Enzymes and microorganisms that defluorinate hydrophilic fluoroalkanes, and their uses
The enzyme and microorganism from Pandoraea pnomenusa (DYG4 strain) address the limitation of α-position defluorination by enabling efficient defluorination at both α- and β-positions of fluoroalkane compounds, achieving high defluorination rates and environmentally friendly decomposition.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- DAIKIN INDUSTRIES LTD
- Filing Date
- 2026-02-04
- Publication Date
- 2026-04-28
AI Technical Summary
Existing enzymes are limited to defluorinating organic fluorine compounds only at the α-position, and there is a need for a technology that can efficiently and simply defluorinate compounds at the β-position with low energy and minimal environmental impact.
Isolation of an enzyme and microorganism from Pandoraea pnomenusa (DYG4 strain) capable of defluorinating fluoroalkane compounds at both the α- and β-positions, utilizing the amino acid sequence described in Sequence ID No. 1 and nucleotide sequence in Sequence ID No. 2, and producing variants with similar or enhanced activity.
Enables efficient defluorination of fluoroalkane compounds with hydrophilic groups, achieving defluorination rates greater than 10% and providing a method for simple and environmentally friendly decomposition of a wide range of fluoroalkane structures.
Smart Images

Figure 2026071313000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an enzyme and a microorganism for defluorinating a fluoroalkane compound containing a hydrophilic group, and their use.
Background Art
[0002] There is a need to develop a technology that can decompose and remove organic fluorine compounds with low energy, low environmental impact, and high efficiency. Decomposition by microorganisms or enzymes they possess is considered an energy-saving and environmentally compatible technology that utilizes the capabilities of natural ecosystems. As an enzyme that decomposes organic fluorine compounds, haloacetate dehydrogenase isolated from microorganisms of the genus Burkholderia is known (Non-Patent Document 1, etc.). However, known enzymes for decomposing / defluorinating organic fluorine compounds only perform α-position defluorination, and no enzyme capable of β-position defluorination has been reported.
Prior Art Documents
Non-Patent Documents
[0003]
Non-Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0004] The present invention aims to provide a novel enzyme for defluorinating organofluorine compounds of a wide range of structures. In particular, it aims to provide an enzyme for defluorinating the fluorine at the β-position of organofluorine compounds. Furthermore, the present invention aims to provide a novel method for efficiently and simply defluorinating organofluorine compounds. [Means for solving the problem]
[0005] As a result of diligent research to solve the above problems, the inventors of the present invention isolated an enzyme and microorganisms that defluorinate hydrophilic group-containing fluoroalkane compounds from environmental microorganisms, and found that this enzyme defluorinates not only the α-position but also the β-position of the hydrophilic group, thus completing the present invention.
[0006] In other words, the present invention provides the following: [1] A method for defluorinating a fluoroalkane compound, which contains a hydrophilic group, for example, a sulfonic acid, a carboxylic acid, a phosphoric acid or a salt thereof, and which may also contain an oxygen atom and / or a halogen atom other than fluorine, wherein the method is The amino acid sequence below: (a) Amino acid sequence described in Sequence ID No. 1, (b) an amino acid sequence having at least 80% identity with the amino acid sequence described in Sequence ID No. 1, (c) Amino acid sequences in which 1 to 60 amino acids are substituted, deleted, inserted, or added in the amino acid sequence described in Sequence ID No. 1, (d) The amino acid sequence encoded by the nucleotide sequence described in Sequence ID No. 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity with the nucleotide sequence described in Sequence ID No. 2, or (f) Amino acid sequence encoded by a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No. 2 and a nucleotide sequence that hybridizes under stringent conditions. A method for defluorination comprising reacting the fluoroalkane compound with an enzyme containing any of the above. [2] The method according to [1], wherein the fluorine at the α-position of the fluoroalkane compound is defluorinated. [3] The method according to [1], wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated. [4] The method according to [1], wherein the fluoroalkane compound comprises a carboxylic acid or a salt thereof. [5] The fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The method according to [4], wherein the fluoroalkyl carboxylic acid shown in [4], or a salt thereof. [6] The method according to any one of [1] to [5], wherein the defluorinating activity of the enzyme with respect to the fluoroalkane compound is {(amount of fluoride ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluoride ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluoride atoms bound to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment} > 10%. [7] An enzyme capable of defluorinating fluoroalkane compounds, which contains a carboxylic acid or a salt thereof and may also contain an oxygen atom and / or a halogen atom other than fluorine, wherein the enzyme has the following amino acid sequence: (a) Amino acid sequence described in Sequence ID No. 1, (b) an amino acid sequence having at least 80% identity with the amino acid sequence described in Sequence ID No. 1, (c) Amino acid sequences in which 1 to 60 amino acids are substituted, deleted, inserted, or added in the amino acid sequence described in Sequence ID No. 1, (d) The amino acid sequence encoded by the nucleotide sequence described in Sequence ID No. 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity with the nucleotide sequence described in Sequence ID No. 2, or (f) Amino acid sequence encoded by a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No. 2 and a nucleotide sequence that hybridizes under stringent conditions. An enzyme containing any of the following. [8] The enzyme according to [7] that defluorinates the fluorine at the α-position of the fluoroalkane compound. [9] The enzyme according to [7] that defluorinates the fluorine at the β-position of the fluoroalkane compound.
