Method for enhancing oil production in oil-accumulating algae

Abstract

This invention provides a means to increase the amount of triacylglycerol accumulated in high-lipid algae. [Solution] Algae characterized by the following (1) and (2), (1) Decreased expression of class 3 lipase genes, (2) An exogenous diacylglycerol acyltransferase gene has been introduced, or the expression of an endogenous diacylglycerol acyltransferase gene has been enhanced.

Description

[Technical Field]

[0001] The present invention relates to algae that accumulate triacylglycerols in large quantities, and to a method for producing triacylglycerols using the same. [Background technology]

[0002] A decrease in nutrients leads to reduced growth and accumulation of lipids such as triacylglycerols (TAGs) in many plants and algae. Algal biomass is larger than that of plants, making it advantageous for biofuel production and the production of useful lipids (Non-Patent Literature 1). Research into producing industrial and food products, including biofuels, using algal-derived TAGs as raw materials is progressing worldwide. However, the high production costs are currently a problem for industrialization. Therefore, further technological development is essential to reduce production costs.

[0003] TAG accumulation is regulated by lipid degradation and lipid synthesis. Lipase is known as a protein involved in TAG degradation, and diacylglycerol acyltransferase (DGAT) is known as a protein involved in TAG synthesis. The true eye-spot alga Nannochloropsis (hereinafter referred to as "Nannochloropsis") is a microalga that accumulates a certain amount of TAG under normal cultivation conditions, but it has been reported that it accumulates even more TAG under nutrient-deficient conditions, and that the fatty acid composition of TAG is simple and suitable for fuel (Non-Patent Literature 1, Non-Patent Literature 2). It also has the characteristics of being able to be cultured in seawater, enabling low-cost production because it can be cultured at high density, and genetic modification technology has already been established (Non-Patent Literature 3, Non-Patent Literature 4). In budding yeast and higher plants, the major known TAG lipases TGL and SDP1 both have a patatin-like domain (Non-Patent Literature 5, Non-Patent Literature 6, Non-Patent Literature 7). There are reports that suppressing the expression level of the AtSDP1 homolog gene in the diatom (Phaeodactylum tricornutum) to 20%-40% by RNAi doubles the amount of TAG (Non-Patent Literature 8). Nannochloropsis has lipases TGL1 and TGL2 with the same domain structure. When a TGL1 / TGL2 double mutant was created, an increase in TAG accumulation was confirmed on the second day of the initial stage of culture (Non-Patent Literature 9). However, since an increase in TAG accumulation has not been confirmed in the later stages of culture or under nutrient-deficient conditions, it is thought that the main TAG degradation in Nannochloropsis is due to an unknown lipase other than TGL1 and TGL2. Furthermore, the present inventors have previously reported that introducing the DGAT2 gene from Chlamydomonas reinhardtii, which is involved in TAG synthesis, into Nannochloropsis and overexpressing it under nutrient-deficient conditions increases the amount of TAG (Patent Literature 1). However, there are no known examples of creating strains of the high-oil-producing alga Nannochloropsis that simultaneously suppress the function of proteins involved in TAG degradation and enhance the expression of proteins involved in TAG synthesis. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] International Publication No. 2015 / 137449 [Non-Patent Documents]

[0005] [Non-Patent Document 1] Plant J. 54, 621 - 639, (2008) [Non-Patent Document 2] Biotechnol. Bioeng. 102, 100 - 112, (2009) [Non-Patent Document 3] Proc. Natl. Acad. Sci. USA 108, 21265 - 21269, (2011) [Non-Patent Document 4] Genes Cells 25, 695 - 702, (2020) [Non-Patent Document 5] Plant Cell 18, 665 - 675, (2006) [Non-Patent Document 6] J. Biol. Chem. 278, 23317 - 23323, (2003) [Non-Patent Document 7] J. Biol. Chem. 280, 37301 - 37309, (2005) [Non-Patent Document 8] Biochim. Biophys. Acta 1861, 239 - 248, (2016) [Non-Patent Document 9] Biochim. Biophys. Acta 1864, 1185 - 1193, (2019) [Summary of the Invention] [Problems to be Solved by the Invention]

[0006] Nannochloropsis is a highly lipid-accumulating algae compared to other algae, but further technological development is desired to reduce production costs. This invention was made against this backdrop and aims to provide a means to increase the amount of TAG accumulated in lipid-accumulating algae such as Nannochloropsis. [Means for solving the problem]

[0007] Genetic knockout strains of Nannochloropsis in which TGL1 and TGL2, homologs of the major plant TAG lipase SDP1, are disrupted do not lead to increased TAG production at a practical level (Biochim. Biophys. Acta 1864, 1185-1193, (2019)). Therefore, in order to achieve the above objective, the inventors have diligently conducted research and have focused on a new TAG lipase, class 3 lipase (Pfam#PF01764). This structure represents a domain containing an α / β hydrolase fold, such as ferloylesterase A from Aspergillus niger (J. Mol. Biol. 338, 495-506, (2004)), triacylglycerol lipase OBL1 from Arabidopsis thaliana (New Phytol 217, 1062-1076, (2018)), and diacylglycerol lipase α from human (Proc Natl Acad Sci USA 113, 26-33, (2016)). A Pfam domain search revealed 23 class 3 lipases in Nannochloropsis. Of these, gene knockout strains were created by genome editing for No. 3LIP7 and No. 3LIP14, and by homologous recombination for No. 3LIP6 and No. 3LIP10. In the No3LIP7, No3LIP14, No3LIP6, and No3LIP10 gene knockout strains, we successfully increased TAG accumulation during the later stages of culture. To further increase TAG accumulation, we enhanced the expression of genes involved in TAG synthesis. Focusing on DGAT1 and DGAT2 from fish that feed on algae, we artificially synthesized two genes, CodDGAT1 and CodDGAT2. We created a construct for strong expression by sandwiching these genes between the LDSP promoter region and LDSP terminator region of Nannochloropsis, and introduced it into the No3LIP14 gene knockout strain. As a result, we succeeded in further increasing TAG accumulation. This invention solves the aforementioned problems by combining novel lipase gene knockout with strong DGAT gene expression.

[0008] The present invention provides the following [1] to [8]. [1] An alga characterized by the following (1) and (2): (1) The expression of the class 3 lipase gene is decreased; (2) A foreign diacylglycerol acyltransferase gene is introduced, or the expression of the endogenous diacylglycerol acyltransferase gene is enhanced.

[0009] [2] The alga according to [1], wherein the alga belongs to the genus Nannochloropsis.

[0010] [3] The alga according to [1], wherein the class 3 lipase gene is a gene encoding the following protein (a), (b), or (c): (a) A protein consisting of the amino acid sequence represented by SEQ ID NO: 2, 4, 6, or 8; (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NO: 2, 4, 6, or 8, and having lipase activity; (c) A protein consisting of an amino acid sequence having 40% or more homology with the amino acid sequence represented by SEQ ID NO: 2, 4, 6, or 8, and having lipase activity.

[0011] [4] The alga according to [1], wherein the foreign diacylglycerol acyltransferase gene is a gene encoding the following protein (a), (b), or (c): (a) A protein consisting of the amino acid sequence represented by SEQ ID NO: 10 or 12; (b) A protein consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NO: 10 or 12, and having diacylglycerol acyltransferase activity; (c) A protein consisting of an amino acid sequence having 40% or more homology with the amino acid sequence represented by SEQ ID NO: 10 or 12, and having diacylglycerol acyltransferase activity.

