Anti-PD-L1 combinations for tumor treatment

JP2026137773APending Publication Date: 2026-08-27BIRDIE BIOPHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026101115
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2014-09-01
Filing Date
2026-06-17
Publication Date
2026-08-27

AI Technical Summary

Benefits of technology

【0053】 本発明の新規特徴は、添付の特許請求の範囲で具体的に記載される。本発明の特長い及び利点のより良好な理解は、本発明の原理を活用する例示的な実施形態を記載する以下の発明を実施するための形態、及び添付図面を参照することによって得られるだろう。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026137773000001_ABST
    Figure 2026137773000001_ABST
Patent Text Reader

Abstract

To provide methods for treating cancer using combinations and adjunct therapies of therapeutic agents. [Solution] A pharmaceutical composition comprising (i) a mixture of 1) an effective amount of anti-PD-1 antibody and 2) one or more pharmaceutically acceptable carriers, excipients, or diluents, and (ii) a pharmaceutical composition comprising a mixture of 1) an effective amount of immunotherapeutic capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof, and 2) one or more pharmaceutically acceptable carriers, excipients, or diluents, wherein the immunotherapeutic is 4-amino-2-(ethoxymethyl)-a,a-dimethyl-1H-imidazo[4,5-c]quinoline-1-ethanol (reximod).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefits of and priority to Chinese Patent Application No. 20140325480.9, filed on 9 July 2014, and Chinese Patent Application No. 201410440824.0, filed on 1 September 2014, and the full disclosures of these applications are incorporated herein by reference in their entirety.

[0002] Field of Invention This invention relates to combinations and methods of therapeutic agents for treating cancer using combination therapy. [Background technology]

[0003] Therapeutic antibodies have been used clinically for over 20 years. Currently, 15 antitumor antibody drugs are in clinical use, including Rituxan (1997), Herceptin (1998), Mylotarg (2000), Campath (2001), Zevalin (2002), Bexxer (2003), Avastin (2004), Erbitux (2004), Vectibix (2006), Arzerra (2009); Benlysta (2011); Yervoy (2011), Adcetris (2011), Perjeta (2012), and Kadcyla (2013). These antibodies primarily target four molecules: EGFR, Her2, CD20, and VEGF.

[0004] Generally, therapeutic antibodies kill tumor cells through three mechanisms (Non-Patent Literature 1): (1) Direct antibody action, i.e., blockade or agonist activity of ligand / receptor signaling, induction of apoptosis, and delivery of drugs or cytotoxic drugs. Antibody receptor activation activity can produce a direct tumor cell killing effect. For example, some antibodies can bind to receptors on the surface of tumor cells, activate the receptors, and induce apoptosis (e.g., in mitochondria). Antibodies can also mediate tumor cell death through receptor antagonistic activity. For example, certain antibodies can bind to cell surface receptors, block dimerization, kinase activation, and downstream signaling, thereby inhibiting proliferation and promoting apoptosis. Binding of antibodies to enzymes can result in neutralization, signal suppression, and cell death. (2) Immune-mediated cell death mechanisms, including complement-dependent cell-mediated cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), and T cell function regulation. Immune-mediated elimination of tumor cells can be achieved by the following methods: induction of phagocytosis, complement activation, antibody-dependent cell-mediated cytotoxicity, genetically modified T cells targeted against tumors by single-strand variable fragments (scFv), T cell activation by antibody-mediated antigen cross-presentation to dendritic cells, and inhibition of T cell inhibitory receptors such as cytotoxic T lymphocyte-associated antigen 4 (CTLA4). Of these, the Fc portion of the antibody features is particularly important for the tumor cell elimination effects mediated by CDC and ADCC. (3) Specific effects of antibodies against tumor vascular systems and matrix by inducing vascular and stromal cell ablation, including stromal cell inhibition, delivery of toxins to stromal cells, and delivery of toxins to the vascular system, through the capture of vascular receptor antagonists or ligands (Non-Patent Literature 1).

[0005] Therapeutic monoclonal antibody drugs are advancing research and development of anticancer drugs. However, further research is still needed to address several issues, including antibody immunogenicity, tolerance for long-term use of tumor targets, and the long-term effects of simple single blockade of signaling pathways. In summary, the majority of antibodies struggle to achieve long-term effective inhibition and death of tumor cells.

[0006] Antibody-drug conjugates combine targeting functionality with small molecule drugs possessing specific pharmacokinetic properties. The structure of an antibody-drug conjugate involves the attachment of a monoclonal antibody with targeting functionality to a compound with specific pharmacological properties. This technique requires a therapeutic antibody with target-specific binding to be bound to a molecule with therapeutic effects or other functions, such as cytotoxins. Many factors, including endocytosis of the bound antibody, binding stability, and toxin release and death activity, influence the effectiveness of this type of antibody.

[0007] Antibody-drug conjugates have direct and indirect anticancer effects. Antibodies can block or activate ligand / receptor signaling, induce apoptosis, and simultaneously present or deliver payload drugs (e.g., drugs, toxins, small interfering RNAs, or radioisotopes) directly or indirectly to tumor cells. Therapeutic antibody-drug conjugates utilize the dual properties of the antibody and the conjugated drug: firstly, the binding function that specifically binds to the target molecule; secondly, the tumor cell-killing function of the antibody itself; and thirdly, the specific effect of the conjugate drug. Current antibody-drug conjugate drugs are limited to how they directly kill tumor cells. However, due to the stringent requirements of the antibody, linker molecule, toxin molecule, and the technology in conjugation, as well as limitations in delivering toxins into the tumor microenvironment molecules, several difficulties still exist in actual clinical research. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Scott AM, Wolchok JD, Old LJ. Antibody therapy of cancer. Nat Rev Cancer. (2012), 12:278-87 [Non-Patent Document 2] Scott AM,Wolchok JD,Old LJ.Antibody therapy of cancer.Nat Rev Cancer.2012,12(4):278-87 [Overview of the Initiative] [Means for solving the problem]

[0009] In one embodiment, the present invention provides a combination comprising (i) an effective amount of a PD-L / PD-1 axis antagonist, and (ii) an effective amount of an immunotherapeutic capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof.

[0010] In some embodiments, the PD-L / PD-1 axis antagonist is selected from the group consisting of PD-1 binding antagonists, PD-L1 binding antagonists, and PD-L2 binding antagonists.

[0011] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-1 binding antagonist.

[0012] In some embodiments, PD-1 binding antagonists inhibit the binding of PD-1 to its ligand-binding partner.

[0013] In some embodiments, PD-1 binding antagonists inhibit the binding of PD-1 to PD-L1.

[0014] In some embodiments, PD-1 binding antagonists inhibit the binding of PD-1 to PD-L2.

[0015] In some embodiments, the PD-1 binding antagonist inhibits the binding of PD-1 to both PD-L1 and PD-L2.

[0016] In some embodiments, the PD-1 binding antagonist is an antibody such as MDX-1106, Merck 3745, CT-011, AMP-224, or AMP-514.

[0017] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-L1 binding antagonist.

[0018] In some embodiments, PD-L1 binding antagonists inhibit the binding of PD-L1 to PD-1.

[0019] In some embodiments, the PD-L1 binding antagonist inhibits the binding of PD-L1 to B7-1.

[0020] In some embodiments, the PD-L1 binding antagonist inhibits the binding of PD-L1 to both PD-1 and B7-1.

[0021] In some embodiments, the PD-L1 binding antagonist is an antibody selected from the group consisting of YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C.

[0022] In some embodiments, the PD-L / PD-1 axis antagonist is a PD-L2 binding antagonist.

[0023] In some embodiments, the PD-L2 binding antagonist is an antibody.

[0024] In some embodiments, the PD-L2 binding antagonist is an immunoadhesin.

[0025] In some embodiments, the treatment elicits a sustained response in the individual after treatment is discontinued.

[0026] In some embodiments, the immunotherapy agent is administered continuously or intermittently.

[0027] In some embodiments, the immunotherapy agent is administered before the PD-L / PD-1 axis antagonist.

[0028] In some embodiments, the immunotherapy agent is administered simultaneously with the PD-L / PD-1 axis antagonist.

[0029] In some embodiments, the immunotherapy agent is administered after the PD-L / PD-1 axis antagonist.

[0030] In some embodiments, the individual has colorectal cancer, melanoma, non-small cell lung cancer, ovarian cancer, breast cancer, pancreatic cancer, hematological malignancy, or renal cell carcinoma.

[0031] In some embodiments, PD-L / PD-1 axis antagonists are administered intravenously, intramuscularly, subcutaneously, topically, orally, percutaneously, intraperitoneally, intrathoracically, by implantation, by inhalation, intraarachnoidally, intraventricularly, or intranasally.

[0032] In some embodiments, the immunotherapy agent may specifically bind to human TLR7 and / or TLR8.

[0033] In some embodiments, the immunotherapy agent comprises (a) single-stranded RNA (ssRNA), preferably ORN02, ORN06, ssPoly(U), ssRNA40, ssRNA41, ssRNA-DR, or Poly(dT), or (b) a receptor ligand analog, preferably CL075, CL097, CL264, CL307, gardiquimod, loxoribine, imiquimod, or reximod.

[0034] In some embodiments, the immunotherapy agent is one of the compounds of formula (I) to (XIXb), or a pharmaceutically acceptable salt or solvate thereof.

[0035] In some embodiments, the immunotherapy agent has the structure of formula (I), [ka] In the formula, dashed lines indicate joining or absence of joining. X is S or -NR1, and R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl-- W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl. W2 is a bond, --O--, --C(O)--, --C(S)--, or -S(O)2--, W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl. W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl-C (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --S-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH are optionally substituted with one or more substituents selected from the group consisting of (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --C(O)-O-R4, --S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl. R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- R4 is optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R4, --C(O)-O-R4, --OC(O)-R4, --S-R4, --C(O)-S-R4, --SC(O)-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, and -SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. n is 0, 1, 2, 3, or 4. Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl. In the formula, R6, R7 and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl, and X and Z can combine to form a (5-9) member ring of their own choosing.

[0036] In some embodiments, the immunotherapeutic agent is 2-propylthiazolo[4,5-c]quinoline-4-amine, 1-(2-methylpropyl)-1H-imidazo[4,5-c]quinoline-4-amine, 4-amino-2-(ethoxymethyl)-a,a-dimethyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-(4-amino-2-ethylaminomethylimidazo-[4,5-c]quinoline-1-yl)-2-methylpropan-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinoline-1-yl] [4-(4-(4-amino-2-butyl-1H-imidazo[4,5-c]]methanesulfonamide, 4-amino-2-ethoxymethyl-aa-dimethyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1-ethanol, 4-amino-aa-dimethyl-2-methoxyethyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-{2-[3-(benzyloxy)propoxy]ethyl}-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-4-amine, N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyl [Lysine-1-yl)butyl]-n'-butylurea, N1-[2-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1-yl)ethyl]-2-amino-4-methylpentanamide, N-(2-{2-[4-amino-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinoline-1-yl]ethoxy}ethyl)-n'-phenylurea, 1-(2-amino-2-methylpropyl)-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-4-amine, 1-{4-[(3,5-dichloromethyl [Lolophenyl)sulfonyl]butyl}-2-ethyl-1H-imidazo[4,5-c]quinoline-4-amine, N-(2-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]ethoxy}ethyl)-n'-cyclohexylurea, N-{3-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]propyl}-n'-(3-cyanophenyl)thiourea, N-[3-(4-amino-2-butyl-1H-imidazo[4,5-c]quinoline-1-yl)-2,2-dimethylpropyl]benzamide, 2-butyl-1-[3-(methylsulfonyl)propyl]-1H-imidazo[4,5-c]quinoline-4-amine, N-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]-1,1-dimethylethyl}-2-ethoxyacetamide, 1-[4-amino-2-ethoxymethyl-7-(pyridine-4-yl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, 1-[4-amino-2-(ethoxymethyl)- 7-(pyridine-3-yl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, N-{3-[4-amino-1-(2-hydroxy-2-methylpropyl)-2-(methoxyethyl)-1H-imidazo[4,5-c]quinoline-7-yl]phenyl}methanesulfonamide, 1-[4-amino-7-(5-hydroxymethylpyridine-3-yl)-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, 3-[4-amino-2- (Ethoxymethyl)-7-(pyridine-3-yl)-1H-imidazo[4,5-c]quinoline-1-yl]propane-1,2-diol, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinoline-1-yl)-1,1-dimethylethyl]-3-propylurea, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinoline-1-yl)-1,1-dimethylethyl]-3-cyclopentylurea, 1-[(2,2-dimethyl-1,3-dioxolan-4-yl)methyl]-2-( Ethoxymethyl)-7-(4-hydroxymethylphenyl)-1H-imidazo[4,5-c]quinoline-4-amine, 4-[4-amino-2-ethoxymethyl-1-(2-hydroxy-2-methylpropyl)-1H-imidazo[4,5-c]quinoline-7-yl]-N-methoxy-N-methylbenzamide, 2-ethoxymethyl-N1-isopropyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1,4-diamine, 1-[4-amino-2-ethyl-7-(pyridine-4-yl)-1H-imidazo[4,The compound is selected from the group consisting of [5-c]quinoline-1-yl]-2-methylpropane-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinoline-1-yl)butyl]methanesulfonamide, and N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1-yl)butyl]-n'-cyclohexylurea.

[0037] In some embodiments, the immunotherapy agent has the structure of formula (II), [ka] In the formula, V is -NR6R7, where R6 and R7 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl. R 10 and R 11 R5 is independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl.

[0038] In some embodiments, the combination or pharmaceutical composition of the therapeutic agents of the present invention further comprises an effective amount of an additional therapeutic agent, such as an anticancer agent.

[0039] In some embodiments, the anticancer agent is an antimetabolite, a topoisomerase I and II inhibitor, an alkylating agent, a microtubule inhibitor, an antiandrogen, a GNRh modulator, or a mixture thereof.

[0040] In some embodiments, the additional therapeutic agent is a chemotherapeutic agent selected from the group consisting of tamoxifen, raloxifen, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minosine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide, etoposide, gemcitabine, epothiron, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

[0041] In another aspect, the present invention provides a method for treating a disease condition in a subject requiring treatment of the disease condition, the method comprising administering a combination of therapeutic agents or pharmaceutical compositions provided herein to the subject.

[0042] In some embodiments, the disease state is a tumor. In some embodiments, the disease state includes abnormal cell proliferation.

[0043] In some embodiments, the abnormal cell proliferation includes precancerous lesions. In some embodiments, the abnormal cell proliferation is that of cancer cells.

[0044] In some embodiments, the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

[0045] In some embodiments, the amount of immunotherapy agent is (1) inducing IFN-α in concentrated human blood DCs, (2) inducing TNF-α in concentrated human blood DCs, and / or (3) inducing IL-12-α in concentrated human blood DCs in an amount capable of doing so.

[0046] In some embodiments, the method comprises administering an oral formulation containing an immunotherapeutic agent (e.g., R848 and its analogs) to the subject at a dose between about 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg or 0.01 mg / kg to about 0.02 mg / kg twice a week.

[0047] In some embodiments, the method comprises administering an oral formulation containing an immunotherapeutic agent (e.g., R848 and its analogs) to the subject at a dose of about 0.005 mg / kg, 0.006 mg / kg, 0.​​​​​​ In some embodiments, the method involves administering an intravenous formulation containing the immunotherapy agent to the subject weekly at doses ranging from approximately 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or 0.006 mg / kg or less to approximately 0.007 mg / kg.

[0050] In some embodiments, the immunotherapy agent in the subject has a local concentration between approximately 0.005 μg / ml and approximately 12 μg / ml.

[0051] In some embodiments, the immunotherapy agent in the subject has a local concentration ranging from approximately 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or 0.4 μg / ml to approximately 0.5 μg / ml.

[0052] In further embodiments, the present invention provides combinations of therapeutic agents provided herein, and optionally kits including instructions.

[0053] Novel features of the present invention are specifically described in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by referring to the following embodiments for carrying out the invention, which describe exemplary embodiments utilizing the principles of the present invention, and the accompanying drawings. [Brief explanation of the drawing]

[0054] [Figure 1] Figure 1 shows the effect of anti-PDL1 mAb treatment on SCCVII tumor growth. SCCVII tumors were inoculated as described in Materials and Methods. Tumor-inoculated mice received intraperitoneal injections of anti-PDL1 mAb (200 μg / mouse) in combination with control rat immunoglobulin or TLRL three times a week. Mean tumor volume ± standard deviation was determined in each group of 5–8 mice. [Figure 2]Figure 2 shows the effect of anti-PDL1 mAb treatment on CT26 tumor growth. CT26 tumors were inoculated as described in Materials and Methods. Tumor-inoculated mice received intraperitoneal injections of anti-PDL1 mAb (200 μg / mouse) in combination with control rat immunoglobulin or TLRL three times a week. Mean tumor volume ± standard deviation was determined in each group of 5–8 mice. [Figure 3A] Figure 3A shows the analysis of cytokines in enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. The supernatant was collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of the triple culture. Three independent experiments were performed from three healthy donors. A: TLRL induced IFN-α expression in enriched human blood DCs (CD3+ / CD19+ / CD14+ / CD16+) from donor 1. [Figure 3B] Figure 3B shows the cytokine analysis of enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. Supernatants were collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of triple cultures. Three independent experiments were performed from three healthy donors. B: TLRL induced IFN-α expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3C]Figure 3C shows the analysis of cytokines in enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. The supernatant was collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of the triple culture. Three independent experiments were performed from three healthy donors. C: TLRL induced TNF-α expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3D] Figure 3D shows the cytokine analysis of enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. The supernatant was collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of the triple culture. Three independent experiments were performed from three healthy donors. D: TLRL induced IL-12 expression in enriched human blood DCs in experiment #2 from donor 2. [Figure 3E] Figure 3E shows the analysis of cytokines in enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. Supernatants were collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of triple cultures. Three independent experiments were performed from three healthy donors. E: TLRL induced IFN-α expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 3F]Figure 3F shows the analysis of cytokines in enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. The supernatant was collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of the triple culture. Three independent experiments were performed from three healthy donors. F: TLRL induced TNF-α expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 3G] Figure 3G shows the analysis of cytokines in enriched human DCs from three healthy donors. Enriched human DCs were transplanted into 96-well plates and directly cultured for 20 to 22 hours in a 37°C incubator with allogeneic untreated (medium) or treated TLRL at different concentrations. Supernatants were collected and human IFN-α, IL-20 (p70), and TNF-α were analyzed by ELISA. Data were obtained as mean ± standard deviation of triple cultures. Three independent experiments were performed from three healthy donors. G: TLRL induced IL-12 expression in enriched human blood DCs in experiment #3 from donor 3. [Figure 4A] Figure 4A shows the expression of IFN-induced genes in mouse PBMCs after TRRL injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at variable time points, and the relative expression of IFN-induced genes was determined by quantitative RT-PCR. The MX2 gene was detected over a time pathway of 5 hours after TLRL injection (4A). The values ​​show the mRNA expression of IFN-induced genes relative to the housekeeping gene actin. The bar graph represents data from three animal individuals. **P<0.01, ***P<0.001. [Figure 4B]Figure 4B shows the expression of IFN-induced genes in mouse PBMCs after TRLR injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at variable time points, and the relative expression of IFN-induced genes was determined by quantitative RT-PCR. The MX2 and ISG15 genes were measured at 2 hours post-injection (4B) at various doses of TLRL. The values ​​show the mRNA expression of IFN-induced genes relative to the housekeeping gene actin. The bar graphs represent data from three animals. **P<0.01, ***P<0.001. [Figure 4C] Figure 4C shows the expression of IFN-induced genes in mouse PBMCs after TRLR injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at variable time points, and the relative expression of IFN-induced genes was determined by quantitative RT-PCR. The values ​​show the mRNA expression of IFN-induced genes relative to the housekeeping gene actin. The bar graph represents data from three animal individuals. **P<0.01, ***P<0.001. [Modes for carrying out the invention]

[0055] Some aspects of the present invention are described below with reference to examples of application for illustrative purposes. It should be understood that many specific details, relationships, and methods are described to provide a complete understanding of the present invention. However, those skilled in the art will readily recognize that the present invention may be carried out without using one or more specific details, or by other means. The present invention is not limited to the order of actions or events described, and some actions may occur in a different order and / or simultaneously with other actions or events.

[0056] Furthermore, not all of the exemplified effects or events are necessary to carry out the method according to the present invention.

[0057] The terms used herein are intended solely to describe specific embodiments and are not intended to limit the invention. Where used herein, the singular forms “a,” “an,” and “the” are also intended to include the plural form unless otherwise clearly indicated by the context. Furthermore, where the terms “including,” “includes,” “having,” “has,” and “with,” or variations thereof, are used in any form for carrying out the invention and / or in the claims, such terms are intended to be comprehensive in a manner similar to that of “comprising.”

[0058] The terms “approximately” or “about” mean within an acceptable margin of error of a particular value as determined by those skilled in the art, which will in part depend on how the value was measured or determined, i.e., the limitations of the measurement system. For example, “approximately” may mean a standard deviation of 1 or more than 1, according to the practice of the art. Alternatively, “approximately” may mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably up to 1% of a given value. Or, particularly with respect to biological systems or processes, the term may mean within a number of decimal places of the value, preferably up to 5 times, more preferably up to 2 times. When a particular value is stated in the application and claims, unless otherwise stated, “approximately” should be assumed to mean within an acceptable margin of error of the particular value.

[0059] I. Definitions and Abbreviations Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used in this specification and laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are well-known and commonly used in the art. Standard techniques are used for nucleic acid and peptide synthesis. Techniques and procedures are generally carried out according to conventional methods in the art and various general references provided throughout this document. The nomenclature used in this specification and laboratory procedures in analytical chemistry and the organic syntheses described below are well-known and commonly used in the art. Standard techniques or modifications thereof are used for chemical synthesis and chemical analysis.

[0060] The term "alkyl", by itself or as part of another substituent, unless otherwise stated, means a straight-chain, branched-chain, or cyclic hydrocarbon radical, or combinations thereof, which may be fully saturated, mono- or polyunsaturated, and having the specified number of carbon atoms (i.e., C1-C 10A saturated hydrocarbon radical can include divalent and polyvalent radicals (where is 1 to 10 carbon atoms). Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, and cyclopropylmethyl, as well as homologs and isomers of n-pentyl, n-hexyl, n-heptyl, and n-octyl. An unsaturated alkyl group is a group having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, clotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and higher-order homologs and isomers. The term "alkyl" is intended to include alkyl derivatives, as defined more precisely below, such as "heteroalkyl," unless otherwise specified. Alkyl groups limited to hydrocarbon groups are referred to as "homoalkyl."

[0061] The term "alkylene" means a divalent radical derived from alkanes, exemplified by, but not limited to, -CH2CH2CH2CH2-, either by itself or as part of another substituent, and further includes groups referred to below as "heteroalkylenes." Typically, alkyl (or alkylene) groups have 1 to 24 carbon atoms, and those having 10 or fewer carbon atoms are preferred for the present invention. "Lower alkyl" or "lower alkylene" generally refers to short-chain alkyl or alkylene groups having 8 or fewer carbon atoms.

[0062] The terms “alkoxy,” “alkylamino,” and “alkylthio” (or thioalkoxy) are used in their traditional sense to mean an alkyl group attached to the rest of the molecule via an oxygen atom, an amino group, or a sulfur atom, respectively.

[0063] "Heteroalkyl," either by itself or in combination with another term, means, unless otherwise specified, a stable linear, branched, or cyclic hydrocarbon radical, or a combination thereof, comprising the specified number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si, and S, wherein the nitrogen and sulfur atoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized. The O, N, S, and Si of the heteroatom(s) may be located at any internal position of the heteroalkyl group or at a position where the alkyl group is attached to the rest of the molecule. Examples include, but are not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, and -CH=CH-N(CH3)-CH3. Up to two heteroatoms can be consecutive, such as -CH2-NH-OCH3 and -CH2-O-Si(CH3)3. Similarly, the term “heteroalkylene” refers to divalent radicals derived from heteroalkyls, exemplified by, but not limited to, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-, either by themselves or as part of another substituent. Regarding heteroalkylene groups, the heteroatom can occupy either or both of the chain ends (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, etc.). Furthermore, for alkylene and heteroalkylene linking groups, the orientation of the linking group is not indicated by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R'- represents both -C(O)2R'- and -R'C(O)2-.

[0064] Generally, "acyl substituents" are also selected from the groups described above. As used herein, "acyl substituent" means a group that, when attached, satisfies the valence of a carbonyl carbon directly or indirectly attached to the polycyclic nucleus of the compound of the present invention.