[10] The fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The enzyme described in [7] is a fluoroalkyl carboxylic acid shown in [7], or a salt thereof.
[11] The following nucleotides: (a) Nucleotides described in Sequence ID No. 2, (b) A nucleotide having at least 80% identity with the base sequence described in Sequence ID No. 2, or (c) Nucleotides that hybridize under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No. 2. An expression vector containing this vector.
[12] Host cells containing the expression vector described in
[11] . A method for producing an enzyme capable of defluorinating a fluoroalkane compound, comprising culturing the host cells described in
[13]
[12] , the enzyme comprising a carboxylic acid or a salt thereof, and which may also contain an oxygen atom and / or a halogen atom other than fluorine.
[14] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
[15] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the α-position of the fluoroalkane compound.
[16] The fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The method described in
[13] , which is a fluoroalkyl carboxylic acid shown in or a salt thereof.
[17] A microorganism deposited with NITE under accession number NITE ABP-04122 or deposit number NITE BP-04122.
[18] An enzyme capable of defluorinating a fluoroalkyl carboxylic acid produced by the microorganism described in
[17] .
[19] A method for producing an enzyme capable of defluorinating a fluoroalkyl carboxylic acid, which includes culturing the microorganism described in
[17] . [Advantages of the Invention]
[0007] According to the present invention, there is provided an enzyme capable of defluorinating not only the fluorine at the α-position but also the fluorine at the β-position with respect to the hydrophilic group of a fluoroalkane compound containing a hydrophilic group. Further, according to the present invention, there is also provided a microorganism that produces such an enzyme. Therefore, using the enzyme and the microorganism according to the present invention, it is possible to efficiently and simply defluorinate fluoroalkane compounds having a wide range of structures containing a hydrophilic group. [Brief Description of the Drawings]
[0008] [Figure 1] Figure 1 shows the sequence of SEQ ID NO: 1. [Figure 2] Figure 2 shows the sequence of SEQ ID NO: 2. [Figure 3] Figure 3 is a graph showing the results of a monofluoroacetic acid decomposition experiment using the cells of the DYG4 strain. [Figure 4] Figure 4 is a graph showing the results of a difluoroacetic acid decomposition experiment using the cells of the DYG4 strain. [Figure 5] Figure 5 is a graph showing the results of a chlorofluoroacetic acid decomposition experiment using the cells of the DYG4 strain. NC indicates no addition of microorganisms. DYG4 indicates addition of the DYG4 microorganism. [Figure 6]Figure 6 is a graph showing the glyoxylic acid production in relation to chlorofluoroacetic acid by DYG4 strain cells. NC indicates no microbial addition, while DYG4 indicates the addition of DYG4 microorganisms. [Figure 7] Figure 7 shows a copy of the depositary certificate issued by the international depositary authority in accordance with Rule 7.1 of the Budapest Convention for the DYG4 strain obtained in Example 1. [Modes for carrying out the invention]
[0009] In one embodiment, the present invention provides a method for defluorinating a fluoroalkane compound, comprising reacting the fluoroalkane compound with an enzyme that defluorinates the hydrophilic group.
[0010] In this specification, "acting a fluoroalkane compound containing a hydrophilic group with an enzyme that defluorinates the fluoroalkane compound" means bringing the enzyme and the fluoroalkane compound into contact so that the fluoroalkane compound is defluorinated. Typically, this is done in an aqueous medium. For example, the enzyme and the fluoroalkane compound may be added to an aqueous medium and reacted for a certain period of time. Reaction conditions such as temperature, pH, optionally supplementing factors in the reaction system, and reaction time can be appropriately selected by those skilled in the art. The enzyme may be purified, crude or partially purified, a microbial extract, or a microbial culture medium. Microbial cells themselves may also be used as the enzyme. The enzyme may be used in a free state or immobilized on a carrier.
[0011] In another aspect, the present invention provides an enzyme for defluorinating fluoroalkane compounds containing hydrophilic groups. In this specification, the "enzyme for defluorinating fluoroalkane compounds containing hydrophilic groups" may be simply referred to as the "enzyme."
[0012] The enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention is an enzyme comprising the amino acid sequence described in Sequence ID No. 1. The enzyme comprising the amino acid sequence described in Sequence ID No. 1 is an enzyme isolated from an environmental microorganism (a strain of Pandoraea pnomenusa (hereinafter referred to as "DYG4 strain")) and has the characteristic of defluorinating not only the α-position but also the β-position of hydrophilic group-containing fluoroalkane compounds.
[0013] The amino acid sequence of the enzyme that defluorinates the hydrophilic group-containing fluoroalkane compound of the present invention is shown in SEQ ID NO: 1. The base sequence of the DNA encoding the enzyme that defluorinates the hydrophilic group-containing fluoroalkane compound of the present invention is shown in SEQ ID NO: 2. In the present invention, an enzyme having the amino acid sequence shown in SEQ ID NO: 1, or an enzyme having the amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2, is preferably used.
