Inhibition of tau aggregation

Abstract

The present invention provides compositions for inhibiting tau aggregation, etc. [Solution] One embodiment of the present invention is a composition for inhibiting tau aggregation, comprising a tau variant or a nucleic acid construct expressing the variant.

Description

Technical Field

[0001] The present invention relates to the inhibition of tau aggregation, and particularly to the inhibition of seed-dependent tau aggregation.

Background Art

[0002] Neurodegenerative diseases such as Alzheimer's disease (AD), corticobasal degeneration (CBD), and progressive supranuclear palsy (PSP) are characterized by the accumulation of tau protein in the lesion sites of the patient's brain and are defined as a type of tauopathy.

Prior Art Documents

Non-Patent Documents

[0003]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0004] In recent years, it has been considered that tau accumulates in the brain by repeating seed-dependent aggregate formation and intercellular propagation like prions, which is the cause of the onset and progression of tauopathy.

[0005] Although research on intercellular propagation is still in progress, it is expected that finding a method to suppress the formation of protein aggregates that occur in a seed-dependent manner will lead to the treatment and prevention of related diseases.

[0006] One aspect of the present invention aims to provide compositions, methods, etc. related to the inhibition of tau aggregation in view of the above-mentioned problems. [Means for solving the problem]

[0007] To solve the above problems, the present invention includes, for example, the following embodiments. 1) A composition for inhibiting tau aggregation, comprising a modified tau or a nucleic acid construct expressing the modified tau. 2) A variant of tau having at least one of the mutations shown in (2) to (4) below. (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1. (3) The amino acid sequence shown in Sequence ID No. 1, from amino acid 316 to amino acid 321 Mutations in one, two, three, four, five, or all six amino acids within the amino acid region (SKVTSK). (4) Mutations in one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 through 316 in the amino acid sequence shown in Sequence ID No. 1. 3) A method for suppressing seed-dependent tau aggregation, comprising the step of coexisting a tau variant with wild-type tau. [Effects of the Invention]

[0008] According to one aspect of the present invention, a composition for inhibiting tau aggregation and its use can be provided. In particular, a composition for inhibiting seed-dependent tau aggregation and its use can be provided. [Brief explanation of the drawing]

[0009] [Figure 1]Figure 1 shows the domain structure of the tau protein. Human tau is a microtubule-binding protein consisting of 352 to 441 amino acids. The N-terminus contains a projection domain that regulates the distance between microtubules, and the C-terminus contains a microtubule-binding domain that binds to microtubules. The aggregated core sequences of AD, CBD, and PSP-tau are located in the 274-380aa region in the numbering of the longest 441-amino acid isoform. The C-terminal fragment of Tau (243-441 aa) covers the entire aggregated core sequence. [Figure 2] Figure 2 is a schematic diagram illustrating the seed-dependent aggregation and propagation of tau. [Figure 3] Figure 3 shows the results of inhibiting AD seed-dependent aggregation of tauWT in an embodiment of the present invention. The "HA-tauWT / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauWT]. The "HA-tauΔ368 / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauΔ368-P2A] and [Myc-tauWT]. As a result of comparing aggregated Myc-tauWT recovered in the insol. fraction, the aggregated Myc-tauWT band was significantly reduced in the case where HA-tauΔ368 was co-expressed. [Figure 4] Figure 4 shows the results of inhibiting AD seed-dependent aggregation of tauWT with tauΔ368, according to an embodiment of the present invention. The "HA-tauWT / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauWT]. The "HA-tauWT / P2A / Myc-tauΔ368" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauΔ368]. As a result of comparing the aggregated HA-tauWT recovered in the insol. fraction, the aggregated HA-tauWT band was significantly reduced in the case where Myc-tauΔ368 was co-expressed. [Figure 5]Figure 5 shows the results of an embodiment of the present invention in which tauΔ368 does not affect the CBD seed-dependent aggregation of tauWT. The "HA-tauWT / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauWT]. The "HA-tauΔ368 / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauΔ368-P2A] and [Myc-tauWT]. As a result of comparing the aggregated Myc-tauWT recovered in the insol. fraction, no decrease in the aggregated Myc-tauWT band was observed even when HA-tauΔ368 was co-expressed. [Figure 6] Figure 6 shows the results of searching for a site that causes tau to lose its ability to aggregate CBD seeds, in relation to an embodiment of the present invention. Mutations at 294-297Ala significantly reduced CBD seed-dependent aggregation. [Figure 7] Figure 7 shows the results of searching for a site that causes tau to lose its ability to aggregate with CBD seeds, in relation to an embodiment of the present invention. Mutations at 294-295Ala significantly reduced CBD seed-dependent aggregation. [Figure 8] Figure 8 shows the results of searching for a site that causes tau to lose its ability to aggregate with PSP seeds, in relation to an embodiment of the present invention. In all Ala substitutions, PSP seed-dependent aggregation was significantly reduced. [Figure 9] Figure 9 shows the results of an embodiment of the present invention, showing that Tau294-295 Ala exhibits specificity for CBD seeds, and tau316-321 Ala exhibits specificity for PSP seeds. The results on the left of the figure use CBD seeds derived from three cases, and in all cases, aggregation was reduced with 294-295 Ala. Aggregation did not change with 316-321 Ala. The results on the right of the figure use PSP seeds derived from three cases, and in all cases, aggregation was reduced with 316-321 Ala. Aggregation did not change with 294-295 Ala. [Figure 10]Figure 10 shows the results of inhibiting CBD seed-dependent aggregation of tauWT in an embodiment of the present invention. The "HA-tauWT / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauWT]. The "HA-tau294-295Ala / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tau294-295Ala-P2A] and [Myc-tauWT]. As a result of comparing aggregated Myc-tauWT recovered in the insol. fraction, the aggregated Myc-tauWT band was significantly reduced in the case where HA-tau294-295Ala was co-expressed. [Figure 11] Figure 11 shows the results of inhibiting PSP seed-dependent aggregation of tauWT in an embodiment of the present invention. The "HA-tauWT / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tauWT-P2A] and [Myc-tauWT]. The "HA-tau316-321Ala / P2A / Myc-tauWT" construct is cleaved and co-expressed as [HA-tau316-321Ala-P2A] and [Myc-tauWT]. As a result of comparing aggregated Myc-tauWT recovered in the insol. fraction, the aggregated Myc-tauWT band was significantly reduced in the case where HA-tau316-321Ala was co-expressed. [Figure 12] Figure 12 shows the amino acid sequence of human wild-type tau (SEQ ID NO: 1) and the nucleotide sequence encoding it (SEQ ID NO: 2). The nucleotides / amino acids enclosed in boxes in the figure correspond to the region of Tau-CTF24 (243-441 amino acid fragment) shown in Figure 13. [Figure 13] Figure 13 shows the amino acid sequence of the 243-441 amino acid fragment Tau-CTF24 of human wild-type tau, and the nucleotide sequence encoding it. The tau variants in the examples correspond to those in which amino acid mutations have been introduced into this Tau-CTF24. [Figure 14]Figure 14 shows the base sequence and amino acid sequence of the modified tau in the example. Deletions (missing values) occur at the underlined base / amino acid locations in the figure. [Figure 15] Figure 15 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 16] Figure 16 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 17] Figure 17 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 18] Figure 18 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 19] Figure 19 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 20] Figure 20 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 21] Figure 21 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 22] Figure 22 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Figure 23] Figure 23 shows the base sequence and amino acid sequence of the modified tau in the example. Substitutions have occurred at the base / amino acid locations enclosed in boxes in the figure. [Modes for carrying out the invention]

[0010] [1. Modified tau and nucleic acid constructs expressing these modified tau molecules] (Modified version) A tau variant according to one embodiment of the present invention refers to a variant in which some of the amino acids in the amino acid sequence that constitutes the primary structure of wild-type tau are mutated. This variant may also be called a tau variant or modified tau. An example of an amino acid mutation is an amino acid substitution and / or deletion (deletion), which is introduced by genetic engineering techniques.

