Novel method for extracting Cnidium officinale and external and internal preparations containing the extract

The extraction method for Cnidium officinale addresses the need for materials with comprehensive biological effects by enhancing hyaluronic acid, collagen production, MMP inhibition, and cell proliferation, while suppressing melanin production, offering a stable and effective solution.

JP2026076510APending Publication Date: 2026-05-12NIPPON MENARD COSMETIC CO
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2024187162
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-10-24
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

There is a demand for safe, highly stable materials that exhibit excellent hyaluronic acid production-promoting, collagen production-promoting, MMP-inhibiting, cell proliferation-promoting, and melanin production-inhibiting effects, but currently, no material that fully satisfies these needs has been provided.

Method used

A method for extracting Cnidium officinale using a two-step process: first with a pretreatment agent of liquid water, followed by extraction with water, lower alcohols, or liquid polyhydric alcohols at a temperature 20°C higher than the first step, yielding an extract with enhanced hyaluronic acid, collagen production, MMP inhibition, cell proliferation promotion, and melanin suppression effects.

Benefits of technology

The extract of Cnidium officinale demonstrates significant hyaluronic acid production promotion, collagen production promotion, MMP inhibition, cell proliferation enhancement, and melanin suppression, with improved stability compared to conventional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026076510000001
    Figure 2026076510000001
  • Figure 2026076510000002
    Figure 2026076510000002
  • Figure 2026076510000003
    Figure 2026076510000003
Patent Text Reader

Abstract

This material is safe, highly stable, and exhibits excellent hyaluronic acid production promoting effects, collagen production promoting effects, MMP inhibition effects, cell proliferation promoting effects, and melanin production suppression effects. [Solution] A method for extracting Cnidium officinale is provided, comprising a first step of obtaining an extraction residue of Cnidium officinale by extracting Cnidium officinale with a pretreatment agent consisting of liquid water, and a second step of obtaining an extract of Cnidium officinale by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or more higher than the extraction temperature of the first step. Furthermore, a hyaluronic acid production promoter, collagen production promoter, MMP inhibitor, wrinkle improvement agent, cell proliferation promoter, melanin production inhibitor, whitening agent, food composition, etc., containing the extract of Cnidium officinale obtained by the above method is also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a novel method for extracting Senkyu and external and internal preparations containing the extract.

Background Art

[0002] Fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, maintaining the firmness of the skin. It is considered that wrinkles and sagging of the skin occur as a result of this connective tissue losing its contractile force and further losing its elastic force.

[0003] Particularly, hyaluronic acid is known as a high-molecular polysaccharide widely distributed in connective tissue, presenting in a gel-like form in the dermis and maintaining the elasticity of the skin. Therefore, alteration and decrease of hyaluronic acid are considered important in skin aging. In addition, since hyaluronic acid is a high-molecular substance, there has been a problem that it is difficult to be absorbed even when a cosmetic containing it is directly applied to the skin. Thus, heretofore, skin external preparations that can promote the production of collagen and hyaluronic acid by the cells themselves by activating fibroblasts have been explored (Patent Document 1).

[0004] Hyaluronic acid is also present in joints and is known to play a role in cushioning the impact of joint loads and smoothing joint movement. While the hyaluronic acid concentration in synovial fluid of a normal human is approximately 2.3 mg / mL, in rheumatoid arthritis, this concentration decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 1). Furthermore, a decrease in hyaluronic acid content is also known to occur in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 2). In these diseases, increasing the amount of hyaluronic acid in the synovial fluid is considered to improve lubrication, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that injecting sodium hyaluronate into the joints of patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 3). However, treatment for these diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.

[0005] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, leading to opacity within the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for foods and medicines containing hyaluronic acid production promoters that can be used daily to prevent and improve physiological floaters.

[0006] The dermis contains fibroblasts and collagen, with type I collagen making up 80% of the total. Besides type I collagen, types III, V, XII, and XIV collagen are also known to exist. A decrease in type I collagen is one of the causes of wrinkles and sagging. Therefore, promoting the production of type I collagen is considered effective in preventing and improving wrinkles and sagging. Furthermore, promoting the production of type I collagen is also effective in improving the healing of skin wounds.

