RNA for complement inhibition

SiRNA molecules targeting complement C3 expression provide a therapeutic approach to inhibit excessive complement activation, reducing C3 levels by up to 90% and treating disorders like paroxysmal nocturnal hemoglobinuria and multiple sclerosis.

JP2026136251APending Publication Date: 2026-08-25APELLIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026086727
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-08-06
Filing Date
2026-05-22
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Inappropriate or excessive activation of the complement system contributes to various serious diseases and conditions, and existing therapeutic agents for complement inhibition are inadequate.

Method used

Development of siRNA molecules comprising specific antisense and sense strands, with optional overhangs and modified nucleotides, designed to target and inhibit complement C3 expression, potentially combined with ligands and administered via intravenous or subcutaneous routes, along with other agents like anti-C3 antibodies.

Benefits of technology

Significant reduction in C3 transcript and protein levels, achieving up to 90% inhibition in complement activity, effectively treating complement-mediated disorders such as paroxysmal nocturnal hemoglobinuria and multiple sclerosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026136251000001_ABST
    Figure 2026136251000001_ABST
Patent Text Reader

Abstract

Provision of RNA for complement inhibition. [Solution] RNA such as miRNA and siRNA, and their use in the treatment of complement-mediated disorders are described. In one embodiment, the disclosure features siRNA comprising an antisense strand and a sense strand, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of a particular set of sequences. In some embodiments, the antisense strand is complementary to a nucleotide sequence that differs from any one of a particular set of sequences by 1, 2, 3, or 4 or fewer nucleotides.
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 62 / 977,012 filed on 14 February 2020, U.S. Provisional Patent Application No. 62 / 980,100 filed on 21 February 2020, and U.S. Provisional Patent Application No. 63 / 062,321 filed on 6 August 2020, the contents of which are incorporated herein by reference in their entirety.

[0002] The complement system is a system of over 30 plasma and cell-bound proteins that plays a crucial role in both innate and adaptive immunity. Complement proteins act in a series of enzymatic cascades through various protein interactions and cleavage events. Complement activation occurs via three major pathways: the antibody-dependent classical pathway, the secondary pathway, and the mannose-binding lectin (MBL) pathway. Inappropriate or excessive complement activation is an underlying cause or contributing factor to many serious diseases and conditions, and considerable effort has been made over the past few decades to explore various complement inhibitors as therapeutic agents. [Overview of the project] [Means for solving the problem]

[0003] In one embodiment, the present disclosure features an siRNA comprising an antisense strand and a sense strand, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs. 76-100.

[0004] In some embodiments, the antisense strand is complementary to a nucleotide sequence containing one, two, three, or four or fewer nucleotides different from any one of SEQ ID NOs. In some embodiments, the antisense strand is complementary to a nucleotide sequence containing any one of SEQ ID NOs. In some embodiments, the antisense strand contains a nucleotide sequence containing any one of SEQ ID NOs. 101 to 125.

[0005] In some embodiments, one or both of the sense strand and the antisense strand include at least one overhang region. In some embodiments, at least one overhang includes a 1, 2, 3, 4, or 5 nucleotide overhang. In some embodiments, at least one overhang includes a 3' overhang. In some embodiments, the overhang region is complementary to the fragment of SEQ ID NO: 75. In some embodiments, the 3' overhang of the siRNA includes a 2-nucleotide overhang.

[0006] In some embodiments, the siRNA comprises a sense strand and an antisense strand containing at least one additional nucleotide at its 5' end, 3' end, or both its 5' and 3' ends that is not complementary to the SEQ ID NO: 75 fragment.

[0007] In some embodiments, one or both of the sense and antisense strands of the siRNA include at least one modified nucleotide. In some embodiments, the at least one modified nucleotide includes a nucleotide containing a 2'-O-methyl group, a nucleotide containing a 2'-fluoro group, and / or a phosphorothioate bond with an adjacent nucleotide.

[0008] In some embodiments, the sense strand of the siRNA contains one of the nucleotide sequences of sequence numbers 76-100, 126-150, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 255, 259, 264, 268, 272, 276, 325, 326, and 327. In some embodiments, the antisense strand of the siRNA contains one nucleotide sequence from sequence numbers 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0009] In some embodiments, the siRNA is the following sequence numbers 201 / 202, 203 / 204, 205 / 206, 207 / 208, 209 / 210, 211 / 212, 213 / 214, 215 / 216, 217 / 218, 219 / 220, 221 / 222, 223 / 224, 225 / 226, 227 / 228, 229 / 230, 231 / 232, 233 / 234, 235 / 236, 237 / 238, 239 / 240, 241 / 242, 243 / 244, 245 / 246, 247 / 248, 249 / 250, 251 / 252, 253 / 254, 201 / 256, 255 / 256, 255 / 257, 201 / 258, 255 / 258, 2 Contains one sense chain nucleotide sequence / antisense chain nucleotide sequence from any of the sense / antisense sets of 07 / 260, 259 / 260, 259 / 261, 207 / 262, 259 / 262, 217 / 263, 264 / 263, 264 / 265, 217 / 266, 264 / 266, 219 / 267, 268 / 267, 268 / 269, 219 / 270, 268 / 270, 231 / 271, 272 / 271, 272 / 273, 231 / 274, 272 / 274, 243 / 275, 276 / 275, 276 / 277, 243 / 278, 276 / 278, 325 / 275, 326 / 260, and 327 / 258.

[0010] In some embodiments, the siRNA includes at least one ligand bound to one or all of the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and the 3' end of the antisense strand. In some embodiments, the ligand includes at least one GalNAc moiety. In some embodiments, the ligand includes three GalNAc moieties.

[0011] In another embodiment, the disclosure features a method for treating a subject having or at risk of having a complement-mediated disorder, the method comprising administering to the subject a composition comprising an effective amount of siRNA. In some embodiments, the method comprises administering to the subject a composition comprising a nucleic acid encoding siRNA. In some embodiments, the subject is human.

[0012] In some embodiments, after administration of the composition, C3 transcript levels or C3 protein levels in a biological sample of the subject or derived from the subject (e.g., a blood sample, serum sample, or plasma sample, and / or a sample containing hepatocytes) decrease compared to levels before administration of the composition. In some embodiments, the C3 transcript levels or C3 protein levels decrease by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to levels before administration.

[0013] In some embodiments, the composition is administered intravenously or subcutaneously to the subject. In some embodiments, the composition is administered to the hepatocytes of the subject. In some embodiments, the composition is administered to hepatocytes ex vivo. In some embodiments, the composition is administered to hepatocytes in vivo.

[0014] In some embodiments, the method includes administering a second agent to a subject. In some embodiments, the second agent is an anti-C3 antibody or a compstatin analog.

[0015] In some embodiments, the subject has a deficiency in complement regulation, optionally including abnormal low expression of one or more complement regulatory proteins by at least a subset of the cells of the subject. In some embodiments, the complement-mediated disorder is a chronic disorder. In some embodiments, the complement-mediated disorder includes complement-mediated damage to red blood cells, optionally in this case the disorder is paroxysmal nocturnal hemoglobinuria or atypical hemolytic uremic syndrome. In some embodiments, the complement-mediated disorder is an autoimmune disease, optionally in this case the disorder is multiple sclerosis. In some embodiments, the complement-mediated disorder involves the kidney, optionally in this case the disorder is membranoproliferative glomerulonephritis, lupus nephritis, IgA nephropathy (IgAN), primary membranous nephropathy (primary MN), C3 glomerulopathy (C3G), or acute kidney injury. In some embodiments, complement-mediated disorders involve the central nervous system, the peripheral nervous system, or the neuromuscular junction, and optionally, in this case, the disorder is neuromyelitis optica, Guillain-Barré syndrome, multifocal motor neuropathy, or myasthenia gravis.

[0016] In some embodiments, the composition comprises a carrier and / or an excipient.

[0017] In another embodiment, the present disclosure features an expression vector comprising one or more nucleotide sequences encoding one or more of the siRNAs described herein. In some embodiments, the expression vector comprises a nucleotide sequence encoding a C3 inhibitor (e.g., an aptamer, an anti-C3 antibody, an anti-C3b antibody, a mammalian complement regulatory protein, or a mini-H factor).

[0018] In another embodiment, the present disclosure features an antisense nucleic acid comprising any one nucleotide sequence of SEQ ID NOs: 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0019] In another embodiment, the disclosure features a method for reducing or inhibiting intracellular complement C3 expression. In some embodiments, the method comprises contacting a cell with an siRNA comprising an antisense strand and a sense strand, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand is complementary to a nucleotide sequence that differs from any one of SEQ ID NOs. 76-100 by 1, 2, 3, or 4 or fewer nucleotides. In some embodiments, the antisense strand is complementary to a nucleotide sequence comprising any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand comprises a nucleotide sequence comprising any one of SEQ ID NOs. 101-125. In some embodiments, one or both of the sense strand and the antisense strand include at least one overhang region. In some embodiments, the at least one overhang includes an overhang of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the at least one overhang includes a 3' overhang. In some embodiments, the overhang region is complementary to the SEQ ID NO: 75 fragment. In some embodiments, the 3' overhang of the siRNA includes a 2-nucleotide overhang. In some embodiments, the siRNA includes a sense strand and an antisense strand containing at least one additional nucleotide at its 5' end, 3' end, or both its 5' and 3' ends that is not complementary to the SEQ ID NO: 75 fragment. In some embodiments, one or both of the sense and antisense strands of the siRNA includes at least one modified nucleotide. In some embodiments, the at least one modified nucleotide includes a nucleotide containing a 2'-O-methyl group, a nucleotide containing a 2'-fluoro group, and / or a phosphorothioate bond with an adjacent nucleotide.In some embodiments, the sense strand of the siRNA contains one of the nucleotide sequences of sequence numbers 76-100, 126-150, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 255, 259, 264, 268, 272, 276, 325, 326, and 327. In some embodiments, the antisense strand of the siRNA contains one nucleotide sequence from sequence numbers 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.In some embodiments, the siRNA is the following sequence numbers 201 / 202, 203 / 204, 205 / 206, 207 / 208, 209 / 210, 211 / 212, 213 / 214, 215 / 216, 217 / 218, 219 / 220, 221 / 222, 223 / 224, 225 / 226, 227 / 228, 229 / 230, 231 / 232, 233 / 234, 235 / 236, 237 / 238, 239 / 240, 241 / 242, 243 / 244, 245 / 246, 247 / 248, 249 / 250, 251 / 252, 253 / 254, 201 / 256, 255 / 256, 255 / 257, 201 / 258, 255 / 258, 2 Contains one sense chain nucleotide sequence / antisense chain nucleotide sequence from any of the sense / antisense sets of 07 / 260, 259 / 260, 259 / 261, 207 / 262, 259 / 262, 217 / 263, 264 / 263, 264 / 265, 217 / 266, 264 / 266, 219 / 267, 268 / 267, 268 / 269, 219 / 270, 268 / 270, 231 / 271, 272 / 271, 272 / 273, 231 / 274, 272 / 274, 243 / 275, 276 / 275, 276 / 277, 243 / 278, 276 / 278, 325 / 275, 326 / 260, and 327 / 258. In some embodiments, the siRNA includes at least one ligand bound to one or all of the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and the 3' end of the antisense strand. In some embodiments, the ligand includes at least one GalNAc moiety. In some embodiments, the ligand includes three GalNAc moieties.

[0020] In some embodiments, the method involves contacting cells with an antisense nucleic acid containing any one nucleotide sequence of SEQ ID NOs: 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0021] In some embodiments, the method includes contacting cells with a composition or expression vector described herein.

[0022] In some embodiments, after the contact step, the C3 transcript level or C3 protein level is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the level before the contact step. In some embodiments, the method includes maintaining the cells for a sufficient time to obtain degradation of the complement C3 gene mRNA transcript, thereby inhibiting the expression of the complement C3 gene in the cells.

[0023] In some embodiments, the cells are present in the subject. In some embodiments, the subject is human. In some embodiments, the subject suffers from complement-mediated disorder.

[0024] In another embodiment, the disclosure features a method for reducing or inhibiting C3 expression in a subject, the method comprising contacting a cell of the subject with an siRNA comprising an antisense strand and a sense strand, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand is complementary to a nucleotide sequence that differs from any one of SEQ ID NOs. 76-100 by 1, 2, 3, or 4 or fewer nucleotides. In some embodiments, the antisense strand is complementary to a nucleotide sequence that includes any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand includes a nucleotide sequence that includes any one of SEQ ID NOs. 101-125. In some embodiments, one or both of the sense strand and the antisense strand include at least one overhang region. In some embodiments, the at least one overhang includes an overhang of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the at least one overhang includes a 3' overhang. In some embodiments, the overhang region is complementary to the SEQ ID NO: 75 fragment. In some embodiments, the 3' overhang of the siRNA includes a 2-nucleotide overhang. In some embodiments, the siRNA includes a sense strand and an antisense strand containing at least one additional nucleotide at its 5' end, 3' end, or both its 5' and 3' ends that is not complementary to the SEQ ID NO: 75 fragment. In some embodiments, one or both of the sense and antisense strands of the siRNA includes at least one modified nucleotide. In some embodiments, the at least one modified nucleotide includes a nucleotide containing a 2'-O-methyl group, a nucleotide containing a 2'-fluoro group, and / or a phosphorothioate bond with an adjacent nucleotide.In some embodiments, the sense strand of the siRNA contains one of the nucleotide sequences of sequence numbers 76-100, 126-150, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 255, 259, 264, 268, 272, 276, 325, 326, and 327. In some embodiments, the antisense strand of the siRNA contains one nucleotide sequence from sequence numbers 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.In some embodiments, the siRNA is the following sequence numbers 201 / 202, 203 / 204, 205 / 206, 207 / 208, 209 / 210, 211 / 212, 213 / 214, 215 / 216, 217 / 218, 219 / 220, 221 / 222, 223 / 224, 225 / 226, 227 / 228, 229 / 230, 231 / 232, 233 / 234, 235 / 236, 237 / 238, 239 / 240, 241 / 242, 243 / 244, 245 / 246, 247 / 248, 249 / 250, 251 / 252, 253 / 254, 201 / 256, 255 / 256, 255 / 257, 201 / 258, 255 / 258, 2 Contains one sense chain nucleotide sequence / antisense chain nucleotide sequence from any of the sense / antisense sets of 07 / 260, 259 / 260, 259 / 261, 207 / 262, 259 / 262, 217 / 263, 264 / 263, 264 / 265, 217 / 266, 264 / 266, 219 / 267, 268 / 267, 268 / 269, 219 / 270, 268 / 270, 231 / 271, 272 / 271, 272 / 273, 231 / 274, 272 / 274, 243 / 275, 276 / 275, 276 / 277, 243 / 278, 276 / 278, 325 / 275, 326 / 260, and 327 / 258. In some embodiments, the siRNA includes at least one ligand bound to one or all of the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and the 3' end of the antisense strand. In some embodiments, the ligand includes at least one GalNAc moiety. In some embodiments, the ligand includes three GalNAc moieties.

[0025] In some embodiments, the method involves contacting cells with an antisense nucleic acid containing any one nucleotide sequence of SEQ ID NOs: 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0026] In some embodiments, the method includes contacting cells with a composition or expression vector described herein.

[0027] In some embodiments, after the contact step, the C3 transcript level or C3 protein level decreases by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the level before the contact step.

[0028] In some embodiments, the subjects are human. In some embodiments, the subjects suffer from complement-mediated disorders.

[0029] In another embodiment, the disclosure features a method for reducing or inhibiting C3 expression in a subject, the method comprising administering an siRNA comprising an antisense strand and a sense strand to the subject, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand is complementary to a nucleotide sequence that differs from any one of SEQ ID NOs. 76-100 by 1, 2, 3, or 4 or fewer nucleotides. In some embodiments, the antisense strand is complementary to a nucleotide sequence comprising any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand comprises a nucleotide sequence comprising any one of SEQ ID NOs. 101-125. In some embodiments, one or both of the sense strand and the antisense strand include at least one overhang region. In some embodiments, the at least one overhang includes an overhang of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the at least one overhang includes a 3' overhang. In some embodiments, the overhang region is complementary to the SEQ ID NO: 75 fragment. In some embodiments, the 3' overhang of the siRNA includes a 2-nucleotide overhang. In some embodiments, the siRNA includes a sense strand and an antisense strand containing at least one additional nucleotide at its 5' end, 3' end, or both its 5' and 3' ends that is not complementary to the SEQ ID NO: 75 fragment. In some embodiments, one or both of the sense and antisense strands of the siRNA includes at least one modified nucleotide. In some embodiments, the at least one modified nucleotide includes a nucleotide containing a 2'-O-methyl group, a nucleotide containing a 2'-fluoro group, and / or a phosphorothioate bond with an adjacent nucleotide.In some embodiments, the sense strand of the siRNA contains one of the nucleotide sequences of sequence numbers 76-100, 126-150, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 255, 259, 264, 268, 272, 276, 325, 326, and 327. In some embodiments, the antisense strand of the siRNA contains one nucleotide sequence from sequence numbers 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.In some embodiments, the siRNA is the following sequence numbers 201 / 202, 203 / 204, 205 / 206, 207 / 208, 209 / 210, 211 / 212, 213 / 214, 215 / 216, 217 / 218, 219 / 220, 221 / 222, 223 / 224, 225 / 226, 227 / 228, 229 / 230, 231 / 232, 233 / 234, 235 / 236, 237 / 238, 239 / 240, 241 / 242, 243 / 244, 245 / 246, 247 / 248, 249 / 250, 251 / 252, 253 / 254, 201 / 256, 255 / 256, 255 / 257, 201 / 258, 255 / 258, 2 Contains one sense chain nucleotide sequence / antisense chain nucleotide sequence from any of the sense / antisense sets of 07 / 260, 259 / 260, 259 / 261, 207 / 262, 259 / 262, 217 / 263, 264 / 263, 264 / 265, 217 / 266, 264 / 266, 219 / 267, 268 / 267, 268 / 269, 219 / 270, 268 / 270, 231 / 271, 272 / 271, 272 / 273, 231 / 274, 272 / 274, 243 / 275, 276 / 275, 276 / 277, 243 / 278, 276 / 278, 325 / 275, 326 / 260, and 327 / 258. In some embodiments, the siRNA includes at least one ligand bound to one or all of the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and the 3' end of the antisense strand. In some embodiments, the ligand includes at least one GalNAc moiety. In some embodiments, the ligand includes three GalNAc moieties.

[0030] In some embodiments, the method involves administering an antisense nucleic acid containing any one nucleotide sequence of SEQ ID NOs: 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0031] In some embodiments, the method includes administering a composition or expression vector described herein.

[0032] In some embodiments, after the administration step, the C3 transcript level or C3 protein level decreases by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the level before the administration step.

[0033] In some embodiments, the subjects are human. In some embodiments, the subjects suffer from complement-mediated disorders.

[0034] In another embodiment, the disclosure features a method for reducing or inhibiting complement in a subject, the method comprising administering an siRNA comprising an antisense strand and a sense strand to the subject, wherein the antisense strand is complementary to a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand is complementary to a nucleotide sequence that differs from any one of SEQ ID NOs. 76-100 by 1, 2, 3, or 4 or fewer nucleotides. In some embodiments, the antisense strand is complementary to a nucleotide sequence comprising any one of SEQ ID NOs. 76-100. In some embodiments, the antisense strand comprises a nucleotide sequence comprising any one of SEQ ID NOs. 101-125. In some embodiments, one or both of the sense strand and the antisense strand include at least one overhang region. In some embodiments, the at least one overhang includes an overhang of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the at least one overhang includes a 3' overhang. In some embodiments, the overhang region is complementary to a fragment of SEQ ID NO. 75. In some embodiments, the 3' overhang of the siRNA includes a 2-nucleotide overhang. In some embodiments, the siRNA includes a sense strand and an antisense strand containing at least one additional nucleotide at its 5' end, 3' end, or both its 5' and 3' ends that is not complementary to the SEQ ID NO: 75 fragment. In some embodiments, one or both of the sense and antisense strands of the siRNA include at least one modified nucleotide. In some embodiments, the at least one modified nucleotide includes a nucleotide containing a 2'-O-methyl group, a nucleotide containing a 2'-fluoro group, and / or a phosphorothioate bond with an adjacent nucleotide.In some embodiments, the sense strand of the siRNA contains one of the nucleotide sequences of sequence numbers 76-100, 126-150, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 255, 259, 264, 268, 272, 276, 325, 326, and 327. In some embodiments, the antisense strand of the siRNA contains one nucleotide sequence from sequence numbers 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.In some embodiments, the siRNA is the following sequence numbers 201 / 202, 203 / 204, 205 / 206, 207 / 208, 209 / 210, 211 / 212, 213 / 214, 215 / 216, 217 / 218, 219 / 220, 221 / 222, 223 / 224, 225 / 226, 227 / 228, 229 / 230, 231 / 232, 233 / 234, 235 / 236, 237 / 238, 239 / 240, 241 / 242, 243 / 244, 245 / 246, 247 / 248, 249 / 250, 251 / 252, 253 / 254, 201 / 256, 255 / 256, 255 / 257, 201 / 258, 255 / 258, 2 Contains one sense chain nucleotide sequence / antisense chain nucleotide sequence from any of the sense / antisense sets of 07 / 260, 259 / 260, 259 / 261, 207 / 262, 259 / 262, 217 / 263, 264 / 263, 264 / 265, 217 / 266, 264 / 266, 219 / 267, 268 / 267, 268 / 269, 219 / 270, 268 / 270, 231 / 271, 272 / 271, 272 / 273, 231 / 274, 272 / 274, 243 / 275, 276 / 275, 276 / 277, 243 / 278, 276 / 278, 325 / 275, 326 / 260, and 327 / 258. In some embodiments, the siRNA includes at least one ligand bound to one or all of the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and the 3' end of the antisense strand. In some embodiments, the ligand includes at least one GalNAc moiety. In some embodiments, the ligand includes three GalNAc moieties.

[0035] In some embodiments, the method involves administering an antisense nucleic acid containing any one nucleotide sequence of SEQ ID NOs: 101-125, 151-200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 257, 258, 260, 261, 262, 263, 265, 266, 267, 269, 270, 271, 273, 274, 275, 277, 278, and 300-324.

[0036] In some embodiments, the method includes administering a composition or expression vector described herein.

[0037] In some embodiments, after the administration step, complement activity is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control, such as the control level of complement activity before the administration step.

[0038] In some embodiments, the subjects are human. In some embodiments, the subjects suffer from complement-mediated disorders.

[0039] definition Antibody: As used herein, the term “antibody” refers to an immunoglobulin or a derivative thereof that contains an immunoglobulin domain having the ability to bind to an antigen. An antibody may be an antibody of any species, such as human, rodent, rabbit, goat, or chicken. An antibody may be any immunoglobulin class, including any of the following human classes: IgG, IgM, IgA, IgD, and IgE, or their subclasses, such as IgG1, IgG2, etc. In various embodiments of the present invention, an antibody may be a fragment, such as Fab', F(ab')2, scFv (single-strand variable), or another fragment retaining an antigen-binding site, or a recombinant-produced scFv fragment containing a recombinant-produced fragment. See, for example, Allen, T., Nature Reviews Cancer, Vol. 2, 750-765, 2002, and the references in that document. An antibody may be monovalent, bivalent, or polyvalent. The antibody may be a chimeric antibody or "humanized" antibody, for example, in which a variable domain of rodent origin is fused to a constant domain of human origin, thereby retaining the specificity of a rodent antibody. The human-derived domain does not need to be directly of human origin, in the sense that it was first synthesized in humans. Rather, the "human" domain may be produced in a rodent whose genome incorporates human immunoglobulin genes. See, for example, Vaughan, et al., (1998), Nature Biotechnology, 16:535-539. The antibody may be partially or completely humanized. The antibody may be a polyclonal antibody or a monoclonal antibody, but for the purposes of the present invention, monoclonal antibodies are generally preferred. Methods for producing antibodies that specifically bind to virtually all target molecules are known in the art. For example, monoclonal or polyclonal antibodies can be purified from the blood or ascites of an animal that produces antibodies (after natural exposure to the molecule or its antigenic fragment, or after immunization with them), produced using recombinant techniques in cell culture or transgenic organisms, or produced at least partially by chemical synthesis.

[0040] Approximately: As used herein, the terms “approximately” or “about” in relation to numbers are generally understood to include numbers that are within the range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of a number, unless otherwise stated or the context makes it clear (except when such number is less than 0% of a possible value or greater than 100%).

[0041] Complementary: As used herein, “complementary” means, in the sense accepted in the art, the ability to form exact pairs between specific bases, nucleosides, nucleotides, or nucleic acids. For example, adenine (A) and uridine (U) are complementary, adenine (A) and thymidine (T) are complementary, and guanine (G) and cytosine (C) are complementary, and are referred to in the art as Watson-Crick base pairs. A nucleotide at a particular position in a first nucleic acid sequence is complementary to a nucleotide located on the opposite side in a second nucleic acid sequence when the strands are aligned antiparallel, so that nucleotide forms a complementary base pair and the nucleic acid is complementary at that position. The proportion of complementarity of a first nucleic acid to a second nucleic acid may be assessed by aligning the nucleic acids antiparallel to obtain the maximum complementarity across the entire evaluation window, determining the total number of nts in both strands that form complementary base pairs within that window, dividing by the total number of nts within that window, and multiplying by 100. For example, AAAAAAAA and TTTGTTAT are 75% complementary because 12 of their 16 nucleotides are in complementary base pairs. When calculating the number of complementary nucleotides required to achieve a particular percentage of complementarity, fractions are rounded to the nearest integer. A position occupied by a non-complementary nucleotide constitutes a mismatch; that is, the position is occupied by a non-complementary base pair. In certain embodiments, the evaluation window has the lengths described herein with respect to the double-stranded portion or target portion. A complementary sequence involves base pairing across the entire length of both nucleotide sequences (if both nucleotides are the same length) or across the entire length of the shorter sequence (if both nucleotides are different lengths) of a polynucleotide containing a first nucleotide sequence and a polynucleotide containing a second nucleotide sequence. Such sequences may be referred to herein as “perfectly complementary” (100% complementary). Nucleic acids that are at least 70% complementary on the evaluation window are considered “substantially complementary” on that window.In certain embodiments, complementary nucleic acids are at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary on an evaluation window. Where the first sequence is referred to as “substantially complementary” with respect to a second sequence in this specification, the two sequences may be perfectly complementary or may contain one or more mismatched bases during hybridization, for example, up to about 5%, 10%, 15%, 20%, or 25% of mismatched bases during hybridization, or, for double strands of up to 30 base pairs, may contain 1, 2, 3, 4, 5, or 6 mismatched bases during hybridization. If two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs are not considered mismatches, i.e., unpaired nucleotides, for the purpose of determining the complementarity ratio. For example, a double-stranded dsRNA containing one oligonucleotide of 21 nucleotides in length and the other oligonucleotide of 23 nucleotides in length, where the longer oligonucleotide contains a 21-nucleotide sequence and a 2-nucleotide overhang that are perfectly complementary to the shorter oligonucleotide, may be referred to herein as “perfectly complementary.” As used herein, a “complementary” sequence may contain one or more non-Watson-Crick base pairs, as long as they satisfy the requirement of hybridizing ability, and / or base pairs formed from non-natural nucleotides and other modified nucleotides. Examples of such non-Watson-Crick base pairs, but not limited to, include G:U fluctuation base pairing or Hoogsteen base pairing.Those skilled in the art will recognize that, for example, according to the so-called "fluctuation" rule (see, e.g., Murphy, FV IV & V, Ramakrishnan, V., Nature Structural and Molecular Biology 11:1251-1252 (2004)), guanine, cytosine, adenine, and uracil are replaceable with other bases without substantially altering the base-pairing performance of polynucleotides containing such base-supporting nucleotides. For example, a nucleotide containing inosine as a base can base-pair with a nucleotide containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of inhibitory RNAs described herein by, for example, a nucleotide containing inosine. The terms “complementary,” “fully complementary,” and “substantially complementary” can be used in reference to base matching between any two nucleic acids, for example, between the sense and antisense strands of a dsRNA, or between the antisense strand of a ds inhibitory RNA (e.g., siRNA) and a target sequence, or between an antisense oligonucleotide and a target sequence, as will be understood and evident from the context. As will be understood by those skilled in the art, where used herein, “hybridize” refers to the interaction between two nucleic acid sequences that contain, or consist of, complementary regions such that a stable double-stranded structure is formed under specific conditions.