[0065] The terms "cycloalkyl" and "heterocycloalkyl," either by themselves or in combination with other terms, represent the cyclic forms of "alkyl" and "heteroalkyl," respectively, unless otherwise specified. In addition, for heterocycloalkyls, the heteroatom can occupy a position where its heterocycle is attached to the rest of the molecule. Examples of cycloalkyls include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, and cycloheptyl. Examples of heterocycloalkyls include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, and 2-piperazinyl.

[0066] The terms “halo” or “halogen” mean, unless otherwise noted, fluorine, chlorine, bromine, or iodine atoms, either by themselves or as part of another substituent. In addition, terms such as “haloalkyl” are intended to include monohaloalkyl and polyhaloalkyl. For example, the term “halo(C1-C4)alkyl” is intended to include, but is not limited to, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, etc.

[0067] As used herein, the term “haloalkyl” refers to an alkyl group as defined herein, substituted with one or more halo groups as described herein. Preferably, a haloalkyl group may be a monohaloalkyl group, a dihaloalkyl group, or a polyhaloalkyl group comprising a perhaloalkyl group. A monohaloalkyl group may have one iodo, bromo, chloro, or fluoro group within the alkyl group. Dihaloalkyl groups and polyhaloalkyl groups may have two or more combinations of the same halo atom or different halo groups within the alkyl group. Preferably, a polyhaloalkyl group contains up to 12, 10, or 8, or 6, or 4, or 3, or 2 halo groups. Non-limiting examples of haloalkyls include fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichloromethyl, trichloromethyl, pentafluoroethyl, heptafluoropropyl, difluorochloromethyl, dichlorofluoromethyl, difluoroethyl, difluoropropyl, dichloroethyl, and dichloropropyl. Perhaloalkyls refer to alkyl groups in which all hydrogen atoms are replaced by halo atoms.

[0068] As used herein, the term "heteroaryl" refers to a 5- to 14-membered monocyclic, dicyclic, or fusion polycyclic system having 1 to 8 heteroatoms selected from N, O, S, or Se. Preferably, heteroaryls are 5- to 10-membered ring systems. Typical heteroaryl groups include 2- or 3-thienyl, 2- or 3-furyl, 2- or 3-pyrrolyl, 2-, 4-, or 5-imidazolyl, 3-, 4-, or 5-pyrazolyl, 2-, 4-, or 5-thiazolyl, 3-, 4-, or 5-isothiazolyl, 2-, 4-, or 5-oxazolyl, 3-, 4-, or 5-isoxazolyl, 3- or 5-1,2,4-triazolyl, 4- or 5-1,2,3-triazolyl, tetrazolyl, 2-, 3-, or 4-pyridyl, 3- or 4-pyridazinyl, 3-, 4-, or 5-pyradinyl, 2-pyradinyl, 2-, 4-, or 5-pyrimidinyl.

[0069] The term "heteroaryl" also refers to a group in which a heteroaromatic ring is fused to one or more aryl, cyclic aliphatic, or heterocycloalkyl rings, where the radical or attachment site is on the heteroaromatic ring. Non-limiting examples include 1-, 2-, 3-, 5-, 6-, 7-, or 8-indolynyl, 1-, 3-, 4-, 5-, 6-, or 7-isoindolyl, 2-, 3-, 4-, 5-, 6-, or 7-indolyl, 2-, 3-, 4-, 5-, 6-, 7-, or 8-prinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, or 9-quinolidinyl, 2-, 3-, 4-, 5-, 6-, 7-, or 8-quinolyl. -, 3-, 4-, 5-, 6-, 7-, or 8-isoquinoliyl, 1-, 4-, 5-, 6-, 7-, or 8-phthalazinyl, 2-, 3-, 4-, 5-, or 6-naphthilidinyl, 2-, 3-, 5-, 6-, 7-, or 8-quinazolinyl, 3-, 4-, 5-, 6-, 7-, or 8-sinnolinyl, 2-, 4-, 6-, or 7-pteridinyl, 1-, 2-, 3-, 4-, 5-, 6-, 7-, or 8-4aHcarbazolyl, 1-, 2-, 3-, 4-, 5 -, 6-, 7-, or 8-carbazolyl, 1-, 3-, 4-, 5-, 6-, 7-, 8-, or 9-carbolinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenanthrolinyl, 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, or 9-acridinyl, 1-, 2-, 4-, 5-, 6-, 7-, 8-, or 9-perimidinyl, 2-, 3-, 4-, 5-, 6-, 8-, 9-, or 10-phenanthrolinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8- , or 9-phenazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenothiazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-, or 10-phenoxazinyl, 2-, 3-, 4-, 5-, 6-, or 1-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-benzoisoquinolinyl, 2-, 3-, 4-, or 5-thieno[2,3-b]furanil, 2-, 3-, 5-, 6-, 7-, 8-, 9-, 10-, or 11-7H-pyrazino[2,3-c]carbazolyl, 2-, 3-, 5-, 6-, or 7-2H-flo[3,2-b]-pyranyl, 2-, 3-, 4-, 5-, 7-, or 8-5H-pyrido[2,3-d]-o-oxazinyl, 1-, 3-, or 5-1H-pyrazolo[4,3-d]-oxazolyl, 2-, 4-, or 54H-imidazo[4,5-d]thia Zolyl, 3-, 5-, or 8-pyrazino[2,3-d]pyridazinyl, 2-, 3-, 5-, or 6-imidazo[2,1-b]thiazolyl, 1-, 3-, 6-, 7-, 8-, or 9-flo[3,4-c]sinnorinyl, 1-, 2-, 3-, 4-, 5-, 6-, 8-, 9-, 10, or 11-4H-pyrido[2,3-c]cal This includes, but is not limited to, bazolyl, 2-, 3-, 6-, or 7-imidazo[1,2-b][1,2,4]triazinyl, 7-benzo[b]thienyl, 2-, 4-, 5-, 6-, or 7-benzoxazolyl, 2-, 4-, 5-, 6-, or 7-benzimidazolyl, 2-, 4-, 4-, 5-, 6-, or 7-benzothiazolyl, 1-, 2-, 4-, 5-, 6-, 7-, 8-, or 9-benzoxapinyl, 2-, 4-, 5-, 6-, 7-, or 8-benzoxazinyl, 1-, 2-, 3-, 5-, 6-, 7-, 8-, 9-, 10-, or 11-1H-pyrrolo[1,2-b][2]benzoazapinyl. Typical fusion heteroaryl groups include, but are not limited to, 2-, 3-, 4-, 5-, 6-, 7-, or 8-quinolinyl, 1-, 3-, 4-, 5-, 6-, 7-, or 8-isoquinolinyl, 2-, 3-, 4-, 5-, 6-, or 7-indolyl, 2-, 3-, 4-, 5-, 6-, or 7-benzo[b]thienyl, 2-, 4-, 5-, 6-, or 7-benzoxazolyl, 2-, 4-, 5-, 6-, or 7-benzimidazolyl, and 2-, 4-, 5-, 6-, or 7-benzothiazolyl.

[0070] As used herein, the terms “heterocyclyl” or “heterocyclo” refer to optionally substituted, fully saturated or unsaturated, aromatic or non-aromatic ring groups, for example, 4 to 7-membered monocyclic, 7 to 12-membered dicyclic, or 10 to 15-membered tricyclic ring systems, which have at least one heteroatom within at least one carbon-containing ring. Each ring of a heterocyclic group containing heteroatoms may have one, two, or three heteroatoms selected from nitrogen, oxygen, and sulfur atoms, where the nitrogen and sulfur heteroatoms may also be optionally oxidized. Heterocyclic groups may be attached to heteroatoms or carbon atoms.

[0071] Exemplary monocyclic heterocyclic groups include pyrrolidinyl, pyrrolyl, pyrazolyl, oxetanyl, pyrazolinyl, imidazolyl, imidazolinyl, imidazolidinyl, triazolyl, oxazolyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolyl, thiadiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, furyl, tetrahydrofuryl, thienyl, oxadiazolyl, piperidinyl, piperazinyl, 2-oxopiperazinyl, 2-ox This includes sopiperidinyl, 2-oxopyrrodinyl, 2-oxoazepinyl, azepinyl, 4-piperidonyl, pyridyl, pyrazinyl, pyrimidinyl, pyridadinyl, tetrahydropyranyl, morpholinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiamorpholinyl sulfone, 1,3-dioxolane, and tetrahydro-1,1-dioxothienyl, 1,1,4-trioxo-1,2,5-thiadiazolidine-2-yl, among others.

[0072] Exemplary bicyclic heterocyclic groups include indolyl, dihydroindolyl, benzothiazolyl, benzoxazinyl, benzoxazolyl, benzothienyl, benzothiadinyl, quinuclidinyl, quinolinyl, tetrahydroquinolinyl, decahydroquinolyl, isoquinolinyl, tetrahydroisoquinolyl, decahydroisoquinolyl, benzimidazolyl, benzopyranil, indolidinyl, benzofuryl, chromonyl, coumalinyl, and ben These include zopyranil, cinnolinil, quinoxalinil, indazolyl, pyrrolopyridyl, flupyridinil (e.g., flu[2,3-c]pyridinil, flu[3,2-b]pyridinil, or flu[2,3-b]pyridinil), dihydroisoindolyl, 1,3-dioxo-1,3-dihydroisoindole-2-yl, dihydroquinazolinyl (e.g., 3,4-dihydro-4-oxo-quinazolinil), and phthalazinil.

[0073] Examples of tricyclic heterocyclic groups include carbazolyl, dibenzoazepinyl, dithienosepinyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridine, phenoxazinyl, phenothiazinyl, xanthenyl, and carbolinyl.

[0074] "Heterocyclyl" further refers to a heterocyclic group as defined herein, substituted with one, two, or three substituents selected from the group consisting of: (a) alkyl, (b) Hydroxy (or protected hydroxy), (c) Haro, (d) Oxo, that is, = O, (e) amino, alkylamino or dialkylamino, (f) Alkoxy, (g) Cycloalkyl, (h) Carboxy, (i) heterocyclooxy, where heterocyclooxy refers to a heterocyclic group linked through an oxygen bridge. (j)alkyl-OC(O)--, (k) Mercapto, (l) Nitro, (m) Cyano, (n) sulfamoyl or sulfonamide, (o) Ariel, (p)alkyl-C(O)-O--, (q)aryl-C(O)-O--, (r) Aryl-S--, (s) aryloxy, (t) alkyl-S--, (u) Formil, that is, HC(O)--, (v) carbamoyl, (w) aryl-alkyl--, and (x) Aryls substituted with alkyl, cycloalkyl, alkoxy, hydroxy, amino, alkyl-C(O)-NH--, alkylamino, dialkylamino, or halogen.

[0075] As used herein, the term "alkenyl" refers to a linear or branched hydrocarbon group having 2 to 20 carbon atoms and containing at least one double bond. The alkenyl group preferably has about 2 to 8 carbon atoms.

[0076] The term "aryl," unless otherwise specified, refers to a polyunsaturated, aromatic, hydrocarbon substituent, which can be monocyclic or polycyclic (preferably 1-3 rings), fused together or covalently bonded together. The term "heteroaryl" refers to an aryl group (or ring) containing 1-4 heteroatoms selected from N, O, and S, where nitrogen and sulfur atoms are optionally oxidized, and nitrogen atoms are optionally quaternized. Heteroaryl groups can be attached to the rest of the molecule via heteroatoms. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2- These include thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. The substituents for each of the aryl and heteroaryl ring systems listed above are selected from the group of acceptable substituents listed below.

[0077] For brevity, the term "aryl," when used in combination with other terms (e.g., aryloxy, arylthiooxy, arylalkyl), includes both the aryl and heteroaryl rings defined above. Thus, the term "arylalkyl" is intended to include radicals (e.g., benzyl, phenethyl, pyridylmethyl, etc.) in which an aryl group is attached to an alkyl group, including alkyl groups in which a carbon atom (e.g., a methylene group) is replaced by an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(1-naphthyloxy)propyl, etc.).

[0078] Each of the above terms (e.g., "alkyl," "heteroalkyl," "aryl," and "heteroaryl") includes both substituted and unsubstituted forms of the radicals shown. Preferred substituents for each type of radical are provided below.

[0079] Substituents of alkyl and heteroalkyl radicals (including groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are generally called "alkyl substituents" and "heteroalkyl substituents," respectively, and these include -OR', =O, =NR', =N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', and -CONR'. R', R'', R''', and R'''' are selected from, but are not limited to, one or more diverse groups from, -OC(O)NR'R'', -NR''C(O)R', -NR'-C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -CN, and -NO2, where the number ranges from zero to (2m'+1), and m' is the total number of carbon atoms in such radicals. R', R'', R''', and R'''' each preferably independently refer to hydrogen, a substituted or unsubstituted heteroalkyl group, a substituted or unsubstituted aryl group, e.g., an aryl group substituted with 1 to 3 halogens, a substituted or unsubstituted alkyl group, an alkoxy or thioalkoxy group, or an arylalkyl group. If the compounds of the present invention contain more than one R group, for example, each R group is independently selected, and so are each R', R'', R''', and R'''' if there are more than one of these groups. If R' and R'' are attached to the same nitrogen atom, they can combine with the nitrogen atom to form a 5-membered, 6-membered, or 7-membered ring. For example, but not limited to these, -NR'R'' is intended to include 1-pyrrolidinyl and 4-morpholinyl. From the above consideration of substituents, those skilled in the art will understand that the term "alkyl" is intended to include groups containing carbon atoms attached to groups other than hydrogen groups, such as haloalkyls (e.g., -CF3 and -CH2CF3) and acyls (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, etc.).

[0080] Similar to the substituents described for alkyl radicals, aryl substituents and heteroaryl substituents are generally called "aryl substituents" and "heteroaryl substituents," respectively, and come in a variety of forms, such as: halogen, -OR', =O, =NR', =N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'' R', R'', R'''', and R'''' are selected from -NR''C(O)R', -NR'-C(O)NR''R'''', -NR''C(O)2R', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -CN and -NO2, -R', -N3, -CH(Ph)2, fluoro(C1~C4)alkoxy and fluoro(C1~C4)alkyl, where the number ranges from zero to the total number of open valences in the aromatic ring system, and R', R'', R''', and R'''' are preferably independently selected from hydrogen, (C1~C8)alkyl and heteroalkyl, unsubstituted aryl and heteroaryl, (unsubstituted aryl)-(C1~C4)alkyl, and (unsubstituted aryl)oxy-(C1~C4)alkyl. If the compound of the present invention contains more than one R group, for example, each R group is independently selected, and the same applies to each R', R'', R''', and R'''' group if more than one of these groups are present.

[0081] Two of the aryl substituents on adjacent atoms of an aryl or heteroaryl ring are optionally of the formula -TC(O)-(CRR') q Substitutings may be -U-, where T and U are independently -NR-, -O-, -CRR'-, or single bonds, and q is an integer from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may be of the formula -A-(CH2) r-B- can be substituted with substituents, where A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer from 1 to 4. One of the single bonds of the novel ring thus formed may be optionally replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may be optionally replaced with substituents of the formula -(CRR') s -X-(CR''R''') d The substituents R, R', R'', and R'''' are preferably independently selected from hydrogen or substituted or unsubstituted (C1-C6) alkyl groups.

[0082] As used herein, the term "heteroatom" includes oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).

[0083] As used herein, the term "aryloxy" refers to both -O-aryl and -O-heteroaryl groups, where aryl and heteroaryl are defined herein.

[0084] As used herein, the term “pharmaceutically acceptable salt” refers to a salt that retains the biological efficacy and properties of the compounds of the present invention, and is not biologically or otherwise undesirable. In many cases, the compounds of the present invention can form acid and / or base salts in the presence of an amino and / or carboxyl group or a similar group (e.g., phenol or hydroxamic acid). Pharmaceutically acceptable acid addition salts can be formed using inorganic and organic acids. Examples of inorganic acids that can induce salts include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc. Examples of organic acids that can induce salts include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, etc. Pharmaceutically acceptable base addition salts can be formed using inorganic and organic bases. Examples of inorganic bases that can derive salts include sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum; ammonium, potassium, sodium, calcium, and magnesium salts are particularly preferred. Examples of organic bases that can derive salts include primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, specifically including isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. The pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds, basic or acidic moieties by conventional chemical methods. Generally, such salts can be prepared by reacting the free acidic form of these compounds with a stoichiometric amount of a suitable base (e.g., Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, etc.) or by reacting the free base form of these compounds with a stoichiometric amount of a suitable acid. Such reactions are typically carried out in water or an organic solvent, or a mixture of these two.Generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred where feasible. A list of additional suitable salts can be found, for example, in Remington's Pharmaceutical Sciences, 20th edition, Mack Publishing Company, Easton, Pennsylvania (1985), which is incorporated herein by reference.

[0085] As used herein, the term “pharmaceutically acceptable carrier / excipient” includes any and all solvents, dispersions, coatings, surfactants, antioxidants, preservatives (e.g., antimicrobials, antifungals), isotonic agents, absorption retarders, salts, drugs, drug stabilizers, binders, excipients, disintegrants, lubricants, sweeteners, flavorings, pigments, such materials and combinations thereof, which will be well known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th edition, Mack Printing Company, 1990, pp. 1289–1329, incorporated herein by reference). Unless any conventional carrier is incompatible with the active ingredient, its use in therapeutic agents or pharmaceutical compositions is intended.

[0086] As used herein, the term “subject” refers to an animal. Preferably, the animal is a mammal. The subject may also refer to, for example, primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, etc. In a preferred embodiment, the subject is a human.

[0087] As used herein, the terms “therapeutic combination” or “combination” refer to a combination of one or more active drug substances, i.e., compounds having therapeutic utility. Typically, each such compound in the therapeutic combination of the present invention will be present in a pharmaceutical composition comprising that compound and a pharmaceutically acceptable carrier. The compounds in the therapeutic combination of the present invention may be administered simultaneously or separately as part of a regimen.

[0088] II. Composition In general, the present invention provides combinations of therapeutic agents, pharmaceutical compositions, and methods for treating cancer using combination therapies. More specifically, combinations of immunotherapeutic agents (e.g., using Toll-like receptor ligands "TLRL" that activate DCs in innate immunity and link to adaptive immunity) and targeted therapies (e.g., PD-L / PD-1 axis antagonists) are used to treat cancers such as gastric and lung cancer.

[0089] In one embodiment, the present invention provides a combination of therapeutic agents or pharmaceutical composition comprising (i) an effective amount of a PD-L / PD-1 axis antagonist, (ii) an effective amount of an immunotherapy agent capable of activating human dendritic cells, NK cells, monocytes, macrophages, or tumor cells, or a combination thereof, and optionally (iii) one or more pharmaceutically acceptable carriers.

[0090] A combination of therapeutic agents may be provided in a single pharmaceutical composition so that both the targeted therapy agent and the immunotherapy agent can be administered together. In an alternative embodiment, the combination of therapeutic agents may be provided using two or more pharmaceutical compositions. In such an embodiment, the targeted therapy agent is provided in one pharmaceutical composition and the immunotherapy agent is provided in a second pharmaceutical composition, so that the two compounds can be administered separately, for example, by being administered at different times or by different routes of administration. Thus, it may also be possible to provide targeted therapy agents and immunotherapy agents in different dosing regimens.

[0091] Unless otherwise specified, references to a compound include any pharmaceutically acceptable form of the compound, including any isomers (e.g., diastereomers or enantiomers), salts, solvates, polymorphs, etc. In particular, if the compound is optically active, references to the compound include each of the enantiomers of the compound and racemic mixtures of said enantiomers.

[0092] Generally, targeted therapy agents and immunotherapy agents are not linked to each other, for example, by covalent linkers.

[0093] A PD-L / PD-1 Axis antagonist Generally, the combinations provided herein include entities such as PD-L / PD-1 Axis antagonists that can specifically bind to specific targets such as PD-L1, PD-L2, or PD-1. The entity can bind to PD-L1, PD-L2, or PD-1 specifically or preferentially as compared to non-targets.

[0094] As used herein, "specifically binds" or "preferentially binds" means that the binding between two binding partners (e.g., between a target moiety and its binding partner) is selective for the two binding partners and can be distinguished from unwanted or non-specific interactions. For example, the ability of an antigen-binding portion to bind to a particular antigenic determinant can be measured through an enzyme-linked immunosorbent assay (ELISA) or other techniques well known to those of skill in the art, such as surface plasmon resonance techniques (analyzed by a BIAcore instrument) (Liljeblad et al., Glyco J 17,323-329 (2000)), and traditional binding assays (Heeley, Endocr Res 28,217-229 (2002)). The terms "anti-[antigen] antibody" and "antibody that binds to [antigen]" mean an antibody that can bind to each antigen with sufficient affinity such that the antibody is useful as a diagnostic agent and / or therapeutic agent that targets the antigen. In some embodiments, the degree of binding of an anti-[antigen] antibody to an irrelevant protein is, for example, less than about 10% of the binding of the antibody to the antigen, measured by a radioimmunoassay (RIA). In some embodiments, the antibody that binds to [antigen] has a dissociation constant (KD) of less than 1 μM, less than 100 nM, less than 10 nM, less than 1 nM, less than 0.1 nM, less than 0.01 nM, or less than 0.001 nM (e.g., 10 -8 M or less, e.g., 10 -8 M to 10 -13 M, e.g., 10 -9 M to 10 -13 M). It should be understood that the above definitions are also applicable to antigen-binding portions that bind to an antigen.

[0095] In this specification, “PD-L / PD-1 Axis antagonist” means a molecule that inhibits the interaction of a PD-L / PD-1 axis binding partner with one or more PD-L / PD-1 axis binding partners in order to eliminate T cell dysfunction resulting from signaling on the PD-L / PD-1 signaling axis, which would restore or enhance T cell function (e.g., proliferation, cytokine production, target cell death). As described herein, PD-L / PD-1 axis antagonists include PD-1 binding antagonists, PD-L1 binding antagonists, and PD-L2 binding antagonists.

[0096] In this specification, “PD-1 binding antagonist” means a molecule that reduces, shields, inhibits, disrupts, or interferes with signaling resulting from the interaction of PD-1 with one or more PD-1 binding partners, such as PD-L1 and PD-L2. In some embodiments, a PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its binding partners. In certain embodiments, a PD-1 binding antagonist inhibits the binding of PD-1 to PD-L1 and / or PD-L2. For example, a PD-1 binding antagonist includes anti-PD-1 antibodies, their antigen-binding fragments, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, shield, inhibit, disrupt, or interfere with signaling resulting from the interaction of PD-1 with PD-L1 and / or PD-L2. In one embodiment, a PD-1 binding antagonist reduces negative co-stimulatory signaling mediated by or via cell surface proteins expressed in PD-1-mediated T lymphocyte-mediated signaling, thereby reducing the dysfunctional state of T cells (e.g., increasing the effector response to antigen recognition). In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody. In certain embodiments, the PD-1 binding antagonist is MDX-1106 as described herein. In another particular embodiment, the PD-1 binding antagonist is Merck 3745 as described herein. In yet another particular embodiment, the PD-1 binding antagonist is CT-011 as described herein.

[0097] As used herein, “PD-L1 binding antagonist” means a molecule that reduces, shields, inhibits, disrupts, or interferes with signaling resulting from the interaction of PD-L1 with one or more PD-L1 binding partners, such as PD-1 and B7-1. In some embodiments, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L1 to its binding partner. In certain embodiments, a PD-L1 binding antagonist inhibits the binding of PD-L1 to PD-1 and / or B7-1. In some embodiments, a PD-L1 binding antagonist includes anti-PD-L1 antibodies, their antigen-binding fragments, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, shield, inhibit, disrupt, or interfere with signaling resulting from the interaction of PD-L1 with one or more PD-L1 binding partners, such as PD-1 and B7-1. In one embodiment, a PD-L1 binding antagonist reduces negative co-stimulatory signaling mediated by or via cell surface proteins expressed in PD-L1-mediated T lymphocyte-mediated signaling, thereby reducing the dysfunctional state of T cells (e.g., increasing the effector response to antigen recognition). In some embodiments, the PD-L1 binding antagonist is an anti-PD-L1 antibody. In some specific embodiments, the anti-PD-L1 antibody is YW243.55.S70 as described herein. In another specific embodiment, the anti-PD-L1 antibody is MDX-1105 as described herein. In yet another specific embodiment, the anti-PD-L1 antibody is MPDL3280A as described herein.