[0014] The present invention may also be used to defluorinate hydrophilic group-containing fluoroalkane compounds by employing a variant of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds. The variant of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds is described below. In this specification, unless otherwise specified, "enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds" includes its variants.
[0015] In the present invention, a variant of an enzyme having defluorinating activity equivalent to or greater than that of the enzyme that defluorinates hydrophilic groups containing fluoroalkane compounds of the present invention is preferably used. The defluorinating activity of a fluoroalkane compound containing hydrophilic groups equivalent to or greater than that of the enzyme that defluorinates hydrophilic groups containing fluoroalkane compounds of the present invention refers to an activity of about 50% or more, preferably about 70% or more, more preferably about 80% or more, and even more preferably about 90% or more, of the activity of the enzyme that defluorinates hydrophilic groups containing fluoroalkane compounds of the present invention, which includes the amino acid sequence described in SEQ ID NO: 1.
[0016] The defluorination activity of an enzyme in hydrophilic fluoroalkane compounds can be measured by reacting the hydrophilic fluoroalkane compound with the enzyme and analyzing the product. For example, the defluorination activity of a hydrophilic fluoroalkane compound can be measured by reacting the hydrophilic fluoroalkane compound with the enzyme for a certain period of time, referring to the procedure described in the examples of this specification, and then subjecting the resulting reaction mixture to LC-MS analysis to measure the amount of defluorinated hydrophilic fluoroalkane compound or the amount of remaining hydrophilic fluoroalkane compound. The certain period of time can be any time, for example, about 4 hours, about 8 hours, about 16 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, etc. For example, the defluorination activity of an enzyme against hydrophilic group-containing fluoroalkane compounds is given by the following formula: {(amount of fluoride ions contained in the aqueous solution of the fluoroalkane compound after defluorination) - (amount of fluoride ions contained in the aqueous solution of the fluoroalkane compound before defluorination)} / {fluoride atoms bonded to the fluoroalkane compound contained in the aqueous solution of the fluoroalkane compound before defluorination}. The percentage of fluoroalkane compounds containing hydrophilic groups that the enzyme defluorinates can also be calculated by multiplying the value obtained from the above formula by 100. The percentage of fluoroalkane compounds containing hydrophilic groups that the enzyme of the present invention defluorinates (defluorination rate) varies depending on the reaction time (a certain period of time), but may be >approximately 10%, >approximately 20%, >approximately 30%, >approximately 40%, >approximately 50%, >approximately 60%, >approximately 70%, >approximately 80%, or >approximately 90%. The amount of fluoride ions can be measured by well-known techniques, such as ion chromatography, spectrophotometry, and ion electrode methods.
[0017] Specific examples of mutants of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention include, but are not limited to, an enzyme having an amino acid sequence that is identical to the amino acid sequence shown in SEQ ID NO: 1 by at least about 30%, for example at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (for example at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (for example at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%), and having activity equivalent to or greater than that of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention. The identity of amino acid sequences can be determined using known search methods such as FASTA and BLAST.
[0018] Further specific examples of variants of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention include, but are not limited to, enzymes having an amino acid sequence in which one to several or tens of amino acids are substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 1, and having activity to defluorinate hydrophilic group-containing fluoroalkane compounds equivalent to or greater than that of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention. Several means 2, 3, 5, 4, 6, 7, 8, or 9. Tens of means about 10 to about 90, for example, about 20, about 30, about 40, about 50, about 60, about 70, about 80, or about 90, or a number in between these numbers. Amino acid substitutions in the amino acid sequence may be substitutions of any amino acid, but preferably substitutions are made with amino acids having similar properties and / or structure (conservative amino acid substitutions). For example, the amino acids in the following parentheses may be substituted for each other: (G, A), (K, R, H), (D, E), (N, Q), (S, T, Y), (C, M), (F, W, Y, H), (V, L, I).
[0019] Further specific examples of mutants of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention include at least about 30%, for example at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 9%) relative to the base sequence shown in SEQ ID NO: 2. An enzyme having an amino acid sequence encoded by a nucleotide sequence having identity of 7%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, and at least 99.9%, and having activity equivalent to or greater than that of the enzyme that defluorinates hydrophilic fluoroalkane compounds containing hydrophilic groups in the present invention, but not limited to these. The identity of the nucleotide sequence can be determined using known search methods such as FASTA or BLAST.
[0020] Further specific examples of variants of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention include, but are not limited to, an enzyme having an amino acid sequence encoded by a nucleotide sequence that hybridizes to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2 under stringent conditions, and having an activity to defluorinate hydrophilic group-containing fluoroalkane compounds equivalent to or greater than that of the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention.