[0011] In comparison with the amino acid sequence of wild-type tau (SEQ ID NO: 1), the amino acid positions where mutations affecting the aggregation of tau (sometimes referred to as "responsible mutations") occur are as shown in any of (1) to (4) below, and preferably as shown in any of (1) to (3).

[0012] (1) A mutation in the amino acid corresponding to the 368th amino acid (asparagine) in the amino acid sequence shown in Sequence ID No. 1. This causative mutation is a mutation that affects the tau aggregation specific to Alzheimer's disease (AD) seeds.

[0013] (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1. This causative mutation is a mutation that affects the tau aggregation specific to corticobasal degeneration (CBD) seeds.

[0014] (3) Mutations in one, two, three, four, five, or all six amino acids in the region (SKVTSK) consisting of amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No. 1. These causative mutations affect tau aggregation specific to progressive supranuclear palsy (PSP) seeds.

[0015] (4) Mutations in amino acids corresponding to one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 to 316 in the amino acid sequence shown in Sequence ID No. 1. Preferably, mutations in amino acids corresponding to one, two, three, four, or all five amino acids in the region (PVDLS) consisting of amino acids 312 to 316 in the amino acid sequence shown in Sequence ID No. 1. The responsible mutation is a mutation that affects at least the seed-dependent tau aggregation of progressive supranuclear palsy (PSP).

[0016] A tau variant may, for example, have only the responsible mutations shown in (1) above, or only the responsible mutations shown in (2) above, or only the responsible mutations shown in (3) above, or only the responsible mutations shown in (4) above. A tau variant may, for example, have two types selected from those shown in (1) to (3) above as responsible mutations (a combination of (1) and (2) above, or a combination of (1) and (3) above, or a combination of (2) and (3) above). A tau variant may, for example, have all of those shown in (1), (2), and (3) above as responsible mutations. A tau variant may, for example, have two or three types selected from those shown in (1) to (4) above as responsible mutations. A tau variant may, for example, have all of those shown in (1), (2), (3), and (4) above as responsible mutations.

[0017] Regarding the responsible mutation in (1) above. One example of a mutation in the amino acid corresponding to the 368th amino acid (asparagine) in the amino acid sequence shown in Sequence ID No. 1 is a deletion. Another example of a mutation is a substitution with a positively charged amino acid (arginine, lysine, or histidine). Yet another example of a mutation is a substitution with a hydrophobic amino acid (alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, or tyrosine; preferably alanine, isoleucine, leucine, or valine).

[0018] Regarding the responsible mutation in (2) above. One example of a mutation in the amino acid corresponding to the 294th amino acid (lysine) in the amino acid sequence shown in Sequence ID No. 1 is a deletion. Another example of a mutation is a substitution with a negatively charged amino acid (aspartic acid or glutamic acid). Yet another example of a mutation is a substitution with a hydrophobic amino acid (alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, or tyrosine; preferably alanine, isoleucine, leucine, or valine). If the mutation in the amino acid corresponding to the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1, described later, is a substitution with a positively charged amino acid, then a deletion or substitution with a hydrophobic amino acid may be preferable for the mutation in the amino acid corresponding to the 294th amino acid (lysine). One example of a mutation in the amino acid corresponding to the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1 is a deletion. Another example of a mutation is a substitution with a positively charged amino acid (arginine, lysine, or histidine). Yet another example of a mutation is a substitution with a hydrophobic amino acid (alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, or tyrosine; preferably alanine, isoleucine, leucine, or valine). If the mutation in the amino acid corresponding to the 294th amino acid (lysine) in the amino acid sequence shown in Sequence ID No. 1 is a substitution with a negatively charged amino acid, then a deletion or substitution with a hydrophobic amino acid may be preferable for the mutation in the amino acid corresponding to the 295th amino acid (aspartic acid).

[0019] Regarding the responsible mutation in (3) above. One example of a mutation in the amino acid region (SKVTSK) from amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No. 1 is a deletion. Another example of a mutation is the substitution of a negatively charged amino acid (aspartic acid or glutamic acid) in the amino acid corresponding to amino acid 317 (lysine) and / or amino acid 321 (lysine). Yet another example of a mutation is the substitution of an amino acid other than serine, threonine, or tyrosine in the amino acid corresponding to at least one selected from amino acids 316 (serine), 319 (threonine), and 320 (serine). Further examples of mutations include substitutions to hydrophobic amino acids (alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, or tyrosine; preferably alanine, isoleucine, leucine, or valine), although the amino acid corresponding to the 318th amino acid (valine) may be unsubstituted (remaining as valine) or substituted with alanine.

[0020] Regarding the responsible mutation in (4) above. One example of a mutation in the amino acid region (KPVDLS) from amino acids 311 to 316 in the amino acid sequence shown in Sequence ID No. 1 is a deletion. Another example of a mutation is the substitution of the amino acid corresponding to amino acid 311 (lysine) with a negatively charged amino acid (aspartic acid or glutamic acid). Yet another example of a mutation is the substitution of the amino acid corresponding to amino acid 316 (serine) with an amino acid other than serine, threonine, or tyrosine. Yet another example of a mutation is the substitution of the amino acid corresponding to amino acid 314 (aspartic acid) with a positively charged amino acid (arginine, lysine, or histidine). Further examples of mutations include substitutions to hydrophobic amino acids (alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, or tyrosine; preferably alanine, isoleucine, leucine, or valine). However, the amino acid corresponding to the 312th amino acid (proline), the 313th amino acid (valine), or the 315th amino acid (leucine) may be unsubstituted (remaining as proline, valine, or leucine, respectively) or substituted to valine or alanine. If the mutation in the amino acid corresponding to the 314th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1 is a substitution to a positively charged amino acid, then the mutation in the amino acid corresponding to the 311th amino acid (lysine) may preferably be a deletion or a substitution to a hydrophobic amino acid.

[0021] Assuming that the modified tau has the responsible mutation described above, it may have further mutations (sometimes referred to as non-responsible mutations) when compared to the amino acid sequence of wild-type tau (SEQ ID NO: 1). The modified tau is, for example, a form corresponding to the truncated form of wild-type tau. The truncated form of wild-type tau lacks, for example, the N-terminal region of wild-type tau. Here, the N-terminal region is, for example, all or a contiguous part of the region from the 1st to the 242nd position of wild-type tau, and all or a contiguous part of the region from the 1st to the 273rd position (up to the microtubule domain R1) of wild-type tau. Furthermore, the truncated form of wild-type tau lacks, for example, the C-terminal region of wild-type tau. Here, the C-terminal region is, for example, all or a contiguous part of the region from the 381st to the 441st position of wild-type tau. The truncated form of wild-type tau lacks, for example, the N-terminal region and / or the C-terminal region of wild-type tau described above. Assuming that the truncated form of wild-type tau has the causative mutation described above, it may also have, for example, only the region corresponding to any of the microtubule-binding domains R2, R3, or R4, only the regions corresponding to microtubule-binding domains R2 and R3, or only the regions corresponding to microtubule-binding domains R3 and R4, etc.