[0042] Complement Components: As used herein, the terms “complement components” or “complement proteins” refer to molecules involved in the activation of the complement system or in the activity of one or more complement-mediated activities. Components of the classical complement pathway include, for example, C1q, C1r, C1s, C2, C3, C4, C5, C6, C7, C8, C9, and the C5b-9 complex, also referred to as cell membrane-damaging complexes (MACs) or active fragments or enzymatic cleavage products of any of the aforementioned (e.g., C3a, C3b, C4a, C4b, C5a, etc.). Components of the secondary pathway include, for example, factor B, factor D, factor H, and factor I, as well as properdin, with factor H being a negative regulator of that pathway. Components of the lectin pathway include, for example, MBL2, MASP-1, and MASP-2. Complement components also include cell-bound receptors for soluble complement components. Examples of such receptors include the C5a receptor (C5aR), C3a receptor (C3aR), complement receptor 1 (CR1), complement receptor 2 (CR2), and complement receptor 3 (CR3). It should be recognized that the term "complement components" is not intended to include molecules and molecular structures that act as "triggers" for complement activation, such as antigen-antibody complexes or exogenous structures present on the surface of microorganisms or artificial materials.

[0043] Host cell: As used herein, the term “host cell” refers to a cell into which exogenous DNA (recombinant or otherwise) is introduced. A person skilled in the art reading this disclosure will understand that the term refers not only to a specific target cell but also to the progeny cells of such a cell. Such progeny cells may not be identical to the parent cell in practice, because certain modifications may occur in subsequent generations due to either mutation or environmental influences, but as used herein, they are still included within the scope of the term “host cell.” In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any biological kingdom suitable for the expression of exogenous DNA (e.g., recombinant nucleic acid sequences). Examples of cells include prokaryotes and eukaryotes (unicellular or multicellular), bacterial cells (e.g., strains of Escherichia coli, Bacillus species, Streptomyces species, etc.), mycobacterial cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, nettle moth (Trichoplusia ni), etc.), non-human animal cells, human cells, or cell fusions such as hybridomas and quadromas. In some embodiments, the cells are human, monkey, ape, hamster, rat, or mouse cells. In some embodiments, the cells are eukaryotic cells and are selected from the following: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60 (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT060562, Sertoli cells, BRL 3 A cells, HT1080 cells, myeloma cells, tumor cells, and cell lines derived from the aforementioned cells. In some embodiments, the cells contain one or more viral genes.

[0044] Identity: As used herein, the term “identity” refers to the overall relationship between polymer molecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polymer molecules are considered “substantially identical” to each other if their sequences are identical by at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. The percentage of identity between two nucleic acid sequences or polypeptide sequences can be calculated, for example, by aligning the two sequences for the purpose of optimal comparison (e.g., gaps may be introduced in one or both of the first and second sequences for the purpose of optimal alignment, and non-identical sequences may be ignored for comparison purposes). In certain embodiments, the length of the sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Next, the nucleotides at the corresponding positions are compared. The molecules are identical at a given position when the position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) as the corresponding position in the second sequence. The percentage of identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences, and the length of each gap. The comparison of sequences and the determination of the percentage of identity between the two sequences may be performed using mathematical algorithms. For example, the percentage of identity between two nucleotide sequences may be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which is incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons generated using the ALIGN program utilize a PAM120 weight residue table, a 12-gap length penalty, and a 4-gap penalty.Alternatively, the percentage of identity between two nucleotide sequences may be determined using the NWSgapdna.CMP matrix and the GAP program in the GCG software package.

[0045] Linked: As used herein, the term “linked” when used in reference to two or more parts means that the parts are physically associated or connected to each other to form a sufficiently stable molecular structure, thereby maintaining the association under the conditions under which the link is formed, preferably such conditions are those under which the new molecular structure is used, such as physiological conditions. In certain preferred embodiments of the present invention, the link is covalent. In other embodiments, the link is non-covalent. The parts may be linked directly or indirectly. When two parts are directly linked, they are covalently bonded to each other or are sufficiently close to maintain their association with intermolecular forces between the two parts. When two parts are indirectly linked, they are each covalently or non-covalently bonded to a third part, and the association of the two parts is maintained. Generally, when two parts are referred to as being linked by a “linker,” “linking part,” or “linking portion,” the link between the two linking parts is indirect, and typically each linked part is covalently bonded to the linker. The linker may be any suitable part that reacts with the two linked parts for a reasonable period of time under conditions that match the stability of the parts (which are protected as needed), and may be in an amount sufficient to yield a reasonable yield.

[0046] MicroRNA (miRNA): As used herein, the terms “microRNA” or “miRNA” refer to small non-coding RNA molecules that can function in the transcriptional and / or post-transcriptional regulation of target gene expression. The term encompasses mature miRNAs, as well as precursor miRNA sequences, including primary transcripts (pri-miRNAs) and stem-loop precursors (pre-miRNAs). Spontaneous miRNA biosynthesis is initiated in the nucleus by RNA polymerase II transcription, producing a primary transcript (pri-miRNA). The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce a stem-loop precursor miRNA (pre-miRNA) of approximately 70 nt. The pre-miRNA is then actively transported to the cytoplasm, where it is cleaved by Dicer ribonuclease to form mature miRNAs. Mature miRNAs include an “antisense strand” or “guide strand” (containing a region substantially complementary to the target sequence) and a “sense strand” or “passenger strand” (containing a region substantially complementary to the antisense strand). Those skilled in the art will recognize that the guide strand may be fully complementary to the target region of the target RNA, or it may be incompletely complementary. This miRNA guide strand is incorporated into an RNA-induced silencing derivative (RISC) and recognizes the target mRNA via base pairing with the miRNA, typically resulting in translational inhibition or destabilization of the target mRNA. As understood in the art, for naturally occurring miRNAs, recognition of the target mRNA occurs via incomplete base pairing with the mRNA. In some embodiments, the miRNA is synthesized or engineered, and recognition of the target mRNA occurs via complete base pairing with the mRNA. Typically, the target mRNA contains a sequence complementary to the miRNA's "seed" sequence, usually corresponding to nucleotides 2–8 of the miRNA.Information regarding miRNA sequences, as well as information related to pri-miRNA and pre-miRNA sequences, is available in miRNA databases such as miRBase (Griffiths-Jones et al. 2008 Nucl Acids Res 36, (Database Issue: D154-D158)) and the NCBI Human Genome Database.

[0047] Operablely coupled: As used herein, the term “operablely coupled” refers to a juxtaposition of components described in such a relationship that they can function in the manner intended. A controllable element “operablely coupled” to a functional element is associated in such a way that the expression and / or activity of the functional element is realized under conditions consistent with the controllable element. In some embodiments, the “operablely coupled” controllable element is contiguous (e.g., covalently coupled) with the code element of interest. In some embodiments, the controllable element acts on, transposes, or otherwise interacts with the functional element of interest.

[0048] Recombinant: As used herein, the term “recombinant” means polypeptides designed, manipulated, prepared, expressed, produced, manufactured, and / or isolated by recombinant means, such as polypeptides expressed using recombinant expression vectors transfected into host cells; polypeptides isolated from recombinants; combinatorial human polypeptide libraries; polypeptides isolated from animals (e.g., mice, rabbits, sheep, fish, etc.) that are transgenic with respect to a gene or gene construct encoding or one or more of their components, parts, elements, or domains, and / or directing their expression; and polypeptides prepared, expressed, produced, and / or isolated by any other means, including splicing or ligating selective nucleic acid sequence elements with each other, chemically synthesizing selective sequence elements, and / or producing nucleic acids that encode or / direct the expression of polypeptides or one or more of their components, parts, elements, or domains. In some embodiments, one or more such selective sequence elements exist naturally. In some embodiments, one or more such selective sequence elements are designed in silico. In some embodiments, one or more such selective sequence elements arise, for example, from the induction of (e.g., in vitro or in vivo) mutations of known sequence elements of natural or synthetic origin in the germ cell lineage of the source organism of interest (e.g., human or mouse).

[0049] RNA Interference: As used herein, the terms “RNA interference” or “RNAi” generally refer to the process by which a double-stranded RNA molecule or a short hairpin RNA molecule reduces or inhibits the expression of a nucleic acid sequence that shares substantial or complete homology with that molecule. While we do not wish to be bound by any theory, in nature, the RNAi pathway is thought to be initiated by a type III endonuclease known as Dicer. This endonuclease cleaves long double-stranded RNA (dsRNA) into double-stranded fragments of 21-23 base pairs, typically with a 2-base 3' overhang (variations in length and overhang are also expected). These are referred to as “small interfering RNA” (siRNA). Such siRNAs consist of two single-stranded RNAs (ssRNA): an “antisense strand” or “guide strand” containing a region substantially complementary to the target sequence, and a “sense strand” or “passenger strand” containing a region substantially complementary to the antisense strand. Those skilled in the art will recognize that the guide strand may be perfectly complementary to the target region of the target RNA, or it may be less than perfectly complementary to the target region of the target RNA.

[0050] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a compound or composition provided in accordance with the present invention is administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans), insects, worms, etc.) and plants. In some embodiments, subjects may be suffering from and / or susceptible to diseases, disorders, and / or conditions.

[0051] Substantially: As used herein, the term “substantially” refers to a qualitative state that represents all or nearly all range or degree of the characteristics or properties of the subject. Those skilled in the biological art will understand that biological and chemical phenomena rarely reach completion and / or progress to completeness, or achieve complete results, or completely avoid results. Therefore, the term “substantially” is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0052] To be afflicted with: An individual who "suffers" from a disease, disorder, and / or condition is diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0053] Target gene: As used herein, “target gene” refers to a gene whose expression is regulated, for example, inhibited. As used herein, “target RNA” refers to RNA that is degraded, repressed, or otherwise inhibited using one or more miRNAs. Target RNA may also be referred to as a target sequence or target transcript. RNA may be a primary RNA transcript transcribed from a target gene (e.g., premRNA) or a processed transcript such as mRNA encoding a polypeptide. As used herein, “target portion” or “target region” refers to a continuous portion of the nucleotide sequence of the target RNA. In some embodiments, the target portion of mRNA is at least long enough to function as a substrate for RNA interference (RNAi)-mediated cleavage within that portion in the presence of a suitable inhibitory RNA. The target portion may be about 8 to 36 nucleotides long, for example, about 10 to 20 or about 15 to 30 nucleotides long. The length of the target portion may have a specific value or subrange within the above range. For example, in a particular embodiment, the target portion is approximately 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28 The lengths may also be 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides.

[0054] Therapeutic agent: As used herein, the term “therapeutic agent” means any agent that, when administered to a subject, has a therapeutic effect and / or exerts a desired biological effect and / or pharmacological effect. In some embodiments, a therapeutic agent is a substance that can be used to reduce, improve, alleviate, suppress, prevent, delay the onset of, reduce the severity of, and / or decrease the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0055] Therapeutic dose: As used herein, the term “therapeutic dose” means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a therapeutic regimen, elicits a desired biological response. In some embodiments, the therapeutic dose of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to said disease, disorder, and / or condition. As those skilled in the art will understand, the effective dose of a substance may vary depending on factors such as the desired biological endpoint, the substance being delivered, and the target cells or tissues. For example, the effective dose of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, improves, reduces, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or signs of the disease, disorder, and / or condition. In some embodiments, the therapeutic dose is administered in a single dose. In some embodiments, multiple unit doses are required to deliver the therapeutic dose.

[0056] Treatment: As used herein, the term “treatment” means providing treatment, i.e., providing control of any type of medical or surgical subject. Treatment may be provided to reverse, alleviate, inhibit progression, prevent or reduce the likelihood of a disease, disorder, or condition, or to reverse, alleviate, inhibit or prevent progression, prevent or reduce the likelihood of one or more symptoms or manifestations of a disease, disorder, or condition. “Prevention” means preventing a disease, disorder, condition, or its symptoms or manifestations from occurring in at least some individuals for at least a certain period of time. Treatment may include administering an agent to a subject after the onset or manifestation of one or more symptoms indicating a complement-mediated condition, for example, to reverse, alleviate, reduce its severity, and / or inhibit or prevent its progression, and / or reverse, alleviate, reduce its severity, and / or inhibit one or more symptoms or manifestations of the condition. The compositions of this disclosure may be administered to subjects who have developed a complement-mediated disorder, or subjects who are at higher risk of developing such a disorder compared to the general population. The compositions of this disclosure may be administered prophylactically, i.e., before any symptoms or manifestations of the condition. In this case, the subject is typically at risk of developing the condition.

[0057] Nucleic acids: The term “nucleic acid” includes any nucleotide, its analogues, and its polymers. As used herein, the term “polynucleotide” refers to a polymeric form of nucleotides of any length, either ribonucleotide (RNA) or deoxyribonucleotide (DNA). These terms refer to the primary structure of molecules and thus include double-stranded DNA and single-stranded DNA, as well as double-stranded RNA and single-stranded RNA. These terms include, but are not limited to, nucleotide analogues such as methylated, protected, and / or capped nucleotides or polynucleotides, and analogues of RNA or DNA made from modified polynucleotides. These terms encompass polynucleotides or oligoribonucleotides (RNA) and polydeoxyribonucleotides or oligodeoxyribonucleotides (DNA), RNA or DNA derived from N-glycosides or C-glycosides of nucleic acid bases and / or modified nucleic acid bases, nucleic acids derived from sugars and / or modified sugars, and nucleic acids derived from phosphate crosslinks and / or modified phosphate crosslinks (also referred herein as “nucleotide interlinks”). The term encompasses nucleic acids containing any combination of nucleic acid bases, modified nucleic acid bases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges. Examples, but not limited to, include nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both a ribose moiety and a deoxyribose moiety, and nucleic acids containing a ribose moiety modified by a ribose moiety. In some embodiments, the prefix poly- refers to nucleic acids containing 2 to about 10,000, 2 to about 50,000, or 2 to about 100,000 nucleotide monomer units. In some embodiments, the prefix oligo- refers to nucleic acids containing 2 to about 200 nucleotide monomer units.

[0058] Vectors: As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another ligated nucleic acid. Certain types of vectors are “plasmids,” which refer to a circular double-stranded DNA loop into which an additional DNA segment can be ligated. Another type of vector is a viral vector, in which an additional DNA segment can be ligated within the viral genome. Certain vectors can autonomously replicate within the host cell into which they are introduced (e.g., bacterial vectors with bacterial replication origins and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors), once introduced into a host cell, can be integrated into the host cell’s genome and thereby replicate alongside the host genome. Furthermore, certain vectors have the ability to direct the expression of a manipulably ligated gene. Such vectors are referred to herein as “expression vectors.”

[0059] Standard techniques may be used for recombinant DNA methods, oligonucleotide synthesis methods, tissue culture methods, and transformation methods (e.g., electroporation, lipofection). Enzyme reactions and purification techniques may be carried out according to the manufacturer's specifications, or as are commonly practiced in the art, or as described herein. The aforementioned techniques and procedures may be carried out according to conventional methods known in the art, and as described in the various general and more specific references cited and discussed throughout this specification. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)). This document is incorporated herein by reference for any purpose. [Brief explanation of the drawing]

[0060] [Figure 1]Figure 1 shows a chart disclosing exemplary modification patterns 1–5 for the sense and antisense strands of a double-stranded inhibitory RNA (e.g., siRNA). In Figure 1, "2OM" represents a 2'-O-methyl modification, "2F" represents a 2'-fluoro modification, and "PS" represents a phosphorothioate bond with an adjacent 3' nucleotide.

[0061] [Figure 2] Figure 2 shows the structure of pegcetacoplan (APL-2), which is estimated to have approximately 800 to 1100 n molecules and approximately 40 kD of PEG.

[0062] [Figure 3] Figure 3 shows the results of an in vivo study in non-human primates. siRNA 58 or the vehicle was administered subcutaneously at doses of 3 mg / kg, 10 mg / kg, or 30 mg / kg. The graph shows the time course of serum C3 protein levels for each group up to 67 days after administration. Serum C3 protein levels were measured using an ELISA assay. The value on day 1 was used as the baseline.

[0063] [Figure 4] Figure 4 shows data from in vivo studies in non-human primates. siRNA 58 or the vehicle was administered subcutaneously at doses of 3 mg / kg, 10 mg / kg, or 30 mg / kg. The graph shows C3 mRNA expression in liver biopsies taken from non-human primates 15 days after injection. C3 mRNA levels in the samples were measured using quantitative PCR assays. In these experiments, C3 mRNA levels were normalized relative to ActB mRNA levels.

[0064] [Figure 5]Figure 5 shows data from in vivo studies in non-human primates. siRNA 58 or the vehicle was administered subcutaneously at doses of 3 mg / kg, 10 mg / kg, or 30 mg / kg. The graph shows C3 mRNA expression in liver biopsies taken from non-human primates 46 days after injection. C3 mRNA levels in the samples were measured using quantitative PCR assays. In these experiments, C3 mRNA levels were normalized relative to ActB mRNA levels.

[0065] [Figure 6] Figure 6 shows the time course of secondary pathway (AH50) activity levels in serum from non-human primates injected with various doses of siRNA 58 (3 mg / kg, 10 mg / kg, 30 mg / kg, or vehicle), collected up to day 29. Secondary pathway activity (AH50) was determined using an ELISA assay. The value on day 1 was used as the baseline.

[0066] [Figure 7] Figure 7 shows the percentage change from baseline in serum C3 concentration after subcutaneous administration of siRNA 59 as a single bolus (A) or as three bolus doses once daily (B). Values ​​represented as zero were less than the assay's LLOQ. Data represent mean ± SEM (n=3).

[0067] [Figure 8] Figure 8 shows the measured secondary pathway activity by detection and quantification of soluble C5b-9 complexes using ELISA (optical density measurement; OD) in the serum of animals subcutaneously treated with vehicle (A), siRNA(-) control (B), siRNA59 at 3 mg / kg (C), siRNA59 at 10 mg / kg (D), and siRNA59 at 30 mg / kg (E). Data represent mean ± SEM (n=3).

[0068] [Figure 9]Figure 9 shows the levels of C3 mRNA in liver tissue at 3 days (A) and 30 days (B and C) after a single dose of siRNA 59 (A and B) or three doses once daily (C). Data represent mean ± SEM (n=3). [Modes for carrying out the invention]

[0069] I. Complement system To facilitate understanding of this disclosure, this section provides an overview of complement and its activation pathways and is not intended to limit the invention in any way. For further details, see, for example, Kuby Immunology, 6th ed., 2006; Paul, WE, Fundamental Immunology, Lippincott Williams & Wilkins; 6th ed., 2008; and Walport This can be found in MJ., Complement. First of two parts. N Engl J Med., 344(14):1058-66, 2001.

[0070] The complement system is a therapeutic group of the innate immune system that plays a crucial role in the body's defense against infectious agents. The complement system comprises over 30 serum and cellular proteins involved in three major pathways known as the classical pathway, the secondary pathway, and the lectin pathway. The classical pathway is typically triggered by the binding of an antigen-IgM or IgG antibody complex to C1 (although certain other activators can also initiate this pathway). Activated C1 cleaves C4 and C2 to produce C4a and C4b, as well as C2a and C2b. C4b and C2a bind to form a C3 convertase, which cleaves C3 to form C3a and C3b. When C3b binds to the C3 convertase, a C5 convertase is produced, which cleaves C5 into C5a and C5b. C3a, C4a, and C5a are anaphyllotoxins and mediate multiple reactions in acute inflammatory responses. C3a and C5a are also chemotactic factors, attracting immune system cells such as neutrophils. It should be noted that the initial names "C2a" and "C2b" were later replaced in scientific literature.

[0071] The second pathway is initiated and amplified, for example, by microbial surfaces or various complex polysaccharides. In this pathway, low-level, spontaneous hydrolysis of C3 to C3(H2O) leads to binding to factor B, which is then cleaved by factor D to produce liquid-phase C3 convertase, which activates complement by cleaving C3 into C3a and C3b. C3b binds to a target, such as the cell surface, and forms a complex with factor B, which is subsequently cleaved by factor D to produce C3 convertase. Surface-bound C3 convertase cleaves and activates additional C3 molecules, leading to rapid C3b deposition near the activation site, resulting in the formation of additional C3 convertase and consequently the generation of additional C3b. This process creates a cycle of C3 cleavage and C3 convertase formation, significantly amplifying the reaction. C3 cleavage and the binding of another C3b molecule to C3 convertase produce C5 convertase. The C3 and C5 convertases in this pathway are regulated by the cellular molecules CR1, DAF, MCP, CD59, and fH. The mechanisms of action of these proteins involve either disintegration-promoting activity (i.e., the ability to dissociate convertases), the ability to act as cofactors in the degradation of C3b or C4b by factor I, or both. Normally, significant complement activation is prevented on the cell surface by the presence of complement regulatory proteins.

[0072] The C5 convertases produced in both pathways cleave C5 to produce C5a and C5b. C5b then binds to C6, C7, and C8 to form C5b-8, which catalyzes the polymerization of C9 to form the C5b-9 cell membrane-damaging complex (MAC). MACs insert themselves into the target cell membrane, causing cell lysis. Even small amounts of MAC on the cell membrane can lead to a variety of consequences other than cell death.

[0073] The lectin complement pathway is initiated by the binding of mannose-binding lectin (MBL) and MBL-associated serine protease (MASP) to carbohydrates. The MB1-1 gene (known as LMAN-1 in humans) encodes a type I intrinsic membrane protein localized in the intermediate region between the endoplasmic reticulum and the Golgi apparatus. The MBL-2 gene encodes a soluble mannose-binding protein present in serum. In the human lectin pathway, MASP-1 and MASP-2 are involved in the degradation of C4 and C2 proteins, giving rise to the C3 convertases mentioned above.

[0074] Complement activity is regulated by various mammalian proteins referred to as complement regulatory proteins (CCPs) or complement activator regulator (RCA) proteins (US Patent No. 6,897,290). These proteins differ in ligand specificity and the mechanism of complement inhibition. They can enzymatically cleave C3b and / or C4b into smaller fragments by accelerating the normal breakdown of convertases and / or acting as cofactors of factor I. CCPs are characterized by the presence of multiple (typically 4–56) homologous motifs known as short consensus repeats (SCRs), complement regulatory protein (CCP) modules, or SUSHI domains, which are about 50–70 amino acids long and contain conserved motifs containing four disulfide-bonded cysteine ​​(two disulfide bonds), proline, tryptophan, and many hydrophobic residues. The CCP family includes complement receptor type 1 (CR1; C3b:C4b receptor), complement receptor type 2 (CR2), membrane cofactor protein (MCP; CD46), disintegration accelerator (DAF), complement factor H (fH), and C4b-binding protein (C4bp). CD59 is a membrane-bound complement regulatory protein that is structurally unrelated to CCPs. Complement regulatory proteins typically function to limit complement activation that may otherwise occur in mammalian, e.g., human host cells and tissues. Thus, "self" cells are usually protected from the harmful effects that would otherwise occur if subsequent complement activation proceeded on them. Deficiencies or defects in complement regulatory proteins are involved in the pathogenesis of various complement-mediated disorders, as discussed herein, for example.

[0075] II. Inhibitory RNA against C3 This disclosure includes compositions and methods relating to one or more nucleotide sequences containing or encoding an inhibitory RNA that binds to messenger RNA (mRNA) produced by a target gene (e.g., C3) and inhibits its expression. The inhibitory RNA may be a single-stranded (e.g., antisense oligonucleotide) or a double-stranded nucleic acid. In some embodiments, the inhibitory RNA contains double-stranded RNA such as microRNA (miRNA) or small interfering RNA (siRNA). In some embodiments, the inhibitory RNA is siRNA or miRNA, or a vector containing a nucleotide sequence encoding siRNA or miRNA.

[0076] In some embodiments, the inhibitory RNA can inhibit the expression of C3 from one or more non-human species, such as cynomolgus monkey (Macaca fascicularis) C3 and non-human primate (chlorocebus sabaeus) C3, in addition to human C3. The cynomolgus monkey C3 gene has been assigned NCBI gene ID: 102131458, and the predicted amino acid sequence and nucleotide sequence of cynomolgus monkey C3 are listed under NCBI RefSeq accession numbers XP_005587776.1 and XM_005587719.2, respectively. In some embodiments, the inhibitory RNA includes an antisense strand that is complementary to the target region, which is identical in human and cynomolgus monkey C3 transcripts. In some embodiments, the inhibitory RNA includes an antisense strand that is complementary to the target region of the human C3 transcript, which differs by 1, 2, or 3 nucleotides from the sequence in the cynomolgus monkey C3 transcript. It is understood that inhibitory RNAs that inhibit human C3 expression can also inhibit the expression of non-primate C3, such as rat or mouse C3, especially when the conserved region of the C3 transcript is targeted.

[0077] The amino acid and nucleotide sequences of human C3 are publicly known in the art and can be found in publicly available databases, such as the National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database, where they are listed under RefSeq accession numbers NP_000055 (accession version number NP_000055.2) and NM_000064 (accession version number NM_000064.4), respectively (wherein "amino acid sequence" refers to the sequence of the C3 polypeptide, and in this context, "nucleotide sequence" refers to the C3 mRNA sequence represented in genomic DNA. It is understood that the actual mRNA nucleotide sequence contains U rather than T). Those skilled in the art will understand that the sequences described above relate to the complement C3 preproprotein and include signal sequences that are cleaved and therefore not present in the mature protein. The human C3 gene is assigned NCBI gene ID:718, and the genomic C3 sequence has RefSeq accession number NG_009557 (accession version number NG_009557.1). The nucleotide sequence of human C3 mRNA is shown below (RefSeq accession number NM_000064.3. T is substituted with U. The AUG start codon is the underlined portion starting at position 94).

[0078] AGAUAAAAAGCCAGCUCCAGCAGGCGCUGCUCACUCCUCCCCAUCCUCUCCCUCUGUCCCUCUGUCCCUCUGACCCUGCACUGUCCCAGCACC AUG CUUCAGUUAUAUCUCAAAAAAAAAAAAAAAAAAA(Sequence number 75)

[0079] In some embodiments, the inhibitory RNA comprises a nucleic acid chain that is complementary to the target portion of a C3 transcript, such as C3 mRNA (for example, complementary to a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the target portion of SEQ ID NO: 75). The target portion may be 15 to 30 nucleotides long, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, but shorter and longer target portions are also expected. In some embodiments, the target portion comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Table 1 below.

[0080] [Table 1]

[0081] Administration of inhibitory RNA can reduce C3 transcript levels or C3 protein levels in a subject or biological sample (e.g., a blood sample, serum sample, or plasma sample, or a sample containing hepatocytes) compared to levels before administration of the composition. In some embodiments, C3 transcript levels or C3 protein levels are reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to levels before administration. C3 protein levels can be measured, for example, in a blood (serum or plasma) sample.

[0082] III. MicroRNA This disclosure also includes compositions and methods relating to microRNAs, microRNAs, or one or more oligonucleotides encoding microRNAs. MicroRNAs (miRNAs) are highly conserved small RNA species that are transcribed from plant and animal genomic DNA but are not translated into proteins. Natural miRNAs are first transcribed as long hairpin-containing primary transcripts (pri-miRNAs). The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce approximately 70 nt stem-loop precursor miRNAs (pre-miRNAs). These miRNAs include an "antisense strand" or "guide strand" (containing a region substantially complementary to the target sequence) and a "sense strand" or "passenger strand" (containing a region substantially complementary to the antisense strand). The pre-miRNA is then actively exported to the cytoplasm, where it is cleaved by Dicer ribonuclease to form mature miRNAs. The processed microRNAs are incorporated into the RNA-induced silencing complex (RISC) to form a mature gene silencing complex, which induces the degradation and / or translational repression of target mRNA. The number of miRNA sequences identified to date is large and continues to grow. Examples of those that can be found include, for example, “miRBase: microRIVA sequences, targets and gene nomenclature” Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. NAR, 2006, 34, Database Issue, D140-D144; and “The microRNA Registry” Griffiths-Jones S. NAR, 2004, 32, Database Issue, D109-D111.

[0083] In some embodiments, miRNAs can be synthesized for therapeutic purposes and administered topically or systemically to a target. miRNAs can be designed and / or synthesized as mature molecules or as precursors (e.g., pri-miRNA or pre-miRNA). In some embodiments, pre-miRNAs include a guide strand and a passenger strand, which are of the same length (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides). In some embodiments, pre-miRNAs include a guide strand and a passenger strand, which are of different lengths (e.g., one strand is about 19 nucleotides and the other is about 21 nucleotides). In some embodiments, miRNAs can target the coding region, 5' untranslated region, and / or 3' untranslated region of endogenous mRNA. In some embodiments, miRNAs include a guide strand containing a nucleotide sequence that is sufficiently sequence-complementary to the target endogenous mRNA, hybridizes with the endogenous mRNA, and inhibits its expression.