[0021] Stringent conditions are known to those skilled in the art, and include, for example, the following: Hybridization is performed for 16 to 24 hours in a buffer containing 0.25 M Na2HPO4, pH 7.2, 7% SDS, 1 mM EDTA, and 1 × Denhardt's solution at a temperature of 60 to 68°C, preferably 65°C, more preferably 68°C; or two washes of 15 minutes each are performed in a buffer containing 20 mM Na2HPO4, pH 7.2, 1% SDS, and 1 mM EDTA at a temperature of 60 to 68°C, preferably 65°C, more preferably 68°C; or Under more stringent conditions, pre-hybridization was performed overnight at 42°C in a hybridization solution containing 25% formamide, or 50% formamide under more stringent conditions, 4×SSC (sodium chloride / sodium citrate), 50 mM HEPES pH 7.0, 10× Denhardt's solution, and 20 μg / ml denatured salmon sperm DNA. This was followed by washing in a buffer containing 1×SSC and 0.1% SDS at 37°C, under more stringent conditions, in a buffer containing 0.5×SSC and 0.1% SDS at 42°C, and under even more stringent conditions, in a buffer containing 0.2×SSC and 0.1% SDS at 65°C. The stringent conditions are not limited to the examples above.
[0022] Examples of base sequences encoding the enzyme that defluorinates the hydrophilic group-containing fluoroalkane compound of the present invention include the following: (a) Nucleotype sequence described in Sequence ID No. 2, (b) A nucleotide sequence having identity with at least about 30%, for example at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (for example at least 75%, at least 80%, at least 85%), even more preferably at least about 90% (for example at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%) to the nucleotide sequence shown in Sequence ID No. 2, (c) A nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence shown in Sequence ID No. 2. The stringent conditions are as explained above. Furthermore, the degenerate sequences of the base sequences (a) to (c) above are also included in the base sequences that encode the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention.
[0023] The mutant enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention may be naturally occurring or may be artificially created, for example, using genetic engineering techniques.
[0024] If the enzyme or its variant that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention is of natural origin, it may originate from any organism, but is preferably derived from a microorganism, particularly a bacterium. Examples of bacteria include those of the genus Pandoraea. An example of a Pandoraea bacterium is Pandoraea pnomenusa. The organism from which the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention originates is not limited to those mentioned above. The gene encoding the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds of the present invention can be obtained using known cloning methods.
[0025] Fluoroalkane compounds containing hydrophilic groups may contain one or more oxygen atoms and / or halogen atoms other than fluorine in the fluoroalkane. Fluoroalkane compounds containing oxygen atoms include, but are not limited to, structures in which -C- is replaced by -O-, -COO-, or -OCO-, structures in which -H is replaced by -OH, or combinations thereof. The number of oxygen atoms contained in the fluoroalkane is not particularly limited. For example, compounds containing one, two, or three oxygen atoms in addition to the oxygen atoms contained in the hydrophilic group are examples.
[0026] Fluoroalkane compounds containing hydrophilic groups may contain one or more oxygen atoms and / or non-fluorine halogen atoms in the fluoroalkane. Fluoroalkane compounds containing non-fluorine halogen atoms include, for example, a structure in which -H is replaced by a non-fluorine halogen atom. The number of non-fluorine halogen atoms contained in the fluoroalkane is not particularly limited. For example, compounds containing one, two, or three non-fluorine halogen atoms are examples. Non-fluorine halogen atoms include chlorine, bromine, iodine, astatine, or tennessine, or any combination thereof. Fluoroalkanes containing one chlorine atom are particularly noteworthy, such as chlorofluoroacetic acid. When a fluoroalkane compound containing a non-fluorine halogen atom is defluorinated, in addition to fluorine, the non-fluorine halogen atom may also be removed. When a fluoroalkane compound containing chlorine is defluorinated, in addition to fluorine, chlorine may also be removed.
[0027] Hydrophilic groups include, but are not limited to, groups that ionize in water to form ions or groups that hydrate through hydrogen bonding without ionizing. One or more hydrophilic groups may be present in a fluoroalkane. Preferably, there are one or two, and most preferably one. Specific examples of hydrophilic groups include, but are not limited to, sulfonic acid groups (-SO3H), carboxylic acid groups (-COOH), phosphate groups (-H2PO4), hydroxyl groups (-OH), amino groups (-NH2), or amide groups (-CONH2). Hydrophilic groups may also be in the form of salts. Examples of salts of hydrophilic groups include, but are not limited to, ammonium salts, nitrates, potassium salts, sodium salts, calcium salts, magnesium salts, sulfates, or phosphates.
[0028] The number of carbon atoms that make up the skeleton of a fluoroalkane is typically 1-2, 1, or 2.
[0029] Fluoroalkanes are alkanes in which one or more hydrogen atoms bonded to a carbon atom are replaced by fluorine atoms. Fluorine atoms can be present in any number at any possible position in the fluoroalkane. Fluorine atoms may be located at the α-position, β-position, or any combination thereof relative to the hydrophilic group. Fluorine atoms may be present in 1-5, 1-4, 1-3, 1-2, 1, or 2 positions in a fluoroalkane. Fluorine atoms may be present at the α-position or β-position, respectively, relative to the hydrophilic group, in the order of 0-3, 0-2, 0-1, 1-3, 1-2, 0, 1, 2, or 3 positions.
[0030] Specific examples of fluoroalkane compounds or salts thereof that contain a hydrophilic group and may also contain an oxygen atom and / or a halogen atom other than fluorine include fluoroalkane compounds that contain a carboxylic acid or a salt thereof and may also contain an oxygen atom and / or a halogen atom other than fluorine. A specific example is the chemical formula: R1-COOH [wherein R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine] Examples include, but are not limited to, fluoroalkyl carboxylic acids represented by , or their salts.