[0007] Furthermore, the skin is exposed daily to various physical and chemical stresses, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function deteriorates, and various signs of skin aging become apparent. Wrinkles are one such sign of skin aging. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also called fine wrinkles, are temporary wrinkles that occur due to a decrease in the amount of water in the stratum corneum of the epidermis caused by skin dryness. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanisms of their formation include a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and the promotion of collagen breakdown due to an increase in matrix metalloproteinases (MMPs).

[0008] Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanism, and treatment methods. Dermal wrinkles caused by UV radiation and aging are difficult to improve with the use of moisturizing cosmetics.

[0009] To date, several agents have been reported for the purpose of improving dermal wrinkles caused by ultraviolet radiation, including a skin wrinkle prevention and improvement agent containing hydrolyzed almond as an active ingredient (Patent Document 2), and a wrinkle improvement agent for ultraviolet irradiation containing extracts of Jochokei, Tenki, and Kisenosa as active ingredients (Patent Document 3).

[0010] MMPs play a major role in the stromal invasion, intravascular invasion, and angiogenesis of cancer cells. The stroma is mainly composed of type I collagen, and the movement of cancer cells requires the destruction of the matrix by stromal collagenases, etc. For metastasis to be completed, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMPs are also involved at this stage (Non-Patent Literature 4). Therefore, substances that have inhibitory activity against MMPs are expected to have an effect in suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer. In addition, inhibition of MMPs is useful in the prevention, treatment, and improvement of various diseases caused by increased MMP levels, such as ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0011] Collagenase (MMP-1), belonging to the MMP group, is an enzyme produced by fibroblasts and chondrocytes, and plays a major role in promoting collagen degradation. Collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, gums, and skin. When collagen molecules are cleaved at one point by collagenase, the normally stable collagen molecules denature into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer, ulcer formation, osteoporosis, periodontitis, and other problems.

[0012] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 4), raspberry extract (Patent Document 5), and lactoferrin (Patent Document 6). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.

[0013] Gelatinase (MMP-2), belonging to the MMP group, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that make up special components of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is broken down by gelatinase, the risk of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increases.

[0014] Generally, the proliferation and division capacity of epidermal keratinocytes decreases with age, and the epidermal layer itself thins (Non-Patent Literature 5). Biological factors such as Epidermal Growth Factor (EGF) and female hormones (estrogen) act on the proliferation of epidermal keratinocytes in the skin, but their secretion decreases with age. This decline in the metabolic function of epidermal keratinocytes due to aging slows down the rate of skin turnover, causing rough skin and skin aging. In addition, the accumulation of keratinocytes that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin within the epidermis, causing hyperpigmentation and dullness of the skin. Furthermore, it is known that wound healing in the epidermis is also slowed. In order to prevent or improve the progression of these phenomena, there has been much research into ingredients that promote the proliferation of epidermal keratinocytes and proposals for topical skin preparations.

[0015] Generally, skin pigmentation such as age spots, freckles, and sunburn is thought to be caused by hormonal abnormalities or ultraviolet radiation stimulating melanin-producing cells in the skin to excessively produce melanin, which then deposits in the skin. One known method to prevent such pigmentation is to suppress the excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and other substances have been used as whitening agents, both internally and externally, for the treatment of pigmentation (Patent Document 7).

[0016] Cnidium officinale (scientific name: Cnidium officinale) is a perennial plant belonging to the genus Cnidium in the family Apiaceae. The herbal medicine "Senkyu" is made from the dried rhizome of Cnidium officinale and contains essential oils mainly composed of phthalide derivatives. It is used in traditional Chinese medicine for its blood-replenishing, sedative, and analgesic effects.

Prior Art Documents

Patent Documents

[0017]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Patent Document 7

Non-Patent Documents

[0018]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0019] There is a demand for safe, highly stable materials that exhibit excellent hyaluronic acid production-promoting, collagen production-promoting, MMP-inhibiting, cell proliferation-promoting, and melanin production-inhibiting effects, but currently, no material that fully satisfies these needs has been provided. [Means for solving the problem]

[0020] Due to these circumstances, the inventors conducted diligent studies and found that the extract of Cnidium officinale obtained by an extraction method comprising a first step of obtaining an extraction residue of Cnidium officinale by extracting Cnidium officinale with a pretreatment agent consisting of liquid water, and a second step of obtaining an extract of Cnidium officinale by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or more higher than the extraction temperature of the first step, has excellent hyaluronic acid production promoting effect, collagen production promoting effect, MMP inhibitory effect, cell proliferation promoting effect, and melanin production suppressing effect, and is also excellent in stability, thus completing the present invention.