[0098] As used herein, “PD-L2 binding antagonist” means a molecule that reduces, shields, inhibits, disrupts, or interferes with signaling resulting from the interaction of PD-L2 with one or more PD-L2 binding partners, such as PD-1. In some embodiments, a PD-L2 binding antagonist is a molecule that inhibits the binding of PD-L2 to its binding partners. In certain embodiments, a PD-L2 binding antagonist inhibits the binding of PD-L2 to PD-1. In some embodiments, a PD-L2 antagonist includes anti-PD-L2 antibodies, their antigen-binding fragments, immunoadhesins, fusion proteins, oligopeptides, and other molecules that reduce, shield, inhibit, disrupt, or interfere with signaling resulting from the interaction of PD-L2 with one or more PD-L2 binding partners, such as PD-1. In one embodiment, a PD-L2 binding antagonist reduces negative co-stimulatory signaling mediated by or via cell surface proteins expressed in PD-L2-mediated T lymphocyte-mediated signaling, so that dysfunctional T cells are less dysfunctional (e.g., increased effector response to antigen recognition). In some embodiments, the PD-L2 binding antagonist is an immunoadhesin.

[0099] antibody In some embodiments, the targeted therapy agent includes an antibody or a functional fragment thereof.

[0100] In this specification, “immunoglobulin” or “antibody” means a full-length immunoglobulin molecule (e.g., an IgG antibody) or an immunoactive (i.e., specifically binding) portion of an immunoglobulin molecule, such as an antibody fragment, which is either naturally occurring or formed by normal immunoglobulin gene fragment recombination processes. Antibodies or antibody fragments may be conjugated or otherwise derivatized within the scope of the claimed subject matter. Such antibodies include IgG1, IgG2a, IgG3, IgG4 (and IgG4 subforms), as well as IgA isotypes.

[0101] The term “antibody” as used herein is used in its broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, as long as they exhibit desired antigen-binding activity and contain an Fc region or a region equivalent to the Fc region of an immunoglobulin. The terms “full-length antibody,” “intact antibody,” and “whole antibody” are used interchangeably herein and refer to antibodies having a structure substantially similar to an undenatured antibody structure, or having a heavy chain containing an Fc region as defined herein.

[0102] In this specification, “undenatured antibody” refers to naturally occurring immunoglobulin molecules having a variety of structures. For example, an undenatured IgG antibody is a heterotetrameric glycoprotein with approximately 150,000 daltons, composed of two identical light chains and two identical heavy chains linked by disulfide bonds. From N to the C-terminus, each heavy chain has a variable region (VH), also called a variable heavy chain domain or heavy chain variable domain, followed by three constant domains (CHI, CH2, and CH3), also called heavy chain constant domains. Similarly, from N to the C-terminus, each light chain has a variable region (VL), also called a variable light chain domain or light chain variable domain, followed by a constant light chain (CL) domain, also called a light chain constant domain. The light chains of an antibody may be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of their constant domains.

[0103] In this specification, “antibody fragment” means a molecule other than an intact antibody, which includes a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv), single-domain antibodies, and multispecific antibodies formed from antibody fragments. For an overview of a particular antibody fragment, see, for example, Hudson et al., Nat Med 9, 129-134 (2003). For an overview of scFv fragments, see, for example, Pliickthun, in The Pharmacology of Monoclonal Antibodies, 113th edition, edited by Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994); also see International Publication No. 93 / 16185; and U.S. Patent Nos. 5,571,894 and 5,587,458. For a discussion of Fab and F(ab')2 fragments containing reusable receptor-binding epitope residues and having increased in vivo half-lives, see U.S. Patent No. 5,869,046. A diabody is an antibody fragment with two antigen-binding sites that may be bivalent or bispecific. See, for example, European Patent No. 404,097; International Publication No. 1993 / 01161; Hudson et al., Nat Med 9,129-134 (2003); and Hollinger et al., Proc Natl Acad Sci USA 90,6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat Med 9,129-134 (2003). A single-domain antibody is an antibody fragment containing all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In certain embodiments, a single-domain antibody is a human single-domain antibody (see, for example, Domantis, Inc., Waltham, Massachusetts; U.S. Patent No. 6,248,516B1).Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies as described herein, and production by recombinant host cells (e.g., Escherichia coli or phages).

[0104] In this specification, “antigen-binding domain” means a portion of an antibody that includes a region that specifically binds to and is complementary to some or all of an antigen. The antigen-binding domain may be provided, for example, by one or more antibody variable domains (also called antibody variable regions). Specifically, the antigen-binding domain includes an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

[0105] In this specification, “variable region” or “variable domain” refers to a domain of the antibody heavy chain or light chain involved in the binding of the antibody to the antigen. The variable domains of the heavy and light chains of an undenatured antibody (VH and VL, respectively) generally have similar structures, and each domain contains four conserved framework regions (FRs) and three hypervariable regions (HVRs). See, for example, Kindt et al., Kuby Immunology, 6th edition, WH Freeman and Co., page 91 (2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity.

[0106] In this specification, “hypervariable region” or “HVR” means each region of the antibody variable domain that is hypervariable in sequence and / or forms a structurally defined loop (“hypervariable loop”). Generally, an undenatured four-chain antibody contains six HVRs, namely three in VH (HI, H2, H3) and three in VL (LI, L2, L3). HVRs generally contain amino acid residues derived from the hypervariable loop and / or the complementarity-determining region (CDR), the latter of which is the most sequence-variable and / or involved in antigen recognition. Except for CDR1 in VH, CDRs generally contain amino acid residues that form the hypervariable loop. Hypervariable regions (HVRs) are also called “complementarity-determining regions” (CDRs), and these terms are used interchangeably in this specification when referring to the portion of the variable region that forms the antigen-binding region. This particular region is described by Kabat et al., USDept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983), and Chothia et al., J Mol Biol 196:901-917 (1987), and the definition includes overlaps or subsets of amino acid residues when compared to one another. In any case, the application of any definition referring to a CDR of an antibody or its variant is intended to be within the scope of the definitions and terms used herein. The exact number of residues that constitute a particular CDR will vary depending on the sequence and size of the CDR. Those skilled in the art can routinely determine which residues constitute a particular CDR by considering the variable region amino acid sequence of an antibody.

[0107] The antibody of the present invention may be a chimeric antibody, a humanized antibody, a human antibody, or an antibody fusion protein.

[0108] In this specification, “chimeric antibody” means a recombinant protein containing a complementarity-determining region (CDR) of an antibody derived from one species, preferably a rodent antibody, more preferably a mouse antibody, while the constant domain of the antibody molecule is derived from that of a human antibody, and contains variable domains for both heavy and light antibody chains. For veterinary applications, the constant domain of a chimeric antibody may be derived from that of another species, such as a primate, cat, or dog.

[0109] In this specification, “humanized antibody” means a recombinant protein in which a CDR derived from an antibody of one species, for example, a rodent antibody, is transferred from the heavy and light variable chains of the rodent antibody to human heavy and light variable domains. The constant domain of the antibody molecule is derived from that of the human antibody. In some embodiments, certain residues in the framework region of the humanized antibody, particularly those in contact with or near the CDR sequence, may be modified and replaced, for example, with corresponding residues derived from the original rodent, primate, or other antibody.

[0110] In this specification, “human antibody” means, for example, an antibody obtained from a transgenic mouse that has been “engineered” to produce a specific human antibody in response to antigen attack. In this technique, elements of human heavy chains and light chain loci are introduced into a mouse line derived from an embryonic stem cell line containing targeted disruption of endogenous heavy chains and light chain loci. The transgenic mouse can synthesize human antibodies specific to human antigens, and these mice can be used to produce human antibody-secreting hybridomas. Methods for obtaining human antibodies from transgenic mice are described in Green et al., Nature Genet. 7:13 (1994), Lonberg et al., Nature 368:856 (1994), and Taylor et al., Int. Immun. 6:579 (1994). Complete human antibodies can also be constructed by gene or chromosome translocation methods and phage display techniques, all of which are known in the field. For in vitro production of human antibodies and their fragments from an immunoglobulin variable domain gene repertoire derived from unimmunized donors, see, for example, McCafferty et al., Nature 348:552-553 (1990). In this technique, the antibody variable domain gene is cloned in-frame into either the major or non-major outer shell protein gene of a filamentous bacteriophage and presented on the surface of a phage particle as a functional antibody fragment. Since the filamentous particle contains a single-stranded DNA copy of the phage genome, selection based on the functional characteristics of the antibody also results in the selection of the gene encoding the antibody that exhibits those characteristics. In this way, the phage mimics some of the characteristics of B cells. Phage display can be performed in various forms; for an overview of these, see, for example, Johnson and Chiswell, Current Opinion in Structural Biology 3:5564-571 (1993). Human antibodies can also be produced by in vitro activated B cells. See U.S. Patent Nos. 5,567,610 and 5,229,275, which are incorporated herein by reference in their entirety.

[0111] In this specification, “antibody fusion protein” means a recombinantly produced antigen-binding molecule to which two or more identical or different innate antibodies, single-chain antibodies, or antibody fragment segments having the same or different specificities are bound. A fusion protein contains at least one specific binding site. The valence of a fusion protein indicates the total number of binding arms or sites the fusion protein has for antigens or epitopes, i.e., monovalent, divalent, trivalent, or polyvalent. The polyvalent nature of an antibody fusion protein means that it can utilize multiple interactions in binding to an antigen, thus increasing its binding activity for binding to one or different antigens. Specificity indicates how many different types of antigens or epitopes an antibody fusion protein can bind to, i.e., monospecificity, bispecificity, trispecificity, or multiplespecificity. Using these definitions, an innate antibody, such as IgG, is bivalent because it has two binding arms, but monospecific because it binds to one type of antigen or epitope. A monospecific polyvalent fusion protein has more than one binding site for the same antigen or epitope. For example, a monospecific diabody is a fusion protein having two binding sites that react to the same antigen. A fusion protein may contain a polyvalent or multispecific combination of different antibody components or multiple copies of the same antibody component. A fusion protein may also contain a therapeutic agent.

[0112] In some embodiments, the target portion includes pro-antibodies such as those described in U.S. Patent No. 8,518,404, U.S. Patent No. 8,513,390, and U.S. Patent Publication Nos. 2012 / 0237977, 2012 / 0149061, and 2013 / 0150558, which are incorporated herein by reference in their entirety.

[0113] Pro-antibodies are monoclonal antibodies that are selectively activated within the tumor microenvironment, concentrating the activity of therapeutic antibodies on the tumor while preserving healthy tissue.

[0114] Generally, a pro-antibody comprises at least an antibody or a fragment of that antibody (collectively referred to as "AB") that can specifically bind to a target, where AB is modified by a masking moiety (MM). When AB is modified with an MM and present in the presence of a target, the specific binding of AB to that target is reduced or inhibited compared to the specific binding of AB that is not modified with an MM or the specific binding of the parent AB to that target. The dissociation constant (Kd) of MM to AB is generally greater than the Kd of AB to the target. When AB is modified with an MM and present in the presence of a target, the specific binding of AB to that target may be reduced or inhibited compared to the specific binding of AB that is not modified with an MM or the specific binding of the parent AB to that target. When AB is bound to or modified by an MM, the MM can "mask," reduce, or inhibit the specific binding of AB to its target. When AB is bound to or modified by an MM, such binding or modification can influence structural changes that reduce or inhibit the ability of AB to specifically bind to its target.

[0115] In some embodiments, the pro-antibody is an activatable antibody (AA) in which the AB modified by the masking moiety (MM) may further comprise one or more cleavable moieties (CMs). Such an AA exhibits activatable / switchable binding to a target of the AB. An AA generally comprises an antibody or antibody fragment (AB) modified by or bound to a masking moiety (MM) and a modifiable or cleavable moiety (CM). In some embodiments, the CM contains an amino acid sequence that acts as a substrate for the target protease. In other embodiments, the CM provides a cysteine-cysteine ​​disulfide bond that is cleavable by reduction. In yet another embodiment, the CM provides a photodegradable substrate that is activatable by photodegradation.

[0116] The CM and AB of AA may be selected such that AB represents the binding site of the target and CM represents the substrate of a protease that co-localizes with the target at the treatment site within the target. Alternatively, the CM may also be a cysteine-cysteine ​​disulfide bond that is cleavable as a result of reduction of this disulfide bond. AA contains at least one of a protease-cleavable CM or a cysteine-cysteine ​​disulfide bond, and in some embodiments, both types of CMs are included. AA may also further contain a photosensitive substrate that is activated by a light source. The AA disclosed herein finds particular applications, for example, when a protease capable of cleaving the site within the CM is present at relatively higher levels in the target-containing tissue at the treatment site (e.g., affected tissue, e.g., for therapeutic or diagnostic treatment) than in the tissue at the non-treatment site (e.g., healthy tissue). The AAs disclosed herein also find specific applications, for example, when a reducing agent capable of reducing a site within a CM is present in the target-containing tissue of a treated or diagnostic site at a relatively higher level than in the tissue of an untreated or undiagnosed site. The AAs disclosed herein also find specific applications, for example, when a light source, such as a laser, capable of photodegrading a site within a CM is introduced into the target-containing tissue of a treated or diagnostic site.

[0117] In some embodiments, AA can provide a reduction in toxicity and / or adverse side effects that may arise from the binding of AB at an untreated site if AB were not masked or inhibited from binding to its target. If AA contains a CM that can be cleaved by a reducing agent that promotes the reduction of disulfide bonds, the AB of such AA may be selected to leverage the activation of AB when a target of interest may be present at a desired treatment site characterized by elevated levels of the reducing agent, such that the environment has a higher reduction potential than, for example, the environment at an untreated site.

[0118] Generally, an AA can be designed by selecting the target AB and constructing the rest of the AA such that, when structurally constrained, the MM provides masking of the AB or reduction of the binding of the AB to its target. Structural design requirements to be considered in order to provide this functional property.

[0119] Anti-PD-1 antibody In some embodiments, TM is a monoclonal anti-PD-1 antibody.

[0120] Programmed death-1 ("PD-1") is the receptor for PD-L1 (also known as CD274, B7-H1, or B7-DC). PD-1 is an approximately 31kD type 1 membrane protein that is a member of the extended CD28 / CTLA4 family of T cell regulators (Ishida, Y. et al. (1992) EMBO J. 11:3887-3895, U.S. Patent Publication Nos. 2007 / 0202100, 2008 / 0311117, 2009 / 00110667, U.S. Patent Nos. 6,808,710, 7,101,550, 7,488,802, 7,635,757, 7,722,868, International Publication No. 01 / 14557). Compared to CTLA4, PD-1 negatively regulates the immune response more broadly.

[0121] PD-1 is expressed in activated T cells, B cells, and monocytes (Agata, Y. et al. (1996) Int. Immunol. 8(5):765-772; Yamazaki, T. et al. (2002 J. Immunol. 169:5538-5545) and at low levels in natural killer (NK) T cells (Nishimura, H. et al. (2000) J. Exp. Med. 191:891-898; Martin-Orozco, N. et al. (2007), Semin. Cancer Biol. 17(4):288-298).

[0122] The extracellular domain of PD-1 consists of a single immunoglobulin (Ig)V domain that is 23% identical to the equivalent domain in CTLA4 (Martin-Orozco, N. et al. (2007) Semin. Cancer Biol. 17(4):288-298). The extracellular IgV domain is located anterior to the transmembrane domain and intracellular tail. The intracellular tail contains two phosphorylation sites located at the immunoreceptor tyrosine system inhibitory motif and the immunoreceptor tyrosine system switch motif, suggesting that PD-1 negatively regulates TCR signaling (Ishida, Y. et al. (1992 EMBO J. 11:3887-3895; Blank, C. et al. (Epub 2006 Dec. 29) Immunol. Immunother. 56(5):739-745).

[0123] Antibodies that can immune-specifically bind to mouse PD-1 have been reported (see, for example, Agata, T. et al. (1996) Int. Immunol. 8(5):765-772).

[0124] Anti-PD-1 antibodies bind to PD-1, enhancing T cell function and upregulating cell-mediated immune responses, and are used to treat T cell dysfunction diseases such as tumor immunity.

[0125] In some embodiments, the anti-PD-1 antibody is MK-3475 (formerly lambrolizumab, Merck), AMP-514, AMP-224 (MedImmune / AstraZeneca), BMS-936558 (MDX-1106, Bristol-Myers Squibb), or CT-011 (Curetech).

[0126] Pembrolizumab (MK-3475) is a humanized monoclonal anti-PD-1 antibody designed to reactivate antitumor immunity. Pembrolizumab affects the dual ligand blockade of the PD-1 pathway by inhibiting the interaction of PD-1 on T cells with its ligands, PD-L1 and PD-L2.

[0127] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in U.S. Patent No. 8,354,509 and U.S. Patent No. 8,168,757, the entirety of which is incorporated by reference.

[0128] Nivolumab (also known as BMS-936558 or MDX1106) is a fully human IgG4 monoclonal antibody developed by Bristol-Myers Squibb for the treatment of cancer.

[0129] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in International Publication No. 2004 / 056875, U.S. Patent No. 7,488,802, and U.S. Patent No. 8,008,449, the entirety of which is incorporated by reference.

[0130] AMP-514 and AMP-224 are anti-programmed cell death 1 (PD-1) monoclonal antibodies (mAbs) developed by Amplimmune, which was acquired by MedImmune.

[0131] In some embodiments, the anti-PD-1 antibody is one of the antibodies disclosed in U.S. Patent Application Publication No. 2014 / 0044738, the entirety of which is incorporated by reference.

[0132] In some embodiments, the six CDRs are (A) three light chain and three heavy chain CDRs of anti-PD-1 antibody 1E3; (B) three light chain and three heavy chain CDRs of anti-PD-1 antibody 1E8; or (C) three light chain and three heavy chain CDRs of anti-PD-1 antibody 1H3.

[0133] Pizilizumab (CT-011) is an anti-PD-1 monoclonal antibody developed by Israel-based Curetech Ltd.

[0134] In some embodiments, the anti-PD-1 antibody is one of the antibodies described in U.S. Patent Application Publication No. 2008 / 0025980 and No. 2013 / 0022595, the entire disclosure of which is incorporated by reference.

[0135] Anti-PD-L1 antibody In some embodiments, TM is a monoclonal anti-PD-L1 antibody.

[0136] Programmed cell death ligand 1 (also known as PD-L1, CD274, and B7-H1) is a ligand for PD-1 found in activated T cells, B cells, myeloid cells, and macrophages. While two endogenous ligands, PD-L1 and PD-L2, exist for PD-1, antitumor therapies focus on anti-PD-L1 antibodies. The PD-1-PD-L1 complex inhibits the proliferation of CD8+ T cells and reduces the immune response (Topalian et al., 2012, N Engl J Med 366:2443-54; Brahmer et al., 2012, N Eng J Med, 366:2455-65). Anti-PD-L1 antibodies are used to treat non-small cell lung cancer, melanoma, colorectal cancer, renal cell carcinoma, pancreatic cancer, gastric cancer, ovarian cancer, breast cancer, and hematological malignancies (Brahmer et al., N Eng J Med 366:2455-65; Ott et al., 2013, Clin Cancer Res 19:5300-9; Radvanyi et al., 2013, Clin Cancer Res 19:5541; Menzies & Long, 2013, Ther Adv Med Oncol 5:278-85; Berger et al., 2008, Clin Cancer Res 14:13044-51). PD-L1 is a member of the B7 family, expressed in many cell types, including APCs and activated T cells (Yamazaki et al. (2002) J. Immunol. 169:5538). PD-L1 binds to both PD-1 and B7-1. Both the binding of T cell-expressed B7-1 by PD-L1 and the binding of T cell-expressed PD-L1 by B7-1 result in T cell inhibition (Butte et al. (2007) Immunity 27: 111). Also, like other members of the B7 family, PD-L1 can provide co-stimulatory signals to T cells (Subudhi et al. (2004) J. Clin. Invest. 113:694; Tamura et al. (2001) Blood 97:1809).

[0137] In this specification, “PD-L1” means any variant or isomer naturally expressed by cells and / or fragments thereof having at least one biological activity of the full-length polypeptide, unless otherwise specified. Furthermore, the term “PD-L1” includes PD-L1 (Freeman et al. (2000) J. Exp. Med. 29:1027) and any variant or isomer naturally expressed by cells, and / or fragments thereof having at least one biological activity of the full-length polypeptide. For example, PD-L1 sequences from different species, including humans, are well known in the art (see, for example, Chen et al., U.S. Patent No. 6,803,192, disclosing human and mouse PD-L1 sequences, which are incorporated herein in their entirety by reference; and Wood et al., U.S. Patent No. 7,105,328, disclosing a human PD-L1 sequence).

[0138] Anti-PD-L1 antibodies bind to PD-L1, enhance T cell function, and upregulate the cellular immune response, making them useful in treating T cell dysfunction diseases such as tumor immunity.

[0139] In some embodiments, the anti-PD-L1 antibodies are MPDL3280A and YW243.55.S70 (Genentech / Roche), MEDI-4736 (MedImmune / AstraZeneca), BMS-936559 (MDX-1105, Bristol-Myers Squibb), and MSB0010718C (EMD Serono / Merck KGaA).

[0140] MPDL3280A (Genentech) is an engineered anti-PD-L1 antibody designed to target PD-L1 expressed on tumor cells and tumor-infiltrating immune cells. MPDL3280A is designed to prevent PD-L1 from binding to PD-1 and B7.1. This blockade of PD-L1 allows T cells to be activated, restoring their ability to detect and attack tumor cells. MPDL3280A contains an engineered fragment crystallizable (Fc) domain designed to optimize efficacy and safety while minimizing antibody-dependent cell-mediated cytotoxicity (ADCC).

[0141] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 7,943,743, the entirety of which is incorporated by reference.

[0142] BMS-936559 (MDX-1105, Bristol-Myers Squibb) is a fully human IgG4 anti-PD-L1 mAb that inhibits the binding of PD-L1 ligands to both PD-1 and CD80.

[0143] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 7,943,743, the entirety of which is incorporated by reference.

[0144] MSB0010718C (Merck KGaA EMD Serono) is a fully human IgG1 monoclonal antibody that binds to PD-L1.

[0145] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in International Publication No. 2013 / 079174, the entirety of which is incorporated by reference.

[0146] MEDI4736 (MedImmune / AstraZeneca) is a human IgG1 antibody that specifically binds to PD-L1 and prevents binding to PD-1 and CD80.

[0147] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in International Publication No. 2011 / 066389 and U.S. Patent No. 8,779,108, the entire disclosure of which is incorporated by reference.

[0148] In some embodiments, the anti-PD-L1 antibody is one of the antibodies disclosed in U.S. Patent No. 8,552,154, the entirety of which is incorporated by reference.

[0149] In some embodiments, the target portion includes antibody analogs comprising Fab, Fab', F(ab')2, single-domain antibody, T and Ab dimer, Fv, scFv, dsFv, ds-scFv, Fd, linear antibody, minibody, diabody, bispecific antibody fragment, vibody, tribody, sc-diabody, kappa (lambda) form, BiTE, DVD-Ig, SIP, SMIP, DART, or one or more CDRs.

[0150] PD-L / PD-1 axis antagonists containing the target region In some embodiments, PD-L / PD-1 axis antagonists are targeted therapies that include a target moiety such as an ADC.

[0151] In this specification, “Targeted portion (TM)” or “Targeted agent” is generally referred to as “Target” or “Marker,” and these mean molecules, complexes or aggregates that specifically or selectively bind to target molecules, cells, particles, tissues or aggregates, as further discussed herein.

[0152] In some embodiments, the target portion includes immunoglobulins, proteins, peptides, small molecules, nanoparticles, or nucleic acids.

[0153] Exemplary targeting agents, such as antibodies (e.g., chimeric, humanized, and human), receptor ligands, lectins, and polysaccharides, and substrates for certain enzymes, are recognized in the art and are useful in carrying out the present invention without limitation. Other targeting agents include compounds that do not contain a specific molecular recognition motif and add molecular weight to the active site, such as nanoparticles, macromolecules like poly(ethylene glycol), polysaccharides, and polyamino acids. The added molecular weight affects the pharmacokinetics of the active site, such as its serum half-life.

[0154] In some embodiments, the target moiety is an antibody, antibody fragment, bispecific antibody, or other antibody-based molecule or compound. However, other examples of target moieties are known in the art and may include, for example, aptamers, avimers, receptor-binding ligands, nucleic acids, biotin-avidin binding pairs, binding peptides, or proteins. The terms “target moiety” and “binding moiety” are used synonymously herein.

[0155] In this specification, “target” or “marker” means any entity that can specifically bind to a particular target portion. In some embodiments, the target specifically associates with one or more specific cell or tissue types. In some embodiments, the target specifically associates with one or more specific disease conditions. In some embodiments, the target specifically associates with one or more specific developmental stages. For example, a cell type-specific marker is typically expressed at a level at least twice as high in its cell type as in a reference population of cells. In some embodiments, the cell type-specific marker is present at a level at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, at least ten times, at least fifty times, at least 100 times, or at least 1,000 times higher than its average expression in the reference population. Detection or measurement of a cell type-specific marker may allow the distinction of a target cell type(s) from many, most, or all other cell types. In some embodiments, the target may include proteins, carbohydrates, lipids, and / or nucleic acids, as described herein.

