed the inventors to monitor the in vivo progression of melanoma cells by bioluminescence imaging. The following number of melanoma cells (resuspended in 100 μL of PBS) were intravenously injected via the tail vein: 4 × 10⁶ 4 MeWo cells, 2.5 × 10⁶ 5 10¹ HT-144 cells, 2 × 10¹⁶ 5 SK-Mel-334.2 cells, 5 × 10 4 A number of B16F10 cells, and 1 × 10⁶ 5 YUMM cells were injected into 6- to 8-week-old sex-matched NOD scid mice, while B16F10 cells and YUMM cells were injected into 6- to 8-week-old sex-matched C57BL / 6 mice. In all experiments evaluating the effect of GW3965 on metastasis formation, mice were pre-treated with either a control diet or a GW3965 supplement diet (20 mg / kg) for 10 days. To evaluate the effect of GW3965 treatment on brain metastases, 1 × 10⁶ cells were used. 5Individual MeWo brain metastatic derivatives were intracardiacally injected into athymic nude mice. Immediately after injection, the mice were randomly assigned to either a control diet or a GW3965 supplement diet (100 mg / kg). To determine whether oral delivery of GW3965 could inhibit the progression of early metastases, 4 × 10⁶ Scid mice were given a GW3965 supplement diet. 4 Individual MeWo cells were intravenously injected, and the cells were allowed to colonize in the lungs for 42 days. Subsequently, mice were blinded and assigned to either a control diet or a GW3965 supplement diet (100 mg / kg).

[0266] Orthotopic metastasis assay To clarify the effect of GW3965 treatment on lung colony formation by melanoma cells isolated from orthotopic sites, we used 1×10⁶ cells expressing a luciferase reporter. 6 MeWo cells were subcutaneously injected into the lower flanks of both NOD Scid mice. The volume was approximately 300 mm³. 3 When tumors formed, they were resected, and mice were randomly assigned to either a control diet or a GW3965 supplement diet (100 mg / kg). One month after tumor resection, the lungs were removed, and colony formation in the lungs was measured by ex vivo bioluminescence imaging. To histologically confirm the extent of melanoma colony formation in the lungs, the lungs were then fixed overnight in 4% PFA, embedded in paraffin, and divided into 5 μM serial sections, which were stained for human vimentin (VP-V684, Vector Laboratories).

[0267] Creation of dacarbazine-resistant melanoma cells Dacarbazine-resistant B16F10 mouse melanoma cells were generated by serial culture of cells in the presence of DTIC (D2390, Sigma-Aldrich, St. Louis, MO). Initially, cells were treated with 500 μg / mL of DTIC for 1 week. Following this initial DTIC treatment, the remaining (approximately 10%) viable cells were allowed to recover for 1 week, after which 750 μg / mL of DTIC was added to the cell medium for 5 days. Following this high-dose treatment, cells were allowed to recover in the presence of a low dose of DTIC (100 μg / mL) for 1 week. Subsequently, the cells were serially cultured in cell medium containing 200 μg / mL of DTIC for at least 1 month before transplantation into mice. DTIC was added to fresh cancer cell medium every 3 days. For tumor growth experiments, 5 × 10⁶ cells were used. 4 Individual B16F10 parental cells and DTIC-resistant cells were subcutaneously injected into the lower flank of 7-week-old C57BL / 6 mice. The volume was approximately 5 mm. 3 ~10mm 3 After small tumors formed, mice were randomly assigned to one of the following treatment groups: (1) control diet + vehicle (ip); (2) control diet + DTIC (ip) (50 mg / kg); (3) GW3965 supplement diet (100 mg / kg) + vehicle (ip). DTIC was dissolved in water in the presence of citrate (1:1 by weight ratio) and administered daily by intraperitoneal injection. DTIC-resistant MeWo human melanoma cell line clones were introduced, with a volume of 600 mm. 3 ~800mm 3 These cells were obtained after DTIC treatment in mice with MeWo tumors. Following the initial tumor reduction in response to daily DTIC administration (50 mg / kg, ip) during the first two weeks, the tumor eventually developed resistance and resumed growth. At that point, tumor cells were isolated, and a DTIC-resistant MeWo cell line was established. The cells were cultured in vitro for 1 week in the presence of DTIC (200 μg / mL), and then expanded to 5 × 10⁻⁶ cells. 5 Individual DTIC-resistant MeWo cells were reinjected into 8-week-old Nod SCID gamma mice. The tumor was 5 mm in volume. 3 ~10mm 3After growth, mice were blindly assigned to the following treatment groups: (1) control diet; (2) control diet + DTIC (50 mg / kg); (3) GW3965 supplement diet (100 mg / kg). To clarify the effect of DTIC on tumor growth by unselected parental MeWo cells, 5 × 10⁶ mice were used. 5 MeWo cells were subcutaneously injected into Nod SCID gamma mice, and the mice were subjected to a volume reduction of 5 mm. 3 ~10mm 3 After the tumors formed, they were treated with a control vehicle or DTIC (50 g / kg). DTIC was administered daily as described above, in a cycle of five consecutive daily treatments with a two-day rest period in between. Tumor growth was measured twice a week.

[0268] Genetic initiation model of melanoma progression Melanoma progression Tyr::CreER;B-Raf V600E / + ;Pten lox / + / Tyr::CreER;B-Raf V600E / + ;Pten lox / loxA conditional model was previously established and characterized by Dankort et al. (2009). Briefly, melanoma was induced in these mice at 6 weeks of age by intraperitoneal injection of 4-HT (H6278, 70% isomer, Sigma-Aldrich, St. Louis...

Claims

[Claim 1] A pharmaceutical composition for treating cancer in subjects who require treatment for cancer, (a) comprising an LXRβ agonist selected from the group consisting of compound 1, compound 2, compound 12, and compound 25, and / or a medically acceptable salt thereof, 【Chemistry 1】 (b) A pharmaceutical composition used in combination with an antiproliferative compound selected from the group consisting of immunomodulators, topoisomerase inhibitors, antimetabolites, angiogenesis inhibitors, tyrosine kinase inhibitors, alkylating agents, and mitotic inhibitors.

Images