[0021] In other words, the present invention encompasses the following inventions. (1) A method for extracting Cnidium officinale, comprising: a first step of obtaining an extraction residue of Cnidium officinale by extracting Cnidium officinale with a pretreatment agent consisting of liquid water; and a second step of obtaining an extract of Cnidium officinale by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or higher than the extraction temperature of the first step. (2) The method for extracting Cnidium officinale according to (1), characterized in that the extraction temperature in the first step is 0 to 20°C, the extractant in the second step is water, and the extraction temperature in the second step is 70°C or higher than the extraction temperature in the first step. (3) A hyaluronic acid production promoter characterized by containing an extract of Cnidium officinale obtained by the extraction method of Cnidium officinale described in (1) or (2). (4) A collagen production promoter characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (1) or (2). (5) An MMP inhibitor characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (1) or (2). (6) A wrinkle-improving agent characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (1) or (2). (7) A cell proliferation promoter characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (1) or (2). (8) A melanin production inhibitor characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (1) or (2). A whitening agent characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (9)(1) or (2). A food composition for the prevention and improvement of skin wound healing, cancer, ulcer formation, arteriosclerosis, chronic rheumatoid arthritis, osteoporosis, and periodontitis, characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in (10)(1) or (2). [Effects of the Invention]

[0022] The present invention provides a hyaluronic acid production promoter, a collagen production promoter, an MMP inhibitor, a wrinkle-improving agent, a cell proliferation promoter, a melanin production inhibitor, a skin whitening agent, and a food composition containing an extract of Cnidium officinale extracted by a specific method as an active ingredient. [Modes for carrying out the invention]

[0023] The Cnidium officinale used in the present invention is a perennial herb native to China belonging to the genus Cnidium of the Apiaceae family, and is also widely cultivated in Japan. Further, the Cnidium officinale used in the present invention can use a part of the plant body such as its flower, fruit, seed, leaf, stem, root, or the whole plant body (whole herb), or a mixture thereof, but the rhizome is particularly preferred. Further, the plant body may be used as it is, or may be subjected to treatments such as drying, pulverization, and cutting. In addition, the crude drug "Senkyu" commercially available with Cnidium officinale as the original plant can also be used.

[0024] [Step 1: Extraction with a pretreatment agent] As the pretreatment agent, liquid water is used. Further, an acid or an alkali may be added to the pretreatment agent to use a pH-adjusted pretreatment agent. There is no particular limitation on the amount of the pretreatment agent used. For example, it is preferably 3 to 100 times, more preferably 10 to 50 times, and particularly preferably 15 to 30 times with respect to the Cnidium officinale (dry weight). The Cnidium officinale used for extraction with the pretreatment agent may be used as it is, but it is preferable to perform treatments such as pulverization and cutting in terms of the efficiency of the pretreatment. When pulverizing or cutting, those passing through a sieve (2 mesh) with a mesh size of 11.2 mm opening are preferable, those passing through a sieve (3 mesh) with a mesh size of 7.47 mm opening are more preferable, and those passing through a sieve (4 mesh) with a mesh size of 5.55 mm opening are most preferable. After extraction, filtration can be performed using filter paper, a mesh, a sieve, or the like. The extraction residue recovered here is used in the following Step 2.

[0025] [Step 2: Extraction with an extraction agent] As the extractant, one or more selected from the group consisting of water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.) are used. Preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used, and particularly preferably, water, a mixed polar solvent of water and ethanol, and a mixed polar solvent of water and 1,3-butylene glycol are used, but the choice can be made depending on the purpose, such as the yield and effectiveness of the extract. In addition, an extractant with pH adjusted by adding an acid or alkali to the above extractant can also be used. There are no particular limitations on the amount of extractant used, for example, it is fine if it is 5 times or more, preferably 10 times or more, relative to the dry weight of Cnidium officinale, but it is preferable to be 100 times or less for the convenience of operations when concentrating or isolating after extraction. Furthermore, the extraction time can be appropriately selected depending on the type of extractant used and the pressure during extraction, but the extraction temperature must be at least 20°C higher than the extraction temperature with the pretreatment agent. In particular, when using water, it is preferable that the temperature be at least 70°C higher than the extraction temperature with the pretreatment agent, more preferably at least 80°C higher, and most preferably at least 90°C higher. Filtration can be carried out in the same manner as in the first step.

