Blockade of CD8 expression and chimeric antigen receptors for immunotherapy of T-cell and NK-cell malignancies

Abstract

The present disclosure provides compositions comprising an anti-CD8 chimeric activating receptor (CAR) and an anti-CD8 protein expression blocking agent, as well as methods of using such compositions to treat cancer. The present disclosure provides cells with downregulated CD8 expression to reduce fratricide. CD8 expression can be downregulated using an anti-CD8 antibody (e.g., a single-chain variable fragment antibody or a single-domain antibody) linked to an intracellular localization signal. Retention of CD8 in the endoplasmic reticulum may allow T cells expressing anti-CD8 CARs to proliferate without compromising their cytotoxic activity against CD8-positive T cells. The T cells described herein may be useful for treating T and / or NK cell-related diseases (e.g., T cell malignancies or NK cell malignancies) in which cancer cells express CD8.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 438,776, filed January 12, 2023, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] Background of the Disclosure Chimeric antigen receptors (CARs) are artificial hybrid proteins that can redirect immune cells and activate them upon engagement with specifically recognized target molecules. CARs have been widely used to confer the ability to kill cancer cells to immune cells, such as T lymphocytes or natural killer cells. CARs are typically composed of an antibody single-chain variable region (scFv) linked to a signaling domain via a transmembrane domain. When the scFv binds to the corresponding antigen expressed on the surface of a target cell, signal transduction is triggered, initiating the target cell killing process. Clinical trials using CAR-expressing T lymphocytes targeting CD19 and other B cell-associated antigens have shown remarkable responses in patients with B cell or plasma cell malignancies, such as acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), and multiple myeloma.

[0003]

[0003] Compared to the progress made with CAR-T cell therapy in B cell malignancies, the development of similar technologies for targeting T cell and NK cell malignancies has lagged. Cells in these forms of cancer lack expression of CD19, CD22, BCMA, and other common CAR targets. CARs targeting CD5 or CD7 molecules expressed in T cell leukemia and lymphoma have been reported. However, in many T cell or NK cell malignancies, CD5 and CD7 are absent, expressed on a subset of tumor cells, and / or expressed at low levels. Novel therapies for T cell malignancies are needed, but progress to date has been slow.

[0004]

[0004] In summary, there is a great need for new treatment options for patients with T-cell and NK-cell malignancies. Summary of the Invention [Means for solving the problem]

[0005] Summary of the Disclosure

[0005] There is herein recognized a need for improved treatment options for patients with T-cell and NK-cell malignancies. In one aspect, the present disclosure provides a recombinant nucleic acid molecule encoding an anti-CD8 CAR, wherein the anti-CD8 CAR comprises an antigen-binding domain that binds to CD8, a transmembrane domain, and a signaling domain.

[0006] In some embodiments, the antigen-binding domain is a single-chain variable fragment (scFv) or a single-domain antibody. In some embodiments, the CD8-binding domain comprises a heavy chain variable region (VH) comprising heavy chain complementarity-determining region 1 (HC CDR1), heavy chain complementarity-determining region 2 (HC CDR2), and heavy chain complementarity-determining region 3 (HC CDR3), and a light chain variable region (VL) comprising light chain complementarity-determining region 1 (LC CDR1), light chain complementarity-determining region 2 (LC CDR2), and light chain complementarity-determining region 3 (LC CDR3), wherein HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1 to 6, respectively; or (ii) SEQ ID NOs: 7 to 12, respectively.

[0007]

[0007] In some embodiments, the CD8 binding domain comprises: a) (i) a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two, or three alterations in the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13, but not more than 30, 20, or 10 alterations, or (iii) an amino acid sequence having 95 to 99% identity to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and b) (i) a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; (ii) an amino acid sequence having at least one, two, or three alterations in the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14, but not more than 30, 20, or 10 alterations, or (iii) an amino acid sequence having 95 to 99% identity to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14.

[0008]

[0008] In some embodiments, the CD8 binding domain comprises: (i) the amino acid sequence set forth in SEQ ID NO: 25; (ii) an amino acid sequence having at least one, two or three modifications of the amino acid sequence set forth in SEQ ID NO: 25, but not more than 30, 20 or 10 modifications, or (iii) an amino acid sequence having 95 to 99% identity to the amino acid sequence set forth in SEQ ID NO: 25.

[0009] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of CD8α, CD8β, 4-1BB, CD28, CD34, CD4, FcεRIγ, CD16, OX40, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, CD32, CD64, VEGFR2, FAS, or FGFR2B. In some embodiments, the transmembrane domain comprises the sequence of SEQ ID NO: 37, or the transmembrane domain comprises an amino acid sequence having at least one, two, or three but not more than 20, 10, or 5 of the following modifications of the amino acid sequence of SEQ ID NO: 37, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 37.

[0010] In some embodiments, the CD8 binding domain is linked to the transmembrane domain by a hinge region. In some embodiments, the intracellular signaling domain comprises a sequence encoding a costimulatory domain. In some embodiments, the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and / or SEQ ID NO: 41. In some embodiments, the intracellular signaling domain comprises an amino acid sequence having at least one, two, or three, but not more than 20, 10, or 5, modifications of the amino acid sequence of SEQ ID NO: 39 and / or 41, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 39 and / or 41.

[0011] In some embodiments, the present disclosure provides a vector comprising a nucleic acid molecule encoding a CAR, such as an anti-CD8 CAR disclosed herein. In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector. In some embodiments, the vector further comprises a promoter, optionally selected from the group consisting of an EF-1 promoter, an MSCV promoter, an SC40 promoter, a CMV promoter, or a PGK promoter.

[0012] In some embodiments, the present disclosure provides a method of producing cells, the method comprising transducing T cells with a vector disclosed herein. In some embodiments, the present disclosure provides a method of providing anti-cancer immunity in a mammal, the method comprising administering to the mammal an effective amount of cells expressing a CAR molecule, e.g., an anti-CD8 CAR molecule disclosed herein. In some embodiments, the immune cells are autologous T cells. In some embodiments, the immune cells are allogeneic T cells.

[0013]

[0013] In one aspect, the present disclosure provides a recombinant nucleic acid molecule encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain linked to an intracellular localization domain, wherein the intracellular localization domain comprises a retention sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localization sequence.

[0014]

[0014] In some embodiments, the anti-CD8 binding domain is an scFv or a single-domain antibody. In some embodiments, the scFv comprises a CD8 binding domain comprising: (i) a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two, or three alterations but not more than 30, 20, or 10 alterations in the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; or (iii) an amino acid sequence having 95 to 99% identity to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and (iv) a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two, or three alterations but not more than 30, 20, or 10 alterations in the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14; or (vi) an amino acid sequence having 95 to 99% identity to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14.

[0015]

[0015] In some embodiments, the CD8 binding domain comprises: i) the amino acid sequence set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two, or three modifications of the amino acid sequence set forth in SEQ ID NO: 25, but not more than 30, 20, or 10 modifications; or iii) an amino acid sequence having 95 to 99% identity to the amino acid sequence set forth in SEQ ID NO: 25.

[0016] In some embodiments, the intracellular localization domain comprises one or more of a Golgi retention sequence, an ER retention sequence, and a proteosome localization sequence. In some embodiments, the intracellular localization domain comprises the amino acid sequence set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 65, 68, 74, or 75. In some embodiments, the intracellular localization domain comprises the amino acid sequence set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 66, or 67. In some embodiments, the intracellular localization domain comprises one or more of a Golgi retention sequence, an ER retention sequence, and a proteosome localization sequence. In some embodiments, the ER retention sequence comprises a KDEL sequence, and the CD8 blocking polypeptide further comprises a linker between the scFv and the intracellular localization domain. In some embodiments, the ER retention sequence comprises a KKXX sequence, where X represents any amino acid. In some embodiments, the Golgi retention sequence comprises YQRL, YGRL, or YKGL. In some embodiments, the proteosome localization sequence comprises a PEST.

[0017] In some embodiments, the present disclosure provides a vector comprising a nucleic acid molecule encoding a CD8 blocking polypeptide disclosed herein, e.g., CD8-PEBL. In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector, and optionally further comprises a promoter, wherein the promoter is optionally selected from the group consisting of an EF-1 promoter, an MSCV promoter, an SC40 promoter, a CMV promoter, or a PGK promoter. In some embodiments, the present disclosure provides a method of modifying a cell, the method comprising transducing or transfecting the cell with a vector disclosed herein.

[0018]

[0018] In one aspect, the present disclosure provides an engineered immune cell comprising: a nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localization sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 in the engineered immune cell.

[0019]

[0019] In one aspect, the present disclosure provides an engineered immune cell comprising: a nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR).

[0020]

[0020] In one aspect, the present disclosure provides an engineered immune cell comprising: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localization sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 in the engineered cell; and (ii) a second nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR), wherein, optionally, the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds to endogenous CD8 in the engineered immune cell.

[0021] In some embodiments, the anti-CD8 binding domain is an scFv or a single domain antibody. In some embodiments, the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK / T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.

[0022]

[0022] In some embodiments, the scFv of the CD8 blocking polypeptide and / or the scFv of the CAR comprises (i) a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two or three modifications of the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13, but having no more than 30, 20 or 10 modifications; or (iii) an amino acid sequence having 95 to 99% identity with the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and (iv) a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two or three modifications of the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14, but having no more than 30, 20 or 10 modifications, or (vi) an amino acid sequence having 95 to 99% identity with the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14. In some embodiments, the scFv of the CD8 blocking polypeptide and / or the scFv of the CAR comprises: i) the amino acid sequence set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the amino acid sequence set forth in SEQ ID NO: 25; or iii) an amino acid sequence having 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 25. In some embodiments, the CD8 blocking polypeptide scFv and / or CAR scFv comprises a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3), and a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3), wherein HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1-6, respectively; or (ii) SEQ ID NOs: 7-12, respectively.

[0023] In some embodiments, the ER retention sequence comprises an amino acid sequence selected as set forth in any of SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:66, or SEQ ID NO:67. In some embodiments, the ER retention sequence is selected from the group consisting of SEQ ID NO:65, SEQ ID NO:64, SEQ ID NO:74, SEQ ID NO:75. In some embodiments, the proteosome localization sequence comprises the amino acid sequence set forth in SEQ ID NO:68.

[0024] In some embodiments, the CD8 blocking polypeptide further comprises a transmembrane domain linked between the scFv and any of the ER retention sequence domains, including EKKMP, where the transmembrane domain is a transmembrane domain selected from the group consisting of CD8 alpha, CD8 beta, 4-1BB, CD28, CD34, CD4, FcεRI gamma, CD16, OX40, CD3 zeta, CD3 epsilon, CD3 gamma, CD35, TCR alpha, CD32, CD64, VEGFR2, FAS, and FGFR2B, e.g., the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 34. In some embodiments, the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 45-47 and 79-81. In some embodiments, the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 95-98. In some embodiments, the transmembrane domain is selected from the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137), and CD 1. In some embodiments, the transmembrane domain is a CD8α transmembrane domain.

[0025] In one aspect, the present disclosure provides engineered immune cells comprising a recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises an antigen binding domain that binds to CD8, a transmembrane domain, and a signaling domain, and the engineered immune cells have reduced expression of endogenous CD8. In some embodiments, the engineered immune cells have reduced expression of endogenous CD8. In some embodiments, endogenous CD8 in the engineered immune cells has been knocked out or knocked down. In some embodiments, endogenous CD8 in the engineered immune cells has been knocked out via zinc finger endonuclease, TALEN, or CRISPR-Cas9. In some embodiments, endogenous CD8 in the engineered immune cells has been knocked down via siRNA or shRNA. In some embodiments, endogenous CD8 in the engineered immune cells has been knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and a subcellular localization domain, wherein the subcellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localization sequence. In some embodiments, the anti-CD8 binding domain is an scFv or a single-domain antibody. In some embodiments, the engineered cells comprise a population of engineered cells, wherein the cytotoxic T cells in the population of engineered cells are at least about 50-fold more numerous than the cytotoxic T cells in an otherwise identical population of cells that express the anti-CD8 CAR without reduced endogenous CD8 expression after transduction and culture for a period of time. In some embodiments, the period of time is at least about 2 days, at least about 3 days, at least about 5 days, or more. In some embodiments, the engineered cells comprise a population of engineered cells, wherein the viability of cytotoxic T cells in the population of engineered cells is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, or at least about 500-fold greater than an otherwise identical population of cells that express the anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, or at least about 3-fold greater than otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1:2. In some embodiments, the target cells are CD8-positive cells, including, for example, MOLT-4 and / or CCRF-CEM. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, or at least about 4-fold greater than otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culture with the target cells. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1:4, or 1:8. In some embodiments, the target cells are CD8-positive cells, including, for example, MOLT-4 and / or CCRF-CEM. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, or at least about 5-fold higher compared to the proliferation of the engineered immune cells in the absence of target cells. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold higher compared to identical cells but with enforced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells is tested at an effector-target ratio of 1:1. In some embodiments, the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days after culturing the engineered immune cells in the presence or absence of target cells.In some embodiments, the target cells are CD8 positive cells, including, for example, MOLT-4 and / or CCRF-CEM.

[0026] In one aspect, the present disclosure provides a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, and a CD8 chimeric antigen receptor (CAR) comprising the anti-CD8 binding domain, wherein optionally the CD8 blocking polypeptide is retained intracellularly in the engineered cell and binds to endogenous CD8 in the engineered cell. In some embodiments, the anti-CD8 binding domain is an scFv or a single-domain antibody.

[0027]

[0027] In one aspect, the present disclosure provides a pharmaceutical composition comprising a recombinant nucleic acid described herein, a CAR described herein, a CD8 blocking polypeptide described herein, a vector described herein, or an engineered immune cell described herein, optionally further comprising an excipient.

[0028] In one aspect, the present disclosure provides a method of treating a disease in a subject in need thereof, the method comprising administering a pharmaceutical composition comprising immune cells comprising an anti-CD8 CAR comprising a CD8-binding domain, a transmembrane domain, and a signaling domain. In one aspect, the present disclosure provides a method of providing anti-cancer immunity to a mammal, the method comprising administering to the mammal a recombinant nucleic acid described herein, a CAR described herein, a CD8-blocking polypeptide described herein, a vector described herein, an engineered immune cell described herein, or a pharmaceutical composition described herein. In some embodiments, the immune cell is engineered to have reduced cell surface expression of CD8. In some embodiments, the immune cell further comprises a chimeric polypeptide comprising a CD8-binding domain and an intracellular localization domain. In some embodiments, the disease is a T-cell malignancy or an NK-cell malignancy.

[0029] In one aspect, the present disclosure provides a method of reducing fratricide in an immune cell population expressing a chimeric antigen receptor comprising a CD8-binding domain, the method comprising expressing a CD8-blocking polypeptide comprising a CD8-binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteasome localization sequence, and optionally, the CD8-blocking polypeptide is retained intracellularly in the engineered cells and binds to endogenous CD8 in the engineered cells. In some embodiments, the CD8-binding domain is an scFv or a single-domain antibody.

[0030] In one aspect, the present disclosure provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject a recombinant nucleic acid described herein, a CAR described herein, a CD8-blocking polypeptide described herein, a vector described herein, an engineered immune cell described herein, or a pharmaceutical composition described herein. In some embodiments, the immune cell is engineered to have reduced cell surface expression of CD8.

[0031] In one aspect, the present disclosure provides a method of treating cancer in a subject in need thereof, the method comprising administering a therapeutic amount of a composition comprising engineered immune cells comprising: (i) a CD8-blocking polypeptide comprising a CD8-binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localization sequence, and wherein the CD8-blocking polypeptide is retained intracellularly in the engineered cell and binds to endogenous CD8 in the engineered cell; and (ii) a CAR comprising a CD8 targeting domain, a transmembrane domain, and a signaling domain. In some embodiments, the CD8-binding domain is an scFv or a single-domain antibody.

[0032] In one aspect, the present disclosure provides a method of providing anti-cancer immunity in a mammal, the method comprising administering to the mammal an effective amount of immune cells expressing a CAR molecule disclosed herein, e.g., an anti-CD8 CAR. In some embodiments, the immune cells are engineered to have reduced cell surface expression of CD8. In some embodiments, the immune cells are autologous T cells. In some embodiments, the immune cells are allogeneic T cells.

[0033]

[0033] In one aspect, the present disclosure provides the use of a recombinant nucleic acid described herein, a CAR described herein, a CD8 blocking polypeptide described herein, a vector described herein, an engineered immune cell described herein, or a pharmaceutical composition described herein in the manufacture of a medicament for the treatment of cancer in a subject in need thereof.

[0034] In one aspect, the present disclosure provides a method of reducing and / or preventing fratricide during the manufacturing of immune cells expressing an anti-CD8 CAR, the method comprising functional inhibition of CD8 signaling during the cell manufacturing process. In some embodiments, the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 in the immune cell. In some embodiments, endogenous CD8 in the immune cell has been knocked out or knocked down. In some embodiments, endogenous CD8 in the immune cell has been knocked out via zinc finger endonuclease, TALEN, or CRISPR-Cas9. In some embodiments, endogenous CD8 in the immune cell has been knocked down via siRNA or shRNA. In some embodiments, endogenous CD8 in the immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and a subcellular localization domain, wherein the subcellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localization sequence. In some embodiments, the anti-CD8 binding domain is an scFv or a single domain antibody. In some embodiments, the survival rate of the cytotoxic T cells in immune cells is at least about 1.1-fold, at least about 5-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, or at least about 500-fold higher than otherwise identical cytotoxic T cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the immune cells against target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, or at least about 3-fold higher than otherwise identical immune cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1:2. In some embodiments, the target cells are CD8-positive cells, including, for example, MOLT-4 and / or CCRF-CEM.In some embodiments, the cytotoxicity of the immune cells against the target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, or at least about 4-fold greater than otherwise identical immune cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culture with the target cells. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1:4, or 1:8. In some embodiments, the target cells are CD8-positive cells, including, for example, MOLT-4 and / or CCRF-CEM. In some embodiments, the proliferation of immune cells in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, or at least about 5-fold higher compared to immune cells in the absence of a target cell claimed herein. In some embodiments, the proliferation of immune cells in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold higher compared to identical immune cells but with enforced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the immune cells and target cells are tested at a 1:1 effector-target ratio. In some embodiments, proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days after culturing the immune cells with or without target cells. In some embodiments, the target cells are CD8-positive cells, including MOLT-4 and / or CCRF-CEM.

[0035] In one aspect, the present disclosure provides a method for producing engineered immune cells, comprising: (i) transducing immune cells with a vector comprising a polynucleotide sequence encoding a CD8-blocking polypeptide comprising a CD8-binding domain and an intracellular localization domain; and (ii) transducing immune cells with a vector comprising a polynucleotide sequence encoding a CD8-chimeric antigen receptor (anti-CD8 CAR) comprising a CD8-binding domain, a transmembrane domain, and a signaling domain. In some embodiments, the CD8-binding domain of the CD8-blocking polypeptide or the CD8-binding domain of the anti-CD8 CAR comprises an scFv or a single-domain antibody. In some embodiments, the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localization sequence. In some embodiments, the CD8-blocking polypeptide remains intracellularly within the engineered cells and binds to endogenous CD8 within the engineered cells. In some embodiments, the CD8-blocking polypeptide is expressed before the anti-CD8 CAR. In some embodiments, the CD8-blocking polypeptide is expressed about 1 day before the anti-CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed at least one day before the anti-CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed simultaneously with the anti-CD8 CAR. In some embodiments, the bicistronic vector comprises sequences encoding a CD8 blocking polypeptide and an anti-CD8 CAR.