[0031] In fluoroalkylcarboxylic acids, fluorine atoms may be present in any number at any position they can be located. Fluorine atoms may be located at the α-position, β-position, or any combination thereof relative to the carboxyl group. There may be 1-5, 1-4, 1-3, 1-2, 1, or 2 fluorine atoms in a fluoroalkylcarboxylic acid. There may be 0-3, 0-2, 0-1, 1-3, 1-2, 0, 1, 2, or 3 fluorine atoms at the α-position or β-position, respectively, relative to the carboxyl group.
[0032] Specific examples of fluoroalkyl carboxylic acids include, but are not limited to, 2-fluoropropanoic acid, 2,2-difluoropropanoic acid, 3-fluoropropanoic acid, 2,3-difluoropropanoic acid, 2,2,3-trifluoropropanoic acid, 3,3-difluoropropanoic acid, 2,3,3-trifluoropropanoic acid, 2,2,3,3-tetrafluoropropanoic acid, 3,3,3-trifluoropropanoic acid, 2,3,3,3-tetrafluoropropanoic acid, or 2,2,3,3,3-pentafluoropropanoic acid.
[0033] Specific examples of fluoroalkyl carboxylic acids include, for instance, monofluoroacetic acid, difluoroacetic acid, trifluoroacetic acid, and chlorofluoroacetic acid, but are not limited to these.
[0034] When the fluoroalkyl group in a fluoroalkyl carboxylic acid has two carbon atoms, the number of fluorine atoms present in each carbon atom is preferably 0 or 1. Specific examples of fluoroalkyl carboxylic acids that are suitably defluorinated in this application include, but are not limited to, monofluoroacetic acid, difluoroacetic acid, chlorofluoroacetic acid, 2-fluoropropanoic acid, 3-fluoropropanoic acid, or 2,3-difluoropropanoic acid.
[0035] Examples of salts of fluoroalkyl carboxylic acids include, but are not limited to, ammonium salts, potassium salts, sodium salts, calcium salts, or magnesium salts. The fluoroalkyl carboxylic acid salt may also be a salt in which the H in the COOH group is substituted, such as a sodium salt or an ammonium salt.
[0036] The enzyme that defluorinates fluoroalkane compounds containing the hydrophilic group of the present invention and its variants can be produced using known methods. For example, the enzyme and its variants may be produced by cloning the gene for the enzyme that defluorinates fluoroalkane compounds containing the hydrophilic group of the present invention, or its homolog or ortholog, using PCR, ligating it into an expression vector, introducing the expression vector into host cells, and culturing the host cells. Alternatively, the base sequence of the gene for the enzyme that defluorinates fluoroalkane compounds containing the hydrophilic group of the present invention may be modified using known methods such as site-directed mutagenesis, and the modified gene may be used to produce variants of the enzyme.
[0037] Therefore, in one embodiment of the present invention, an expression vector is provided which comprises a nucleotide of a base sequence encoding an enzyme that defluorinates a hydrophilic group-containing fluoroalkane compound of the present invention. For example, a nucleotide of any of the base sequences (a) to (c) above may be incorporated into the expression vector. Alternatively, a nucleotide of a degenerate sequence of any of the base sequences (a) to (c) above, designed for codon optimization, may be incorporated into the expression vector.
[0038] In a further embodiment, the present invention provides a host cell comprising an expression vector containing a nucleotide of a base sequence encoding an enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds.
[0039] Furthermore, in a further embodiment, the present invention provides a method for producing the enzyme, comprising culturing a host cell containing an expression vector comprising a nucleotide of a base sequence encoding an enzyme that defluorinates hydrophilic fluoroalkane compounds. Expression vectors, host cells, and methods for culturing the same are known and can be appropriately selected and used by those skilled in the art.
[0040] In a further embodiment, the present invention provides the Pandoraea pnomenusa DYG4 strain, which was deposited on May 27, 2024 (receipt number NITE ABP-04122) with the Patent Microorganism Depositary Center (NPMD) of the Biotechnology Center of NITE (National Institute of Technology and Evaluation) (address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture), and was assigned accession number NITE BP-04122 on August 1, 2024. The DYG4 strain produces an enzyme that defluorinates fluoroalkane compounds containing hydrophilic groups, including the amino acid sequence described in Sequence ID No. 1. Therefore, in a further embodiment, the present invention provides the enzyme produced by the DYG4 strain that defluorinates fluoroalkane compounds containing hydrophilic groups. Furthermore, in a further embodiment, the present invention provides a method for producing the enzyme that defluorinates fluoroalkane compounds containing hydrophilic groups, comprising culturing the DYG4 strain.
[0041] In a further embodiment, the present invention provides a mutant strain of the DYG4 strain that produces an enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds.
[0042] The polypeptide containing the amino acid sequence shown in SEQ ID NO: 1, and the polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 2, are novel. Furthermore, their variants may also be novel.
[0043] Therefore, in one embodiment of the present invention, the present invention provides a polypeptide comprising an amino acid sequence having at least about 90% (for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) identity with the amino acid sequence shown in Sequence ID No. 1. Furthermore, in a further embodiment, the present invention provides a polynucleotide comprising a nucleotide sequence having at least about 90% identity (for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) with respect to the nucleotide sequence shown in Sequence ID No. 2.