[0026] The extraction residue from the pretreatment agent may be dried before extraction with the extractant, or it may be extracted directly without drying. In the latter case, it is advisable to select the extraction solvent considering the effect of any water remaining in the extraction residue. The extraction method with the extractant is not particularly limited and can be carried out by methods such as stirring extraction or column extraction.

[0027] The extract obtained using the above extractant may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, or ethanol precipitation, to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0028] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0029] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0030] For external use, the content of the above extract used in this invention is preferably 0.000001% by weight or more, and more preferably 0.00001 to 10% by weight, when converted to solid matter. Furthermore, 0.0001 to 5% by weight is most preferable. Below 0.000001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0031] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0032] Next, in order to describe the present invention in detail, examples of the production, formulation, and experimental use of the extract in the present invention will be given as examples, but the present invention is not limited thereto. In the production examples, % refers to weight percentage, and in the formulation examples, parts refer to parts by weight. [Examples]

[0033] Example of production method for Cnidium officinale extract The Cnidium officinale extract of the present invention was prepared according to Production Examples 1 to 4. Conventional Cnidium officinale extracts were prepared according to Comparative Production Examples 1 to 3. The extraction material used was a pulverized rhizome of Cnidium officinale (passed through a sieve with a mesh size of 11.2 mm).

[0034] (Manufacturing Example 1) Preparation of a hot water extract of pre-treated Cnidium officinale 10 g of dried rhizomes of Cnidium officinale were mixed with 20 times their weight in water and extracted at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 22 hours, and no further extraction was possible). The obtained extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in water was added to the resulting dried residue and extracted at 95°C for 2 hours. The obtained extract was filtered through filter paper No. 5C, the filtrate was concentrated, and freeze-dried to obtain 0.6 g of hot water extract of Cnidium officinale.

[0035] (Comparative manufacturing example 1) Preparation of conventional hot water extract of Cnidium officinale Ten times the weight of water was added to 10 g of dried rhizomes of Cnidium officinale, and the mixture was extracted at 95°C for 2 hours. The resulting extract was filtered through filter paper No. 5C, the filtrate was concentrated, and freeze-dried to obtain 1.9 g of hot water extract of Cnidium officinale.

[0036] (Manufacturing Example 2) Preparation of a 50% ethanol extract of pre-treated Cnidium officinale 10 g of dried rhizomes of Cnidium officinale were mixed with 20 times their weight in water and extracted at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 22 hours, indicating that no further extraction was possible). The resulting extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in a 50% ethanol aqueous solution was added to the resulting dried residue. The mixture was immersed at 25°C for 7 days to extract the residue. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.3 g of a 50% ethanol extract of Cnidium officinale.

[0037] (Comparative manufacturing example 2) Preparation of a conventional 50% ethanol extract of Cnidium officinale To 10 g of dried rhizomes of Cnidium officinale, 10 times its weight in a 50% ethanol aqueous solution was added, and the mixture was steeped at 25°C for 7 days to extract the solution. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 2.0 g of a 50% ethanol extract of Cnidium officinale.

[0038] (Manufacturing Example 3) Preparation of ethanol extract of pre-treated Cnidium officinale 20 g of dried rhizomes of Cnidium officinale were mixed with 20 times their weight in water and extracted at 5°C for 24 hours (the increase in the solid content of the extract stopped within 22 hours, indicating that no further extraction was possible). The resulting extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in ethanol was added to the resulting dried residue. The mixture was immersed at 25°C for 7 days to extract the residue. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.1 g of ethanol extract of Cnidium officinale.

[0039] (Comparative manufacturing example 3) Preparation of conventional ethanol extract of Cnidium officinale 20 g of dried rhizomes of Cnidium officinale were mixed with 10 times its weight in an aqueous ethanol solution and steeped at 25°C for 7 days to extract the contents. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.2 g of ethanol extract of Cnidium officinale.