[0084] In some embodiments, the miRNA comprises a nucleic acid chain containing a region that is perfectly complementary to at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of SEQ ID NO: 75 (e.g., any one of SEQ ID NOs. 76-100). In some embodiments, the miRNA comprises a maturation guide chain having a nucleotide sequence that is perfectly complementary to a target region containing a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs. 76-100.

[0085] IV. siRNA In some embodiments, the inhibitory RNA is double-stranded RNA (dsRNA), which inhibits C3 expression by RNA interference (RNAi). RNAi is a sequence-specific post-transcriptional gene silencing process, which allows double-stranded RNA (dsRNA) homologous to a target locus, for example, to specifically inactivate gene function (Hammond). (See, et al., Nature Genet. 2001;2:110-119; Sharp, Genes Dev. 1999;13:139-141). This dsRNA-induced gene silencing can be mediated by short double-stranded small interfering RNAs (siRNAs) generated by the cleavage of long dsRNAs using ribonuclease III (Bernstein et al., Nature 2001;409:363-366 and Elbashir et al., Genes Dev. 2001;15:188-200). RNAi-mediated gene silencing is thought to occur via the degradation of sequence-specific RNAs, with sequence specificity determined by the interaction between the siRNA and a complementary sequence within the target RNA (see, for example, Tuschl, Chem. Biochem. 2001;2:239-245). RNAi may involve the use of, for example, siRNA (Elbashir, et al., Nature 2001;411:494-498) or short hairpin RNAs (shRNAs) with a folded stem-loop structure (Paddison et al., Genes Dev. 2002;16:948-958; Sui et al., Proc. Natl. Acad. Sci. USA 2002;99:5515-5520; Brummelkamp et al., Science 2002;296:550-553; Paul et al., Nature Biotechnol. 2002;20:505-508).

[0086] This disclosure includes siRNA molecules that target C3 transcripts, such as C3 mRNA (SEQ ID NO: 75). In some embodiments, the siRNA molecule includes a sequence complementary to a target region containing any one of SEQ ID NOs: 76-100. In some embodiments, the siRNA molecule includes (i) a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 76-100 (or a portion thereof), and / or (ii) a nucleotide sequence complementary to the nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 76-100 (or a portion thereof).

[0087] In some embodiments, the siRNA of this disclosure is a double-stranded nucleic acid duplex (e.g., a 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 base pair strand) containing an annealed complementary single-stranded nucleic acid molecule. In some embodiments, the siRNA is a short dsRNA containing an annealed complementary single-stranded RNA. In some embodiments, the siRNA comprises an annealed RNA:DNA duplex, where the sense strand of the duplex is a DNA molecule and the antisense strand of the duplex is an RNA molecule. In some embodiments, the siRNA comprises a sense strand having a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs. 76-100 (or a portion thereof).

[0088] In some embodiments, the siRNA comprises an antisense strand having a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of sequence numbers 101-125 (or a portion thereof) in Table 2 below.

[0089] [Table 2]

[0090] In some embodiments, the siRNA includes mismatches with the target, mismatches within the double hemisphere, or combinations thereof. Mismatches may also occur in overhang regions and / or double-strand portions. Base pairs may be ranked based on their tendency to promote dissociation or dissolution (e.g., based on the free energies of binding and dissociation of a particular pair formation; the simplest method is to validate pairs on an individual pair base, but neighbor analysis or similarity analysis may also be used). With respect to promoting dissociation: A:U is preferred over G:C. G:U is preferred over G:C. I:C is preferred over G:C (I=inosine).

[0091] In some embodiments, the siRNA includes at least one of the first 1, 2, 3, 4, or 5 base pairs in the double helix portion from the 5' end of the antisense strand, independently selected from the group consisting of A:U, G:U, I:C, and mismatch pairs. In some embodiments, the nucleotide at position 1 from the 5' end of the double helix portion of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Furthermore, or alternatively, at least one of the first 1, 2, or 3 base pairs from the 5' end of the double helix portion of the antisense strand is an AU base pair. For example, the first base pair from the 5' end of the double helix portion of the antisense strand is an AU base pair.

[0092] In some embodiments, the sense strand may contain one or more nucleotides (e.g., 2, 3, 4, or 5) that are not identical to the target sequence at its 3' and / or 5' ends, and / or the antisense strand may contain one or more nucleotides (e.g., 2, 3, 4, or 5) that are not complementary to the target sequence at its 3' and / or 5' ends. For example, in some embodiments, a double-stranded siRNA includes a sense strand containing the sequences listed in Table 3 below. The sequences in Table 3 contain an adenine (A) nucleotide at its 3' end, which is complementary to the target sequence in some parts of the sequence (e.g., complementary to the next consecutive nucleotide of the target sequence). In some parts of the sequences in Table 3, the adenine (A) nucleotide at the 3' end is not complementary to the target sequence (e.g., not complementary to the next consecutive nucleotide of the target sequence).

[0093] [Table 3]

[0094] In some embodiments, the double-stranded siRNA includes blunt ends at both ends. In some embodiments, the double-stranded siRNA includes at least one overhang region. In some embodiments, the double-stranded siRNA includes a 3' overhang of 1, 2, 3, 4, 5, or 6 nucleotides on the sense strand and / or antisense strand of the double-stranded siRNA. In some embodiments, the double-stranded siRNA includes a 5' overhang of 1, 2, 3, 4, 5, or 6 nucleotides on the sense strand and / or antisense strand of the double-stranded siRNA.

[0095] In some embodiments, the antisense strand includes an overhang containing one or more nucleotides complementary to the C3 mRNA transcript (SEQ ID NO: 75). In some embodiments, the antisense strand includes an overhang containing 1, 2, 3, 4, 5, or 6 nucleotides complementary to the C3 mRNA transcript (SEQ ID NO: 75). For example, in some embodiments, the double-stranded siRNA includes an antisense strand containing one of the sequences from SEQ ID NOs: 300 to 324.

[0096] [Table 4]

[0097] In some embodiments, the double-stranded siRNA includes one of the sequences SEQ ID NOs. 300-324, but also includes an antisense strand lacking a "U" at its 5' end.

[0098] In some embodiments, the antisense strand includes an overhang containing one or more nucleotides that are not complementary to the C3 mRNA transcript (SEQ ID NO: 75). In some embodiments, the antisense strand includes an overhang containing 1, 2, 3, 4, 5, or 6 nucleotides that are not complementary to the C3 mRNA transcript (SEQ ID NO: 75). In one example, the overhang includes a 3' overhang on the antisense strand and / or sense strand containing 1, 2, or 3 uracil nucleotides. In one example, the overhang includes a 3' overhang on the antisense strand and / or sense strand containing 1, 2, or 3 adenine nucleotides.

[0099] In some embodiments, the dual-stranded siRNA includes an antisense strand containing the sequences listed in Table 5 below.

[0100] [Table 5]

[0101] In some embodiments, the double-stranded siRNA includes an antisense strand containing the sequences listed in Table 6 below.

[0102] [Table 6]

[0103] In some embodiments, the siRNA may include a 5'-phosphate group and / or a 3'-hydroxyl group (e.g., one or both ends of the sense strand and / or one or both ends of the antisense strand), and / or one or more additional modifications as described herein.

[0104] V. Qualification In some embodiments, the inhibitory RNA (e.g., siRNA or miRNA) of the Disclosure comprises one or more native nucleic acid bases and / or one or more modified nucleic acid bases derived from native nucleic acid bases. Examples, but not limited to, include uracil, thymine, adenine, cytosine, and guanine, each amino group protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs, e.g., pseudoisocytosine and pseudouracil, as well as other modified nucleic acid bases, e.g., 8-substituted purines, xanthine or hypoxanthine (the latter two being natural degradation products). Examples of modified nucleic acid bases include Chiu This information is disclosed in and Rana, RNA, 2003, 9, 1034-1048, Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.

[0105] Modified nucleic acid bases also include size-enlarged nucleic acid bases to which one or more aryl rings, such as a phenyl ring, have been added. Nucleic acid base substitutions are described in the Glen Research catalog (www.glenresearch.com); Krueger AT et al, Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner SA, et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627, and are expected to be useful for the siRNA molecules described herein. Modified nucleic acid bases also include structures that are not considered nucleic acid bases but are other parts, such as choline or porphyrin-derived rings, for example, but are not limited to these. Porphyrin-derived base substitutions are described by Morales-Rojas,H This is described in and Kool, ET, Org. Lett., 2002, 4, 4377-4380.

[0106] In some embodiments, the modified nucleic acid base is optionally substituted with one of the following structures: [ka]

[0107] In some embodiments, the modified nucleic acid bases are fluorescent. Examples of such fluorescently modified nucleic acid bases include phenanthrene, pyrene, stilbene, isoxanthine, isozanthopterin, terphenyl, terthiophene, benzoterthiophene, coumarin, lumazine, tethered stillbene, benzouracil, and naphthouracil, as shown below: [ka]

[0108] In some embodiments, the modified nucleic acid base is not substituted. In some embodiments, the modified nucleic acid base is substituted. In some embodiments, the modified nucleic acid base is substituted to include, for example, a heteroatom, alkyl group, or fluorescent moiety, biotin or avidin moiety, or a linking moiety that binds to another protein or peptide. In some embodiments, the modified nucleic acid base is not a nucleic acid base in the most classical sense, but is a "universal base" that functions similarly to a nucleic acid base. A typical example of such a universal base is 3-nitropyrrole.

[0109] In some embodiments, the siRNAs described herein include nucleosides incorporating modified nucleic acid bases and / or nucleic acid bases covalently to modified sugars. Some examples of nucleosides incorporating modified nucleic acid bases include 4-acetylcytidine, 5-(carboxyhydroxylmethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseudridine, beta, D-galactosylquyeosin, 2'-O-methylguanosine, N 6- Isopentenyladenosine, 1-methyladenosine, 1-methylpseudridine, 1-methylguanosine, l-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, N 7- Methylguanosine, 3-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytosine, 5-carboxycytosine, N 6- Methyladenosine, 7-methylguanosine, 5-methylaminoethyluridine, 5-methoxyaminomethyl-2-thiouridine, beta, D-mannosylqueosin, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N 6Examples include isopentenyladenosine, N-((9-beta,D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-beta,D-ribofuranosylpurine-6-yl)-N-methylcarbamoyl)threonine, uridine-5-oxyacetate methyl ester, uridine-5-oxyacetate(v), pseudouridine, cueosin, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2'-O-methyl-5-methyluridine, and 2'-O-methyluridine.

[0110] In some embodiments, the nucleoside includes a 6'-modified bicyclic nucleoside analog having either (R) or (S)-chirality at the 6' position, such as the analog described in U.S. Patent No. 7,399,845. In some embodiments, the nucleoside includes a 5'-modified bicyclic nucleoside analog having either (R) or (S)-chirality at the 5' position, such as the analog described in U.S. Patent Application Publication 20070287831. In some embodiments, the nucleic acid base or modified nucleic acid base is 5-bromouracil, 5-iodoluracil, or 2,6-diaminopurine. In some embodiments, the nucleic acid base or modified nucleic acid base is modified by substitution with a fluorescent moiety.

[0111] Methods for making modified nucleobases are described, for example, in U.S. Patent Nos. 3,687,808, 4,845,205, 5,130,30, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,457,191, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, 5,587,469, 5,594,121, 5,596,091, 5,614,617, 5,681,941, 5,750,692, 6,015,886, 6,147,200, 6,166,197, 6,222,025, 6,235,887, 6,380,368, 6,528,640, 6,639,062, 6,617,438, 7,045,610, 7,427,672, and 7,495,088.

[0112] In some embodiments, the siRNAs described herein contain one or more modified nucleotides, in which case the phosphate group or linking phosphorus in the nucleotide is linked to various positions of the sugar or modified sugar. As non-limiting examples, the phosphate group or linking phosphorus can be linked to the 2′, 3′, 4′, or 5′ hydroxyl moieties of the sugar or modified sugar. Nucleotides incorporating the modified nucleobases described herein are also contemplated in this background.

[0113] Other modified sugars can also be incorporated into the siRNA molecule. In some embodiments, the modified sugar contains one or more substituents at the 2′ position, including one of the following: -F, -CF3, -CN, -N3, -NO, -NO2, -OR′, -SR′, or -N(R′)2, where R′ is independently defined as above and as described herein; -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl) or -N(C1-C 10 alkyl)2; -O-(C2-C 10 alkenyl), -S-(C2-C 10Alkenyl), -NH-(C2-C 10 Alkenyl) or -N(C2-C 10 Alkenyl)2;-O-(C2-C 10 Alkinyl), -S-(C2-C 10 Alkinyl), -NH-(C2-C 10 Alkinyl) or -N(C2-C 10 Alkinyl)2; or -O--(C1-C 10 Alkylene)-O--(C1-C 10 Alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 Alkyl), or -O-(C1-C 10 Alkylene)-NH(C1-C 10 Alkyl)2,-NH-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl) where alkyl, alkylene, alkenyl and alkynyl may be substituted or unsubstituted. Examples of substituents are not limited to -O(CH2) n OCH3 and -O(CH2) n NH2 is an example, where n is 1 to approximately 10, MOE, DMAOE, DMAEOE. Also, in this specification, WO2001 / 088198 and Martin et al. Modified sugars described in al., Helv. Chim. Acta, 1995, 78, 486-504 are also expected. In some embodiments, the modified sugar comprises one or more groups selected from substituted silyl groups, RNA cleavage groups, reporter groups, fluorescent labels, intercalators, groups for improving the pharmacokinetic properties of nucleic acids, groups for improving the pharmacodynamic properties of nucleic acids, or other substituents having similar properties. In some embodiments, the modification is carried out at one or more of the 2', 3', 4', 5', or 6' positions of the sugar or modified sugar, including the 3' position of the sugar on the 3' terminal nucleotide or the 5' position of the 5' terminal nucleotide.

[0114] In some embodiments, the 2'-OH group of ribose is substituted with a substituent comprising one of the following: -H, -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, where R' is independently defined above and as described herein; -O-(C1-C 10 Alkyl), -S-(C1-C 10 Alkyl), -NH-(C1-C 10 Alkyl) or -N(C1-C 10 Alkyl)2;-O-(C2-C 10 Alkenyl), -S-(C2-C 10 Alkenyl), -NH-(C2-C 10 Alkenyl) or -N(C2-C 10 Alkenyl)2;-O-(C2-C 10 Alkinyl), -S-(C2-C 10 Alkinyl), -NH-(C2-C 10 Alkinyl) or -N(C2-C 10 Alkinyl)2; or -O--(C1-C 10 Alkylene)-O--(C1-C 10 Alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 Alkyl), or -O-(C1-C 10 Alkylene)-NH(C1-C 10 Alkyl)2,-NH-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 Alkylene)-O-(C1-C 10 In the formula, alkyl, alkylene, alkenyl and alkynyl may or may not be substituted. In some embodiments, 2'-OH is substituted with -H (deoxyribose). In some embodiments, 2'-OH is substituted with -F. In some embodiments, 2'-OH is substituted with -OR'. In some embodiments, 2'-OH is substituted with -OMe. In some embodiments, 2'-OH is substituted with -OCH2CH2OMe.

[0115] Modified sugars also include loc nucleic acid (LNA). In some embodiments, the loc nucleic acid has the structure shown below: The following loc nucleic acid is shown, where Ba represents a nucleic acid base or modified nucleic acid base as described herein, and R 2s It is -OCH2C4'-. [ka]

[0116] In some embodiments, the modified sugar is an ENA as described, for example, in Seth et al., J Am Chem Soc. 2010 October 27;132(42):14942-14950. In some embodiments, the modified sugar is any of those found in XNAs (heteronucleotides), such as arabinose, anhydrohexitol, threose, 2'-fluoroarabinose, or cyclohexene.

[0117] Modified sugars include sugar mimes such as cyclobutyl or cyclopentyl moieties that replace pentofuranosyl sugars (see, for example, U.S. Patents 4,981,957, 5,118,800, 5,319,080, and 5,359,044). Some expected modified sugars include sugars in which the oxygen atom in the ribose ring is replaced with nitrogen, sulfur, selenium, or carbon. In some embodiments, the modified sugar is a modified ribose in which the oxygen atom in the ribose ring is replaced with nitrogen, and the nitrogen is optionally replaced with an alkyl group (e.g., methyl, ethyl, isopropyl, etc.).

[0118] Non-limiting examples of modified sugars include glycerol, which forms glycerol nucleic acid (GNA) analogs. Examples of GNA analogs are described in Zhang, R et al., J.Am.Chem.Soc., 2008, 130, 5846-5847; Zhang L, et al., J.Am.Chem.Soc., 2005, 127, 4174-4175 and Tsai CH et al., PNAS, 2007, 14598-14603. Another example of a GNA-derived analog is flexible nucleic acid (FNA) based on a mixed acetal aminal of formylglycerol, described in Joyce GF et al., PNAS, 1987, 84, 4398-4402 and Heuberger BD, and Switzer C, J.Am.Chem.Soc., 2008, 130, 412-413. Additional non-limiting examples of modified sugars include hexopyranosyl (6'-4'), pentopyranosyl (4'-2'), pentopyranosyl (4'-3'), or tetrofuranosyl (3'-2').

[0119] Modified sugars and sugar mimes can be prepared by methods known in the art, including, but not limited to, the following: A. Eschenmoser, Science (1999), 284:2118; M. Bohringer et al, Helv. Chim. Acta (1992), 75:1416-1477; M. Egli et al, J. Am. Chem. Soc. (2006), 128(33):10847-56; A. Eschenmoser in Chemical Synthesis: Gnosis to Prognosis, C. Chatgilialoglu and V. Sniekus, Ed., (Kluwer Academic, Netherlands, 1996), p.293; K.-U. Schoning et al, Science (2000), 290:1347-1351; A. Eschenmoser et al, Helv. Chim. Acta (1992), 75:218; J. Hunziker et al, Helv. Chim. Acta (1993), 76:259; G. Otting et al, Helv. Chim. Acta (1993), 76:2701; K. Groebke et al, Helv. Chim. Acta (1998), 81:375; and A. Eschenmoser, Science (1999), 284:2118. Modifications for the 2' modification can be found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134, and in all references in that document. Specific modifications to ribose can be found in the following literature: 2'-fluoro(Kawasaki et.al., J.Med.Chem., 1993, 36, 831-841), 2'-MOE(Martin, P.Helv.Chim.Acta) 1996, 79, 1930-1938), "LNA" (Wengel, J.Acc.Chem.Res. 1999, 32, 301-310), PCT International Patent Application Publication WO2012 / 030683.

[0120] In certain embodiments, various nucleotide modifications or nucleotide modification patterns may be selectively used in either the sense strand or antisense strand of the inhibitory RNA (e.g., siRNA) described herein. For example, in some embodiments, unmodified ribonucleotides may be used in the antisense strand (at least within its double-stranded portion), while modified nucleotides and / or modified or unmodified deoxyribonucleotides may be employed at some or all positions of the sense strand. In some embodiments, a particular modification pattern is employed across some or all of one or both strands of the siRNA. Nucleotide modifications may be present in any of various patterns. For example, alternating patterns may be used. For example, the antisense strand, the sense strand, or both may have 2'-O-methyl modifications or 2'-fluoro modifications on every other nucleotide. In some embodiments, the inhibitory RNA (e.g., siRNA) contains a sense strand and / or antisense strand, each containing at least one unmodified nucleotide.

[0121] In some embodiments, the sense strand and / or antisense strand include one or more motifs of three identical modifications on three consecutive nucleotides. For example, in some embodiments, a double-stranded siRNA includes one or more motifs of three identical modifications on three consecutive nucleotides in the sense strand, antisense strand, or both. In some embodiments, such motifs may be present at or near the cleavage sites of either strand or both strands. Examples of such motifs are described in U.S. Patent Application Publications 20150197746, 20150247143, and 20160298124.

[0122] In some embodiments, the inhibitory RNA (e.g., siRNA) is a blunt-ended strand 19 nucleotides long, in which the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end. In some embodiments, the inhibitory RNA (e.g., siRNA) is a double-ended strand 20 nucleotides long, in which the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end. In some embodiments, the inhibitory RNA (e.g., siRNA) is a 21-nucleotide blunt-ended strand, in which the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0123] In some embodiments, the inhibitory RNA (e.g., siRNA) comprises a sense strand of 19 nucleotides and an antisense strand of 21 nucleotides, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, wherein one end of the inhibitory RNA (e.g., siRNA) is a blunt end and the other end contains a 2-nucleotide overhang. Preferably, the 2-nucleotide overhang is at the 3' end of the antisense strand. When the 2-nucleotide overhang is at the 3' end of the antisense strand, there may be two phosphorothioate nucleotide-nucleotide bonds between the three terminal nucleotides, wherein two of the three nucleotides are the overhang nucleotide and the third nucleotide is the pairing nucleotide adjacent to the overhang nucleotide. In some embodiments, the inhibitory RNA (e.g., siRNA) further has two phosphorothioate internucleotide bonds between the three terminal nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand. In some embodiments, each nucleotide in the sense and antisense strands of the inhibitory RNA (e.g., siRNA), including a nucleotide that is part of a motif, is a modified nucleotide. In some embodiments, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example, in an alternating motif.

[0124] In some embodiments, the inhibitory RNA (e.g., siRNA) comprises a sense strand of 19 nucleotides and an antisense strand of 21 nucleotides, in which (i) the sense strand comprises 2'-F modifications at positions 3, 7, 8, 9, 12 and 17 from the 5' end, (ii) the sense strand comprises 2'-O-methyl modifications at positions 1, 2, 4, 5, 6, 10, 11, 13, 14, 15, 16, 18 and 19 from the 5' end, and (iii) the antisense strand (iv) The antisense strand includes 2'-F modifications at positions 2 and 14 from the 5' end, and (iv) the antisense strand includes 2'-O-methyl modifications at positions 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, 20 and 21 from the 5' end, in which case one end of the inhibitory RNA (e.g., siRNA) is blunt and the other end includes a 2-nucleotide overhang at the 3' end of the antisense strand. In some embodiments, the inhibitory RNA (e.g., siRNA) includes an antisense strand with two phosphorothioate internucleotide bonds between the three terminal nucleotides at the 3' end, in which case two of the three nucleotides are overhang nucleotides and the third nucleotide is a pairing nucleotide adjacent to the overhang nucleotide. In some embodiments, the inhibitory RNA (e.g., siRNA) further has two phosphorothioate nucleotide interbonds between the three terminal nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand.

[0125] In some embodiments, each nucleotide in the sense and antisense strands of an inhibitory RNA (e.g., siRNA), including nucleotides that are part of a motif, may be modified. Each nucleotide may be modified with the same or different modifications, which may include alteration of one or more oxygens of one or both of the unbound phosphate groups and / or alteration of one or more oxygens of the bound phosphate group; alteration of components of the ribose sugar, e.g., alteration of the 2' hydroxyl on the ribose sugar; "dephosphorylation" linkers and large-scale substitutions of the phosphate moiety; alteration or substitution of native bases; and substitution or modification of the ribose-phosphate backbone.

[0126] In some embodiments, at least 50%, 60%, 70%, 80%, 90%, or more, e.g., 100%, of the residues in the sense strand and antisense strand are independently modified with LNA, CRN, cET, UNA, HNA (1,5-anhydrohexitol nucleic acid), CeNA (cyclohexenyl nucleic acid, i.e., a DNA mimetic in which deoxyribose is substituted with a 6-membered cyclohexene ring), 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The strands may contain multiple modifications. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, or more, e.g., 100%, of the sense strand and antisense strand are independently modified with 2'-O-methyl or 2'-fluoro. In some embodiments, at least two different modifications are present on the sense strand and antisense strand. These two modifications may be 2'-O-methyl modifications, 2'-fluoro modifications, or other modifications.

[0127] In some embodiments, the sense and antisense strands of a double-stranded inhibitory RNA (e.g., siRNA) include one of the modification patterns described as patterns 1-5 in Figure 1. In Figure 1, at any given position, "2OM" represents a 2'-O-methyl modification, and "2F" represents a 2'-fluoro modification. "PS" represents a phosphorothioate bond between the nucleotide at the position indicated by "PS" and the adjacent nucleotide 3' to the position indicated by "PS". In some embodiments, one of the antisense strands disclosed in SEQ ID NOs. 176-200 and 300-324 may be modified according to one of the antisense strand (AS) modification patterns 1-5 disclosed in Figure 1. In some embodiments, one of the sense strands disclosed in SEQ ID NOs. 126-150 may be modified according to one of the sense strand (SS) modification patterns 1-5 disclosed in Figure 1. In some embodiments, the sense strand and / or antisense strand of the double-stranded inhibitory RNA (e.g., siRNA) contains one of the modification patterns shown as patterns 1 to 5 in Figure 1, but position 1, 2, 3, or 4 of either the sense strand or / or antisense strand does not contain the modification shown at position 1, 2, 3, or 4 in one of patterns 1 to 5.

[0128] In some embodiments, the siRNA comprises one of modification patterns 1 to 5 (shown in Figure 1) and further comprises phosphorothioate bonds between the last two, three, or four nucleotides of (i) the 5' end of the sense strand, (ii) the 3' end of the sense strand, (iii) the 5' end of the antisense strand, and / or (iv) the 3' end of the antisense strand. For example, in some embodiments, the siRNA comprises (i) a sense strand containing a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; (ii) a sense strand containing a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end; (iii) an antisense strand containing a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; and / or (iv) an antisense strand containing a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0129] In some embodiments, the siRNA may be modified according to any one of the modification patterns 1 to 5 in Figure 1, and may be conjugated with a ligand, for example, as described herein. In some such cases, the ligand may be attached to either the 3' or 5' end of the sense strand or antisense strand. In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15: 1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to a terminal (e.g., the 3' or 5' end of the sense strand or antisense strand), and the siRNA does not contain a phosphorothioate bond between two, three, or four nucleotides at the ligand-conjugated terminal. For example, in some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand conjugated to the 5' end of a sense strand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein), and the siRNA comprises (i) a sense strand without a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 5' end, (ii) a sense strand with a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand with a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, and (iv) an antisense strand with a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0130] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 3' end of the sense strand, and the siRNA comprises: (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; (ii) a sense strand not having a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 3' end; (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0131] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 5' end of an antisense strand, and the siRNA comprises (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand without a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 5' end, and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0132] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 3' end of an antisense strand, and the siRNA comprises (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, and (iv) an antisense strand without a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 3' end.

[0133] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to a terminal (e.g., the 3' or 5' end of the sense or antisense strand), wherein the siRNA contains a phosphorothioate bond between two, three, or four nucleotides at the ligand-conjugated terminal.

[0134] For example, in some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 5' end of the sense strand, and the siRNA comprises (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 5' end, (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0135] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 3' end of the sense strand, and the siRNA comprises: (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 3' end; (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end; and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0136] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 5' end of an antisense strand, and the siRNA comprises (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 5' end, and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end.

[0137] In some embodiments, the siRNA (e.g., any of the siRNAs listed in Tables 10 and 15:1 to 57, e.g., siRNAs 22, 32, and 53) comprises a ligand (e.g., a GalNAc ligand, e.g., GalNAc of formula XD or formula XE as described herein) conjugated to the 3' end of an antisense strand, and the siRNA comprises (i) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, (ii) a sense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 3' end and between the nucleotides at positions 2 and 3 from the 3' end, (iii) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1 and 2 from the 5' end and between the nucleotides at positions 2 and 3 from the 5' end, and (iv) an antisense strand having a phosphorothioate bond between the nucleotides at positions 1, 2, 3, or 4 from the 3' end.

[0138] In some embodiments, the sense strand and / or antisense strand include alternating pattern modifications. As used herein, the term “alternating motif” refers to a motif having one or more modifications, each modification occurring on alternating bases of one or more nucleotides on a single strand. For example, alternating nucleotides may refer to one nucleotide every other nucleotide, or one nucleotide every three nucleotides, and similar patterns. For example, if A, B, and C each represent a certain type of modification to a nucleotide, the alternating motif may be “ABABABABABAB…”, “AABBAABBAABB…”, “AABAABAABAAB…”, “AAABAAABAAAB…”, “AAABBBAAABBB…”, or “ABCABCABCABC…”, etc.