[0012] [5] The alga described in [1], characterized in that the endogenous diacylglycerol acyltransferase gene is a gene that encodes the following protein (a), (b), or (c). (a) A protein consisting of the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24 (b) A protein having diacylglycerol acyltransferase activity, consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24, (c) A protein having an amino acid sequence having 60% or more homology to the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24, and possessing diacylglycerol acyltransferase activity.

[0013] [6] The algae according to [1], characterized in that, when cultured under phosphorus-deficient conditions, the proportion of oleic acid in triacylglycerol decreases and the proportion of palmitic acid increases compared to the wild strain.

[0014] A method for producing triacylglycerol, characterized by culturing algae described in any one of items [7], [1] to [6], causing the algae to produce triacylglycerol, and collecting the produced triacylglycerol.

[0015] [8] A method for producing triacylglycerol according to [7], characterized by culturing algae under phosphorus-deficient conditions. [Effects of the Invention]

[0016] This invention provides a novel alga. This alga accumulates a large amount of TAG, making it useful for TAG production. Furthermore, the TAG produced by this alga has a lower proportion of oleic acid (C18:1) and a higher proportion of palmitic acid (C16:0) compared to the wild strain, making it suitable as a raw material for biofuels. [Brief explanation of the drawing]

[0017] [Figure 1] A diagram showing constructs for disrupting the No3LIP6 and No3LIP10 genes. [Figure 2] This figure shows the growth of the No3LIP7 gene knockout strain. * indicates a significant difference between WT and No3LIP7, >* indicates a significant difference between the upper and lower sides, and ** indicates a significant difference among all three groups (p < 0.05, Tukey test, n=4, error bars are se). [Figure 3] This figure shows the amount of TAG accumulation in No3LIP7 gene knockout strains (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 4] This figure shows the fatty acid composition in the TAG of the No3LIP7 gene knockout strain (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 5] This figure shows the growth of the No3LIP14 gene knockout strain. * indicates a significant difference between WT and No3LIP14, and >* indicates a significant difference between the upper and lower tails (p < 0.05, Tukey test, n=4, error bars are se). [Figure 6] This figure shows the amount of TAG accumulation in the No3LIP14 gene knockout strain (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 7] This figure shows the fatty acid composition in the TAG of the No3LIP14 gene knockout strain (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 8] This figure shows the growth and TAG accumulation of the No3LIP6 gene knockout strain (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 9] This figure shows the growth and TAG accumulation of the No3LIP10 gene knockout strain (p < 0.05, Tukey test, n=4, error bars represent se). [Figure 10] A diagram showing the constructs for strengthening the TAG production system. [Figure 11]This figure shows the growth of codDGAT1 / LIP14 and codDGAT2 / LIP14. ** indicates a significant difference between WT and others, * indicates a significant difference between codDGAT1 / LIP14B1-4 and others, and >* indicates a significant difference between the upper and lower sides (p < 0.05, Tukey test, error bars are se, n=3 for normal medium, n=4 for phosphorus-deficient medium). [Figure 12] This figure shows the TAG accumulation levels of codDGAT1 / LIP14 and codDGAT2 / LIP14 (p < 0.05, Tukey test, error bars represent se, n=3 for normal medium, n=4 for phosphorus-deficient medium). [Figure 13] Figure showing the fatty acid composition in the TAGs of codDGAT1 / LIP14 and codDGAT2 / LIP14 (p < 0.05, Tukey test, error bars represent se, n=4). [Figure 14] Diagram showing light and temperature conditions for high-density aeration culture. A. Light and temperature control program used for culture. Solid line indicates light intensity, dashed line indicates temperature. B. Culture conditions for pre-culture and main culture. [Figure 15] This figure compares the biomass of wild-type, parental, codDGAT1 / LIP14, and codDGAT2 / LIP14 strains. A. Time course of biomass per unit of culture medium. B. Time course of biomass per cell. * indicates a significant difference between WT and CodDGAT2, and ** indicates a significant difference between WT and both CodDGAT1 and CodDGAT2. C. Biomass per unit of culture medium on day 7 of culture. D. Biomass per cell on day 7 of culture. n=3, error bars indicate se. p < 0.05 (Tukey test). [Figure 16] This figure compares TAG accumulation in wild-type, parental, codDGAT1 / LIP14, and codDGAT2 / LIP14 strains. A. Time course of TAG accumulation per unit of culture medium. * indicates a significant difference between WT and CodDGAT2. B. TAG accumulation per unit of culture medium at 10 days after the start of culture. n=3, error bars represent se. p < 0.05 (Tukey test). [Figure 17]This figure shows the fatty acid composition in TAGs of wild-type, parental, codDGAT1 / LIP14, and codDGAT2 / LIP14 (p < 0.05, Tukey test, error bars represent se, n=3). [Modes for carrying out the invention]

[0018] The present invention will be described in detail below. The algae of the present invention are preferably algae belonging to the genus Nannochloropsis, but other algae may also be used. Algae belonging to the genus Nannochloropsis include Nannochloropsis oceanica, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oculata, Nannochloropsis atomus, Nannochloropsis maculata, Nannochloropsis granulata, Nannochloropsis limnetica, Nannochloropsis maritima, and Nannochloropsis australis.

[0019] The algae of the present invention have the following two characteristics. The first characteristic is the reduced expression of the class 3 lipase gene. Class 3 lipase has a domain containing an α / β hydrolase fold. Therefore, it is possible to identify the class 3 lipase gene in algae based on this domain (for example, accession number: PF01764 in the Pfam database). The class 3 lipase gene is preferably class 3 triacylglycerol lipase.

[0020] Specific examples of class 3 lipase genes include No3LIP7, No3LIP14, No3LIP6, No3LIP10, or the genes corresponding to these genes in each alga. The nucleotide sequences of No3LIP7, No3LIP14, No3LIP6, and No3LIP10 are shown in SEQ ID NOs. 1, 3, 5, and 7, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in SEQ ID NOs. 2, 4, 6, and 8, respectively. Examples of genes corresponding to No3LIP7, No3LIP14, No3LIP6, or No3LIP10 include (b) genes encoding a protein having lipase activity, consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted from the amino acid sequence represented by SEQ ID NOs. 2, 4, 6, or 8, and (c) genes encoding a protein having lipase activity, consisting of an amino acid sequence having 40% or more homology to the amino acid sequence represented by SEQ ID NOs. 2, 4, 6, or 8.

[0021] In the protein of (b), the number of amino acid residues to be substituted, added, or deleted is not particularly limited as long as it is between 1 and 50, but is preferably around 1 to 30, more preferably around 1 to 10, even more preferably around 1 to 5, and particularly preferably around 1, 2, 3, or 4.

[0022] In the protein of (c), the homology with the amino acid sequence represented by SEQ ID NOs: 2, 4, 6, or 8 is not particularly limited as long as it is 40% or more, but is preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, and particularly preferably 80% or more. The homology value may be even higher, for example, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more. The homology of the amino acid sequence can be calculated using the BLASTP program provided by NCBI (National Center of Biotechnology Information).

[0023] A Blast search was performed on the amino acid sequences represented by SEQ ID NOs: 2, 4, 6, and 8. The results showed that for SEQ ID NO: 2 (No3LIP7), there is a protein with approximately 70% homology to Nanochloropsis gaditana; for SEQ ID NO: 4 (No3LIP14), there is a protein with approximately 40% homology to both Nanochloropsis gaditana and Nanochloropsis salina; for SEQ ID NO: 6 (No3LIP6), there is a protein with approximately 80% homology to both Nanochloropsis gaditana and Nanochloropsis salina; and for SEQ ID NO: 8 (No3LIP10), there is a protein with approximately 60% homology to Nanochloropsis gaditana and approximately 70% homology to Nanochloropsis salina. From this, it is thought that the genes encoding the protein in (c) (genes with more than 40% homology at the amino acid level) include genes corresponding to No3LIP7, No3LIP14, No3LIP6, and No3LIP10 in algae belonging to the genus Nannochloropsis.