[0022] In this specification, "amino acid residues corresponding to a predetermined amino acid residue in the amino acid sequence shown in SEQ ID NO: 1" refers to 1) the predetermined amino acid residue itself in the amino acid sequence shown in SEQ ID NO: 1, and 2) an amino acid residue in another amino acid sequence that corresponds to the predetermined amino acid residue in the amino acid sequence shown in SEQ ID NO: 1. In case 2), it refers to amino acid residue X in another amino acid sequence that is identified by homology analysis as corresponding to amino acid residue X in the amino acid sequence shown in SEQ ID NO: 1. Examples of homology analysis methods include pairwise sequence alignment methods such as the Needleman-Wunsch method and the Smith-Waterman method, and multiple sequence alignment methods such as the ClustalW method. Those skilled in the art can use these methods to understand the "corresponding amino acid residues" in other amino acid sequences under analysis, using the amino acid sequence shown in SEQ ID NO: 1 as a reference sequence. Examples of other amino acid sequences under analysis include isoforms, homologs, or modifications of the above reference sequence. The analysis may be performed with default settings, or parameters may be changed from the default settings as appropriate. This concept is also applicable to amino acid sequences other than those shown in SEQ ID NO: 1. Furthermore, by replacing amino acid residues with bases, this concept can be applied to any base sequence.

[0023] In one example of a tau variant, the amino acid sequence excluding the responsible mutations described above exhibits sequence identity of, for example, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% when compared with the corresponding region in the amino acid sequence shown in Sequence ID No. 1. The tau variant is preferably a variant based on the wild-type sequence of human tau, but may also be a variant based on the wild-type sequence of tau from other animals (preferably mammals) such as mice, rats, or pigs.

[0024] From another perspective, in one example of a tau variant, the amino acid sequence excluding the aforementioned responsible mutation shows, for example, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity when compared with the amino acid sequence of the tau variant used in the example (also shown in Figures 14-23).

[0025] In one example of a tau variant, its amino acid length is, for example, 450 amino acid length or less, 400 amino acid length or less, 350 amino acid length or less, 300 amino acid length or less, 250 amino acid length or less, 200 amino acid length or less, 150 amino acid length or less, 120 or 110 amino acid length or less, 100 amino acid length or less, or 50 amino acid length or less. In another example of a tau variant, its amino acid length is, for example, 20 amino acid length or more, 30 amino acid length or more, 40 amino acid length or more, 50 amino acid length or more, 100 amino acid length or more, or 150 amino acid length or more. The above examples of upper and lower limits for the amino acid lengths of tau variants can be arbitrarily combined as long as the relationship upper limit > lower limit is satisfied, and can take a range from above the lower limit to below the upper limit.

[0026] As described later, modified tau can be used, for example, to suppress seed-dependent tau aggregation and accumulation, and for the treatment or prevention of tauopathy.

[0027] (Nucleic acid constructs expressing tau variants) A nucleic acid construct according to one embodiment of the present invention expresses any of the above-described tau variants. The type of nucleic acid constituting the nucleic acid construct is not particularly limited, but examples include those composed of DNA, those composed of RNA, and those composed of DNA and RNA. The nucleic acid construct may also contain non-natural nucleic acids as needed.

[0028] One form of the nucleic acid construct according to this embodiment is a gene that expresses one of the above-described tau variants. The gene that expresses the tau variant has a base sequence, excluding the region encoding the responsible mutation, that shows, for example, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity when compared with the corresponding region of the base sequence shown in Sequence ID No. 2 (human tau gene). The tau variant is preferably a variant based on the wild-type sequence of human tau, but may also be a variant based on the wild-type sequence of tau from other animals (preferably mammals) such as mice, rats, or pigs.

[0029] From another perspective, in an example of a gene expressing a tau variant, the base sequence excluding the region encoding the responsible mutation, when compared with the base sequence of the tau variant gene used in the example (also shown in Figures 14-23), shows, for example, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity.

[0030] Another form of the nucleic acid construct according to this embodiment is an expression cassette for expressing the above-mentioned gene. The expression cassette is preferably an expression vector, and its type is appropriately selected depending on the host cell. The expression vector is more preferably a viral vector such as a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, or vaccinia virus vector. Among these, adeno-associated virus vectors are preferred from the viewpoint of use in gene therapy for neurological diseases, and among these, adeno-associated virus vectors such as serotype 1 (AAV1) which shows tissue tropism to the central nervous system, serotype 2 (AAV2) which has broad tissue tropism, serotype 5 (AAV5) which shows tissue tropism to the central nervous system, and serotype 9 (AAV9) which may be preferred from the viewpoint of use in gene therapy for neurological diseases.

[0031] The expression cassette described above contains any functional regulatory region within the expression host. The type of promoter, which is the regulatory region, is not particularly limited, but specifically, promoters that result in high expression in mammals (especially humans) or that function selectively in specific tissues, such as the CAG promoter, CMV promoter, and SYN (synapsin) I, may be preferred. Among these, the CAG promoter may be more preferred. In the expression cassette, the promoter is located upstream of the gene.

[0032] The expression cassette described above may further contain functional sequences that enhance gene expression, such as by increasing the stability of the mRNA produced by transcription, as needed. An example of a functional sequence is the WPRE (woodchuck hepatitis virus posttranscriptional regulatory element) sequence. In the expression cassette, the WPRE sequence is located downstream of the gene.

[0033] Another example of a functional sequence that the expression cassette described above may contain is a polyA tail addition signal sequence. Examples of polyA tail addition signal sequences include the relevant sequence in Simian virus 40 and the relevant sequence in human growth hormone, with the relevant sequence in human growth hormone being preferable in some cases. In the expression cassette, the WPRE sequence is located downstream of the gene.

[0034] The expression cassette described above may further include ITRs (inverted terminal repeat sequences), etc. The ITRs are positioned within the expression cassette so as to surround the entire transcription unit (from the promoter to the poly(A) tail addition signal sequence).

[0035] The expression cassette described above may be configured as a nucleic acid construct to polycistronically express a gene expressing a tau variant and other genes under the control of the same promoter. For example, the nucleic acid construct is constructed by interposing a sequence encoding an IRES element and / or a sequence encoding a 2A peptide between the gene expressing the tau variant and the other genes. The type of other gene is not particularly limited, but one example is a gene expressing wild-type tau, which makes it easy to create an experimental system that co-expresses tau variants and wild-type tau in host cells. Another example of the type of other gene is a gene expressing another variant of tau.

[0036] [2. Composition for inhibiting tau aggregation] A composition according to one embodiment of the present invention comprises a modified tau or a nucleic acid construct expressing the modified tau. The modified tau and nucleic acid construct are those described in the section [1. Modified Tau and Nucleic Acid Constructs Expressing the Modified Tau] above.

[0037] The composition according to this embodiment can be used as a composition for inhibiting the aggregation of tau (especially wild-type tau). This composition can be used particularly for the purpose of inhibiting seed-dependent tau aggregation. Here, "inhibition of tau aggregation" refers to the inhibition of tau aggregation (typically wild-type tau) compared to the case where the composition according to this embodiment is not present. The degree of tau aggregation inhibition is not particularly limited, but when the amount of tau aggregation in the case where the composition according to this embodiment is not present is set to 100%, the amount of aggregation refers to, for example, 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, or a state in which aggregation is substantially eliminated. Here, the inhibition of tau aggregation may be a phenomenon in an in vitro (cell-free) environment or a phenomenon in an intracellular environment. The intracellular environment may be an isolated cell or one present in the body of a human or non-human animal. The cells are preferably nervous system cells, and include central nervous system cells, peripheral nervous system cells, glial cells, and precursor cells of these cells.