[0139] The types of modifications included in the alternating motif may be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternating pattern, i.e., the modifications on every other nucleotide, may be the same, but the sense strand and antisense strand may each be selected from several possible modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0140] In some embodiments, the inhibitory RNA (e.g., siRNA) includes a modification pattern for alternating motifs on the sense strand, which is shifted relative to the modification pattern for alternating motifs on the antisense strand. The shift may be such that the modified nucleotide groups on the sense strand correspond to different modified nucleotide groups on the antisense strand, and vice versa. For example, when paired with an antisense strand in a dsRNA double helix, within the double helix portion, the alternating motifs in the sense strand may begin with "ABABAB" from 5' to 3' of the strand, and the alternating motifs in the antisense strand may begin with "BAB ABA" from 5' to 3' of the strand. As another example, within the double helix portion, the alternating motifs in the sense strand may begin with "AABBAABB" from 5' to 3' of the strand, and the alternating motifs in the antisense strand may begin with "BBAABBAA" from 5' to 3' of the strand. As a result, there is a complete or partial shift in the modification patterns between the sense strand and the antisense strand.

[0141] In some embodiments, the inhibitory RNA (e.g., siRNA) has a pattern of alternating 2'-O-methyl and 2'-F modifications on the sense strand, which is shifted relative to the pattern of alternating 2'-O-methyl and 2'-F modifications on the antisense strand. That is, the 2'-O-methyl modified nucleotides on the sense strand base-pair with the 2'-F modified nucleotides on the antisense strand, and vice versa. The sense strand may begin at position 1 with a 2'-F modification, and the antisense strand may begin at position 1 with a 2'-O-methyl modification.

[0142] In some embodiments, one or more of the three identical modification motifs may be introduced into three consecutive nucleotides on the sense and / or antisense strands to interrupt the initial modification pattern present on the sense and / or antisense strands. In some embodiments, the three identical modification motifs on three consecutive nucleotides are introduced into either of the two strands, and the modification of the nucleotide adjacent to the motif is a different modification from that of the motif. For example, in the sequence portion containing the motif "...NaYYYNb...", "Y" represents the modification of the three identical modification motifs on three consecutive nucleotides, and "Na" and "Nb" represent modifications to nucleotides different from the modification of Y adjacent to the motif "YYY", where Na and Nb may be the same modification or different modifications.

[0143] The inhibitory RNA (e.g., siRNA) may further contain at least one phosphorothioate internucleotide bond or a methylphosphonate internucleotide bond. In some embodiments, the internucleotide bond modification may be present on each nucleotide of the sense strand and / or antisense strand, each internucleotide bond modification may be present in an alternating pattern of the sense strand and / or antisense strand, or the sense strand or antisense strand may contain both internucleotide bond modifications in an alternating pattern. The alternating pattern of internucleotide bond modifications on the sense strand may be the same as or different from that of the antisense strand. The alternating pattern of internucleotide bond modifications on the sense strand may have a shift relative to the alternating pattern of internucleotide bond modifications on the antisense strand. In some embodiments, the inhibitory RNA (e.g., siRNA) contains 6 to 8 phosphorothioate internucleotide bonds. In some embodiments, the antisense strand includes two phosphorothioate nucleotide interbonds at its 5' end and two phosphorothioate nucleotide interbonds at its 3' end, while the sense strand includes at least two phosphorothioate nucleotide interbonds at either its 5' or 3' end.

[0144] In certain embodiments, the inhibitory RNA (e.g., siRNA) may have any of the arrangement and / or modification patterns described in the claims of either or both of the following publications: WO / 2015 / 089368, p. 59 (line 20) to p. 65 (line 15), or the corresponding paragraphs

[0469] to

[0537] of U.S. Patent Application Publication 20160298124. For example, in some embodiments, the inhibitory RNA (e.g., siRNA) comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, and the antisense strand comprises a region complementary to a portion of mRNA encoding C3 (e.g., the target region as described herein), and each strand is approximately 14 to approximately 30 nucleotides long, and the substance is represented by formula (III): Sense: 5'-N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p’ -N a’ -(X'X'X') k -N b’ -Y'Y'Y'-N b’ -(Z'Z'Z') l -N a’ -n q’ 5'

[0145] In the formula, i, j, k, and 1 are each independently 0 or 1, and p, p', q, and q' are each independently 0 to 6, and each N a and N a ' independently represents an oligonucleotide sequence containing 0 to 25 nucleotides that are either modified, unmodified, or a combination thereof, and each sequence contains at least two different modified nucleotides, N b and N b Each of the ' independently represents an oligonucleotide sequence containing 0 to 10 nucleotides, which are either modified, unmodified, or a combination thereof, n p , np ’, n q , and n q ’ may each be present or absent, each independently representing an overhang nucleotide, and XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications of three consecutive nucleotides, and N b ’s modification is different from that of Y, and N b ’s modification is different from that of Y’, and the sense strand is conjugated to at least one ligand. In some embodiments, i is 0, or j is 0, or i is 1, or j is 1, or both i and j are 0, or both i and j are 1. In some embodiments, XXX is complementary to X’X’X’, YYY is complementary to Y’Y’Y’, and ZZZ is complementary to Z’Z’Z’. It should be understood that each X may contain a different base as long as each X contains the same modification. For example, XXX may represent AGC, in which case each nucleotide contains a 2-F modification. Similarly, each X’, each Y, each Y’, each Z, and each Z’ may be different.

[0146] In some embodiments, formula (III) is represented by formula (IIIa):

[0147] Sense: 5’n p -N a -YYY-N a -n q 3’ Antisense: 3’n p’ -N a’ -Y’Y’Y’-N a’ -n q’ 5’

[0148] Or formula (III) is represented by formula (IIIb):

[0149] Sense: 5’n p -N a -YYY-N b -ZZZ-N a -n q3' Antisense: 3'n p’ -N a’ -Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5'

[0150] Wherein, N b and N b’ each independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides. Or formula (III) is represented by formula (IIIc):

[0151] Sense: 5'n p -N a -XXX-N b -YYY-N a -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N a’ -n q’ 5'

[0152] Wherein, N b and N b’ each independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides. Or formula (III) is represented by formula (IIId):

[0153] Sense: 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5

[0154] Wherein, N b and N b’Each of these independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides, N a and N a’ Each of these independently represents an oligonucleotide sequence containing 2 to 10 modified nucleotides.

[0155] In some embodiments, the nucleotide modification is selected from the group consisting of LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.

[0156] In some embodiments, the nucleotide modification is a 2'-O-methyl modification or a 2'-fluoro modification. In some embodiments, the ligand is one or more GalNAc derivatives linked via a divalent or trivalent branched linker. In some embodiments, the ligand is represented by formula XA, formula XB, or formula XC, or by another GalNAc structure shown below.

[0157] In some embodiments, the ligand is bound to the 3' end of the sense strand. In some embodiments, the binding is as shown in formula XD below.

[0158] In some embodiments, the inhibitory RNA (e.g., siRNA) further includes at least one phosphorothioate nucleotide linkage or methylphosphonate nucleotide linkage.

[0159] In some embodiments, p'>0 or p'=2.

[0160] In some embodiments, q'=0, p=0, q=0, and the p' overhang nucleotide is complementary to the C3 mRNA. In some embodiments, q'=0, p=0, q=0, and the p' overhang nucleotide is not complementary to the C3 mRNA.

[0161] In some embodiments, at least one n p’ However, it is bound to an adjacent nucleotide via a phosphorothioate bond.

[0162] In some embodiments, the ligand targets nucleic acid molecules in hepatocytes. For example, in some embodiments, the ligand binds to hepatocyte-specific asialoglycoprotein receptors (ASGPRs), and the ligand includes, for example, galactose derivatives such as GalNAc.

[0163] In some embodiments, the inhibitory RNA (e.g., siRNA) is conjugated to or physically associated with one or more moieties, which modulate the inhibitory RNA (e.g., siRNA) such as enhancing its activity, stability, cell distribution and / or cell uptake, and / or modulating one or more physical properties of the inhibitory RNA (e.g., siRNA), such as charge or solubility. In some embodiments, the moieties may include antibodies or ligands. The ligands may be carbohydrates, lectins, proteins, glycoproteins, lipids, cholesterol, steroids, bile acids, nucleic acid hormones, growth factors, or receptors. In some embodiments, bioinactive variants of naturally occurring hormones, growth factors, or other ligands may be used. In some embodiments, the moieties include a targeting moiety that targets the inhibitory RNA (e.g., siRNA) to a specific cell type, such as hepatocytes. In some embodiments, the targeting moiety binds to a hepatocyte-specific asialoglycoprotein receptor (ASGPR).

[0164] In some embodiments, the portion is bound to inhibitory RNA (e.g., siRNA) via a reversible ligation. “Reversible ligation” is a ligation that includes a reversible ligation. “Reversible ligation” (also called an unstable ligation or cleavable ligation) is a covalent bond other than a hydrogen atom that, under selected conditions, can be selectively broken or cleaved more rapidly than other bonds in the molecule, and such bond can be selectively broken or cleaved under conditions that do not substantially break or cleave other covalent bonds in the same molecule. The cleavage or instability of a bond is determined by the half-life (t) of the cleavage. 1 / 2 ) may be expressed in units of (time required for half of the bond to be cleaved). Unless otherwise indicated, in this specification, a reversible bond is a “physiologically reversible bond,” meaning that the bond can be cleaved under conditions normally encountered or under conditions similar to those encountered in mammals. A physiologically reversible linkage is a linkage that includes at least one physiologically reversible bond. In some embodiments, a physiologically reversible bond is reversible under mammalian intracellular conditions, which include, for example, chemical conditions such as pH, temperature, oxidation or reduction conditions or substances, and salt concentration that are present or similar to those present in mammalian cells. Mammalian intracellular conditions also include the presence of enzyme activity normally present in mammalian cells, such as proteolytic enzymes or hydrolytic enzymes. Enzymatically unstable bonds are cleaved by enzymes in the body, such as intracellular enzymes. pH-unstable bonds are cleaved at a pH of 7.0 or less. Examples of reversible binding and ligation, as well as its use for conjugating portions to inhibitory RNA (e.g., siRNA), are described, for example, in U.S. Patent Application Publications 20130281685 and 20150273081.

[0165] In some embodiments, the portion includes a protein transduction domain (PTD). A protein transduction domain is a polypeptide or portion that facilitates the uptake of a heterologous molecule bound to the domain (the heterologous molecule may also be referred to as "cargo"). A protein transduction domain that is a peptide may also be referred to as a cell penetrating peptide (CPP). Numerous protein transduction domains / peptides are known in the art. PTDs include a variety of native or synthetic arginine-rich peptides. Arginine-rich peptides are peptides containing at least 30% arginine residues, e.g., at least 40%, 50%, 60%, or more arginine residues. Examples of PTDs include TAT (at least amino acids 49-56), Antenopedia homeodomain, HSV VP22, and polyarginine. Such peptides may be cationic, hydrophobic, or amphiphilic, and may include non-standard amino acids and / or various modifications or variations, such as cyclic substitutions, inverso, retro, retro-inverso, or peptide-mimicking versions. The binding of the PTD to the cargo may be covalent or non-covalent.

[0166] Exemplary PTDs that may be used are described in U.S. Patent Application Publications 20090093026, 20090093425, 20120142763, 20150238516, and 20160215022. A PTD may comprise two or more PTDs (e.g., 2 to 10 PTDs), which may be the same or different. PTDs may be directly linked to one another or separated by linking portions, which may comprise one or more amino acids and / or one or more non-amino acid portions, such as alkyl chains or oligoethylene glycol portions.

[0167] In some embodiments, inhibitory RNA (e.g., siRNA) contains or is physically associated with an anionic charge neutralizing moiety. An anionic charge neutralizing moiety refers to a molecule or chemical group that can reduce the overall net anionic charge of the nucleic acid to which the moiety is physically associated. One or more anionic charge neutralizing molecules or groups may be associated with the nucleic acid, in which case each independently contributes to a decrease in anionic charge and / or an increase in cationic charge. Charge neutralization means that the anionic charge of the nucleic acid is reduced, neutralized, or becomes more cationic than that of the nucleic acid in the absence of the anionic charge neutralizing molecule or group. Phosphodiester protecting groups and / or phosphothioate protecting groups are examples of anionic charge neutralizing groups. In some embodiments, inhibitory RNA (e.g., siRNA) contains one or more protecting groups at one or more positions that reduce the net anionic charge of a backbone containing a negatively charged group (e.g., a phosphodiester backbone or a phosphorothioate backbone). In some embodiments, a negatively charged phosphodiester backbone is neutralized by synthesis using a biologically reversible phosphotriester protecting group, which is then converted into an intracellular charged phosphodiester bond by the action of cytoplasmic thioesterase. This results in a biologically active substance for expression inhibition, such as an inhibitory RNA (siRNA) that can mediated RNAi. Such substances are sometimes referred to as short interfering ribonucleic neutrals (siRNNs) and can also function as siRNA prodrugs. It should be understood that the backbone does not need to be completely neutralized (i.e., completely uncharged). In some embodiments, 5% to 100% of the phosphate groups, e.g., 25% to 50%, 50% to 75%, or 75% to 100%, are protected. In specific embodiments, at least 5, 6, 7, 8, 9, or 10 phosphate groups on one or both chains are protected.Examples of useful phosphodiester protecting groups and / or phosphothioate protecting groups, methods for their preparation, and their applications in nucleic acids (e.g., for the preparation of RNAi prodrugs) are described in U.S. Patent Application Publications 20110294869, 20090093425, 20120142763, and 20150238516. In various embodiments, the siRNA may contain any of the modifications described herein. For example, in some embodiments, the siRNA may contain a 2' sugar modification (e.g., 2'-F, 2'-O-Me). Furthermore, the siRNN may have any of the configurations or modification patterns described herein.

[0168] In some embodiments, the moiety attached to the inhibitory RNA (e.g., siRNA) includes a carbohydrate. Typical carbohydrates include monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units. In certain embodiments, the carbohydrate includes galactose or galactose derivatives, such as galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-iso-butanoylgalactosamine. In some embodiments for a particular subject, the galactose derivative includes N-acetylgalactosamine (GalNAc). In certain embodiments, the moiety includes multiple galactose or galactose derivative entities, such as multiple N-acetylgalactosamine moieties, such as three GalNAc moieties. As used herein, the term “galactose derivative” includes both galactose and galactose derivatives, where the galactose derivative has an affinity for asialoclycoprotein receptors equal to or greater than that of galactose. The term “galactose cluster” refers to a structure comprising at least two galactose derivatives, which are physically linked to one another, typically by covalent bonding to another part. In some embodiments, a galactose cluster has 2 to 10 (e.g., 6) or 2 to 4 (e.g., 3) terminal galactose derivatives. The terminal galactose derivatives may be attached to another part via the C-1 carbon of the galactose derivative. In some embodiments, two or more, for example, three galactose derivatives, may be attached to a part that can function as a branching point and can be attached to inhibitory RNA (e.g., siRNA). In some embodiments, the galactose derivatives are linked to the part that functions as a branching point via a linker or spacer. In some embodiments, the part that functions as a branching point may be attached to inhibitory RNA (e.g., siRNA) via a linker or spacer. For example, in some embodiments, the galactose derivative is added to the branch point via a linker or spacer containing an amide, carbonyl, alkyl, oligoethylene glycol moiety, or a combination thereof.In some embodiments, the linker or spacer attached to each galactose derivative is identical. In some embodiments, the galactose cluster has three terminal galactosamines or galactosamine derivatives (e.g., GalNAc), each having affinity for the asialoglycoprotein receptor. A structure in which three terminal GalNAc moieties are attached to a branching point (e.g., via the C-1 carbon of a sugar) is sometimes referred to as tri-antennary N-acetylgalactosamine (GalNAc3). In some embodiments, one or more monomeric units containing galactose derivatives may be incorporated into site-specific inhibitory RNA (e.g., siRNA). Such monomeric units containing galactose derivatives may include galactose derivatives such as GalNAc attached to a nucleoside moiety or a non-nucleoside moiety. In some embodiments, at least three nucleoside-GalNAc monomers or at least three non-nucleoside-GalNAc monomers are site-specifically incorporated into the inhibitory RNA (e.g., siRNA). In some embodiments, such incorporation may occur during solid-phase synthesis using phosphoramidite chemistry or via post-synthetic conjugation. In some embodiments, monomer units containing galactose derivatives are linked to each other via phosphodiester bonds and / or to the nucleoside of the inhibitory RNA (e.g., siRNA) that does not have galactose derivatives attached. In some embodiments, monomer units containing two, three or more galactose derivatives are arranged sequentially, i.e., without any intervening units that do not contain galactose derivatives. In some embodiments, monomer units containing carbohydrates, e.g., galactose clusters, e.g., triantennae-type N-acetylgalactosamine, or two or more GalNAc molecules are located at the ends of the chain, such as the 3' end of the sense strand or the 5' end of the antisense strand.Exemplary carbohydrates (e.g., galactose clusters), monomeric units containing galactose derivatives, carbohydrate modification inhibitory RNA, and methods for producing and using them are described in U.S. Patent Application Publications 20090203135, 20090239814, 20110207799, 20120157509, 20150247143, US Pub.'124; Nair, JK, et al., J.Am. Chem. Soc. 136, 16958-16961 (2014); Matsuda, S., et al., ACS Chem. Biol. 10, 1181-1187 (2015); Rajeev, K., et al., ChemBioChem 16, 903-908 (2015); Migawa, MT., et al., Bioorg Med Chem This is described in Lett.26(9):2194-7(2016); Prakash,TP,et al.,J Med Chem.59(6):2718-33(2016). An example of a galactose cluster is shown below.

[0169] [ka]

[0170] Formula XA

[0171] [ka]

[0172] Formula XB

[0173] [ka]

[0174] Formula XC

[0175] An additional GalNAc structure is shown below (and can be synthesized as described in Sharma et al., Bioconjug. Chem. 29:2478-2488 (2018)). [ka] In some embodiments, m=0 and n=2. In some embodiments, m=1 and n=1. In some embodiments, m=1 and n=2. In some embodiments, m=1 and n=3. [ka]

[0176] Those skilled in the art will recognize that the structure of the junction connecting each GalNAc to a branching point can vary. In some embodiments, inhibitory RNA (e.g., siRNA) is conjugated to GalNAc as shown below: [ka]

[0177] Formula XD (wherein the formula, the GalNAc may be conjugated to either the 3' or 5' end of either strand (e.g., the sense strand)). [ka]

[0178] Formula XE

[0179] In some embodiments, inhibitory RNA (e.g., siRNA, e.g., any of the siRNAs listed in Tables 10 and 15: 1 to 57, e.g., siRNAs 22, 32, and 53) is conjugated to a GalNAc ligand (e.g., GalNAc of formula XD or formula XE).

[0180] In some embodiments, a GalNAc ligand (e.g., shown in formula XD or formula XE) is conjugated to the 3' terminal nucleotide of the sense or antisense strand of an siRNA (e.g., any one of siRNA:1 to 57, e.g., siRNA22, 32, and 53). In some embodiments, the GalNAc ligand (e.g., shown in formula XD or formula XE) is conjugated to the 3' position of a sugar on the 3' terminal nucleotide of the sense or antisense strand of the siRNA.

[0181] In some embodiments, a GalNAc ligand (e.g., shown in formula XD or formula XE) is conjugated to the 5' terminal nucleotide of the sense or antisense strand of an siRNA (e.g., any one of siRNA:1 to 57, e.g., siRNA22, 32, and 53). In some embodiments, a GalNAc ligand (e.g., shown in formula XD or formula XE) is conjugated at the 5' position of the 5' terminal nucleotide of the sense or antisense strand of an siRNA.

[0182] In some embodiments, when an inhibitory RNA (e.g., siRNAs of sequence numbers 1-57, e.g., siRNAs 22, 32, and 53) is conjugated to a ligand (e.g., a GalNAc ligand), the inhibitory RNA does not need to include modifications (e.g., phosphorothioate linkages "PS") to the nucleotide conjugated to the ligand.

[0183] In some embodiments, an siRNA (e.g., any of siRNA:1 to 57, e.g., siRNA22, 32, and 53) is conjugated at one end of the sense or antisense strand to a GalNAc ligand (e.g., shown in formula XD or formula XE). In some embodiments, the other three ends not conjugated to the GalNAc ligand contain modifications, such as phosphorothioate bonds (PS). In some embodiments, the modifications include PS bonds between two, three, or four nucleotides at the 5' or 3' ends. In some embodiments, the ends conjugated to the GalNAc ligand do not contain phosphorothioate bonds between two, three, or four nucleotides at the 5' or 3' ends.

[0184] In some embodiments, the siRNAs described herein can be conjugated to the galactose structure shown below: [ka]

[0185] In some embodiments, the linker comprises an amide, carbonyl, alkyl, oligoethylene glycol moiety, or a combination thereof.

[0186] In some embodiments, the siRNAs described herein can be conjugated to the galactose structure shown below: [ka]

[0187] In some embodiments, the linker comprises an amide, carbonyl, alkyl, oligoethylene glycol moiety, or a combination thereof.

[0188] Methods for synthesizing GalNAc ligands, methods for conjugating GalNAc ligands to inhibitory RNA, and additional GalNAc ligands are publicly known in the art, including, for example, those described in WO2017 / 021385, WO2017 / 178656, WO2018 / 215391, WO2019 / 145543, WO2017 / 084987, WO2017 / 055423, and WO2012 / 083046. These documents are incorporated herein by reference in their entirety.

[0189] In some embodiments, the inhibitory RNA (e.g., siRNA) is conjugated to a ligand as shown below: [ka]

[0190] In the formula, X is either O or S. In most embodiments, X is O. Those skilled in the art will recognize that the structure of the linking portion that connects the galactose cluster to the phosphate group can vary.

[0191] In certain embodiments, the portion includes a lipophilic portion. In some embodiments, the lipophilic portion includes tocopherol, such as alpha-tocopherol. In some embodiments, the lipophilic portion includes cholesterol. In some embodiments, the lipophilic compound includes an alkyl group or heteroalkyl group. In some embodiments, the lipophilic compound includes palmitoyl, hexadeca-8-enoyl, oleyl, (9E,12E)-octadeca-9,12-dienoyl, dioctanoyl, or C16-C20 acyl. In some embodiments, the lipophilic portion includes at least 16 carbon atoms. In some embodiments, the lipophilic portion includes -(CH) n -NH-(C=O)-(CH) mContains -CH3. In some embodiments, n and m are each independently 1 to 20. In some embodiments, n+m is at least 10, 12, 14, or 16. In some embodiments, the lipophilic moiety is as shown below and / or is added to the sugar moiety as shown below. [ka]

[0192] In general, the moiety may be attached to a terminal or internal subunit of an inhibitory RNA (e.g., siRNA). In some embodiments, the moiety is attached to a modified subunit of an inhibitory RNA (e.g., siRNA). Those skilled in the art will recognize suitable methods for producing nucleic acids having a conjugated moiety. A nucleic acid chain containing a modified nucleotide with a reactive functional group may react with a moiety containing a second reactive functional group, in which case the first and second reactive functional groups can react with each other under conditions suitable for maintaining the structure of the nucleic acid chain. In some embodiments, the moiety may be attached to a sense or antisense chain and subsequently hybridized with an antisense or sense chain complementary to that chain, respectively. In some embodiments, the chain may be hybridized to form a double helix and then the moiety may be incorporated. In general, various conjugation methods described herein may be used. See, for example, Hermanson, G., Bioconjugate Techniques, 2nd ed., Academic Press, San Diego, 2008.

[0193] In some embodiments, the inhibitory RNA (e.g., siRNA) is a chimeric siRNA. As used herein, “chimeric” siRNA comprises two or more chemically distinct regions, each consisting of at least one monomeric unit, in which case the regions confer distinct properties to the compound. In some embodiments, at least one region is modified to give the siRNA increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to target nucleic acids. At least one additional region of the siRNA may function as a substrate for an enzyme (e.g., RNase H) capable of cleaving RNA:DNA or RNA:RNA hybrids. In some embodiments, at least one region of the siRNA may function as a substrate for an enzyme (e.g., RNase H) capable of cleaving RNA:DNA or RNA:RNA hybrids, and at least one region may inhibit translation by steric inhibition.

[0194] In some embodiments, the inhibitory RNA (e.g., siRNA) described herein may be introduced into target cells as annealed double-stranded siRNA. In some embodiments, the inhibitory RNA (e.g., siRNA) described herein is introduced into target cells as single-stranded sense and antisense nucleic acid sequences and anneals to form an inhibitory RNA (e.g., siRNA) double helix upon entry into the target cells. Alternatively, the sense and antisense strands of the inhibitory RNA (e.g., siRNA) may be encoded by an expression vector (e.g., an expression vector described herein) introduced into the target cells. Once expressed in the target cells, the transcribed sense and antisense strands can anneal to reconstruct the inhibitory RNA (e.g., siRNA).

[0195] The inhibitory RNAs described herein (e.g., siRNA or miRNA, or vectors containing nucleotide sequences encoding siRNA or miRNA) can be synthesized by standard methods known in the art, such as using an automated synthesizer. RNA produced by such methodologies tends to be highly pure and efficiently anneal to form inhibitory RNA (e.g., siRNA) double helix. After chemical synthesis, the single-stranded RNA molecules can be deprotected, annealed to form siRNA, and purified (e.g., by gel electrophoresis or HPLC). Alternatively, in vitro transcription of RNA from a DNA template can be performed using standard procedures, such as supporting one or more RNA polymerase promoter sequences (e.g., T7 or SP6 RNA polymerase promoter sequences). Protocols for the preparation of siRNA using T7 RNA polymerase are publicly known in the art (see, for example, Donze and Picard, Nucleic Acids Res. 2002;30:e46, and Yu et al., Proc. Natl. Acad. Sci. USA 2002;99:6047-6052). Sense and antisense transcripts may be synthesized in two independent reactions followed by annealing, or they may be synthesized simultaneously in a single reaction.

[0196] Inhibitory RNA (e.g., siRNA or miRNA) may be formed intracellularly by transcription of RNA from an expression construct introduced into the cell (see, e.g., Yu et al., Proc. Natl. Acad. Sci. USA 2002;99:6047-6052). An expression construct for in vivo production of inhibitory RNA (e.g., siRNA) may include one or more siRNA coding sequences operably ligated to factors necessary for proper transcription of the siRNA coding sequence, such as promoter factors and transcription termination signals. Preferred promoters for use in such expression constructs include the polymerase-III HI-RNA promoter (see, e.g., Brummelkamp et al., Science 2002;296:550-553) and the U6 polymerase-III promoter (see, e.g., Sui et al., Proc.Natl.Acad.Sci.USA 2002; Paul et al., Nature Biotechnol. 2002;20:505-508; and Yu et al., Proc.Natl.Acad.Sci.USA 2002;99:6047-6052). The siRNA expression construct may further include one or more vector sequences to facilitate the cloning of the expression construct. A standard vector that may be used is, for example, the pSilencer 2.0-U6 vector (Ambion Inc., Austin, Texas).

[0197] VI. Expression Vectors In some embodiments, the inhibitory RNAs described herein are delivered to a target (e.g., target cells, e.g., target liver cells) using an expression vector. Many forms of vectors can be used to deliver the inhibitory RNAs described herein. Non-limiting examples of expression vectors include viral vectors (e.g., vectors suitable for gene therapy), plasmid vectors, bacteriophage vectors, cosmids, phagemids, and artificial chromosomes.

[0198] In some embodiments, the nucleotide sequences encoding the inhibitory RNA described herein are incorporated into a viral vector. Non-limiting examples of viral vectors include retroviruses (e.g., Moloney's mouse leukemia virus (MMLV), Harvey's mouse sarcoma virus, mouse mammary tumor virus, Rous sarcoma virus), adenoviruses, adeno-associated viruses, SV40 viruses, polyomaviruses, Epstein-Barr virus, papillomaviruses, herpesviruses, vaccinia viruses, and polioviruses.

[0199] In vivo, many complement proteins, including C3, are primarily synthesized in the liver. Therefore, in some embodiments, hepatocytes are the target of inhibitory RNA delivery as described herein. Retroviral vectors (see, e.g., Axelrod et al., PNAS 87:5173-5177 (1990); Kay et al., Hum. Gene Ther. 3:641-647 (1992); Van den Driessche et al., PNAS 96:10379-10384 (1999); Xu et al., ASAIO J. 49:407-416 (2003); and Xu et al., PNAS 102:6080-6085 (2005)), lentiviral vectors (see, e.g., McKay et al., Curr. Pharm. Des. 17:2528-2541 (2011); Brown et al., Blood 109:2797-2805 (2007); and Matrai et al., Hepatology) See 53:1696-1707 (2011), adeno-associated virus (AAV) vectors (see, e.g., Herzog et al., Blood 91:4600-4607 (1998)), and adenovirus vectors (see, e.g., Brown et al., Blood 103:804-810 (2004) and Ehrhardt et al.) Several viral vectors, including al., Blood 99:3923-3930 (2002), have been shown to have the ability to deliver gene therapy constructs to the liver.