[0024] In the algae of the present invention, the expression of the class 3 lipase gene is reduced. Here, "reduced expression of the class 3 lipase gene" means that the expression level of the class 3 lipase gene is lower compared to the wild type, and includes cases where the class 3 lipase gene is not expressed at all. Furthermore, the reduction in expression may be due to an effect on genes in the genome (e.g., gene modification by genome editing, mutation introduction by radiation), or it may be due to a method that does not affect genes in the genome (e.g., suppression of gene expression by RNAi or antisense method).

[0025] Modifications of class 3 lipase genes include, for example, gene deletion (gene disruption), introduction of mutations in the protein-coding region, and introduction of mutations in the expression regulatory region.

[0026] The second characteristic is that either an exogenous DGAT gene has been introduced, or the expression of an endogenous DGAT gene has been enhanced. This second characteristic can be achieved by either introducing an exogenous gene or enhancing the expression of an endogenous gene, but algae with enhanced expression of the endogenous DGAT gene are generally not considered genetically modified organisms, making outdoor cultivation possible, which is preferable.

[0027] DGAT has two isozymes: DGAT1 and DGAT2. Either can be used in this invention. DGAT genes are known to be derived from plants and animals, and either of these can be used as the foreign DGAT gene.

[0028] Specific examples of foreign DGAT genes include CodDGAT1, CodDGAT2, or genes similar to these. The nucleotide sequences of CodDGAT1 and CodDGAT2 are shown in SEQ ID NOs. 9 and 11, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in SEQ ID NOs. 10 and 12, respectively. Genes similar to CodDGAT1 or CodDGAT2 include (b) genes encoding proteins with DGAT activity, consisting of amino acid sequences in which 1 to 50 amino acid residues are substituted, added, or deleted from the amino acid sequence represented by SEQ ID NOs. 10 or 12, and (c) genes encoding proteins with DGAT activity, consisting of amino acid sequences having 40% or more homology to the amino acid sequence represented by SEQ ID NOs. 10 or 12.

[0029] In the protein of (b), the number of amino acid residues to be substituted, added, or deleted is not particularly limited as long as it is between 1 and 50, but is preferably around 1 to 30, more preferably around 1 to 10, even more preferably around 1 to 5, and particularly preferably around 1, 2, 3, or 4.

[0030] In the protein of (c), the homology with the amino acid sequence represented by SEQ ID NO: 10 or 12 is not particularly limited as long as it is 40% or more, but is preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, and especially preferably 80% or more. The homology value may be even higher, for example, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more.

[0031] Since endogenous DGAT genes are known in many algae, the present invention only requires enhancing the expression of these DGAT genes. In algae belonging to the genus Nannochloropsis, endogenous DGAT genes such as DGAT1A, DGAT2A, and DGAT2B are known. The nucleotide sequences of DGAT1A, DGAT2A, and DGAT2B of Nannochloropsis oceanica strain NIES-2145 are shown in SEQ ID NOs. 13, 15, and 17, respectively, and the amino acid sequences of the proteins encoded by these genes are shown in SEQ ID NOs. 14, 16, and 18, respectively. Furthermore, the nucleotide sequences of DGAT1A, DGAT2A, and DGAT2B of the Nannochloropsis oceanica IMET1 strain are publicly available (Wei, H. et al., Biotechnol Biofuels 10, 174 (2017), and the GenBank accession numbers are KY073295.1, KX867956.1, and KX867957.1, respectively), as shown in SEQ ID NOs. 19, 21, and 23, respectively. The amino acid sequences of the proteins encoded by these genes are shown in SEQ ID NOs. 20, 22, and 24, respectively. In this invention, the genes of the NIES-2145 strain and the IMET1 strain described above can be used, but genes similar to these genes may also be used. Similar genes include (b) genes encoding proteins having DGAT activity, consisting of amino acid sequences in which 1 to 50 amino acid residues are substituted, added, or deleted from the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24, and (c) genes encoding proteins having DGAT activity, consisting of amino acid sequences having 60% or more homology to the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24.

[0032] In the protein of (b), the number of amino acid residues to be substituted, added, or deleted is not particularly limited as long as it is between 1 and 50, but is preferably around 1 to 30, more preferably around 1 to 10, even more preferably around 1 to 5, and particularly preferably around 1, 2, 3, or 4.

[0033] In the protein of (c), the homology with the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24 is not particularly limited as long as it is 60% or more, but is preferably 70% or more, more preferably 80% or more, even more preferably 90% or more, and particularly preferably 95% or more. The homology value may be even higher, for example, 97% or more, 98% or more, or 99% or more.

[0034] The method for enhancing the expression of the endogenous DGAT gene is not particularly limited. For example, one method is to replace the promoter or terminator of the endogenous DGAT gene with a promoter or terminator that enables robust protein expression. The promoter and terminator that enables robust protein expression are not particularly limited, but it is preferable to use the endogenous promoter and terminator, as using an exogenous promoter or terminator would result in the resulting algae being genetically modified organisms. Furthermore, the promoter and terminator that enables robust protein expression may enable robust protein expression under normal conditions, or it may enable robust protein expression only under special conditions such as phosphorus deficiency.

[0035] Specific examples of promoters that enable strong protein expression include the LDSP promoter derived from algae belonging to the genus Nannochloropsis, and specific examples of terminators that enable strong protein expression include the LDSP terminator derived from algae belonging to the genus Nannochloropsis. The nucleotide sequences of the LDSP promoter and terminator derived from algae belonging to the genus Nannochloropsis are shown in SEQ ID NOs. 25 and 26, respectively. The promoters and terminators used are not limited to these; for example, promoters and terminators that enable strong protein expression under normal conditions may include the promoter and terminator for the LHC gene, the promoter and terminator for the FCP gene, the promoter and terminator for the VCP1 gene, the promoter and terminator for the elongation factor 1-alpha gene, the promoter and terminator for the Actin gene, the promoter and terminator for the Tuburin beta gene, or the promoter and terminator for the Tuburin alpha gene. Furthermore, the promoter and terminator of the SQD2 gene may be used as promoters and terminators that enable robust protein expression under phosphorus-deficient conditions.

[0036] The properties of the algae of the present invention include: 1) high accumulation of TAG in cells under both normal culture conditions and phosphorus-deficient conditions; and 2) when cultured under phosphorus-deficient conditions, the proportion of oleic acid (C18:1) in TAG decreases and the proportion of palmitic acid (C16:0) increases compared to the wild strain.

[0037] The present invention's method for producing TAG is characterized by culturing the algae described above, allowing the algae to produce TAG, and collecting the produced TAG.

[0038] The algae of the present invention may be cultured under normal conditions (conditions that do not deplete phosphorus), but it is preferable to culture them under phosphorus-deficient conditions in order to increase the amount of TAG accumulated. Culture conditions other than phosphorus can be appropriately selected depending on the type of algae. For example, when culturing algae of the genus Nannochloropsis, F2N medium, HD medium, or a medium from which phosphorus has been removed can be used as the culture medium, the culture temperature can be set to about 15 to 30°C, and the light intensity during cultivation can be 10 to 2000 μmol photons / m². 2 It can be set to / sec.