[0156] A substance is considered “targeted” for the purposes described herein if it specifically binds to a nucleic acid target moiety. In some embodiments, the nucleic acid target moiety specifically binds to the target under stringent conditions. A complex or compound of the present invention containing a target moiety is considered “targeted” if the target moiety specifically binds to a target, thereby delivering the entire complex or compound composition to a specific organ, tissue, cell, extracellular matrix component, and / or intracellular compartment. In some embodiments, the target may include proteins, carbohydrates, lipids, and / or nucleic acids, as described herein.

[0157] In certain embodiments, the compound according to the present invention includes a target moiety that specifically binds to one or more targets (e.g., antigens) that associate with organs, tissues, cells, extracellular matrix components, and / or intracellular compartments. In some embodiments, the compound includes a target moiety that specifically binds to targets that associate with specific organs or organ systems. In some embodiments, the compound according to the present invention includes a nuclear target moiety that specifically binds to one or more intracellular targets (e.g., organelles, intracellular proteins). In some embodiments, the compound includes a target moiety that specifically binds to targets that associate with affected organs, tissues, cells, extracellular matrix components, and / or intracellular compartments. In some embodiments, the compound includes a target moiety that specifically binds to targets that associate with specific cell types (e.g., endothelial cells, cancer cells, malignant cells, prostate cancer cells, etc.).

[0158] In some embodiments, the compounds according to the present invention include a target moiety that binds to a target specific to one or more particular tissue types (e.g., liver tissue vs. prostate tissue). In some embodiments, the compounds according to the present invention include a target moiety that binds to a target specific to one or more particular cell types (e.g., T cells vs. B cells). In some embodiments, the compounds according to the present invention include a target moiety that binds to a target specific to one or more particular disease conditions (e.g., tumor cells vs. healthy cells). In some embodiments, the compounds according to the present invention include a target moiety that binds to a target specific to one or more particular developmental stages (e.g., hepatocytes vs. differentiated cells).

[0159] In some embodiments, the target may be a marker that exclusively or primarily associates with one or more cell types, one or more diseases, and / or one or more developmental stages. Cell type-specific markers are typically expressed at a level at least twice as high in that cell type as in a reference population of cells that may consist, for example, a mixture containing multiple (e.g., 5 to 10 or more) cells from different tissues or organs in roughly equal amounts. In some embodiments, the cell type-specific marker is present at a level at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, at least ten times, at least 50 times, at least 100 times, or at least 1,000 times higher than its average expression in the reference population. Detection or measurement of cell type-specific markers may allow the cell type(s) of interest to be distinguished from many, most, or all other cell types.

[0160] In some embodiments, the target includes proteins, carbohydrates, lipids, and / or nucleic acids. In some embodiments, the target includes proteins and / or characteristic parts thereof, such as tumor markers, integrins, cell surface receptors, transmembrane proteins, intercellular proteins, ion channels, membrane transporter proteins, enzymes, antibodies, chimeric proteins, glycoproteins, etc. In some embodiments, the target includes carbohydrates and / or characteristic parts thereof, such as glycoproteins, sugars (e.g., monosaccharides, disaccharides, polysaccharides), and sugar coatings (i.e., the carbohydrate-rich marginal zone on the outer surface of most eukaryotic cells). In some embodiments, the target includes lipids and / or characteristic parts thereof, such as oils, fatty acids, glycerides, hormones, steroids (e.g., cholesterol, bile acids), vitamins (e.g., vitamin E), phospholipids, sphingolipids, lipoproteins, etc. In some embodiments, the target includes nucleic acids and / or characteristic parts thereof, such as DNA nucleic acids; RNA nucleic acids; modified DNA nucleic acids; modified RNA nucleic acids; nucleic acids including any combination of DNA, RNA, modified DNA, and modified RNA.

[0161] Many markers are known in this field. Typical markers include cell surface proteins, such as receptors. Exemplary receptors include, but are not limited to, transferrin receptors; LDL receptors; growth factor receptors, such as members of the epidermal growth factor receptor family (e.g., EGFR, Her2, Her3, Her4) or vascular endothelial growth factor receptors; cytokine receptors; cell adhesion molecules; integrins; selectins; and CD molecules. Markers can also be molecules that are exclusively or more abundantly present on malignant cells, such as tumor antigens.

[0162] In some embodiments, the target moiety binds specifically or preferentially to tumor cells compared to non-tumor cells.

[0163] The binding of the target portion to tumor cells can be measured using assays known in this field.

[0164] In some embodiments, the tumor cells are those of carcinoma, sarcoma, lymphoma, myeloma, or central nervous system cancer.

[0165] In some embodiments, the target moiety can bind specifically or preferentially to tumor antigens compared to non-tumor antigens.

[0166] In certain embodiments, the target is a tumor marker. In some embodiments, the tumor marker is an antigen present in a tumor that is not present in normal organs, tissues, and / or cells. In some embodiments, the tumor marker is an antigen found more frequently in tumors than in normal organs, tissues, and / or cells. In some embodiments, the tumor marker is an antigen found more frequently in malignant cancer cells than in normal cells.

[0167] In some embodiments, the target moiety includes folic acid or a derivative thereof.

[0168] In recent years, research on folic acid has advanced significantly. Folic acid is a small molecule vitamin necessary for cell division. Tumor cells divide abnormally and express large amounts of folic acid receptors (FRs) on their surface to capture enough folic acid to support cell division.

[0169] The data show that FR expression in tumor cells is 20 to 200 times higher than in normal cells. The FR expression rates in various malignancies are 82% in ovarian cancer, 66% in non-small cell lung cancer, 64% in kidney cancer, 34% in colon cancer, and 29% in breast cancer (Xia W, Low PS. Late-targeted therapies for cancer. J Med Chem. 2010;14;53(19):6811-24). The expression rate of FA and the malignancy of epithelial tumor invasion and metastasis are positively correlated. FA enters cells through FR-mediated endocytosis, and FA forms a complex with the drug entering the cell through its carboxyl group. Under acidic conditions (pH 5), FR separates from FA, and FA releases the drug into the cytoplasm.

[0170] Clinically, this system can be used to deliver drugs that selectively attack tumor cells. Folic acid has a small molecular weight, is non-immunogenic and highly stable, and is inexpensive to synthesize. More importantly, the chemical bond between the drug and the carrier is simple, and thus, using FA as the target moiety to construct drug delivery systems has become an active area in cancer treatment research. Currently in clinical trials, EC145 (a FA chemotherapy drug conjugate compound) can effectively attack cancer cells (Pribble P and Edelman MJ. EC145: a novel targeted agent for adenocarcinoma of the lung. Expert Opin. Investigation. Drugs (2012) 21:755-761).

[0171] In some embodiments, the target portion includes PD-1, PDL-1, CTLA4, CD47, BTLA, KIR, TIM3, 4-1BB, and LAG3, the full length of a portion of the surface ligand amphiregulin, beta-cellulin, EGF, ephrin, epigen, epiregulin, IGF, neuregulin, TGF, TRAIL, or the extracellular domain (ECD) or soluble form of VEGF.

[0172] In some embodiments, the target portion includes antibody analogs comprising Fab, Fab', F(ab')2, single-domain antibodies, T and Ab dimers, Fv, scFv, dsFv, ds-scFv, Fd, linear antibodies, minibodies, diabodies, bispecific antibody fragments, vibodies, tribodies, sc-diabodies, kappa (lambda) bodies, BiTE, DVD-Ig, SIP, SMIP, DART, or one or more CDRs.

[0173] In some embodiments, the target portion is an antibody or antibody fragment selected based on its specificity to an antigen expressed on a target cell or site. A wide variety of tumor-specific or other disease-specific antigens have been identified, and antibodies against these antigens have been used or proposed to be used in the treatment of such tumors or other diseases. Antibodies known in the art can be used in the compounds of the present invention, in particular, in the treatment of diseases associated with the target antigen. Examples of target antigens (and their associated diseases) that the antibody linker-drug conjugate of the present invention can target include CD2, CD19, CD20, CD22, CD27, CD33, CD37, CD38, CD40, CD44, CD47, CD52, CD56, CD70, CD79, CD137, 4-1BB, 5T4, AGS-5, AGS-16, angiopoietin 2, B7.1, B7.2, B7DC, B7H1, B7H2, B7H3, BT-062, BTLA, CAIX, carcinoembryonic antigen, CTLA4, crypto, ED-B, ErbB1, ErbB2, ErbB3, ErbB4, EGFL7, EpCAM, EphA2, EphA3, EphB2, FAP, fibronectin, Folate receptor, ganglioside GM3, GD2, glucocorticoid-induced tumor necrosis factor receptor (GITR), gp100, gpA33, GPNMB, ICOS, IGF1R, integrin αν, integrin ανβ, KIR, LAG-3, Lewis Y, mesothelin, c-MET, MN carbonic anhydrase IX, MUC1, MUC16, nectin-4, NKGD2, NOTCH, OX40, OX40L, PD-1, PDL1, PSCA, PSMA, RANKL, ROR1, ROR2, SLC44A4, syndecan-1, TACI, TAG-72, tenascin, TIM3, TRAILR1, TRAILR2, VEGFR-1, VEGFR-2, and VEGFR-3 can be listed.

[0174] In some embodiments, the target portion includes particles (target particles), preferably nanoparticles, which optionally attach to target molecules that can bind specifically or preferentially to the target. In some embodiments, the target particles themselves lead to the compound of the present invention (e.g., by enrichment in tumor cells or tissues), with no additional target molecules attached thereto.

[0175] In this specification, “nanoparticles” means any particles having a diameter of less than 1000 nm. In some embodiments, the therapeutic agent and / or target molecule can associate with a polymer matrix. In some embodiments, the target molecule can covalently associate with the surface of the polymer matrix. In some embodiments, the covalent association is mediated by a linker. In some embodiments, the therapeutic agent can associate with the surface of the polymer matrix, be encapsulated within the polymer matrix, be surrounded by the polymer matrix, and / or be dispersed throughout the polymer matrix. Incorporated throughout, U.S. Patent No. 8,246,968.

[0176] In general, the nanoparticles of the present invention include any type of particle. Any particle can be used in accordance with the present invention. In some embodiments, the particles are biodegradable and biocompatible. In general, biocompatible substances are not toxic to cells. In some embodiments, a substance is considered biocompatible if its addition to cells results in cell death below a certain threshold. In some embodiments, a substance is considered biocompatible if its addition to cells does not induce adverse effects. In general, biodegradable substances are those that undergo degradation over a therapeutically relevant period (e.g., weeks, months, or years) under physiological conditions. In some embodiments, biodegradable substances are substances that can be degraded by cellular mechanisms. In some embodiments, biodegradable substances are substances that can be degraded by chemical processes. In some embodiments, the particles are substances that are both biocompatible and biodegradable. In some embodiments, the particles are substances that are biocompatible but not biodegradable. In some embodiments, the particles are substances that are biodegradable but not biocompatible.

[0177] In some embodiments, the particles are larger than the renal excretion limit (e.g., particles with a diameter greater than 6 nm). In some embodiments, the particles are small enough to avoid hepatic clearance of the particles from the bloodstream (e.g., particles with a diameter less than 1000 nm). Generally, the physiochemical characteristics of the particles should allow the targeted particles to circulate in the plasma longer by reducing renal excretion and hepatic clearance.

[0178] It is often desirable to use a group of particles that are relatively uniform in size, shape, and / or composition, so that each particle has similar properties. For example, at least 80%, at least 90%, or at least 95% of the particles may have a diameter or maximum dimension that falls within 5%, 10%, or 20% of the average diameter or maximum dimension. In some embodiments, the group of particles may be heterogeneous in terms of size, shape, and / or composition.

[0179] Zeta potential is a measure of the surface potential of a particle. In some embodiments, the particle has a zeta potential in the range of -50mV to +50mV. In some embodiments, the particle has a zeta potential in the range of -25mV to +25mV. In some embodiments, the particle has a zeta potential in the range of -10mV to +10mV. In some embodiments, the particle has a zeta potential in the range of -5mV to +5mV. In some embodiments, the particle has a zeta potential in the range of 0mV to +50mV. In some embodiments, the particle has a zeta potential in the range of 0mV to +25mV. In some embodiments, the particle has a zeta potential in the range of 0mV to +10mV. In some embodiments, the particle has a zeta potential in the range of 0mV to +5mV. In some embodiments, the particle has a zeta potential in the range of -50mV to 0mV. In some embodiments, the particles have a zeta potential in the range of -25mV to 0mV. In some embodiments, the particles have a zeta potential in the range of -10mV to 0mV. In some embodiments, the particles have a zeta potential in the range of -5mV to 0mV. In some embodiments, the particles have a substantially neutral zeta potential (i.e., approximately 0mV).

[0180] Various different particles can be used according to the present invention. In some embodiments, the particles are spherical or spherical. In some embodiments, the particles are spherical or spherical. In some embodiments, the particles are flat or plate-shaped. In some embodiments, the particles are cubic or cubic. In some embodiments, the particles are oval or elliptical. In some embodiments, the particles are cylindrical, conical, or pyramidal.

[0181] In some embodiments, the particles are microparticles (e.g., microspheres). Generally, “microparticles” refers to any particle having a diameter of less than 1000 μm. In some embodiments, the particles are picoparticles (e.g., picospheres). Generally, “picoparticles” refers to any particle having a diameter of less than 1 nm. In some embodiments, the particles are liposomes. In some embodiments, the particles are micelles.

[0182] The particles may be solid or hollow and may contain one or more layers (e.g., nanoshells, nanorings). In some embodiments, each layer may have a unique composition and properties compared to the other layers. For example, the particles may have a core / shell structure, where the core is a first layer and the shell is a second layer. The particles may contain multiple different layers. In some embodiments, the first layer may be substantially crosslinked, the second layer substantially uncrosslinked, and so on. In some embodiments, one, several, or all of the different layers may contain one or more therapeutic or diagnostic agents to be delivered. In some embodiments, the first layer may contain the drug to be delivered, the second layer may not contain the drug to be delivered, and so on. In some embodiments, each individual layer may contain a different drug or set of drugs to be delivered.

[0183] In some embodiments, the particles are porous, meaning that the particles contain holes or channels that are typically small relative to the particle size. For example, the particles may be porous silica particles, e.g., mesoporous silica nanoparticles, or may have a coating of mesoporous silica (Lin et al., 2005, J.Am.Chem.Soc., 17:4570). The particles may have pores with diameters ranging from about 1 nm to about 50 nm, for example, in the range of about 1 to 20 nm. About 10% to 95% of the particle volume may constitute cavities within the pores or channels.

[0184] The particles may have a coating layer. The use of a biocompatible coating layer can be beneficial, for example, when the particles contain materials that are toxic to cells. Suitable coating materials include, but are not limited to, natural proteins such as bovine serum albumin (BSA), biocompatible hydrophilic polymers such as polyethylene glycol (PEG) or PEG derivatives, phospholipids-(PEG), silica, lipids, polymers, carbohydrates such as dextran, and other nanoparticles that can associate with the nanoparticles of the present invention. The coating can be applied or organized by various methods such as immersion, the use of alternating adsorption techniques, self-assembly, and conjugation. Self-assembly refers to the process of spontaneous organization into higher-order structures (e.g., molecules) that depend on the natural attraction of components to each other. Typically, this occurs through the random movement of molecules and the formation of bonds based on size, shape, composition, or chemical properties.

[0185] Examples of polymers include polyalkylenes (e.g., polyethylene), polycarbonates (e.g., poly(1,3-dioxan-2one)), polyanhydrides (e.g., poly(sebacic anhydride)), polyhydroxy acids (e.g., poly(β-hydroxyalkanoate)), polyfumarates, polycaprolactones, polyamides (e.g., polycaprolactam), polyacetals, polyethers, polyesters (e.g., polylactide, polyglycolide), poly(orthoesters), polyvinyl alcohol, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, and polyamines. In some embodiments, the polymers according to the present invention include, but are not limited to, polymers approved for human use by the U.S. Food and Drug Administration (FDA) 21C.FR §177.2600, which include polyesters (e.g., polylactic acid, polyglycolic acid, poly(lactic acid-coglycolic acid), polycaprolactone, polyvalerolactone, poly(1,3-dioxan-2one)); polyanhydrides (e.g., poly(sebacic anhydride)); polyethers (e.g., polyethylene glycol); polyurethanes; polymethacrylates; polyacrylates; and polycyanoacrylates.

[0186] In some embodiments, the particles may be nonpolymer particles (e.g., metal particles, quantum dots, ceramic particles, polymers containing inorganic materials, bone-derived materials, bone substitutes, virus particles, etc.). In some embodiments, the delivered therapeutic or diagnostic agent may associate with the surface of such nonpolymer particles. In some embodiments, the nonpolymer particles are aggregates of nonpolymer components, such as aggregates of metal atoms (e.g., gold atoms). In some embodiments, the delivered therapeutic or diagnostic agent may associate with the surface of the aggregates of nonpolymer components, and / or be encapsulated within the aggregates of nonpolymer components, be surrounded by aggregates of nonpolymer components, and / or be dispersed throughout the aggregates of nonpolymer components.

[0187] Particles (e.g., nanoparticles, fine particles) can be prepared using any method known in the art. For example, particulate formulations can be formed by methods such as nanoprecipitation, flow focusing fluidic channel, spray drying, single and double emulsion solvent evaporation, solvent extraction, phase separation, pulverization, microemulsion treatment, microfabrication, nanofabrication, sacrificial layer, simple and complex coacervation, and other methods well known to those skilled in the art. Alternatively, aqueous and organic solvent synthesis of monodisperse semiconductor, conductive, magnetic, organic and other nanoparticles has been described (Pellegrino et al., 2005, Small, 1:48; Murray et al., 2000, Ann. Rev. Mat. Sci., 30:545; and Trindade et al., 2001, Chem. Mat., 13:3843).

[0188] Methods for preparing microparticles for delivering encapsulated drugs are described in the literature (see, for example, Doubrow, ed., “Microcapsules and Nanoparticles in Medicine and Pharmacy,” CRC Press, Boca Raton, 1992; Mathiowitz et al., 1987, J. Control. Release, 5:13; Mathiowitz et al., 1987, Reactive Polymers, δ:275; and Mathiowitz et al., 1988, J. Appl. Polymer Sci., 35:755).

[0189] In some embodiments, the target portion includes a nucleic acid target portion.

[0190] Generally, the nucleic acid targeting portion is any polynucleotide that binds to organs, tissues, cells, extracellular matrix components, and / or components associated with intracellular compartments (targets).

[0191] In some embodiments, the nucleic acid target portion is an aptamer.

[0192] Aptamers are typically polynucleotides that bind to specific target structures associated with particular organs, tissues, cells, extracellular matrix components, and / or intracellular compartments. Generally, the target function of an aptamer is based on the three-dimensional structure of the aptamer. In some embodiments, aptamer binding to a target is typically mediated by interactions between the two-dimensional and / or three-dimensional structures of both the aptamer and the target. In some embodiments, aptamer binding to a target depends not solely on the primary sequence of the aptamer, but on the three-dimensional structure (or multiple) of the aptamer and / or target. In some embodiments, aptamers bind to their targets via complementary Watson-Crick base pairing, which is interfered with by structures that disrupt base pairing (e.g., hairpin loops).

[0193] In some embodiments, the nucleic acid target moiety is a spiegelmer (PCT Publications International Publication No. 98 / 08856, International Publication No. 02 / 100442, and International Publication No. 06 / 117217). Generally, a spiegelmer is a synthetic enantiomer (i.e., enantiomer) that can specifically bind to a target. Spiegelmers are characterized by structural features that make them insensitive to exo and endonucleases.

[0194] Those skilled in the art will recognize that any nucleic acid target moiety (e.g., aptamers or spiegelmers) capable of specifically binding to a target can be used in accordance with the present invention. In some embodiments, the nucleic acid target moiety used in accordance with the present invention may target markers associated with diseases, disorders, and / or conditions. In some embodiments, the nucleic acid target moiety used in accordance with the present invention may target cancer-related targets. In some embodiments, the nucleic acid target moiety used in accordance with the present invention may target tumor markers. Any type of cancer and / or any tumor marker can be targeted using the nucleic acid target moiety in accordance with the present invention. To give some examples, the nucleic acid target moiety may target markers associated with prostate cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, endometrial cancer, ovarian cancer, bone cancer, esophageal cancer, liver cancer, gastric cancer, brain tumors, cutaneous melanoma, and / or leukemia.

[0195] The nucleic acids of the present invention (including nucleic acid target portions and / or functional RNAs to be delivered, e.g., RNAi-inducing entities, ribozymes, tRNAs, etc., as described in more detail below) may be prepared according to any available techniques, including but not limited to chemical synthesis, enzymatic synthesis, and enzymatic or chemical cleavage of longer precursors. Methods for synthesizing RNA are known in the art (see, for example, Gait, MJ (ed.), Oligonucleotide synthesis: a practical approach, Oxford [Oxfordshire], Washington, DC: IRL Press, 1984, and Herdewijn, P. (ed.), Oligonucleotide synthesis: methods and applications, Methods in molecular biology, v.288 (Clifton, New Jersey) Totowa, NJ: Humana Press, 2005).

[0196] The nucleic acids forming the nucleic acid target moiety may include naturally occurring nucleosides, modified nucleosides, naturally occurring nucleosides having a hydrocarbon linker (e.g., alkylene) or polyether linker (e.g., PEG linker) inserted between one or more nucleosides, modified nucleosides having a hydrocarbon or PEG linker inserted between one or more nucleosides, or combinations thereof. In some embodiments, the nucleoside or modified nucleotide of the nucleic acid target moiety may be replaced with a hydrocarbon linker or polyether linker, provided that the binding affinity and selectivity of the nucleic acid target moiety are not substantially reduced by the substitution (e.g., the dissociation constant of the nucleic acid target moiety to the target is approximately 1 × 10⁻⁶). -3 (M should not be exceeded.)

[0197] Those skilled in the art will understand that the nucleic acids according to the present invention may contain only the types of nucleotides found in naturally occurring nucleic acids, or instead may contain one or more nucleotide analogs, or may have structures otherwise different from those of naturally occurring nucleic acids. U.S. Patents Nos. 6,403,779, 6,399,754, 6,225,460, 6,127,533, 6,031,086, 6,005,087, and 5,977,089, and the references therein, disclose a wide variety of specific nucleotide analogs and modified forms that may be used. See Crooke, S. (ed.), Antisense Drug Technology: Principles, Strategies, and Applications (Part 1), Marcel Dekker; ISBN: 0824705661; Part 1 (2001) and the references therein. For example, 2' modifications include halo, alkoxy, and allyloxy groups. In some embodiments, the 2'-OH group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is a C1-C6 alkyl, alkenyl, or alkynyl group, and halo is F, Cl, Br, or I. Examples of modifying bonds include phosphorothioates and 5'-N-phosphoramidite bonds.

[0198] Nucleic acids containing various different nucleotide analogs, modified skeletons, or non-natural nucleoside bonds can be utilized according to the present invention. The nucleic acids of the present invention may contain natural nucleosides (i.e., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) or modified nucleosides. Examples of modified nucleotides include base-modified nucleosides (e.g., aracitidine, inosine, isoguanosine, nebularin, pseudouridine, 2,6-diaminopurine, 2-aminopurine, 2-thiothymidine, 3-deaza-5-azacitidine, 2'-deoxyuridine, 3-nitrpyrrole, 4-methylindole, 4-thiouridine, 4-thiothymidine, 2-aminoadenosine, 2-thiothymidine, 2-thiouridine, 5-bromocytidine, 5-iodouridine, inosine, 6-azauridine, 6-chloropurine, 7-deazaadenosine, 7-deazaguanosine, 8-azadenosine, 8-azidoadenosine, benzimidazole, M1-methyladenosine, pyrrolo-pyrimidine, 2-amino-6-chloro Examples include purines, 3-methyladenosine, 5-propynylcytidine, 5-propynyluridine, 5-bromouridine, 5-fluorouridine, 5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically or biologically modified bases (e.g., methylated bases), modified sugars (e.g., 2'-fluororibose, 2'-aminoribose, 2'-azidribose, 2'-O-methylribose, L-enantiomerate nucleoside arabinose, and hexoses), modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite bonds), and combinations thereof. Natural and modified nucleotide monomers for the chemical synthesis of nucleic acids are readily available. In some cases, nucleic acids containing such modified forms exhibit improved properties compared to nucleic acids consisting solely of naturally occurring nucleotides. In some embodiments, the nucleic acid modified forms described herein are utilized to reduce and / or prevent digestion by nucleases (e.g., exonucleases, endonucleases, etc.).For example, the structure of nucleic acids can be stabilized by including nucleotide analogs at the 3' ends of one or both strands to reduce digestion.