[0200] Retroviruses are enveloped viruses belonging to the Retroviridae family. Once inside a host cell, the virus replicates by transcribing its RNA into DNA using the viral reverse transcriptase enzyme. The DNA of the retrovirus is replicated as part of the host genome and is called a provirus. The selected nucleic acid can be inserted into a vector and packaged into retroviral particles using techniques known in the art. Protocols for generating replication-defective retroviruses are known in the art (see, for example, Kriegler, M., Gene Transfer and Expression, A Laboratory Manual, W.H. Freeman Co., New York (1990) and Murry, E.J., Methods in Molecular Biology, Vol. 7, Humana Press, Inc., Cliffton, N.J. (1991)). The recombinant virus can then be isolated and delivered to the target cells either in vivo or ex vivo. Many retroviral systems are known in the art; see, for example, U.S. Patent Nos. 5,994,136, 6,165,782, and 6,428,953. Retroviruses include the genera Alpharetrovirus (e.g., avian leukosis virus), Betaretrovirus (e.g., mouse mammary tumor virus), Deltaretrovirus (e.g., bovine leukemia virus and human T-lymphotropic virus), Epsilonretrovirus (e.g., walleye dermal sarcoma virus), and Lentivirus.

[0201] In some embodiments, the retrovirus is a lentivirus of the Retroviridae family. Lentiviral vectors can transduce non-proliferating cells and exhibit low immunogenicity. In some examples, the lentivirus includes, but is not limited to, human immunodeficiency virus (HIV-1 and HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia (EIA), and visna virus. Vectors derived from lentiviruses can achieve significant levels of nucleic acid delivery in vivo.

[0202] In some embodiments, the vector is an adenoviral vector. Adenoviruses are large viruses that contain double-stranded DNA. Adenoviruses replicate in the nucleus of host cells and use the host cell machinery to synthesize viral RNA, DNA, and proteins. Adenoviruses are known in the art to infect both replicating and non-replicating cells, accommodate large transgenes, and encode proteins without integrating into the host cell genome.

[0203] In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. AAV systems are generally known in the art (see, for example, Kelleher and Vos, Biotechniques, 17(6):1110-17(1994); Cotten et al., P.N.A.S.U.S.A., 89(13):6094-98(1992); Curiel, Nat Immun, 13(2-3):141-64(1994); Muzyczka, Curr Top Microbiol Immunol, 158:97-129(1992); and Asokan A, et al., Mol.Ther., 20(4):699-708(2012). Methods for making and using recombinant AAV vectors (rAAV) are described, for example, in U.S. Pat. Nos. 5,139,941 and 4,797,368.

[0204] Several AAV serotypes have been characterized, including AAV1, AAV2, AAV3 (e.g., AAV3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11, as well as their variants. Generally, any AAV serotype may be used to deliver the inhibitory RNA described herein. However, serotypes have different directivity, for example, serotypes preferentially infect different tissues. In one embodiment, since complement proteins are produced in the liver, AAV serotypes are selected based on liver directivity, which has been found in at least serotypes AAV2, AAV3 (e.g., AAV3B), AAV5, AAV7, AAV8, and AAV9 (see, e.g., Shaoyong et al., Mol.Ther.23:1867-1876 (2015)).

[0205] The AAV sequence of an rAAV vector typically contains cis-acting 5' and 3' terminal inverted repeat sequences (see, e.g., B.J. Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequence is approximately 145 bp long. In some embodiments, substantially the entire sequence encoding the ITR is used in the rAAV vector, although some minor modifications to these sequences are permissible. The skill to modify these ITR sequences is within the scope of the skills of this art. (e.g., Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, New) See books such as York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996). An example of an rAAV vector in this disclosure is a “cis-acting” plasmid containing a transgene (e.g., a nucleic acid encoding an inhibitory RNA as described herein), in which the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. The AAV ITR sequences may be obtained from any known AAV, including currently identified mammalian AAV types.

[0206] In addition to the key elements identified above for rAAV vectors, vectors may also include conventional regulatory elements operably ligated to the transgene in a manner that enables its transcription, translation, and / or expression in cells transfected with the vector or in cells infected with the virus produced by this disclosure. Expression regulatory sequences include sequences for appropriate transcription start, termination, promoter, and enhancer; efficient RNA processing signals such as splicing and polyadenylation (poly-A) signals; sequences for stabilizing cytoplasmic mRNA; sequences for enhancing translation efficiency (i.e., Kozak sequences); sequences for enhancing protein stability; and, if desired, sequences for enhancing the secretion of encoded products. Numerous expression regulatory sequences, including promoters that are innate, structural, inducible, and / or tissue-specific, are known in the art and may be included in the vectors described herein. In some embodiments, the operably ligated coding sequences give rise to functional RNA (e.g., miRNA or siRNA).

[0207] Examples of structural promoters include, but are not limited to, the retroviral Roussarcoma virus (RSV) LTR promoter (optionally accompanied by an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally accompanied by a CMV enhancer), the SV40 promoter, and the dihydrofolate reductase promoter. Inducible promoters allow for the regulation of gene expression and can be controlled by exogenously supplied compounds, such as environmental factors like temperature, or by specific physiological conditions such as the acute phase, specific differentiation states of cells, or only by replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but are not limited to, Invitrogen, Clontech, and Ariad. Many other systems have been reported and can be easily selected by those skilled in the art. Examples of inducible promoters controlled by exogenously supplied promoters include the zinc-inducible sheep metallothione (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system, the ecdysone insect promoter, the tetracycline repressor system, the tetracycline inducing system, the RU486-inducing system, and the rapamycin inducing system. Further types of inducible promoters that may be useful in this context are promoters controlled by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of cells, or only by replicating cells. In another embodiment, a native promoter or fragment thereof for a transgene is used. In a further embodiment, native expression may be mimicked by using other native expression regulatory elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences.

[0208] In some embodiments, the regulatory sequence confers tissue-specific gene expression ability. In some cases, the tissue-specific regulatory sequence binds to a tissue-specific transcription factor that induces transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. In some embodiments, the promoter is the chicken β-actin promoter, the pol II promoter, or the pol III promoter.

[0209] In some embodiments, rAAV is designed to express the inhibitory RNA described herein in hepatocytes, and rAAV comprises one or more liver-specific regulatory elements that substantially restrict the expression of the inhibitory RNA to hepatocytes. Generally, liver-specific regulators may be derived from any gene known to be exclusively expressed in the liver. WO2009 / 130208 identifies several genes expressed in a liver-specific manner, including serpin peptidase inhibitor and clade A Member 1 includes α-antitrypsin (SERPINA1; GeneID 5265), apolipoprotein CI (APOC1; GeneID 341), apolipoprotein C-IV (APOC4; GeneID 346), apolipoprotein H (APOH; GeneID 350), transthyretin (TTR; GeneID 7276), albumin (ALB; GeneID 213), aldolase B (ALDOB; GeneID 229), cytochrome P450, Family 2, subfamily E, polypeptide 1 (CYP2E1; GeneID 1571), fibrinogen alpha chain (FGA; GeneID 2243), transferrin (TF; GeneID 7018), and haptoglobin-related protein (HPR; GeneID 3250). In some embodiments, the viral vectors described herein include liver-specific regulators derived from one or more genomic loci of these proteins. In some embodiments, the promoter may be the liver-specific promoter thyroxin-binding globulin (TBG). Alternatively, other liver-specific promoters may be used (e.g., Liver Specific Gene Promoter Database, Cold Spring Harbor, http: / / rulai.cshl.edu / LSPD / , e.g., alpha-1 anti-trypsin (A1AT); human albumin (Miyatake et al.) See al., J. Virol. 71:5124 32 (1997); humA1b; hepatitis B virus core promoter (Sandig et al., Gene Ther. 3:1002 9 (1996)); or LSP1. Additional vectors and regulators are described, for example, in Baruteau et al., J. Inherit. Metab. Dis. 40:497-517 (2017).

[0210] In some embodiments, the viral vector (e.g., the rAAV vector) includes a DNA sequence encoding an inhibitory RNA as described herein.

[0211] In some embodiments, the vector (e.g., a viral vector) comprises one or more nucleotide sequences encoding multiple (e.g., two, three, four, five, or more) miRNAs or siRNAs, each containing a nucleic acid chain complementary to a target portion of a C3 transcript, such as C3 mRNA (SEQ ID NO: 75). In some embodiments, the vector comprises multiple nucleotide sequences, each encoding one of the various inhibitory RNAs described herein. In some embodiments, the vector comprises multiple nucleotide sequences encoding at least two different inhibitory RNAs, at least two of which are copies of the same inhibitory RNA described herein.

[0212] In some embodiments, in addition to one or more sequences encoding one or more inhibitory RNAs described herein, the vector (e.g., a viral vector) includes one or more additional nucleotide sequences encoding one or more C3 inhibitors, such as C3 inhibitors described herein. For example, the C3 inhibitor may be a polypeptide inhibitor and / or a nucleic acid aptamer (see, for example, U.S. Patent Application Publication 20030191084). Examples of polypeptide inhibitors include compstatin analogs (e.g., compstatin analogs described herein that contain genetically encoding amino acids), anti-C3 antibodies or anti-C3b antibodies (e.g., scFv or single-domain antibodies, e.g., nanobodies), enzymes that degrade C3 or C3b (e.g., see U.S. Patent No. 6,676,943), or mammalian complement regulatory proteins (e.g., CR1, DAF, MCP, CFH, CFI, C1 inhibitors (C1-INH), soluble form of complement receptor 1 (sCR1), TP10 or TP20 (Avant)). Examples include Therapeutics, Inc., or parts thereof. Additional polypeptide inhibitors include minifactor H (e.g., U.S. Patent Application Publication 20150110766), Staphylococcus aureus-derived Efb protein or complement inhibitor (SCIN) protein, or variants, derivatives, or mimics thereof (see, for example, U.S. Patent Application Publication 20140371133).

[0213] In some embodiments, the polypeptide inhibitor is linked to a secretion signal sequence, causing the polypeptide to be secreted from the host cell.

[0214] VII. Generating Expression Vectors Methods for obtaining expression vectors such as rAAV are known in this field. Typically, the method involves culturing a host cell containing sufficient helper functions to package the recombinant AAV vector into the AAV capsid protein or a fragment thereof, a functional rep gene, an AAV terminal inverted repeat (ITR), and an transgene, and / or the recombinant AAV vector into the AAV capsid protein.

[0215] To package the rAAV vector into the AAV capsid, the components cultured in the host cell may be provided to the host cell in trans. Alternatively, any one or more required components (e.g., recombinant AAV vector, rep sequence, cap sequence, and / or helper function) may be provided by a stable host cell manipulated to contain the one or more required components using methods known to those skilled in the art. In some embodiments, such a stable host cell contains the required components under the control of an inductive promoter. In other embodiments, the required components may be under the control of a structural promoter. In other embodiments, a selected stable host cell may contain a selected component under the control of a structural promoter and other selected components under the control of one or more inductive promoters. For example, a stable host cell may be prepared that is derived from 293 cells (containing the E1 helper function under the control of a structural promoter) but contains the rep protein and / or cap protein under the control of an inductive promoter. Other stable host cells can be prepared by those skilled in the art using routine methods.

[0216] The recombinant AAV vector, rep sequence, cap sequence, and helper function necessary for constructing the rAAV of this disclosure may be delivered to a packaging host cell using any suitable gene element (e.g., a vector). The selected gene element may be delivered by any suitable method known in the art, including genetic engineering, recombination, and synthesis techniques, for example, by any suitable method known to a person skilled in the art with skills in nucleic acid manipulation (see, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY). Similarly, methods for constructing rAAV virions are also known and any suitable method may be used in conjunction with this disclosure (see, for example, K. Fisher et al, J. Virol., 70:520-532 (1993) and USPat. No. 5, 478, 745).

[0217] In some embodiments, recombinant AAVs may be prepared using a triple transfection method (e.g., as described in U.S. Patent No. 6,001,650). In some embodiments, recombinant AAVs are prepared by transfecting host cells with a recombinant AAV vector (containing the transgene) and packaging them into AAV particles, an AAV helper functional vector, and an accessory functional vector. The AAV helper functional vector encodes "AAV helper functional" sequences (i.e., rep and cap) and functions in trans for productive AAV replication and capsid encapsulation. In some embodiments, the AAV helper functional vector supports the efficient production of AAV vectors without producing detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in this disclosure include the pHLP19 vector (e.g., U.S. Patent No. 6,001,650) and the pRep6cap6 vector (e.g., U.S. Patent No. 6,156,303). Accessory functional vectors encode nucleotide sequences related to non-AAV viral and / or cellular functions on which AAV replication depends. Accessory functions include, but are not limited to, functions necessary for AAV replication, such as activation of AAV gene transcription, stage-specific splicing of AAV mRNA, replication of AAV DNA, synthesis of cap expression products, and assembly of the AAV capsid. Accessory functions of viral systems can be derived from any known helper virus, such as adenoviruses, herpesviruses (other than herpes simplex virus type 1), and vacciniaviruses.

[0218] In some embodiments, this disclosure provides transfected host cells. The term “transfection” refers to the uptake of exogenous DNA by a cell, and a cell is “transfected” when the exogenous DNA is introduced inside the cell membrane. Numerous transfection techniques are generally known in the art (e.g., Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; and Chu See et al. (1981) Gene 13:197). Using such techniques, one or more exogenous nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, can be introduced into suitable host cells.

[0219] In some embodiments, the host cell is a mammalian cell. The host cell may be used as the recipient of the AAV helper construct, AAV minigene plasmid, accessory function vector, and / or other transfer DNA associated with the production of recombinant AAV. The term includes the progeny cells of the transfected original cell. Thus, as used herein, “host cell” may refer to a cell transfected with an exogenous DNA sequence. Progeny cells of a single parental cell may not necessarily be completely identical to the original parent in morphology or genomic or overall DNA complementation due to natural, accidental, or intentional mutations.

[0220] Further methods for constructing and isolating AAV viral vectors suitable for delivery to target are described, for example, in U.S. Patents 7,790,449, 7,282,199, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and 7,588,772. In one system, a producing cell line is transiently transfected with a construct encoding a transgene adjacent to the ITR, as well as constructs encoding rep and cap. In another system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding a transgene adjacent to the ITR. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, and rAAV is isolated from the contaminating virus. The other systems do not require infection with a helper virus to restore AAV. In other words, the functions of helpers (i.e., adenoviruses E1, E2a, and E4, or herpesviruses UL5, UL8, UL52, and UL29, as well as herpesvirus polymerases) are also supplied trans by the system. In such a system, the helper functions can be supplied by transiently transfecting cells with constructs encoding the helper functions. Alternatively, cells can be manipulated to stably contain genes encoding the helper functions, and their expression can be controlled at the transcriptional or post-transcriptional level.

[0221] In yet another system, the transgene adjacent to the ITR and the rep / cap genes are introduced into insect host cells by infection with a baculovirus-based vector. Such production systems are known in the art (see, for example, Zhang et al., 2009, Human Gene Therapy 20:922-929). The preparation methods and use methods of these AAV production systems and other AAV production systems are also described in U.S. Patent Nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0222] The foregoing methods for making recombinant vectors are not intended to be limiting, and other suitable methods will be apparent to those skilled in the art.

[0223] VIII. Compositions and Administration Inhibitory RNAs (e.g., siRNAs or miRNAs described herein), or vectors comprising nucleotide sequences encoding the siRNAs or miRNAs described herein, can be used to treat complement-mediated diseases or disorders in a subject afflicted with or susceptible to a complement-mediated disease or disorder as described herein. The route of administration and / or mode of administration of the inhibitory RNAs described herein can vary depending on the desired result. Those skilled in the art, i.e., physicians, recognize that the dosing regimen can be adjusted to provide a desired response, such as a therapeutic response. The methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal (e.g., intracapsular or via lumbar puncture), intravaginal, transdermal, rectal, inhalation or topical, particularly topical administration to the ear, nose, eye or skin. In some embodiments, the composition of the inhibitory RNA is delivered to the central nervous system (CNS), for example, via intracerebroventricular administration. The method of administration is left to the discretion of the physician.

[0224] Those skilled in the art will understand that a vector comprising inhibitory RNA (e.g., siRNA or miRNA as described herein), or a nucleotide sequence encoding siRNA or miRNA as described herein, can be delivered to the CNS (e.g., via intrathecal administration) to treat diseases or disorders affecting the CNS, such as multiple sclerosis, Parkinson's disease, Huntington's disease, Alzheimer's disease, other chronic demyelinating diseases (e.g., neuromyelitis optica), amyotrophic lateral sclerosis, chronic pain, stroke, allergic neuritis, progressive supranuclear palsy, Lewy body dementia (i.e., dementia with Lewy bodies, or Parkinson's disease dementia), frontotemporal dementia, traumatic brain injury, traumatic spinal cord injury, multiple system atrophy, chronic traumatic encephalopathy, Creutzfeldt-Jakob disease, and leptomeningeal metastasis.

[0225] The delivery of inhibitory RNAs (e.g., siRNAs) to cells described herein can be achieved in many different ways. In vivo delivery may be carried out by administering a composition containing the inhibitory RNA to the target, for example, via parenteral administration routes, such as subcutaneous, intravenous, or intramuscular administration.

[0226] In some embodiments, the inhibitory RNA is associated with a delivery agent. “Delivery agent” means a substance or entity that, either non-covalently or covalently associated with the inhibitory RNA, or administered co-administered with the inhibitory RNA, performs one or more functions that enhance the stability and / or efficacy of the bioactive agent beyond what would occur if the bioactive agent were delivered (administered to a target) in the absence of the delivery agent. For example, the delivery agent may protect the inhibitory RNA from degradation (e.g., in the blood), facilitate the entry of the inhibitory RNA into a cell, or facilitate its entry into a target cell compartment (e.g., the cytoplasm), and / or enhance its association with a specific cell containing the molecular target being regulated. Those skilled in the art will recognize many delivery agents that can be used to deliver inhibitory RNA, such as siRNA. For an overview of some of these techniques, see Kanasty, R., et al. Nat Mater. 12(11):967-77 (2013). In some embodiments, for systemic administration of inhibitory RNA, the inhibitory RNA may be associated with a delivery agent such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. While we do not wish to be bound by any theory, it is thought that positively charged cationic delivery systems facilitate the binding of negatively charged inhibitory RNA and further enhance negatively charged interactions at the cell membrane, thereby efficiently taking up the inhibitory RNA into cells. Lipids (e.g., cationic or neutral lipids), dendrimers, or polymers may be conjugated to the inhibitory RNA or form vesicles or micelles that encapsulate the inhibitory RNA. Methods for constructing and administering complexes containing cationic agents and inhibitory RNA are known in the art. In some embodiments, it is anticipated that one of the delivery agents described in particular in U.S. Patent Application Publication 20160298124 will be used. In some embodiments, the inhibitory RNA forms a complex with cyclodextrin for systemic administration. In some embodiments, the inhibitory RNA is administered associated with lipids or lipid-containing particles.In some embodiments, the inhibitory RNA is administered in association with a cationic polymer (which may be a polypeptide or a non-polypeptide polymer), a lipid, a peptide, PEG, a cyclodextrin, or a combination thereof, and may be in the form of nanoparticles or microparticles. The lipid or peptide may be cationic. "Nanoparticles" refer to particles with a two-dimensional or three-dimensional length greater than 1 nanometer (nm) and less than about 150 nm, for example, 20 nm to 50 nm or 50 nm to 100 nm. "Microparticles" refer to particles with a two-dimensional or three-dimensional length greater than 150 nm and less than about 1000 nm. Nanoparticles may have a targeting moiety and / or a cell membrane permeable moiety, or a membrane active moiety, which are covalently or acovalently bonded to the nanoparticle. Nanoparticles such as lipid nanoparticles are described in Tatiparti et al., Nanomaterials 7:77 (2017). Exemplary delivery agents, methods of preparation, and methods of use for the delivery of inhibitory RNA are described in U.S. Patents 7,427,605, 8,158,601, 9,012,498, 9,415,109, 9,062,021, and 9,402,816. In some embodiments, the use of a delivery technique known in the art as “Smarticles” is expected. In some embodiments, the use of a delivery technique known in the art as “stable nucleic acid lipid particles (SNALPs)” is expected, in which the nucleic acid to be delivered is encapsulated in a lipid bilayer containing a mixture of cationic and fusion lipids and is also coated with a diffusible polyethylene glycol-lipid (PEG-lipid) conjugate that provides a neutral, hydrophilic exterior.

[0227] In some embodiments, the delivery agent includes one or more amino alcohol cationic lipids, such as those described in U.S.C. 9,044,512.

[0228] In some embodiments, the delivery agent comprises one or more amino acid lipids. Amino acid lipids are molecules containing amino acid residues (e.g., arginine, homoarginine, noarginine, nor-noarginine, ornithine, lysine, homolysine, histidine, 1-methylhistidine, pyridylalanine, asparagine, N-ethylasparagine, glutamine, 4-aminophenylalanine, its N-methylated form, and its side-chain modified derivatives) and one or more lipophilic tails. Exemplary amino acid lipids and their use for delivering nucleic acids are described in U.S. Patent Application Publication 20110117125, and U.S. Patents 8,877,729, 9,139,554, and 9,339,461. In some embodiments, membrane-soluble poly(amidoamine) polymers and polyconjugates, such as those described in U.S. Patent Application Publication 20130289207, may be used. In some embodiments, the delivery agent comprises a lipopeptide compound comprising a central peptide with lipophilic groups attached to each end. In some embodiments, the lipophilic groups may be derived from naturally occurring lipids. In some embodiments, the lipophilic groups may include C(1-22)alkyl, C(6-12)cycloalkyl, C(6-12)cycloalkyl-alkyl, C(3-18)alkenyl, C(3-18)alkynyl, C(1-5)alkoxy-C(1-5)alkyl, or sphinganine, or (2R,3R)-2-amino-1,3-octadecanediol, eicosusphinganine, sphingosine, phytosphingosine, or cis-4-sphingenin. The central peptide may comprise a cationic or amphiphilic amino acid sequence. Examples of such lipopeptides and their use for delivering nucleic acids are described, for example, in U.S. Patent No. 9,220,785.

[0229] A “masking moiety” means a molecule or group that, when physically linked with another agent (e.g., a polymer), shields, inhibits, or inactivates one or more properties (biophysical or biochemical properties) or the activity of a drug. In some embodiments, the masking moiety may be covalently or noncovalently attached to the inhibitory RNA. The masking moiety may be reversible. This means that the masking moiety, when attached to the inhibitory RNA, masks the inhibitory RNA via reversible ligation. As those skilled in the art will understand, a sufficient number of masking moieties are ligated to the inhibitory RNA to be masked in order to achieve the desired level of inactivation.

[0230] In some embodiments, the inhibitory RNA is conjugated to a delivery agent that is a polymer. Useful delivery polymers include, for example, poly(acrylic acid) polymers (see, e.g., U.S. Patent Application Publication 20150104408), poly(vinyl ester) polymers (see, e.g., U.S. Patent Application Publication 20150110732), and certain polypeptides. In some embodiments, the delivery polymer is a reversibly masked membrane-active polymer. In some embodiments, the inhibitory RNA or the polymer, or both, is conjugated to a targeting moiety. In some embodiments, the inhibitory RNA, or the inhibitory RNA-targeting moiety conjugate, is administered co-administered with the delivery polymer but is not conjugated to the polymer. In this context, “co-administered” means that the inhibitory RNA and the delivery polymer are administered to the target so that they are present in the target for an overlapping period. The inhibitory RNA-targeting moiety conjugate and the delivery polymer may be administered simultaneously or sequentially. For co-administration, they may be mixed before administration. For sequential administration, either the inhibitory RNA or the delivery polymer may be administered first. The inhibitory RNA and the delivery polymer may be administered in the same composition, or they may be administered separately and in close proximity to each other for a time interval such that cytoplasmic delivery of the inhibitory RNA to cells is enhanced compared to cytoplasmic delivery without the polymer. In some embodiments, the inhibitory RNA and the delivery polymer are administered with intervals of 15 minutes or less, 30 minutes or less, 60 minutes or less, or 120 minutes or less. In some embodiments, the delivery polymer is a targeted and reversibly masked membrane-active polymer. The polymer is modified by adding a targeting moiety to target the polymer to cells where enhanced cytoplasmic delivery of the inhibitory RNA is desired. The inhibitory RNA may be targeted to the same cells, and optionally the same targeting moiety may be used. That is, the inhibitory RNA may be administered as an inhibitory RNA-targeting moiety conjugate.As used herein, a membrane-active polymer is a surface-active, amphiphilic polymer that can induce one or more of the following effects on a biological membrane: altering or disrupting the membrane to allow non-membrane-permeable molecules to enter or traverse the membrane, forming pores in the membrane, dividing the membrane, or disrupting or lysing the membrane. As used herein, a membrane, or cell membrane, includes a lipid bilayer. The alteration or disruption of the membrane can be functionally defined by the activity of the polymer in at least one of the following assays: erythrocyte lysis (hemolysis), liposome leakage, liposome fusion, cell fusion, cell lysis, and endosomal release. A membrane-active polymer may enhance the delivery of polynucleotides to cells by disrupting or destabilizing the cell membrane or internal vesicular membrane (e.g., endosomes or lysosomes), for example by forming pores in the membrane, or by disrupting endosomal vesicles or lysosomal vesicles to release their contents into the cytoplasm. In some embodiments, the targeted, reversibly masked membrane-active polymer is an endosomal-soluble polymer. An endosomal-soluble polymer is a polymer that can cause endosome disruption or lysis in response to a change in pH, or a polymer that can otherwise release normally membrane-impermeable compounds, such as polynucleotides or proteins, from internal membrane-encapsulated vesicles, such as endosomes or lysosomes. In some embodiments, the polymer is a reversibly modified amphiphilic membrane-active polyamine, in which case the reversible modification inhibits membrane activity, neutralizes the polyamine, reduces its positive charge, and forms a nearly neutral charged polymer. The reversible modification may provide cell-type specific targeting of the polymer and / or inhibit nonspecific interactions. The polyamine may be reversibly modified via reversible modification of the amine on the polyamine. A reversibly masked membrane-active polymer is substantially non-membrane-active when masked, but becomes membrane-active when the masking is removed. The masking portion is generally covalently bonded to the membrane-active polymer via physiologically reversible linkages.By using physiologically reversible conjugations, the masking portion can be detached from the polymer in vivo, thereby demasking the polymer and restoring the activity of the demasked polymer. By selecting an appropriate reversible conjugation, the activity of the membrane-active polymer is restored after the conjugate is delivered to or targeted to a desired cell type or location. The reversibility of the conjugation provides selective activation of the membrane-active polymer. Physiologically reversible conjugations are reversible under mammalian intracellular conditions, which include, for example, pH, temperature, oxidation or reduction conditions or substances, and chemical conditions such as salt concentration that are present or similar to those present in mammalian cells. In some embodiments, the targeted portion, e.g., the ASGPR-targeted portion, can function as the masking portion. In some embodiments, the ASGPR-targeted portion is conjugated with a lipophilic portion. Exemplary targeting moieties (e.g., ASGPR targeting moieties), physiologically unstable bindings (e.g., enzymatically unstable bindings, pH unstable bindings), masking moieties, membrane-active polymers (e.g., polymers active for endosomal lysis), lipophilic moieties, RNAi agent-targeting moiety conjugates, delivery agent-targeting moiety conjugates, conjugates comprising RNAi agents, targeting moieties and delivery agents, and methods for delivering nucleic acids to cells (e.g., hepatocytes) are described in U.S. Patent Application Publications 20130245091, 20130317079, 20120157509, 20120165393, 20120172412, 20120230938, 20140135380, 20140135381, 20150104408, and 20150110732. In some embodiments, the inhibitory RNA is administered co-administered with, for example, the mellitin peptide described in U.S. Patent Application Publication 20120165393. The inhibitory RNA, the mellitin peptide, or both may optionally conjugate the targeting moiety via reversible ligation. In some embodiments, the masking moiety includes, for example, a dipeptide-amidobenzyl carbonate or disubstituted maleic anhydride masking moiety described in U.S. Patent Application Publication 20150110732.

[0231] In some embodiments, the inhibitory RNA may be administered in a “naked” form, i.e., in the absence of a delivery agent. The naked inhibitory RNA may be in a suitable buffer solution. The buffer solution may include, for example, acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In some embodiments, the buffer solution is phosphate-buffered saline (PBS). The pH and osmolality of the buffer solution can be adjusted to suit administration to the target. In some embodiments, the inhibitory RNA is administered without physical association with lipids or lipid-containing particles. In some embodiments, the inhibitory RNA is administered without physical association with nanoparticles or microparticles. In some embodiments, the inhibitory RNA is administered without physical association with cationic polymers. In some embodiments, the inhibitory RNA is administered without physical association with cyclodextrins. In some embodiments, the inhibitory RNA administered in a “naked” form includes a targeting moiety.