[0038] Furthermore, seed-dependent tau aggregation refers to tau aggregation in which abnormal tau protein molecules act as aggregation nuclei (seeds). These abnormal tau protein molecules constitute aggregates. These tau aggregates may be, for example, tau aggregates present in living organisms or isolated tau aggregates. Tau aggregates can be artificially constructed in vitro, artificially constructed within cells using methods such as genetic engineering, or naturally generated in living organisms. For example, seed tau aggregates can be obtained by denaturing and fibrillating artificially constructed wild-type tau, or by using the brains of patients with tauopathy (see also Examples).

[0039] A composition according to one embodiment of the present invention is a composition for the treatment or prevention of tauopathy, i.e., a pharmaceutical composition. The pharmaceutical composition according to one embodiment of the present invention preferably comprises the nucleic acid construct described above. As described above, this pharmaceutical composition suppresses the aggregation and accumulation of tau in nerve cells present in the bodies of humans or non-human animals, particularly seed-dependent aggregation and accumulation of tau. It also suppresses the propagation of abnormally accumulated tau aggregates between nerve cells that occur following seed-dependent aggregation and accumulation of tau. As a result, it exhibits preventive and therapeutic effects such as prevention, cessation of progression, and delay of progression of tauopathy. The scope of the present invention includes a method for treating and / or preventing tauopathy by administering an effective amount of this pharmaceutical composition to a target.

[0040] The human or non-human animal to which the pharmaceutical composition is administered is preferably selected from the group consisting of mammals, including humans. The type of mammal to which it is administered is not particularly limited, but examples include laboratory animals such as mice, rats, rabbits, guinea pigs, and primates other than humans; pet animals such as dogs and cats; livestock such as cattle and horses; and humans, with humans being particularly preferred. The human or non-human animal to which it is administered is, for example, one that has developed or is in the pre-symptomatic stage of tauopathy, as described later.

[0041] The types of tauopathy targeted for treatment and / or prevention are not particularly limited and broadly refer to neurodegenerative diseases characterized by abnormal structure and aggregation of tau in nerve cells and glial cells. Examples of tauopathy include Alzheimer's disease (AD), corticobasal degeneration (CBD), and progressive supranuclear palsy (PSP). As described in the section above, [1. Tau Modifiers and Nucleic Acid Constructs Expressing These Modifiers], of the four causative mutations identified in this study (1) to (4), at least three of the causative mutations (1) to (3) are involved in seed-dependent aggregation suppression depending on the type of tauopathy. For example, a tau modifier having only the causative mutation (1) above as the causative mutation may suppress tau aggregation specific to Alzheimer's disease (AD) seeds and contribute to the treatment and / or prevention of Alzheimer's disease. A tau variant having only the causal mutation described in (2) above may suppress tau aggregation specific to the seeds of corticobasal degeneration (CBD) and contribute to the treatment and / or prevention of corticobasal degeneration. A tau variant having only the causal mutation described in (3) above may suppress tau aggregation specific to the seeds of progressive supranuclear palsy (PSP) and contribute to the treatment and / or prevention of progressive supranuclear palsy. Of course, depending on the condition of the target of administration of the pharmaceutical composition, a tau variant having two or more of the causal mutations described in (1) to (4), or (1) to (3), may be used (expressed), or two or more tau variants having different causal mutations may be used (co-expressed).

[0042] The method of administering the pharmaceutical composition is not particularly limited. It may be administered locally by methods such as injection (using a syringe or infusion pump, etc.), ophthalmic administration, transdermal administration, or sublingual administration, or it may be administered systemically by methods such as oral administration, intravenous or intra-arterial administration, or intra-intestinal administration. One preferred method of administration is local administration to the vicinity of the nervous system that is the target of treatment.

[0043] The dosage (effective amount) of the pharmaceutical composition may be appropriately determined according to the age, sex, symptoms, route of administration, and number of administrations of the human or animal being administered. Furthermore, if necessary, an in vivo assay using the pharmaceutical composition can be performed beforehand to determine the dosage without requiring excessive experimentation.

[0044] The number of times the pharmaceutical composition is administered is not particularly limited as long as the effect is obtained, and can be set appropriately according to the above-mentioned dosage, route of administration, symptoms, and the age and sex of the human or animal.

[0045] A composition (including a pharmaceutical composition) according to one embodiment of the present invention may comprise at least a modified tau or a nucleic acid construct expressing the modified tau, and a carrier (for example, a pharmaceutically acceptable carrier). The carrier is not particularly limited, but it is preferable that it does not substantially inhibit the function of the modified tau or nucleic acid construct and does not substantially adversely affect the human or non-human animal to which it is administered. It is preferable that this composition includes a liquid carrier such as water, and in one example, it may be a liposome formulation.

[0046] The components of the above composition may also include, but are not limited to, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for osmotic pressure adjustment, buffers, colorants, antioxidants, viscosity modifiers, and the like.

[0047] [3. Methods for suppressing tau aggregation, etc.] A method according to one embodiment of the present invention is a method for suppressing seed-dependent tau aggregation, comprising the step of coexisting a tau variant with wild-type tau. The tau variant is supplied, for example, using the composition described in the section [2. Compositions for Suppressing Tau Aggregation] above, or expressed from a nucleic acid construct. The step of coexisting the tau variant with wild-type tau can be carried out in vitro (cell-free), in an intracellular environment, or in vivo (in the brain environment of experimental animals such as mice and rats). For details on the method for suppressing tau aggregation, refer to the description in the section [2. Compositions for Suppressing Tau Aggregation] above.

[0048] The method for designing a tau variant according to one embodiment of the present invention involves designing a responsible mutation to be introduced into an amino acid residue located in a region that affects the aggregation of tau. The responsible mutation is as described in the section [1. Tau variant and nucleic acid construct expressing this variant] above. The tau variant designed in this way is obtained by introducing a mutation using a genetic engineering technique based on the gene sequence encoding wild-type tau, and then expressing the nucleic acid construct into which the mutation was introduced. The obtained tau variant is subjected to screening, if necessary, to confirm its ability to suppress seed-dependent tau aggregation. Screening can be performed, for example, by coexisting the obtained tau variant with wild-type tau and seeds and checking whether the seed-dependent aggregation of wild-type tau is suppressed (see also Examples).