[0036] Incorporation by Reference

[0036] All publications, patents, and patent applications mentioned in this specification are incorporated by reference into this specification to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. [Brief explanation of the drawings]

[0037] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1]

[0037] Figure 1 shows the schematic design of the anti-CD8 α-41BB-CD3ζ construct. The anti-CD8 CAR contains a CD8 signal peptide in the 5'-3' region, a CD8 antigen-binding domain derived from the humanized scFv sequence of the OKT8 antibody, a CD8 hinge and transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3ζ intracellular signaling domain. [Figure 2]

[0038] Figure 2 shows the expression of anti-CD8α-41BB-CD3ζ in NK92 cells. Retroviral transduction of anti-CD8 CAR in CD8-negative NK92 cells resulted in higher expression of anti-CD8 CAR in transduced GFP-positive NK-92 cells compared to controls. Flow cytometry analysis of NK92 cells transduced with either GFP-only "mock" (Figure 2; left panel) or GFP + anti-CD8α-41BB-CD3ζ (Figure 2; right panel). Dot plots show GFP fluorescence and CAR expression revealed by staining with biotin-conjugated goat anti-mouse F(ab')2 antibody followed by streptavidin conjugated to APC. [Figure 3]

[0039] NK92 expressing anti-CD8α-41BB-CD3ζ-mediated cytotoxicity against CD8+ cells. NK92 cells expressing anti-CD8 CARs exhibited significantly higher cytotoxicity against the CD8-positive leukemia cell line MOLT-4 (Figure 3, left panel), but no increase in cytotoxicity was observed when the target cells were the CD8-negative leukemia cell line Jurkat (Figure 3, right panel). [Figure 4]

[0040] Figure 1 shows the expression of anti-CD8 α-41BB-CD3ζ in human peripheral blood T lymphocytes. Peripheral blood T lymphocytes transduced with anti-CD8 CAR show high expression of anti-CD8 CAR 2 days after transduction. The dot plot represents flow cytometry analysis of transduced T lymphocytes stained with biotin-conjugated goat anti-mouse F(ab')2 antibody to detect the CAR, followed by streptavidin conjugated to APC. [Figure 5]

[0041] We show that expression of an anti-CD8 CAR in T lymphocytes induces lymphocyte killing. Anti-CD8 CAR expression in peripheral T lymphocytes was associated with a significant decrease in cell recovery, in contrast to T cells transduced with GFP alone ("mock"). [Figure 6]

[0042] 1 shows the expression of anti-CD8 CAR in T lymphocyte-induced killing of CD8+ lymphocytes. Analysis of CD4 and CD8 expression in peripheral blood T lymphocytes transduced with anti-CD8 CAR shows that 2 days after transduction, CD8-positive cells were largely eliminated, and the majority of remaining surviving cells were CD4-positive. [Figure 7]

[0043] Schematic designs of five PEBLs containing OKT8 scFv linked to the ER retention domain KYKSRRSFIEEKKMP (EEKKMP) or AEKDEL are shown. The first PEBL contains CD8α signal peptide-OKT8 light chain 1-scFv linker 1-OKT8 heavy chain 1-linker 20(1)-AEKDEL (anti-CD8(20)AEKDEL) (Figure 7, top panel). The second PEBL contains CD8α signal peptide, OKT8 light chain 1, scFv linker 1, OKT8 heavy chain 1, CD8 transmembrane 1, and EEKKMP1 (anti-CD8-EEKMP) (Figure 7, second panel from the top). The third PEBL contained CD8α signal peptide 2-OKT8 light chain 3-scFv linker 3-OKT8 heavy chain 3-linker 20 2-OKT8 light chain 4-scFv linker 4-OKT8 heavy chain 4-CD8 transmembrane 2-EEKKMP 2 (bi(20)-anti-CD8-EEKMP) (Figure 7, third panel from the top). The fourth PEBL contained CD8α signal peptide-OKT8 light chain 2-scFv linker 2-OKT8 heavy chain 2-linker 5-OKT8 light chain 1-scFv linker 1-OKT8 heavy chain 1-CD8 transmembrane 1-EEKKMP 1 (bi(5)-anti-CD8-EEKMP) (Figure 7, fourth panel from the top). The fifth PEBL contains CD8α signal peptide-OKT8 light chain 2-scFv linker 2-OKT8 heavy chain 5-linker 5-OKT8 light chain 1-scFv linker 1-OKT8 heavy chain 1-linker 20(1)-AEKDEL (bi(5)-anti-CD8(20)AEKDEL) (Figure 7, lower panel). [Figure 8]

[0044] Anti-CD8 PEBL abolished surface CD8 expression on MOLT-4 cells. MOLT-4 cells transduced with anti-CD8(20)AEKDEL (second panel from the left), bi(5)-anti-CD8(20)AEKDEL (third panel), anti-CD8-EEKKMP PEBL (fourth panel), bi(5)-anti-CD8-EEKKMP PEBL (fifth panel), or bi(20)-anti-CD8-EEKKMP (sixth panel) showed significantly reduced CD8 expression on the MOLT-4 surface compared to CD8 expression on GFP-transduced MOLT-4 cells (first panel). [Figure 9]

[0045] Figure 1 shows PEBL expression in transduced MOLT-4 cells confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab')2 antibody followed by phycoerythrin (PE)-conjugated streptavidin. [Figure 10]

[0046] T lymphocytes transduced with anti-CD8(20)AEKDEL, bi(5)-anti-CD8(20)AEKDEL, anti-CD8-EEKMP PEBL, bi(20)-anti-CD8-EEKKMP PEBL, or bi(5)-anti-CD8-EEKKMP PEBL show reduced CD8 expression on their surface compared to CD8 expression on T lymphocytes transduced with GFP. Surface CD8 expression was reduced with all PEBL in GFP-expressing CD4-negative T lymphocytes. T lymphocytes were transduced with GFP only ("mock") or GFP+ PEBL as indicated. Transduced T lymphocytes were stained with PE-conjugated anti-CD8, PEcy7-conjugated anti-CD4, and APC-conjugated anti-CD3 antibodies. Symbols indicate CD8 MFI in GFP-expressing CD3+ / CD4- cells. Mock and anti-CD8-EEKKMP were transduced in seven donors. Bi(20)-anti-CD8-EEKKMP was transduced in four donors. Bi(5)-anti-CD8-EEKKMP was transduced in six donors. Anti-CD8(20)AEKDEL and bi(5)-anti-CD8(20)AEKDEL were transduced in two donors. (****P<0.0001) [Figure 11]

[0047] PEBL expression in transduced T lymphocytes was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab')2 antibody followed by phycoerythrin (PE)-conjugated streptavidin PE after permeabilization with BD Cytofix / Cytoperm. Histograms represent GFP+ cells. [Figure 12]

[0048] This figure shows that downregulation of CD8 expression persisted in MOLT-4 cells and T lymphocytes transduced with anti-CD8-EEKMP PEBL or bi(5)-anti-CD8-EEKMP PEBL. T lymphocytes and MOLT-4 were transduced with the indicated anti-CD8 PEBL. After transduction, cells were stained with PE-conjugated anti-CD8, PEcy7-conjugated anti-CD4, and APC-conjugated anti-CD3 antibodies and monitored for surface CD8 expression for up to 23 days by gating on CD3+CD4- cells expressing GFP. [Figure 13]

[0049] Surface CD8 expression as a function of the level of GFP expression in T lymphocytes transduced with anti-CD8-EEKMP PEBL, bi(20)-anti-CD8-EEKKMP PEBL, or bi(5)-anti-CD8-EEKKMP PEBL is shown. [Figure 14]

[0050] Figure 1 shows CAR expression in peripheral blood T lymphocytes transduced with either anti-CD8 (EEKKMP) or GFP-containing vectors, followed one day later by anti-CD8 CAR. T lymphocytes were first transduced with GFP alone ("mock") or GFP + anti-CD8-PEBL (EEKKMP). Half of the transduced T lymphocytes were subsequently transduced with GFP + anti-CD8 CAR. Transduced cells were stained with biotin-conjugated goat anti-human F(ab')2 antibody, followed by streptavidin conjugated to APC. CAR was highly expressed regardless of the construct used in the previous transduction. [Figure 15]

[0051] Figure 1 shows that expression of anti-CD8 CAR, with or without anti-CD8 PEBL, results in a decrease in CD8 expression in T lymphocytes. CD8 expression in peripheral blood T lymphocytes transduced with either anti-CD8-EEKKMP or a vector containing GFP, followed by transduction with anti-CD8 CAR one day later. Anti-CD8-EEKKMP reduced CD8 surface expression. No CD8-positive cells were observed after transduction with anti-CD8 CAR. [Figure 16]

[0052] We show that PEBL improves cell recovery after transduction with anti-CD8 CAR. The number of viable T cells recovered after CAR transduction was significantly higher in cells transduced with both PEBL and CAR compared to cells transduced with CAR alone. [Figure 17]

[0053] These results show that anti-CD8 CAR T lymphocytes carrying anti-CD8-EEKKMP mediated better cytotoxicity against CD8-positive MOLT-4 cells. Anti-CD8-EEKKMP CAR-T cells exerted significantly greater cytotoxicity against CD8-positive MOLT-4 target cells than T lymphocytes expressing anti-CD8 CAR but without PEBL transduction and CD8 downregulation. (****P<0.0001, ***P<0.001, **P<0.01) [Figure 18]

[0054] Anti-CD8 PEBL T cells exert TCR-driven cytotoxicity. T cells expressing the HLA-A201-restricted S183 TCR with or without anti-CD8-EEKKMP PEBL (PEBL-TCR) (IRES-TCR) exerted similar cytotoxicity against T2 cells presenting the S183 peptide. (****P<0.0001) [Figure 19]

[0055] These results demonstrate that anti-CD8 PEBL T cells are stimulated by TCR engagement. CD25 upregulation mediated by T2 cells presenting the S183 peptide (T2) was similar in TCR-expressing T cells with or without anti-CD8 PEBL (****P<0.0001). [Figure 20]

[0056] This shows that CD8 knockout by CRISPR-Cas9 improves the recovery of cytotoxic T cells after transduction with anti-CD8α-41BB-CD3ζ CAR. Anti-CD8α-41BB-CD3ζ CAR was transduced into T cells that either underwent CD8 knockout (CD8KO-CAR) or not (Cas9-CAR). CD8 knockout was successful; across five experiments, the mean (±SD) percentage of CD8+ T cells was 44.7% (±12.8) with Cas9 alone and 1.8% (±1.7) with CD8KO. Bars represent the percentage of CD4-negative cells relative to the cells originally used for transduction. [Figure 21A]

[0057] Figures 21A and 21B show that expression of the anti-CD8α-41BB-CD3ζ CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines. T cells electroporated with NLS-Cas9 alone ("Cas9") or a complex of NLS-Cas9 and CD8α gRNA ("CD8KO") were transduced with either GFP alone or the anti-CD8α-41BB-CD3ζ CAR and GFP. MOLT-4 (Figure 21A) and CCRF-CEM (Figure 21B) cells labeled with calcein AM red orange were cocultured with transduced T cells at 2:1, 1:1, and 1:2 E:T ratios for 4 hours. Bars represent the mean (±SD) of triplicate cultures from three donors for MOLT-4 and two donors for CCRF-CEM. (***p<0.001, ****p<0.0001). Figure 21A shows the cytotoxicity of T cells electroporated with NLS-Cas9 alone ("Cas9"), NLS-Cas9 in complex with GFP alone (CD8KO), or anti-CD8α-41BB-CD3ζ CAR and GFP (CD8KO-CAR) using the MOLT-4 cell line. [Figure 21B]

[0057] Figure 21B shows the cytotoxicity of T cells electroporated with NLS-Cas9 alone ("Cas9"), NLS-Cas9 in complex with GFP alone (CD8KO), or anti-CD8α-41BB-CD3ζ CAR and GFP (CD8KO-CAR) using the CCRF-CEM cell line. [Figure 22A]

[0058] Figures 22A and 22B show that anti-CD8 α-41BB-CD3ζ CAR-T cells with a CD8 knockout induce greater long-term cytotoxicity against CD8+ leukemia cell lines than CAR-T cells without a CD8 knockout. T cells electroporated with NLS-Cas9 alone ("Cas9") or a complex of NLS-Cas9 and CD8α gRNA ("CD8KO") were transduced with either GFP alone or the anti-CD8α-41BB-CD3ζ CAR and GFP. Transduced T cells were cocultured with mCherry-expressing MOLT-4 (Figure 22A) or CCRF-CEM (Figure 22B) cells at the indicated ratios in flat-bottom 96-well plates. Data represent the mCherry signal from target cells, expressed as the integrated intensity of the red object. Figure 22A shows the cytotoxicity exerted by T cells electroporated with NLS-Cas9 alone ("Cas9"), NLS-Cas9 complexed with CD8α guide RNA, GFP alone (CD8KO), or anti-CD8α-41BB-CD3ζ CAR and GFP (CD8KO-CAR), measured at successive time points during coculture with the MOLT-4 cell line. [Figure 22B]

[0058] Figure 22B shows the cytotoxicity exerted by T cells electroporated with NLS-Cas9 alone ("Cas9"), NLS-Cas9 in complex with CD8α guide RNA, GFP alone (CD8KO), or anti-CD8α-41BB-CD3ζ CAR and GFP (CD8KO-CAR), measured at successive time points during coculture with the CCRF-CEM cell line. [Figure 23]

[0059] Figure 1 shows that anti-CD8 α-41BB-CD3ζ CAR-T cells with a CD8 knockout proliferate in the presence of CD8+ target cells. CD8 knockout T cells were transduced with GFP alone or with anti-CD8 α-41BB-CD3ζ CAR and GFP and co-cultured 1:1 in triplicate with or without 100 Gy-irradiated MOLT-4 cells. Each plot represents a separate T cell donor. DETAILED DESCRIPTION OF THE INVENTION

[0038] Detailed Description of the Disclosure

[0060] Immunotherapy is becoming a mainstay of modern cancer treatment. Infusion of genetically engineered immune cells has produced very promising clinical results, suggesting that tumor responses can be achieved even in patients for whom standard therapies have failed. Central to the success of CAR-T cell therapy is the identification of targets that are highly expressed on cancer cells but not on healthy cells. Antigens with these properties that can be targeted by CARs are rare and typically associated with tumor peptides expressed in the context of specific HLA molecules. Much of the clinical experience with CARs has instead relied on antigens expressed on healthy cells that are temporarily unnecessary and / or whose absence can be counteracted by clinical intervention. For example, the clinical impact of agammaglobulinemia resulting from B-cell depletion after anti-CD19 CAR-T cell therapy can be mitigated by regular supplementation with intravenous immunoglobulin. Identification of other such antigens could broaden the scope of CAR-T cell therapy and enable its use in cancer forms currently unsuitable for cell therapy.

[0039]

[0061] The present disclosure identifies CD8 as a target for CAR-T cell therapy. CD8 is widely expressed in T-cell leukemias and lymphomas. For example, CD8 expression has been reported in cases of Epstein-Barr virus (EBV)+ T-cell lymphoproliferative disorders in children, including T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, peripheral T-cell lymphoma, and Epstein-Barr virus (EBV)+ hemophagocytic lymphohistiocytosis, pediatric systemic EBV+ T-cell leukemia, and primary EBV+ nodal T-cell or NK-cell lymphoma. Herein, we describe a "second-generation" anti-CD8 CAR that can be expressed at high levels in the CD8-negative NK cell line NK92. Upon expression, this "second-generation" anti-CD8 CAR induced highly specific cell killing of CD8+ leukemia cells. However, when expressed in peripheral blood T lymphocytes, the anti-CD8 CARs disclosed herein induced the killing of CD8-expressing T lymphocytes, including those expressing the anti-CD8 CAR. Because CD8+ T cells are the primary direct effectors of anti-tumor cytotoxicity, this fratricidal activity may reduce the number of cells that can be harvested for infusion into patients, thus compromising the clinical activity of the anti-CD8 CAR T cells.

[0040]

[0062] To protect CAR-T cells from fratricide, the present disclosure provides cells with downregulated CD8 expression. In one embodiment, downregulation is achieved using the PEBL technology described in International Publication No. 2016 / 126213. Anti-CD8 PEBL significantly reduced CD8 expression in MOLT-4 cells and T lymphocytes. CD8 downregulation can also be achieved by gene editing methods such as zinc finger endonucleases, TALENs, and CRISPR-Cas9. In some embodiments, downregulation occurs via PEBL co-expressed with the CAR via a bicistronic vector, allowing for the desired genetic modification to occur in one single transduction.

[0041]

[0063] CD8 is important for TCR-mediated signaling because it stabilizes binding to peptide-bound HLA and promotes signal transduction. Therefore, the consequences of downregulating CD8 on the function of CAR- or TCR-engineered human peripheral blood T cells were unpredictable. The present disclosure provides anti-CD8 CAR T cells with downregulated CD8α that have improved cytotoxicity compared to anti-CD8 CAR T cells in which CD8α expression is not downregulated, e.g., via expression of PEBL (e.g., anti-CD8 PEBL). In some embodiments, downregulation of CD8α by PEBL does not affect TCR-mediated signaling or peptide-HLA-specific cytotoxicity. In some embodiments, high expression of CAR or TCR in engineered immune cells can reduce the influence of the CD8 co-receptor on signal transduction. In some embodiments, the functional capacity of T cells expressing physiological levels of TCR can be reduced in the absence of CD8 expression. In some embodiments, downregulation of CD8 by PEBL (e.g., anti-CD8 PEBL disclosed herein) or gene editing techniques can provide a method for silencing TCR receptor signaling. In some embodiments, infusion of a T cell product, e.g., an engineered immune cell (e.g., an allogeneic T cell) disclosed herein, can suppress TCR receptor signaling. In some embodiments, suppression of TCR receptor signaling can reduce the risk of graft-versus-host disease following infusion of a T cell product, e.g., an allogeneic T cell product, disclosed herein.

[0042]

[0064] In one aspect, the present disclosure provides CAR-T cells, e.g., anti-CD8 CAR T cells, that are effective against CD8+ malignancies. In one aspect, the present disclosure provides autologous and / or allogeneic anti-CD8 CAR T cells with downregulated CD8 expression (e.g., using PEBL technology described herein) for treating malignancies, e.g., CD8+ malignancies.

[0043]

[0065] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0044]

[0066] As used herein, the terms "a" and "an" refer to one or to more than one (i.e., to at least one) of the grammatical object of the article; for example, "an element" means one element or more than one element.

[0045]

[0067] As used herein, the terms "about" or "approximately" refer to a measurable value, such as an amount, temporal duration, or the like, within a statistically significant range of variation of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1% from a particular value.

[0046]

[0068] The term "alleviate," as used herein in relation to a disease, refers to a decrease in the severity of one or more symptoms of the disease.

[0047]

[0069] The term "allogeneic," as used herein, refers to any material derived from an individual that is transplanted into a genetically different recipient of the same species. Two or more individuals are said to be allogeneic to one another if the genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically different to interact antigenically.

[0048]

[0070] As used herein, the term "autologous" refers to any material derived from the same individual that is later reintroduced.

[0049]

[0071] As used herein, the term "binding domain" (e.g., "CD8 binding domain") generally refers to a molecule that binds to a particular molecule, optionally forming a binding complex, but does not substantially recognize or bind other molecules in a sample. The term "binding domain" encompasses antibodies and antibody fragments.

[0050]

[0072] As used herein, the term "bind" refers to a bond that occurs between paired species (e.g., enzyme / substrate, receptor / agonist, antibody / antigen, lectin / carbohydrate), which may be mediated by covalent and / or noncovalent interactions. "Binding" occurs between a species in which an interaction between the two produces a bound complex. "Specific binding" occurs between two molecules that have a selective affinity for each other, as opposed to "nonspecific binding," which may result from nonselective interactions between molecules with compatible charged or hydrophobic surfaces. An antibody that specifically binds to an antigen from one species may also bind to the homologous antigen from one or more different species. However, such cross-species reactivity does not, in itself, alter the specific classification of the antibody. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. Thus, under specified immunoassay conditions, a specified antibody binds to a specific protein at least twice above background, more typically 10-100 times above background. Specific binding to an antibody under such conditions requires an antibody selected for its specificity for a particular protein.

[0051]

[0073] As used herein, the term "antibody" refers to a protein or polypeptide sequence comprising an immunoglobulin domain that specifically binds to an antigen. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain, or intact immunoglobulins, and can be derived from natural or recombinant sources. In some embodiments, an antibody comprises at least one heavy chain. In some embodiments, an antibody comprises at least one light chain. In some embodiments, an antibody comprises at least one heavy chain and one light chain. Each heavy chain is composed of a heavy chain variable region ("HCVR" or "VH") and a heavy chain constant region (composed of domains CH1, CH2, and CH3). Each light chain is composed of a light chain variable region ("LCVR" or "VL") and a light chain constant region (CL). "Antibodies" include bispecific antibodies, multispecific antibodies, murine antibodies, chimeric antibodies, humanized antibodies, and human antibodies. In some embodiments, the antibody may be modified or engineered, e.g., a chimeric antibody, a humanized antibody, a multiparatopic antibody (e.g., a biparatopic antibody), and / or a multispecific antibody (e.g., a bispecific antibody). In some embodiments, the antibody disclosed herein is a CD8 antibody, e.g., an OKT8 antibody.

[0052]

[0074] The term "scFv" disclosed herein refers to a fusion protein comprising the variable region of an antibody light chain and the variable region of an antibody heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker and can be expressed as a single polypeptide chain, wherein the scFv retains the specificity of the intact antibody from which it is derived. An scFv can have the VL and VH variable regions in either order; for example, relative to the N- and C-termini of the polypeptide, an scFv can comprise VL-linker-VH or VH-linker-VL.

[0053]

[0075] The term "variable region" or "variable domain" of an antibody refers to the domains of the antibody heavy or light chain that are involved in binding the antibody to an antigen.