[0232] Inhibitory RNA (e.g., siRNA or miRNA as described herein), or vectors containing nucleotide sequences encoding siRNA or miRNA as described herein, may be incorporated into the pharmaceutical composition. Such pharmaceutical compositions are particularly useful for administration and delivery to subjects in vivo or in vitro. In some embodiments, the pharmaceutical composition also contains a pharmaceutically acceptable carrier or excipient. Such excipients include any pharmaceutical, e.g., a pharmaceutical that does not itself induce an adverse immune response in the individual to whom the composition is administered, and which can be administered without excessive toxicity. As used herein, the terms “pharmaceutically acceptable” and “physiologically acceptable” mean a biocompatible formulation, gas, liquid or solid, or mixture thereof, suitable for one or more routes of administration, in vivo delivery, or contact. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugar, and ethanol. Pharmaceutically acceptable salts may include, for example, mineral salts such as hydrochloride, hydrobromide, phosphate, and sulfate, as well as salts of organic acids such as acetate, propionate, malonate, and benzoate. Furthermore, auxiliary substances such as humectants or emulsifiers and pH buffers may be present in such vehicles.

[0233] The pharmaceutical composition may be provided as a salt, and may also be formed from many acids, including, but not limited to, hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid, and others. Salts tend to be more soluble in aqueous or other protic solvents than their corresponding free base forms. In some embodiments, the pharmaceutical composition may be a lyophilized powder.

[0234] Pharmaceutical compositions may include solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil in water or water in oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic agents, and absorption enhancers or retarders, all suitable for pharmaceutical administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions may include suspending agents and thickeners. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Supplementary active compounds (e.g., preservatives, antimicrobial agents, antiviral agents, and antifungal agents) may also be incorporated into the composition.

[0235] Pharmaceutical compositions may be formulated to be compatible with specific routes of administration or delivery as specified herein or known to those skilled in the art. Accordingly, pharmaceutical compositions may include carriers, diluents, or excipients suitable for administration via various routes.

[0236] Compositions suitable for parenteral administration may include aqueous and non-aqueous solutions, suspensions, or emulsions of the active compound, which are typically sterile and may be isotonic with the blood of the recipient of interest. Non-limiting examples include water, buffered saline, Hanks' solution, Ringer's solution, dextrose, fructose, ethanol, animal oils, vegetable oils, or synthetic oils. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Furthermore, suspensions of the active compound may be prepared as suitable oil injection suspensions. Suitable lipophilic solvents or vehicles include fatty acids such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Optionally, suspensions may also contain suitable stabilizers or agents that increase solubility and allow for the preparation of highly concentrated solutions.

[0237] Cosolvents and adjuvants may be added to the formulation. Non-limiting examples of cosolvents include hydroxyl groups or other polar groups, alcohols such as isopropyl alcohol; glycols such as propylene glycol, polyethylene glycol, polypropylene glycol, and glycol ethers; glycerol; polyoxyethylene alcohol; and polyoxyethylene fatty acid esters. Examples of adjuvants include surfactants such as soy lecithin and oleic acid; sorbitan esters such as sorbitan trioleate; and polyvinylpyrrolidone.

[0238] After the pharmaceutical compositions are prepared, they may be placed in appropriate containers and labeled with respect to the treatment. Such labeling may include the amount, frequency, and method of administration.

[0239] The compositions, methods, and suitable pharmaceutical compositions and delivery systems for use described herein are known in the art (see, for example, Remington: The Science and Practice of Pharmacy. 21st Edition. Philadelphia, PA. Lippincott Williams & Wilkins, 2005).

[0240] This disclosure also provides methods for introducing inhibitory RNA (e.g., siRNA or miRNA as described herein) or a vector comprising a nucleotide sequence encoding siRNA or miRNA as described herein into cells or animals. In some embodiments, the method involves contacting or administering the inhibitory RNA (e.g., a target cell or tissue) to a subject (e.g., a target such as a mammal) to express the inhibitory RNA in the subject (e.g., a target cell or tissue). In other embodiments, the method involves providing the inhibitory RNA (e.g., a vector comprising a nucleotide sequence encoding an inhibitory RNA as described herein) to cells of an individual (e.g., a patient or subject such as a mammal) to express the inhibitory RNA in the individual.

[0241] The inhibitory RNA compositions described herein (or vectors containing nucleotide sequences encoding the inhibitory RNA described herein (e.g., rAAV vectors)) may be administered to the subject in need in an adequate or effective amount. The dose may vary and depend on the type, onset, progression, severity, frequency, duration, or probability of the disease to which treatment is directed, the desired clinical endpoint, previous or concurrent treatments, the subject's overall health status, age, sex, race, or immune capacity, and other factors recognized by those skilled in the art. The amount, number, frequency, or duration of administration may be increased or decreased proportionally if suggested by any adverse side effects, complications, or other risk factors of the treatment or therapy, and the subject's condition. Those skilled in the art will recognize factors that may influence the amount and timing of administration required to provide an amount sufficient to deliver a therapeutic or prophylactic benefit.

[0242] The dose required to achieve a therapeutic effect, for example, in units of vector genome per kilogram of body weight (vg / kg) (e.g., in the case of vector-based delivery) or in units of mg / kg of body weight (mg / kg), is not limited but varies depending on several factors, including the route of administration, the level of inhibitory RNA expression required to achieve a therapeutic effect, the specific disease being treated, any host immune response to the viral vector, the host immune response to heterologous inhibitory RNA, and the stability of the expressed inhibitory RNA. Those skilled in the art can determine the dose range of AAV / vector genome in relation to vector-based delivery of inhibitory RNA and treat patients with specific diseases or disorders based on the aforementioned and other factors. Generally, the dose required to obtain a therapeutic effect is at least 1 x 10¹⁶ per kilogram of body weight of the subject. 8 For example, 1 × 10 9 , 1 x 10 10 , 1 x 10 11、 1 x 10 12 , 1 x 10 13 , 1 x 10 14 or a range of vector genomes (vg / kg) or higher.

[0243] In some embodiments, the inhibitory RNA composition is administered to the subject in amounts of 0.01 mg / kg to 50 mg / kg. In some embodiments, the inhibitory RNA composition is administered in doses of approximately 0.01 mg / kg to approximately 10 mg / kg or approximately 0.5 mg / kg to approximately 15 mg / kg. In some embodiments, the inhibitory RNA composition is administered in doses of approximately 10 mg / kg to approximately 30 mg / kg. In some embodiments, the inhibitory RNA composition is administered in doses of approximately 0.5 mg / kg, approximately 1 mg / kg, approximately 1.5 mg / kg, approximately 2.0 mg / kg, approximately 2.5 mg / kg, approximately 3 mg / kg, approximately 3.5 mg / kg, approximately 4 mg / kg, approximately 5 mg / kg, approximately 10 mg / kg, approximately 15 mg / kg, approximately 20 mg / kg, approximately 25 mg / kg, approximately 30 mg / kg, approximately 35 mg / kg, approximately 40 mg / kg, approximately 45 mg / kg, or approximately 50 mg / kg. In some embodiments, the amounts are 0.01 mg / kg to 0.1 mg / kg, 0.01 mg / kg to 0.1 mg / kg, 0.1 mg / kg to 1.0 mg / kg, 1.0 mg / kg to 2.5 mg / kg, 2.5 mg / kg to 5.0 mg / kg, 5.0 mg / kg to 10 mg / kg, 10 mg / kg to 20 mg / kg, 20 mg / kg to 30 mg / kg, 30 mg / kg to 40 mg / kg, or 40 mg / kg to 50 mg / kg. In some embodiments, a fixed dose is administered. In some embodiments, the dose is 5 mg to 1.0 g, for example, 5 mg to 10 mg, 10 mg to 20 mg, 20 mg to 40 mg, 40 mg to 80 mg, 80 mg to 160 mg, 160 mg to 320 mg, 320 mg to 640 mg, or 640 mg to 1 g. In some embodiments, the dose is approximately 1 mg, 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1000 mg. In some embodiments, the dose is a daily dose. In some embodiments, the dose is administered according to a dosing regimen with an interval of at least 2 days, for example, at least 7 days, for example, about 2, 3, 4, 6, or 8 weeks. For example, in some embodiments, the inhibitory RNA composition is administered according to a dosing regimen with an interval of at least 7 days.In some embodiments, the inhibitory RNA composition is administered daily, weekly, monthly, or every two, three, four, five, or six months or more. In some embodiments, any of the doses and / or administration regimens described herein are administered subcutaneously. In some embodiments, the inhibitory RNA composition is administered once, and the inhibition level is measured thereafter. Subsequent doses of the inhibitory composition are administered when the inhibition level has decreased to a certain level.

[0244] In some embodiments, subjects exhibit sustained inhibition of C3, as measured by C3 mRNA expression (e.g., in liver tissue, e.g., in liver biopsy), for at least two days following administration, e.g., at least seven days, e.g., for approximately two, three, four, six, eight, ten, twelve, six, or twenty weeks. In some embodiments, subjects exhibit decreased serum C3 levels, which are maintained for at least two days following administration, e.g., at least seven days, e.g., for approximately two, three, four, six, eight, ten, twelve, six, or twenty weeks.

[0245] An effective or sufficient dose may be provided as a single dose (but not required), or may require multiple doses, and may be administered alone or in combination with another composition (e.g., another complement inhibitor described herein) (but not required). For example, the dose may be increased proportionally if indicated by the subject requiring treatment, the type, condition and severity of the disease being treated, or any side effects of treatment. A dose considered effective may also include a dose that results in a reduction of the use of another treatment, treatment regimen, or protocol, such as the administration of another complement inhibitor described herein.

[0246] Accordingly, the pharmaceutical compositions of this disclosure include compositions containing an active ingredient in an amount effective to achieve the intended therapeutic objective. Determining the therapeutically effective dose is within the capabilities of a physician using the techniques and guidance provided in this disclosure. The therapeutic dose may depend, among other factors, particularly the age and general condition of the subject, the severity of the complement-mediated disease or disorder, and the strength of the regulatory sequence that modulates the expression level of the inhibitory RNA described herein. Accordingly, the therapeutically effective dose in humans falls within a relatively broad range and can be determined by a physician based on the individual patient's response to vector therapy. The pharmaceutical compositions are delivered to the subject by gene therapy and / or cell therapy, or by in vitro modification of patient cells or donor cells, enabling in vivo production of the inhibitory RNA described herein.

[0247] The methods and uses of the present disclosure include delivery and administration by systemic, local, topical, or any route, for example, by injection or intravenous infusion. In vivo delivery of pharmaceutical compositions can generally be achieved by conventional syringe injection, but other delivery methods may also be used, such as convection-enhanced delivery (see, for example, U.S. Patent No. 5,720,720). For example, compositions may be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorbitally, intramucosally, intraperitoneally, intravenously, intrapleurally, intraarterially, orally, intrahepatically, intraventricularly (e.g., via intraventricular injection), via the portal vein, or intramuscularly. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal application. Clinicians specializing in the treatment of patients with complement-mediated disorders may determine the optimal route for the administration of inhibitory RNA (e.g., siRNA or miRNA as described herein) or vectors containing nucleotide sequences encoding siRNA or miRNA as described herein.

[0248] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be administered to a subject once daily, weekly, every two weeks, every three weeks, or every four weeks, or at longer intervals. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be administered according to a dosing regimen including (i) an initial dose once daily, weekly, every two weeks, every three weeks, or every four weeks, or at longer intervals, followed by (ii) a period of no administration, for example, 1, 2, 3, 4, 5, 6, 8, or 10 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, a vector containing a nucleotide sequence encoding an inhibitory RNA described herein is administered (i) once or more during an initial period of up to 2, 4, or 6 weeks, thereafter (ii) with a period of no administration, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, subjects are monitored before and / or after treatment with respect to the level of C3 expression and / or activity, measured, for example, using a secondary pathway assay, a classical pathway assay, or both. Suitable assays are known in the art, for example, hemolysis assays. In some embodiments, subjects are treated or retreated if the measured level of C3 expression and / or activity is 10%, 20%, 30%, 40%, 50%, 100%, 200%, or more higher than the measured level of C3 expression and / or activity in a control subject.

[0249] IX. Diseases, Disorders, and Conditions In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to subjects suffering from or at risk of complement-mediated injury to organs, tissues, or cells. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to subjects suffering from or at risk of complement-mediated injury to organs, tissues, or cells in combination with one or more additional complement inhibitors. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) comes into contact with organs, tissues, or cells in vitro. The organs, tissues, or cells may be introduced into the subject and may be protected from damage otherwise induced by the recipient's complement system.

[0250] Specific applications include: (1) protecting red blood cells (RBCs) from complement-mediated injury in individuals with disorders such as paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, or other disorders characterized by complement-mediated RBC lysis; (2) protecting transplanted organs, tissues, and cells from complement-mediated injury; (3) reducing ischemia / reperfusion (I / R) injury (in individuals suffering from trauma, vascular occlusion, myocardial infarction, or other conditions in which I / R injury may occur); and (4) protecting various body structures (e.g., the retina) and membranes (e.g., the synovial membrane) that may be exposed to complement components from complement-mediated injury in any of the various different complement-mediated disorders. The beneficial effects of inhibiting complement activation on the surface of cells or other body structures are not limited to those directly resulting from protecting the cells or structures themselves from direct complement-mediated injury (e.g., prevention of cytolysis). For example, inhibiting complement activation may reduce anaphyllotoxin production and the resulting influx / activation of neutrophils and other pro-inflammatory events, and / or the release of potentially harmful intracellular content, potentially leading to beneficial effects on distant organ systems or the entire body.

[0251] A. Protection of blood cells In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used in combination with one or more additional complement inhibitors described herein, or alone, to protect blood cells from complement-mediated injury. Blood cells may be any cellular component of blood, for example, red blood cells (RBCs), white blood cells (WBCs), and / or platelets. Various disorders are associated with complement-mediated injury to blood cells. Such disorders may result from a deficiency or defect in one or more of an individual's cellular or soluble CRP, for example, due to (a) a mutation in a gene encoding such a protein, (b) a mutation in a gene required for the production of one or more CRPs or genes required for proper function, and / or (c) the presence of one or more autoantibodies against CRP. Complement-mediated RBC lysis may result from the presence of autoantibodies against the RBC antigen, and autoantibodies can arise from a variety of causes (often idiopathic). Individuals with such mutations in the gene encoding CRP, and / or individuals with antibodies against CRP, or antibodies against their own RBCs, are at high risk of disorder involving complement-mediated RBC damage. Individuals who have experienced one or more episodes of the symptoms characteristic of the disorder are at high risk of recurrence.

[0252] Paroxysmal nocturnal hemoglobinuria (PNH) is a relatively rare disorder characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and a tendency to form blood clots (a tendency to develop thrombi), including acquired hemolytic anemia. An estimated 16 people per million worldwide are affected, and it affects both men and women. It can develop at any age, but is more common in young adults (Bessler, M. & Hiken, J., Hematology Am Soc Hematol Educ Program, 104-110 (2008); Hillmen, P., Hematology Am Soc Hematol Educ Program, 116-123 (2008)). PNH is a chronic and debilitating disease, but it can rapidly deteriorate with acute hemolytic attacks, resulting in significantly higher mortality and reduced life expectancy. In addition to anemia, many patients experience abdominal pain, dysphagia, erectile dysfunction, and pulmonary hypertension, and are at high risk of renal failure and thromboembolic events.

[0253] PNH was first reported as a distinct disease in the 1800s, but the cause of hemolysis in PNH was not established until the 1950s with the discovery of a second pathway of complement activation (Parker CJ. Paroxysmal nocturnal hemoglobinuria: an historical overview. Hematology Am Soc Hematol Educ Program. 93-103 (2008)). CD55 and CD59 are normally bound to the cell membrane via glycosylphosphatidylinositol (GPI) anchors (glycolipid structures that fix specific proteins to the cell membrane). PNH arises as a result of non-malignant clonal expansion of hematopoietic stem cells that have somatic mutations in the PIGA gene, which encodes a protein involved in GPI anchor synthesis (Takeda J, et al. Deficiency of the GPI anchor caused by a somatic mutation of the PIG-A gene in paroxysmal nocturnal hemoglobinuria. Cell. 73:703-711 (1993). Progeny cells of such stem cells lack GPI-anchored proteins, including CD55 and CD59. This deficiency makes these cells susceptible to complement-mediated RBC lysis. Flow cytometry analysis using antibodies against GPI-anchored proteins is commonly used for diagnosis. This method allows for the detection of GPI-anchored protein deficiencies on the cell surface and the determination of the degree of deficiency and the percentage of affected cells (Brodsky RA. Advances in the diagnosis and therapy). of paroxysmal nocturnal hemoglobinuria. Blood Rev. 22(2):65-74 (2008). PNH type III RBCs are completely deficient in GPI-linking protein and are highly sensitive to complement. On the other hand, PNH type II RBCs are partially deficient and less sensitive. FLAER is an inactive variant of fluorescently labeled proaerolysin (a bacterial toxin that binds to the GPI anchor) and is increasingly used in conjunction with flow cytometry for the diagnosis of PNH. Absence of FLAER binding to granulocytes is sufficient for the diagnosis of PNH. In some embodiments, the inhibitory RNAs described herein (or vectors encoding the inhibitory RNAs described herein) protect PNH RBCs from C3b deposition, either alone or in combination with one or more additional complement inhibitors described herein. In some embodiments, the inhibitory RNAs described herein (or vectors encoding the inhibitory RNAs described herein), either alone or in combination with one or more additional complement inhibitors described herein, inhibit intravascular and extravascular hemolysis in subjects suffering from PNH.

[0254] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to a subject suffering from atypical hemolytic syndrome (aHUS). aHUS is a chronic disorder characterized by microangiovascular hemolytic anemia, thrombocytopenia, and acute renal failure, caused by inadequate complement activation, often due to mutations in genes encoding complement regulatory proteins (Warwicker, P., et al., Kidney Int 53, 836-844 (1998); Kavanagh, D. & Goodship, T. Pediatr Nephrol 25, 2431-2442 (2010). Mutations in the complement H factor (CFH) gene are the most common genetic abnormalities in aHUS patients, and 60-70% of aHUS patients die within one year of disease onset or progress to end-stage renal failure (Kavanagh & (Goodship, see above). Mutations in factor I, factor B, C3, factor H-related proteins 1-5, and thrombomodulin have also been reported. Other causes of aHUS include autoantibodies against complement regulatory proteins such as CFH. In some embodiments, the inhibitory RNA described herein (or a vector containing a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to subjects identified as having mutations in factor I, factor B, C3, factor H-related proteins 1-5, or thrombomodulin, or to subjects identified as having autoantibodies against complement regulatory proteins such as CFH.

[0255] Complement-mediated hemolysis occurs in a variety of other disease groups, including autoimmune hemolytic anemia, in which antibodies binding to red blood cells (RBCs) lead to complement-mediated hemolysis. For example, such hemolysis can occur in primary chronic cold agglutinin disease and in certain reactions to drugs or other exogenous substances (Berentsen, S., et al., Hematology 12, 361-370 (2007); Rosse, WF, Hillmen, P. & Schreiber, ADHematology Am Soc Hematol Educ Program, 48-62 (2004)). In some embodiments, the inhibitory RNA described herein (or a vector containing a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to subjects suffering from or at risk of chronic cold agglutinin disease. In another embodiment, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of HELLP syndrome. This syndrome is characterized by the presence of hemolysis, elevated liver enzymes, and a low platelet count, and in at least some subjects, is associated with mutations in complement regulatory proteins (Fakhouri, F., et al., 112:4542-4545 (2008)).

[0256] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to subjects suffering from or at risk of suffering from warm autoimmune hemolytic anemia.

[0257] In other embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to protect RBCs or other cellular components of blood infused into a subject. Specific examples of such use are discussed further below.

[0258] B.Transplantation Transplantation is a therapeutic method that provides a means of replacing organs and tissues damaged by trauma, disease, or other conditions, and its importance is increasing. The kidneys, liver, lungs, pancreas, and heart are organs that are particularly likely to be successfully transplanted. Frequently transplanted tissues include bone, cartilage, tendons, cornea, skin, heart valves, and blood vessels. Transplantation of pancreatic islets or pancreatic cell transplants is a promising method for treating diabetes, such as type 1 diabetes. For the purposes of this invention, an organ, tissue, or cell (or cell population) that is being transplanted, being transplanted, or has been transplanted may be referred to as a “graft.” For the purposes of this specification, a blood transfusion is considered a “graft.”

[0259] During transplantation, grafts are exposed to a variety of damaging events and stimuli, which can lead to graft dysfunction and potentially transplant failure. For example, ischemia-reperfusion (I / R) injury is a common and significant cause of morbidity and death in many graft cases (especially solid organs) and can be a major determinant of graft survival. Transplant rejection is one of the major risks associated with transplantation between genetically different individuals, leading to transplant failure and potentially requiring the removal of the graft from the recipient.

[0260] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used in combination with one or more additional complement inhibitors described herein, or alone, to protect the graft from complement-mediated injury. For example, a cell-reactive compstatin analog reacts with cells in the graft to covalently bind to them and inhibit complement activation. A cell-targeted compstatin analog binds to a target molecule in the graft (e.g., expressed by endothelial cells or other cells in the graft) to inhibit complement activation. The target molecule may be, for example, a molecule whose expression is induced or stimulated by a stimulus such as injury or inflammation, a molecule recognized as "non-self" by the recipient, a blood group antigen or heterogeneous antigen, or a carbohydrate heterogeneous antigen such as a molecule containing an alpha-Gal epitope, for example, an antibody that is ubiquitous in humans. In some embodiments, reduced complement activation can be indicated by a reduction in mean C4d deposition in the blood vessels of grafts that have been contacted with the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein, compared to the mean level of C4d deposition in grafts that have not been contacted with the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein (e.g., the level in a matched subject with respect to the graft and to other treatments they receive).

[0261] In various embodiments of this disclosure, the graft may be contacted before, during, and / or after transplantation with the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein), either alone or in combination with one or more additional complement inhibitors described herein that inhibit C3 expression. For example, before transplantation, the graft removed from the donor may be contacted with a liquid containing a cell-reactive, long-acting, or targeted compstatin analog. For example, the graft may be immersed in a solution and / or perfused in a solution. In another embodiment, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to the donor alone or in combination with one or more additional complement inhibitors described herein before the graft is removed. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to the recipient alone or in combination with one or more additional complement inhibitors described herein during and / or after the graft is introduced. In some embodiments, the inhibitory RNA described herein (or a vector containing a nucleotide sequence encoding the inhibitory RNA described herein) is delivered locally to the transplanted graft, either alone or in combination with one or more additional complement inhibitors described herein. In some embodiments, cell-reactive, long-acting, or targeted compstatin analogs are administered systemically, such as intravenously or subcutaneously. In some embodiments, the inhibitory RNA described herein (or a vector containing a nucleotide sequence encoding the inhibitory RNA described herein) is administered to the recipient alone or in combination with one or more additional complement inhibitors described herein before graft introduction. In some embodiments, the subject receives one or more additional doses of the inhibitory RNA, the vector encoding the inhibitory RNA, and / or one or more additional complement inhibitors after transplantation.

[0262] This disclosure provides compositions comprising (a) an isolated graft, and (b) an inhibitory RNA described herein that inhibits C3 expression (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein). This disclosure further provides compositions comprising (a) an isolated graft, and (b) a cell-reactive, long-acting, or targeted compstatin analog, and (c) an inhibitory RNA described herein that inhibits C3 expression (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein). In some embodiments, the composition further comprises a solution suitable for contact with grafts (e.g., organs), such as isolated grafts removed from a donor and awaiting transplantation to a recipient (e.g., suitable for rinsing, washing, immersion, perfusion, maintenance, or storage). In some embodiments, this disclosure provides compositions comprising (a) a solution suitable for contact with grafts (e.g., organs), and (b) an inhibitory RNA described herein that inhibits C3 expression (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein). In some embodiments, the composition further comprises a cell-reactive, long-acting, or targeted compstatin analog. The solution may be any solution that is physiologically acceptable to the graft (e.g., suitable osmotic composition, non-cytotoxic), medically acceptable with respect to the subsequent introduction of the graft into the recipient (e.g., preferably sterilized, or at least reasonably free of microorganisms or other contaminants), compatible with cytoreactive compstatin analogs (i.e., does not disrupt the reactivity of compstatin analogs), or compatible with long-acting or targeted compstatin analogs. In some embodiments, the solution is any solution known in the art. In some embodiments, the solution is Marshall's or Hyperosmolar Citrate (Soltran®, Baxter Healthcare), University of Wisconsin (UW) solution (ViaSpan®, Bristol Myers These include Histidine Tryptophan Ketoglutarate (HTK) solution (Custodial®, Kohler Medical Limited), EuroCollins (Fresenius), and Celsior® (Sangstat Medical), Polysol, IGL-1, or AQIX® RS-1. Of course, other solutions containing equivalent or similar components at the same or different concentrations may also be used within the range of physiologically acceptable compositions. In some embodiments, the solution does not contain components that the cell-reactive compstatin analog is expected to react significantly with. Any solution may be modified or designed to not contain such components. In some embodiments, the cell-reactive compstatin analog may be present in the graft-fitting solution at concentrations of, for example, 0.01 mg / ml to 100 mg / ml, or may be added to the solution to reach such concentrations.

[0263] In some embodiments, the graft is or includes a solid organ, such as a kidney, liver, lung, pancreas, or heart. In some embodiments, the graft is or includes bone, cartilage, fascia, tendon, ligament, cornea, sclera, pericardium, skin, heart valve, blood vessel, amnion, or dura mater. In some embodiments, the graft includes multiple organs, such as a heart-lung or pancreas-kidney graft. In some embodiments, the graft is less than a complete organ or tissue. For example, the graft may include a portion of an organ or tissue, such as a liver lobe, a piece of blood vessel, a skin flap, or a heart valve. In some embodiments, the graft includes a preparation comprising isolated cells or tissue fragments isolated from the tissue of its origin but retaining at least some tissue structure, such as pancreatic islets. In some embodiments, the preparation includes isolated cells not bound to each other via connective tissue, such as hematopoietic stem cells or progenitor cells derived from peripheral blood and / or umbilical cord blood, or whole blood, or any cell-containing blood product such as red blood cells (RBCs) or platelets. In some embodiments, grafts are obtained from deceased donors (e.g., “post-brain death” (DBD) donors or “post-cardiac death” donors). In some embodiments, depending on the type of graft, grafts are obtained from living donors. For example, kidneys, liver sections, and blood cells are types of grafts that can often be obtained from living donors, which poses no undue risk to the donor and is consistent with safe medical practice.

[0264] In some embodiments, the graft is a xenograft (i.e., the donor and recipient are of different species). In some embodiments, the graft is an autograft (i.e., a graft from one part of the body of the same individual to another). In some embodiments, the graft is an isograft (i.e., the donor and recipient are genetically identical). In many embodiments, the graft is an allograft (i.e., the donor and recipient are genetically dissimilar individuals of the same species). In the case of an allograft, the donor and recipient may or may not be genetically related (e.g., family). Typically, the donor and recipient have compatible blood types (at least ABO compatibility, and optionally Rh, Kell, and / or other blood cell antigen compatibility). The recipient's blood may be screened for alloantibodies against the graft and / or against the recipient and donor. This is because the presence of such antibodies can lead to hyperacute rejection (i.e., rejection that begins almost immediately, within minutes of the graft coming into contact with the recipient's blood). A complement-dependent cell-mediated cytotoxicity (CDC) assay may be used to screen the serum of the subject for anti-HLA antibodies. The serum is incubated with a panel of lymphocytes whose HLA phenotypes are known. If the serum contains antibodies against HLA molecules on the target cells, cell death occurs via complement-mediated lysis. Specificity can be assigned to the detected antibodies using a selection panel of target cells. Other techniques useful for determining the presence or absence of anti-HLA antibodies, and optionally for determining their HLA specificity, include ELISA assays, flow cytometry assays, and microbead array techniques (e.g., Luminex techniques). Methodologies for performing these assays are publicly known, and various kits for performing them are commercially available.