[0199] Modified nucleic acids do not need to be uniformly modified along the entire length of the molecule. Different nucleotide modification forms and / or skeletal structures can be present at various positions on the nucleic acid. Those skilled in the art will understand that nucleotide analogs or other modification forms may be placed at any position on the nucleic acid such that the function of the nucleic acid is not substantially affected. For example, a modification form may be placed at any position on the nucleic acid target moiety such that the ability of the nucleic acid target moiety to specifically bind to the target is not substantially affected. The modification region may be at the 5' end and / or 3' end of one or both strands. For example, modified nucleic acid target moieties are used in which approximately 1 to 5 residues at the 5' end and / or 3' end of either of the strands are nucleotide analogs and / or have skeletal modifications. The modification may be a 5' or 3' end modification. One or both nucleic acid strands may contain at least 50% unmodified nucleotides, at least 80% unmodified nucleotides, at least 90% unmodified nucleotides, or 100% unmodified nucleotides.

[0200] The nucleic acids according to the present invention may include modifications to sugars, nucleosides, or nucleoside bonds, such as those described in, for example, U.S. Patent Publication Nos. 2003 / 0175950, 2004 / 0192626, 2004 / 0092470, 2005 / 0020525, and 2005 / 0032733. The present invention encompasses the use of any nucleic acid having any one or more of the modifications described therein. For example, many terminal conjugates, such as cholesterol, lithocholic acid, aluric acid, or lipids such as long alkyl branched chains, have been reported to improve cellular uptake. Analogues and modified forms may be tested, for example, using any suitable assay known in the art, to select those that result in, for example, improved delivery of therapeutic or diagnostic agents, improved specific binding of nucleic acid target portions to targets, etc. In some embodiments, the nucleic acids according to the present invention may include one or more non-natural nucleoside bonds. In some embodiments, one or more internal nucleotides at the 3' end, 5' end, or both the 3' and 5' ends of the nucleic acid target region are inverted to obtain a bond such as a 3'-3' bond or a 5'-5' bond.

[0201] In some embodiments, the nucleic acids according to the present invention are naturally occurring entities isolated from their natural environment, rather than being synthesized.

[0202] Novel nucleic acid target moieties can be designed using any method (for example, U.S. Patent Nos. 6,716,583, 6,465,189, 6,482,594, 6,458,543, 6,458,539, 6,376,190, 6,344,318, 6,242,246, 6,184,364, 6,001,577, 5,958,691, 5,874,218, 5,853,984, 5,843,732, 5,843, See U.S. Patent Publication No. 653, No. 5,817,785, No. 5,789,163, No. 5,763,177, No. 5,696,249, No. 5,660,985, No. 5,595,877, No. 5,567,588, and No. 5,270,163, and U.S. Patent Publication No. 2005 / 0069910, No. 2004 / 0072234, No. 2004 / 0043923, No. 2003 / 0087301, No. 2003 / 0054360, and No. 2002 / 0064780. The present invention provides a method for designing novel nucleic acid target moieties. The present invention further provides a method for isolating or identifying novel nucleic acid target moieties from a mixture of candidate nucleic acid target moieties.

[0203] Nucleic acid target moieties that bind to proteins, carbohydrates, lipids, and / or nucleic acids can be designed and / or identified. In some embodiments, nucleic acid target moieties can be designed and / or identified for use in the complexes of the present invention that bind to proteins and / or characteristic portions thereof, such as tumor markers, integrins, cell surface receptors, transmembrane proteins, intercellular proteins, ion channels, membrane transport proteins, enzymes, antibodies, and chimeric proteins. In some embodiments, nucleic acid target moieties can be designed and / or identified for use in the complexes of the present invention that bind to carbohydrates and / or characteristic portions thereof, such as glycoproteins, sugars (e.g., monosaccharides, disaccharides, and polysaccharides), and sugar coatings (i.e., carbohydrate-rich marginal zones on the outer surface of most eukaryotic cells). In some embodiments, nucleic acid target moieties can be designed and / or identified for use in the complexes of the present invention that bind to lipids and / or characteristic portions thereof, such as oils, saturated fatty acids, unsaturated fatty acids, glycerides, hormones, steroids (e.g., cholesterol, bile acids), vitamins (e.g., vitamin E), phospholipids, sphingolipids, and lipoproteins. In some embodiments, the nucleic acid target portion may be designed and / or identified for use in the complex of the present invention to bind to characteristic portions of nucleic acids and / or thereof, such as DNA nucleic acids; RNA nucleic acids; modified DNA nucleic acids; modified RNA nucleic acids; and nucleic acids including any combination of DNA, RNA, modified DNA, and modified RNA.

[0204] Nucleic acid target moieties (e.g., aptamers or spiegelmers) can be designed and / or identified using any available method. In some embodiments, nucleic acid target moieties are designed and / or identified by identifying them from a candidate mixture of nucleic acids. In vitro evolution (SELEX) or its variations are commonly used methods for identifying nucleic acid target moieties that bind to a target from a candidate mixture of nucleic acids.

[0205] Nucleic acid target regions that selectively bind to any target can be isolated by the SELEX process or a variation thereof, provided that the target can be used as a target in the SELEX process.

[0206] B. Immunotherapy agents Generally, the combinations and compositions of the present invention include immunotherapeutic agents.

[0207] In this specification, “immunotherapy agent” means a compound, molecule, or drug that can stimulate or enhance the body’s immune system or tumor cells. Immunotherapy agents are used for the treatment of disease by inducing, enhancing, or suppressing an immune response. The immunotherapy agents of the present invention are generally designed to elicit or increase an immune response rather than suppress it.

[0208] Generally, the immunotherapeutic agents of the present invention act directly or indirectly on Toll-like receptors, nucleotide-oligomerized domain-like receptors, RIG-I-like receptors, type C lectin receptors, or cytoplasmic DNA sensors, or combinations thereof. In particular, the immunotherapeutic agents of the present invention can activate human plasmacytoid dendritic cells, myeloid dendritic cells, NK cells, or tumor cells, or combinations thereof.

[0209] In some embodiments, the immunotherapy agents of the present invention activate human immune cells, including but not limited to dendritic cells, macrophages, monocytes, myeloid-derived suppressor cells, NK cells, B cells, T cells, or tumor cells, or combinations thereof.

[0210] Dendritic cells are the most potent antigen-presenting cells. They play a crucial role in initiating both innate and adaptive immune responses. Dendritic cells also play a major role in inducing and maintaining immune tolerance.

[0211] In this specification, “dendritic cells” (DCs) refer to a heterogeneous cell population that includes two main subtypes: bone marrow DCs (mDCs) and plasmacytoid DCs (pDCs) (Steinman et al., 1979, J. Exp. Med., 149, 1-16). These two blood DC subsets were originally distinguished by their expression of CD11c (integrin complement receptor) and CD123 (IL-3Rα). The pDC and mDC populations each account for approximately 0.2% to 0.6% of the human PBMC population.

[0212] In this specification, “pDC” means plasmacytoid dendritic cells, representing a subtype of dendritic cells found in blood and peripheral lymphoid organs. These cells express the surface markers CD123, BDCA-2 (CD303), and BDCA-4 (CD304), and HLA-DR, but do not express CD11c, CD14, CD3, CD20, or CD56, thereby distinguishing them from conventional dendritic cells, monocytes, T cells, B cells, and NK cells. As components of the innate immune system, these cells express intracellular Toll-like receptors 7 and 9, which enable the detection of viral and bacterial nucleic acids, such as ssRNA or CpG DNA motifs. Upon stimulation and subsequent activation, these cells produce large amounts of type I interferons (primarily IFN-α and IFN-β) and type III interferons (e.g., IFN-λ), which are important multifaceted antiviral compounds that mediate a wide range of effects. By producing numerous type I interferons, cytokines, and chemokines, plasmacytoid dendritic cells are extensively involved in the body's innate and adaptive immune responses. They can modulate NK cells, T cells, B cells, and other cells involved in the intensity, duration, and mode of the immune response, and therefore play a crucial role in tumors, infections, and autoimmune diseases (Liu YJ. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 2005;23:275-306. Gilliet M, Cao W, Liu YJ. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol. 2008 Aug;8(8):594-606).

[0213] In this specification, “mDC” means bone marrow dendritic cells and represents a subtype of circulating dendritic cells found in the blood and peripheral lymphoid organs. These cells express the surface markers CD11c, CD1a, HLA-DR, and either BDCA-1 (CD1c) or BDCA-3 (CD141). They do not express BDCA-2 or CD123, which distinguishes them from pDCs. mDCs also do not express CD3, CD20, or CD56. As components of the innate immune system, mDCs express Toll-like receptors (TLRs), including TLR2, 3, 4, 5, 6, and 8, which enable the detection of bacterial and viral components. Upon stimulation and subsequent activation, these cells are the most potent antigen-presenting cells, activating antigen-specific CD4 and CD8 T cells. In addition, mDCs have the ability to produce large amounts of IL-12 and IL-23, which is important for inducing Th1-mediated or Th17 cell-mediated immunity.

[0214] Studies have shown that many solid tumors, including breast cancer, head and neck cancer, and ovarian cancer, have pDC infiltration (Treilleux I, Blay JY, Bendriss-Vermare N et al., Dendritic cell infiltration and prognosis of early stage breast cancer. Clin Cancer Res 2004;10:7466-7474. Hartmann E, Wollenberg B, Rothenfusser S et al., Identification and functional analysis of tumor-infiltrating plasmacytoid dendritic cells in head and neck cancer. Cancer Res 2003;63:6478-6487. Zou WP, Machelon V, Coulomb-L'Hermin A et al., Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat (Med2001;7:1339-1346) and factors secreted by tumor cells inhibit dendritic cell maturation (Gabrilovich DI, Corak J, Ciernik IF et al., Decreased antigen presentation by dendritic cells in patients with breast cancer. Clin Cancer Res 1997;3:483-490. Bell D, Chomarat P, Broyles D et al., In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 1999;190:1417-1425.)Menetrier-Caux C, Montmain G, and Dieu MC et al. found that inhibition of the differentiation of dendritic cells from CD34(+) progenitors by tumor cells: role of interleukin-6 and macrophage colony-stimulating factor (Blood 1998;92:4778-4791). These immature DC cells did not play a role in promoting anti-tumor immunity. In contrast, DCs within the tumor microenvironment promote tumor growth by inhibiting anti-tumor immunity and promoting angiogenesis. There is evidence that the Toll-like receptor 7 agonist imiquimod and the Toll-like receptor 9 agonist CpG can stimulate pDCs in the tumor microenvironment and inhibit tumor development (Dummer R, Urosevic M, Kempf W et al., Imiquimod in basal cell carcinoma: how does it work? Br J Dermatol 2003;149:57-58. Miller RL, Gerster JF, Owens ML et al., Imiquimod applied topically: a novel immune response modifier and new class of drug. Int J Immunopharmacol 1999;21:1-14. Hofmann MA, Kors C, Audring H et al., Phase 1 evaluation of intralesionally injected TLR9-agonist PF-3512676 in patients with basal cell carcinoma or metastatic melanoma. J Immunother 2008;31:520-527). .

[0215] Natural killer (NK) cells are a type of cytotoxic lymphocyte that constitutes a major component of the immune system. NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). They recognize and kill transformed cell lines without initial stimulation in an MHC-unrestricted manner. NK cells play a major role in the rejection of tumor and virus-infected cells. The process by which NK cells recognize target cells and deliver sufficient signals to induce targeted lysis is determined by a set of inhibitory and activating receptors on the cell surface. NK recognition of self from altered self involves the recognition of inhibitory receptors for MHC-I molecules and non-MHC ligand-like CD48 and Clr-1b. NK recognition in infected or damaged cells (altered self) is regulated by stress-induced ligands (e.g., MICA, MICB, Rae1, H60, Mult1) recognized by various activating receptors including NKG2D, Ly49H, and NKp46 / Ncr1, or by viral coding ligands (e.g., m157, hemagglutinin).

[0216] NK cells present as dominant lymphocytes in the peripheral blood for several months after allogeneic or autologous stem cell transplantation, playing a major role in immunity against pathogens during this period (Reittie et al., (1989) Blood 73:1351-1358; Lowdell et al., (1998) Bone Marrow Transplant 21:679-686). The roles of NK cells in engraftment, graft-versus-host disease, anti-leukemic activity, and post-transplant infection are outlined in Lowdell (2003) Transfusion Medicine 13:399-404.

[0217] Human NK cells mediate the lysis of tumor cells and virus-infected cells through innate cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC).

[0218] Human NK cells are regulated by positive and negative cytolytic signals. Negative (inhibitory) signals are transmitted by C-lectin domains containing the receptor CD94 / NKG2A and by several killer immunoglobulin-like receptors (KIRs). The regulation of NK lysis by inhibitory signals is known as the "loss of self" hypothesis, in which specific HLA class I alleles expressed on the surface of target cells ligate the inhibitory receptor of NK cells. Downregulation of HLA molecules on tumor cells and some virus-infected cells (e.g., CMV) lowers this inhibition below the target threshold, and if the target cells also possess NK initial stimulation and activation molecules, the target cells may become sensitive to NK cell-mediated lysis. TLR7, TLR8, or TLR9 agonists can activate both mDCs and pDCs to produce type I IFN and express co-stimulating molecules such as GITR-ligands, which subsequently activate NK cells to produce IFN-γ and potently promote the NK cell death function.

[0219] Inhibitory receptors can be divided into two groups: the Ig superfamily, known as killer immunoglobulin-like receptors (KIRs), and the lectin family, specifically NKG2s, which dimerize with CD94 on the cell surface. KIRs have a 2- or 3-domain extracellular structure and bind to HLA-A, -B, or -C. The NKG2 / CD94 complex ligates HLA-E.

[0220] Inhibitory KIRs have up to four intracellular domains containing ITIM, the most distinctive being KIR2DL1, KIR2DL2, and KIR2DL3, which are known to bind HLA-C molecules. KIR2DL2 and KIR2DL3 bind to group 1 HLA-C alleles, while KIR2DL1 binds to group 2 alleles. Certain leukemia / lymphoma cells are known to express both group 1 and group 2 HLA-C alleles and be resistant to NK-mediated cytolysis.

[0221] Regarding positive activation signals, ADCC is thought to be mediated via CD16, and numerous trigger receptors responsible for innate cytotoxicity have been identified, including CD2, CD38, CD69, NKRP-I, CD40, B7-2, NK-TR, NKp46, NKp30, and NKp44. In addition, several KIR molecules with short intracytoplasmic tails are also stimulant. These KIRs (KIR2DS1, KIR2DS2, and KIR2DS4) are known to bind to HLA-C; their extracellular domains are identical to their associated inhibitory KIRs. Activating KIRs lack ITIM and instead associate with DAP12, leading to NK cell activation. The mechanisms of expression regulation between inhibitory and activating KIRs remain unclear.

[0222] Several reports describe the expression of TLRs in mouse or human cancer or cancer cell lines. For example, TLR1-TLR6 are expressed in colon, lung, prostate, and melanoma mouse tumor cell lines (Huang B, et al., Toll-like receptors on tumor cells facilitate evasion of immune surveillance. Cancer Res. 2005;65(12):5009-5014), TLR3 is expressed in human breast cancer cells (Salaun B, Coste I, Rissoan MC, Lebecque SJ, Renno T. TLR3 can directly trigger apoptosis in human cancer cells. J Immunol. 2006;176(8):4894-4901), and hepatocellular carcinoma and gastric carcinoma cells express TLR2 and TLR4 (Huang B, et al., Listeria monocytogenes promotes tumor growth via tumor cell toll-like receptor 2 signaling. Cancer). Res.2007;67(9):4346-4352), TLR9 (Droemann D et al., Human lung cancer cells express functionally active Toll-like receptor 9. Respir Res.2005;6:1), and TLR4 (He W, Liu Q, Wang L, Chen W, Li N, Cao X. TLR4 signaling promotes immune escape of human lung cancer cells by inducing immunosuppressive cytokines and apoptosis resistance. Mol Immunol.2007;44(11):2850-2859) are expressed by human lung cancer cells.TLR7 and TLR8 are found in human lung cancer tumor cells. Invest.2010;120(4):1285-1297).

[0223] TLRs are a family of proteins that sense microbial products and / or initiate adaptive immune responses. TLRs activate dendritic cells (DCs). TLRs are conserved membrane-spanning molecules containing a leucine-rich repeat external domain, a transmembrane domain, and an intracellular TIR (Tall / interleukin receptor) domain. TLRs often recognize specific structures within microorganisms, known as "PAMPs" (pathogen-associated molecular patterns). Ligands that bind to TLRs trigger a cascade of intracellular signaling pathways that induce the production of factors involved in inflammation and immunity.

[0224] In some embodiments, the immunotherapeutic agent is a TLR7 and / or TLR8 agonist. TLR7 and TLR8 are phylogenetically and structurally related. TLR7 is selectively expressed by human pDCs and B cells. TLR8 is predominantly expressed in mDCs, monocytes, macrophages, and myelosuppressor cells. TLR7-specific agonists activate plasmacytoid DCs (pDCs) to produce large amounts of type 1 IFN and express high levels of co-stimulating molecules that promote the activation of T cells, NK cells, B cells, and mDCs. TLR8-specific agonists activate bone marrow DCs, monocytes, macrophages, or myeloid suppressor cells to produce large amounts of type 1 IFN, IL-12, and IL-23 and express high levels of MHC class I, MHC class II, and co-stimulating molecules that promote the activation of antigen-specific CD4 and CD8+ T cells.

[0225] In some embodiments, the immunotherapeutic agent is a TLR7 and / or TLR8 agonist represented by the structure of formula (I), or a pharmaceutically acceptable salt or solvate thereof. That is the case. [ka] In the formula, dashed lines indicate joining or absence of joining. X is S or -NR1, and R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl-- W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl. W2 is a bond, --O--, --C(O)--, --C(S)--, or -S(O)2-, W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl. W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl-C (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --S-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH are optionally substituted with one or more substituents selected from the group consisting of (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --C(O)-O-R4, --S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl. R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- R4 is optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R4, --C(O)-O-R4, --OC(O)-R4, --S-R4, --C(O)-S-R4, --SC(O)-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, and -SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. n is 0, 1, 2, 3, or 4. Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl. Here, R6, R7, and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl. X and Z can combine to form a (5-9) member ring of their own choosing.

[0226] In some embodiments, X in equation (I) is S.

[0227] In some embodiments, X in formula (I) is -NR1, and R1 is alkyl, --alkyl-W4, --alkyl-O-W4, --alkyl-NH-C(O)-W4, --alkoxy-NH-C(O)-W4, --alkyl-NH-C(O)-NH-W4, --alkoxy-NH-C(O)-NH-W4, --alkyl-S(O)2-W4, or --alkyl-NH-C(S)-W4, where W4 is as defined above.

[0228] In some embodiments, Z in formula (I) is hydrogen, alkyl, alkoxy, aryl, heteroaryl, or haloalkyl, each of which is optionally substituted with one to three substituents selected from the group consisting of hydroxyl, alkyl, aryl, heteroaryl, heterocyclyl, cyano, --alkoxy-alkyl, nitro, and -N(R5)2, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or -alkyl-heteroaryl.

[0229] In some embodiments, Y in formula (I) is -NH2, --alkyl-NH2, each of which is optionally substituted with one to three substituents selected from the group consisting of alkyl, alkoxy, alkenyl, and alkynyl.

[0230] In some embodiments, n in equation (I) is 1 or 2.

[0231] In some embodiments, R in formula (I) is an aryl or heteroaryl, each of which is hydroxyl, alkoxy, --alkyl-hydroxyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --OC(O)-R4, --S-R4, --C(O)-S-R4, -S R4 is optionally substituted with one to three substituents selected from the group consisting of C(O)-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, -NH-alkyl-R4, halogen, --CN, and -SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl.

[0232] In some embodiments, the immunotherapy agent is a TLR7 and / or TLR8 agonist selected from Table 2. The compounds in Table 2 are described and characterized in more detail in U.S. Patent Nos. 4,689,338, 5,389,640, 5,226,575, 6,110,929, 6,194,425, 5,352,784, 6,331,539, 5,482,936, 6,451,810, International Publication Nos. 2002 / 46192, 2002 / 46193, 2002 / 46194, U.S. Patent Application Publication Nos. 2004 / 0014779 and U.S. Patent Application Publication Nos. 2004 / 0162309. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9]

[0233] In some embodiments, the immunotherapy agent is preferably rexiquimod or imiquimod.

[0234] In some embodiments, the immunotherapeutic agent is a TLR modulator represented by the structure of formula (II) (e.g., a TLR7 and / or TLR8 agonist) or a pharmaceutically acceptable salt or solvate thereof. [ka] In the formula, V is -NR6R7, where R6 and R7 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl. R 10 and R 11 R5 is independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl.

[0235] In some embodiments, the immunotherapy agent is a TLR modulator represented by the structure of formula (III) (e.g., a TLR7 and / or TLR8 agonist). [ka] During the ceremony, [ka] R2 and R3 are either double or single bonds, R2 and R3 are independently selected from H and lower alkyl, or R2 and R3 are linked to form a saturated carbocyclyl having a 3-7 membered ring, and R7 and R8 are [ka] And the others are hydrogen, and R4 is -NR c R d OR 10 And R c and R d is a lower alkyl group, where the alkyl group is optionally substituted with one or more -OH groups, and R 10 is an alkyl group, where the alkyl group is optionally substituted with one or more -OH groups, Z is C, and [ka] is a double bond, or Z is N, and [ka] It is a single bond, R a and R b H, alkyl, alkenyl, alkynyl and R e Independently selected from the group consisting of, where alkyl is optionally one or more -OR 10 or R e Replaced with R e This is selected from -NH2, -NH(alkyl), and -N(alkyl)2. [ka] If it is a double bond, R1 does not exist, or [ka] In the case of a single bond, N1-R1 and R a or R b One of the two is linked to form a saturated, partially unsaturated, or unsaturated heterocycline having a 5-7 membered ring, Ra or R b The other side may accept cyclic unsaturation as needed, either hydrogen or absent, and apply at least one of the following A and D: A) R7 is not hydrogen, B) R8 is not hydrogen and R a and R b At least one of them is not hydrogen, C)Z is N, or d)N1-R1 and R a or R b One of the components is linked to form a saturated, partially unsaturated, or unsaturated heterocycline having a 5- to 7-membered ring. U.S. Patent Application Publication No. 2014 / 0088085 incorporates, by reference, the entire disclosure.

[0236] In some embodiments, R7 of the compound of formula (III) is [ka] Furthermore, R a and R b At least one of the compounds of formula (III) is not hydrogen, or for example, R a and R b One of the components is alkyl, and R a and R b The other is hydrogen. Furthermore, the alkyl in formula (III) is R e It is replaced by R. In a different embodiment, a and R b Both are alkyl, or R a and R b One of them is R e And R a and R b The other is hydrogen. For example, R8 in equation (III) is not hydrogen.

[0237] In some alternative embodiments, N1 and R in formula (III) a or R b One of the two is linked to form a saturated, partially unsaturated, or unsaturated heterocycline having a 5-7 membered ring, and R a or R bThe other side may have hydrogen to accept ring unsaturation as needed, or it may be absent, where the ring is a 5-membered ring, or for example, the ring is [ka] That is the case.

[0238] In some embodiments, at least one of R2 and R3 in the compound of formula (III) is not hydrogen, or for example, R2 and R3 are linked to form a saturated carbocyclyl, where saturated carbocyclyl is cyclopropyl. Alternatively, Z is N in the compound of formula (III).

[0239] In some embodiments, the TLR agonist or modulator has the structure of formula (IV). [ka] In the formula, R4 is -NR c R d and -OR 10 Selected from, R c and R d is a lower alkyl group, where the alkyl group is optionally substituted with one or more -OH groups, and R 10 is an alkyl group, where the alkyl group is optionally substituted with one or more -OH groups, R f and R g is a lower alkyl, or R f and R g These, together with the nitrogen atoms to which they are bonded, form a saturated heterocyclyl ring having a 4-6 membered ring. For example, in the compound of formula (IV), R f and R g These atoms, along with the nitrogen atom to which they bond, form a saturated heterocyclyl ring, where the heterocyclyl ring is pyrrolidine.