[0049] (summary) In summary, the present invention can be summarized as follows, based on the embodiments described above. 1) A composition for inhibiting tau aggregation, comprising a modified tau or a nucleic acid construct expressing the modified tau. 2) The composition according to 1), wherein the above-mentioned variant of tau has at least one of the following mutations (1) to (4). (1) A mutation in the amino acid corresponding to the 368th amino acid (asparagine) in the amino acid sequence shown in the amino acid sequence of wild-type tau (SEQ ID NO: 1). (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1. (3) Mutations in one, two, three, four, five, or all six amino acids in the region (SKVTSK) consisting of amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No. 1. (4) Mutations in one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 through 316 in the amino acid sequence shown in Sequence ID No. 1. 3) The composition according to 1) or 2), which suppresses seed-dependent tau aggregation. 4) The composition according to 3), which suppresses seed-dependent tau aggregation in Alzheimer's disease, or seed-dependent tau aggregation in corticobasal degeneration, or seed-dependent tau aggregation in progressive supranuclear palsy. 5) A composition according to any one of 1) to 4) for the treatment or prevention of tauopathy. 6) The composition according to any one of 1) to 5), wherein the above-mentioned variant of tau is one or more (two, three, four, or five) variants of tau selected from the group consisting of the variant having the mutation shown in (1), the variant having the mutation shown in (2), the variant having the mutation shown in (3), the variant shown in (4), and the variant shown in (5). (5) Mutations in one, two, three, four, five, or all six amino acids in the region (VQIVYK) consisting of amino acids 306 to 311 in the amino acid sequence shown in Sequence ID No. 1. 7) A variant of tau having at least one of the mutations shown in (2) to (4) below. (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No. 1. (3) Mutations in one, two, three, four, five, or all six amino acids in the region (SKVTSK) consisting of amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No. 1. (4) Mutations in one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 through 316 in the amino acid sequence shown in Sequence ID No. 1. 8) A nucleic acid construct encoding a variant of tau as described in 7) above. 9) A method for suppressing seed-dependent tau aggregation, comprising the step of coexisting a tau variant with wild-type tau. 10) In the above 9), the tau variant is supplied, for example, using the composition described in any of 1) to 6), or expressed from a nucleic acid construct constituting the composition described in any of 1) to 6). 11) In 9) or 10) above, the tau variant is, for example, the tau variant described in 7) or expressed from the nucleic acid construct described in 8). 12) In any of the above 9) to 11), the step of introducing a modified tau molecule into the wild-type tau molecule can be performed in vitro (cell-free), in an intracellular environment, or in vivo.

[0050] The present invention is not limited to the embodiments described above, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed in different embodiments are also included in the technical scope of the present invention. [Examples]

[0051] One embodiment of the present invention is described below.

[0052] [Example 1: Method for inhibiting tau aggregation using artificially introduced mutagenesis tau that distinguishes tau-strain] (overview) Neurodegenerative diseases such as Alzheimer's disease (AD), corticobasal degeneration (CBD), and progressive supranuclear palsy (PSP) are characterized by the accumulation of tau protein in the diseased areas of the patient's brain and are defined as a type of tauopathy. It is thought that tau accumulates in the brain through seed-dependent aggregate formation and intercellular propagation, similar to prions, which is the cause of the onset and progression of tauopathy. Therefore, it is expected that suppressing tau aggregation could lead to an effective treatment for tauopathy.

[0053] In this study, the inventors have developed a new artificial mutant tau that is no longer subject to AD seed-dependent aggregation. Δ368 By co-expressing tau WT We found in a cell model that (wild-type) AD seed-dependent aggregation is strongly inhibited. Δ368 However, it has been shown that it intervened in and inhibited the AD seed-dependent aggregation process of other tau molecules, and this tau Δ368 The potential to use it as a "therapeutic protein" that inhibits tau aggregation was discovered. In addition, in order to design artificial mutant tau to respond to CBD and PSP seed-dependent aggregation, artificial mutations that would prevent CBD and PSP seed-dependent aggregation were searched for, and as a result, tau was found to be effective against CBD. 294-295Ala For PSP, tau 316-321Ala We identified tau in the cell model. WT In a co-expression system with tau WT We confirmed that it inhibits CBD and PSP seed-dependent aggregation, respectively.

[0054] This example demonstrates that the various artificially mutated tau compounds discovered here have potential as disease-modifying agents targeting tau, suppressing tau aggregation in representative taupathies such as AD, CBD, and PSP.

[0055] (Background and Objectives) In neurodegenerative diseases such as Alzheimer's disease (AD), corticobasal degeneration (CBD), and progressive supranuclear palsy (PSP), the accumulation of abnormally aggregated tau protein (tau) (Figure 1) is observed in the lesioned areas of the brain, and they are collectively called "Tauopathy". In recent years, the fine structures of aggregated tau in AD, CBD, and PSP have been determined, and it has been confirmed that each has distinct structural polymorphs (tau-strain). These aggregated tau, like prions, induce structural changes in unaggregated tau as aggregation nuclei (seeds), elongate while incorporating into their own structures, and spread between cells to cause progressive neuronal death (Figure 2). In various tauopathies, aggregated tau with different structures accumulates in different regions of the brain in this way, resulting in different clinical symptoms for each disease. Therefore, in order to establish radical treatments for these tauopathies, an aggregation inhibition method that can respond to different tau aggregation patterns for each disease is necessary.

[0056] The inventors have previously discovered that tau lacking the 368th asparagine residue Δ368 does not aggregate even in the presence of tau seeds (AD seeds) derived from AD patients (Shimonaka et al., J Biol Chem. 2020;295(41):13996-14014). Tau Δ368 can aggregate normally in the presence of tau seeds (CBD seeds, PSP seeds) derived from CBD and PSP patients, indicating that it is a variant lacking only the ability to aggregate against AD seeds. Subsequently, an experiment was conducted to aggregate wild-type tau (tau Δ368 , WT: wild type) with AD-seeds as the nuclei in the presence of tau wt . As a result, it was found that not only tau Δ368 but also the aggregation of tau WT was significantly suppressed. Thus, it has been clarified that tau Δ368 not only does not undergo aggregation by AD seeds itself but also exhibits the property of acting actively and inhibiting the AD-seed-dependent aggregation of other tau molecules, indicating its potential as an aggregation inhibitor.

[0057] This example aims to demonstrate that by designing artificial mutant tau that exhibit specific aggregation inhibitory effects on each tau-strain, tau aggregation inhibition can be inhibited in AD, CBD, and PSP, respectively, thereby laying the groundwork for clinical application of tau as a curative treatment for tauopathy with tau as the therapeutic target.

[0058] (Contents) Human tau is a microtubule-associated protein consisting of 352 to 441 amino acid residues (Figure 1). Since the core region of aggregated tau observed in the brains of AD, CBD, and PSP patients corresponds to 274-380 aa, the inventors' previous studies used a tau C-terminal fragment from 243-441 aa covering this region, and this tau fragment was continued in this embodiment. After expressing tau in SH-SY5Y cells using a cell expression vector, AD seeds extracted from the brains of AD patients were introduced into the cells. The AD seeds acted as aggregation nuclei, causing the expressed tau to aggregate, resulting in the formation of surfactant-insoluble tau aggregates. These tau aggregates can be separated and recovered from non-aggregated, soluble tau in the surfactant-insoluble fraction of cell lysate and quantified by Western blotting (a cellular model of seed-dependent tau aggregation).

[0059] The inventors created a cell expression vector called "pcDNA3-HA-tau Δ368 Regarding (HA: hemagglutinin tag sequence YPYDVPDYA), downstream of it are the "P2A sequence (GSGATNFSLLKQAGDVEENPGP)" which self-cleaves during translation within the cell, and "Myc-tau WT (Myc: Myc tag sequence EQKLISEEDL) co-expression vector "pcDNA3-HA-tau Δ368 / P2A / Myc-tau WT We constructed "HA-tau". By transfecting SH-SY5Y cells with this, the protein in the process of translation becomes "HA-tau". Δ368 -P2A" and "Myc-tau WT It cleaves into and becomes a pseudo-co-expression system (Figure 3). The inventors tau wt"pcDNA3-HA-tau" for co-expression of the two WT / P2A / Myc-tau WT Simultaneously, both vectors were constructed, and after expressing each in SH-SY5Y cells, AD-seed was added and the cells were cultured for 3 days. The cells were then harvested, homogenized in A68 buffer, ultracentrifuged, and the pellet was collected. Next, the pellet was homogenized in A68 buffer containing 1% Triton-X100 (surfactant), ultracentrifuged, and the pellet was collected. Finally, the pellet was homogenized in A68 buffer containing 1% sarkosyl (surfactant), ultracentrifuged, and the pellet was collected. 2xSDS sample buffer was added to this pellet, and the resulting mixture was homogenized to obtain the surfactant-insoluble fraction (insol. fraction). Western blotting of the insol. fraction was performed using an anti-Myc-tag antibody to identify agglutinated Myc-tags. WT When the band intensity was quantified, HA-tau WT The band observed in co-expression was HA-tau Δ368 In those where it was co-expressed, the decrease was significant.