[0265] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) inhibits complement-mediated rejection, either alone or in combination with one or more additional complement inhibitors described herein. For example, in some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) inhibits hyperacute rejection, either alone or in combination with one or more additional complement inhibitors described herein. Hyperacute rejection is caused, at least in part, by antibody-mediated activation of the complement system via the recipient's classical pathway and the resulting MAC deposition on the graft. Typically, it arises from the presence of pre-existing antibodies in the recipient that react with the graft. While it is desirable to attempt to avoid hyperacute rejection by performing appropriate matching before transplantation, this is not always possible, for example, due to time and / or resource constraints. Furthermore, some recipients (e.g., individuals who have received multiple blood transfusions, individuals who have previously received transplants, women who have been pregnant multiple times) already have a large number of antibodies formed. These may include antibodies against antigens that are not typically tested, making it difficult, or perhaps nearly impossible, to reliably obtain a compatible graft in a timely manner. Such individuals are at high risk of hyperacute rejection.

[0266] In some embodiments, the inhibitory RNAs described herein (or vectors containing nucleotide sequences encoding the inhibitory RNAs described herein) can inhibit acute rejection or transplant failure, either alone or in combination with one or more additional complement inhibitors described herein. As used herein, “acute rejection” refers to a rejection that occurs at least 24 hours after transplantation, typically at least a few days to a week, and up to six months after transplantation. Acute antibody-mediated rejection (AMR) often involves the rapid development of donor-specific alloantibodies (DSAs) in the first few weeks after transplantation. While we do not wish to be bound by any theory, the conversion of existing plasma cells and / or memory B cells into new plasma cells may contribute to the increased DSA production. Such antibodies may cause complement-mediated damage to the graft, which can be inhibited by contacting the graft with a cell-reactive compstatin analog. While we do not wish to be bound by any particular theory, inhibiting complement activation in the graft may reduce leukocyte (e.g., neutrophil) infiltration, another factor contributing to acute transplant failure.

[0267] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) inhibits complement-mediated I / R injury to grafts, either alone or in combination with one or more additional complement inhibitors described herein. As will be further discussed below, I / R injury occurs during reperfusion of tissues whose blood supply has been temporarily interrupted, and can similarly occur in transplanted organs. By reducing I / R injury, the likelihood or severity of acute graft failure is reduced, and the likelihood of acute transplant failure is also reduced.

[0268] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) inhibits chronic rejection and / or chronic transplant failure, either alone or in combination with one or more additional complement inhibitors described herein. As used herein, “chronic rejection or chronic transplant failure” refers to rejection or failure occurring at least six months after transplantation, for example, between six months and one, two, three, four, five years or longer after transplantation, often occurring after several months to several years of good graft function. Chronic rejection or chronic transplant failure is caused by chronic inflammation and immune responses to the graft. For the purposes of this specification, chronic rejection may include chronic allograft vascular damage, a term used to refer to fibrosis of the internal blood vessels of the transplanted tissue. With immunosuppressive regimens reducing the incidence of acute rejection, chronic rejection has become a prominent cause of graft dysfunction and transplant failure. There is growing evidence that B-cell alloantibody production is a crucial factor in the development of chronic rejection and chronic transplant failure (Kwun J. and Knechtle SJ, Transplantation, 88(8):955-61 (2009)). Early damage to the graft can be a contributing factor to chronic processes such as fibrosis, which can ultimately lead to chronic rejection. Therefore, by using cell-reactive compstatin analogs to inhibit such early damage, chronic graft rejection may be delayed and / or its likelihood or severity may be reduced.

[0269] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to a graft recipient alone or in combination with one or more additional complement inhibitors described herein to inhibit graft rejection and / or graft failure.

[0270] C. Ischemia / Reperfusion Injury Ischemia-reperfusion (I / R) injury is a significant cause of post-traumatic tissue damage, and is also a major cause of tissue damage in other conditions associated with temporary disruption of blood flow, such as myocardial infarction, stroke, severe infection, vascular disease, aneurysm repair, cardiopulmonary bypass, and transplantation.

[0271] In cases of trauma, systemic hypoxemia, hypotension, and local disruption of blood supply resulting from contusions, compartment syndrome, and vascular injury cause ischemia, damaging metabolically active tissues. Restoration of blood supply triggers a very severe systemic inflammatory response, often more harmful than ischemia itself. When the ischemic area is reperfused, factors produced and released enter the circulatory system locally and reach distant locations, potentially causing significant damage to organs unaffected by the original ischemic injury, such as the lungs and intestines, leading to single- and multi-organ dysfunction. Complement activation occurs immediately after reperfusion and is a crucial mediator for both direct post-ischemic injury and post-ischemic injury through its chemoattracting and stimulating effects on neutrophils. All three major complement pathways are activated and act synergistically or independently to contribute to I / R-related adverse events, affecting numerous organ systems. In some embodiments of this disclosure, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to a subject who has recently suffered trauma (e.g., within the last 2, 4, 8, 12, 24, or 48 hours), such as systemic hypoxemia, hypotension, and / or local blood supply blockage, which puts the subject at risk of I / R injury. In some embodiments, the cell-reactive compstatin analog may be administered intravascularly, optionally intravascularly to supply the injured body part, or directly to the body part. In some embodiments, the subject suffers from spinal cord injury, traumatic brain injury, burns, and / or hemorrhagic shock.

[0272] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to a subject, either alone or in combination with one or more additional complement inhibitors described herein, before, during, or after a surgical procedure, such as a surgical procedure that is expected to temporarily interrupt blood flow to a tissue, organ, or body part. Examples of such surgeries include cardiopulmonary bypass, angioplasty, heart valve repair / replacement, aneurysm repair, or other vascular surgery. The inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be administered alone or in combination with one or more additional complement inhibitors described herein, before, after, and / or during the period overlapping with the surgical procedure.

[0273] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein to subjects suffering from MI, thromboembolic stroke, deep vein thrombosis, or pulmonary embolism. The inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be administered alone or in combination with one or more additional complement inhibitors described herein, in combination with thrombolytic agents such as tissue plasminogen activator (tPA) (e.g., alteplase, reteplase, tenecteplase (TNKase)), anistreplase (Eminase), streptokinase (Kabikinase, Streptase), or urokinase (Abbokinase). The inhibitory RNAs described herein (or vectors comprising nucleotide sequences encoding the inhibitory RNAs described herein) may be administered alone or in combination with one or more additional complement inhibitors described herein, before, after, and / or during periods overlapping with thrombolytic agents.

[0274] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered to a subject alone or in combination with one or more additional complement inhibitors described herein to treat I / R injury.

[0275] D. Other complement-mediated disorders In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is introduced intraocularly, alone or in combination with one or more additional complement inhibitors described herein, for the treatment of eye disorders such as macular degeneration (e.g., age-related macular degeneration (AMD) and Stargardt macular dystrophy), diabetic retinopathy, glaucoma, or uveitis. For example, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be introduced intravitreously (e.g., by intravitreal injection) or subretinally (e.g., by subretinal injection) for the treatment of subjects with AMD or at risk of AMD. In some embodiments, AMD is neovascular (exudative) AMD. In some embodiments, AMD is atrophic (dry) AMD. As will be recognized by those skilled in the art, atrophic AMD encompasses geographic atrophy (GA), intermediate AMD, and early AMD. In some embodiments, subjects with GA are treated to slow or halt the progression of the disease. For example, in some embodiments, treatment of subjects with GA reduces the rate of retinal cell death. The reduction in the rate of retinal cell death may be demonstrated by a reduction in the growth rate of GA lesions in patients treated with the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein), alone or in combination with one or more additional complement inhibitors described herein, compared to a control (e.g., a patient receiving a placebo). In some embodiments, subjects have intermediate AMD. In some embodiments, subjects have early AMD. In some embodiments, subjects with intermediate or early AMD are treated to slow or halt the progression of the disease. For example, in some embodiments, treatment of subjects with intermediate AMD may slow or prevent progression to progressive AMD (neovascular AMD or GA). In some embodiments, treatment of subjects with early-stage AMD may slow or prevent progression to intermediate-stage AMD.In some embodiments, the eye has both GA and neovascular AMD. In some embodiments, the eye has GA but not exudative AMD. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein into the suprachoroid space, for example by choroidal injection, for the treatment of eye disorders such as macular degeneration (e.g., age-related macular degeneration (AMD) and Stargardt macular dystrophy), diabetic retinopathy, glaucoma, or uveitis. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein by intravitreal or subretinal injection to treat glaucoma, uveitis (e.g., posterior uveitis), or diabetic retinopathy. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is introduced into the anterior chamber, either alone or in combination with one or more additional complement inhibitors described herein, to treat, for example, anterior uveitis.

[0276] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of autoimmune diseases, such as autoimmune diseases at least partially mediated by antibodies against one or more autoantigens.

[0277] The inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be introduced alone or in combination with one or more additional complement inhibitors described herein into the synovial space of a subject suffering from arthritis (e.g., rheumatoid arthritis).

[0278] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of intracerebral hemorrhage.

[0279] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of myasthenia gravis (e.g., generalized myasthenia gravis).

[0280] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of suffering from hidradenitis suppurativa.

[0281] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of immune-mediated necrotizing myopathy.

[0282] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of neuromyelitis optica (NMO).

[0283] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of kidney-affecting disorders, such as those affecting the glomeruli of the kidney. In some embodiments, the disorder is membranoproliferative glomerulonephritis (MPGN), e.g., MPGN The disorder is type I, MPGN type II, or MPGN type III. In some embodiments, the disorder is IgA nephropathy (IgAN). In some embodiments, the disorder is primary membranous nephropathy. In some embodiments, the disorder is C3 glomerulopathy. In some embodiments, the disorder is characterized by glomerular deposits in the kidney containing one or more complement activating products, such as C3b. In some embodiments, the treatment described herein reduces the level of such deposits. In some embodiments, subjects suffering from complement-mediated kidney disorder have proteinuria (abnormally high levels of protein in the urine) and / or an abnormally low glomerular filtration rate (GFR). In some embodiments, the treatment described herein results in a reduction of proteinuria and / or an increase or stabilization of GFR.

[0284] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of neurodegenerative diseases. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of developing neuropathic pain. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects suffering from or at risk of rhinosinusitis or nasal polyps. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects with cancer or at risk thereof. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects with sepsis or at risk thereof. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects with adult respiratory distress syndrome or at risk thereof.

[0285] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat subjects who suffer from or are at risk of anaphylaxis or an infusion reaction. For example, in some embodiments, subjects may be treated before, during, or after administration of a drug or vehicle that may cause anaphylaxis or an infusion reaction. In some embodiments, subjects who are at risk of or suffer from anaphylaxis from food (e.g., peanuts, shellfish, or other food allergens) or insect bites (e.g., honeybees, wasps) are treated with the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein.

[0286] The inhibitory RNAs described herein (or vectors comprising nucleotide sequences encoding the inhibitory RNAs described herein) may be administered locally or systemically, either alone or in combination with one or more additional complement inhibitors described herein, in various embodiments of this disclosure.

[0287] In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat respiratory diseases such as asthma, chronic obstructive pulmonary disease (COPD), or idiopathic pulmonary fibrosis. The inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) may be administered in various embodiments, for example, as a dry powder or by inhalation via spray, or by injection, for example, intravenously, intramuscularly, or subcutaneously. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is used alone or in combination with one or more additional complement inhibitors described herein to treat severe asthma, for example, asthma that is not adequately controlled by bronchodilators and / or inhaled corticosteroids.

[0288] In some embodiments, a method is provided for treating complement-mediated disorders, such as chronic complement-mediated disorders, which includes administering an inhibitory RNA (or a vector comprising a nucleotide sequence encoding an inhibitory RNA) described herein, alone or in combination with one or more additional complement inhibitors described herein, to a subject in need of treatment for the disorder. In some embodiments, a method is provided for treating Th17-related disorders, which includes administering an inhibitory RNA (or a vector comprising a nucleotide sequence encoding an inhibitory RNA) described herein, alone or in combination with one or more additional complement inhibitors described herein, to a subject in need of treatment for the disorder.

[0289] In some embodiments, a “chronic disorder” is a disorder that lasts for at least three months and / or is accepted as a chronic disorder in the art. In many embodiments, a chronic disorder lasts for at least six months, for example, at least one year, or longer, for example, indefinitely. Those skilled in the art will recognize that at least some signs of various chronic disorders may be intermittent and / or may increase and decrease in severity over time. Chronic disorders may also be progressive, for example, tending to become more severe over time or tending to affect a wider area. A number of chronic complement-mediated disorders are discussed herein. A chronic complement-mediated disorder may be any chronic disorder in which complement activation (e.g., excessive or inappropriate complement activation) is involved as a factor and / or at least partially as a causative element. For convenience, disorders may also be grouped by referring to the organ or system that is most often affected in the subject suffering from the disorder. Naturally, it is recognized that many disorders can affect multiple organs or systems, and such classifications are by no means limiting. Furthermore, many signs (e.g., symptoms) may occur in subjects suffering from any of many different disorders. Non-limiting information regarding the disorders of the subjects of this specification may be found, for example, in standard internal medicine textbooks such as Cecil Textbook of Medicine (e.g., 23rd edition) and Harrison's Principles of Internal Medicine (e.g., 17th edition), as well as in standard textbooks focusing on specific medical areas, specific body systems or organs, and / or specific disorders.

[0290] In some embodiments, chronic complement-mediated disorders are Th2-related disorders. As used herein, a Th2-related disorder is a disorder characterized by an excessive number and / or excessive or inappropriate activity of CD4+ T helper T cells (Th2 cells) of the Th2 subtype in the body or a part thereof, for example, in at least one tissue, organ, or tissue. For example, in at least one tissue, organ, or structure affected by the disorder, Th2 cells may be dominant compared to CD4+ helper T cells (Th1) of the Th1 subtype. As is known in the art, Th2 cells typically secrete characteristic cytokines such as interleukin-4 (IL-4), interleukin-5 (IL-5), and interleukin-13 (IL-13), while Th1 cells typically secrete interferon-γ (IFN-γ) and tumor necrosis factor β (TNFβ). In some embodiments, Th2-related disorders are characterized by the overproduction and / or excess levels of IL-4, IL-5, and / or IL-13 compared to IFN-γ and / or TNFβ in at least some or at least one tissue, organ, or structure.

[0291] In some embodiments, chronic complement-mediated disorders are Th17-related disorders. In some embodiments, the "Methods of Treating" filed on June 22, 2012, is used. As detailed in PCT / US2012 / 043845, titled "Chronic Disorders with Complement Inhibitors," complement activation and Th17 cells are involved in a cycle that, along with dendritic cells and antibodies, contributes to maintaining the pathological immunological microenvironment underlying various disorders. While we do not wish to be bound by any theory, the pathological immunological microenvironment, once established, becomes self-sustaining and causes cell and tissue damage. In some embodiments, long-acting compstatin analogs are used to treat Th17-related disorders.

[0292] As used herein, Th17-related disorder is a disorder characterized by an excessive number and / or excessive or inappropriate activity of CD4+ T helper T cells (Th17 cells) of the Th17 subtype in the body or a part thereof, for example, in at least one tissue, organ, or tissue. For example, in at least one tissue, organ, or structure affected by the disorder, Th17 cells may be dominant compared to Th1 cells and / or Th2 cells. In some embodiments, the Th17 cell dominance is relative, for example, the ratio of Th17 cells to Th1 cells and / or the ratio of Th17 cells to Th2 cells is elevated compared to normal values. In some embodiments, Th17 cells and T regulatory cells (CD4 + CD25 +The proportion of regulatory T cells (also known as Treg cells) is elevated compared to normal levels. Th17 cell formation and / or activation are promoted by various cytokines, such as interleukin-6 (IL-6), interleukin-21 (IL-21), interleukin-23 (IL-23), and / or interleukin-1β (IL-1β). Th17 cell formation includes the differentiation of progenitor cells, such as unsensitized CD4+ T cells, into Th17 phenotypic cells and their maturation into functional Th17 cells. In some embodiments, Th17 cell formation includes any aspect of Th17 cell development, proliferation (expansion), survival, and / or maturation. In some embodiments, Th17-related disorders are characterized by the excessive production and / or quantity of IL-6, IL-21, IL-23, and / or IL-1β. Th17 cells typically secrete characteristic cytokines such as interleukin-17A (IL-17A), interleukin-17F (IL-17F), interleukin-21 (IL-21), and interleukin-22 (IL-22). In some embodiments, Th17-related dysfunction is characterized by the overproduction and / or quantity of Th17 effector cytokines, such as IL-17A, IL-17F, IL-21, and / or IL-22. In some embodiments, the overproduction or quantity of cytokines is detectable in the blood. In some embodiments, the overproduction or quantity of cytokines is detectable locally, such as in at least one tissue, organ, or structure. In some embodiments, Th17-related dysfunction is associated with a decrease in the number of Tregs and / or a decrease in the quantity of Treg-related cytokines. In some embodiments, Th17 disorders are any chronic inflammatory diseases, and the term encompasses a broad range of diseases characterized by autoimmune damage to various tissues, seemingly unrelated (and possibly unknown) to the initial injury that caused the damage. In some embodiments, Th17-related disorders are any autoimmune diseases. Many, if not most, “chronic inflammatory diseases” may actually be autoimmune diseases.Examples of Th17-related disorders include inflammatory skin diseases such as psoriasis and atopic dermatitis; systemic scleroderma and sclerosis; inflammatory bowel disease (IBD) (e.g., Crohn's disease and ulcerative colitis); Behçet's disease; dermatomyositis; polymyositis; multiple sclerosis (MS); dermatitis; meningitis; encephalitis; uveitis; osteoarthritis; lupus nephritis; rheumatoid arthritis (RA); Sjögren's syndrome, multiple sclerosis, vasculitis; inflammatory disorders of the central nervous system (CNS), chronic hepatitis; chronic pancreatitis, glomerulonephritis; sarcoidosis; thyroiditis, pathological rejection of tissue / organ transplants (e.g., transplant rejection); COPD, asthma, bronchiolitis, hypersensitivity pneumonitis, idiopathic pulmonary fibrosis (IPF), periodontitis, and gingivitis. In some embodiments, the Th17 disease is a classic known autoimmune disease such as type 1 diabetes or psoriasis. In some embodiments, the Th17-related disorder is age-related macular degeneration.

[0293] In some embodiments, chronic complement-mediated disorders are IgE-related disorders. As used herein, “IgE-related disorders” are disorders characterized by excessive and / or inadequate production and / or quantity of IgE, excessive or inadequate activity of IgE-producing cells (e.g., IgE-producing B cells or plasma cells), and / or excessive and / or inadequate activity of IgE-responsive cells such as eosinophils or mast cells. In some embodiments, IgE-related disorders are characterized by elevated total IgE levels, and / or elevated levels of allergen-specific IgE in the plasma of the subject and / or locally.

[0294] In some embodiments, chronic complement-mediated disorders are characterized by the presence of autoantibodies and / or immune complexes in the body, which may activate complement, for example, via classical pathways. Autoantibodies may, for example, bind to autoantigens on cells or tissues in the body. In some embodiments, autoantibodies bind to antigens in blood vessels, skin, nerves, muscles, connective tissue, heart, kidneys, thyroid, etc. In some embodiments, the subject has neuromyelitis optica and produces autoantibodies against aquaporin 4 (e.g., IgG autoantibodies). In some embodiments, the subject has bullous pemphigoid and produces autoantibodies (e.g., IgG autoantibodies or IgE autoantibodies) against structural components of hemidesmosomes (e.g., transmembrane collagen XVII (BP180 or BPAG2) and / or plakin family protein BP230 (BPAG1)). In some embodiments, chronic complement-mediated disorders are not characterized by autoantibodies and / or immune complexes.

[0295] In some embodiments, chronic complement-mediated disorders are respiratory disorders. In some embodiments, chronic respiratory disorders are asthma or chronic obstructive pulmonary disease (COPD). In some embodiments, chronic respiratory disorders are pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), radiation-induced lung injury, allergic bronchopulmonary aspergillosis, hypersensitivity pneumonitis (also known as allergic alveolitis), eosinophilic pneumonia, interstitial pneumonia, sarcoid, Wegener's granulomatosis, or bronchiolitis obliterans. In some embodiments, the Disclosure provides a method for treating subjects in need of treatment for chronic respiratory disorders, such as asthma, COPD, pulmonary fibrosis, radiation-induced lung injury, allergic bronchopulmonary aspergillosis, hypersensitivity pneumonitis (also known as allergic alveolitis), eosinophilic pneumonia, interstitial pneumonia, sarcoid, Wegener's granulomatosis, or bronchiolitis obliterans, and the method comprises administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to subjects in need of treatment for such disorders.

[0296] In some embodiments, the chronic complement-mediated disorder is allergic rhinitis, rhinosinusitis, or nasal polyps. In some embodiments, the Disclosure provides a method for treating a subject in need of treatment for allergic rhinitis, rhinosinusitis, or nasal polyps, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to a subject in need of treatment for the disorder.

[0297] In some embodiments, chronic complement-mediated disorders are disorders affecting the musculoskeletal system. Examples of such disorders include inflammatory joint diseases (e.g., rheumatoid arthritis, psoriatic arthritis, juvenile chronic arthritis, spondyloarthritis, Reiter's syndrome, gout). In some embodiments, musculoskeletal disorders result in symptoms such as pain, stiffness, and / or limited movement of the affected body part. Inflammatory myopathy includes dermatomyositis, polymyositis, and various other myositis, which are disorders of chronic muscle inflammation of unknown etiology resulting in muscle weakness. In some embodiments, a chronic complement-mediated disorder is myasthenia gravis. In some embodiments, the disclosure provides a method for treating any of the aforementioned disorders affecting the musculoskeletal system, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to a subject in need of treatment for the disorder.

[0298] In some embodiments, chronic complement-mediated disorders are disorders affecting the dermal system. Examples of such disorders include, for example, atopic dermatitis, psoriasis, bullous pemphigoid, pemphigus, lupus erythematosus, dermatomyositis, scleroderma, sclerodermamyositis, Sjögren's syndrome, and chronic urticaria. In some embodiments, the disclosure provides a method for treating any of the aforementioned disorders affecting the dermal system, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to a subject in need of treatment for the disorder.

[0299] In some embodiments, chronic complement-mediated disorders affect the nervous system, such as the central nervous system (CNS) and / or peripheral nervous system (PNS). Examples of such disorders include, for example, multiple sclerosis, other chronic demyelinating diseases (e.g., neuromyelitis optica, or inflammatory demyelinating polyneuropathy (CIDP)), amyotrophic lateral sclerosis, chronic pain, stroke, allergic neuritis, Huntington's disease, Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, Lewy body dementia (i.e., dementia with Lewy bodies, or Parkinsonian dementia), frontotemporal dementia, traumatic brain injury, traumatic spinal cord injury, multiple system atrophy, chronic traumatic encephalopathy, Creutzfeldt-Jakob disease, and leptomania. In some embodiments, the Disclosure provides a method for treating any of the aforementioned disorders affecting the nervous system, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to a subject in need of treatment for the disorder.

[0300] In some embodiments, chronic complement-mediated disorders affect the circulatory system. For example, in some embodiments, the disorder is vasculitis or other disorders related to inflammation of the vascular system, such as inflammation of blood vessels and / or lymphatic vessels. In some embodiments, vasculitis is polyarteritis nodosa, Wegener's granulomatosis, giant cell arteritis, Churg-Strauss syndrome, microscopic polyangiitis, Henoch-Schönlein purpura, Takayasu's arteritis, Kawasaki disease, or Behçet's disease. In some embodiments, subjects, such as those requiring treatment for vasculitis, are positive for antineutrophil cytoplasmic antibody (ANCA).

[0301] In some embodiments, chronic complement-mediated disorders affect the gastrointestinal system. For example, the disorder may be an inflammatory bowel disease such as Crohn's disease or ulcerative colitis. In some embodiments, the disclosure provides a method for treating a chronic complement-mediated disorder affecting the gastrointestinal system, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to a subject in need of treatment for the disorder.

[0302] In some embodiments, chronic complement-mediated disorders include thyroiditis (e.g., Hashimoto's thyroiditis, Graves' disease, postpartum thyroiditis), myocarditis, hepatitis (e.g., hepatitis C), pancreatitis, glomerulonephritis (e.g., membranoproliferative glomerulonephritis or membranous glomerulonephritis), or panniculitis.

[0303] In some embodiments, the disclosure provides a method for treating a subject suffering from chronic pain, the method comprising administering an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein) alone or in combination with one or more additional complement inhibitors described herein to the subject in need. In some embodiments, the subject suffers from neuropathic pain. Neuropathic pain is defined as pain that begins with or results from a primary lesion or dysfunction of the nervous system, and in particular as pain that results as a direct consequence of a lesion or disease affecting the somatosensory system. For example, neuropathic pain may result from a lesion involving somatosensory pathways with damage to small fibers of peripheral nerves and / or damage to the spinothalamic-cortical system of the CNS. In some embodiments, neuropathic pain results from an autoimmune disease (e.g., multiple sclerosis), a metabolic disease (e.g., diabetes), an infection (e.g., viral diseases such as herpes zoster or HIV), a vascular disease (e.g., stroke), a trauma (e.g., injury, surgery), or cancer. For example, neuropathic pain may be pain that persists after an injury has healed or after the cessation of stimulation of peripheral nerve endings, or pain that results from damage to a nerve. Examples of conditions associated with neuropathic pain include painful diabetic neuropathy, postherpetic neuralgia (e.g., pain at the site of acute herpes zoster that persists for more than three months after an acute attack or recurs), trigeminal neuralgia, cancer-related neuropathic pain, chemotherapy-related neuropathic pain, HIV-related neuropathic pain (e.g., resulting from HIV neuropathy), central / post-stroke neuropathic pain, neuropathy associated with back pain such as low back pain (e.g., resulting from nerve root compression such as compression of spinal nerve roots, such as compression of lumbar nerve roots; these compressions may result from a herniated disc), spinal stenosis, pain from peripheral nerve injury, phantom limb pain, polyneuropathy, pain associated with spinal cord injury, myelopathy, and multiple sclerosis.In certain embodiments of this disclosure, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein, according to a dosing schedule, to treat neuropathic pain in subjects having one or more of the aforementioned conditions.

[0304] In some embodiments, chronic complement-mediated disorders are chronic eye disorders. In some embodiments, chronic eye disorders are characterized by macular degeneration, choroidal neovascularization (CNV), retinal neovascularization (RNV), inflammation of the eye, or any combination thereof. Macular degeneration, CNV, RNV, and / or inflammation of the eye may be defining features of the disorder and / or diagnostic features. Examples of disorders characterized by one or more of these features include, but are not limited to, conditions associated with macular degeneration, diabetic retinopathy, retinopathy of prematurity, proliferative vitreoretinopathy, uveitis, keratitis, conjunctivitis, and scleritis. Conditions associated with macular degeneration include, for example, age-related macular degeneration (AMD) and Stargardt macular dystrophy. In some embodiments, subjects require treatment for exudative AMD. In some embodiments, subjects require treatment for atrophic AMD. In some embodiments, subjects require treatment for geographic atrophy (GA). In some embodiments, the subject requires treatment for inflammation of the eye. Inflammation of the eye can affect numerous ocular structures, such as the conjunctiva (conjunctivitis), cornea (keratitis), episclera, sclera (scleritis), uvea, retina, vascular structures, and / or optic nerve. Signs of ocular inflammation include the presence of inflammation-associated cells in the eye, such as leukocytes (e.g., neutrophils, macrophages), the presence of endogenous inflammatory mediators, and one or more symptoms such as eye pain, redness, photosensitivity, blurred vision, and clouding of the eye. Uveitis is a general term referring to inflammation of the uvea of ​​the eye, for example, in any of the structures of the uvea, including the iris, ciliary body, or choroid. Specific types of uveitis include iritis, iridocyclitis, cyclitis, squamous inflammation, and choroiditis. In some embodiments, chronic eye disorders are eye disorders characterized by optic nerve damage (e.g., optic nerve degeneration), such as glaucoma.

[0305] As mentioned above, in some embodiments, the chronic respiratory disease is asthma. Information regarding asthma risk factors, epidemiology, etiology, diagnosis, current management methods, etc. can be found, for example, in "Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma. National Heart, Lung and Blood Institute. 2007. http: / / www.nhlbi.nih.gov / guidelines / asthma / asthgdln.pdf ("NHLBI Guidelines"; www.nhlbi.nih.gov / guidelines / asthma / asthgdln.htm), Global Initiative for Asthma, Global Strategy for Asthma Management and Prevention 2010 “GINA Report”) and / or, for example, Cecil Textbook of Medicine (20th edition), Harrison's Principles of Internal It can be found in standard internal medicine textbooks such as Medicine (17th edition), and / or standard textbooks focusing on pulmonary medicine. Asthma is a chronic inflammatory disorder of the airways, in which many cells and cellular elements play a role, such as mast cells, eosinophils, T lymphocytes, macrophages, neutrophils, and epithelial cells. Asthma patients may experience symptoms such as wheezing, shortness of breath (dyspnea or shortness of breath). Asthma patients experience recurrent attacks associated with symptoms such as chest tightness and cough (also known as airway constriction). These attacks are usually associated with widespread but changeable airway obstruction, which is often reversible spontaneously or with treatment. Inflammation also contingently increases pre-existing bronchial hypersensitivity to various stimuli. Airway hypersensitivity (exaggerated bronchoconstriction in response to stimuli) is a typical feature of asthma. Generally, airflow limitation results from bronchial narrowing and airway edema. Reversibility of airflow limitation may be incomplete in some asthma patients. For example, airway remodeling can lead to the fixation of airway narrowing. Structural changes may include thickening of the membranes beneath the basement membrane, subepithelial fibrosis, hypertrophy and hyperplasia of airway smooth muscle, proliferation and dilation of blood vessels, and hyperplasia and hypersecretion of mucous glands.