[0044] Unless otherwise specified, terms used herein are understood in the sense commonly understood in the fields of chemistry, biology, biochemistry, etc. In this specification, when "approximately" is placed before a number, it means ±20%, preferably ±10%, and more preferably ±5% of that number.
[0045] The present invention will be described in more detail and specifically below with reference to examples, but these examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention. [Examples]
[0046] [Example 1] Isolation and identification of a microorganism that produces an enzyme that defluorinates fluoroalkylcarboxylic acids 1 g of a Japanese environmental sample was added to 20 mL of sterile DYG medium, and difluoroacetic acid was added to a concentration of 50 ppm. The culture was incubated with shaking at 30°C (1st generation). Every two weeks, 200 μL of the culture medium was collected, filtered and sterilized using a 0.22 μm pore size membrane filter, and the difluoroacetic acid concentration in the culture supernatant was measured by LC-MS. When the residual difluoroacetic acid concentration fell below 25 ppm, the culture medium was subpoenaed onto new DYG medium at a concentration of 1% (v / v) (2nd generation). Difluoroacetic acid was then re-added to a concentration of 100 ppm. Subpoenaing was performed again (3rd generation), and the fluoride ion concentration was measured when the decomposition of difluoroacetic acid was confirmed. After confirming the detection of fluoride ions, subpoenaing was performed again (4th generation), and after confirming the decomposition of difluoroacetic acid, the culture medium was serially diluted as appropriate and spread onto DYG agar medium containing 100 ppm of difluoroacetic acid. The obtained colonies were inoculated into DYG medium containing 100 ppm difluoroacetic acid, and the decomposition ability was evaluated to obtain four DYG strains. Upon examining the 16S rRNA gene of the DYG4 strain, it was found to be more than 99.9% identical to the 16S rRNA gene of Pandoraea pnomenusa strain TF-18 (described in Microbiol Resour Announc. 2020 Jan; 9(1): e01008-19). Based on this, the DYG4 strain was identified as a strain of Pandoraea pnomenusa. The DYG4 strain was deposited with the Patent Microorganism Depository Center (NPMD) of the Biotechnology Center of NITE (National Institute of Technology and Evaluation) (address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on May 27, 2024 (receipt number NITE ABP-04122), and was assigned accession number NITE BP-04122 on August 1, 2024.
[0047] [Example 2] Cloning of a gene encoding an enzyme that defluorinates fluoroalkylcarboxylic acids from the DYG4 strain. Using the total DNA of the DYG4 strain as a template, restriction enzyme sites were added to primers (fac-dex DYG4_F: TTTGGATCCGTAAGGAGGTGTTCATATGGACTTTCCAGGATTCAA, fac-dex DYG4_R: TTTCTCGAGGCCGTTTCGAGCAAGAA) to amplify the region of the gene encoding the defluorinating enzyme, from the transcription start site to the region excluding the stop codon. The PCR product was purified and blunt-end ligated to pZErO-2 treated with EcoRV. After introduction into E. coli DH5α strain, transformants were selected for kanamycin resistance. Plasmids were extracted, and sequencing analysis confirmed that there were no mutations in the PCR-amplified sequence. The obtained vector was restricted enzyme-treated, and the fragment containing the target gene was purified. The obtained fragment was ligated to pET-26b(+), and the DH5α strain was transformed. After selecting transformants and extracting plasmids, a heterologous expression system was constructed by transforming E. coli BL21 strain with these plasmids. The amino acid sequence of the enzyme that defluorinates fluoroalkyl carboxylic acids was sequenced as shown in Sequence ID No. 1. Furthermore, the nucleotide sequence of the gene encoding the enzyme that defluorinates fluoroalkyl carboxylic acids was sequenced as shown in Sequence ID No. 2.