[0039] Methods for collecting TAG produced in algae include methods commonly used to recover TAG accumulated within cells, such as drying, freezing, crushing, filtering, centrifugation, and solvent extraction of algal cells. [Examples]

[0040] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0041] Experimental materials The true eyespot alga Nannochloropsis NIES-2145 (hereinafter referred to as "N. 2145") was used. This algal strain is available from the National Institute for Environmental Studies (http: / / www.nies.go.jp / ).

[0042] The genes used As novel lipase genes, we searched the transcript data of Nanochloropsis oceanica CCMP1779 v2.0 (https: / / phycocosm.jgi.doe.gov / Nanoce1779_2 / Nanoce1779_2.home.html) for those possessing a lipase class 3 domain (Pfam#PF01764), and selected 23 candidates. Of these, we focused on No3LIP7, No3LIP14, No3LIP6, and No3LIP10 based on their expression profiles. codDGAT1 and codDGAT2 were determined from the publicly available sequence of Atlantic cod (Gadus morhua) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_902167405.1 / ) using Human DGAT1 and Human DGAT2 as queries, and then artificially synthesized and obtained by Eurofins after modifying them to Nannochloropsis codons.

[0043] The sequences of each gene are listed in the sequence listing. The sequences of No3LIP7, No3LIP14, No3LIP6, No3LIP10, codDGAT1, and codDGAT2 are listed in sequence numbers 1, 3, 5, 7, 9, and 11, respectively.

[0044] Experimental Procedure 1 Culture conditions For culturing N. 2145 in a way other than high-density aeration culture, F2N medium was used as the standard liquid culture medium. For plate culture, F2N medium with 0.8% agar added was used.

[0045] 440 mg of Na2EDTA·2H2O, 316 mg of FeCl3·6H2O, 1.2 mg of CoSO4·7H2O, 2.1 mg of ZnSO4·7H2O, 18 mg of MnCl2·4H2O, 0.7 mg of CuSO4·5H2O, and 0.7 mg of Na2MoO4·2H2O were dissolved in 100 mL of deionized water and stored at 4°C as f / 2 metal. 121.14 g of tris(hydroxymethyl)aminomethane was dissolved in 900 mL of deionized water, adjusted to pH 7.6 with HCl, and then adjusted to 1 L. This was stored at 4°C as 1 M Tris-HCl (pH 7.6). 37.5 mg of NaNO3, 26.745 mg of NH4Cl, 3 mg of NaH2PO4·2H2O, and Vitamin B 12 0.25 μg of biotin, 0.25 μg of biotin, 50 μg of thiamine HCl, 0.5 mL of f / 2 metal, and 1 mL of 1 M Tris-HCl (pH 7.6) were dissolved in 98.5 mL of artificial seawater, filtered and sterilized, and used as F2N medium. Daigo Artificial Seawater SP (FUJIFILM) was used as the artificial seawater. A phosphorus-deficient medium was used by removing NaH2PO4 from F2N medium. 30 μmol photons / m³ was used only when culturing strains introduced with codDGAT1 or codDGAT2 into No3LIP14#6B-6 in normal medium. 2 / sec, 23℃, 120 min -1 Swirling culture was performed, with three culture points for each strain. For the remaining strains, each liquid medium was used, with a concentration of 50-60 μmol photons / m². 2 / sec, 23℃, 120 min -1 Swirling culture was performed. Four cultures were performed for each cell line. The cell concentration of each cell line at the start of culture was 3 × 10⁶. 6 The cell count was expressed as cells / mL. CellDrop BF (DeNovix) was used to measure the number of cells.

[0046] For high-density aerated culture, HD medium was used as the standard liquid culture medium. 222 mg of ZnSO4·7H2O, 79 mg of CuSO4·5H2O, 15 mg of MoO3, 2.86 g of H3BO3, and 1.81 g of MnCl2·4H2O were dissolved in 1 L of ion-exchanged water and stored at 4 °C as A-5 stock. 2.5 g of KNO3, 0.25 g of Na2HPO4, 0.075 g of Fe-EDTA, and 5 mL of A-5 stock were dissolved in 500 mL of ion-exchanged water, and the solution obtained by dissolving Diago artificial seawater SP (FUJIFILM) in 500 mL of ion-exchanged water was sterilized by an autoclave and then mixed. After adding 2 mL of the vitamin mixture, it was used as HD medium. The vitamin mixture was prepared by dissolving 0.6 μg of Vitamin B 12 , 0.3 μg of Biotin, and 60 μg of Thiamine HCl in 10 mL of ion-exchanged water, and used after filter sterilization. The medium obtained by removing Na2HPO4 from the HD medium was used as the phosphorus-deficient medium, and the medium with 0.125 g of Na2HPO4 in the HD medium was used as the 1 / 2 phosphorus medium. For normal culture, 5 mL of the culture solution cultured in 50 mL of HD medium for 7 days was added, and the culture was aerated at 700 μmol photons / m 2 / sec, 25 °C, and 2% CO2 at 15 mL / min.

[0047] Cells cultured normally for 7 days were subcultured into 500 mL of the 1 / 2 phosphorus medium at a density of 1×10 8 cells / mL, and pre-cultured for 4 days under the light irradiation conditions shown in Fig. 14, the set temperature of the incubator, and 2% CO2 aerated at 450 mL / min. Then, the cells were subcultured into 500 mL of the phosphorus-deficient medium at a density of 2×10 8 cells / mL, and cultured for 10 days under the light irradiation conditions shown in Fig. 14, the set temperature of the incubator, and 2% CO2 aerated at 450 mL / min. The culture under phosphorus-deficient conditions was performed in three replicates. The cell count was measured using a flow cytometer RF-500 (Sysmex).

[0048] 2 Lipid extraction Except for the samples of high-density aeration culture, 1 mL of the culture solution cultured in the normal medium or the phosphorus-deficient medium was collected at each number of days and stored frozen at -80 °C.

[0049] Frozen cells were mixed with 1.5 mL of chloroform and 3 mL of methanol, and left at room temperature for 1 hour, with suspensions every 10 minutes. The mixture was centrifuged at 1000 × g for 5 minutes using a swing rotor, and 5.5 mL of the supernatant was collected as the first extract. 0.26 mL of 1% (w / v) KCl, 0.4 mL of chloroform, and 0.8 mL of methanol were added to the precipitate, and after suspension, the mixture was centrifuged at 1000 × g for 5 minutes using a swing rotor, and 1.46 mL of the supernatant was collected as the second extract. The first and second extracts were combined, and 2.16 mL of 1% (w / v) KCl and 1.9 mL of chloroform were added. After suspension, the mixture was centrifuged at 1000 × g for 5 minutes using a swing rotor, and the lower layer was collected as the lipid extract. The lipid extract was dried, dissolved in chloroform:methanol = 2:1, and stored at -20°C.

[0050] For samples cultured in high-density aeration, 10 mL of culture medium cultured in phosphorus-deficient medium was collected at each day, cells were harvested, and frozen and stored at -80°C.

[0051] Frozen cells were suspended in 0.8 mL of deionized water, 1 mL of chloroform and 2 mL of methanol were added, and the mixture was stirred and left at room temperature for 1 hour. 1 mL of chloroform and 1 mL of deionized water were added to the suspension and centrifuged at 1000 × g for 5 minutes using a swing rotor. The water-methanol layer (upper layer) was removed, and the chloroform layer (lower layer) was transferred to a new glass test tube. Meanwhile, 1.5 mL of chloroform was added to the original glass test tube and suspended. Both the original test tube with this suspension and the new test tube containing the chloroform layer were centrifuged at 1000 × g for 5 minutes using a swing rotor. After centrifugation, the chloroform layer from the new test tube was transferred to another test tube whose weight was measured. The chloroform layer from the original test tube was recovered and centrifuged at 1000 × g for 5 minutes using a swing rotor. The chloroform layer was recovered and combined with the previously prepared chloroform extract to obtain the lipid extract. This lipid extract was dried using a vacuum concentrator, dissolved in chloroform to a concentration of 10 mg / mL, and then stored at -20°C.