[0054]

[0076] The term "antibody heavy chain" (VH) refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, which usually determines the class to which the antibody belongs.

[0055]

[0077] The term "antibody light chain" (VL) refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda (λ) light chains refer to the two major antibody light chain isotypes.

[0056]

[0078] The heavy and light chain variable domains (VH and VL, respectively) of natural antibodies generally have a similar structure, with each domain containing four conserved framework regions (FR) and three hypervariable regions (HVR). (See, for example, Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). A single VH or VL domain may be sufficient to confer antigen-binding specificity. The VH and VL regions may be further subdivided into hypervariable regions called hypervariable regions (HVR) or complementarity-determining regions (CDR), which are interspersed with more conserved regions called framework regions (FR). In some embodiments, each VH and VL is composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In some embodiments, these CDRs may be distributed between their appropriate framework regions. In certain embodiments of the present invention, the FRs of the antibody (or antigen-binding fragment thereof) may be identical to the human germline sequence or may be naturally or artificially modified.

[0057]

[0079] The terms "hypervariable region," "HVR," "complementarity-determining region," or "CDR," as used herein, refer to the sequences of amino acids within an antibody variable region that are important for antigen specificity and binding affinity. The precise amino acid sequence boundaries of a given CDR can be determined using the "Kabat" numbering scheme (Kabat et al., (1991) "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD), Al-Lazikani et al., (1997) JMB 273, 927-948 (Chothia numbering scheme), and ImMunoGenTics (IMGT) numbering scheme (Lefranc, M.-P., The Immunologist, 7, 132-136 (1999); Lefranc, M.-P. et al., The Immunologist, 7, 132-136 (1999)). al., Dev. Comp. Immunol., 27, 55-77 (2003) ("IMGT" numbering scheme). Generally, antibodies contain six HVRs: three in the VH (HCDR1, HCDR2, HCDR3) and three in the VL (LCDR1, LCDR2, LCDR3).

[0058]

[0080] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an engineered cell surface receptor comprising at least an extracellular binding domain, a transmembrane domain, and an intracellular signaling domain (also referred to as a "cytoplasmic signaling domain") comprising functional signaling domains derived from a stimulatory molecule and one or more costimulatory molecules. The chimeric antigen receptors of the present disclosure are primarily intended for use in lymphocytes, such as T cells and natural killer (NK) cells. In some embodiments, the binding domain comprises a single-chain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody. In some embodiments, a CAR described herein is an anti-CD8 CAR (sometimes referred to as a CD8 CAR), e.g., a CAR whose binding domain binds to CD8. In some embodiments, the anti-CD8 CAR comprises an scFv comprising the VH and VL domains of an OKT8 antibody.

[0059]

[0081] The extracellular binding domain of a CAR of the present disclosure can exist in a variety of forms in which the antigen-binding domain is expressed as part of a contiguous polypeptide chain, including, for example, a single-domain antibody fragment (sdAb), a single-chain antibody (scFv), a humanized antibody, or a bispecific antibody.

[0060]

[0082] As used herein, the term "CD8" refers to cluster of differentiation 8 protein, a transmembrane glycoprotein that functions as a co-receptor for the T cell receptor (TCR).

[0061]

[0083] As used herein, the term "effective amount" refers to the minimum amount necessary to achieve a measurable improvement. The effective amount disclosed herein may vary depending on factors such as the patient's condition, age, sex, and weight. An effective amount is also one in which the therapeutically beneficial effects outweigh the toxic or adverse effects of the treatment. In therapeutic applications, beneficial or desired results include clinical results such as reducing one or more symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, reducing the dose of other drugs required to treat the disease, enhancing the effect of another drug, for example by targeting, delaying disease progression, and / or prolonging survival. In the case of cancer or tumors, an effective amount of a therapeutic agent may have the effect of reducing the number of cancer cells, reducing tumor size, inhibiting cancer cell invasion into peripheral organs, inhibiting tumor metastasis, inhibiting tumor growth to some extent, and / or alleviating one or more symptoms associated with the disorder.

[0062]

[0084] As used herein, the term "express" refers to causing the transcription and / or translation of a particular nucleotide sequence into RNA or protein. The protein may be expressed and remain intracellular, become a component of the cell surface membrane, or be secreted into the extracellular matrix or medium.

[0063]

[0085] As used herein, the term "engineered" refers to any composition that has been intentionally altered from its native state by human intervention.

[0064]

[0086] "Engineered nucleic acid," as used herein, refers to a nucleic acid whose sequence has been deliberately altered by human intervention to have one or more nucleotide modifications, substitutions, additions, or deletions.

[0065]

[0087] As used herein, the term "engineered immune cells" refers to immune cells that are genetically engineered relative to naturally occurring immune cells. For example, engineered T cells generated according to the present methods possess nucleic acids that include nucleotide sequences that do not naturally occur in the T cells from which they are derived.

[0066]

[0088] In certain embodiments, the engineered immune cells are engineered T cells, engineered natural killer (NK) cells, engineered NK / T cells, engineered monocytes, engineered macrophages, or engineered dendritic cells.

[0067]

[0089] In certain embodiments, "immune activating receptor," as used herein, refers to a receptor that activates an immune response upon binding of a cancer cell ligand. In some embodiments, an immune activating receptor comprises a molecule that can activate an immune response upon binding (linking) to a ligand (e.g., a peptide or antigen) expressed on a cancer cell. In one embodiment, the immune activating receptor is a CAR, and methods for designing and engineering CARs are known in the art.

[0068]

[0090] As used herein, the term "fratricide" refers to one cell in a population killing a second cell in the population, where the first cell and the second cell are of the same type, e.g., both cells are T cells.

[0069]

[0091] As used herein, the term "reducing and / or preventing fratricide" relates to a reduction in the occurrence of fratricide in a cell population compared to an appropriate control population of cells (typically, but not necessarily, a population of identical cells having normal expression of the target of the CAR).

[0070]

[0092] As used herein, the term "sequence identity" refers to the subunit sequence identity between two polymer molecules, e.g., between two polynucleotide or polypeptide sequences. Sequence identity analysis begins by aligning the two sequences. Identical sequences (100% sequence identity) have identical nucleotides or amino acids at every position in the alignment. "Percent sequence identity" is determined by comparing the number of identical positions with the total number of subunits in the sequence alignment. Percent sequence identity can be determined over a portion of a sequence or over the entire sequence. Percent sequence identity can be determined using a sequence comparison algorithm. Test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences and calculates the percent sequence identity based on the designated program parameters.

[0071]

[0093] Sequence identity is typically measured using sequence analysis software. Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the similarity search method of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), by computer implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., Current Protocols in Molecular Biology). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. In an exemplary approach to determining the degree of identity, the BLAST program can be used, with a probability score of e-3 to e-100 indicating closely related sequences. One example of a suitable algorithm for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (publicly accessible through the National Institutes of Health NCBI internet server). Sequence comparisons are typically performed using default program parameters, although customized parameters can also be used.For amino acid sequences, the BLASTP program uses as default a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)). In some embodiments, sequence identity is determined by Needleman-Wunsch alignment of two sequences, with gap costs set at Existence: 11 and Extension: 1, where percent identity is calculated by dividing the number of identities by the length of the alignment. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0072]

[0094] The term "intracellular signaling domain," as used herein, refers to the intracellular (e.g., cytoplasmic) portion of a molecule sufficient to transmit an effector function signal. In embodiments, the intracellular signaling domain transmits the effector function signal and induces the cell to perform a specialized function.

[0073]

[0095] As used herein, the term "isolated" refers to altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not "isolated," but the same nucleic acid or peptide that is partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially pure form, or can exist in a non-native environment, e.g., a host cell. In some cases, the polynucleotide or polypeptide is not naturally occurring (e.g., recombinant, synthetic, etc.).

[0074]

[0096] The term "nucleotide sequence" with respect to nucleic acids refers to a contiguous series of nucleotides, e.g., a polynucleotide, linked by covalent bonds, e.g., phosphorus bonds (e.g., phosphodiester, alkyl and aryl-phosphonate, phosphorothioate, phosphotriester bonds), and / or non-phosphorus bonds (e.g., peptide and / or sulfamate bonds).

[0075]

[0097] The term "nucleic acid" includes, for example, genomic DNA, cDNA, RNA, and DNA-RNA hybrid molecules. Nucleic acid molecules can be natural, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded, or triple-stranded. In some embodiments, nucleic acid molecules can be modified. In the case of double-stranded polymers, "nucleic acid" can refer to either or both strands of the molecule. In certain embodiments, for example, the nucleotide sequence encoding the target binding molecule linked to the localization domain is a heterologous sequence (e.g., a gene originating from a different species or cell type).

[0076]

[0098] The terms "nucleotide" and "nucleotide monomer" refer to naturally occurring ribonucleotide or deoxyribonucleotide monomers, as well as non-naturally occurring derivatives and analogs thereof. Thus, nucleotides can include, for example, nucleotides containing naturally occurring bases (e.g., adenosine, thymidine, guanosine, cytidine, uridine, inosine, deoxyadenosine, deoxythymidine, deoxyguanosine, or deoxycytidine) and nucleotides containing modified bases.

[0077]

[0099] The terms "nucleic acid encoding" and "nucleotide sequence encoding" a polypeptide or amino acid sequence include all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence, and may also include introns that have been excised to produce spliced ​​nucleotide sequences, to the extent that a nucleotide sequence encoding a protein may contain introns in some versions.

[0078]

[0100] As used herein, the term "polynucleotide" refers to a chain of nucleotides.

[0079]

[0101] As used herein, the term "protein expression blocker" or "PEBL" refers to a polypeptide construct containing a target binding molecule that binds to a target (e.g., CD8) linked to a localization domain (e.g., an intracellular retention domain) that directs the polypeptide to a specific cellular compartment such as the Golgi apparatus, the ER, or the proteasome, depending on the application.

[0080]

[0102] As used herein, the term "host cell" refers to a cell capable of supporting the replication or expression of an expression vector. Host cells can be prokaryotic cells, such as E. coli, or eukaryotic cells, such as yeast, insect cells, amphibian cells, or mammalian cells.

[0081]

[0103] As used herein, the term "vector" refers to a composition containing a polynucleotide that can be used to deliver a polynucleotide to the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes self-replicating plasmids or viruses. In some embodiments, the term is further interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0082]

[0104] The term "expression vector" refers to a vector containing a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. Expression vectors contain sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viral vectors (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating a recombinant polynucleotide.

[0083]

[0105] The term "lentivirus" refers to a genus of the Retroviridae family that can be used as a gene delivery vector as described herein.Lentiviruses are unique among retroviruses in that they can infect cells; they can deliver significant amounts of genetic information to the DNA of host cells.HIV, SIV, and FIV are all examples of lentiviruses.

[0084]

[0106] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, including, in particular, self-inactivating lentiviral vectors such as those provided in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that can be used in clinics include, but are not limited to, the LENTIVECTOR® gene delivery technology from Oxford BioMedica and the LENTIMAX® vector system from Lentigen. Non-clinical versions of lentiviral vectors are also available and would be known to those skilled in the art.

[0085]

[0107] As used herein, the term "in vivo" refers to inside an organism. As used herein, the terms "ex vivo" or "in vitro" refer to outside an organism.

[0086]

[0108] As used herein, the term "subject" refers to any animal, e.g., a mammal or marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and any type of poultry. In certain embodiments, the subject is a human. A "subject in need thereof" refers, for example, to a subject (e.g., a patient) having a disease or condition or at risk of developing a disease or condition that can be treated (ameliorated, ameliorated, prevented) with engineered T cells.

[0087]

[0109] The term "cancer" as used herein refers to a disease characterized by the uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream and lymphatic system. Examples of various cancers are described herein and include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma leukemia, lung cancer, etc. As used herein, the term "cancer" includes pre-malignant and malignant cancers. The cancers described herein can be stage I cancer, stage II cancer, stage III cancer, or stage IV cancer.

[0088]

[0110] As used herein, the term "T cell" and its grammatical equivalents can refer to T cells from any source. For example, T cells can be primary T cells, e.g., autologous T cells, allogeneic T cells, cell lines, etc. T cells can also be human or non-human.

[0089]

[0111] As used herein, the terms "T cell activation" or "T cell induction" and their grammatical equivalents can refer to a state in which T cells have been sufficiently stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function. In some cases, "full T cell activation" can be equivalent to inducing T cell cytotoxicity. T cell activation can be measured using various assays known in the art. Assays can be ELISA to measure cytokine secretion, ELISPOT, flow cytometry assays to measure intracellular cytokine expression, flow cytometry assays to measure proliferation, and cytotoxicity assays (51Cr release assays) to determine target cell elimination. Assays typically use a control (non-engineered cells) to compare the engineered cells (CAR T) to determine the relative activation of the engineered cells compared to a control. Additionally, assays can compare engineered cells incubated or contacted with target cells that do not express the target antigen. For example, the comparison can be anti-CD8 CAR T cells incubated with target cells that do not express CD8.

[0090]

[0112] As used herein, the terms "treat," "treating," or "treatment" refer to combating a medical condition (e.g., a condition associated with a T-cell malignancy) to the extent that the medical condition is improved.

[0091]

[0113] Provided herein are compositions of matter and methods of use for the treatment of diseases such as cancer using cells expressing a CD8 chimeric antigen receptor (CAR), e.g., an anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on effector T cells. A description of example embodiments of the disclosure follows below.

[0092]

[0114] In one aspect, the present disclosure provides novel nucleic acid molecules encoding chimeric antigen receptors (CARs) (e.g., anti-CD8 CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain. In one aspect, the present disclosure provides novel nucleic acid molecules encoding CD8-blocking polypeptides comprising a single-chain variable fragment (scFv) linked to an intracellular localization domain. In one aspect, the present disclosure provides cells (e.g., immune effector cells, e.g., T cells or NK cells) engineered to express a CAR, e.g., an anti-CD8 CAR, wherein the CAR-T cells ("CAR-T") or CAR NK ("CAR-NK") cells exhibit anti-tumor properties. In one aspect, a cell is transformed with a CAR, e.g., an anti-CD8 CAR, and the CAR, e.g., the anti-CD8 CAR, is expressed on the cell surface. In one aspect, the present disclosure provides chimeric antigen receptors (CARs) (e.g., anti-CD8 CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain. In one aspect, the present disclosure provides a polypeptide construct comprising a target binding molecule that binds to a target (e.g., CD8) to be ablated or neutralized. In one aspect, the present disclosure provides a method of treating a disease, e.g., cancer, in a subject in need thereof by administering a cell expressing an anti-CD8 CAR, e.g., a composition comprising an anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on effector T cells.

[0093]

[0115] As described herein, anti-CD8 CARs induce T cells to exert specific cytotoxicity against T cell malignancies. Furthermore, it has been shown that T cell cytotoxicity is significantly increased when anti-CD8 CARs are used in combination with downregulation of CD8 expression on effector T cells. As demonstrated herein, downregulation (e.g., elimination, reduction, and / or relocalization) of CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing for greater T cell recovery after CAR expression and more effective cytotoxicity against T leukemia / lymphoma cells compared to cells that retained the target antigen (e.g., CD8).

[0094]

[0116] In one aspect, the present disclosure provides novel nucleic acid molecules encoding chimeric antigen receptors (CARs) (e.g., anti-CD8 CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain. In one aspect, the present disclosure provides novel nucleic acid molecules encoding CD8-blocking polypeptides (e.g., CD8-PEBL) comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localization domain.

[0095]

[0117] CD8 is a type I transmembrane glycoprotein expressed on a subset of T cells in all cases, as well as in mature T-cell and NK-cell neoplasms. CD8 is expressed on the surface of cytotoxic T cells, but can also be found on natural killer cells, cortical thymocytes, and dendritic cells. CD8 is an antigenic determinant detectable on some acute lymphocytic leukemias, such as T-cell lymphoblastic lymphoma, and mature T-cell and NK-cell neoplasms, such as hypopigmented mycosis fungoides. CD8 can be expressed as a heterodimer consisting of CD8α and CD8β chains, but can also be expressed as a CD8α homodimer. CD8 binds to class I human leukocyte antigens (HLA) on targets. CD8 is involved in T-cell activation and function. CD8 stabilizes T-cell receptor (TCR) binding to cognate peptide-binding HLA through binding to a distinct site on HLA, a function particularly important for low-affinity TCRs. CD8 recruits the protein tyrosine kinase LCK to the CD3 complex after target binding to the TCR. The CD8α cytoplasmic domain contains a binding site for LCK, which phosphorylates immunoreceptor tyrosine-based activation motifs (ITAMs) on CD3 and transmits an activation signal through a signaling cascade that results in T cell effector function. T cells lacking CD8α or its cytoplasmic domain were unable to exert effector function after crosslinking with anti-CD3 and anti-CD8 antibodies or in the presence of target cells expressing cognate HLA.

[0096]

[0118] In some embodiments, the CD8 binding portion or CD8 blocking polypeptide (CD8 binding domain) of the CAR is an scFv antibody fragment. In some embodiments, the affinity of the CD8 binding domain for CD8 is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% of the binding affinity for CD8 of the antibody from which it is derived.

[0097]

[0119] In some embodiments, the antibody that binds to CD8 is a single-chain variable fragment ("scFv") derived from an antibody. For a review of scFvs, see Pluckthun (1994) The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315. See also WO 88 / 01649 and U.S. Pat. Nos. 4,946,778 and 5,260,203. As will be appreciated by those skilled in the art, a variety of suitable linkers can be designed and tested for optimal function, as provided in the art and as disclosed herein.

[0098]

[0120] The anti-CD8 antibody can be an scFv or single domain antibody. In some embodiments, the anti-CD8 antibody is selected from the group consisting of OKT8, LS-B3914-BCD1, RFT8, FAB1509A, 4B11, EPR21769, CAL66, CAL67, EPR20305, EPR22483-288, CAL38, EPR22331-81, EPR22331-54, OX-8, SP239, C8 / 144B, EP1150Y, BLR044F, EPR26538-16, rC8 / 468, YTS169.4, SP16, EP10640( 2), EP21769, ab4055, ab288669, EPR223341-54, EPR22331-81, ab25478, YTC182.20, CA9.JD3, CAL38, IBL-3 / 25, YTS105.18, ab90965, ab20133, ab225491, RPA-T8, 53-6.7, 4SM15, 5H10, SP16, AA51-150, ABIN94235, or ABIN94233. In some embodiments, the anti-CD8 antibody is OKT8. In some embodiments, the anti-CD8 antibody is humanized OKT8. In some embodiments, the anti-CD8 antibody sequence is codon-optimized. In some embodiments, the anti-CD8 antibody sequence is altered, for example, to facilitate cloning. In some embodiments, a single domain antibody can be a single variable domain on a heavy chain (VHH) antibody, such as caplacizumab, ozoralizumab, and bovalizumab.

[0099]

[0121] In some embodiments, the CD8 binding domain of the CAR or CD8 blocking polypeptide is an anti-CD8 scFv. In some embodiments, the CD8 binding domain of the CAR or CD8 blocking polypeptide is a murine scFv antibody fragment. In some embodiments, the CD8 binding domain of the CAR or CD8 blocking polypeptide is an scFv antibody fragment that is humanized compared to the murine sequence of the scFv from which it is derived. In some embodiments, the CD8 binding domain of the CAR or CD8 blocking polypeptide is a human scFv antibody fragment. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence having one, two, or three alterations, but not more than 30, 20, or 10 alterations, of the amino acid sequence set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence having 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv is encoded by a polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 17, 52, 71, 72, or 101. In some embodiments, the scFv is encoded by a codon-optimized polynucleotide comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71, 72, or 101. In some embodiments, the scFv is encoded by a modified polynucleotide comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71, 72, or 101, e.g., for cloning efficiency. In some embodiments, the scFv is encoded by a polynucleotide comprising a nucleic acid sequence having at least 50%, 60%, 70%, 80%, 90%, or 95% sequence identity to SEQ ID NO: 17, 52, 71, 72, or 101.

[0100]

[0122] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) having the amino acid sequence set forth in SEQ ID NO: 13. The CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain having the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the heavy chain variable region comprises an amino acid sequence having 95 to 99% identity to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13, and the light chain variable region comprises an amino acid sequence having 95 to 99% identity to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14.

[0101]

[0123] In certain embodiments, the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having amino acid sequences having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NOs: 13 and 14, respectively. The heavy chain variable region may comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13. The light chain variable region may comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14. In some cases, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In particular cases, the heavy chain variable region comprises 10 or fewer (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid substitutions in the sequence set forth in SEQ ID NO: 13. In some cases, the light chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In particular cases, the light chain variable region comprises 10 or fewer (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid substitutions in the sequence set forth in SEQ ID NO: 14. Table 1 discloses the amino acid sequences of the VH and VL regions of exemplary anti-CD8 scFvs.In some cases, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in a framework region sequence compared to the amino acid sequence set forth in SEQ ID NO: 13. In some cases, the light chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in a framework region sequence compared to the amino acid sequence set forth in SEQ ID NO: 14.