[0040] (Manufacturing Example 4) Preparation of 1,3-butylene glycol extract of pre-treated Cnidium officinale 10 g of dried rhizomes of Cnidium officinale were mixed with 20 times their weight in water and extracted at 5°C for 24 hours (the increase in the solid content of the extract stopped within 22 hours, indicating no further extraction was possible). The resulting extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in 1,3-butylene glycol was added to the resulting dried residue. The mixture was immersed at 25°C for 7 days to extract the residue. The resulting extract was filtered through filter paper No. 5C to obtain 61.6 g of 1,3-butylene glycol extract of Cnidium officinale. [Examples]

[0041] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of pre-treated Cnidium officinale (Production Example 1) 0.1 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0042] (Comparative formulation example 1) Conventional lotion In Formulation Example 1, the hot water extract of pre-treated Cnidium officinale was replaced with a conventional hot water extract of Cnidium officinale (Comparative Manufacturing Example 1), resulting in a conventional lotion.

[0043] (Prescription example 2) Cream Formulation Content (per portion) 1. 50% ethanol extract of pre-treated Cnidium officinale (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain the product.

[0044] (Prescription example 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of pre-treated Cnidium officinale (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0045] (Prescription example 4) Gel Formulation Content (per portion) 1. Pre-treated Angelica shikokiana 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0046] (Prescription example 5) Pack Formulation Content (per portion) 1. Hot water extract of pre-treated Cnidium officinale (Production Example 1) 1.0 2. Pre-treated Angelica shikokiana 1,3-Butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0047] (Prescription example 6) Foundation Formulation Content (per portion) 1. 50% ethanol extract of pre-treated Cnidium officinale (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0048] (Example prescription 7) Bath additive Formulation Content (per portion) 1. Ethanol extract of pre-treated Cnidium officinale (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0049] (Prescription example 8) Ointment Formulation Content (per portion) 1. Hot water extract of pre-treated Cnidium officinale (Production Example 1) 5.0 2. 50% ethanol extract of pre-treated Cnidium officinale (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0050] (Prescription example 9) Powder Formulation Content (per portion) 1. Hot water extract of pre-treated Cnidium officinale (Production Example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0051] (Prescription example 10) Tablets Formulation Content (per portion) 1. Ethanol extract of pre-treated Cnidium officinale (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0052] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Ethanol extract of pre-treated Cnidium officinale (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0053] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of pre-treated Cnidium officinale (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0054] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]

[0055] Experimental Example 1: Hyaluronic Acid Production Promotion, Collagen Production Promotion, and MMP Inhibition Test HAS2, COL1A1, MMP-1, and MMP-2 mRNA expression levels were measured. Human dermal fibroblasts were placed in a φ60 mm dish in a 1 × 10⁶ dish. 5Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to a final concentration of 1 or 10 μg / mL, and then total RNA was extracted. Total RNA was extracted from cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of HAS2, COL1A1, MMP-1, and MMP-2 mRNA were determined as a percentage of the expression level of the internal standard, GAPDH mRNA. The HAS2 expression rate was calculated as the ratio of the HAS2 mRNA expression level in the sample-added group to the HAS2 mRNA expression level in the control (no sample added) group. The COL1A1 expression rate, MMP-1, and MMP-2 expression rates were calculated similarly. The primers used to measure the expression levels of each gene are as follows.

[0056] Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 1) GCTGGATTACTGTGGCAATGAG(Sequence ID 2) Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(Sequence ID 3) TTGCAGTGGTAGGTGATGTTCTG(Sequence ID 4) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (Sequence ID 5) TGAGCATCCCCTCCAATACC(Sequence ID 6) Primer set for MMP-2 CCGTCGCCCATCATCAA (Sequence ID 7) CTTCTGCATCTTCTTTAGTGTGTCCTT(Sequence No. 8) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence ID 9) TCTTCTGGGTGGCAGTGATG (Sequence ID 10)

[0057] These experimental results are shown in Tables 1-4. As a result, the extract of Cnidium officinale pretreated with the present invention showed excellent HAS2 expression promoting effect (hyaluronic acid production promoting effect), COL1A1 expression promoting effect (collagen production promoting effect), and MMP-1 and MMP-2 expression suppressing effect (MMP inhibitory effect). Furthermore, in all of these effects, the extract of Cnidium officinale pretreated with the present invention was significantly higher than that of conventional Cnidium officinale extract. In particular, the HAS2 expression promoting effect and MMP expression suppressing effect of the extract of Cnidium officinale pretreated with the present invention showed the opposite effect to that of conventional Cnidium officinale extract, which was an unexpectedly remarkable effect.