[0052] 3 Lipid analysis For samples other than those cultured in high-density aeration, lipid extracts were spotted onto thin-layer silica plates and developed for 45 minutes with a developing solution of 160 mL of hexane, 40 mL of diethyl ether, and 4 mL of acetic acid. TAGs were confirmed under UV irradiation using 0.001% (w / v) primuline. The silica containing the TAGs was scraped off, and 50 μL of 1 mM henoeicosanoic acid and 500 μL of 1.5 M hydrochloric acid / methanol were added to suspend the mixture. After standing at 85°C for 1 hour, the fatty acids were methylated. 500 μL of hexane was added, and after suspending, the mixture was centrifuged at 1000 × g for 5 minutes using a swing rotor, and the methylated fatty acids in the upper layer were collected. Another 500 μL of hexane was added to the lower layer, and after suspending, the mixture was centrifuged at 1000 × g for 5 minutes using a swing rotor, and the upper layer was collected. The collected methylated fatty acids were dried and dissolved in 100 μL of hexane to prepare the gas chromatography sample. Gas chromatography was performed using a SHIMADZU GC-2030 with an HR-SS-10 (0.25 φ x 25 m) (SHINWA CHEMICAL INDUSTRIES, LTD.) attached.

[0053] For samples cultured at high density, lipid extracts were spotted onto thin-layer silica plates and developed for 35 minutes using a developing solution of 160 mL of hexane, 40 mL of diethyl ether, and 4 mL of acetic acid. Tags were identified under UV irradiation using 0.001% (w / v) primuline. The silica containing the tags was scraped off, and 10 μL of 5 mM henoeicosanoic acid and 2.5 mL of 1.5 M hydrochloric acid / methanol were added to suspend the mixture. The mixture was then allowed to stand at 85°C for 2.5 hours to methylate the fatty acids. 2.5 mL of hexane was added, the mixture was suspended, and the upper layer of methylated fatty acids was collected. The collected methylated fatty acids were dried and dissolved in 100 μL of hexane to prepare the gas chromatography sample. Gas chromatography was performed using a SHIMADZU GC-2014 with an HR-SS-10 (0.25 φ x 25 m) (SHINWA CHEMICAL INDUSTRIES, LTD.) attached.

[0054] 4. Measurement of biomass (dry weight of cells) Ten mL of culture medium cultured in phosphorus-deficient medium was collected at each day, transferred to a 50 mL tube, and centrifuged at 4670 G for 10 minutes at 25°C. After centrifugation, the supernatant was removed, taking care not to remove the cells. H2O was added to the remaining precipitate to suspend it, and it was transferred to a weighed 1.5 mL tube. Centrifuged at 7000 G for 10 minutes at 25°C. The supernatant was removed, taking care not to remove the cells, and the tube was placed in a high-temperature drying oven. With the cap removed, it was dried at 105°C for 5 hours. The 1.5 mL tube was removed from the high-temperature drying oven, and the biomass was weighed using an electronic balance.

[0055] 5. Method for creating lipase-disrupting strains To disrupt the class 3 lipase genes No3LIP14 and No3LIP7, we used a genome editing tool called transcriptional activator-like effector (TALE) nucleases (TALENs). TALENs are artificial nucleases created by fusing a TALE domain, a DNA-binding protein with a target design capability derived from plant pathogens, with a FokI nuclease domain derived from marine bacteria. The TALE domain has 16 to 18 TALE repeats, each consisting of 34 amino acids, and each TALE repeat identifies a single DNA base. Two TALENs, L-TALEN and R-TALEN, can introduce one DNA double-strand break. In this experiment, we used the Platinum TALEN (PtTALEN) system, which had its activity further enhanced by modifying the 4th and 32nd amino acids of the TALE repeat. The TALEN target sequences of each gene were searched using a web tool called TAL Effector Nucleotide Targeter 2.0 (https: / / tale-nt.cac.cornell.edu). Two PtTALEN target sequences were designed for NoLIP14, and PtTALEN pairs corresponding to these target sequences were constructed using the Golden Gate method. The cleavage activity of each PtTALEN was examined using cultured cells, and LIP14_A (L-TALEN: TCAGTCTGCGGCATGCCC, Spacer: TTGTGTCGGGCGCGC, LR-TALEN: CAGCCGCCGTGGCTGCGA), which showed higher activity, was used to construct an all-in-one PtTALEN vector for nannochloropsis expression. This vector was introduced into nannochloropsis by electroporation, genomic DNA was extracted from the resulting colonies, the region near the target sequence was amplified by PCR, and mutations at the target site were investigated by direct sequencing. As a result, two frameshift mutant strains of No3LIP14 were obtained (6B-6 strain (13 base deletion) and 6B-10 strain (17 base deletion)). For No3LIP7, two PtTALENs were initially constructed, and after confirming their activity in cultured cells, attempts were made to introduce mutations in Nannochloropsis, but no mutations were detected.Therefore, we designed two more PtTALEN target sequences and obtained two frameshift mutant strains (strain 3-4-1 (4-base deletion) and strain 3-12-1 (2-base insertion)) using an all-in-one PtTALEN vector targeting LIP7_D (L-TALEN: TTCCAGCAGCAGCCAGTA, spacer: TCATCGTCGCTCACC, R-TALEN: ACCAAGCCCGCAGCACCA). The sequences used for mutation introduction are listed as sequence numbers 27-32 in the sequence listing.

[0056] Gene disruption of the class 3 lipase genes No3LIP6 and No3LIP10 was performed by homologous recombination. Using the genome of N.2145 as a template, the promoter region of LHC (proLHC), the terminator region of FCP (terFCP), the upstream region of No3LIP6 (LIP6LF), the downstream region of No3LIP6 (LIP6RF), the upstream region of No3LIP10 (LIP10LF), and the downstream region of No3LIP10 (LIP10RF) were amplified by PCR. For the selection of gene transfection strains, the paromomycin resistance gene (Aph8 from Streptomyces rimosus) was linked to proLHC and terFCP, creating proLHCAph8terFCP. ProLHCAph8terFCP was linked to proLHCAph8terFCP to proximity of LIP6LF and LIP6RF to create the construct deltalip6ParoR for disrupting the No3LIP6 gene, and proLHCAph8terFCP was linked to proximity of LIP10LF and LIP10RF to create the construct deltalip10ParoR for disrupting the No3LIP10 gene (Figure 1).

[0057] For PCR, a suspension consisting of 10 μL of 5 × PrimeSTAR GXL Buffer, 4 μL of dNTP Mixture (2.5 mM each), 1 μL of 10 μM primerF, 1 μL of 10 μM primerR, 1 μL of genome solution, 1 μL of PrimeSTAR GXL DNA Polymerase, and 32 μL of sterile deionized water was used.