[0102]

[0124] In some embodiments, the nucleic acid sequence encoding the VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences set forth in SEQ ID NOs: 15, 16, 18, 19, and 94. In other embodiments, the nucleic acid sequence encoding the VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences set forth in SEQ ID NOs: 20-23. Table 2 discloses the nucleic acid sequences of the VH and VL regions of exemplary anti-CD8 scFvs.

[0103]

[0125] In certain embodiments, the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having sequences having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NOs: 13 and 14, respectively. The heavy chain variable region may comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13. The light chain variable region may comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14.

[0104]

[0126] In some cases, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In particular cases, the heavy chain variable region comprises 10 or fewer (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid substitutions in the sequence set forth in SEQ ID NO: 13. In some cases, the light chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In particular cases, the heavy chain variable region comprises 10 or fewer (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acid substitutions in the sequence set forth in SEQ ID NO: 14.

[0105]

[0127] In some embodiments, the nucleic acid sequence encoding the VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences set forth in SEQ ID NOs: 15, 16, 18, 19, and 94. In other embodiments, the nucleic acid sequence encoding the VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences set forth in SEQ ID NOs: 20-23.

[0106]

[0128] In some embodiments, an scFv of the disclosure comprises a variable heavy chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the variable heavy chain sequence of an anti-CD8 antibody. In some embodiments, an scFv of the disclosure comprises a variable light chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the variable light chain sequence of an anti-CD8 antibody. For example, the anti-CD8 antibody can be any recognized by one of skill in the art.

[0107] [Table 1]

[0108] [Table 2]

[0109] [Table 3]

[0110] [Table 4]

[0111] [Table 5]

[0112] [Table 6]

[0113]

[0129] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3), and a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3). In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise: (i) the amino acid sequences of SEQ ID NOs: 1-6, respectively; or (ii) the amino acid sequences of SEQ ID NOs: 7-12, respectively. In some embodiments, the CD8 binding domain comprises HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences set forth in Table 3 or Table 4.

[0114] [Table 7]

[0115] [Table 8]

[0116]

[0130] In certain embodiments, the CD8 binding domain described herein comprises: (1) one, two, or three heavy chain (HC) CDRs selected from one of the following: (i) an HC CDR1 of SEQ ID NO: 1, an HC CDR2 of SEQ ID NO: 2, and an HC CDR3 of SEQ ID NO: 3; or (ii) an HC CDR1 of SEQ ID NO: 7, an HC CDR2 of SEQ ID NO: 8, and an HC CDR3 of SEQ ID NO: 9; and / or (2) one, two, or three light chain (LC) CDRs selected from one of the following: (i) an LC CDR1 of SEQ ID NO: 4, an LC CDR2 of SEQ ID NO: 5, and an LC CDR3 of SEQ ID NO: 6; or (ii) an LC CDR1 of SEQ ID NO: 10, an LC CDR2 of SEQ ID NO: 11, and an LC CDR3 of SEQ ID NO: 12.

[0117]

[0131] In certain embodiments, the CD8 binding domain molecule described herein comprises (i) a heavy chain comprising an HC CDR1 of SEQ ID NO: 1, an HC CDR2 of SEQ ID NO: 2, and an HC CDR3 of SEQ ID NO: 3, and (ii) a light chain comprising an LC CDR1 of SEQ ID NO: 4, an LC CDR2 of SEQ ID NO: 5, and an LC CDR3 of SEQ ID NO: 6; or (i) a heavy chain comprising an HC CDR1 of SEQ ID NO: 7, an HC CDR2 of SEQ ID NO: 8, and an HC CDR3 of SEQ ID NO: 9, and (ii) a light chain comprising an LC CDR1 of SEQ ID NO: 10, an LC CDR2 of SEQ ID NO: 11, and an LC CDR3 of SEQ ID NO: 12.

[0118]

[0132] In some embodiments, the anti-CD8 binding domain comprises a Gly-Ser linker, e.g., a linker having the amino acid sequence set forth in SEQ ID NO: 29, e.g., GSTSGGGSGGGSGGGGSS. In some embodiments, the linker comprises the nucleotide sequence set forth in any of SEQ ID NOs: 30-33. The light chain variable region and heavy chain variable region of the scFv can be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0119]

[0133] In one aspect, the present disclosure provides a nucleic acid molecule encoding a CAR (e.g., an anti-CD8 CAR) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain. In one embodiment, the present disclosure provides an anti-CD8 CAR comprising a CD8 targeting domain comprising a single-chain variable fragment (scFv) (CD8 binding domain), a transmembrane domain, and a signaling domain (anti-CD8 CAR).

[0120]

[0134] In some embodiments, a CAR molecule, e.g., a recombinant CAR molecule described herein, e.g., an anti-CD8 CAR described herein, comprises a CD8 binding domain comprising: (1) one, two, or three heavy chain (HC) CDRs selected from one of the following: (i) an HC CDR1 of SEQ ID NO: 1, an HC CDR2 of SEQ ID NO: 2, and an HC CDR3 of SEQ ID NO: 3; or (ii) an HC CDR1 of SEQ ID NO: 7, an HC CDR2 of SEQ ID NO: 8, and an HC CDR3 of SEQ ID NO: 9; and / or (2) one, two, or three light chain (LC) CDRs selected from one of the following: (i) an LC CDR1 of SEQ ID NO: 4, an LC CDR2 of SEQ ID NO: 5, and an LC CDR3 of SEQ ID NO: 6; or (ii) an LC CDR1 of SEQ ID NO: 10, an LC CDR2 of SEQ ID NO: 11, and an LC CDR3 of SEQ ID NO: 12.

[0121]

[0135] In some embodiments, the anti-CD8 CAR further comprises a hinge and transmembrane sequence. In some embodiments, the intracellular signaling domain may comprise a signaling domain and one or more costimulatory domains. Hinge and transmembrane sequences suitable for use in the present disclosure are known in the art and are provided, for example, in publication WO 2016 / 126213, the entire contents of which are incorporated herein by reference. In some embodiments, the recombinant CAR molecule comprises a hinge and transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the hinge and transmembrane domain comprise the amino acid sequence set forth in SEQ ID NO: 37. In some embodiments, the hinge and transmembrane domain comprises an amino acid sequence having at least one, two, or three alterations (e.g., substitutions) but not more than 20, 10, or 5 alterations (e.g., substitutions) of the amino acid sequence of SEQ ID NO: 37, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 37. In some embodiments, the hinge and transmembrane domain comprises the nucleic acid sequence set forth in SEQ ID NO: 38. In some embodiments, the hinge and transmembrane domain of an anti-CD8 CAR can comprise a signaling domain (e.g., a transmembrane domain) from CD8β, 4-1BB, CD28, CD34, CD4, FcεRIγ, CD16, OX40, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, CD32, CD64, VEGFR2, FAS, FGFR2B, or another transmembrane protein.

[0122]

[0136] In some embodiments, the recombinant CAR molecule, e.g., an anti-CD8 CAR molecule, further comprises one or more sequences encoding an intracellular signaling domain, e.g., an intracellular signaling domain or a costimulatory domain described herein. In some embodiments, the intracellular signaling domain comprises a functional signaling domain of a protein selected from the group consisting of OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB (CD137). In some embodiments, the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 39. In some embodiments, the intracellular signaling domain comprises an amino acid sequence having at least one, two, or three alterations (e.g., substitutions) but not more than 20, 10, or five alterations (e.g., substitutions) of the amino acid sequence of SEQ ID NO: 39, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 39. In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence set forth in SEQ ID NO: 40. In some embodiments, the intracellular signaling domain of 4-1BB may be replaced with another intracellular signaling domain from a costimulatory molecule such as CD28, OX40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2. In some embodiments, the intracellular signaling domain of the CAR may have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, OX40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.

[0123]

[0137] In some embodiments, the intracellular signaling domain of 4-1BB may also include another intracellular signaling domain (or a portion thereof) from a costimulatory molecule such as CD28, OX40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2. In some embodiments, the additional intracellular signaling domain may have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, OX40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2. In other embodiments, the additional intracellular signaling domain comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to one or more intracellular signaling domain fragments of CD28, OX40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.

[0124]

[0138] In some embodiments, the recombinant CAR molecule, e.g., an anti-CD8 CAR molecule, further comprises a sequence encoding an intracellular signaling domain, e.g., an intracellular signaling domain described herein. In some embodiments, the intracellular signaling domain comprises a functional signaling domain of 4-IBB and / or a functional signaling domain of CD3 zeta. In some embodiments, the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and / or the sequence of SEQ ID NO: 41. In one embodiment, the intracellular signaling domain comprises an amino acid sequence having at least one, two, or three alterations (e.g., substitutions) but not more than 20, 10, or five alterations (e.g., substitutions) of the amino acid sequence of SEQ ID NO: 39 and / or the amino acid sequence of SEQ ID NO: 41, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 39 and / or the amino acid sequence of SEQ ID NO: 41. In one embodiment, the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and the sequence of SEQ ID NO: 41, and the sequences comprising the intracellular signaling domain are expressed in the same frame as a single polypeptide chain. In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 40 and / or the nucleic acid sequence of SEQ ID NO: 42.

[0125]

[0139] In some cases, the intracellular signaling domain comprises an immunoreceptor tyrosine-based activation motif (ITAM), or a portion thereof, so long as it has the desired function. The intracellular signaling domain of a CAR can comprise a sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to an ITAM. In certain embodiments, the intracellular signaling domain can have at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to FcεRIγ, CD4, CD7, CD8, CD28, OX40, or H2-Kb, so long as it has the desired function.

[0126]

[0140] In some embodiments, the recombinant CAR molecule, e.g., an anti-CD8 CAR molecule, further comprises a leader sequence, e.g., a leader sequence described herein. In some embodiments, the leader sequence encodes a CD8α signal peptide. In some embodiments, the leader sequence comprises the amino acid sequence of SEQ ID NO: 26, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 26. In some embodiments, the leader sequence comprises the nucleic acid sequence set forth in any of SEQ ID NOs: 27-28. In some embodiments, the leader sequence is cleaved from the mature CAR polypeptide. In some embodiments, the recombinant CAR molecule, e.g., an anti-CD8 CAR molecule, also comprises a VH-VL linker, such as, but not limited to, a peptide linker having the amino acid sequence set forth in SEQ ID NO: 29.

[0127]

[0141] In some embodiments, the present disclosure relates to engineered immune cells comprising a nucleic acid comprising a nucleotide sequence encoding a CAR comprising an antigen-binding domain, e.g., a CD8 antigen-binding domain, and one or more intracellular signaling domains selected from 4-1BB and CD3ζ. In some embodiments, the antigen-binding domain specifically binds to the alpha chain of cluster of differentiation 8 (CD8). A CAR of the present disclosure may be referred to herein as "anti-CD8-41BB-CD3ζ" (anti-CD8 CAR). Exemplary embodiments are shown in Figure 1. In some embodiments, the anti-CD8 CAR comprises the amino acid sequence set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence having at least one, two, or three modifications, but not more than 30, 20, or 10 modifications, of the amino acid sequence set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence having 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises the nucleic acid sequence set forth in SEQ ID NO: 44.

[0128]

[0142] In some embodiments, "engineered" immune cells include immune cells that are genetically modified compared to naturally occurring immune cells. In some embodiments, engineered T cells generated according to the present methods harbor a nucleic acid that includes a nucleotide sequence, e.g., a nucleic acid having the nucleotide sequence set forth in SEQ ID NO: 44, that does not naturally occur in the T cell from which it is derived.

[0129]

[0143] In some aspects, the present disclosure provides recombinant CAR molecules comprising a leader sequence, e.g., a leader sequence described herein, e.g., the leader sequence of SEQ ID NO: 26, or a leader sequence having 95-99% identity thereto; an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising an HC CDR1, an HC CDR2, an HC CDR3, an LC CDR1, an LC CDR2, and an LC CDR3 described herein, e.g., an anti-CD8 binding domain described in Table 1, 3, or 4, or an anti-CD8 binding domain having the sequence set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identity thereto; a transmembrane and hinge region, e.g., a transmembrane and hinge region described herein, e.g., the transmembrane and hinge region of SEQ ID NO: 37, or a transmembrane and hinge region with 95-99% identity thereto; an intracellular signaling domain, e.g., an intracellular signaling domain described herein. In one embodiment, the intracellular signaling domain comprises a 4-IBB domain having SEQ ID NO: 39, or a sequence having 95-99% identity thereof, and / or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3ζ stimulatory domain having SEQ ID NO: 41, or a sequence having 95-99% identity thereof. In some embodiments, the CAR molecule, e.g., an anti-CD8 CAR molecule described herein (e.g., a mature CAR molecule), does not comprise a leader sequence.

[0130]

[0144] In one aspect, the present disclosure provides a nucleotide sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 44, which encodes a recombinant CAR molecule comprising: a leader sequence, e.g., a leader sequence described herein, e.g., a CD8α signal peptide, e.g., the leader sequence of SEQ ID NO: 26, or a leader sequence having 95-99% identity thereof; an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 described herein, e.g., an anti-CD8 binding domain described in Table 1, 3, or 4 or SEQ ID NO: 24 or 25, or a sequence with 95-99% identity thereof; a transmembrane and hinge region, e.g., a transmembrane and hinge region described herein, e.g., the transmembrane and hinge region of SEQ ID NO: 37, or a transmembrane and hinge region having 95-99% identity thereof; an intracellular signaling domain, e.g., an intracellular signaling domain described herein. In some embodiments, the intracellular signaling domain comprises a 4-1BB domain having SEQ ID NO: 39, or a sequence having 95-99% identity thereto, and / or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3ζ stimulatory domain having SEQ ID NO: 41, or a sequence having 95-99% identity thereto.

[0131]

[0145] In one aspect, the present disclosure provides a recombinant CAR molecule comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence encoded by nucleotides having the nucleic acid sequence set forth in any of SEQ ID NOs: 27 or 28, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 described herein; e.g., an anti-CD8 binding domain encoded by nucleotides comprising the nucleic acid sequence set forth in any of SEQ ID NOs: 17, 52, 71, 72, or 101, an scFv linker comprising the nucleic acid sequence set forth in any of SEQ ID NOs: 30-33, a transmembrane region and a hinge region, e.g., a transmembrane region and a hinge region described herein, e.g., a transmembrane region and a hinge region encoded by nucleotides having the nucleic acid sequence set forth in SEQ ID NO: 38; and an intracellular signaling domain, e.g., an intracellular signaling domain described herein. In some embodiments, the intracellular signaling domain comprises a 4-1BB domain encoded by nucleotides comprising the nucleic acid sequence set forth in SEQ ID NO:40 and / or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain encoded by nucleotides comprising the nucleic acid sequence set forth in SEQ ID NO:42. Tables 5 and 6 disclose the amino acid and nucleotide sequences of exemplary anti-CD8 CARs and various components thereof. In some embodiments, the disclosure provides a CAR comprising an amino acid sequence according to Table 5. In some embodiments, the CAR comprises components having an amino acid sequence disclosed in Table 5. In some embodiments, a recombinant nucleic acid of the disclosure comprises a nucleotide sequence encoding a CAR according to Table 6. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a component of a CAR according to Table 6.

[0132] [Table 9]

[0133] [Table 10]

[0134] Table 11

[0135] Table 12

[0136] Table 13

[0137] Table 14

[0138] Table 15

[0139] Table 16

[0140]

[0146] As described herein, in some embodiments, the cytotoxic activity of T cells is significantly increased when an anti-CD8 CAR is used in combination with downregulation of CD8 expression on effector T cells. In some embodiments, downregulation (e.g., elimination, reduction, and / or relocalization) of CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing for greater T cell recovery after CAR expression and more effective cytotoxicity against T leukemia / lymphoma cells compared to cells that retained the target antigen (e.g., CD8). As one skilled in the art will appreciate, downregulation of CD8 expression on effector T cells can be achieved according to a variety of known methods, including, for example, "intrabodies" directed against CD8 (as described in WO 2016 / 126213; e.g., PEBL technology), RNAi directed against CD8, or gene editing methods such as, for example, meganucleases, TALENs, CRISPR / Cas9, and zinc finger nucleases.

[0141]

[0147] In certain aspects of the present disclosure, the CAR is capable of binding to molecules expressed on the surface of cells, including, but not limited to, members of the CD1 family of glycoproteins, CD2, CD3, CD4, CD5, CD7, CD8, CD25, CD28, CD30, CD38, CD45, CD45RA, CD45RO, CD52, CD56, CD57, CD99, CD127, and CD137.

[0142]

[0148] In one aspect, the present disclosure provides novel nucleic acid molecules encoding CD8-blocking polypeptides (e.g., CD8-PEBL) comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localization domain.

[0143]

[0149] In one aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a target-binding molecule linked to a localization domain (or subcellular localization domain or localization domain). In the present disclosure, the terms localization domain, subcellular localization domain, or localization domain can be used interchangeably. A "target-binding molecule linked to a localization domain (or subcellular localization domain, or localization domain)" may be referred to herein as a protein expression blocking agent (PEBL) or, in some cases, an "intrabody" as described in WO 2016 / 126213 (the teachings of which are incorporated by reference in their entirety). An exemplary embodiment of a PEBL is shown in FIG. 7. In some embodiments, the nucleotide sequence encodes a polypeptide comprising a target-binding domain, e.g., a CD8-binding domain and a subcellular localization domain, e.g., a CD8-blocking polypeptide. In some embodiments, the target-binding domain is an scFv. In some embodiments, the subcellular localization domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localization sequence. In the present disclosure, the terms retention sequence, retention signal, or retention peptide can be used interchangeably. In some embodiments, the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 in engineered cells. In some embodiments, the target binding molecule further comprises a leader sequence, e.g., a leader sequence described herein. In some embodiments, the leader sequence encodes a CD8α signal peptide. In some embodiments, the leader sequence comprises the amino acid sequence of SEQ ID NO: 26, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 26. In some embodiments, the leader sequence comprises a nucleic acid sequence set forth in any of SEQ ID NOs: 27-28. In some embodiments, the PEBL described herein is CD8-PEBL, e.g., CD8-PEBL comprising a CD8 binding molecule linked to a localization domain or an intracellular retention domain. In some embodiments, the CD8 binding molecule comprises a single-chain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody, e.g., the VH and VL domains of an OKT8 antibody.

[0144]

[0150] As used herein, "linked" in the context of a protein expression blocking agent refers to a nucleic acid sequence encoding a target binding domain directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding one or more localization domains. Alternatively, the nucleic acid sequence encoding the target binding domain can be connected to one or more nucleic acid sequences encoding one or more localization domains via a linker sequence, for example, as described in WO 2016 / 126213. In some embodiments, the nucleic acid sequence encoding the target binding domain can be connected to one or more nucleic acid sequences encoding a TM domain, for example, for KKXX ER retention. In some embodiments, the nucleic acid sequence encoding the target binding domain is directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding a TM domain, for example, for KKXX ER retention.

[0145]

[0151] In some embodiments, the target binding molecule is an antibody that binds to CD8. In some embodiments, the target binding molecule is an antigen-binding fragment. In some embodiments, the target binding molecule is an scFv. In some embodiments, the target binding molecule comprises a target binding domain, e.g., a CD8-binding domain. In some embodiments, the target binding domain is an scFv. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 24 or 25 or Table 1. In some embodiments, the scFv comprises an amino acid sequence having one, two, or three, but not more than 30, 20, or 10, modifications of the amino acid sequence set forth in SEQ ID NO: 24 or 25 or Table 1. In some embodiments, the scFv comprises an amino acid sequence having 95-99% identity to the amino acid sequence set forth in SEQ ID NO: 24 or 25 or Table 1. In some embodiments, the scFv comprises the nucleic acid sequence set forth in SEQ ID NO: 17, 52, 71, 72, or 101 or Table 2.

[0146]

[0152] In some embodiments, the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a VL sequence set forth in SEQ ID NO: 14 or Table 3. As described herein, in certain embodiments, the scFv comprises a VH and a VL having sequences having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NOs: 13 and 14, respectively.

[0147]

[0153] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) having the amino acid sequence set forth in SEQ ID NO: 13. The CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the heavy chain variable region comprises an amino acid sequence having 95 to 99% identity to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13, and the light chain variable region comprises an amino acid sequence having 95 to 99% identity to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14.