[0060] Next, a construct was created with the arrangement order reversed, by incorporating WT on the upstream HA side of P2A and Δ368 on the downstream Myc side ("pcDNA3-HA-tau WT / P2A / Myc-tau Δ368 A similar experiment was performed (Figure 4). Western blotting was performed on the insol. fraction using an anti-HA-tag antibody, and aggregated HA-tau WT When the band intensity was quantified, Myc-tau WT The band observed in co-expression with Myc-tau Δ368 In those where it was co-expressed, the decrease was significant.

[0061] The results of these two experiments are both tau Δ368 under the presence of tau WT This indicates that aggregation by AD-seed was strongly inhibited, and tau Δ368 ga tau WTThis suggests that the aggregation process was intervened in or suppressed.

[0062] tau Δ368 However, in order to confirm whether it inhibits aggregation by tau seeds other than AD, we used "pcDNA3-HA-tau WT / P2A / Myc-tau WT " and "pcDNA3-HA-tau Δ368 / P2A / Myc-tau WT Cells expressing '' were introduced with CBD seeds and cultured for 3 days (Figure 5). Subsequently, insol. fractions were prepared in the same manner and Western blotting was performed to aggregate Myc-tau. WT The band was quantified.

[0063] As a result, HA-tau WT , HA-tau Δ368 Regardless of whether one of them is co-expressed, Myc-tau WT It was revealed that the same degree of aggregation occurred with CBD seeds. This result differed from that with AD seeds, and tau Δ368 Even in the presence of tau WT This indicates that aggregation by CBD seeds was not inhibited. Therefore, tau Δ368 The aggregation-inhibiting effect of [the substance] was suggested to be specifically exerted only on tau aggregation of AD strain.

[0064] tau Δ368Since the aggregation-inhibiting effect of is not exhibited in tau-strains other than AD, it is necessary to design new artificial mutant tau that are tailored to these strains in order to treat tauopathy such as CBD and PSP. The inventors attempted to identify mutation sites that cause loss of aggregation ability for CBD and PSP seeds, similar to Δ368 for AD seeds. As a method, they first created a series of modified strains with Ala mutations of several residues to cover the regions of interest in the tau sequence. Next, these modified strains were expressed in SH-SY5Y cells, and aggregation was induced with CBD and PSP seeds. Then, aggregation for each modified strain was quantified by Western blotting of the insol. fraction to identify modified strains that showed a significant reduction in aggregation. The mutation sites of these modified strains were used as candidate strain-specific sequences, and finally, those that could distinguish between CBD and PSP seeds were selected from among them.

[0065] Focusing on the 290-305 aa sequence for CBD, we constructed cell expression vectors for tau in which four amino acids were replaced with Ala, such as "290-293 Ala", "294-297 Ala", "298-301 Ala", and "302-305 Ala". These modified vectors were expressed in SH-SY5Y cells, cultured under CBD seed-induced aggregation, and then the insol. fraction bands were quantified. A particularly significant reduction in aggregation was observed with "294-297 Ala" (Figure 6). Subsequently, expression vectors for the further subdivided sequences "294-295 Ala" and "296-297 Ala" were constructed, and similar experiments were performed. A reduction in aggregation was observed with "294-295 Ala" (Figure 7).

[0066] Next, focusing on 306-321 aa for PSP, we constructed vectors expressing three variants: "306-311 Ala", "311-316 Ala", and "316-321 Ala" (Figure 8). These variants were expressed in SH-SY5Y cells, cultured under PSP seed aggregation induction, and then the insol. fraction bands were quantified. A significant reduction in aggregation was observed in all variants. Among these, "306-311 Ala" showed reduced aggregation regardless of the seed type.

[0067] In summary, "294-295 Ala" specifically reduces tau aggregation ability in CBD seeds, and "316-321 Ala" specifically reduces tau aggregation ability in PSP seeds (Figure 9). SH-SY5Y cells expressing both strains were cultured with CBD and PSP seeds, respectively, and then insol. fractions were prepared and aggregates were quantified by Western blotting. As a result, in the system with CBD seeds, aggregation reduction was observed only with "294-295 Ala," and in the system with PSP seeds, aggregation reduction was observed only with "316-321 Ala." Therefore, we determined that "294-295 Ala" is a mutation that specifically reduces aggregation in CBD seeds, and "316-321 Ala" is a mutation that specifically reduces aggregation in PSP seeds.

[0068] Next, tau 294-295 Ala CBD seeds WT To verify whether it inhibits aggregation, we used "pcDNA3-HA-tau" as a cell co-expression vector. 294-295 Ala / P2A / Myc-tau WT " was constructed (Figure 10). "pcDNA3-HA-tau WT / P2A / Myc-tau WT " and the "pcDNA3-HA-tau" constructed this time 294-295 Ala / P2A / Myc-tau WT Cells expressing '' were introduced with CBD seeds and cultured for 3 days. Subsequently, the insol. fraction was prepared in the same manner and Western blotting was performed to aggregate Myc-tau. WTThe band was quantified. As a result, tau 294-295 Ala In co-expression, aggregated Myc-tau WT It became clear that the band had decreased significantly. 294-295 Ala , tau Δ368 As shown for AD seed aggregation, tau WT It was suggested that it intervenes in and inhibits the aggregation of CBD seeds.

[0069] Similarly, tau 316-321 Ala ga PSP Seed by tau WT To verify whether it inhibits aggregation, we used "pcDNA3-HA-tau" as a cell co-expression vector. 316-321 Ala / P2A / Myc-tau WT " was constructed (Figure 11). "pcDNA3-HA-tau WT / P2A / Myc-tau WT " and the "pcDNA3-HA-tau" constructed this time 316-321 Ala / P2A / Myc-tau WT Cells expressing '' were introduced with PSP seeds and cultured for 3 days. Subsequently, insol. fractions were prepared in the same manner and Western blotting was performed to collect aggregated Myc-tau. WT The band was quantified. As a result, tau 316-321 Ala In co-expression, aggregated Myc-tau WT A decrease was observed in the band. This indicates that tau 306-321 Ala , tau WT This suggests that it intervenes in and inhibits PSP seed aggregation.

[0070] Therefore, tau is an artificially modified version of tau. Δ368 , tau 294-295 Ala and tau 316-321 Ala When co-expressed within cells, AD, CBD, and PSP seeds are used in tau WTIt was revealed that the aggregation of tau was suppressed. This indicates that tau with an artificial mutation intervenes in and inhibits pathological tau aggregation, which is a novel finding that has not been reported at all to date. A particularly important aspect of the present invention is that by selecting the mutation to be introduced from Δ368, 294-295 Ala, and 316-321 Ala, it is possible to inhibit tau aggregation in a manner that matches the aggregation morphology in AD, CBD, and PSP.