[0058] PCR was performed using the following reaction cycle. Step 1: 94℃ for 2 minutes Step 2: Repeat 30 cycles of 98°C for 10 seconds, 60°C for 15 seconds, and 68°C for 1 minute / kb. The following primers were used. LIP6LF_F CTGGTAGATGGGCAGGTGTGAG LIP6LF_R AAGTTAACACAACGAAGCGCCG LIP6RF_F GCCTGACTTGCCCCATCCTAC LIP6RF_R GGAACAGGAGCTTCATATTC LIP10LF_F GGTGAGATAATGGGGCAAATGC LIP10LF_R GGTCTTGGCGCCTCCGTTTGCG LIP10RF_F TGGAGCCCGGACGTTTAGAGAC LIP10RF_R CACCTCTTCATCTCAGGTTGACC proLHC_F GGTGGAGTGAGATAGCAGGAGCAT proLHC_R GCTTGGGAAAGAAGGAGGGAGTTG terFCP_F GCCGCAGCCTCTTGGGTGAAGTGT terFCP_R AATACAACCGAAAAGAATAAGGAG The sequences used for introducing the mutation are listed as sequence numbers 33-44 in the sequence listing.

[0059] 6. Method for constructing DGAT overexpression Using the genome of N.2145 as a template, the promoter region of LDSP (proLDSP), the terminator region of LDSP (terLDSP), the promoter region of LHC (proLHC), and the terminator region of FCP (terFCP) were amplified by PCR. The codDGAT1 or codDGAT2 gene was ligated between proLDSP and terLDSP to form proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP. For selection of gene transfection lines, the hygromycin resistance gene (Aph7 from Streptomyces hygroscopicus) was ligated between proLHC and terFCP to form proLHCAph7terFCP. By connecting proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP to the upstream region of proLHCAph7terFCP, we created constructs codDGAT1HygR and codDGAT2HygR for strengthening the TAG production system (Figure 10). For PCR, a suspension consisting of 10 μL of 5 × PrimeSTAR GXL Buffer, 4 μL of dNTP Mixture (2.5 mM each), 1 μL of 10 μM primerF, 1 μL of 10 μM primerR, 1 μL of genome solution, 1 μL of PrimeSTAR GXL DNA Polymerase, and 32 μL of sterile deionized water was used.

[0060] PCR was performed using the following reaction cycle. Step 1: 94℃ for 2 minutes Step 2: Repeat 30 cycles of 98°C for 10 seconds, 60°C for 15 seconds, and 68°C for 1 minute / kb. The following primers were used. proLDSP_F GTCTCTAAGATGGAGTGGATGGAG proLDSP_R TGTTGATGCGGGCTGAGATTGGTG terLDSP_F GAAAGATCCAAGAGAGACGAGTAG terLDSP_R TAAGCTCACCGGCTTTTCTTACAC proLHC_F GGTGGAGTGAGATAGCAGGAGCAT proLHC_R GCTTGGGAAAGAAGGAGGGAGTTG terFCP_F GCCGCAGCCTCTTGGGTGAAGTGT terFCP_R AATACAACCGAAAAGAATAAGGAG The sequences of the primers used in PCR are listed in sequence numbers 45-52 of the sequence listing.

[0061] 7. Gene transfer method using electroporation Gene transfer into Nannochloropsis was performed using electroporation. ELEPO21 (NEPAGENE Inc.) was used for electroporation.

[0062] Nannochloropsis in F2N liquid medium at 30 μmol photons / m² 2 / sec, 23℃, 120 min -1 The cells were cultured in a rotating manner for 7-10 days until the cell concentration reached 2-3 × 10⁶. 6 The cells were subcultured in 400 mL of F2N liquid medium to achieve a cell / mL ratio and then cultured further. The number of cells in the logarithmic growth phase cultured for 2-4 days was measured, and the count was 1 × 10⁶. 7 The cell-to-mL ratio was confirmed to be approximately 1 / mL. The culture medium was centrifuged at 4°C at 5500×g for 10 minutes, and the cells were precipitated and collected. 375 mM sorbitol (chilled on ice) was added to the precipitate, and the cells were washed and desalted by centrifuging again at 4°C at 5500×g for 10 minutes. After washing the cells with sorbitol solution four times, the cells were suspended in sorbitol solution and 1 × 10⁶ cells were collected. 10 The cell concentration was adjusted to cells / mL. 20 μL of cell suspension, 1 μL of DNA to be introduced (1-0.1 μg / μL), and 49 μL of 375 mM sorbitol were added to make a total volume of 70 μL. The mixture was then transferred to a 0.1 mm wide cuvette. After standing for 10 minutes, it was cooled on ice for 5 minutes. After wiping off the moisture from the ice-cooled cuvette and removing any air bubbles, it was placed in the chamber and the resistance was measured by pressing the Ω button. The electroporation conditions were set as follows. Poring pulse: Voltage 2000V, pulse width 5ms, pulse interval 50ms, number of pulses 1, polarity + Transfer pulse: Voltage 150V, pulse width 50ms, pulse interval 50ms, number of pulses 5, polarity + / -

[0063] Immediately after electroporation, the cell saturation was removed from the cuvette using a dropper and transferred to a 15 mL Corning tube containing 5 mL of F2N medium, where it was suspended. The cap of the Falcon tube was loosened and secured with surgical tape, and the sides were wrapped in two layers of paper towels to create a low-light environment (~5 μmol photons / m²). 2 The culture medium was set to 0.4% agar ( / sec) and shaken for 48 hours for recovery incubation. The top agar was autoclaved and cooled to about 60°C. 5 mL was taken and transferred to 50 mL of Corning medium, cooled, and then added to the culture medium. After mixing, the entire volume was immediately spread onto an F2N plate containing the antibiotic for selection, and the agar was allowed to solidify. For the top agar, an F2N liquid medium containing 0.4% agar was used. Once the agar had solidified, the culture medium was set to 00 μmol photons / m². 2 The cells were incubated statically at 23°C for 3-6 weeks at 1 / sec, and then drug selection was performed. Colonies that emerged from the drug-containing plates were transferred to new plates using a sterile toothpick and used as transformed strains.

[0064] Experimental results 1. Comparison of growth and TAG in No3LIP7 gene disruption. Nannochloropsis is known to store carbon sources as TAGs in intracellular oil droplets even under normal culture conditions. It is also known that TAG accumulation increases further under phosphorus-deficient conditions. Therefore, the growth and TAG accumulation of No3LIP7 gene knockout strains 3-4-1 and 3-12-1 were compared with wild-type strains under normal culture conditions and phosphorus-deficient conditions. F2N medium was used as the normal culture medium, and a phosphorus-deficient medium was prepared by removing Na2HPO4 from F2N medium. The culture medium was rotated in Erlenmeyer flasks, and the initial cell concentration was 3 × 10⁶. 6 The concentration was set to cells / mL.

[0065] As shown in Figure 2 (left), the growth of the gene knockout strain in normal medium was slightly worse than that of the wild-type strain, but as shown in Figure 2 (right), no significant difference in growth was observed in phosphorus-deficient medium. As shown in Figure 3 (left), we found that the amount of TAG accumulated per unit of culture medium in the gene knockout strain increased compared to the wild-type strain even at day 11, which is the later stage of culture. We also found that the amount of TAG accumulated per cell increased compared to the wild-type strain even at the later stage of culture. In phosphorus-deficient medium, where TAG accumulation increases, as shown in Figure 3 (right), the amount of TAG accumulated per unit of culture medium in the gene knockout strain increased compared to the wild-type strain at day 7 of culture, but when viewed per cell, there was no significant increase in the amount of TAG accumulated in the gene knockout strain compared to the wild-type strain. Since the amount of unsaturated fatty acids in TAG affects the shelf life of TAG and the quality of hydrogenated fuel, we compared the fatty acid composition contained in the TAG of the gene knockout strain with that of the wild-type strain. In normal medium, as shown in Figure 4 (left), we found that the proportion of C16:1 decreased and the proportion of C16:0 increased compared to the wild-type strain at day 7 of culture. In phosphorus-deficient medium, we found that the proportion of C18:1 decreased compared to the wild-type strain on days 4, 7, and 12 of culture, as shown in Figure 4 (right).