[0240] In some embodiments, R4 in either formula (III) or formula (IV) is -OR 10 And here R 10is alkyl or ethyl. In some embodiments, R4 of either formula (III) or formula (IV) is -NR c R d And here both are alkyl or both are propyl. Furthermore, in certain embodiments, R c or R d At least one of them is an alkyl group substituted with one -OH group, and R c and R d At least one of them [ka] And the remaining R c or R d It is propyl.

[0241] In some alternative embodiments, the TLR is [ka] It is a compound selected from. Alternatively, the compound is [ka] Selected from.

[0242] In some alternative embodiments, the TLR agonist is [ka] That is the case.

[0243] In some alternative embodiments, the TLR agonist is [ka] It is a compound selected from among them.

[0244] In some alternative embodiments, the TLR agonist is [ka] That is the case.

[0245] In some alternative embodiments, the TLR agonist is [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] It is a compound selected from among them.

[0246] In some embodiments, the immunotherapy agent is a TLR modulator represented by the structure of formula (V) (e.g., a TLR7 and / or TLR8 agonist), and its metabolites, solvates, tautomers, and prodrugs. [ka] During the ceremony, Y is CF2CF3, CF2CF2R 6 , or an aryl or heteroaryl ring, wherein the aryl and heteroaryl rings are alkenyl, alkynyl, Br, CN, OH, NR 6 R 7 , C(=O)R 8 , NR 6 SO2R 7 , (C1~C6 alkyl)amino, R 6 OC(=O)CH=CH2-, SR 6 and SO2R 6substituted with one or more groups independently selected therefrom, wherein the aryl and heteroaryl rings are optionally further substituted with one or more groups independently selected from F, Cl, CF3, CF3O-, HCF2O-, alkyl, heteroalkyl and ArO- R 1 、R 3 及びR 4 are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl5Br, I, CN, OR 6 、NR 6 R 7 、C(=O)R 6 、C(=O)OR 6 、OC(=O)R 6 、C(=O)NR 6 R 7 、(C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(^O)CH=CH2-, NR 6 SO2R 7 、SR 6 及びSO2R 6 optionally substituted with one or more groups independently selected from または、R 3 及びR 4 form a saturated or partially unsaturated carbocyclic ring together with the atoms to which they are attached, wherein the carbocyclic ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 、NR 6 R 7 、C(=O)R 6 、C(=O)OR 6 、0C(=O)R 6 、C(=O)NR 6 R 7 、(C1-C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, R 2 and R 8 H, OR 6、 NR 6 R 7 A alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are independently selected from alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, F, Cl, Br5I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(^O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, R 5a , R 5b and R 5c These are independently H, F, Cl, Br, I5OMe5CH3, CH2F5CHF2 or CF3, and R 6 and R 7 The elements are independently selected from H5 alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(^O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements that are independently selected from or R 6 and R 7 These atoms, together with the atoms to which they are bonded, form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally substituted with one or more groups independently selected from R. In certain embodiments, R 1 , R 3 and R 4 These are hydrogen atoms, respectively. In a particular embodiment, R 5a , R 5b and R 5c These are hydrogen, respectively. International Publication No. 2007 / 024612 is incorporated by reference in its entirety.

[0247] In some embodiments of the compound of formula (V), R 2 is OR 6 In some embodiments, R 6is an alkyl group, for example, a (1-4C) alkyl group. In certain embodiments, R 6 It is ethyl.

[0248] In some embodiments of the compound of formula (V), R 2 is NR 6 R 7 In some embodiments, R 6 and R 7 Independently, are H, alkyl, e.g., (1-6C)alkyl, or heteroalkyl, e.g., (1-4C)alkoxy(2-4C)alkyl. In certain embodiments, R 6 and R 7 Y is independently H, ethyl, propyl, or CH2CH2OCH3. In some embodiments of the compound of formula V, Y is an aryl, for example, phenyl. In some embodiments, the aryl is C(=O)R 8 For example, Para-R 8 It is substituted with C(=O)phenyl. In some embodiments, R 8 is OR 6 , NR 6 R 7 or heterocycloalkyl. In some embodiments, R 6 and R 7 R is independently H or alkyl, for example, (1-6C)alkyl. In some other embodiments, R 6 and R 7 These, together with the nitrogen atom to which they are bonded, form a 4- to 6-membered azacycloalkyl ring, such as pyrrolidinyl. In some embodiments, Y is. [ka]

[0249] In some embodiments of the compound of formula (V), Y is CF2CF3.

[0250] In some embodiments, the immunotherapy agent is a TLR modulator represented by the structure of formula (VI) (e.g., a TLR8 agonist), as well as its metabolites, solvates, tautomers, pharmaceutically acceptable prodrugs and salts. [ka] During the ceremony, Z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR 6 or NR 6 R 7 Here, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl3Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more groups that are optionally selected from, R 1 , R 2 , R 3 and R 4 The elements are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , NR 6 R 7, C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 , which is optionally replaced by one or more elements independently selected from, or R 1 and R 2 These atoms, together with the atoms to which they are bonded, form a saturated or partially unsaturated carbocyclyl ring, where the carbocyclyl ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, or R 3 and R 4 Both are oxo, Each R 5 It is independently selected from H, F, Cl, Br, I, OMe, CH3, CH2F, CHF2, CF3 and CF2CF3, R 6 and R 7The elements are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, or R 6 and R 7 These atoms, together with the atoms to which they bond, form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally substituted with one or more elements independently selected from, and n is 0, 1, 2, 3, or 4. Incorporate by reference the entirety of International Publication 2007 / 048402.

[0251] In some embodiments, the immunotherapy agent is a TLR modulator represented by the structure of formula (VI) (e.g., a TLR8 agonist), as well as its metabolites, solvates, tautomers, pharmaceutically acceptable salts, and prodrugs. [ka] During the ceremony, Z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR 6 or NR 6 R 7 Here, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, R 1 , R 2 , R 3 and R 4 The elements are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , NR 6 R 7, C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OCC=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 , optionally replaced by one or more elements independently selected from, or R 1 and R 2 These atoms, together with the atoms to which they are bonded, form a saturated or partially unsaturated carbocyclyl ring, where the carbocyclyl ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I 、 CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, or R 3 and R 4 Both are oxo, R 5 These are H, F, Cl, Br, I, OMe, CH3, CH2F, CHF2, CF3 or CF2CF3, R 6 and R 7The elements are independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl, where alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, and heteroaryl are alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino 、 CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more elements independently selected from, or R 6 and R 7 These atoms, together with the atoms to which they bond, form a saturated or partially unsaturated heterocyclyl ring, where the heterocyclyl ring is alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR 6 , NR 6 R 7 , C(=O)R 6 , C(=O)OR 6 ,OC(=O)R 6 , C(=O)NR 6 R 7 (C1~C6 alkyl)amino, CH3OCH2O-, R 6 OC(=O)CH=CH2-, NR 6 SO2R 7 , SR 6 and SO2R 6 It is optionally replaced by one or more groups independently selected from, and n is 0, 1, 2, 3, or 4.

[0252] In some embodiments, Z is OR 6 In some embodiments, R 6 is an alkyl group, for example, a (1-6C) alkyl group. In certain embodiments, R 6 These are ethyl, propyl, isopropyl, or isobutyl.

[0253] In some embodiments, Z is NR 6 R 7 In some embodiments, R 6 and R 7 R is independently H or alkyl, for example, (1-6C)alkyl. In some embodiments, R 6 and R 7 is ethyl. In some embodiments, n is 0 or 1.

[0254] In some embodiments, R 5 CF2CF3. In a particular embodiment, R 3 is H or alkyl, for example, (1~4C) alkyl, and R 4 R is H. In certain embodiments, R is alkyl, for example, (1-4C)alkyl. In some embodiments, R is methyl. In other specific embodiments, R 3 is H. In some embodiments, R is H or alkyl, for example, (1-4C) alkyl, and R is H. In some embodiments, R 1 is alkyl. In some embodiments, R 1 is methyl. In some specific embodiments, R 1 H is H.

[0255] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist represented by the structure of formula (XV), [ka] In the formula, ring A represents a 6-10 membered aromatic carbocyclyl ring or a 5-10 membered heteroaromatic ring. R represents a halogen atom, alkyl group, hydroxyalkyl group, haloalkyl group, alkoxy group, hydroxyalkoxy group, haloalkoxy group, amino group, alkylamino group, dialkylamino group, or a 4-7 membered cyclyl ring containing 1-2 nitrogen atoms and a 1-2 ring heteroatom optionally selected from 0-1 oxygen atoms or 0-1 sulfur atoms. n represents an integer between 0 and 2, and when n is 2, Rs can be the same or different. Z 1 This includes substituted or unsubstituted alkylene groups or substituted or unsubstituted cycloalkylene groups. X 2 These are oxygen atoms, sulfur atoms, SO2, NR 5 CO, CONR 5 , NR 5 CO, SO2NR 5 , NR 5 SO2, NR 5 CONR 6 or NR 5 CSNR 6 (R here) 5 and R 6 Each of these independently represents a hydrogen atom, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted cycloalkyl group. Y 1 , Y 2 and Y 3 Each of these independently represents a single bond or an alkylene group. X 1 These are oxygen atoms, sulfur atoms, SO2, NR 4 (Here, R 4 (represented by a hydrogen atom or alkyl group) or a single bond, R 2 This represents a hydrogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted alkynyl group, or a substituted or unsubstituted cycloalkyl group, and R 1'NH2' represents a hydrogen atom, a hydroxyl group, an alkoxy group, an alkoxycarbonyl group, a haloalkyl group, a haloalkoxy group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, or a substituted or unsubstituted cycloalkyl group. The linker is bonded to one of the binding sites of the agonist, for example, -NH2.

[0256] In some embodiments, R 1 These are hydrogen, hydroxyl, or C1-C6 alkoxy, C2-C5 alkoxycarbonyl, C1-C6 haloalkyl, C1-C6 haloalkoxy, C6-C 10 Aryl, C5~C 10 The group is a heteroaryl or C3-C8 cycloalkyl group, where each group is optionally substituted with one or more substituents independently selected from halogen, hydroxyl, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 haloalkoxy, C2-C5 alkoxycarbonyl, amino(NH2), (mono)-C1-C6 alkylamino, and (di)-C1-C6 alkylamino groups. Y 1 This represents a single bond or a C1-C6 alkylene. X 1 This is a single bond, oxygen, sulfur atom, sulfonyl (SO2) or NR 3 This represents, Z 1 This represents a C2-C6 alkylene or C3-C8 cycloalkylene group, where each group is optionally substituted with at least one hydroxyl group. X 2 , NR 4 This represents, Y 2 This represents a single bond or a C1-C6 alkylene. Y 3 This represents a single bond or a C1-C6 alkylene. n is an integer, either 0, 1, or 2. R represents a C3-C8 saturated heterocyclyl ring comprising a halogen or a C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 haloalkyl, C1-C6 alkoxy, C1-C6 hydroxyalkoxy, C1-C6 haloalkoxy, amino(NH2), (mono)-C1-C6 alkylamino, (di)-C1-C6 alkylamino group, or a ring nitrogen atom and one or more further heteroatoms optionally selected independently from nitrogen, oxygen, and sulfur, which is optionally substituted with one or more substituents optionally selected independently from halogen, hydroxyl, oxo, C1-C6 alkyl, C1-C6 alkoxy, C2-C5 alkylcarbonyl, and C2-C5 alkoxycarbonyl groups. R 2 represents hydrogen or C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C8 cycloalkyl, and each group is a halogen, hydroxyl or C1-C6 alkoxy, C2-C 10 The acyloxy group is optionally substituted with one or more substituents independently selected from groups selected from acyloxy, C2-5 alkylcarbonyloxy, C2-C5 alkenylcarbonyloxy, C2-C5 alkynylcarbonyloxy, C6-C9 arylcarbonyloxy, and C5-C9 heteroarylcarbonyloxy groups, provided that the total number of carbon atoms in the acyloxy group does not exceed 10, and each acyloxy group is substituted with halogen, hydroxyl, C1-C3 alkoxy and phenyl, amino(NH2), (mono)-C1-C6 alkylamino A C3-C8 saturated heterocyclyl ring comprising a (di)-C1-C6 alkylamino group, a ring nitrogen atom, and one or more further heteroatoms optionally selected independently from nitrogen, oxygen, and sulfur, which may be optionally substituted sequentially with one or more substituents optionally selected independently from halogen, hydroxyl, oxo, C1-C6 alkyl, C1-C6 alkoxy, C2-C5 alkylcarbonyl, and C2-C5 alkoxycarbonyl groups, or optionally substituted with one or more substituents optionally selected independently from the heterocyclyl ring. R 3 This represents hydrogen or C1-C6 alkyl, R 4 CO2R 5 SO2R 5 COR 5 SO2NR 6 R 7 and CONR 6 R 7 This represents, R 5 Independently (i) Ring group NR 8 , S(O) m Alternatively, a 3- to 8-membered heterocyclyl ring containing one or two heteroatoms selected from oxygen, wherein the 3- to 8-membered heterocyclyl ring is optionally substituted with one or more substituents independently selected from halogens, hydroxyls, or C1-C6 alkyl and C1-C6 alkoxy groups, or (ii) C6~C 10 Aryl or C5~C 10 These are heteroaryl groups, each of which is a halogen, cyano, C1-C6 alkyl, C1-C3 haloalkyl, carboxyl, or S(O) m R 9 , OR 10 CO2R 10 SO2NR 10 R 11 CONR 10 R 11 , NR 10 R 11 , NR 10 SO2R 9 , NR 10 CO2R 9 , NR 10 COR 9 It may be optionally substituted with one or more substituents independently selected from, or (iii) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C8 cycloalkyl, each of which is a halogen, CN, C3-C8 cycloalkyl, or S(O) p R 12 , OR 13 COR 13 CO2R 13 SO2NR 13 R14 CONR 13 R 14 , NR 13 R 14 , NR 13 SO2R 12 , NR 13 CO2R 12 , NR 13 COR 12 , NR 13 SO2R 12 Or C6~C 10 Aryl or C5~C 10 The group may be optionally substituted with one or more substituents independently selected from the heteroaryl group or heterocyclyl ring, the latter three groups being optionally substituted with C1-C6 alkyl (hydroxy, C1-C6 alkoxy, C1-C6 alkoxycarbonyl, amino, C1-C6 alkylamino, di-C1-C6 alkylamino, NH2C(O)-, C1-C6 alkylNHC(O), di-C1-C6 alkylNC(O), -OCH2CH2OH, pyrrolidinyl, pyrrolidinylcarbonyl, furanyl, piperidinyl, methylpiperidinyl, or phenyl), C2-C6 alkenyl (optionally substituted with phenyl). (and may be), optionally substituted with one or more substituents independently selected from halogen, hydroxy, cyano, carboxy, amino, C1-C6 alkylamino, di-C1-C6 alkylamino, NH2C(O)-, C1-C6 alkylNHC(O)-, di-C1-C6 alkylNC(O), C1-C6 alkoxycarbonyl, C1-C6 alkylsulfonyl, C1-C6 alkylcarbonylamino, C1-C6 alkylcarbonylmethylamino, phenyl (optionally substituted with hydroxy, fluoro or methyl), pyrrolidinyl, pyridyl, piperidinyl, benzothiazolyl or pyrimidinyl, R 6 is a hydrogen or a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl or heterocyclyl ring, each of which is a halogen, hydroxyl, oxo, cyano, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, OR 15 , S(O)q R 15 CO2R 16 COR 16 , NR 16 R 17 CONR 16 R 17 , NR 16 COR 17 , NR 16 CO2R 15 SO2NR 16 R 17 , NR 16 SO2R 15 , or C6~C 10 Aryl or C5~C 10 The group may be optionally substituted with one or more substituents independently selected from a heteroaryl group or a heterocyclyl ring, the last three groups being C1-C6 alkyl, C3-C8 cycloalkyl, halogen, or S(O). q R 15 CO2R 16 COR 16 , optionally substituted with one or more substituents independently selected from hydroxyl or cyano, and R 7 The group is hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or C3-C8 cycloalkyl, and each group is halogen, C3-C8 cycloalkyl, C6-C 10 Aryl or C5~C 10 Heteroaryl group, carboxyl, cyano, OR 15 , hydroxy or NR 18 R 19 It may be optionally substituted with one or more substituents independently selected from, or R 6 and R 7 Along with the nitrogen atom to which they bond, nitrogen, S(O) m Alternatively, a saturated or partially saturated heterocyclyl ring of 3- to 8-membered rings optionally further comprising a heteroatom or heterogroup selected from oxygen, wherein the heterocyclyl ring is a halogen, hydroxyl, carboxyl, cyano, OR 20 , NR 21 R 22, S(O) q R 23 COR 24 CO2R 24 , NR 24 R 25 CONR 24 R 25 , NR 24 COR 25 , NR 24 CO2R 23 SO2NR 24 R 25 , NR 24 SO2R 23 , C6~C 10 Aryl, C5~C 10 The group may be optionally substituted with one or more substituents independently selected from a heteroaryl group, a heterocyclyl ring, a C1-C6 alkyl group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or a C3-C8 cycloalkyl group, and the last seven groups may be halogen, hydroxyl, oxo, cyano, OR 20 , S(O) q R 23 COR 24 CO2R 24 , NR 24 R 25 CONR 24 R 25 , NR 24 CO2R 23 , NR 24 COR 25 SO2NR 24 R 25 , NR 24 SO2R 23 , heterocyclyl ring or C6~C 10 Aryl or C5~C 10 The heteroaryl group is optionally substituted with one or more substituents independently selected, and the following three groups are optionally substituted with one or more substituents independently selected from C1-C6 alkyl, halogen, hydroxy, or cyano groups. R 8 Hydrogen, CO2R 26 COR 26 SO2R 26, represents a C1-C6 alkyl or C3-C6 cycloalkyl group, and each group is a halogen, hydroxyl, and NR 27 R 28 Optionally substituted with one or more substituents independently selected from, R 10 , R 11 , R 16 , R 17 , R 18 , R 19 , R 21 , R 22 , R 26 , R 27 Or R 28 Each of these independently represents hydrogen and a C1-C6 alkyl or C3-C6 cycloalkyl group. R 24 and R 25 Each of these independently represents hydrogen and a C1-C6 alkyl or C3-C6 cycloalkyl group, or R 24 and R 25 Along with the nitrogen atom to which they bond, nitrogen, S(O) m Alternatively, a saturated or partially saturated heterocyclyl ring of 3- to 8-membered rings may be formed, further optionally containing a heteroatom or heterogroup selected from oxygen. R 9 , R 12 , R 15 and R 23 This represents a C1-C6 alkyl or C3-C6 cycloalkyl group. R 13 and R 14 These are R, respectively. 6 and R 7 It is defined as, R 20 is halogen, hydroxyl or OR 23 Represents a C1-C6 alkyl group optionally substituted with one or more substituents independently selected from the above. m, p, q, and r each independently represent an integer of 0, 1, or 2, and A is C6~C 10 Aryl or C5~C 12Represents a heteroaryl group. Refer to and incorporate by reference the disclosures of International Publication No. 2008 / 004948, U.S. Patent No. 8,138,172, and U.S. Patent No. 8,575,180.

[0257] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist having the following structure. [ka] In the formula, R is either Me or H.

[0258] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist having the following structure. [ka] [ka] [ka]

[0259] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist having the structure of formula (XVI). [ka] In the formula, R 1 These are independently H, -C(O)R 3 , or racemic mixture, L-, or D-amino acid group -C(O)CHNH2R 4 And here R 3 R is a substituted or unsubstituted alkyl group. 4 is H, or a substituted or unsubstituted alkyl group. R 2 H, O, OR 5 , or N(R 6 )2, and here, R 5 R is independently H or alkyl, 6These independently form a substituted or unsubstituted heterocycloalkyl ring with H, a substituted or unsubstituted alkyl, a cycloalkyl, or a nitrogen, and when R is -OH, at least one of the R groups is a racemic, L-, or D-amino acid group -C(O)CHNH2R 4 See U.S. Patent No. 6,924,271, incorporating its entire disclosure by reference.

[0260] In some embodiments, R 1 At least one of the groups is a racemic, L-, or D-amino acid group -C(O)CHNH2R 4 And here R 4 is a substituted or unsubstituted alkyl, and the remaining R 1 The base is H, and R 2 is OR 5 Or N(R 6 )2, and here, R 5 R is independently selected from H or alkyl, and R independently forms a substituted or unsubstituted heterocycloalkyl ring with H, a substituted or unsubstituted alkyl, a cycloalkyl, or nitrogen.

[0261] In some embodiments, R 1 At least one of the groups is an L-amino acid group -C(O)CHNH2R 4 And in the formula R 4 is a substituted or unsubstituted alkyl, and the remaining R 1 The base is H, and R 2 is OR 5 Or N(R 6 )2, and here, R 4 is a substituted alkyl, and R 6 These are independently H or a substituted or unsubstituted alkyl group.

[0262] In some embodiments, R 1 At least one of the groups is an L-amino acid group -C(O)CHNH2R, where R 4 is -CH(CH3)2, and the remaining R 1 The base is H, and R 2It is OH.

[0263] In some embodiments, TLR7 and / or the agonist are [ka] [ka] [ka] [ka] Selected from the group consisting of

[0264] In some embodiments, the activated portion is TLR7 and / or TLR8 having the following structure: [ka] [ka] During the ceremony, Each R 1 This is a substituted or unsubstituted alkyl, alkenyl, or alkynyl, or substituted or unsubstituted aryl or heteroaryl, in which H or one or more O, S, or N heteroatoms may be interposed. R 2 This is a substituted or unsubstituted alkyl, alkenyl, or alkynyl, or a substituted or unsubstituted -O-(alkyl), -O-(aryl), -O-(heteroaryl), -S-(alkyl), -S-(aryl), -S-(heteroaryl), aryl, or heteroaryl, in which H, OH, SH, halo, or one or more O, S, or N heteroatoms may be interposed. R 3H, OH, or SH, or substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl, heteroaryl, -O-(alkyl), -O-(aryl), -O-(heteroaryl), -S-(alkyl), -S-(aryl), -S-(heteroaryl), -NH(alkyl), -NH(aryl), -NH(heteroaryl), -NH(R 4 )(alkyl), -NH(R 4 )(aryl), or -NH(R 4 )(heteroaryl), where R 4 These are substituted or unsubstituted alkyl groups. X is either O or S, Y is H, Halo, OH, OR 4 SH, SR 4 , or substituted or unsubstituted alkyl or aryl, and Z is H, Halo, OH, OR 4 , SH, or SR 4 See U.S. Patent No. 7,576,068, incorporating its entirety by reference.