[0148]

[0154] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3), and a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3). In some embodiments, HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise: (i) the amino acid sequences of SEQ ID NOs: 1-6, respectively; or (ii) the amino acid sequences of SEQ ID NOs: 7-12, respectively. In some embodiments, the CD8 binding domain comprises HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences set forth in Table 3 or Table 4. In some embodiments, the CD8 binding domain comprises a VH and a VL comprising the amino acid sequences shown in Table 1. In some embodiments, the CD8 binding domain is encoded by a nucleic acid having a sequence set forth in Table 2.

[0149]

[0155] In some embodiments, the target binding molecules described herein, such as the anti-CD8 PEBL described herein, comprise a CD8 binding domain comprising: (i) a heavy chain comprising an HC CDR1 of SEQ ID NO: 1, an HC CDR2 of SEQ ID NO: 2, and an HC CDR3 of SEQ ID NO: 3, and (ii) a light chain comprising an LC CDR1 of SEQ ID NO: 4, an LC CDR2 of SEQ ID NO: 5, and an LC CDR3 of SEQ ID NO: 6, or (i) a heavy chain comprising an HC CDR1 of SEQ ID NO: 7, an HC CDR2 of SEQ ID NO: 8, and an HC CDR3 of SEQ ID NO: 9, and (ii) a light chain comprising an LC CDR1 of SEQ ID NO: 10, an LC CDR2 of SEQ ID NO: 11, and an LC CDR3 of SEQ ID NO: 12.

[0150]

[0156] In some embodiments, the nucleic acid sequence of any of SEQ ID NOs: 15, 16, 18, 19, and 94 encoding the immunoglobulin heavy chain variable region of the anti-CD8 scFv, and the nucleic acid sequence of any of SEQ ID NOs: 20 to 23 encoding the immunoglobulin light chain variable region of the anti-CD8 scFv are used to produce the anti-CD8 protein expression blocking agent.

[0151]

[0157] In some embodiments, the anti-CD8 binding domain further comprises a Gly-Ser linker, e.g., a linker having the amino acid sequence set forth in SEQ ID NO: 29, e.g., GSTSGGGSGGGSGGGGSS. In some embodiments, the linker comprises the nucleotide sequence set forth in any of SEQ ID NOs: 30-33. The light chain variable region and heavy chain variable region of the scFv can be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0152]

[0158] In some embodiments, the target binding molecule comprises at least one, at least two, at least three, at least four, or at least five target binding domains. In some embodiments, the target binding molecule comprises one target binding domain, e.g., a CD8 binding domain. In some embodiments, the target binding molecule comprises a first target binding domain, e.g., a first CD8 binding domain, and a second target binding domain, e.g., a second CD8 binding domain. In some embodiments, the first target binding domain and the second target binding domain are identical. In some embodiments, the first target binding domain and the second target binding domain are different. In some embodiments, the first target binding domain and the second target binding domain are connected via a linker, e.g., a peptide linker. In some embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 51 or 54. In some embodiments, the linker is encoded by a nucleic acid comprising the sequence set forth in any of SEQ ID NOs: 53, 55, or 93.

[0153]

[0159] In some embodiments, an antibody or antigen-binding fragment that binds to CD8 in the context of a CAR as described herein can be different from an antibody or antigen-binding fragment that binds to CD8 in the context of a target binding molecule (PEBL). In some embodiments, an antibody or antigen-binding fragment that binds to CD8 in the context of a CAR as described herein can be the same as an antibody or antigen-binding fragment that binds to CD8 in the context of a target binding molecule (PEBL).

[0154]

[0160] In some embodiments, the localization domain of PEBL comprises an ER or Golgi retention sequence; a proteosome localization sequence; or a transmembrane domain sequence derived from CD8α, CD8β, 4-1BB, CD28, CD34, CD4, FcεRIγ, CD16, OX40, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, CD32, CD64, VEGFR2, FAS, or FGFR2B. In some embodiments, the localization domain comprises a CD8 hinge and CD8 transmembrane domain, e.g., a CD8 hinge and CD8 transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 34. In some embodiments, the transmembrane domain comprises an amino acid sequence having at least one, two, or three, but not more than 20, 10, or 5, modifications of the amino acid sequence of SEQ ID NO: 34, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 34. In some embodiments, PEBL can downregulate or reduce surface expression of its targets. In some embodiments, PEBL further comprises a signal peptide, e.g., a signal peptide comprising the sequence set forth in SEQ ID NO: 26 or having 95-99% identity thereto. In some embodiments, PEBL further comprises a transmembrane domain. In some embodiments, the transmembrane domain contributes to intracellular localization.

[0155]

[0161] In some embodiments, the localization domain further comprises one or more of the following: ER retention peptide AEKDEL (SEQ ID NO: 56), ER retention peptide (SEQ ID NO: 58), localization domain KDEL tethered to the scFv by myc ("myc KDEL") (SEQ ID NO: 61), localization domain "mb DEKKMP" (SEQ ID NO: 63). Table 7 provides the amino acid and nucleic acid sequences of some exemplary ER retention peptide and localization domain components.

[0156] [Table 17]

[0157]

[0162] The localization domain can direct PEBL to a specific cellular compartment, such as the Golgi or endoplasmic reticulum, the proteasome, or the plasma membrane, depending on the application. In some embodiments, the ER or Golgi retention sequence comprises an amino acid sequence selected from KDEL (SEQ ID NO: 64), YQRL (SEQ ID NO: 65), KKXX (wherein X is any amino acid) (SEQ ID NO: 66), or KXD / E (e.g., KXD or KXE) (wherein X is any amino acid) (SEQ ID NO: 67). In some embodiments, the proteasome localization sequence can comprise a PEST (SEQ ID NO: 68) motif.

[0158]

[0163] In some embodiments, proteasomal localization is achieved by linking an scFv sequence to a trimolecular motif containing 21 (TRIM21) targeting domain sequence and coexpressing a sequence encoding the human TRIM21 E3 ubiquitin ligase protein. TRIM21 binds with high affinity to the Fc domain of antibodies and can recruit the ubiquitin-proteosome complex to degrade molecules (e.g., proteins and peptides) bound to the antibody. The TRIM21 targeting domain sequence encodes an amino acid sequence selected from the group of human immunoglobulin G (IgG) constant region (Fc) genes, such as IgG1, IgG2, or IgG4, and is used to form a fusion protein comprising the scFv and Fc domains. In this embodiment, the exogenously expressed TRIM21 protein binds to the scFv-Fc fusion protein bound to a target protein (e.g., CD8) and directs the complex to the proteasome for degradation.

[0159]

[0164] Details of the amino acid sequence of the human TRIM21 E3 ligase protein can be found, for example, in the NCBI Protein database under NCBI Ref. SEQ ID NO: NP_003132.2. Details of the nucleic acid sequence encoding the human TRIM21 E3 ligase protein can be found, for example, in the NCBI Protein database under NCBI Ref. SEQ ID NO: NM_003141.3.

[0160]

[0165] In certain embodiments, the protein expression blocking agent is any one or more of the PEBLs disclosed in WO 2016 / 126213 (the disclosure of which is incorporated herein by reference in its entirety for all purposes). Accordingly, the engineered immune cells described herein can comprise PEBL (a target binding molecule linked to a localization domain) as described in WO 2016 / 126213. The sequences of the components of PEBL are set forth in Figure 2, Table 1, and Table 2 of WO 2016 / 126213.

[0161]

[0166] Tables 8 and 9 disclose the amino acid and nucleotide sequences of exemplary anti-CD8 PEBL and various components thereof. In some embodiments, the anti-CD8 PEBL comprises any of the amino acid sequences shown in Table 8, e.g., SEQ ID NOs: 45-47 and 79-81. In some embodiments, the anti-CD8 PEBL comprises any of the amino acid sequences shown in Table 8, e.g., SEQ ID NOs: 95-98.

[0162]

[0167] Exemplary embodiments of anti-CD8 PEBL are shown in Figure 7. Table 8 shows the amino acid sequences of exemplary anti-CD8 PEBL and select components. In some embodiments, the present disclosure provides PEBL comprising an amino acid sequence according to Table 8. In some embodiments, the PEBL comprises a component having an amino acid sequence disclosed in Table 8.

[0163] [Table 18]

[0164] [Table 19]

[0165] [Table 20]

[0166] [Table 21]

[0167] [Table 22]

[0168] [Table 23]

[0169] [Table 24]

[0170] Table 25

[0171] Table 26

[0172] Table 27

[0173] In some aspects, the present disclosure provides a CD8 blocking polypeptide comprising the amino acid sequence set forth in any of SEQ ID NOs: 45-47, 79-81, or 95-98. In some embodiments, the CD8 polypeptide comprises the amino acid sequence set forth in any of SEQ ID NOs: 45-47 or 79-81. In some embodiments, the CD8 polypeptide comprises the amino acid sequence set forth in any of SEQ ID NOs: 95-98. In one aspect, the present disclosure provides a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., the leader sequence of SEQ ID NO: 26, or a leader sequence having 95-99% identity thereto; at least one (e.g., one, two) anti-CD8 binding domain described herein, e.g., HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 described herein; Provided are CD8 blocking polypeptides comprising an anti-CD8 binding domain comprising a CDR3, e.g., an anti-CD8 binding domain described in Tables 1, 3, or 4, or an anti-CD8 binding domain having the sequence set forth in SEQ ID NO:24 or 25, or a sequence with 95-99% identity thereto; an intracellular localization domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:66, or SEQ ID NO:67, and optionally a transmembrane domain linked between the scFv and the ER retention sequence domain, the transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:34, or an amino acid sequence having at least one, two, or three, but not more than 20, 10, or 5, alterations of the amino acid sequence of SEQ ID NO:34, or an amino acid sequence with 95-99% identity to the amino acid sequence of SEQ ID NO:34. In some embodiments, the CD8 blocking polypeptide further comprises one or more linkers comprising the amino acid sequence set forth in any of SEQ ID NOs:51 and 54. In some embodiments, the CD8 blocking polypeptide further comprises a Golgi retention sequence having an amino acid sequence selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, and SEQ ID NO: 75. In some embodiments, the CD8 blocking polypeptide further comprises a proteosome localization sequence having the amino acid sequence set forth in SEQ ID NO: 68.

[0174] In one aspect, the present disclosure provides a nucleotide comprising a nucleic acid sequence set forth in any of SEQ ID NOs: 48-50 or 99-100, which comprises a leader sequence, e.g., a leader sequence described herein, e.g., the leader sequence of SEQ ID NO: 26, or a leader sequence having 95-99% identity thereto; an anti-CD8 binding domain described herein, e.g., HC CDR1, HC CDR2, HC CDR3, LCDR1, LC CDR2, and LC CDR3 described herein; an anti-CD8 binding domain comprising a CDR3, e.g., an anti-CD8 binding domain described in Table 1, 3, or 4, or an anti-CD8 binding domain having the sequence set forth in SEQ ID NO:24 or 25, or a sequence with 95-99% identity thereto; an intracellular localization domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:66, or SEQ ID NO:67, and optionally a CD8-blocking polypeptide comprising a transmembrane domain linked between the scFv and the ER retention sequence domain, the transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:34, or an amino acid sequence having at least one, two, or three alterations, but not more than 20, 10, or 5 alterations, of the amino acid sequence of SEQ ID NO:34, or an amino acid sequence with 95-99% identity to the amino acid sequence of SEQ ID NO:34.

[0175] In one aspect, the present disclosure provides a method for producing a CD8+-antibody comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence encoded by nucleotides having the nucleic acid sequence set forth in either SEQ ID NO:27 or 28, an anti-CD8 binding domain described herein, e.g., HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 described herein. Provided are CD8-blocking polypeptides comprising an anti-CD8 binding domain comprising a CDR3; e.g., an anti-CD8 binding domain encoded by nucleotides comprising the nucleic acid sequence set forth in any of SEQ ID NOs: 17, 52, 71, 72, or 101; a transmembrane region and a hinge region, e.g., a transmembrane region and a hinge region described herein, e.g., a transmembrane region and a hinge region encoded by nucleotides having the nucleic acid sequence set forth in any of SEQ ID NOs: 35 or 36; and an ER retention sequence domain encoded by nucleotides comprising the nucleic acid sequence set forth in any of SEQ ID NOs: 57, 59, or 60, optionally further comprising one or more linkers encoded by nucleotides comprising the nucleic acid sequence set forth in any of SEQ ID NOs: 30-33, 53, 55, or 93.

[0176]

[0171] In some embodiments, the VH domain of the anti-CD8 scFv of PEBL comprises a nucleotide sequence set forth in any of SEQ ID NOs: 15, 16, 18, 19, and 94, and the VL domain of the anti-CD8 scFv of PEBL comprises a nucleotide sequence set forth in any of SEQ ID NOs: 20 to 23. In some embodiments, the VH domain of the anti-CD8 scFv of PEBL comprises a nucleotide sequence having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to any of SEQ ID NOs: 15, 16, 18, 19, and 94, and the VL domain of the anti-CD8 scFv of PEBL comprises a nucleotide sequence having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to any of SEQ ID NOs: 20-23. Table 9 shows the nucleotide sequences of exemplary anti-CD8 PEBL and select components. In some embodiments, the anti-CD8 PEBL comprises a nucleotide sequence set forth in Table 9, e.g., any of SEQ ID NOs: 48-50 or 99-100. In some embodiments, a recombinant nucleic acid of the present disclosure comprises a nucleotide sequence encoding a PEBL according to Table 9. In some embodiments, a nucleic acid comprises a nucleotide sequence encoding a component of a PEBL according to Table 9.

[0177] [Table 28]

[0178] [Table 29]

[0179] [Table 30]

[0180] [Table 31]

[0181] [Table 32]

[0182] [Table 33]

[0183] [Table 34]

[0184] [Table 35]

[0185] [Table 36]

[0186]

[0172] In some embodiments, the CAR (e.g., anti-CD8 CAR) and / or CD8 blocking polypeptide (e.g., anti-CD8 PEBL) may comprise one or more linkers (e.g., peptide linkers). Non-limiting examples of linkers include GSTSGGGSGGGSGGGGSS (SEQ ID NO:29), GGGGS (SEQ ID NO:54), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:51), or GGGGSGGGGSGGGGGS (SEQ ID NO:83), GGGGSGGGGS (SEQ ID NO:84), ((GS)n (SEQ ID NO:85), (GGS)n (SEQ ID NO:86), (Gly3Ser)n (SEQ ID NO:87), (Gly2SerGly)n (SEQ ID NO:88), (Gly2SerGly2)n (SEQ ID NO:89), or (Gly4Ser)n (SEQ ID NO:90), where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the linker is encoded by a nucleic acid having a sequence set forth in any of SEQ ID NOs:30-33, 53, 55, 82, or 93. GGCAGCACATCCGGAGGAGGCTCCGGAGGAGGCTCTGGAGGCGGCGGCTCCTCT (SEQ ID NO: 30), GGCTCCACATCCGGCGGAGGCTCTGGCGGTGGATCTGGCGGAGGCGGCTCATCC (SEQ ID NO: 31), GGCTCCACATCTGGAGGAGGATCTGGAGGAGGAAGCGGAGGAGGCGGCTCTAGC (SEQ ID NO: 32), GGATCCACATCTGGCGGCGGCTCCGGCGGGGGCTCCGGAGGAGGCGGCTCCTCT (SEQ ID NO: 33), GGCGGCGGCGGCTCTGGAGGCGGCGGAAGCGGAGGAGGAGGAAGCGGCGGCGGCGGCTCT (SEQ ID NO: 53), GGAGGTGGAGGTTCT (SEQ ID NO: 55), or GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCCGGTGGTGGTGGATCC (SEQ ID NO: 82). GGCGGCGGCGGCTCTGGAGGAGGAGGCAGCGGCGGAGGAGGCTCCGGAGGGGGCGGCTCT (SEQ ID NO: 93)

[0187]

[0173] In some embodiments, the nucleic acid sequence encoding the localization domain of the anti-CD8 protein expression blocking agent comprises a sequence selected from SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, or SEQ ID NO: 62, or a codon-optimized variant thereof.

[0188] Nucleic acids include, for example, genomic DNA, cDNA, RNA, and DNA-RNA hybrid molecules. Nucleic acid molecules can be naturally occurring, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded, or triple-stranded. In certain embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, "nucleic acid" can refer to either or both strands of the molecule.

[0189] As will be appreciated by those skilled in the art, in some embodiments, the nucleic acid comprises regulatory sequences from a plasmid. The nucleic acid sequence may include, for example, one or more of a promoter sequence, a selectable marker sequence, or a gene targeting sequence.

[0190] Codon usage bias has been reported in many organisms, from viruses to eukaryotes. Because the genetic code is degenerate (i.e., each amino acid can be coded for by an average of three different codons), DNA sequences can be modified by synonymous nucleotide substitutions without changing the amino acid sequence of the encoded protein. Such synonymous codon optimization has been performed for the purpose of optimizing expression in a desired host, as described in the scientific and patent literature. See U.S. Patent Nos. 5,786,464 and 6,114,14. In some embodiments, the nucleic acids described herein can be modified to improve cloning efficiency. In some embodiments, the nucleic acids described herein are subjected to codon optimization to increase the efficiency of gene expression; for example, SEQ ID NOs: 15, 20, 27, 30, 36, 18, 22, 32, 19, 23, 33, 94, 28, 53, 57, and 60 are codon-optimized. In some embodiments, the CD8 binding domain of the anti-CD8 CAR and / or anti-CD8 PEBL is encoded by a nucleic acid whose sequence has been codon-optimized for expression in a mammalian cell. In some embodiments, the anti-CD8 CAR described herein is encoded by a nucleic acid that has been codon-optimized for expression in a mammalian cell. In some embodiments, the anti-CD8 PEBL described herein is encoded by a nucleic acid that has been codon-optimized for expression in a mammalian cell.

[0191] As will be appreciated by those skilled in the art, in certain embodiments, any of the sequences of the various components disclosed herein (e.g., scFv, intracellular signaling domain, hinge, linker, localization sequence, and combinations thereof) may have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the specific corresponding sequence disclosed herein. For example, in certain embodiments, the intracellular signaling domain 4-1BB can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO:40, so long as it has the desired function.

[0192] In one aspect, the present disclosure provides a vector comprising a nucleic acid molecule described herein. In some embodiments, the vector comprises a nucleic acid molecule encoding a CAR described herein, e.g., an anti-CD8 CAR. In some embodiments, the vector comprises a nucleic acid molecule encoding a PEBL described herein, e.g., CD8-PEBL. In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector. In some embodiments, the vector is a murine retroviral vector, e.g., a murine stem cell virus (MSCV) retroviral vector. In some embodiments, the vector further comprises a promoter. In some embodiments, the promoter is an EF-1 promoter, an MSCV promoter, an SC40 promoter, or a PGK promoter. In some embodiments, the vector further comprises a polyA tail. In some embodiments, the promoter is an EF-1 promoter having the nucleic acid sequence set forth in SEQ ID NO: 77. In some embodiments, the promoter is an MSCV promoter having the nucleic acid sequence set forth in SEQ ID NO: 78.

[0193]

[0179] [ka]

[0194]

[0180] [ka]

[0195] In one aspect, the present disclosure provides a cell (e.g., an engineered immune cell) comprising a recombinant nucleic acid, a CAR (e.g., an anti-CD8 CAR), a CD8 blocking polypeptide (e.g., an anti-CD8 PEBL), or a vector described herein. In some embodiments, the engineered immune cell comprises a nucleic acid molecule described herein. In some embodiments, the engineered immune cell comprises a nucleic acid molecule encoding a CAR described herein, e.g., an anti-CD8 CAR. In some embodiments, the engineered immune cell comprises a nucleic acid molecule encoding PEBL described herein, e.g., CD8-PEBL. In some embodiments, the engineered immune cell comprises: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising a single chain variable fragment (scFv) and an intracellular localization domain, wherein the scFv binds to CD8 (CD8 binding domain) and the intracellular localization domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localization sequence; and (ii) a second nucleic acid encoding an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8). In some embodiments, the engineered immune cells comprise: (i) a CD8 blocking polypeptide comprising a single-chain variable fragment (scFv) and an intracellular localization domain, wherein the scFv binds to CD8 (the CD8-binding domain), and the intracellular localization domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localization sequence; and (ii) an anti-CD8 CAR comprising a CD8 targeting domain comprising a single-chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8). In some embodiments, the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 in the engineered cells. In some embodiments, the CD8 blocking polypeptide remains intracellularly in the engineered cells and binds to endogenous CD8 in the engineered cells.

[0196] In some embodiments, the engineered immune cells are engineered T cells, engineered natural killer (NK) cells, engineered NK / T cells, engineered monocytes, engineered macrophages, or engineered dendritic cells. In some embodiments, the engineered immune cells are engineered T cells. In some embodiments, the engineered T cells are CD4+ T cells, CD8+ T cells, naive T cells, or memory T cells.