[0066] 2. Comparison of growth and TAG in No3LIP14 gene disruption. Similar to the No3LIP7 gene knockout strain, the growth and TAG accumulation of the No3LIP14 gene knockout strains 6B-6 and 6B-10 were compared with the wild-type strain under normal culture conditions and phosphorus-deficient conditions. As shown in Figure 5 (left), growth was poorer in the normal medium compared to the wild-type strain in the later stages of culture, but as shown in Figure 5 (right), no significant difference in growth was observed in the phosphorus-deficient medium. As shown in Figure 6 (left), the amount of TAG accumulated per unit of culture medium in the gene knockout strains increased compared to the wild-type strain on days 4 and 7 of culture, and per cell, the amount of TAG accumulated in the gene knockout strains increased compared to the wild-type strain in the later stages of culture, on days 7 and 11. In the phosphorus-deficient medium, where TAG accumulation increases, as shown in Figure 6 (right), the amount of TAG accumulated per unit of culture medium in the gene knockout strains increased compared to the wild-type strain on day 7 of culture, and per cell, the amount of TAG accumulated in the gene knockout strains increased compared to the wild-type strain in the later stages of culture, on days 7 and 11. When comparing the fatty acid composition of the TAG of gene knockout strains with that of wild-type strains, we found that in normal medium, the proportion of C16:1 decreased and the proportion of C16:0 increased, as shown in Figure 7 left. In phosphorus-deficient medium, we found that the proportions of C18:0 and C18:1 decreased and the proportion of C16:0 increased, as shown in Figure 7 right.

[0067] Comparison of growth and TAG in No3LIP6 gene disruption Similar to the No3LIP7 and No3LIP14 gene knockout strains, the growth and TAG accumulation of the No3LIP6 gene knockout strains 1F6 and 6A4 were compared to the wild-type strain under phosphorus-deficient conditions. As shown in Figure 8 (left), no significant difference in growth was observed in phosphorus-deficient medium. As shown in Figure 8 (upper right), the amount of TAG accumulated per unit of culture medium in the gene knockout strains increased compared to the wild-type strain at the 14th day of culture, which is the later stage of culture. As shown in Figure 8 (lower right), the amount of TAG accumulated per cell in the gene knockout strains also increased compared to the wild-type strain at the 14th day.

[0068] Comparison of growth and TAG in No3LIP10 gene disruption Similar to the No3LIP7 and No3LIP14 gene knockout strains, the growth and TAG accumulation of the No3LIP10 gene knockout strains 4E3 and 8F3 were compared to the wild-type strain under phosphorus-deficient conditions. As shown in Figure 9 (left), no significant difference in growth was observed in phosphorus-deficient medium. As shown in Figure 9 (upper right), the amount of TAG accumulated per unit of culture medium in the gene knockout strain 4E3 increased compared to the wild-type strain at the later stage of culture, day 14. As shown in Figure 9 (lower right), there was no significant difference in TAG accumulation per cell between the gene knockout strains and the wild-type strain.

[0069] 3. Creation of DGAT expression-enhanced strains to further enhance TAG accumulation. We successfully increased TAG accumulation by disrupting the No3LIP7, No3LIP14, No3LIP6, and No3LIP10 genes. The No3LIP14 gene knockout strain and the No3LIP6 gene knockout strain showed a more significant increase in TAG accumulation in the later stages of phosphorus-deficient culture than the No3LIP7 gene knockout strain and the No3LIP10 gene knockout strain. Furthermore, unlike the No3LIP6, No3LIP7, and No3LIP10 gene knockout strains, the No3LIP14 gene knockout strain showed a decrease in the proportion of C16:1 and an increase in the proportion of C16:0 in TAG under normal culture conditions, and a decrease in the proportion of C18:0 and C18:1 under phosphorus-deficient culture conditions. This suggests a decrease in the proportion of unsaturated fatty acids in TAG, which is expected to lead to a longer storage period for TAG and improved quality of hydrogenated fuel. Therefore, in order to further enhance TAG accumulation, we introduced genes to enhance TAG synthesis using No3LIP14#6B-6, a parent strain in which increased TAG accumulation was particularly pronounced during the later stages of phosphorus-deficient culture. Diacylglycerol acyltransferase (DGAT) is an enzyme that catalyzes the final step of TAG biosynthesis. DGAT is an enzyme widely present in animals and plants, and two types, DGAT1 and DGAT2, have been reported. The inventors have previously identified a promoter pSQD2a that induces strong expression under phosphorus-deficient conditions, linked it to the DGTT4 gene, one of the DGAT2 genes in Chlamydomonas, and introduced the gene into Chlamydomonas, thereby developing a method to promote TAG accumulation in Chlamydomonas algae under phosphorus-deficient conditions (Japanese Patent Publication No. 2014-68638). Furthermore, a method was developed to promote TAG accumulation in Nannochloropsis algae under phosphorus-deficient conditions by introducing a ligated pSQD2a gene to the DGTT4 gene into Nannochloropsis (International Publication No. 2015 / 137449). In this case, the inventors focused on DGAT1 and DGAT2, genes from fish that feed on algae, as the genes to be introduced, and obtained two types of genes, codDGAT1 and codDGAT2, through artificial synthesis.Using the genome of N.2145 as a template, the promoter region of LDSP (proLDSP), the terminator region of LDSP (terLDSP), the promoter region of LHC (proLHC), and the terminator region of FCP (terFCP) were amplified by PCR. The codDGAT1 or codDGAT2 gene was ligated between proLDSP and terLDSP to form proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP. For selection of gene transfection lines, the hygromycin resistance gene (Aph7 from Streptomyces hygroscopicus) was ligated between proLHC and terFCP to form proLHCAph7terFCP. The constructs codDGAT1HygR and codDGAT2HygR were created by connecting proLDSPcodDGAT1terLDSP or proLDSPcodDGAT2terLDSP to the upstream region of proLHCAph7terFCP, respectively, to enhance the TAG production system (Figure 10). The constructs in Figure 10 were introduced into No3LIP14#6B-6 by electroporation, and 88 strains were obtained for each strain after selection with hygromycin. In codDGAT1 / LIP14 into which codDGAT1HygR was introduced, genomes were recovered from 22 of the 88 strains, and gene transfer was confirmed in 16 strains by PCR. The strains in which gene transfer was confirmed were cultured statically in a small amount of phosphorus-deficient medium (2 mL), and it was found that 9 of the 16 gene-transformed strains had increased TAG accumulation per cell compared to the parental LIP14TALEN. In codDGAT2 / LIP14 cells into which codDGAT2HygR was introduced, genomes were recovered from 26 out of 88 cells, and gene transfer was confirmed in 20 cells by PCR. The cells in which gene transfer was confirmed were cultured statically in small quantities of 2 mL of phosphorus-deficient medium, and it was found that 16 of the 20 gene-transformed cells had increased TAG accumulation per cell compared to the parental LIP14TALEN. Two cells each with particularly high TAG accumulation and no problems with growth were designated as codDGAT-enhanced expression strains codDGAT1 / LIP14#B7-3, codDGAT1 / LIP14#B8-4, codDGAT2 / LIP14#B1-4, and codDGAT2 / LIP14#B5-4.