[0048] [Example 3] Evaluation of the activity of an enzyme that defluorinates fluoroalkylcarboxylic acids 1. Microbial evaluation (1) Method for evaluating degradation activity 1. Inoculate the DYG4 strain, stored at -80°C, onto DYG agar medium containing 100 ppm of fluoroalkylcarboxylic acid and culture at 30°C for 3 days. 2. Select small colonies from the formed colonies that are thought to have fluoroalkylcarboxylic acid degrading activity, and inoculate them into DYG liquid medium containing fluoroalkylcarboxylic acid. 3. Analysis of residual fluoroalkylcarboxylic acid levels from day 0 to day 3 of culture using LC-MS. 4. Measure the amount of fluoride ions in the culture medium using an electrode on the second day of culture. (2) Defluorination rate evaluation results (after 2 days)Fluoride ion analysis (n=1) The experimental results are shown in Table 1. [Table 1] -; No data available (3) Results of evaluation of residual amount of fluoroalkylcarboxylic acid :LC-MS analysis (i) Monofluoroacetic acid The results are shown in Figure 3. In the system with the DYG4 strain added, monofluoroacetic acid disappeared after 3 days of reaction, whereas no disappearance of monofluoroacetic acid was observed in the system without the DYG4 strain added. (ii) Difluoroacetic acid The results are shown in Figure 4. In the system with the DYG4 strain added, difluoroacetic acid disappeared after 2 days of reaction, whereas no disappearance of difluoroacetic acid was observed in the system without the DYG4 strain added. 2. Evaluation using crude enzyme solution (1) Method for evaluating degradation activity 1. Inoculate the DYG4 strain, stored at -80°C, onto DYG agar medium containing 100 ppm of fluoroalkylcarboxylic acid and culture at 30°C for 3 days. 2. Select small colonies from the formed colonies that are thought to have fluoroalkylcarboxylic acid degrading activity, and inoculate them into DYG liquid medium containing fluoroalkylcarboxylic acid. 3. After culturing for 2 days, confirm the remaining amount of fluoroalkylcarboxylic acid by LC-MS. 4. Centrifuge the culture medium at 4°C and 6,000×g for 30 minutes to collect the cells. 5. Resuspend the cells in Tris-H2SO4 buffer and centrifuge as in step 4. 6. Wash the cells by repeating steps 4 and 5. 7. Resuspend the washed cells in Tris-H2SO4 buffer and adjust the turbidity to 30. 8. Sonicate disruption is performed on ice, followed by centrifugation at 4°C and 6,000 × g for 10 minutes. The supernatant is collected and filtered through a 0.45 μm pore size membrane filter. 9. Add fluoroalkylcarboxylic acid to the filtrate to a total concentration of 100 ppm and react at 30°C. 10. Collect a portion of the crude enzyme solution and immediately deactivate it by heating it at 90°C for 10 minutes. 11. Perform the same process as in step 10 after 16 hours. 12. The reaction solutions from 10 and 11 were filtered through a 0.22 μm pore size membrane filter, and the residual amount of fluoroalkylcarboxylic acid was evaluated by LC-MS. Fluoride ions were also detected using an electrode. (2) Decomposition activity evaluation results (after 16 hours) Fluoride ion analysis (n=2) The results are shown in Table 2. [Table 2] 3. Heterogeneous expression (E. coli) (1) Method for evaluating degradation activity 1. Introduce the gene sequence expressing the enzyme identified in Example 2 into pET-26b(+). 2. Introduce the plasmid constructed in step 1 into the E. coli BL21 strain. 3. Dissolve the E. coli prepared in step 2 in 100 μg mL. -1 Incubate for 16 hours at 37°C in LB medium (LB+Km medium) containing kanamycin. 4. Incubate the E. coli culture in 200 mL of LB+Km medium at 37°C until the bacterial turbidity is 0.5. Add IPTG to a final concentration of 1 mM, and incubate at 37°C for a further 3-5 hours. 5. Collect the cells by centrifuging 400 mL of culture medium at 20°C and 6,000 × g for 30 minutes. 6. Wash with 100 mL of NMM4 medium (repeat this step twice). 7. Resuspend the cell solution in NMM4 medium until the turbidity is 30, and dispense 4 mL into a 96-well deep plate. 8. Add the fluoroalkylcarboxylic acid to be evaluated to a concentration of 100 ppm. 9. After thorough mixing, immediately collect 200 μL and heat at 98°C for 10 minutes to inactivate the enzyme. 10. Filtration using a membrane filter with a pore size of 0.22 μm. 11. After 24 hours, the reaction solution is collected in the same manner, and the fluoride ions are measured using electrodes. (2) Decomposition activity evaluation results (after 24 hours): Fluoride ion analysis (n=1) The results are shown in Table 3. [Table 3] 4. Evaluation using purified enzyme solution from heterologous expression system (E. coli) (1) Method for evaluating degradation activity 1. The heterologous expression strain prepared in "3. Heterologous Expression (E. coli)" was cultured in 15 mL of LB+Km medium at 37°C for 17 hours, then scaled up to 800 mL and cultured at 37°C for 17 hours. 2. The cells are collected by centrifuging the culture medium at 4°C and 6000×g for 30 minutes. 3. Wash the cells with 200 mL of Tris-H2SO4 (repeat this step twice). 4. Resuspend the cells in 100 mL of Tris-H2SO4 and sonicate them on ice for 5 minutes. 5. Centrifuge the cell lysate from step 4 at 25,000 × g at 4°C for 30 minutes, and collect the supernatant. 6. Filter the supernatant from step 5 through a 0.22 μm pore size membrane filter and purify using a HisTrap HP column. 7. Take 1 mL from each peak, concentrate the active fraction confirmed in the same manner as in "2. Evaluation of crude enzyme solution" to 150 μL, and purify it using a Superdex 200 10 / 300 GL column. 8. Separate the active fraction and replace the buffer with Tris-H2SO4. 9. Add Tris-H2SO4, 0.5 μM purified enzyme, and 1 mM of the target fluoroalkyl carboxylic acid to a polypropylene tube and react at 30°C. 10. Collect 100 μL of the reaction solution and immediately inactivate it by adding 2 μL of 2M H2SO4. 11. Perform the same process as in step 3 after 118 hours. 12. The reaction solutions from steps 2 and 3 were filtered through a 0.22 μm pore size membrane filter, and the residual amount of the target fluoroalkyl carboxylic acid and, in the case of chlorofluoroacetic acid, the amount of glyoxylic acid produced (a dechlorinated and defluorinated product) were evaluated by LC-MS. (2) Evaluation of degradation activity (after 118 hours): LC-MS analysis (n=3) The results are shown in Table 4, Figure 5, and Figure 6. [Table 4] [Industrial applicability]
[0049] By using the enzyme that defluorinates hydrophilic group-containing fluoroalkane compounds according to the present invention, or by using a microorganism that produces the said enzyme, the fluoroalkane compounds can be defluorinated with low energy, minimal environmental impact, and high efficiency. Therefore, the present invention is useful for environmental remediation, environmental protection, health promotion, disease prevention, and the like. [Sequence Listing Free Text]
[0050] Sequence ID:1 shows the amino acid sequence of an enzyme isolated from DYG4 that defluorinates hydrophilic fluoroalkane compounds. Sequence ID:2 shows the DNA sequence encoding an enzyme isolated from DYG4 that defluorinates hydrophilic fluoroalkane compounds. Sequence ID: 3 shows the forward primer used in Example 2. Sequence ID: 4 shows the reverse primer used in Example 2.