[0197] In one aspect, an engineered immune cell is provided comprising: a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises the intracellular signaling domains of 4-1BB and CD3ζ, and an antibody or antigen-binding fragment that specifically binds to cluster of differentiation 8 (CD8), e.g., an anti-CD8 CAR disclosed herein, and optionally further comprising a second nucleotide sequence encoding a target binding molecule linked to a localization domain, wherein the target binding molecule is an antibody or antigen-binding fragment that binds to CD8, and the localization domain comprises an endoplasmic reticulum retention sequence, such as anti-CD8 PEBL disclosed herein. In some embodiments, the antibody that binds to CD8 in the context of the CAR and in the context of the target binding molecule comprises a CD8 binding domain disclosed herein. In some embodiments, the antibody that binds to CD8 in the context of the CAR can be the same as the antibody that binds to CD8 in the context of the target binding molecule (protein expression blocker or PEBL) as described herein, e.g., has the amino acid sequence set forth in SEQ ID NO:25. In certain embodiments, an antibody that binds to CD8 in the context of a CAR can be different from an antibody that binds to CD8 in the context of a target binding molecule (protein expression blocking agent or PEBL) as described herein. In certain embodiments, the intracellular signaling domain of 4-1BB comprises the sequence set forth in SEQ ID NO: 39. In certain embodiments, the intracellular signaling domain of CD3ζ comprises the sequence set forth in SEQ ID NO: 41.

[0198] In some embodiments, the antibody that binds to CD8 in the context of a CAR and in the context of a target binding molecule is an scFv. In some embodiments, the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a variable light chain VL sequence set forth in SEQ ID NO: 14. As described herein, in some embodiments, the scFv comprises a VH and a VL having sequences comprising at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity, respectively, to the VH and VL sequences set forth in SEQ ID NOs: 13 and 14, respectively. In some embodiments, the CAR, e.g., an anti-CD8 CAR, further comprises a hinge and transmembrane sequence, e.g., as set forth in SEQ ID NO: 37. In some embodiments, the PEBL, eg, anti-CD8 PEBL, further comprises a hinge and transmembrane sequence, eg, as set forth in SEQ ID NO:34.

[0199] As noted above, downregulation of CD8 expression on effector T cells can be achieved according to a variety of other known methods, including, for example, gene editing methods using meganucleases, TALENs, CRISPR / Cas9, and zinc finger nucleases. Thus, in certain embodiments, the engineered immune cells further comprise a modified CD8 gene, where the modification renders the CD8 gene or protein non-functional. By way of example, the engineered immune cells of the present disclosure further comprise a modified (e.g., non-functional) CD8 gene (e.g., modified using meganucleases, TALENs, CRISPR / Cas9, or zinc finger nucleases) that prevents or reduces CD8 expression and / or otherwise impairs (e.g., structurally) the CD8 protein from being recognized by an anti-CD8 CAR. Methods for modifying gene expression using such methods are readily available and well known in the art.

[0200]

[0186] Methods for inactivating target genes in immune cells using CRISPR / Cas9 technology are described, for example, in U.S. Patent Application Publication Nos. 2016 / 0272999, 2017 / 0204372, and 2017 / 0119820.

[0201] The CRISPR / Cas system is a system for inducing targeted gene mutations (genomic modifications). Target recognition by the Cas9 protein requires a "seed" sequence within the guide RNA (gRNA) and a conserved polynucleotide containing a protospacer adjacent motif (PAM) sequence upstream of the gRNA binding region. This allows the CRISPR / Cas system to be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines, primary cells, and engineered cells. The CRISPR / Cas system can simultaneously target multiple genomic loci by coexpressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes. Examples of CRISPR / Cas systems used to inhibit gene expression are described in U.S. Patent Application Publication No. 2014 / 0068797 and U.S. Patent Nos. 8,697,359 and 8,771,945. This system utilizes the RNA-guided Cas9 endonuclease to induce permanent gene disruption by introducing DNA double-strand breaks that trigger error-prone repair pathways leading to frameshift mutations. In some cases, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4 Other endonucleases may also be used, including, but not limited to, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, T7, Fok1, other nucleases known in the art, homologs thereof, or modified versions thereof.

[0202] CRISPR / Cas gene disruption occurs when a gRNA sequence specific to a target gene and a Cas endonuclease are introduced into a cell, forming a complex that allows the Cas endonuclease to introduce a double-strand break in the target gene. In some cases, the CRISPR system includes one or more expression vectors containing a nucleic acid sequence encoding the Cas endonuclease and a guide nucleic acid sequence specific to the target gene. The guide nucleic acid sequence is specific to the gene and targets the gene for Cas endonuclease-induced double-strand break. The sequence of the guide nucleic acid sequence can be within the locus of the gene. In some embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, or more nucleotides in length. The guide nucleic acid sequence includes an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combination sequence), or a sequence having synthetic nucleotides, such as peptide nucleic acid (PNA) or locked nucleic acid (LNA). The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.

[0203] In some embodiments, the engineered immune cells of the present disclosure can be modified via a CRISPR / Cas system to inactivate the human CD8 gene. Details of the genomic structure and sequence of the human CD8 gene can be found, for example, in the NCBI gene database under Gene ID No. 925 or UNIPROT ID NO. P01732.

[0204]

[0190] Commercially available kits, gRNA vectors, and donor vectors for knockout of specific target genes are available from, for example, OriGene (Rockville, Md.), GenScript (Atlanta, Ga.), Applied Biological Materials (AbM; Richmond, British Colombia), BioCat (Heidelberg, Germany), or others. For example, commercially available kits or kit components for CRISPR-mediated knockout of CD8 include those available, for example, from OriGene under catalog numbers KN201231, KN201231G1, KN201231G2, and KN201231D, respectively, and those available under catalog numbers sc-4072847, sc-4072847-KO-2, sc-4072847-HDR-2, sc-4072847-NIC, sc-4072847HDR-2, and sc-4072847-NIC-2, respectively, from Santa Cruz Biotechnology.

[0205]

[0191] In some embodiments, the chimeric antigen receptors described herein can be introduced into the human CD8 gene locus using the CRISPR / Cas system.

[0206] In one aspect, the engineered immune cells of the present disclosure have reduced expression of endogenous CD8. Reducing endogenous CD8 expression can improve cell recovery of engineered immune cells (e.g., engineered immune cells expressing an anti-CD8 CAR described herein). For example, after transducing a population of engineered immune cells with an anti-CD8 CAR and CRISPR-Cas9 or PEBL to downregulate endogenous CD8, the cytotoxicity (e.g., CD4-negative T cells) in the population of engineered immune cells can be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700% or more of the initial input cells after an incubation or culture period. In some cases, the cytotoxic T cells (e.g., using CD4 negativity as a marker) in the engineered immune cell population may be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700% or more of the initial input cells after incubation or culture for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 12 days, at least about 15 days, at least about 20 days, or more. In some cases, cell growth of engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can outgrow otherwise identical engineered immune cells expressing an anti-CD8 CAR without reduced expression of endogenous CD8.For example, after transduction and culture for a period of time (e.g., at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 12 days, at least about 15 days, at least about 20 days, or more), engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can be at least about 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 120-fold, 130-fold, 140-fold, 150-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold or more in number than otherwise identical engineered immune cells expressing an anti-CD8 CAR without reduced expression of endogenous CD8. In some cases, the cytotoxic T cells (e.g., as detected by a CD4-negative marker) in a population of engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 may be at least about 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 120-fold, 130-fold, 140-fold, 150-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold or more in number than the cytotoxic T cells in an otherwise identical population of engineered immune cells expressing an anti-CD8 CAR without reduced expression of endogenous CD8.

[0207] In some embodiments, the engineered cells comprise a population of engineered cells. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 1.1-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 5-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 10-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 25-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 50-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 60-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 70-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 80-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 90-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 100-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 125-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 150-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 175-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 200-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 250-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 300-fold greater compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced expression of endogenous CD8. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 400-fold greater compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced expression of endogenous CD8.In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 500-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 600-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 700-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 800-fold higher compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 900-fold higher compared to a population of otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 1.1-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 5-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 10-fold higher compared to an identical population of cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without a reduction in endogenous CD8 expression.In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 25-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 50-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 60-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 70-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 80-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 90-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 100-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 125-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 150-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 175-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 200-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 250-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 300-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 400-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 500-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 600-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 700-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced expression of endogenous CD8. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 800-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced expression of endogenous CD8. In some embodiments, the viability of cytotoxic T cells in the population of engineered cells is at least about 800-fold higher compared to a population of otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced expression of endogenous CD8. The expression is at least about 900-fold higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without a reduction in expression.

[0208] In some embodiments, the cytotoxicity of the engineered immune cells against target cells is higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.1-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.2-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.3-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.4-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.6-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.7-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.8-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.9-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is two-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, cytotoxicity is tested at an effector-target ratio of 5:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 4:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:4. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:5. In some embodiments, the target cells are CD8 positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.1-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.2-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.3-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.4-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.7-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.8-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduction in endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.9-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, cytotoxicity is tested at an effector-target ratio of 5:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 3: 1.In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:4. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:5. In some embodiments, the target cells are CD8 positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.

[0209]

[0195] Reducing endogenous CD8 expression in a population of engineered immune cells expressing an anti-CD8 CAR can improve the long-term cytotoxicity of cytotoxic T cells in the population. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is higher after co-culture with the target cells for a period of time, compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, cytotoxicity is represented by the number of target cells remaining after co-culture with the engineered immune cells. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is at least about 1.1-fold higher after co-culture with the target cells, compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.2-fold higher than otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.3-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.4-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.6-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.7-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.8-fold greater compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.9-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against the target cells is 4-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against the target cells is 4.5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against the target cells is 5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the engineered immune cells are co-cultured with the target cells for 2 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 20 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 30 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 40 hours.In some embodiments, the engineered immune cells are co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 100 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 110 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 120 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cells are co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 4 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 5 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 6 weeks. In some embodiments, cytotoxicity is tested at an effector-target ratio of 5:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 4:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:4. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:5. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:6.In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:7. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:8. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:10. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:12. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:15. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM. In some embodiments, the cytotoxicity of the engineered immune cells against the target cells is higher after a period of co-culture with the target cells compared to identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reducing endogenous CD8 expression. In some embodiments, cytotoxicity is represented by the number of target cells remaining after co-culture with the engineered immune cells. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is at least about 1.1-fold higher after co-culture with the target cells compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.2-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.3-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.4-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.6-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.7-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.8-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 1.9-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 2.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 3.5-fold higher compared to identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduction in endogenous CD8 expression.In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. In some embodiments, the cytotoxicity of the engineered immune cells against target cells is 4.5-fold higher compared to otherwise identical cells electroporated with Cas9 alone and expressing an anti-CD8 CAR without reduced endogenous CD8 expression. 5-fold higher compared to otherwise identical cells expressing an anti-CD8 CAR without reduction. In some embodiments, the engineered immune cells are co-cultured with the target cells for 2 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 20 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 30 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 40 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 100 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 110 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 120 hours. In some embodiments, the engineered immune cells are co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cells are co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 4 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 5 weeks. In some embodiments, the engineered immune cells are co-cultured with the target cells for 6 weeks. In some embodiments, cytotoxicity is tested at an effector-target ratio of 5:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 4:1.In some embodiments, cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 2:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:4. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:5. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:6. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:7. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:8. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:10. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:12. In some embodiments, cytotoxicity is tested at an effector-target ratio of 1:15. In some embodiments, the target cells are CD8 positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.

[0210] In some embodiments, the proliferation of engineered immune cells in the presence of target cells is higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.1-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.2-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.3-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.4-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.5-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.6-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.7-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.8-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 1.9-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 2-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 2.5-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 3-fold higher compared to engineered immune cells in the absence of target cells. In some embodiments, the proliferation of engineered immune cells in the presence of target cells is 3.5-fold higher compared to engineered immune cells in the absence of target cells.In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 4-fold higher compared to the engineered immune cells in the absence of target cells. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 4.5-fold higher compared to the engineered immune cells in the absence of target cells. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 5-fold higher compared to the engineered immune cells in the absence of target cells. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is higher compared to identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is at least about 1.1-fold higher compared to identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.2-fold higher compared to identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.3-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.4-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.5-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.6-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.7-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR.In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.8-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 1.9-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 2-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 2.5-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 3-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 3.5-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 4-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 4.5-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 5-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cells in the presence of target cells is 10-fold higher compared to otherwise identical cells with forced reduced CD8 expression but without expression of an anti-CD8 CAR. In some embodiments, proliferation of the engineered immune cells in the presence of target cells is 15-fold higher compared to identical cells with enforced reduced CD8 expression but without expression of the anti-CD8 CAR.In some embodiments, proliferation of the engineered immune cells in the presence of target cells is 20-fold higher compared to identical cells with forced reduced CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, proliferation is tested at an effector-target ratio of 5:1. In some embodiments, proliferation is tested at an effector-target ratio of 4:1. In some embodiments, proliferation is tested at an effector-target ratio of 3:1. In some embodiments, proliferation is tested at an effector-target ratio of 2:1. In some embodiments, proliferation is tested at an effector-target ratio of 1:1. In some embodiments, proliferation is tested at an effector-target ratio of 1:2. In some embodiments, proliferation is tested at an effector-target ratio of 1:3. In some embodiments, proliferation is tested at an effector-target ratio of 1:4. In some embodiments, proliferation is tested at an effector-target ratio of 1:5. In some embodiments, proliferation is tested about 2 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 4 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 6 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 7 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 10 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 12 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 14 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 16 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested at about 18 days after culturing the engineered immune cells in the presence or absence of target cells, hi some embodiments, proliferation is tested at about 20 days after culturing the engineered immune cells in the presence or absence of target cells.In some embodiments, proliferation is tested about 25 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, proliferation is tested about 30 days after culturing the engineered immune cells in the presence or absence of target cells. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.

[0211] In some embodiments, the present disclosure provides a composition, e.g., a pharmaceutical composition, comprising a CAR described herein, e.g., an anti-CD8 CAR. In some embodiments, the composition further comprises a PEBL described herein, e.g., an anti-CD8 PEBL. In some embodiments, the present disclosure provides a composition comprising an engineered immune cell described herein, e.g., an engineered immune cell comprising a nucleic acid encoding a CAR (e.g., an anti-CD8 CAR) disclosed herein, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL disclosed herein.

[0212] In some embodiments, the engineered immune cells are produced by transducing or transfecting vectors encoding an anti-CD8 CAR and an anti-CD8 protein expression blocking agent simultaneously, or within 1, 2, 3, or 4 hours of each other. In some embodiments, the anti-CD8 CAR and anti-CD8 PEBL are co-expressed using a bicistronic vector. In some embodiments, the vector encoding the anti-CD8 CAR is transduced or transfected after expression of the vector encoding the anti-CD8 protein expression blocking agent, for example, the vector encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocking agent is transduced or transfected.

[0213] In some aspects, the present disclosure provides methods of downregulating CD8 expression by a target binding molecule, e.g., PEBL, e.g., CD8-PEBL. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL, downregulates CD8 expression. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL, downregulates CD8α expression. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL, downregulates CD8 expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100%. In some embodiments, the targeted binding molecule, e.g., anti-CD8 PEBL, downregulates CD8α expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or 100%. In some embodiments, the targeted binding molecule, e.g., anti-CD8 PEBL, downregulates CD8 expression for at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely.In some embodiments, the targeted binding molecule, e.g., anti-CD8 PEBL, downregulates CD8α expression for at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely.

[0214] In some embodiments, the present disclosure provides methods of reducing fratricide by immune cells expressing a CAR disclosed herein, e.g., an anti-CD8 CAR, by expressing a target binding molecule, e.g., CD8-PEBL, in the immune cells. In some embodiments, the anti-CD8 CAR and CD8-PEBL are administered together, e.g., by co-expressing the anti-CD8 CAR and CD8-PEBL using a bicistronic vector. In some embodiments, the anti-CD8 CAR and CD8-PEBL are administered sequentially, e.g., a nucleotide sequence encoding CD8-PEBL is transduced or transfected into the immune cells before transducing or transfecting the nucleotide sequence encoding the anti-CD8 CAR, e.g., the nucleotide sequence encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocking agent is transduced or transfected.

[0215]

[0201] The present disclosure provides a CD8-directed CAR. As demonstrated herein, expression of an anti-CD8 CAR in immune cells, such as effector T cells, induces the T cells to exert specific cytotoxicity against T cell malignancies. This cytotoxic effect was shown to be enhanced when CD8 expression on effector T cells was downregulated using an antibody-based molecule (protein expression blocking agent or PEBL) targeted to CD8 downregulation. Thus, the present disclosure provides an immunotherapy for treating cancer, e.g., T cell malignancies.

[0216] In other aspects, methods of killing CD8-positive cells in a subject in need thereof are also provided, the methods comprising administering to the subject a therapeutic amount of engineered immune cells having any of the embodiments described herein, thereby treating the disease in the subject in need thereof. In some embodiments, the present disclosure provides use of a CAR (e.g., an anti-CD8 CAR), engineered immune cells (engineered immune cells comprising a nucleic acid encoding a CAR (e.g., an anti-CD8 CAR) disclosed herein, and optionally further comprising a second nucleic acid encoding a CD8-blocking polypeptide (e.g., anti-CD8 PEBL)), or a composition comprising the engineered immune cells disclosed herein, in the manufacture of a medicament for killing CD8-positive cells in a subject in need thereof.

[0217] In other aspects, methods of treating cancer in a subject in need thereof are also provided, the methods comprising administering to the subject a therapeutic amount of engineered immune cells having any of the embodiments described herein, thereby treating the cancer in the subject in need thereof. In some embodiments, the present disclosure provides use of a CAR (e.g., an anti-CD8 CAR), engineered immune cells (engineered immune cells comprising a nucleic acid encoding a CAR (e.g., an anti-CD8 CAR) disclosed herein, and optionally further comprising a second nucleic acid encoding a CD8-blocking polypeptide (e.g., anti-CD8 PEBL)), or a composition comprising the engineered immune cells disclosed herein, in the manufacture of a medicament for treating cancer in a subject in need thereof.

[0218]

[0204] In certain embodiments, the method includes administering a therapeutic amount of engineered immune cells comprising a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises the intracellular signaling domains of 4-1BB and CD3ζ and an antibody that binds to CD8, as described herein.

[0219]

[0205] In certain embodiments, the method includes administering a therapeutic amount of engineered immune cells that further comprise a nucleic acid having a nucleotide sequence encoding a target binding molecule (e.g., an anti-CD8 protein expression blocking agent) linked to a localization domain as described herein.

[0220]

[0206] In certain embodiments, the use comprises administering a therapeutic amount of the engineered immune cells or compositions described herein to a subject in need thereof.

[0221] In certain embodiments, the cancer is a T-cell malignancy, e.g., a T-cell leukemia or T-cell lymphoma, such as T-cell acute lymphoblastic leukemia, T-cell prolymphocytic leukemia, T-cell large granular lymphoma, enteropathy-associated T-cell lymphoma, hepatosplenic T-cell lymphoma, subcutaneous disseminated T-cell lymphoma, mycosis fungoides, Sézary syndrome, primary cutaneous gamma delta T-cell lymphoma, peripheral T-cell lymphoma not otherwise specified, angioimmunoblastic T-cell lymphoma, or anaplastic large cell lymphoma. In certain embodiments, the T-cell malignancy is early stage T-cell precursor acute lymphoblastic leukemia (ETP-ALL). In certain embodiments, the cancer is an NK-cell malignancy, e.g., NK / T-cell lymphoma, nasal type (ENKL), or aggressive NK-cell leukemia (ANKL).

[0222] In some embodiments, the engineered immune cells are autologous to the subject in need of treatment, e.g., cancer treatment. In other embodiments, the engineered immune cells are allogeneic to the subject in need of treatment.

[0223] In another aspect, there is also provided a use of engineered immune cells having any of the embodiments described herein for treating cancer, comprising administering a therapeutic amount of the engineered immune cells to a subject in need thereof. In certain embodiments, the cancer is a T-cell malignancy. In certain embodiments, the T-cell malignancy is early stage T-cell precursor acute lymphoblastic leukemia (ETP-ALL). In certain embodiments, the cancer is an NK-cell malignancy.