[0070] 4. Comparison of growth and TAG of codDGAT1 / LIP14 and codDGAT2 / LIP14 The growth and TAG accumulation of codDGAT1 / LIP14#B7-3, codDGAT1 / LIP14#B8-4, codDGAT2 / LIP14#B1-4, and codDGAT2 / LIP14#B5-4 were compared with wild-type strains under normal culture conditions and phosphorus-deficient conditions. As shown in Figure 11 (left), codDGAT1-introduced and codDGAT2-introduced strains grew worse than wild-type strains in normal medium, and as shown in Figure 11 (right), codDGAT2 / No3LIP14TALEN#B1-4 grew worse than the other strains in phosphorus-deficient medium. As shown in Figure 12 (left), the TAG accumulation per unit of culture medium for codDGAT-introduced strains increased in the later stages of culture in normal medium, and it was found that the TAG accumulation of codDGAT2 / No3LIP14TALEN#B1-4 was three times that of wild-type strains. We found that, even when viewed per cell, the amount of TAG accumulation in codDGAT-introduced strains was higher in the later stages of culture, with codDGAT2 / No3LIP14TALEN#B1-4 accumulating more than five times the amount of TAG in the wild-type strain. In phosphorus-deficient medium, where TAG accumulation is likely to occur, on day 7, codDGAT1 / No3LIP14TALEN#B7-3 and codDGAT2 / No3LIP14TALEN#B1-4 showed increased TAG accumulation per culture medium compared to the wild-type strain, and per cell, from day 5 onwards, codDGAT2 / No3LIP14TALEN#B1-4 showed increased TAG accumulation compared to the wild-type strain. Comparing the fatty acid composition of TAG in codDGAT-introduced strains in phosphorus-deficient medium, where TAG accumulation is high, with that of the wild-type strain, we found that, as shown in Figure 13, the proportion of C18:1 decreased and the proportion of C16:0 increased throughout the entire period from day 3 to day 9.

[0071] 5. Comparison of growth and TAG in high-density aeration culture systems. For practical application, biomass and TAG accumulation under high-light and high-density conditions are also important for outdoor culture. Therefore, the inventors compared biomass and TAG accumulation under high-density aeration conditions in phosphorus-deficient medium. HD medium was used as the medium for normal liquid culture for high-density aeration. 2% CO2 was aerated at 450 mL / min, and the cell concentration at the start of culture in phosphorus-deficient medium was 2 × 10⁶. 8 The culture was performed using cells / mL. Since this differed from previous culture conditions, the light intensity and temperature were precisely controlled as shown in Figure 14.

[0072] As shown in Figure 15, the biomass amount in codDGAT2-introduced strains was significantly higher per culture medium and per cell compared to the wild-type and parental strain (No3LIP14#6B-6) at 6, 7, and 10 days of culture under phosphorus-deficient conditions. In the codDGAT1 / LIP14#B8-4 strains, the biomass amount per cell was higher than that of the wild-type strain at 6 and 7 days of culture under phosphorus-deficient conditions. As shown in Figures 16A and 16B, the codDGAT2 / LIP14#B1-4 strains had a higher TAG accumulation per culture medium compared to the wild-type strain at 10 days of culture under phosphorus-deficient conditions. From these results, we discovered that even under high-density aeration culture conditions, the combination of LIP14 gene disruption and codDGAT1 or codDGAT2 gene expression improves biomass amount and TAG accumulation. Furthermore, comparing the fatty acid composition of the TAG in the codDGAT-introduced strain with that of the wild-type strain, we found that even under high-density aeration culture conditions, the proportion of C18:1 decreased and the proportion of C16:0 increased on days 7 and 10, which are the later stages of culture, as shown in Figure 17.

[0073] 6. Summary By disrupting the newly discovered TAG degradation genes No3LIP7, No3LIP14, No3LIP6, and No3LIP10, we successfully increased TAG accumulation in the later stages of culture under both normal and phosphorus-deficient conditions. Further increases in TAG accumulation were achieved by introducing the TAG synthesis gene codDGAT1 or codDGAT2 into the TAG degradation gene knockout strain No3LIP14#6B-6. In particular, codDGAT2 / No3LIP14#B1-4 successfully accumulated more than five times the amount of TAG compared to the wild-type strain in the later stages of normal culture and 1.5 times the amount in the later stages of phosphorus-deficient culture. We also discovered that biomass and TAG accumulation improved even under high-density, continuous culture conditions close to those used industrially. Furthermore, we discovered that in strains of No3LIP14#6B-6 into which codDGAT was introduced under phosphorus-deficient conditions, the proportion of C16:1 in TAG decreased by 1-3%, the proportion of C18:1 decreased by 3-5%, and the proportion of C16:0 increased by 3-5% compared to the wild-type strain. We also found that the proportion of C18:1 decreased by 3-5% and the proportion of C16:0 increased by 3-5% under high-density continuous culture conditions. Since the unsaturated bonds contained in TAG are reduced, it is expected that the storage period of TAG will be extended and the quality of hydrogenated fuel will be improved. In addition, it is expected that the proportion of diesel oil produced from TAG will increase as C16, which is more suitable as a diesel oil material than C18, increases. This invention, which combines novel lipase gene disruption and strong expression of the DGAT gene, is an extremely useful method for reducing production costs of biofuel production and useful lipid production in algae, especially Nannochloropsis, which have a larger biomass than plants. [Industrial applicability]

[0074] This invention can be used in industrial fields related to fuels and the like.

Claims

1. Algae characterized by the following (1) and (2), (1) Decreased expression of class 3 lipase genes, (2) The patient has been introduced with an exogenous diacylglycerol acyltransferase gene, or the expression of the endogenous diacylglycerol acyltransferase gene has been enhanced.

2. The algae according to claim 1, characterized in that the algae belong to the genus Nannochloropsis.

3. The algae according to claim 1, characterized in that the class 3 lipase gene is a gene that encodes one of the following proteins (a), (b), or (c). (a) A protein consisting of an amino acid sequence represented by SEQ ID NOs: 2, 4, 6, or 8, (b) A protein having lipase activity, consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NOs: 2, 4, 6, or 8, (c) A protein having lipase activity and consisting of an amino acid sequence having 40% or more homology to the amino acid sequence represented by Sequence ID No. 2, 4, 6, or 8.

4. The algae according to claim 1, characterized in that the foreign diacylglycerol acyltransferase gene is a gene encoding the following protein (a), (b), or (c), (a) A protein consisting of an amino acid sequence represented by Sequence ID No. 10 or 12, (b) A protein having diacylglycerol acyltransferase activity, consisting of an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NO: 10 or 12. (c) A protein having an amino acid sequence having 40% or more homology to the amino acid sequence represented by Sequence ID No. 10 or 12, and having diacylglycerol acyltransferase activity.

5. The algae according to claim 1, characterized in that the endogenous diacylglycerol acyltransferase gene is a gene that encodes one of the following proteins: (a), (b), or (c). (a) A protein consisting of the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24 (b) A protein having diacylglycerol acyltransferase activity, comprising an amino acid sequence in which 1 to 50 amino acid residues are substituted, added, or deleted in the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24, (c) A protein having an amino acid sequence having 60% or more homology to the amino acid sequence represented by SEQ ID NOs: 14, 16, 18, 20, 22, or 24, and possessing diacylglycerol acyltransferase activity.

6. The algae according to claim 1, characterized in that, when cultured under phosphorus-deficient conditions, the proportion of oleic acid in triacylglycerol decreases and the proportion of palmitic acid increases compared to the wild strain.

7. A method for producing triacylglycerol, characterized by culturing algae according to any one of claims 1 to 6, causing the algae to produce triacylglycerol, and collecting the produced triacylglycerol.

8. A method for producing triacylglycerol according to claim 7, characterized by culturing algae under phosphorus-deficient conditions.

Images