[0306] Asthma patients may experience exacerbations, which are identified as events characterized by a change from the individual's past state. A severe asthma exacerbation may be defined as an event requiring emergency measures from both the individual and the physician to prevent serious outcomes such as hospitalization or asthma-related death. For example, a severe asthma exacerbation may require the use of systemic corticosteroids (e.g., oral corticosteroids) or an increase in the stable maintenance dose in a subject whose asthma was previously well controlled without OCS. A moderate asthma exacerbation can be defined as a difficult event for the subject that necessitates a change in treatment, but is not severe. These events are clinically identified by a deviation from the usual range of variability in the subject's routine asthma.

[0307] Current asthma medications are typically categorized into two general classifications: long-acting control agents (controller drugs), such as inhaled corticosteroids (ICS), oral corticosteroids (OCS), long-acting bronchodilators (LABAs), leukotriene modifiers (e.g., leukotriene receptor antagonists or leukotriene synthesis inhibitors, anti-IgE antibodies (omalizumab (Xolair®)), cromolyn and nedocromil (used to achieve and maintain control of persistent asthma)); and quick-relief drugs, such as short-acting bronchodilators (SA). BA) (Used to treat acute symptoms and exacerbations). For the purposes of this invention, these treatments may be referred to as “conventional therapies.” Treatment of exacerbations may also include increasing the dose and / or intensity of controller drug therapy. For example, one course of OCS can be used to restore control of asthma. Current guidelines mandate daily administration of controller drugs, and in many cases, multiple doses of controller drugs are mandated daily for patients with persistent asthma (with the exception of Xolair, which is administered every 2-4 weeks).

[0308] A subject is generally considered to have persistent asthma if they experience symptoms more than twice a week on average, and / or typically use quick-relief medications (e.g., SABAs) more than twice a week to control their symptoms. Once associated comorbidities are treated and inhalation technique and adherence are optimized, “asthma severity” can be classified based on the intensity of treatment required to control the subject’s asthma (see, e.g., GINA Report; Taylor, DR, Eur Respir J 2008; 32: 545-554). For information on treatment intensity, see, e.g., NHLBI. The recommended medications and dosages may be based on stepwise treatment algorithms found in guidelines such as Guidelines 2007, GINA Report, and their preceding guidelines, as well as / or standard medical textbooks. For example, asthma can be classified as intermittent, mild, moderate, or severe, as shown in Table 7, where “treatment” refers to treatment sufficient to achieve the best level of asthma control in question. It will be understood that the categories of mild, moderate, and severe asthma generally suggest persistence rather than intermittent asthma. Those skilled in the art will understand that Table 7 is illustrative, not all of these medications are available in all healthcare systems, and they may influence the assessment of asthma severity in some settings. It will also be recognized that other newly emerging or novel methods may also influence the classification of mild / moderate asthma. However, the same principle can also be applied that mild asthma is defined by the fact that good control can be achieved using very low-intensity treatment, and severe asthma is defined by the need for high-intensity treatment. Asthma severity can also be classified alternatively based on the inherent intensity of the disease if left untreated (see, for example, the NHBLI Guidelines 2007). Assessment can be performed based on current vital capacity measurements and the patient's recall of symptoms over the past 2–4 weeks. Parameters of current impairment and future risk may also be assessed and included in determining the level of asthma severity. In some embodiments, asthma severity is defined for individuals aged 0–4 years, 5–11 years, or 12 years and older, as shown in Figures 3.4(a), 3.4(b), and 3.4(c) of the NHBLI Guidelines, respectively.

[0309] [Table 7]

[0310] "Asthma control" refers to the degree to which the symptoms of asthma are reduced or eliminated by treatment (pharmacological or non-pharmacological). Asthma control can be assessed based on factors such as symptom frequency, nocturnal symptoms, and objective measures of lung function such as vital capacity parameters (e.g., predicted %FEV1, FEV1 variability, and the requirement for use of SABA for symptom control). Parameters related to current impairment and future risk may also be assessed and included in determining the level of asthma control. In some embodiments, asthma control is defined for individuals aged 0–4 years, 5–11 years, or 12 years or older, as shown in Figures 4.3(a), 4.3(b), or 4.3(c) of the NHBLI guidelines, respectively.

[0311] Generally, a person skilled in the art can select appropriate means for determining the severity level and / or degree of control of asthma, and can use any classification scheme that is considered reasonable by a person skilled in the art.

[0312] In some embodiments of this disclosure, subjects suffering from persistent asthma are treated using an inhibitory RNA (or a vector comprising a nucleotide sequence encoding an inhibitory RNA as described herein) alone or in combination with one or more additional complement inhibitors as described herein, using a dosage regimen. In some embodiments, subjects suffer from mild or moderate asthma. In some embodiments, subjects suffer from severe asthma. In some embodiments, subjects have asthma that is not adequately controlled with conventional therapies. In some embodiments, subjects have asthma that requires the use of ICS for adequate control when treated with conventional therapies. In some embodiments, subjects have asthma that is not adequately controlled even with the use of ICS. In some embodiments, subjects have asthma that would require the use of OCS for adequate control when treated with conventional therapies. In some embodiments, subjects have asthma that is not adequately controlled with high-intensity conventional therapies, including OCS. In some embodiments, the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein) is administered alone or in combination with one or more additional complement inhibitors described herein as a controller drug, or to cause a subject to avoid the use of conventional controller drugs or to reduce their dosage.

[0313] In some embodiments, subjects suffer from allergic asthma, and most individuals with asthma have allergic asthma. In some embodiments, subjects with asthma are considered to have allergic asthma if non-allergic triggers for asthma (e.g., colds, exercise) are not identified and / or not identified by standard diagnostic assessments. In some embodiments, subjects with asthma are considered to have allergic asthma if (i) they reproducibly develop asthma symptoms (or exacerbations of asthma symptoms) after exposure to a susceptible allergen, (ii) they exhibit IgE specific to the susceptible allergen, (iii) they show a positive skin prick test to the susceptible allergen, and / or (iv) they exhibit other symptoms consistent with atopic dermatitis, such as allergic rhinitis, eczema, or elevated total serum IgE. While specific allergic triggers may not be identified, it would be understood that an allergic trigger may be suspected or inferred if a subject experiences symptom exacerbations, for example, under specific environmental conditions.

[0314] Inhalation-induced allergen challenge is a widely used technique in the evaluation of allergic airway diseases. Upon inhalation of an allergen, cross-linking of allergen-specific IgE is generated, for example, by binding to IgE receptors on mast cells and basophils. This leads to activation of secretory pathways, resulting in the release of mediators of bronchoconstriction and vascular permeability. Individuals with allergic asthma may exhibit various signs after allergen challenge, such as early asthmatic response (EAR), late asthmatic response (LAR), airway hyperreactivity (AHR), and airway eosinophilia, each of which can be detected and quantified as known in the art. For example, airway eosinophilia may be detected as an increase in eosinophils in sputum and / or BAL fluid. EAR, sometimes referred to as immediate asthmatic response (IAR), is a response to an allergen challenge induced by inhalation and is detectable immediately after inhalation, typically within 10 minutes, as a decrease in FEV1, for example. EAR typically peaks within 30 minutes and recovers within 2-3 hours of the challenge. For example, a subject may be considered "positive" if their FEV1 decreases by at least 15%, e.g., at least 20%, compared to their baseline FEV1 within this timeframe (in this context, "baseline" refers to the pre-challenge state, e.g., the subject's normal state when not experiencing an asthma exacerbation and not exposed to a susceptible allergic stimulus). Late asthmatic response (LAR) typically begins between 3 and 8 hours after the challenge and is characterized by cellular inflammation of the airways, increased bronchial vascular permeability, and mucus secretion. It is typically detected as a decrease in FEV1, and the decrease is greater than that associated with EAR, potentially indicating greater clinical significance. For example, a subject may be considered "positive" if, during the relevant period, their FEV1 decreases by at least 15%, or even at least 20%, compared to their baseline FEV1.The delayed airway response (DAR) begins between approximately 26 and 32 hours, reaches its peak between approximately 32 and 48 hours, and can recover within approximately 56 hours of the challenge (Pelikan, Z. Ann Allergy Asthma Immunol. 2010, 104(5):394-404).

[0315] In some embodiments, chronic respiratory impairment is chronic obstructive pulmonary disease (COPD). COPD encompasses a spectrum of conditions characterized by airflow limitation, which are not entirely reversible with treatment, and are usually progressive. Symptoms of COPD include dyspnea (shortness of breath), decreased exercise tolerance, cough, sputum production, wheezing, and chest tightness. Patients with COPD may experience acute exacerbations of symptoms (called COPD exacerbations), which occur over a course of less than a week, often within 24 hours. The frequency and duration of these exacerbations can vary and are associated with significant pathological conditions. These may be triggered by events such as respiratory infections or exposure to harmful particles, or the etiology may be unknown. Smoking is the most common risk factor for COPD, and other inhalation exposures may also contribute to the onset and progression of the disease. The role of genetic factors in COPD is an area that is actively being researched. A small number of COPD patients have a hereditary deficiency in alpha-1 antitrypsin, a major circulating inhibitor of serine proteases, which can lead to a rapidly progressive disease.

[0316] Characteristic pathophysiological features of COPD include narrowing and structural changes of the peripheral airways, as well as destruction of the lung parenchyma (especially around the alveoli), with chronic inflammation being the most common cause. The chronic airflow limitation typically observed in COPD is a result of the interplay of these factors, and their relative importance in contributing to airflow limitation and symptoms varies from person to person. The term "emphysema" refers to the dilation of the air spaces (alveoli) distal to the terminal bronchioles, accompanied by destruction of the walls. It should be noted that the term "emphysema" is often used clinically to refer to the medical condition associated with such pathological changes. Some COPD patients have chronic bronchitis, which is clinically defined as a cough with sputum production for most of three months of the year, for two consecutive years. Further information on risk factors, epidemiology, etiology, diagnosis, and current management of COPD can be found, for example, in the Global Initiative on Chronic Obstructive, also known as the "GOLD Report." The “Global Strategy for the Diagnosis,Management,and Prevention This can be found in the “of Chronic Obstructive Pulmonary Disease” (latest 2009 edition), the American Thoracic Society / European Respiratory Society Guidelines (2004), referred herein as the “ATC / ERS COPD Guidelines,” available on the ATS website at www.thoracic.org / clinical / copd-guidelines / resources / copddoc.pdf, and in standard textbooks of internal medicine such as the Cecil Textbook of Medicine (20th edition) and Harrison's Principles of Internal Medicine (17th edition), and / or standard textbooks focusing on pulmonary medicine.

[0317] In some embodiments, the methods disclosed herein inhibit (interfere with, disrupt) the DC-Th17-B-Ab-C-DC cycle discussed above. For example, the cycle in which complement stimulates DC cells to promote the Th17 phenotype may be disrupted by administering, alone or in combination with one or more additional complement inhibitors described herein, an inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding an inhibitory RNA described herein). As a result, the number and / or activity of Th17 cells is reduced, and the amount of Th17-mediated B cell stimulation and polyclonal antibody production decreases. In some embodiments, these effects “reset” the immunological microenvironment to a more normal, less pathological state. As described in Example 1 of PCT / US2012 / 043845 (WO / 2012 / 178083) and U.S. Patent Application Publication 20140371133, evidence supporting the long-term inhibitory effect on Th17-related cytokine production by inhibiting complement has been obtained in animal models of asthma.

[0318] In some embodiments, inhibition of the DC-Th17-B-Ab-C-DC cycle has disease-modifying effects. While we do not wish to be bound by any theory, inhibiting the DC-Th17-B-Ab-C-DC cycle may not merely treat the symptoms of the disorder, but may also interfere with underlying pathological mechanisms that can cause continuous tissue damage and / or contribute to disease exacerbation, even when symptoms are well controlled. In some embodiments, inhibition of the DC-Th17-B-Ab-C-DC cycle induces remission of chronic disorder. In some embodiments, remission refers to a state in a subject with chronic disorder in which there is no or substantially no disease activity, although there is a possibility of disease relapse. In some embodiments, remission can be maintained for a long period (e.g., at least 6 months, e.g., 6–12 months, 12–24 months, or longer) in the absence of continuing therapy, or by dose reduction or increased dosing intervals. In some embodiments, complement inhibition can alter the immunological microenvironment of Th17 cell-rich tissues, transforming it into a microenvironment rich in regulatory T cells (Tregs). This can "reset" the immune system itself, leading to remission. In some embodiments, remission can be maintained until a trigger event occurs. Trigger events may include, for example, infection (which can result in the production of polyclonal antibodies that react to both infectious agents and autologous proteins), or exposure to specific environmental conditions (e.g., high levels of air pollutants such as ozone or particulate matter or smoke components, e.g., cigarette smoke, allergens). Genetic factors may also play a role. For example, individuals with specific alleles of genes encoding complement components may have higher baseline levels of complement activity, higher complement system reactivity, and / or lower baseline levels of endogenous complement regulatory protein activity. In some embodiments, individuals have genotypes associated with an increased risk of AMD. For example, the subject may have polymorphisms in genes encoding complement proteins or complement regulatory proteins, such as CFH, C3, and factor B, in which case these polymorphisms are associated with an increased risk of AMD.

[0319] In some embodiments, the immunological microenvironment may progressively shift towards a pathological state over time, for example, in subjects who have not yet developed symptoms of chronic disorder, or in subjects who have developed disorder and have received the treatments described herein. Such a shift may occur stochastically (for example, at least in part due to apparent random fluctuations in antibody levels and / or antibody affinity) and / or as a result of an accumulation of “subthreshold” trigger events that are not strong enough to induce a symptomatic outbreak of disorder.

[0320] In some embodiments, a relatively short cycle, e.g., 1 to 6 weeks, e.g., about 2 to 4 weeks, of the inhibitory RNA described herein (or a vector comprising a nucleotide sequence encoding the inhibitory RNA described herein), either alone or in combination with one or more additional complement inhibitors described herein, may provide long-lasting benefits. In some embodiments, remission is achieved over a long period, e.g., 1 to 3 months, 3 to 6 months, 6 to 12 months, 12 to 24 months, or longer. In some embodiments, subjects may be monitored and / or treated prophylactically before symptom relapse. For example, subjects may be treated before or at the time of exposure to a trigger event. In some embodiments, subjects may be monitored for increases in biomarkers, such as Th17 cells or Th17 cell activity, or biomarkers including indicators of complement activation, and may be treated when levels of such biomarkers are elevated. For further consideration, see, for example, PCT / US2012 / 043845.

[0321] X. Combination therapy In some embodiments, the methods of this disclosure include administering the inhibitory RNA described herein alone or in combination with one or more additional complement inhibitors described herein. In some embodiments, the inhibitory RNA is administered to a subject already receiving treatment with another complement inhibitor. In some embodiments, the other complement inhibitor is administered to a subject receiving the inhibitory RNA. In some embodiments, both the inhibitory RNA and the other complement inhibitor are administered to the subject.

[0322] In some embodiments, administration of inhibitory RNA may enable the administration of a second complement inhibitor in a low-dose regimen (e.g., lower individual doses, lower administration frequency, fewer administrations, and / or reduced overall exposure) compared to administration of the second complement inhibitor as monotherapy. While we do not wish to be bound by any theory, in some embodiments, a low-dose regimen of a second complement inhibitor may avoid one or more undesirable adverse effects that may otherwise occur.

[0323] In some embodiments, administering inhibitory RNA combined with a second complement inhibitor can sufficiently reduce the target's blood C3 level, and as a result, a low-dose regimen of inhibitory RNA and / or a second complement inhibitor is required to achieve the desired degree of complement inhibition.

[0324] In some embodiments, administering inhibitory RNA in combination with a secondary complement inhibitor can adequately reduce the target's blood C3 level, and as a result, a low-dose regimen of inhibitory RNA and / or a secondary complement inhibitor may be required to achieve a desired level of, or a desired improvement in, one or more signs, symptoms, biomarkers, or outcome measures of complement-mediated disorder.

[0325] In some embodiments, such low doses can be administered in smaller volumes, at lower concentrations, at longer dosing intervals, or in any of the aforementioned combinations, compared to the administration of inhibitory RNA or a secondary complement inhibitor as monotherapy.

[0326] Any complement inhibitor, such as complement inhibitors known in the art, can be administered in combination with the inhibitory RNA described herein. In some embodiments, the complement inhibitor is compstatin or a compstatin analog.

[0327] Compstatin is a cyclic peptide that binds to C3 and inhibits complement activation. U.S. Patent No. 6,319,897 describes a peptide having the sequence Ile- [Cys-Val-Val-Gln-Asp-Trp-Gly-His-His-Arg-Cys]-Thr (Sequence ID 1), where the disulfide bond between the two cysteine ​​groups is indicated in parentheses. Although the name "compstatin" is not used in U.S. Patent No. 6,319,897, it has since been adopted in scientific and patent literature (see, for example, Morikis, et al., Protein Sci., 7(3):619-27, 1998) to refer to a peptide having the same sequence as Sequence ID 2 disclosed in U.S. Patent No. 6,319,897, but with amidation at the C-terminus. The term "compstatin" is used herein in accordance with that use. Compstatin analogs with higher complement inhibitory activity than compstatin have been developed. For example, WO2004 / 026328 (PCT / US2003 / 029653), Morikis, D., et al., Biochem Soc Trans. 32 (Pt 1): 28-32, 2004, Mallik, B., et al., J. Med. Chem., 274-286, 2005; Katragadda, M., et al. See al. J. Med. Chem., 49:4616-4622, 2006; WO2007062249 (PCT / US2006 / 045539), WO2007044668 (PCT / US2006 / 039397), WO / 2009 / 046198 (PCT / US2008 / 078593), and WO / 2010 / 127336 (PCT / US2010 / 033345).

[0328] As used herein, the term “compstatin analog” includes compstatin and any complement-inhibitory analogues thereof. The term “compstatin analogue” encompasses compstatin and other compounds designed or identified based on compstatin, whose complement-inhibitory activity is at least 50% of that of compstatin when measured, for example, using any complement activity assay accepted in the art, or substantially similar or equivalent assays. Specific preferred assays are described in U.S. Patent No. 6,319,897, WO2004 / 026328, Morikis, Mallik, Katragadda 2006, WO2007062249 (PCT / US2006 / 045539), WO2007044668 (PCT / US2006 / 039397), WO / 2009 / 046198 (PCT / US2008 / 078593), and / or WO / 2010 / 127336 (PCT / US2010 / 033345). The assay may measure, for example, secondary or classical pathway-mediated erythrolysis, or it may be an ELISA assay. In some embodiments, the assay described in WO / 2010 / 135717 (PCT / US2010 / 035871) is used.

[0329] Table 8 provides a non-limiting list of compstatin analogs useful in this disclosure. Analogues are abbreviated in the left column by indicating specific modifications at designated positions (1-13) compared to the parent peptide, compstatin. As used herein in accordance with articulation, “compstatin” and the activity compared to compstatin of the compstatin analogues described herein refer to the C-terminally amidated compstatin peptide. Unless otherwise indicated, the peptides in Table 8 are C-terminally amidated. Bold is used to indicate specific modifications. Activity compared to compstatin is based on published data and assays described herein (WO2004 / 026328, WO2007044668, Mallik, 2005; Katragadda, 2006). In certain embodiments, the peptides listed in Table 8 are cyclized via a disulfide bond between two Cys residues when used in the therapeutic compositions and methods of this disclosure. Alternative methods for cyclizing peptides are also within the scope of this disclosure.

[0330] [Table 8]

[0331] In certain embodiments of the compositions and methods of this disclosure, the compstatin analog has a sequence selected from sequences 9 to 36. In one embodiment, the compstatin analog has the sequence of SEQ ID NO: 28. As used herein, “L-amino acid” refers to either a naturally occurring levorotatory alpha-amino acid that is normally present in proteins, or an alkyl ester of such alpha-amino acids. The term “D-amino acid” refers to a dextrorotatory alpha-amino acid. Unless otherwise specified, all amino acids referred to herein are L-amino acids.

[0332] In some embodiments, one or more amino acids of a compstatin analog (e.g., any of the compstatin analogs disclosed herein) may be N-alkyl amino acids (e.g., N-methyl amino acids). For example, but not limited to, at least one amino acid in the cyclic portion of the peptide, at least one amino acid at the N-terminus of the cyclic portion, and / or at least one amino acid at the C-terminus of the cyclic portion may be N-alkyl amino acids, such as N-methyl amino acids. In some embodiments, for example, a compstatin analog contains N-methylglycine, for example, at the position corresponding to position 8 of compstatin and / or at the position corresponding to position 13 of compstatin. In some embodiments of the present invention, one or more of the compstatin analogs in Table 8 contain at least one N-methylglycine, for example, at the position corresponding to position 8 of compstatin and / or at the position corresponding to position 13 of compstatin. In some embodiments of the present invention, one or more of the compstatin analogs in Table 8 contain at least one N-methylglycine, for example, at the position corresponding to position 13 of compstatin. For example, the C-terminal Thr, or Thr near the C-terminus, of the peptide sequence listed in Table 8, or any other compstatin analog sequence, may be substituted with N-methylIle. As can be understood, in some embodiments, the N-methylated amino acid contains N-methylGly at position 8 and N-methylIle at position 13. In some embodiments, the compstatin analog (e.g., any one of the compstatin analogs listed in Table 8) contains isoleucine at the position corresponding to position 3 of SEQ ID NO: 8, in place of or in addition to one or more substitutions described herein. For example, in some embodiments, the compstatin analog comprises or consists of any one of the sequences of SEQ ID NOs: 8-36, in which case position 3 is isoleucine. In some embodiments, the compstatin analog comprises or consists of any one of the sequences of SEQ ID NOs: 25, 33, or 36, in which case position 4 is isoleucine. Additional compstatin analogs are described, for example, in WO2019 / 166411.

[0333] Compstatin analogs may be prepared, for example, by various synthetic methods for peptide synthesis known in the art, via condensation of amino acid residues, following conventional peptide synthesis methods, or by expression in vitro or in living cells from a suitable nucleic acid sequence encoded using methods known in the art. For example, peptides may be synthesized using standard solid-phase methodologies as described in Malik, Katragadda, WO2004026328, and / or WO2007062249. Potentially reactive moieties, such as amino groups and carboxyl groups, and reactive functional groups may be protected and then deprotected using various protecting groups and methodologies known in the art. For example, “Protective Groups in Organic Synthesis”,3 rd See ed. Greene, TW and Wuts, PG, Eds., John Wiley & Sons, New York: 1999. The peptides may be purified using standard methods such as reversed-phase HPLC. If desired, the separation of diastereomer peptides may be carried out using known methods such as reversed-phase HPLC. If desired, the preparations may be lyophilized and then dissolved in a suitable solvent such as water. The pH of the resulting solution may be adjusted to a physiological pH using a base such as NaOH. The peptide preparations may be characterized by mass spectrometry, if desired, to confirm the mass and / or disulfide bond formation. See, for example, Mallik, 2005, and Katragadda, 2006.

[0334] Compstatin analogs can be modified by adding molecules such as polyethylene glycol (PEG) to stabilize the compound, reduce its immunogenicity, extend its lifespan in the body, increase or decrease its solubility, and / or increase its resistance to degradation. The PEGylation method is publicly known in the art (see Veronese, FM & Harris, Adv. Drug Deliv. Rev. 54, 453-456, 2002; Davis, FF, Adv. Drug Deliv. Rev. 54, 457-458, 2002); Hinds, KD & Kim, SW, Adv. Drug Deliv. Rev. 54, 505-530 (2002; Roberts, MJ, Bentley, MD & Harris, JMA, Adv. Drug Deliv. Rev. 54, 459-476; 2002); Wang, Y. Set al., Adv. Drug Deliv. Rev. 54, 547-570, 2002). Various polymers, including PEG and modified PEG, such as derivatized PEG to which polypeptides can be easily added, are described in the Nektar Advanced Pegylation 2005-2006 Product Catalog, Nektar Therapeutics, San Carlos, California. This document also provides details of appropriate conjugation procedures.

[0335] In some embodiments, the compstatin analog of any of SEQ ID NOs: 9-36 is elongated by one or more amino acids at the N-terminus, C-terminus, or both, in which case at least one of the amino acids has a side chain containing a reactive functional group such as a primary or secondary amine, a sulfhydryl group, a carboxyl group (which may be present as a carboxylic acid group), a guanidino group, a phenol group, an indole ring, a thioether, or an imidazole ring, which promotes conjugation with the reactive functional group to add PEG to the compstatin analog. In some embodiments, the compstatin analog contains an amino acid having a side chain containing a primary or secondary amine, such as a Lys residue. For example, a Lys residue, or a sequence containing a Lys residue, is added to the N-terminus and / or C-terminus of the compstatin analog described herein (e.g., a compstatin analog containing any one of SEQ ID NOs: 9-36).

[0336] In some embodiments, the Lys residue is separated from the cyclic portion of the compstatin analog by a rigid or plastic spacer. The spacer may include, for example, a substituted or unsubstituted, saturated or unsaturated alkyl chain, an oligo(ethylene glycol) chain, and / or other parts as described herein with respect to a linker, for example. The length of the chain may be, for example, 2 to 20 carbon atoms. In other embodiments, the spacer is a peptide. The peptide spacer may be, for example, 1 to 20 amino acids long, for example, 4 to 20 amino acids long. A suitable spacer may include, for example, a plurality of Gly residues, Ser residues, or both. Optionally, an amino acid having a side chain containing a primary or secondary amine, and / or at least one amino acid in the spacer, is a D-amino acid. Any of a variety of polymer backbone or scaffolds may be used. For example, the polymer backbone or scaffold may be a polyamide, polysaccharide, polyanhydride, polyacrylamide, polymethacrylate, polypeptide, polyethylene oxide, or dendrimer. Preferred methods and polymer skeletons are described, for example, in WO98 / 46270 (PCT / US98 / 07171) or WO98 / 47002 (PCT / US98 / 06963). In one embodiment, the polymer skeleton or scaffold comprises several reactive functional groups, such as carboxylic acids, anhydrides, or succinimide groups. The polymer skeleton or scaffold reacts with a compstatin analog. In one embodiment, the compstatin analog comprises one of a number of different reactive functional groups, such as carboxylic acids, anhydrides, or succinimide groups, which react with suitable groups on the polymer skeleton. Alternatively, monomer units that can be bonded to each other to form a polymer skeleton or scaffold first react with a compstatin analog, and the resulting monomers are polymerized. In another embodiment, short chains are polymerized and functionalized beforehand, and then a mixture of short chains of different compositions is assembled into a long polymer.

[0337] In some embodiments, the compstatin analog moiety is attached to each end of a linear PEG. A bifunctional PEG having a reactive functional group at each end of the chain can be used, for example, as described herein. In some embodiments, the reactive functional groups are identical, while in other embodiments, different reactive functional groups are present at each end.

[0338] Generally, in the compounds shown herein, the polyethylene glycol moiety is depicted with oxygen atoms either to the right or to the left of the repeating unit. Even when only one direction is depicted, this disclosure does not include depicting both directions of the polyethylene glycol moiety for a given compound or genus (i.e., (CH2CH2O) n and (OCH2CH2) n ) encompasses all combinations of directional properties if the compound or genus contains multiple polyethylene glycol moieties.

[0339] In some embodiments, a bifunctional linear PEG includes a moiety containing a reactive functional group at each of its ends. The reactive functional groups may be identical (homodifunctional) or different (heterodifunctional). In some embodiments, the structure of the bifunctional PEG may be symmetric, in which case the same moiety may be used to form -(CH2CH2O) n A reactive functional group is attached to the oxygen atom at each end of the chain. In some embodiments, different parts are used to attach two reactive functional groups to the PEG portion of the molecule. An exemplary bifunctional PEG structure is shown below. For illustrative purposes, t...

Claims

[Claim 1] The invention described in the present specification.