[0224] In another aspect, a method for generating an engineered immune cell having any of the embodiments described herein is also provided, the method comprising introducing into an immune cell a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises the intracellular signaling domains of 4-1BB and CD3ζ and an antibody that binds to CD8. In certain embodiments, the method further comprises introducing into the immune cell a nucleic acid comprising a nucleotide sequence encoding a target binding molecule (e.g., an anti-CD8 protein expression blocking agent or anti-CD8 PEBL) linked to a localization domain. In certain embodiments, the nucleotide sequence encoding the CAR and the nucleotide sequence encoding anti-CD8 PEBL are introduced on a single plasmid, for example, using a bicistronic vector. Also outlined herein are methods and kits for producing the engineered immune cells described herein (e.g., T cells, natural killer (NK) cells, NK / T cells, monocytes, macrophages, or dendritic cells). The present disclosure also describes the use of any of the engineered immune cells or compositions outlined herein to treat cancer.

[0225] In some embodiments, provided herein are methods for producing the engineered immune cells described herein. The method can include introducing into an immune cell a nucleic acid comprising a nucleotide sequence encoding a CAR, where the CAR comprises the intracellular signaling domains of 4-1BB and CD3ζ, and an antibody that binds to CD8, thereby producing the engineered immune cell. The method can further include introducing into the immune cell a nucleic acid comprising a nucleotide sequence encoding a target binding molecule linked to a localization domain. In some embodiments, the method further includes functional inhibition of CD8 signaling during the cell manufacturing process. In some embodiments, the functional inhibition of CD8 signaling includes reducing expression of endogenous CD8 in the immune cell. In some embodiments, endogenous CD8 in the immune cell is knocked out or knocked down.

[0226] In various aspects, kits for generating the engineered immune cells described herein are also provided. The kits can be used to generate T cells, e.g., allogeneic or autologous T cells, with anti-CD8 CAR-mediated cytotoxic activity. In some embodiments, the kits are useful for generating allogeneic effector T cells with anti-CD8 CAR-mediated cytotoxic activity. In certain embodiments, the kits are useful for generating autologous effector T cells with anti-CD8 CAR-mediated cytotoxic activity.

[0227]

[0213] Accordingly, provided herein is a kit comprising a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises the intracellular signaling domains of 4-1BB and CD3ζ, and an antibody that binds to CD8 (e.g., an anti-CD8 CAR disclosed herein). The nucleotide sequence encoding the anti-CD8 CAR can be designed according to any of the embodiments described herein.

[0228] In certain embodiments, the kit further comprises a nucleic acid having a nucleotide sequence encoding a target-binding molecule (e.g., an anti-CD8 PEBL molecule described herein) linked to a localization domain as described herein. The nucleotide sequence encoding the localization domain-linked target-binding molecule can be designed according to any of the embodiments described herein.

[0229] In certain embodiments, the nucleotide sequence encoding the anti-CD8 CAR and / or the nucleotide sequence encoding the anti-CD8 PEBL are linked to, for example, a sequence that allows for cloning and / or expression (e.g., a plasmid or vector sequence). For example, the nucleotide sequence may be provided as part of a plasmid for ease of cloning into other plasmids and / or vectors (expression vectors or viral expression vectors), e.g., for transfection, transduction, or electroporation into cells (e.g., immune cells). In certain embodiments, the nucleotide sequence encoding the anti-CD8 CAR and the nucleotide sequence encoding the anti-CD8 PEBL are provided on a single plasmid or vector (e.g., a single construct comprising the anti-CD8 CAR and anti-CD8 PEBL). In certain embodiments, the nucleotide sequences are provided on separate plasmids or vectors (expression vectors or viral expression vectors).

[0230] Typically, the kit is compartmentalized for ease of use and may include one or more containers with reagents. In certain embodiments, all of the components are packaged together. Alternatively, one or more individual components of the kit may be provided in a package separate from the other kit components. The kit may also include instructions for use of the kit components.

[0231]

[0217] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the disclosure, and it will be understood by their illustrative nature that other procedures, methods, or techniques known to those skilled in the art may alternatively be used. [Example]

[0232] Example Example 1: Materials and Methods

[0218] This example relates to materials and methods used in the experiments disclosed in Examples 2-8.

[0233] Cells and culture conditions: The T cell ALL lines Jurkat, CCRF-CEM, and MOLT-4, the lymphoblastoid cell line T2, and the NK cell line NK92 were obtained from the American Type Culture Collection (ATCC; Rockville, MD). Jurkat, MOLT-4, and T2 were maintained in RPMI-1640 (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. NK92 was maintained in 12.5% ​​FBS, 12.5% ​​horse serum (Sigma-Aldrich, St. Louis, MO), and 1% penicillin-streptomycin, supplemented with 200 IU / mL IL-2 (Novartis, Basel, Switzerland) three times a week. The cell lines were characterized by the donor for molecular and / or gene expression characteristics. The cell lines were expanded and cryopreserved after receipt. Experimental cells were obtained from recently thawed vials.

[0234] Peripheral blood mononuclear cells were obtained by separating blood samples using a Lymphoprep density step (Nycomed, Oslo, Norway). Samples were collected from discarded anonymous by-products provided by the Health Sciences Authority of Singapore Blood Bank. After separation, cells were washed twice with RPMI-1640.

[0235] Gene cloning and retroviral transduction: Anti-CD8α scFv was obtained from Genscript (Piscataway, NJ) according to the sequence of humanized scFv derived from the OKT8 antibody. For CAR, anti-CD8α scFv was conjugated to the CD8α signal peptide, CD8α hinge and transmembrane domain, and the intracellular domains of 4-1BB and CD3ζ. For protein expression blocker (PEBL), anti-CD8α scFv was conjugated to the CD8α signal peptide, CD8α hinge, and transmembrane domain linked to the ER retention peptide KYKSRRSFIEEKKMP or AEKDEL via a (GGGGS)4 linker. PEBL with two scFv sequences linked by 5 or 20 amino acids was also generated. Murine stem cell virus (MSCV) retroviral vector was obtained from St. Jude Children's Research Hospital Vector Development and Production Shared Resource (Memphis, TN). The retroviral vector-conditioned medium was added to a RetroNectin (Takara, Otsu, Japan)-coated polypropylene tube; after centrifugation and removal of the supernatant, T cells (5 × 105) previously activated with Transact (Miltenyi Biotec, Bergisch Gladbach, Germany) were added to the tube and left at 37 °C for 24 hours. In some cases, T cells were electroporated to eliminate CD8 expression using CRISPR three days before transduction. This process was repeated twice. T lymphocytes were then maintained in RPMI-1640 containing FBS, antibiotics, and 200 IU / mL IL-2 until the time of the experiment. Control cells were transduced with an MSCV retroviral vector containing only GFP.

[0236] CRISPR-mediated CD8 knockout Guide RNA (gRNA) for the CD8α gene and Cas9 nuclease with a nuclear localization signal (NLS-Cas9) were obtained from Genscript. The gRNA and Cas9 were combined and incubated at room temperature for 10 minutes to form a ribonucleoprotein (RNP) complex. Day 2-expanded T cells were suspended in electroporation buffer (Lonza, Basel, Switzerland) and mixed with NLS-Cas9 or RNP alone. The mixture was electroporated using the U-014 program in an Amaxa Nucleofactor II electroporator (Lonza).

[0237] Detection of scFv and surface antigens CAR expression was detected using biotin-conjugated goat anti-mouse F(ab')2 antibody (Jackson ImmunoResearch, West Grove, PA) or biotin-conjugated goat anti-human F(ab')2 antibody (Jackson ImmunoResearch), followed by streptavidin conjugated to allophycocyanin (APC; Jackson ImmunoResearch). PEBL expression was detected by permeabilizing cells with BD Cytofix / Cytoperm (BD Biosciences, San Jose, CA), followed by sequential staining with biotin-conjugated goat anti-human F(ab')2 antibody (Jackson ImmunoResearch) and streptavidin conjugated to phycoerythrin (PE; Jackson ImmunoResearch). Surface expression of CD3, CD8, and CD4 was detected with APC-conjugated anti-human CD3 (clone SK7; BD Biosciences), PE-conjugated anti-human CD8 (clone RPA-T8; BD Pharmingen, San Diego, CA), and PECy7-conjugated anti-human CD4 (clone SK3; BD Biosciences). Stained cells were fixed with 0.5% formaldehyde (Polysciences, Warrington, PA) and analyzed using a Fortessa flow cytometer (BD Biosciences). Expression of the S183 TCR was detected with fluorescein isothiocyanate (FITC)-conjugated anti-human TCRvβ3 antibody (Beckman Coulter, Brea, CA).

[0238] Cytotoxicity assay Cytotoxicity was tested by labeling target cells with Calcein AM Red Orange (Invitrogen, Carlsbad, CA) and 1 x 10 cells per well. 5Cells were plated at a cell concentration of 1000x1000x1000 in a 96-well round-bottom plate (Corning Costar, Corning, NY). NK92 or T cells were added at the appropriate effector:target (E:T) ratio and co-cultured with target cells for 4 hours at 37°C and 5% CO2. After 4 hours, 100 μL of 0.5% formaldehyde was added to each well, and the number of viable target cells was counted using an Accuri C6 Plus cytometer (BD Biosciences).

[0239] In a 96-well flat-bottom plate (Corning Costar), 4 x 10 expressing target cells were 4 Long-term cytotoxicity was tested by plating mCherry in the appropriate E:T medium. T cells were added to the appropriate E:T medium and cultured for 120 hours at 37°C and 5% CO2 in an Incucyte Zoom imaging system (Essen Bioscience, Ann Arbor, MI). IL-2 (120 IU / mL) was added three times weekly. Cultures were imaged every 4 hours, and the mCherry signal released from target cells was quantified.

[0240] Proliferation assay Transduced T cells were cultured in 96-well flat-bottom plates at a 1:1 E:T ratio with or without 100 Gy gamma-irradiated MOLT-4. 120 IU / mL IL-2 was added three times a week. GFP-positive cells, representing transduced T cells, were counted every 7 days using an Accuri C6 Plus cytometer. Irradiated MOLT-4 was replenished every 7 days to maintain a 1:1 ratio.

[0241] TCR activation assay The hepatitis B virus peptide S183 and a TCR construct that binds the peptide in the context of HLA-A2 were a gift from Professor Antonio Bertoletti (Duke-NUS, Singapore). The TCR was expressed in T cells by retroviral vector transduction as described above. HLA-A2-expressing T2 cells were pulsed with 1 μg / mL of S183 peptide for 1 h at 37°C and cocultured with T cells at a 1:1 ratio in 96-well round-bottom plates in the presence of 200 IU / mL of IL-2 for 24 h at 37°C. T cells were either untransduced, transduced with a vector containing anti-CD8 PEBL linked to the TCR by an internal ribosome entry site (IRES), or transduced with a vector containing only the TCR. After 24 hours, cells were stained with PE-conjugated anti-CD25 (clone 2A3; BD Biosciences), peridinin-chlorophyll-protein complex conjugate (PerCP)-conjugated anti-CD3 (clone SK7; BD Biosciences), PECy7-conjugated anti-CD4, and APC-conjugated anti-CD8 (clone BW135 / 80; Miltenyi Biotec). Stained cells were analyzed using a Fortessa flow cytometer. T2 cell killing was measured by flow cytometry after labeling T2 cells with calcein AM-red orange.

[0242] Example 2: Design and expression of anti-CD8 CAR To target CD8, an anti-CD8 CAR was designed by linking the humanized scFv of the anti-CD8α antibody OKT8 to the hinge and transmembrane domains of CD8α and the signaling domains of 4-1BB (CD137) and CD3 zeta (FIG. 1) using the methods described in Example 1. The resulting CAR construct was inserted into an MSCV gamma-retroviral vector along with a DNA sequence encoding GFP. After retroviral transduction into CD8-negative NK92 cells, the transduced cells, marked by GFP expression, also expressed the anti-CD8 CAR (FIG. 2).

[0243] Example 3: Expression of anti-CD8 CAR on NK92 cells induces specific cytotoxicity of CD8-positive target cells Cytotoxicity assays were performed using the anti-CD8 CAR of Example 2 according to the method described in Example 1. MOLT-4 (CD8+) and Jurkat (CD8-) target cells were labeled with calcein AM red orange and co-cultured with NK92 cells transduced with GFP only ("mock") or GFP + anti-CD8α-41BB-CD3ζ CAR at effector-to-target (E:T) ratios of 1:2, 1:4, and 1:8 for 4 hours at 37°C. (***P<0.001, ****P<0.0001).

[0244] The results show that NK92 cells expressing anti-CD8 CARs exerted significantly higher cytotoxicity against CD8-positive MOLT-4 leukemia cells (Figure 3, left panel). In contrast, no increase in cytotoxicity was observed against CD8-negative Jurkat leukemia target cells (Figure 3, right panel).

[0245] Example 4: Expression of anti-CD8 CAR in T lymphocytes is associated with reduced CD8-positive cell viability Peripheral blood T lymphocytes were stimulated with anti-CD3 / anti-CD28 antibodies (Transact, Miltenyi Biotec) for two days and then transduced with a bicistronic vector to express either GFP alone ("mock") or GFP plus anti-CD8α-41BB-CD3ζ CAR. After two days, expression of the anti-CD8 CAR was determined by the method outlined in Example 1. The resulting cells expressed both anti-CD8 CAR and GFP (Figure 4). Expression of the anti-CD8 CAR in T lymphocytes induces lymphocyte killing. T lymphocytes were co-expressed with either GFP alone ("mock") or GFP plus anti-CD8α-41BB-CD3ζ CAR. Mock and CAR T lymphocytes were harvested, and viable cells were counted 48 hours later.

[0246] In contrast to anti-CD8 CAR expression in NK92 cells, anti-CD8 CAR expression in peripheral T lymphocytes was associated with a significant decrease in cell recovery (Figure 5). The average T cell recovery 48 hours after anti-CD8 CAR viral transduction was 9.6% of that of parallel mock-transduced T cells (Figure 5). T lymphocytes transduced with GFP alone ("mock") or anti-CD8 CAR were stained with PE-conjugated anti-CD8, PECy7-conjugated anti-CD4, and APC-conjugated anti-CD3 antibodies. Flow cytometry plots show CD4 and CD8 expression in GFP+CD3+ cells. Analysis of CD4 and CD8 expression after transduction showed that the majority of CD8-positive cells disappeared, with the majority of remaining surviving cells being CD4-positive (Figure 6). These results demonstrate fratricide among CD8-positive T cells expressing anti-CD8 CAR.

[0247] Example 5: Identification of anti-CD8α PEBL that effectively downregulates CD8 expression on T lymphocytes To downregulate CD8 expression, we used protein expression blockers (PEBLs), i.e., scFvs linked to peptides that anchor them to the endoplasmic reticulum and / or Golgi apparatus. Five PEBLs were designed, consisting of OKT8 scFvs linked to the ER retention domains KYKSRRSFIEEKKMP (EEKKMP) and AEKDEL (Figure 7). MOLT-4 cells were transduced with retroviral vectors containing either GFP alone (mock) or GFP + designated PEBLs. Transduced MOLT-4 cells were surface stained with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody. Dot plots represent GFP + cells. After transduction, PEBL significantly reduced CD8 expression on the surface of MOLT-4 cells (Figure 8). PEBL expression in transduced MOLT-4 cells was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab')2 antibody followed by phycoerythrin (PE)-conjugated streptavidin after permeabilization with BD Cytofix / Cytoperm. The histogram shows the level of anti-CD8 PEBL expression in GFP-positive cells (Figure 9).

[0248] Similar results were observed in T lymphocytes (Figure 10). T lymphocytes were transduced with GFP only ("mock") or GFP + the indicated PEBL. Transduced T lymphocytes were stained with PE-conjugated anti-CD8, Pecy7-conjugated anti-CD4, and APC-conjugated anti-CD3 antibodies. Symbols indicate CD8 MFI in GFP-expressing CD3+ / CD4- cells. Mock and anti-CD8-EEKKMP were transduced in seven donors. Bi(20)-anti-CD8-EEKKMP was transduced in four donors. Bi(5)-anti-CD8-EEKKMP was transduced in six donors. Anti-CD8(20)AEKDEL and bi(5)-anti-CD8(20)AEKDEL were transduced in two donors (****P<0.0001). Surface CD8 expression was reduced in all PEBLs among GFP-expressing CD4-negative T lymphocytes (Figure 10). Anti-CD8 PEBLs were well expressed in T lymphocytes (Figure 11). Anti-CD8-EEKKMP PEBLs had the highest expression (Figure 11) and resulted in the greatest downregulation of CD8 (Figure 10). Downregulation persisted for at least 25 days (Figure 12). Because the transduction efficiency of PEBLs containing single or dual scFvs varied, surface CD8 expression was analyzed according to the level of GFP expression (Figure 13). Regression analysis based on GFP and CD8 MFI between GFP-expressing CD3+ and CD4- cells was performed. This analysis revealed that the presence of one or two scFvs in PEBL resulted in a comparable reduction in surface CD8 (Figure 13). The results demonstrate that cells with the highest GFP expression, indicating high anti-CD8 PEBL expression, also had the greatest reduction in cell surface CD8 levels. Anti-CD8-EEKKMP was used as an exemplary anti-CD8 PEBL for subsequent studies.

[0249] Example 6: Sequential transduction of anti-CD8 PEBL and anti-CD8 CAR suppresses fratricide and improves killing of CD8+ target cells The examples demonstrate that reducing CD8 surface expression with anti-CD8 PEBL improves the recovery of anti-CD8 PEBL CAR-T cells, enabling them to exert greater cytotoxicity against CD8-positive cells. Peripheral blood T lymphocytes were transduced with either anti-CD8-EEKKMP or a vector containing GFP alone (mock). The next day, half of the cells were transduced with anti-CD8 CAR and collected on day 3. As shown in Figure 14, the CAR was highly expressed regardless of the construct used in the previous transduction. To measure the effects of anti-CD8-EEKKMP and anti-CD8 CAR on CD4- and CD8-positive T cells, the transduced cells were surface stained with PE-conjugated anti-CD8 antibody, PECy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody, and then analyzed by flow cytometry using a gate for GFP+ and CD3+ cells. Expression of anti-CD8 CAR substantially reduced the percentage of CD8-positive cells, even without expression of anti-CD8-EEKKMP PEBL (Figure 15). Expression of anti-CD8 CAR also substantially reduced the number of viable cells, an effect that was reversed by expression of anti-CD8-EEKKMP PEBL (Figure 16). Together, these results indicate that anti-CD8 CAR induces fratricide of CD8-positive T cells and that fratricide can be prevented by expressing anti-CD8-EEKKMP PEBL.

[0250] To determine the effect of anti-CD8 PEBL on T cell activity, a cytotoxicity assay was performed. T lymphocytes were first transduced with GFP alone ("mock") or GFP plus anti-CD8-EEKKMP. Half of the transduced T lymphocytes were sequentially transduced with GFP plus anti-CD8 CAR. Transduced T lymphocytes were cocultured with calcein-AM red-orange-labeled CD8-positive MOLT-4 cells and transduced T cells at 2:1, 1:1, and 1:2 E:T ratios for 4 hours. (*P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001). Anti-CD8-PEBL(EEKKMP) CAR-T cells exerted significantly greater cytotoxicity against CD8-positive MOLT-4 target cells than T lymphocytes expressing the anti-CD8 CAR but without PEBL transduction and CD8 downregulation (Figure 17). These results demonstrate that reduced CD8 expression surprisingly enhances the cytotoxic activity of anti-CD8 CAR T cells.

[0251] Example 7: Expression of anti-CD8 PEBL does not impair TCR-driven T cell function The effect of PEBL-mediated downregulation was examined in T cells engineered to express the HLA-A201-restricted S183 TCR. T lymphocytes were transduced with anti-CD8-EEKKMPPEBL, which bound to the HLA-A201-restricted S183 TCR via an internal ribosome entry site (IRES), or with an IRES-TCR. T2 target cells were pulsed with the S183 peptide and labeled with calcein AM-red orange. Subsequently, labeled T2 cells were cocultured with untransduced T cells, T cells expressing only the TCR, or T cells expressing both the TCR and PEBL. Untransduced, IRES-TCR-, or PEBL-IRES-TCR-transduced T lymphocytes were cocultured with T2 cells for 4 hours, pulsed with S183 peptide, and labeled with calcein AM at E:T ratios of 2:1, 1:1, and 1:2 (****P<0.0001). The results showed that T cells expressing TCRs with or without PEBL exerted similar cytotoxicity against pulsed T2 target cells (Figure 18).