[0071] For Alzheimer's disease (AD), a representative tauopathy, disease-modifying drugs targeting amyloid-beta have already been launched in addition to existing symptom-improving drugs. However, the development of disease-modifying drugs that act on tau has lagged behind. Based on the findings of this embodiment, a treatment method is expected in which, for example, the sequence information of an artificial mutant tau is loaded onto an adeno-associated virus (AAV) vector and the patient's brain, where tau aggregation is progressing, is infected. This would allow the artificial mutant tau expressed in the nerve cells of the patient's brain to suppress tau aggregation. In this case, by examining the AAV serotype and administration method, it would be possible to administer the artificial mutant tau, a "therapeutic protein," into nerve cells with high efficiency and over a long period of time in the form of sustained protein expression. In the future, for example, by introducing all three types of mutations, it is possible to create therapeutic tau that can address all tauopathy, rather than just a specific strain.

[0072] (method) 1) Construction of a plasmid vector for cell expression encoding a tau variant. Plasmids encoding TAU variants were constructed using expression plasmid pcDNA3, which contained the cDNA sequence of a human TAU fragment (243-441 aa). The primers used are shown below. Various variant vectors were constructed using these primers and the wild-type vector template described above with the KOD Plus Mutagenesis Kit (Toyobo).

[0073] Primers for replacing specific regions of the tau sequence with Ala: =tau 290-293 Ala= For: GCCGCCGCTGCGAAGGATAATATCAAACACGTC Rev: GGACTGGACGTTGCTAAGATC =tau 294-297 Ala= For: GCCGCCGCTGCGAAACACGTCCCGGGAGGCG Rev: TGAGCCACACTTGGACTGGACG =tau 298-301 Ala= For: GCCGCCGCTGCGGGAGGCGGCAGTGTGCAAATAG Rev: GATATTATCCTTTGAGCCACAC =tau 302-305 Ala= For: GCCGCCGCTGCGGTGCAAATAGTCTACAAACC Rev: CGGGACGTGTTTGATATTATC =tau 294-295 Ala= For: GCCGCCAATATCAAACACGTCCCGGGAGGC Rev: TGAGCCACACTTGGACTGGACG =tau 296-297 Ala= For: GCCGCCAAACACGTCCCGGGAGGCGGC Rev: ATCCTTTGAGCCACACTTGGAC =tau 306-311 Ala= For: GCCGCCGCTGCGGCAGCT CCAGTTGACCTGAGCAAGGTGAC Rev: ACTGCCGCCTCCCGGGACGTGTTTG =tau 311-316 Ala= For: GCCGCCGCTGCGGCAGCT AAGGTGACCTCCAAGTGTGGCTC Rev: GTAGACTATTTGCACACTGCC =tau 316-321 Ala= For: GCCGCCGCTGCGGCAGCT TGTGGCTCATTAGGCAACATCC Rev: CAGGTCAACTGGTTTGTAGAC These are the primers for replacing a specific region of the tau sequence with Ala.

[0074] Next, to construct a co-expression vector using the P2A sequence, the P2A sequence GSGATNFSLLKQAGDVEENPGP was inserted into the multi-cloning site region of pcDNA3. This was performed using the KOD Plus Mutagenesis Kit with the following primers. =P2A insertion (Stage 1: Insertion of the first part GSGATNFSLLK)= For: GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGTGGCGGCCGCTCGAGTC Rev: TGCTGGATATCTGCAGAATTC =P2A insertion (2nd stage: Insertion of the latter part QAGDVEENPGP)= For: CAGGCTGGAGACGTGGAGGAGAACCCTGGACCT CAGTGGCGGCCGCTCGAGTC Rev: CTTCAGCAGGCTGAAGTTAGTAGC These are the primers for inserting the P2A sequence.

[0075] Next, HA and Myc-tag-tau were incorporated into the upstream and downstream sides of the P2A sequence, respectively. When incorporating HA-tau into the upstream side of the P2A sequence, the pcDNA3-P2A vector was first treated with restriction enzymes BamH1 (Toyobo, Cat. #BAH-111) and EcoR1 (Toyobo, Cat.#ECO-111) at 37°C for 2 hours to linearize it. Furthermore, to prepare the HA-tau sequence as an insert (insertion fragment), PCR was performed using the following primer and PrimeSTAR GXL DNA polymerase (TaKaRa, Cat.#R050A). =HA-tau fragment= For: TACCGAGCTCGGATCCATGTACCCATACGATGTTCC Rev: GATATCTGCAGAATTCCAAACCCTGCTTGGCCAG The resulting vector was cloned using the In-Fusion HD Cloning kit (Clontech, Cat.#639648) to create the insert. To incorporate Myc-tau downstream of the P2A sequence, the pcDNA3-P2A vector was first treated with the restriction enzyme Not1 (Toyobo, Cat.#NOT-111) at 37°C for 2 hours to linearize it. Furthermore, to prepare the Myc-tau sequence as an insert (insertion fragment), PCR was performed using the following primer and PrimeSTAR GXL DNA polymerase. =Myc-tau fragment= For: ACCTCAGTGGCGGCCTATGGAGCAGAAACTCATCTC Rev: TAGACTCGAGCGGCCTCACAAACCCTGCTTGGC The resulting vector was cloned using the In-Fusion HD Cloning kit (Clontech, Cat.#639648) to create the insert.

[0076] 2) Preparation of patient brain-derived tau-seeds 0.25 g of brain tissue from biochemically and neuropathologically diagnosed AD, CBD, and PSP patients was immersed in 1.0 mL of ice-cold A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl), and then homogenized on ice using a Dawns homogenizer. Subsequently, the homogenates were sonicated on ice for 1 minute using a TAITEC VP-050 sonicator (PWM 30% intensity), and the homogenates were transferred in equal volumes to 1.5 mL tubes. Next, the samples were centrifuged at 3000 xg for 15 min using a micro-high-speed centrifuge, and the supernatant was transferred to a new 1.5 mL tube and used as patient brain tau-seed.

[0077] 3) Cultured cells Human neuroblast cells of the SH-SY5Y strain (American Type Culture Collection, Cat. #CRL-2266) purchased from the American Type Culture Collection were used. The culture medium was DMEM (Dulbecco's modified eagle's medium nutrient mixture) / F-12HAM (Sigma-Aldrich, Cat. #D8062-500ML), which contained 10% (v / v) fetal bovine serum, non-essential amino acid solution (MEM Non-Essential Amino Acids Solution (100X), ThermoFisher, Cat. #11140050), and penicillin-streptomycin-glutamine solution (Penicillin-Streptomycin-Glutamine (100X), ThermoFisher, Cat. #10378016). The cells were cultured at 37°C in a 5% CO2 incubator (Thermo SCIENTIFIC). For culturing, collagen-coated 6 cm dishes (biocoat 6cm dish, Corning, Cat.#356401) and 24-well plates (biocoat 24-well plate, Corning, Cat.#356408) were used. Cell subculturing was performed when the cells were 100% confluent using the following procedure: After removing the medium from the 6 cm petri dish, the cells were washed with 2.0 mL of 1xPBS and the 1xPBS was removed. Then, 0.5 mL of 0.25% trypsin was added and incubated at 37°C for 5 minutes. Subsequently, 2.5 mL of fresh medium was added to stop the trypsin reaction, after which the cells were thoroughly suspended and seeded in a 6 cm petri dish with 3 mL of medium.