[0058] [Table 1]

[0059] [Table 2]

[0060] [Table 3]

[0061] [Table 4]

[0062] Experimental Example 2: Cell Proliferation Promotion Test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS in a 96-well plate, with 2 × 10⁶ cells per well. 3 Cells were seeded individually, and each sample was added to achieve a final concentration of 0.1 μg / mL. The cells were then cultured at 37°C under 5% CO2 conditions for 5 days. Cell count was measured by staining. Specifically, after the culture period, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and thoroughly mixed. The absorbance at 650 nm was measured using a microplate reader. Cell proliferation rate was calculated as the ratio of the cell volume in the sample-added group to the cell volume in the control group (no sample added).

[0063] These experimental results are shown in Table 5. As a result, the extract of Cnidium officinale treated with the present invention showed excellent cell proliferation promoting activity. Furthermore, the extract of Cnidium officinale treated with the present invention showed significantly higher activity compared to conventional Cnidium officinale extract.

[0064] [Table 5]

[0065] Experimental Example 3: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were placed in a φ60mm dish in a 3×10 4Cells were seeded individually and cultured for 5 days at 37°C under 5% CO2 conditions in a MEM culture medium containing 10% FBS to which each sample was added to a final concentration of 1 μg / mL. After culturing, the cells were detached and centrifuged to obtain a pellet, which was then dissolved in PBS(-) by sonication. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265-275, 1951). In addition, to measure melanin content, 4N NaOH was added to the remaining cell lysate taken for protein quantification, and after heating at 60°C for 2 hours, the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation). Melanin content was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in melanin content in the sample-added group to the control group (no sample added).

[0066] These experimental results are shown in Table 6. As a result, it was found that the extract of Cnidium officinale pretreated according to the present invention has excellent melanin production inhibitory effects. Furthermore, the extract of Cnidium officinale pretreated according to the present invention showed significantly higher effects compared to conventional Cnidium officinale extracts.

[0067] [Table 6]

[0068] Experimental Example 4: Usage Test The feel of the lotion was evaluated for Formulation Example 1 and Comparative Formulation Example 1 of the present invention.

[0069] Five panelists were divided into groups and blindly used each sample. They compared their experience using Formula Example 1 and Comparative Formula Example 1, and also evaluated the presence or absence of skin problems.

[0070] As a result, the lotion obtained using formulation example 1 had a better feel to it than comparative formulation example 1 and could be used safely without causing skin problems. Furthermore, there were no issues with the degradation of the formulation ingredients. [Industrial applicability]

[0071] Based on the above, the Cnidium officinale extract of the present invention possesses excellent hyaluronic acid production promoting effects, collagen production promoting effects, MMP inhibitory effects, cell proliferation promoting effects, and melanin production inhibitory effects, and also exhibits excellent stability. Therefore, the Cnidium officinale extract of the present invention can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A method for extracting Cnidium officinale, comprising: a first step of obtaining an extraction residue of Cnidium officinale by extracting Cnidium officinale with a pretreatment agent consisting of liquid water; and a second step of obtaining an extract of Cnidium officinale by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or more higher than the extraction temperature of the first step.

2. The method for extracting Cnidium officinale according to claim 1, characterized in that the extraction temperature in the first step is 0 to 20°C, the extractant in the second step is water, and the extraction temperature in the second step is 70°C or higher than the extraction temperature in the first step.

3. A hyaluronic acid production promoter characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

4. A collagen production promoter characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

5. An MMP inhibitor characterized by containing an extract of Cnidium officinale obtained by the method for extracting Cnidium officinale described in claim 1 or 2.

6. A wrinkle-improving agent characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

7. A cell proliferation promoter characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

8. A melanin production inhibitor characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

9. A skin whitening agent characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.

10. A food composition for the prevention and improvement of skin wound healing, cancer, ulcer formation, arteriosclerosis, chronic rheumatoid arthritis, osteoporosis, and periodontitis, characterized by containing an extract of Cnidium officinale obtained by the method of extracting Cnidium officinale described in claim 1 or 2.