[0265] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist having the structure of formula (XVIII): [ka] During the ceremony, YZ is -CR 4 R 5 -, -CR 4 R 5 -CR 4 R 5 -, -C(O)CR 4 R 5 -, -CR 4 R 5 C(O)-, -NR 8 C(O)-, -C(O)NR 8 -, -CR 4 R 5 S(O)2-, or -CR 5 -CR 5 -and, L 1 -NR8 -, -O-, -S-, -N(R 8 )C(O)-, -S(O)2-, -S(O)-C(O)N(R 8 )-,-N(R 8 )S(O)2-, -S(O)2N(R 8 )-or covalent bond, R 1 This includes alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroalkyl, substituted heteroalkyl, carbosyl, substituted carbosyl, carbosylalkyl, substituted carbosylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, or substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbosyl heteroalkyl, substituted carbosyl heteroalkyl, heterocyclyl heteroalkyl, substituted heterocyclyl heteroalkyl, aryl heteroalkyl, substituted aryl heteroalkyl, heteroaryl heteroalkyl, or substituted heteroaryl heteroalkyl. X 1 This includes alkylene, substituted alkylene, heteroalkylene, substituted heteroalkylene, alkenylene, substituted alkenylene, alkynylene, substituted alkynylene, carbocyclylene, substituted carbocyclylene, heterocyclylene, substituted heterocyclylene, -NR 8 -, -O-, -C(O)-, -S(O)-, S(O)2-, or a bond, D is a carbocyclyl, substituted carbocyclyl, heterocyclyl, or substituted heterocyclyl, where carbocyclyl, substituted carbocyclyl, heterocyclyl, or substituted heterocyclyl is 1 or 2 -L 2 -NR 6 R 7 Replaced by, or D is a heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl, where the heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl contains 1 to 4 nitrogen atoms. Each L 2These are independently alkylene, substituted alkylene, heteroalkylene, substituted heteroalkylene, or covalent bond. Each R 3 These are independently halogen, cyano, azide, nitro, alkyl, substituted alkyl, hydroxyl, amino, heteroalkyl, substituted heteroalkyl, alkoxy, haloalkyl, haloalkoxy, -CHO, -C(O)OR 8 ,-S(O)R 8 -S(O)2R 8 -C(O)NR 9 R 10 , -N(R 9 )C(O)R 8 , carbocyclyl, substituted carbocyclyl, carbocyclyl alkyl, substituted carbocyclyl alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, -S(O)2NR 9 R 10 , -N(R 9 )S(O)2R 8 , -N(R 9 )S(O)2OR 10 -OS(O)2NR 9 R 10 And, n is 0, 1, 2, 3, 4, or 5. R 4 and R 5 Each of these independently includes H, alkyl, substituted alkyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carboxycyclyl, substituted carboxycyclyl, carboxycyclyl alkyl, substituted carboxycyclyl alkyl, heterocyclyl, substituted heterocyclyl, heterocyclyl alkyl, substituted heterocyclyl alkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carboxycyclyl heteroalkyl, substituted carboxycyclyl heteroalkyl, heterocyclyl heteroalkyl, substituted heterocyclyl heteroalkyl, aryl heteroalkyl, substituted aryl heteroalkyl, heteroaryl heteroalkyl, or substituted heteroaryl heteroalkyl, cyano, azide, OR 8 -C(O)H, -C(O)R 8 ,-S(O)R 8 -S(O)2R 8, -C(O)OR 8 , or -C(O)NR 9 R 10 is, or R 4 and R 5 They both form a carbosicle, substituted carbosicle, heterocycline, or substituted heterocycline with the carbon they bond to, R 4 and R 5 When they are on the same carbon atom and together with the carbon they are bonded to, they are -C(O)- or -C(NR 8 )- and or Two R atoms on adjacent carbon atoms 4 or two R's 5 They form 3- to 6-membered ring carbosicles, substituted carbosicles, heterosicles, or substituted heterosicles together with the carbon atoms to which they are bonded. R 6 and R 7 Each of these independently represents H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbosyl, substituted carbosyl, carbosylalkyl, substituted carbosylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbosyl heteroalkyl, substituted carbosyl heteroalkyl, heterocyclyl heteroalkyl, substituted heterocyclyl heteroalkyl, aryl heteroalkyl, substituted aryl heteroalkyl, heteroaryl heteroalkyl, or substituted heteroaryl heteroalkyl, -C(O)H, -C(O)R 8 ,-S(O)R 8 -S(O)2R 8 , -C(O)OR 8 , or -C(O)NR 9 R 10 , S(O)2NR 9 R 10 is, or R 6 and R 7They form a substituted or unsubstituted heterocycle that may contain one or more further heteroatoms selected from N, O, P, or S, together with the nitrogen to which they are bonded, or R 7 L 2 , and together with N to which they are bonded, they form a substituted or unsubstituted 3 to 8-membered ring heterocycle which may contain one or more further heteroatoms selected from N, O, S, or P. R 8 H, alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroalkyl, substituted heteroalkyl, carbosylyl, substituted carbosylyl, carbosylalkyl, substituted carbosylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbosyl heteroalkyl, substituted carbosyl heteroalkyl, heterocyclyl heteroalkyl, substituted heterocyclyl heteroalkyl, aryl heteroalkyl, substituted aryl heteroalkyl, heteroaryl heteroalkyl, or substituted heteroaryl heteroalkyl, and R 9 and R 10 Each of these is independently H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbosylyl, substituted carbosylyl, carbosylalkyl, substituted carbosylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbosyl heteroalkyl, substituted carbosyl heteroalkyl, heterocyclyl heteroalkyl, substituted heterocyclyl heteroalkyl, aryl heteroalkyl, substituted aryl heteroalkyl, heteroaryl heteroalkyl, or substituted heteroaryl heteroalkyl. R 9 and R 10Together with the nitrogen to which they bind, they form substituted or unsubstituted heterocycles. Here, each substituted alkyl, substituted alkenyl, substituted alkynyl, substituted heteroalkyl, substituted carbocykyl, substituted carbocykylalkyl, substituted heterocyclyl, substituted heterocyclylalkyl, substituted arylalkyl, substituted heteroarylalkyl, substituted carbocykyl heteroalkyl, substituted heterocyclyl heteroalkyl, substituted arylhetalkyl, substituted heteroarylhetalkyl, substituted alkylene, substituted heteroalkylene, substituted alkenylene, substituted alkynylene, substituted carbocycrylene, or substituted heterocyclene is independently -halogen, -R, -O - , =O, -OR, -SR, -S - -NR2, -N(+)R3, =NR, -C(halogen)3, -CR(halogen)2, -CR2(halogen), -CN, -OCN, -SCN, -N=C=O, -NCS, -NO, -NO2, =N2, -N3, -NRC(=O)R, -NRC(=O)OR, -NRC(=O)NRR, -C(=O)NRR, -C(=O)OR, -OC(=O)NRR, -OC(=O)OR, -C(=O)R, -S(=O)2OR, -S(=O)2R, -OS(=O)2OR, -S(=O)2NR, -S(=O)R, -NRS(=O)2R, -NRS( The molecules are independently substituted with one to four substituents selected from the group consisting of -O)2NRR, -NRS(=O)2OR, -OP(=O)(OR)2, -P(=O)(OR)2, -P(O)(OR)(O)R, -C(=O)R, -C(=S)R, -C(=O)OR, -C(=S)OR, -C(=O)SR, -C(=S)SR, -C(=O)NRR, -C(=S)NRR, -C(=NR)NRR, and -NRC(=NR)NRR, where each R is independently H, alkyl, cycloalkyl, aryl, arylalkyl, or heterocyclyl. See U.S. Patent Application Publication No. 20100143301, incorporating its entire disclosure by reference.

[0266] In some embodiments, the activating portion is a TLR7 and / or TLR8 agonist having the following structure. [ka] During the ceremony, L 1 It is -NH- or -O-, R 1 These are alkyl, substituted alkyl, heteroalkyl, substituted heteroalkyl, heterocyclylalkyl, substituted heterocyclylalkyl, carbosylalkyl, or substituted carbosylalkyl. Each R 4 and R 5 R is independently formed with H or C1-C6 alkyl, or the carbon to which they are bonded. 4 and R 5 is -C(O)-, X 1 These are C1-C6 alkylenes, C1-C6 heteroalkylenes, or C1-C6 substituted heteroalkylenes. D is phenyl, biphenyl, or pyridinyl, where phenyl, biphenyl, or pyridinyl is -L 2 -NR 6 R 7 Replaced by, or D is pyridinyl, piperidinyl, piperazinyl, or 1,2,3,4-tetrahydroisoquinolinyl. n is either 0 or 1. R 3 These include halogens, cyano, alkyl, carbocyrill, carbocyrillylalkyl, haloalkyl, and -C(O)OR 6 -C(O)NR 9 R 10 or -CHO, L 2 These are C1-C6 alkylenes or covalent bonds. Each R 6 and R 7 These are independently H, alkyl, or heteroaryl, or R, which binds them together with nitrogen. 6 and R 7 These form substituted or unsubstituted 4-6 membered ring heterocycles containing 0 to 2 heteroatoms selected from N, O, or S.

[0267] In some embodiments, the active portion is a TLR7 and / or TLR8 agonist having the structure described below. [ka]

[0268] C. Amount of immunotherapy agent in combination of therapeutic agents In another aspect, the present invention provides a combination of therapeutic agents comprising a targeted therapy agent and an immunotherapy agent in an appropriate amount for a combination of treatments for diseases such as tumors and cancer.

[0269] In some embodiments, the immunotherapy agent is in an amount that can: (1) induce IFN-α in concentrated human blood DCs, (2) induce TNF-α in concentrated human blood DCs, and / or (3) induce IL-12-α in concentrated human blood DCs.

[0270] Methods for measuring the activity of immunotherapy agents include: 1) assays that measure cytokines released from human dendritic cells stimulated by the immunotherapy agent; 2) assays that detect antibody-dependent cell-mediated cytotoxicity enhanced by the immunotherapy agent; and 3) efficacy studies of tumor models treated with the immunotherapy agent.

[0271] In some embodiments, the immunotherapy agent (e.g., reximod or an analogue) is administered orally or intravenously using an oral or intravenous formulation, such that the local concentration of the immunotherapy agent (e.g., near or at the tumor site of a solid tumor) is between approximately 0.005 μg / ml and approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 μg / ml (including all values).

[0272] Local concentrations of immunotherapeutic agents (e.g., near or within the tumor of a solid tumor) can be measured using methods known in the art, such as measuring tissue or lymphatic concentrations. The local effective concentration of a therapeutic agent depends on its absorption from pathways, tissue distribution, and metabolic processes, and the plasma pharmacokinetics of drug and tissue concentrations can be routinely measured using methods known in the art.

[0273] In some embodiments, the immunotherapy agent is administered in such a quantity that the local concentration of the immunotherapy agent (e.g., near or at the tumor site of a solid tumor) is between approximately 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or 0.4 μg / ml and approximately 0.5 μg / ml (including all values).

[0274] In some embodiments, subjects are administered an oral formulation containing an immunotherapy agent (e.g., rexiquimod or an analogue) twice a week at doses ranging from approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, or 0.015 mg / kg to approximately 0.02 mg / kg (including all values). In some embodiments, subjects are administered an oral formulation containing an immunotherapy agent (e.g., rexiquimod or an analogue) twice a week at doses ranging from approximately 0.0005 mg / kg to approximately 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, 0.015 mg / kg, or 0.02 mg / kg (including all values).

[0275] In some embodiments, subjects are administered an oral formulation containing an immunotherapy agent (e.g., rexiquimod or an analogue) twice a week at doses of approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg or less.

[0276] In some embodiments, subjects are administered an intravenous formulation containing an immunotherapy agent (e.g., rexiquimod or an analogue) weekly at doses ranging from approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, or approximately 0.015 mg / kg to approximately 0.02 mg / kg (including all values). In some embodiments, subjects are administered an intravenous formulation containing an immunotherapy agent (e.g., rexiquimod or an analogue) weekly at doses ranging from approximately 0.0005 mg / kg to approximately 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, 0.015 mg / kg, or 0.02 mg / kg (including all values).

[0277] In some embodiments, the method involves administering an intravenous formulation containing the immunotherapy agent (e.g., rexiquimod or an analogue) to the subject weekly at a dose between approximately 0.0008 mg / kg and approximately 0.0133 mg / kg.

[0278] In some embodiments, the administration of an intravenous preparation containing an immunotherapy agent (e.g., rexiquimod or an analogue) to a target patient at doses of approximately 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or less, up to approximately 0.007 mg / kg, on a weekly basis. For references regarding safe dosages of immunotherapy agents, see Jurk et al., Nature Immunology, Vol. 4, No. 6”499 (2002), and Pockros et al., J. Hepatology, 47:174-182 (2007), and incorporate their entire disclosure by reference.

[0279] III. Pharmaceutical preparations and administration The present invention further relates to pharmaceutical formulations comprising the compound of the present invention or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

[0280] The compounds described herein, comprising pharmaceutically acceptable carriers such as added salts or their hydrates, can be delivered to patients using a wide variety of routes or modes of administration. Preferred routes of administration include inhalation, transdermal, oral, rectal, transmucosal, intraintestinal, and parenteral administration, including intramuscular, subcutaneous, and intravenous injection. Preferably, the compounds of the present invention, comprising an antibody or antibody fragment as a target moiety, are administered parenterally, more preferably intravenously.

[0281] As used herein, the terms “administer” or “dosage” are intended to encompass all methods of directly and indirectly delivering a compound to its intended site of action.

[0282] The compounds described herein, or their pharmaceutically acceptable salts and / or hydrates, may be administered alone, in combination with other compounds of the present invention, and / or in cocktails with other therapeutic agents. Naturally, the choice of therapeutic agents that can be administered concurrently with the compounds of the present invention will, in part, depend on the condition being treated.

[0283] For example, when administered to a patient suffering from a disease condition caused by an organism dependent on a self-inducing agent, the compound of the present invention may be administered in a cocktail containing agents used to treat pain, infection, and other symptoms and side effects commonly associated with the disease. Such agents include, for example, analgesics and antibiotics.

[0284] When administered to patients undergoing cancer treatment, the compound may be administered in a cocktail containing anticancer agents and / or augmentatives. The compound may also be administered in a cocktail containing drugs to treat side effects of radiation therapy, such as antiemetics and radioprotective agents.

[0285] Adjuvants that can be administered concurrently with the compounds of the present invention include, for example, tricyclic antidepressants (e.g., imipramine, desipramine, amitriptyline, clomipramine, trimipramine, doxepin, nortriptyline, protriptyline, amoxapine, and maprotiline); non-tricyclic antidepressants (e.g., sertraline, trazodone, and citalopram); Ca+2 antagonists (e.g., verapamil, nifedipine, nitrendipine, and caloverine); amphotericin; tripanol analogs (e.g., tamoxifen); antiarrhythmics (e.g., quinidine); antihypertensives (e.g., reserpine); thiol depletion agents (e.g., butionine, and sulfoximine); and calcium leucovorin.

[0286] The active compounds(s) of the present invention are administered either by themselves or in the form of a pharmaceutical composition in which the active compounds(s) are mixed with one or more pharmaceutically acceptable carriers, excipients, or diluents. Pharmaceutical compositions for use according to the present invention are typically formulated in a conventional manner using one or more physiologically acceptable carriers containing excipients and adjuvants that facilitate the processing of the active compounds into pharmaceutically usable preparations. Appropriate formulation depends on the selected route of administration.

[0287] For transmucosal administration, a permeabilizing agent suitable for the barrier through which the drug is absorbed is used in the formulation. Such permeabilizing agents are generally known in this field.

[0288] For oral administration, the compounds can be readily formulated by combining the active compound(s) with a pharmaceutically acceptable carrier known in the art. Such carriers enable the compounds of the present invention to be formulated for oral intake by the patient being treated as tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, or suspensions. Pharmaceutical preparations for oral use can be obtained by optionally grinding a solid excipient and processing a granular mixture after adding a suitable adjuvant, if desired, to obtain a tablet or sugar-coated core. Suitable excipients include fillers such as sugars containing lactose, sucrose, mannitol, or sorbitol; and cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrants such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or its salts, such as sodium alginate, may be added.

[0289] The sugar-coated tablet core is provided with a suitable coating. For this purpose, a sugar concentrate may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, Carbopol gel, polyethylene glycol, and / or titanium dioxide, lacquer solution, and a suitable organic solvent or solvent mixture. Dyes or pigments may be added to the tablet or sugar coating for identification or to characterize different combinations of active compound doses.

[0290] Pharmaceutical preparations for oral use include push-in capsules made from gelatin, and soft, sealable capsules made from gelatin and plasticizers such as glycerol or sorbitol. Push-in capsules may contain the active ingredient in a mixture with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active compound may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers may be added. All formulations for oral administration should be in a dosage suitable for such administration.

[0291] For oral administration, the composition may take the form of tablets or lozenges formulated by conventional methods.

[0292] For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray from a pressurized pack or atomizer, with the use of a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of a pressurized aerosol, the dose unit may be determined by providing a valve for dispensing the measured amount. For example, gelatin capsules and cartridges for use in inhalers or injectors may be formulated containing a powder mixture of the compound and a suitable powder base such as lactose or starch.

[0293] The compounds can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Injection is a preferred method of administration of the compositions of the present invention. The injectable formulations may be in unit dosage forms, such as ampoules or multi-dose containers, and may be accompanied by the addition of preservatives. The compositions may take the form of suspensions, liquids, or emulsions in oily or aqueous vehicles, and may contain formulation agents such as suspensions, stabilizers, and / or dispersants, and may also contain cross-linked polyvinylpyrrolidone, agar, or alginic acid, or salts thereof such as sodium alginate.

[0294] Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compound in a water-soluble form. In addition, suspensions of the active compound can be prepared as suitable oily injectable suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injectable suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension may contain suitable stabilizers or agents that increase the solubility of the compound to enable the preparation of high-concentration solutions. For injection, the agents of the present invention can be formulated in aqueous solutions, preferably in physiologically miscible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.

[0295] Alternatively, the active ingredient may be in powder form for composition with a suitable vehicle, such as pyrogen-free sterile water, before use.

[0296] The compound can also be formulated into rectal compositions such as suppositories or retained enemas, which may contain conventional suppository bases, such as cocoa butter or other glycerides.

[0297] In addition to the formulations described above, the compounds can also be formulated as depot preparations. Such long-acting formulations can be administered by implantation or transdermal delivery (e.g., subcutaneous or intramuscular), intramuscular injection, or transdermal patch. Therefore, for example, the compounds can be formulated with suitable polymers or hydrophobic materials (e.g., as emulsions in acceptable oils), or with ion exchange resins, or as somewhat poorly soluble derivatives, for example, as somewhat poorly soluble salts.

[0298] The pharmaceutical composition may also include a suitable solid or gel phase carrier or excipient. Examples of such carriers or excipients include, but are not limited to, polymers such as calcium carbonate, calcium phosphate, various sugars, starch, cellulose derivatives, gelatin, and polyethylene glycol.

[0299] A preferred pharmaceutical composition is one formulated for injection, such as intravenous injection, and contains about 0.01% to about 100% by weight of the compound of the present invention, based on 100% by weight of the total pharmaceutical composition. The drug-ligand conjugate may be an antibody-cytotoxin conjugate in which the antibody is selected to target a specific cancer.

[0300] In some embodiments, the pharmaceutical composition of the present invention further comprises an additional therapeutic agent.

[0301] In some embodiments, the additional therapeutic agent is an anticancer drug.

[0302] In some embodiments, additional anticancer agents are selected from antimetabolites, topoisomerase I and II inhibitors, alkylating agents, microtubule inhibitors, antiandrogens, GNRh modulators, or mixtures thereof.

[0303] In some embodiments, the additional therapeutic agent is a chemotherapy agent.

[0304] In this specification, “chemotherapeutic agent” means a chemical compound useful for treating cancer. Examples include, but are not limited to, gemcitabine, irinotecan, doxorubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytotoxin, TAXOL, methotrexate, cisplatin, melphalan, vinblastine, and carboplatin.

[0305] In some embodiments, the second chemotherapeutic agent is selected from the group consisting of tamoxifen, raloxifen, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minosine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide etoposide, gemcitabine, epothiron, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

[0306] IV. Kit In another embodiment, the present invention provides a kit comprising a combination of therapeutic agents provided herein and instructions for using the combination of therapeutic agents. The kit may also include a container and optionally one or more vials, test tubes, flasks, bottles, or syringes. Other forms of the kit may be obvious to those skilled in the art and are within the scope of the present invention.

[0307] V. Medical Use In another embodiment, the present invention provides a method for treating a disease condition in a subject requiring treatment of the disease condition, the method comprising administering to the subject a combination of a therapeutic agent or pharmaceutical composition comprising a therapeutically effective amount of the compound of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[0308] In addition to the compositions and constructs described above, the present invention also provides numerous uses of combinations of the present invention. Uses of combinations of the present invention include the killing or inhibition of growth, proliferation or replication of tumor or cancer cells, treatment of cancer, treatment of precancerous conditions, prevention of proliferation by division of tumor or cancer cells, prevention of cancer, and prevention of proliferation by division of cells expressing autoimmune antibodies. These uses involve administering an effective amount of the compounds of the present invention to mammals or animals such as humans that require it.

[0309] The combinations of the present invention are useful for treating diseases such as cancer in subjects such as humans. The present invention provides combinations and uses for treating tumors by providing the compositions in a pharmaceutically acceptable manner in pharmaceutically effective amounts for subjects.

[0310] In this specification, “cancer” means a pathological condition in humans characterized by uncontrolled cell proliferation. Examples include, but are not limited to, carcinoma, lymphoma, blastoma, and leukemia. More specific examples of cancer include, but are not limited to, lung (small cell and non-small cell), breast, prostate, carcinoid, bladder, stomach, pancreas, liver (hepatocyte), hepatoblastoma, colorectal, head and neck squamous cell carcinoma, esophagus, ovary, cervix, endometrium, mesothelioma, melanoma, sarcoma, osteosarcoma, liposarcoma, thyroid, desmoid, chronic myeloid leukemia (AML), and chronic myeloid leukemia (CML).

[0311] In this specification, “inhibit,” “treat,” or “treat” means reduction, therapeutic treatment, and preventive or preventive treatment, the objective being to reduce or prevent a targeted pathological disorder or condition. For example, after administration of a compound of the present invention, a cancer patient may experience a reduction in tumor size. “Treatment” or “treat” includes (1) inhibiting a disease in a subject experiencing or exhibiting the pathology or symptoms of the disease, (2) improving the disease in a subject experiencing or exhibiting the pathology or symptoms of the disease, and / or (3) resulting in any measurable reduction of the disease in a subject experiencing or exhibiting the pathology or symptoms of the disease. To the extent that a compound of the present invention can prevent the growth of cancer cells and / or kill them, it may be cell proliferation inhibitory and / or cytotoxic.

[0312] In this specification, “therapeutic dose” means the amount of the compound provided herein that is effective in “treating” a disorder in a subject or mammal. In the case of cancer, a therapeutic dose of the drug may reduce the number of cancer cells, reduce tumor size, inhibit the invasion of cancer cells into peripheral organs, inhibit tumor metastasis, inhibit tumor growth to some extent, and / or alleviate to some extent one or more symptoms associated with cancer.

[0313] Administering "in combination" with one or more further therapeutic agents includes simultaneous (concurrent) and sequential administration in any order. As used herein, the term "pharmaceutical combination" refers to the product obtained by mixing or combining active ingredients, and includes both fixed and unfixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, e.g., the compound of formula (1) and the co-agent are both administered to the patient simultaneously in the form of a single entity or dosage. The term "unfixed combination" means that the active ingredients, e.g., the compound of formula (1) and the co-agent are both administered to the patient as separate entities simultaneously, concurrently, or sequentially without any specific time limit, and such administration provides the patient with a therapeutically effective level of the active ingredient in their body. The latter also applies to cocktail therapies, e.g., the administration of three or more active ingredients.

[0314] In some embodiments, the disease condition is a tumor or cancer. In some embodiments, the cancer or tumor is selected from the stomach, colon, rectum, liver, pancreas, lung, breast, cervix, uterine body, ovary, testis, bladder, kidney, brain / CNS, head and neck, throat, Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer, acute lymphoblastic leukemia, acute myeloid leukemia, Ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma, trichotoid cell leukemia, oral cavity / pharynx, esophagus, larynx, kidney cancer, or lymphoma.

[0315] In some embodiments, the disease state includes abnormal cell proliferation, such as precancerous lesions.

[0316] The present invention is particularly useful in animals for the treatment of cancer and for inhibiting the division and proliferation of tumor cells or cancer cells. Cancer or precancerous conditions include any disease or disorder characterized by tumors, metastases, or uncontrolled cell growth, and can be treated or prevented by administration of the drug-ligand complex of the present invention. The compound delivers an activated moiety to tumor cells or cancer cells. In some embodiments, the target moiety specifically binds to or associates with cancer cells or tumor cell-associated antigens. Due to its proximity to the ligand, after internal migration, the activated moiety can be taken up into tumor cells or cancer cells, for example, through receptor-mediated endocytosis. The antigen may be an extracellular matrix protein that can adhere to or associate with tumor cells or cancer cells. Once inside the cell, the linker is hydrolytically or enzymatically cleaved by tumor cell or cancer cell-associated proteases, thereby releasing the activated moiety. The released activated moiety then diffuses freely, inducing or enhancing the immune activity of immune cells or tumor cells. In alternative embodiments, the activated moiety is cleaved from the compound's tumor microenvironment, followed by the drug's penetration into the cells.

[0317] Representative examples of precancerous conditions that can be targeted by the compounds of the present invention include metaplasia, hyperplasia, dysplasia, colorectal polyps, actinic keratosis, actinic cheilitis, human papillomavirus, vitiligo, lichen planus, and Bowen's disease.

[0318] Representative examples of cancers or tumors that can be targeted by the compounds of the present invention include lung cancer, colorectal cancer, prostate cancer, lymphoma, melanoma, breast cancer, ovarian cancer, testicular cancer, CNS cancer, renal cancer, kidney cancer, pancreatic cancer, gastric cancer, oral cancer, nasal cavity cancer, cervical cancer, and leukemia. It will be readily apparent to those skilled in the art that the specific target moiety used in the compound can be selected to target the activating portion in the tumor tissue treated with the drug (i.e., a target agent specific to the tumor-specific antigen is selected). Examples of such target moieties are well known in the art and include anti-Her2 for the treatment of breast cancer, anti-CD20 for the treatment of lymphoma, anti-PSMA for the treatment of prostate cancer, and anti-CD30 for the treatment of lymphoma, including non-Hodgkin lymphoma.

[0319] In some embodiments, the abnormal proliferation is that of cancer cells.