[0078] 4) Expression of tau plasmid and introduction of patient brain tau-seeds into cells In a 24-well plate, 8 x 10⁶ per well 5Nine cells were seeded and cultured for two days. Then, a mixture of WT expression plasmid (pcDNA3-tau) and X-treamGENE9 (Roche, Cat. # 6365809001) was prepared for plasmid introduction into the cells. Specifically, Opti-MEM (ThermoFisher, Cat. # 31985062), plasmid, and X-treamGENE9 were gently mixed in a ratio of 20 μL:0.2 μg:0.6 μL and allowed to stand at room temperature for 15 minutes. Simultaneously, a mixture of patient brain seeds and Multifectam (Promega, Cat.# ETF5000) was prepared for the introduction of patient brain tau-seeds into the cells. Specifically, Opti-MEM, patient brain tau-seeds, and Multifectam were gently mixed in a ratio of 25 μL:0.8 μL:12.5 μL, allowed to stand at room temperature for 30 minutes, then 12.5 μL of Opti-MEM was added and allowed to stand for another 5 minutes. Subsequently, the two mixtures were sequentially added dropwise to the culture medium in each well. The treated cells were incubated in a CO2 incubator. After 24 hours, the culture medium was removed with an aspirator, and 0.5 mL of fresh medium preheated to 37°C was added to each well to replace the medium. The cells were then returned to the CO2 incubator and incubated for another 48 hours.

[0079] 5) Detection of insoluble tau by Western blotting The culture medium in each well was removed using an aspirator, and 10.5 mL of physiological saline was added to detach and collect the cells from the plate. The cells were collected by centrifugation at 6,500 g for 10 minutes, and 150 μL of A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl) was added. The cells were then treated with a TAITEC VP-050 sonicator (PWM 25% intensity) for 40-60 seconds to disrupt them. After centrifugation at 100,000 xg for 20 minutes (himac CS100GXL, Eppendorf Himac Technologies), the supernatant and pellet were separated. A68 buffer containing 1% Triton-X100 (t-octylphenoxypolyethoxyethanol, Sigma-Aldrich, Cat.#T6878) was added to the pellet, and the pellet was crushed by sonication for 15 seconds (PWM 25% intensity). After centrifugation at 100,000 g for 20 minutes, the supernatant and pellet were separated. A68 buffer containing 1% Sarkosyl (N-lauroyl sarcosinate sodium, Fujifilm Wako Pure Chemical Industries, Cat.#194-10381) was added to the pellet, and the pellet was crushed by sonication for 15 seconds using a TAITEC VP-050 sonicator (PWM 25% intensity). After centrifugation at 100,000 g for 20 minutes, the supernatant and pellet were separated, and 30 μL of double-strength SDS sample buffer containing 2% 2-mercaptoethanol was added to the pellet. Subsequently, the pellet was crushed by sonication for 10 seconds (PWM intensity 20%), and the mixture was heat-treated at 100°C for 5 minutes to obtain the surfactant-insoluble fraction (Insol. fraction).

[0080] The insol. fraction was subjected to electrophoresis on a 15% polyacrylamide gel and then transferred to a PVDF membrane (Millipore) under conditions of 200 mA for 1 hour. The PVDF membrane was blocked in 1xPBS containing 3% gelatin (Fujifilm Wako Pure Chemical Industries, Cat.#077-03155) at room temperature for 10 minutes, and then reacted overnight at room temperature with primary antibodies diluted in 1xPBS containing 10% bovine serum (CS: Bovine Serum, ThermoFisher, Cat. #16170-078) and 0.1% NaN3 (10% CS / 1xPBS). (Tau-recognizing antibody: T46 antibody, 1:1,000 dilution, Thermo, Cat#13-6400; HA-tag-recognizing antibody: Anti-HA antibody, 1:1000 dilution, Sigma-Aldrich, Cat. # H9658; Myc-tag-recognizing antibody: Anti-Myc antibody, 1:1000 dilution, Proteintech, Cat.#16286-1-AP). Subsequently, the PVDF membrane was washed with 1xPBS and reacted with secondary antibodies diluted in 10% CS / physiological saline (antibodies against T46 and Anti-HA, which are mouse-derived antibodies: Biotin-Goat anti mouse IgG, Vector, Cat. # BA-9200-1.5; antibody against Anti-Myc, which is rabbit-derived antibody: Biotin-Goat anti rabbit IgG, Vector, Cat. # BA-1000-1.5) at room temperature for 2 hours, and then washed with 1xPBS. The PVDF membrane was reacted with peroxidase-labeled avidin-biotin complex (ABC Standard Kit, Vector, Cat. #PK-4000) for 30 minutes, washed with physiological saline, and treated with 1x PBS containing 0.1% 3,3'-Diaminobenzidine (Sigma-Aldrich, Cat. #D8001-5G), 0.2 mg / mL nickel(II) chloride hexahydrate (Fujifilm Wako Pure Chemical Industries, Cat. #141-01045), and 0.05% H2O2 (hydrogen peroxide, Sigma-Aldrich, Cat. #13-1910-5) to develop colored protein bands on the membrane. The color development reaction was stopped by washing the PVDF membrane with tap water. [Industrial applicability]

[0081] This invention relates to a technology for suppressing tau aggregation, which is extremely useful, for example, in research and medical applications related to tau aggregation.

Claims

1. A composition for inhibiting tau aggregation, comprising a modified tau or a nucleic acid construct expressing the modified tau.

2. The composition according to claim 1, wherein the above-mentioned variant of tau has at least one of the following mutations (1) to (4). (1) A mutation in the amino acid corresponding to the 368th amino acid (asparagine) in the amino acid sequence shown in the amino acid sequence of wild-type tau (SEQ ID NO: 1). (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No.

1. (3) Mutations in one, two, three, four, five, or all six amino acids in the region (SKVTSK) consisting of amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No.

1. (4) Mutations in one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 to 316 in the amino acid sequence shown in Sequence ID No.

1.

3. The composition according to claim 1 or 2, which suppresses seed-dependent tau aggregation.

4. The composition according to claim 3, which suppresses seed-dependent tau aggregation in Alzheimer's disease, or seed-dependent tau aggregation in corticobasal degeneration, or seed-dependent tau aggregation in progressive supranuclear palsy.

5. The composition according to claim 1 or 2, for the treatment or prevention of tauopathy.

6. The composition according to claim 2, wherein the above-mentioned variant of tau is two or more variants of tau selected from the group consisting of a variant having the mutation shown in (1), a variant having the mutation shown in (2), a variant having the mutation shown in (3), a variant shown in (4), and a variant shown in (5). (5) Mutations in one, two, three, four, five, or all six amino acids in the region (VQIVYK) consisting of amino acids 306 to 311 in the amino acid sequence shown in Sequence ID No.

1.

7. A variant of tau having at least one of the mutations shown in (2) to (4) below. (2) A mutation in one or both of the amino acids corresponding to the 294th amino acid (lysine) and the 295th amino acid (aspartic acid) in the amino acid sequence shown in Sequence ID No.

1. (3) Mutations in one, two, three, four, five, or all six amino acids in the region (SKVTSK) consisting of amino acids 316 to 321 in the amino acid sequence shown in Sequence ID No.

1. (4) Mutations in one, two, three, four, five, or all six amino acids in the region (KPVDLS) consisting of amino acids 311 to 316 in the amino acid sequence shown in Sequence ID No.

1.

8. A nucleic acid construct encoding a variant of tau as described in claim 7.

9. A method for suppressing seed-dependent tau aggregation, comprising the step of coexisting a tau variant with wild-type tau.

Images