Claims
1. A method for defluorinating a fluoroalkane compound that contains a hydrophilic group, for example, a sulfonic acid, a carboxylic acid, a phosphoric acid, or a salt thereof, and may also contain an oxygen atom and / or a halogen atom other than fluorine, wherein the method is The amino acid sequence is as follows: (a) The amino acid sequence described in Sequence ID No. 1, (b) an amino acid sequence having at least 80% identity with the amino acid sequence described in Sequence ID No. 1, (c) An amino acid sequence in which 1 to 60 amino acids are substituted, deleted, inserted, or added in the amino acid sequence described in Sequence ID No. 1, (d) The amino acid sequence encoded by the nucleotide sequence described in Sequence ID No. 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity with the nucleotide sequence described in Sequence ID No. 2, or (f) Amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No.
2. A method for defluorination comprising reacting the fluoroalkane compound with an enzyme containing any of the above.
2. The method according to claim 1, wherein the fluorine at the α-position of the fluoroalkane compound is defluorinated.
3. The method according to claim 1, wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated.
4. The method according to claim 1, wherein the fluoroalkane compound comprises a carboxylic acid or a salt thereof.
5. The aforementioned fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The method according to claim 4, wherein the fluoroalkyl carboxylic acid is shown in or a salt thereof.
6. The method according to any one of claims 1 to 5, wherein the defluorinating activity of the enzyme with respect to the fluoroalkane compound is such that {(amount of fluoride ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluoride ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluorine atoms bound to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment} > 10%.
7. An enzyme capable of defluorinating fluoroalkane compounds, which contain a carboxylic acid or a salt thereof and may also contain an oxygen atom and / or a halogen atom other than fluorine, wherein the enzyme has the following amino acid sequence: (a) The amino acid sequence described in Sequence ID No. 1, (b) an amino acid sequence having at least 80% identity with the amino acid sequence described in Sequence ID No. 1, (c) An amino acid sequence in which 1 to 60 amino acids are substituted, deleted, inserted, or added in the amino acid sequence described in Sequence ID No. 1, (d) The amino acid sequence encoded by the nucleotide sequence described in Sequence ID No. 2, (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity with the nucleotide sequence described in Sequence ID No. 2, or (f) Amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No.
2. An enzyme containing any of the following.
8. The enzyme according to claim 7, which defluorinates the fluorine at the α-position of the fluoroalkane compound.
9. The enzyme according to claim 7, which defluorinates the fluorine at the β-position of the fluoroalkane compound.
10. The aforementioned fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The enzyme according to claim 7, wherein the enzyme is a fluoroalkyl carboxylic acid shown in or a salt thereof.
11. The following nucleotides: (a) Nucleotides described in Sequence ID No. 2, (b) A nucleotide having at least 80% identity with the base sequence described in Sequence ID No. 2, or (c) Nucleotides that hybridize under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No.
2. An expression vector containing this vector.
12. A host cell comprising the expression vector described in claim 11.
13. A method for producing an enzyme capable of defluorinating a fluoroalkane compound, comprising culturing the host cell described in claim 12, the enzyme containing a carboxylic acid or a salt thereof, and which may also contain an oxygen atom and / or a halogen atom other than fluorine.
14. The method according to claim 13, wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
15. The method according to claim 13, wherein the enzyme defluorinates the fluorine at the α-position of the fluoroalkane compound.
16. The aforementioned fluoroalkane compound is of formula I: R1-COOH (I) [In the formula, R1 represents a fluoroalkyl group which may contain an oxygen atom having 1 to 2 carbon atoms and / or a halogen atom other than fluorine.] The method according to claim 13, wherein the fluoroalkyl carboxylic acid is shown in or a salt thereof.
17. A microorganism deposited with NITE under accession number NITE BP-04122.
18. An enzyme produced by the microorganism described in claim 17 that can defluorinate fluoroalkylcarboxylic acids.
19. A method for producing an enzyme capable of defluorinating fluoroalkylcarboxylic acids, comprising culturing the microorganism described in claim 17.