[0320] In some embodiments, the cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

[0321] In some embodiments, the present invention provides compounds for use in killing cells. The compounds are administered to cells in an amount sufficient to kill them. In exemplary embodiments, the compounds are administered to an object having cells. In further exemplary embodiments, the administration serves to delay or halt the growth of a tumor containing cells (for example, the cells may be tumor cells). For administrations to delay growth, the rate of cell growth should be at least 10% lower than the rate of growth before administration. Preferably, the rate of growth is delayed by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or completely stopped.

[0322] In addition, the present invention provides compounds or pharmaceutical compositions for use as pharmaceuticals. The present invention also provides compounds or pharmaceutical compositions for killing tumors or cancer cells, inhibiting or slowing the growth of tumors or cancer cells, or for treating diseases involving TLR7 and / or TLR8.

[0323] Effective dose Suitable pharmaceutical compositions for use in the present invention include compositions in which the active ingredient is contained in a therapeutically effective amount, i.e., an amount effective in achieving its intended purpose. The actual effective amount for a particular use will depend, among other things, on the condition being treated. Determining the effective amount is well within the capabilities of those skilled in the art, especially considering the detailed disclosure herein.

[0324] For any compound described herein, the therapeutically effective dose can first be determined from a cell culture assay. The target plasma concentration would be the concentration of the active compound(s) capable of inhibiting cell growth or division. In a preferred embodiment, cell activity is inhibited by at least 25%. In the present invention, a target plasma concentration of the active compound(s) capable of inducing inhibition of cell activity of at least about 30%, 50%, 75%, or even 90%, or higher, is preferred. The degree of inhibition of cell activity (%) in the patient can be monitored to assess the appropriateness of the plasma drug concentration achieved, and the dose can be adjusted upward or downward to achieve the desired degree of inhibition (%).

[0325] As is well known in this field, therapeutically effective doses for use in humans can also be determined from animal models. For example, human doses can be formulated to achieve circulating concentrations found to be effective in animals. Human doses can be adjusted, as described above, by monitoring cell inhibition and adjusting the dose upward or downward.

[0326] The therapeutically effective dose can also be determined from human data for compounds known to exhibit similar pharmacological activity. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound compared to known compounds.

[0327] Adjusting the dose to achieve maximum efficacy in humans based on the above method and other methods well known in the art is well within the capabilities of those skilled in the art.

[0328] In the case of local administration, the systemic circulating concentration of the administered compound is not particularly important. In such cases, the compound is administered to achieve a concentration in a local area that is effective in achieving the intended result.

[0329] The therapeutic doses of specific antibodies described herein are also immunotherapeutic agents and may be administered in single mixed form or separately as components of a combination. In some embodiments, the therapeutic dose is the amount that eliminates or reduces the patient's tumor burden or inhibits or reduces the proliferation of metastatic cells. The dose will depend on many parameters, including the nature of the tumor, the patient's medical history, the patient's condition, the possibility of concomitant use of other oncolytic agents, and the method of administration. The method of administration includes injection (e.g., parenteral, subcutaneous, intravenous, intraperitoneal, etc.), for which the antibody is provided in water, saline solution, Ringer's solution, glucose solution, 5% human lymphatic albumin, fixative oil, ethyl oleate, or a non-toxic, pharmaceutically acceptable carrier such as liposomes. Typical doses may range from about 0.01 to about 20 mg / kg, for example, from about 0.1 to about 10 mg / kg. Other effective methods of administration and doses may be determined by routine experimentation and are within the scope of the present invention.

[0330] The therapeutically effective dose of the administered drug (disclosed herein) may vary depending on the desired effect and the target being treated when used in combination therapy. For example, a target may receive at least 1 mg / kg of each antibody drug intravenously (e.g., 1 mg / kg to 20 mg / kg, 2.5 mg / kg to 10 mg / kg, or 3.75 mg / kg to 5 mg / kg). The dose may be administered in divided doses (e.g., two, three, or four divided doses per day) or as a single dose.

[0331] In a method of combined administration, the drug may be administered simultaneously with the antibody used in the present invention, or the drug may be administered before or after the administration of the antibody used in the present invention.

[0332] Regarding other modes of administration, the dosage and interval can be individually adjusted to provide plasma levels of the administered compound effective for the specific clinical indication being treated. For example, in one embodiment, the compound according to the present invention may be administered at relatively high concentrations multiple times per day. Alternatively, it may be more preferable to administer the compound according to the present invention at the minimum effective concentration and to use a less frequent administration regimen. This would provide a treatment regimen tailored to the severity of the individual's disease.

[0333] By utilizing the teachings provided herein, it is possible to plan effective therapeutic regimens that do not cause substantial toxicity but are fully effective in addressing the clinical symptoms exhibited by specific patients. This plan should necessarily involve careful selection of active compounds by considering factors such as the potency of the compound, relative bioavailability, patient weight, presence and severity of adverse side effects, preferred mode of administration, and toxicity profile of the selected drug.

[0334] Preferred embodiments of the present invention have been shown and described herein, but it will be apparent to those skilled in the art that such embodiments are provided only as examples. Many variations, alterations, and substitutions will be conceivable to those skilled in the art without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be adopted in the practice of the present invention. The following claims define the scope of the present invention, and the methods and structures contained within these claims, and their equivalents, are intended to be encompassed thereby. [Examples]

[0335] The present invention will be further illustrated by the following examples illustrating the preparation of the compounds of the present invention, but will not be limited thereto.

[0336] Example 1 Evaluation of the inoculated tumor and tumor growth

[0337] Mice: Female 6-week-old BALB / c and C3H / HeN (C3H) mice were purchased from Japan SLC (Hamamatsu, Japan). All procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Tokyo Medical and Dental University. SCCVII (C3H-derived, 3 × 10⁻¹⁰) 5 ) or Colon26 (BALB / c origin, 5×10 5 Parental cells of ) were subcutaneously injected into the shaved right flank of syngeneic mice (sc), and tumor volume was assessed. In experiments investigating the effect of anti-PDL1(MIH5) mAb with TLRL, 200 μg of anti-PDL1 mAb or a 200 μg mixture of anti-PDL1 mAb was intraperitoneally injected with TLRL or control rat IgG three times within one week after tumor inoculation. Tumor volume was measured along three orthogonal axes (x, y, z) and calculated as tumor volume = (xyz) / 2. If a mouse lost more than 20% of its body weight or was so ill that it could not take in sufficient food or water, it was excluded from the study and euthanized. (Figures 1 and 2)

[0338] Example 2 Enrichment of human dendritic cells (DCs) from PBMCs

[0339] Human PBMCs were prepared from buffy coats obtained from healthy volunteers by Ficoll centrifugation. Dendritic cells were enriched using negative depletion with magnetic beads (Miltenyi Biotec) containing a mixture of anti-CD3, CD19, CD20, CD14, and CD16 antibodies from human PBMCs. The enriched DCs were stained with goat anti-mouse FITC (series), HLA-DR-APCCy7, CD123-BV421, and CD11C-APC. The stained cells were analyzed using BDLSR Fortessa (BD Biosciences). Anti-CD3, CD4, CD11C, CD19, CD14, CD16, and CD123 monoclonal antibodies were purchased from BD Biosciences, CA or Biolgend, San Diego, CA.

[0340] Stimulation and cytokine expression of concentrated human DCs

[0341] 1-2 x 10 5 Concentrated DCs were seeded in 100 μL of culture medium in a 96-well plate, and 100 μL of diluted stimulant containing TLRL was added to the plate. The cells were incubated at 37°C for 20–22 hours. The supernatant was collected and analyzed for human IFN-α, IL-12 (p70), and TNF-α by ELISA (Mabtech AB, Sweden).

[0342] Figures 3A–3G show the analysis of cytokine production by enriching human dendritic cells (DCs) from three healthy donors. The enriched human DCs were seeded in 96-well plates and directly cultured in a 37°C incubator for 20–22 hours at different concentrations, either untreated (in medium) or treated with TLRL. The supernatant was collected, and human IFN-α, IL-12 (p70), and TNF-α were analyzed by ELISA. Data were obtained as the mean ± standard deviation of the triple culture. Three independent experiments were performed from three healthy donors (Donor 1: Figure 3A, Donor 2: Figures 3B–D, Donor 3: Figures 3E–G).

[0343] Example 3 Detection of systemic immune activation in IFN-induced gene expression in mouse PBMCs using TLRL

[0344] Female Balb / c mice, 6-8 weeks old, purchased from Vital River, were intravenously injected with TLRL at the indicated time points. Blood samples were taken from the mice, and IFN-induced genes were tested by qPCR. IFN-induced genes were determined for each selective expression time, and separate experiments were performed with various doses of TLRL. Quantitative real-time PCR was performed, and gene expression data were standardized against the geometric mean of two housekeeping genes (actin). Mouse actin F:CATTGCTGACAGGATGCAGAAGG (Sequence ID: 1), Mouse actin R:TGCTGGAAGGTGGACAGTGAGG (Sequence ID: 2), Mouse Inf-b: F: CTCCAGCACTGGGTGGAATG (Sequence ID: 3), Mouse Inf-b R: AGTGGAGAGCAGTTGAGGAC (Sequence ID: 4), Mouse Mx2: F; GTGGCAGAGGGAGAATGTCG (Sequence ID: 5), Mouse Mx2 R:TAAAACAGCATAACCTTTTGCGA (Sequence ID: 6), Mouse Ifn-a: F: CCTGAGAGAGAAGAAACACAGCC (Sequence ID: 7), Mouse Ifn-a R: GGCTCTCCAGACTTCTGCTCTG (Sequence ID: 8), Mouse ISG15: F: CAGCAATGGCCTGGGACCTAA (Sequence ID: 9), Mouse ISG15R: GGAAAGCCGGCACACCAATC (Sequence ID: 10).

[0345] Figures 4A–4C show the expression of IFN-induced genes in mouse PBMCs after TLRL injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at various time points, and the relative expression of IFN-induced genes was determined by quantitative RT-PCR. The MX2 gene was detected over a 5-hour time course after TLRL injection (Figure 4A), and the MX2 and ISG15 genes were measured at 2 hours post-injection at various doses of TLRL (Figures 4B and 4C). The values ​​show the mRNA expression of IFN-induced genes relative to the housekeeping gene actin. The bar graphs represent data from three individual animals. ** P<0.01, *** P < 0.001.

[0346] statistical analysis

[0347] The significance of all comparisons was calculated by estimating the unequal variances between the mock and sample groups and using a Student's two-tailed t-test, with results considered significant if p < 0.05. Correlations between parameters were evaluated using Spearman's rank correlation test, with a p value < 0.05 considered statistically significant.

[0348] (Note) (Note 1) (i) an effective amount of PD-L / PD-1 axis antagonist, and (ii) an effective amount of immunotherapeutic capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof. A combination that includes this.

[0349] (Note 2) The PD-L / PD-1 axis antagonist is selected from the group consisting of PD-1 binding antagonists, PD-L1 binding antagonists, and PD-L2 binding antagonists, in the combination described in Appendix 1.

[0350] (Note 3) The PD-L / PD-1 axis antagonist is a PD-1 binding antagonist, as described in Appendix 2.

[0351] (Note 4) The PD-1 binding antagonist is the combination described in Appendix 3, which inhibits the binding of PD-1 to its ligand-binding partner.

[0352] (Note 5) The PD-1 binding antagonist is the combination described in Appendix 3, which inhibits the binding of PD-1 to PD-L1.

[0353] (Note 6) The PD-1 binding antagonist is the combination described in Appendix 3, which inhibits the binding of PD-1 to PD-L2.

[0354] (Note 7) The PD-1 binding antagonist is the combination described in Appendix 3, which inhibits the binding of PD-1 to both PD-L1 and PD-L2.

[0355] (Note 8) The PD-1 binding antagonist is an antibody, as described in Appendix 3.

[0356] (Note 9) The PD-1 binding antagonist is MDX-1106, Merck 3745, CT-011, AMP-224, or AMP-514, as per the combinations listed in Appendix 8.

[0357] (Note 10) The PD-L / PD-1 axis antagonist is a PD-L1 binding antagonist, as described in Appendix 2.

[0358] (Note 11) The PD-L1 binding antagonist is a combination of agents described in Appendix 10 that inhibits the binding of PD-L1 to PD-1.

[0359] (Note 12) The PD-L1 binding antagonist is the combination described in Appendix 10, which inhibits the binding of PD-L1 to B7-1.

[0360] (Note 13) The PD-L1 binding antagonist is the combination described in Appendix 10, which inhibits the binding of PD-L1 to both PD-1 and B7-1.

[0361] (Note 14) The PD-L1 binding antagonist is an antibody, as described in Appendix 10.

[0362] (Note 15) The PD-L1 binding antagonist is selected from the group consisting of YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C, in the combination described in Appendix 14.

[0363] (Note 16) The PD-L / PD-1 axis antagonist is a PD-L2 binding antagonist, as described in Appendix 2.

[0364] (Note 17) The PD-L2 binding antagonist is an antibody, as described in Appendix 16.

[0365] (Note 18) The PD-L2 binding antagonist is immunoadhesin, as described in Appendix 16.

[0366] (Note 19) The immunotherapy agent is one compound of formula (I) to (XIXb), or a pharmaceutically acceptable salt or solvate thereof, as described in any one of the combinations listed in Appendix 1 to 18.

[0367] (Note 20) The immunotherapy agent has the structure of formula (I), [ka] In the formula, dashed lines indicate joining or absence of joining. X is S or -NR1, and R1 is -W0-W1-W2-W3-W4, W0 is a bond, alkyl, alkenyl, alkynyl, alkoxy, or -alkyl-S-alkyl-- W1 is a bond, --O--, or --NR2--, where R2 is hydrogen, alkyl, or alkenyl. W2 is a bond, --O--, --C(O)--, --C(S)--, or -S(O)2--, W3 is a bond, --NR3--, where R3 is hydrogen, alkyl, or alkenyl. W4 is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl, or heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --alkyl-C (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --S-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH are optionally substituted with one or more substituents selected from the group consisting of (O)-R4, --alkyl-C(O)-O-R4, --C(O)-O-R4, --C(O)-O-R4, --S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, --NO2, and --SH, where R4 is independently hydrogen, alkyl, alkenyl, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. Z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halogen, cyano, nitro, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --OC(O)-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl. R is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, --NH2, nitro, --alkyl-hydroxyl, --alkyl-aryl, --alkyl-heteroaryl, --alkyl-heterocyclyl, --O-R4, --O-alkyl-R4, --alkyl-O-R4, --C(O)-R4, --C(O)-NH-R4, --C(O)-NR4R4, --alkyl-C(O)-R4, --alkyl- R4 is optionally substituted with one or more substituents selected from the group consisting of C(O)-O-R4, --C(O)-O-R4, --OC(O)-R4, --S-R4, --C(O)-S-R4, --SC(O)-R4, --S(O)2-R4, --NH-S(O)2-R4, --alkyl-S-R4, --alkyl-S(O)2-R4, --NHR4, --NR4R4, --NH-alkyl-R4, halogen, --CN, and -SH, where R4 is independently hydrogen, alkyl, alkenyl, alkoxy, --alkyl-hydroxyl, aryl, heteroaryl, heterocyclyl, or haloalkyl. n is 0, 1, 2, 3, or 4. Y is -NR6R7, -CR6R7R8, or -alkyl-NH2, each of which can be optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, --NH2, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl. In the formula, R6, R7, and R8 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl. X and Z can together optionally form a (5-9) member ring. A combination listed in any one of the appendices 1 through 18.

[0368] (Note 21) The aforementioned immunotherapy agents, 2-propylthiazolo[4,5-c]quinoline-4-amine, 1-(2-methylpropyl)-1H-imidazo[4,5-c]quinoline-4-amine, 4-amino-2-(ethoxymethyl)-a,a-dimethyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-(4-amino-2-ethylaminomethylimidazo-[4,5-c]quinoline-1-yl)-2-methylpropan-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinoline-1-yl)butyl-] Methanesulfonamide, 4-amino-2-ethoxymethyl-aa-dimethyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1-ethanol, 4-amino-aa-dimethyl-2-methoxyethyl-1H-imidazo[4,5-c]quinoline-1-ethanol, 1-{2-[3-(benzyloxy)propoxy]ethyl}2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-4-amine, N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1 -yl)butyl]-n'-butylurea, N1-[2-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1-yl)ethyl]-2-amino-4-methylpentanamide, N-(2-{2-[4-amino-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinoline-1-yl]ethoxy}ethyl)-n'-phenylurea, 1-(2-amino-2-methylpropyl)-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-4-amine, 1-{4-[(3,5-dichloroph [phenyl)sulfonyl]butyl}-2-ethyl-1H-imidazo[4,5-c]quinoline-4-amine, N-(2-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]ethoxy}ethyl)-n'-cyclohexylurea, N-{3-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]propyl}-n'-(3-cyanophenyl)thiourea, N-[3-(4-amino-2-butyl-1H-imidazo[4,5-c]quinoline-1-yl)-2,2-dimethylpropyl]benzamide, 2-butyl-1-[3-(methylsulfonyl)propyl]-1H-imidazo[4,5-c]quinoline-4-amine, N-{2-[4-amino-2-(ethoxymethyl)-1H-imidazo[4,5-c]quinoline-1-yl]-1,1-dimethylethyl}-2-ethoxyacetamide, 1-[4-amino-2-ethoxymethyl-7-(pyridine-4-yl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, 1-[4-amino-2-(ethoxymethyl)- 7-(pyridine-3-yl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, N-{3-[4-amino-1-(2-hydroxy-2-methylpropyl)-2-(methoxyethyl)-1H-imidazo[4,5-c]quinoline-7-yl]phenyl}methanesulfonamide, 1-[4-amino-7-(5-hydroxymethylpyridine-3-yl)-2-(2-methoxyethyl)-1H-imidazo[4,5-c]quinoline-1-yl]-2-methylpropane-2-ol, 3-[4-amino-2- (Ethoxymethyl)-7-(pyridine-3-yl)-1H-imidazo[4,5-c]quinoline-1-yl]propane-1,2-diol, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinoline-1-yl)-1,1-dimethylethyl]-3-propylurea, 1-[2-(4-amino-2-ethoxymethyl-1H-imidazo[4,5-c]quinoline-1-yl)-1,1-dimethylethyl]-3-cyclopentylurea, 1-[(2,2-dimethyl-1,3-dioxolan-4-yl)methyl]-2-( Ethoxymethyl)-7-(4-hydroxymethylphenyl)-1H-imidazo[4,5-c]quinoline-4-amine, 4-[4-amino-2-ethoxymethyl-1-(2-hydroxy-2-methylpropyl)-1H-imidazo[4,5-c]quinoline-7-yl]-N-methoxy-N-methylbenzamide, 2-ethoxymethyl-N1-isopropyl-6,7,8,9-tetrahydro-1H-imidazo[4,5-c]quinoline-1,4-diamine, 1-[4-amino-2-ethyl-7-(pyridine-4-yl)-1H-imidazo[4,A compound selected from the group consisting of [5-c]quinoline-1-yl]-2-methylpropane-2-ol, N-[4-(4-amino-2-ethyl-1H-imidazo[4,5-c]quinoline-1-yl)butyl]methanesulfonamide, and N-[4-(4-amino-2-butyl-1H-imidazo[4,5-c][1,5]naphthyridine-1-yl)butyl]-n'-cyclohexylurea, The combinations listed in Appendix 20.

[0369] (Note 22) The aforementioned immunotherapy agent has the structure of formula (II), [ka] In the formula, V is -NR6R7, where R6 and R7 are independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, --alkyl-hydroxyl, --alkyl-C(O)-O-R9, --alkyl-C(O)-R9, or --alkyl-OC(O)-R9, where R9 is hydrogen, alkyl, alkenyl, halogen, or haloalkyl. R 10 and R 11 R5 is independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl, or cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, halogen, --N(R5)2, --alkoxy-alkyl, --alkoxy-alkenyl, --C(O)-alkyl, --C(O)-O-alkyl, --C(O)-N(R5)2, aryl, heteroaryl, --CO-aryl, and --CO-heteroaryl, where each R5 is independently hydrogen, alkyl, haloalkyl, --alkyl-aryl, or --alkyl-heteroaryl. A combination listed in any one of the appendices 1 through 18.

[0370] (Note 23) A combination of any one of the appendices 1 to 22, further comprising an effective amount of additional therapeutic agent.

[0371] (Note 24) The aforementioned additional therapeutic agents are anticancer drugs, in the combinations described in Appendix 23.

[0372] (Note 25) The combination described in Appendix 24, wherein the anticancer agent is an antimetabolite, a topoisomerase I and II inhibitor, an alkylating agent, a microtubule inhibitor, an antiandrogen, a GNRh modulator, or a mixture thereof.

[0373] (Note 26) The aforementioned additional therapeutic agents are chemotherapeutic agents selected from the group consisting of tamoxifen, raloxifene, anastrozole, exemestane, letrozole, imatanib, paclitaxel, cyclophosphamide, lovastatin, minosine, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide, etoposide, gemcitabine, epothiron, vinorelbine, camptothecin, daunorubicin, actinomycin D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin, as described in Appendix 23.

[0374] (Note 27) The amount of the aforementioned immunotherapy agent is (1) Inducing IFN-α in concentrated human blood dendritic cells, (2) Inducing TNF-α in concentrated human blood dendritic cells, and / or (3) Inducing IL-12-α in concentrated human blood dendritic cells, A combination of any one of the following appendices 1 to 26, which is an amount that can achieve the desired result.

[0375] (Note 28) A method for treating a disease condition in a subject, comprising administering a combination of any one of the items described in Appendix 1 to 27 to the subject requiring treatment of the disease condition.

[0376] (Note 29) The aforementioned disease state is a tumor, as described in Appendix 28.

[0377] (Note 30) The disease state described above is the method described in Appendix 28, including abnormal cell proliferation.

[0378] (Note 31) The abnormal cell proliferation described above includes precancerous lesions, as described in Appendix 30.

[0379] (Note 32) The abnormal cell proliferation described above is that of cancer cells, as described in Appendix 30.

[0380] (Note 33) The cancer is selected from the group consisting of breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular carcinoma, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma, as described in Appendix 31.

[0381] (Note 34) The method according to any one of the appendices 28 to 33, comprising administering an oral formulation containing the immunotherapy agent to the subject twice a week in doses including approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or all values ​​between 0.01 mg / kg and approximately 0.02 mg / kg.

[0382] (Note 35) The method according to any one of the appendices 28 to 33, comprising administering an oral formulation containing the immunotherapy agent to the subject twice a week at doses of approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, or 0.01 mg / kg or less.

[0383] (Note 36) The method according to any one of the appendices 28 to 33, comprising administering to the subject weekly an intravenous preparation containing the immunotherapy agent in doses including all values ​​between approximately 0.0005 mg / kg, 0.0006 mg / kg, 0.0007 mg / kg, 0.0008 mg / kg, 0.0009 mg / kg, 0.001 mg / kg, 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or between 0.006 mg / kg and approximately 0.015 mg / kg.

[0384] (Note 37) The method according to any one of the appendices 28 to 33, comprising administering an intravenous preparation containing the immunotherapy agent to the subject weekly at a dose of approximately 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, or less than or equal to 0.006 mg / kg and up to approximately 0.01 mg / kg.

[0385] (Note 38) The immunotherapy agent in the subject has a local concentration between approximately 0.005 μg / ml and approximately 12 μg / ml, according to any one of the methods described in Appendix 28 to 37.

[0386] (Note 39) The immunotherapy agent in the subject has a local concentration between approximately 0.05 μg / ml, 0.1 μg / ml, 0.15 μg / ml, 0.2 μg / ml, 0.3 μg / ml, or approximately 0.5 μg / ml, according to any one of the methods described in Appendix 28 to 38.

[0387] (Note 40) A kit containing any combination listed in one of the appendices 1 through 27.

Claims

[Claim 1] (i) A pharmaceutical composition comprising a mixture of 1) an effective amount of anti-PD-1 antibody and 2) one or more pharmaceutically acceptable carriers, excipients, or diluents, and (ii) A pharmaceutical composition comprising a mixture of 1) an effective amount of an immunotherapy agent capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells, or a combination thereof, and 2) one or more pharmaceutically acceptable carriers, excipients, or diluents. Includes, The immunotherapy agent is 4-amino-2-(ethoxymethyl)-a,a-dimethyl-1H-imidazo[4,5-c]quinoline-1-ethanol (reximod), The anti-PD-1 antibody in (i) and the immunotherapy agent in (ii) are not linked to each other. Used in the treatment of a disease condition in a person who requires treatment for that disease condition, The aforementioned disease state is the proliferation of tumor or cancer cells. combination.