[0252] To examine the effect of reduced CD8 expression on T cell receptor-mediated T cell activation, T lymphocytes were transduced with either anti-CD8-EEKKMP linked to the HLA-A201-restricted S183 TCR via an internal ribosome entry site (IRES) or the IRES-TCR with pulsed T2 at a 1:1 ratio for 24 hours. Untransduced, IRES-TCR, or PEBL-IRES-TCR-transduced T lymphocytes were cocultured with or without T2 pulsed with the S183 peptide for 24 hours. Subsequently, cells were stained with PE-conjugated anti-CD25, PerCP-conjugated anti-CD3, PECy7-conjugated anti-CD4, and APC-conjugated anti-CD8 antibodies. Flow cytometry plots and graphs show the expression of CD25 and CD8 in CD3+CD4- cells. (****P<0.0001). T2 cells presenting the S183 peptide induced CD25 expression (T cell activation) by T cells expressing the HLA-A201-restricted S183 TCR, with or without anti-CD8 PEBL, but did not activate control T cells that did not express the S183 TCR (Figure 19), indicating that anti-CD8 PEBL did not impair TCR-mediated T cell activation.

[0253] Example 8: Expression of anti-CD8 CAR in CD8 knockout cells improves their cytotoxicity We examined the recovery of cytotoxic T cells after anti-CD8 CAR transduction. Anti-CD8 CAR was transduced into T cells that underwent CD8 knockout (CD8KO-CAR) or not (Cas9-CAR). Cells were counted 3, 7, and 10 days after transduction. CD4-negative cells were identified by flow cytometry using PE-conjugated anti-human CD8 and PECy7-conjugated anti-human CD4 antibodies. As shown in Figure 20, the number of CD8 knockout cells was higher than that of CD8 wild-type cells. This suggests that CD8 knockout by CRISPR-Cas9 improves the recovery of cytotoxic T cells after transduction of anti-CD8α-41BB-CD3ζ CAR.

[0254] To further investigate the effect of CD8 knockout on cytotoxicity against CD8+ cell lines, T cells electroporated with NLS-Cas9 alone ("Cas9") or a complex of NLS-Cas9 and CD8α gRNA ("CD8KO") were transduced with either GFP alone or anti-CD8 CAR and GFP. MOLT-4 (Figure 21A) and CCRF-CEM (Figure 21B) cells labeled with calcein AM red orange were cocultured with T cells transduced at 2:1, 1:1, and 1:2 E:T ratios for 4 hours. CD8 knockout cells expressing anti-CD8 CAR had higher cytotoxicity rates against both MOLT-4 and CCRF-CEM cells, as shown in Figures 21A and 21B. This suggests that expression of anti-CD8 CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines.

[0255] To test the duration of cytotoxicity of CD8 knockout CAR-expressing cells against CD8+ cell lines, T cells electroporated with NLS-Cas9 alone ("Cas9") or a complex of NLS-Cas9 and CD8α gRNA ("CD8KO") were transduced with either GFP alone or an anti-CD8 CAR and GFP. The transduced T cells were cocultured with mCherry-expressing MOLT-4 (Figure 22A) or CCRF-CEM (Figure 22B) at the indicated ratios in flat-bottom 96-well plates. As shown in Figures 22A and 22B, the cytotoxicity of CD8 knockout cells was higher than that of CD8 wild-type cells at 40, 80, and 120 hours against both MOLT-4 and CCRF-CEM. Thus, anti-CD8 CAR-T cells with a CD8 knockout induce greater long-term cytotoxicity against CD8+ leukemia cell lines than CAR-T cells without a CD8 knockout.

[0256] To test the proliferation of CD8 knockout CAR-expressing cells, CD8 knockout T cells were transduced with GFP alone or with anti-CD8 CAR and GFP and co-cultured 1:1 in triplicate with or without 100 Gy-irradiated MOLT-4 cells. As shown in Figure 23, CD8 knockout cells expressing anti-CD8 CAR proliferated faster in the presence of MOLT-4 cells compared to their absence. This suggests that CD8 knockout anti-CD8 CAR-T cells proliferate in the presence of CD8+ target cells.

[0257]

[0243] The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety.

[0258] equivalent

[0244] While the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is intended to illustrate, but not limit, the scope of the invention as defined by the appended claims. Certain aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), comprising: A recombinant nucleic acid molecule comprising an antigen-binding domain that binds to CD8, a transmembrane domain, and an intracellular signaling domain.

2. 2. The recombinant nucleic acid molecule of claim 1, wherein the antigen-binding domain is a single-chain variable region (scFv) or a single-domain antibody.

3. the antigen-binding domain a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3); and a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3); the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 are i. SEQ ID NOs: 1-3, 6, respectively; or ii. SEQ ID NOs: 7 to 12, respectively 3. The recombinant nucleic acid molecule of claim 1, comprising the amino acid sequence:

4. the antigen-binding domain a) i. a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; ii. an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the heavy chain variable region amino acid sequence set forth in SEQ ID NO: 13; or iii. An amino acid sequence having 95 to 99% identity with the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and b) i. a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; ii. an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, alterations of the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14; or iii. An amino acid sequence having 95 to 99% identity with the amino acid sequence of the light chain variable region shown in SEQ ID NO: 14 The recombinant nucleic acid molecule according to any one of claims 1 to 3, comprising:

5. the antigen-binding domain i. the amino acid sequence set forth in SEQ ID NO: 25; ii. an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the amino acid sequence set forth in SEQ ID NO: 25; or iii. An amino acid sequence having 95 to 99% identity with the amino acid sequence shown in SEQ ID NO: 25 The recombinant nucleic acid molecule according to any one of claims 1 to 3, comprising:

6. 6. The recombinant nucleic acid molecule of any one of claims 1 to 5, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of CD8α, CD8β, 4-1BB, CD28, CD34, CD4, FcεRIγ, CD16, OX40, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, CD32, CD64, VEGFR2, FAS, or FGFR2B.

7. The recombinant nucleic acid molecule of any one of claims 1 to 6, wherein the transmembrane domain comprises the sequence of SEQ ID NO:

37.

8. 8. The recombinant nucleic acid molecule of any one of claims 1 to 7, wherein the transmembrane domain comprises an amino acid sequence having at least one, two, or three but not more than 20, 10, or 5 modifications of the amino acid sequence of SEQ ID NO: 37, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO:

37.

9. 9. The recombinant nucleic acid molecule of claim 1, wherein the platelet-binding domain is linked to the transmembrane domain by a hinge region.

10. 10. The recombinant nucleic acid molecule of claim 1, wherein the intracellular signaling domain comprises a sequence encoding a costimulatory domain.

11. 11. The recombinant nucleic acid molecule of any one of claims 1 to 10, wherein the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and / or SEQ ID NO:

41.

12. 12. The recombinant nucleic acid molecule of any one of claims 1 to 11, wherein the intracellular signaling domain comprises an amino acid sequence having at least one, two, or three but not more than 20, 10, or 5 modifications of the amino acid sequence of SEQ ID NO: 39 and / or 41, or a sequence having 95-99% identity to the amino acid sequence of SEQ ID NO: 39 and / or 41.

13. A CAR encoded by the recombinant nucleic acid of any one of claims 1 to 12.

14. A vector comprising a nucleic acid sequence encoding the CAR according to any one of claims 1 to 12 or the CAR according to claim 13.

15. 15. The vector of claim 14, wherein the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

16. 16. The vector of claim 14 or 15, further comprising a promoter, optionally the promoter is selected from the group consisting of EF-1 promoter, MSCV promoter, SC40 promoter, CMV promoter, or PGK promoter.

17. 17. A method for manipulating immune cells, comprising transducing said immune cells with the recombinant nucleic acid of any one of claims 1 to 12, the CAR of claim 13, or the vector of any one of claims 14 to 16.

18. 18. The method of claim 17, wherein the immune cells are autologous T cells.

19. 18. The method of claim 17, wherein the immune cells are allogeneic T cells.

20. A recombinant nucleic acid molecule encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain linked to an intracellular localization domain, wherein the intracellular localization domain comprises a retention sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteasome localization sequence.

21. 21. The recombinant nucleic acid molecule of claim 20, wherein the anti-CD8 binding domain is an scFv or a single domain antibody.

22. The scFv is a) i. a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; ii. an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the heavy chain variable region amino acid sequence set forth in SEQ ID NO: 13; or iii. An amino acid sequence having 95 to 99% identity with the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and b) i. a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; ii. an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, alterations of the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14; or iii. An amino acid sequence having 95 to 99% identity with the amino acid sequence of the light chain variable region shown in SEQ ID NO: 14 22. The recombinant nucleic acid molecule of claim 21, comprising a CD8 binding domain comprising:

23. the CD8 binding domain i) the amino acid sequence set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the amino acid sequence set forth in SEQ ID NO: 25; or iii) an amino acid sequence having 95 to 99% identity with the amino acid sequence shown in SEQ ID NO: 25 23. The recombinant nucleic acid molecule of claim 22, comprising:

24. The recombinant nucleic acid molecule of any one of claims 20 to 23, wherein the intracellular localization domain comprises an amino acid sequence set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 65, 68, 74, or 75.

25. 25. The recombinant nucleic acid molecule of any one of claims 19 to 24, wherein the intracellular localization domain comprises an amino acid sequence set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 66, or 67.

26. 26. The recombinant nucleic acid molecule of any one of claims 20 to 25, wherein the intracellular localization domain comprises one or more of a Golgi retention sequence, an ER retention sequence, and a proteasome localization sequence.

27. 27. The recombinant nucleic acid molecule of claim 26, wherein the ER retention sequence comprises a KDEL sequence and the CD8 blocking polypeptide further comprises a linker between the scFv and the intracellular localization domain.

28. 27. The recombinant nucleic acid molecule of claim 26, wherein the ER retention sequence comprises a KKXX sequence, where X represents any amino acid.

29. 27. The recombinant nucleic acid molecule of claim 26, wherein the Golgi retention comprises YQRL (SEQ ID NO: 65), YGRL (SEQ ID NO: 74), or YKGL (SEQ ID NO: 75).

30. 27. The recombinant nucleic acid molecule of claim 26, wherein the proteosome localization sequence comprises a PEST.

31. A CD8 blocking polypeptide encoded by a recombinant nucleic acid according to any one of claims 20 to 30.

32. A vector comprising a nucleic acid molecule encoding a CD8 blocking polypeptide according to any one of claims 20 to 30 or a CD8 blocking polypeptide according to claim 31.

33. 33. The vector of claim 32, wherein the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

34. 34. The vector of claim 32 or 33, further comprising a promoter, optionally the promoter is selected from the group consisting of EF-1 promoter, MSCV promoter, SC40 promoter, CMV promoter, or PGK promoter.

35. A method of modifying a cell, comprising transducing or transfecting the cell with a vector according to any one of claims 32 to 34.

36. 36. An engineered immune cell comprising the recombinant nucleic acid of any one of claims 1 to 12 or 20 to 30, the CAR of claim 13, the CD8 blocking polypeptide of claim 31, or the vector of any one of claims 14 to 16 or 32 to 34.

37. 1. An engineered immune cell, comprising: An engineered immune cell comprising a nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteasome localization sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 in the engineered immune cell.

38. 1. An engineered immune cell, comprising: An engineered immune cell comprising a nucleic acid encoding a CD8 chimeric antigen receptor (CAR), comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR).

39. 1. An engineered immune cell, comprising: (i) a first nucleic acid encoding a CD8-blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localization sequence, and wherein the CD8-blocking polypeptide reduces cell surface expression of endogenous CD8 in the engineered immune cell; and (ii) a second nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR), wherein optionally, the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds to endogenous CD8 within the engineered immune cell. engineered immune cells, including

40. 40. The engineered immune cell of any one of claims 36 to 39, wherein the anti-CD8 binding domain is an scFv or a single domain antibody.

41. the scFv of the CD8 blocking polypeptide or the scFv of the CAR a heavy chain variable region (VH) comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3); and a light chain variable region (VL) comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3); the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 are (i) SEQ ID NOs: 1 to 6, respectively; or (ii) SEQ ID NOs: 7 to 12, respectively 41. The engineered immune cell of claim 40, comprising:

42. the scFv of the CD8 blocking polypeptide and / or the scFv of the CAR a) (i) a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, alterations of the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; or (iii) an amino acid sequence having 95 to 99% identity with the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 13; and b) (i) a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 14; (ii) an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, alterations of the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 14; or (iii) an amino acid sequence having 95 to 99% identity with the amino acid sequence of the light chain variable region shown in SEQ ID NO: 14 42. The engineered immune cell of claim 41 , comprising:

43. the scFv of the CD8 blocking polypeptide or the scFv of the CAR (i) the amino acid sequence set forth in SEQ ID NO: 25; (ii) an amino acid sequence having at least one, two, or three, but not more than 30, 20, or 10, modifications of the amino acid sequence set forth in SEQ ID NO: 25; or (iii) an amino acid sequence having 95 to 99% identity with the amino acid sequence shown in SEQ ID NO: 25 43. The engineered immune cell of claim 42, comprising:

44. i) the ER retention sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:66 and SEQ ID NO:67; ii) the Golgi retention sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NO:65, SEQ ID NO:64, SEQ ID NO:74, and SEQ ID NO:75; or iii) the proteosome localization sequence comprises the amino acid sequence set forth in SEQ ID NO: 68; 44. The engineered immune cell of any one of claims 36-37 or 39-43.

45. 45. The engineered immune cell of any one of claims 36-37 or 39-44, wherein the CD8 blocking polypeptide further comprises a transmembrane domain linked between the scFv and the ER retention sequence comprising KKMP, wherein the transmembrane domain is a transmembrane domain selected from the group consisting of CD8 alpha, CD8 beta, 4-1BB, CD28, CD34, CD4, FcεRI gamma, CD16, OX40, CD3 zeta, CD3 epsilon, CD3 gamma, CD35, TCR alpha, CD32, CD64, VEGFR2, FAS, and FGFR2B.

46. 46. ​​The engineered immune cell of claim 45, wherein the transmembrane domain comprises the amino acid sequence of SEQ ID NO:

34.

47. 47. The engineered immune cell of any one of claims 36-37 or 39-46, wherein the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 45-47, 79-81, and 95-98.

48. 48. The engineered immune cell of any one of claims 36-47, wherein the transmembrane domain is selected from the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137), and CD1.

49. 49. The engineered immune cell of claim 48, wherein the transmembrane domain is a CD8α transmembrane domain.

50. 50. The engineered immune cell of any one of claims 36 to 49, wherein the engineered immune cell has reduced expression of endogenous CD8.

51. 1. An engineered immune cell comprising a recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises an antigen-binding domain that binds to CD8, a transmembrane domain, and a signaling domain, and wherein the engineered immune cell has reduced expression of endogenous CD8.

52. 52. The engineered immune cell of any one of claims 36 to 51, wherein endogenous CD8 of the engineered immune cell is knocked out or knocked down.

53. 53. The engineered immune cell of any one of claims 36 to 52, wherein endogenous CD8 of the engineered immune cell has been knocked out via zinc finger endonuclease, TALEN or CRISPR-Cas9.

54. 53. The engineered immune cell of any one of claims 36 to 52, wherein endogenous CD8 of the engineered immune cell is knocked down via siRNA or shRNA.

55. 53. The engineered immune cell of any one of claims 36-52, wherein endogenous CD8 of the engineered immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and a subcellular localization domain, wherein the subcellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteasome localization sequence.

56. 56. The engineered immune cell of claim 55, wherein the anti-CD8 binding domain is an scFv or a single domain antibody.

57. 57. The engineered immune cell of any one of claims 36-56, wherein said engineered cell comprises a population of engineered cells, wherein the cytotoxic T cells in said population of engineered cells, after transduction and culture for a period of time, are at least about 50-fold more abundant than the cytotoxic T cells in an otherwise identical population of cells that express the anti-CD8 CAR without a reduction in expression of endogenous CD8.

58. 58. The engineered immune cell of claim 57, wherein the period of time is at least about 2 days, at least about 3 days, at least about 5 days or more.

59. 57. The engineered immune cell of any one of claims 36-56, wherein said engineered cell comprises a population of engineered cells, wherein viability of cytotoxic T cells in said population of engineered cells is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, or at least about 500-fold greater compared to a population of otherwise identical cells that express an anti-CD8 CAR without reduced expression of endogenous CD8.

60. 57. The engineered immune cell of any one of claims 36-56, wherein the cytotoxicity of the engineered immune cell against a target cell is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, or at least about 3-fold greater compared to an otherwise identical cell expressing an anti-CD8 CAR without reduced expression of endogenous CD8.

61. 61. The engineered immune cell of claim 60, wherein the cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1:

2.

62. 62. The engineered immune cell of claim 60 or 61, wherein the target cell is a CD8-positive cell, including MOLT-4 and / or CCRF-CEM.

63. 58. The engineered immune cell of any one of claims 36-57, wherein the cytotoxicity of the engineered immune cell against the target cell is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, or at least about 4-fold greater than an otherwise identical cell expressing an anti-CD8 CAR without reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culture with the target cell.

64. 64. The engineered immune cell of claim 63, wherein the cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1:4, or 1:

8.

65. 65. The engineered immune cell of claim 63 or 64, wherein the target cell is a CD8 positive cell.

66. 66. The engineered immune cell of any one of claims 36-65, wherein proliferation of the engineered immune cell in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, or at least about 5-fold greater than proliferation of the engineered immune cell in the absence of the target cells.

67. 66. The engineered immune cell of any one of claims 36-65, wherein proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold, at least 5 fold, or at least about 10 fold greater compared to identical cells but with enforced reduced CD8 expression but without expression of an anti-CD8 CAR.

68. 68. The engineered immune cell of claim 66 or 67, wherein the proliferation of the engineered immune cell is tested at an effector-target ratio of 1:

1.

69. 69. The engineered immune cell of any one of claims 66-68, wherein the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days after culturing the engineered immune cells in the presence or absence of the target cells.

70. 70. The engineered immune cell of any one of claims 66 to 69, wherein the target cell is a CD8 positive cell.

71. 1. An engineered immune cell comprising a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, and a CD8 chimeric antigen receptor (CAR) comprising the anti-CD8 binding domain, wherein optionally, said CD8 blocking polypeptide remains intracellularly within said engineered cell and binds to endogenous CD8 within said engineered cell.

72. 72. The engineered immune cell of claim 71, wherein the anti-CD8 binding domain is an scFv or a single domain antibody.

73. 73. A pharmaceutical composition comprising the recombinant nucleic acid of any one of claims 1 to 12 or 20 to 30, the CAR of claim 13, the CD8 blocking polypeptide of claim 31, the vector of any one of claims 14 to 16 or 32 to 34, or the engineered immune cell of any one of claims 36 to 72, and optionally further comprising an excipient.

74. 19. A method of providing anti-cancer immunity to a mammal, the method comprising administering to said mammal a recombinant nucleic acid of any one of claims 1 to 12 or 20 to 30, a CAR of claim 13, a CD8-blocking polypeptide of claim 31, a vector of any one of claims 14 to 16 or 32 to 34, an engineered immune cell of any one of claims 36 to 71, or a pharmaceutical composition of claim 73.

75. 1. A method of treating a disease in a subject in need thereof, comprising:

1. A method comprising administering a pharmaceutical composition comprising immune cells comprising a CD8 chimeric antigen receptor (CAR), the immune cells comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.

76. 76. The method of claim 75, wherein the immune cells are engineered to have reduced cell surface expression of CD8.

77. 77. The method of claim 75 or 76, wherein the immune cell further comprises a chimeric polypeptide comprising a CD8 binding domain and an intracellular localization domain.

78. 78. The method of any one of claims 75 to 77, wherein the disease is a T-cell malignancy or an NK-cell malignancy.

79. 1. A method for reducing fratricide in an immune cell population expressing a chimeric antigen receptor comprising a CD8-binding domain, the method comprising expressing a CD8-blocking polypeptide comprising a CD8-binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteasome localization sequence, and wherein the CD8-blocking polypeptide remains intracellularly within the immune cell and binds to endogenous CD8 within the immune cell.

80. 80. The method of claim 79, wherein the CD8 binding domain is an scFv or a single domain antibody.

81. 10. A method of treating cancer in a subject in need thereof, comprising administering to the subject a recombinant nucleic acid of any one of claims 1 to 12 or 20 to 30, a CAR of claim 13, a CD8 blocking polypeptide of claim 31, a vector of claims 14 to 16 or 32 to 34, an engineered immune cell of claims 36 to 71, or a pharmaceutical composition of claim 73.

82. 82. The method of claim 81, wherein the immune cells are engineered to have reduced cell surface expression of CD8.

83. 1. A method of treating cancer in a subject in need thereof, comprising: (i) a CD8-blocking polypeptide comprising a CD8-binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteasome localization sequence, and wherein the CD8-blocking polypeptide remains intracellularly within the engineered immune cell and binds to endogenous CD8 within the engineered immune cell; and (ii) a chimeric antigen receptor (CAR) comprising a CD8-binding domain, a transmembrane domain, and a signaling domain; 20. A method comprising administering a therapeutic amount of a composition comprising engineered immune cells comprising:

84. 84. The method of claim 83, wherein the CD8 binding domain is an scFv or a single domain antibody.

85. 85. A method for providing anti-cancer immunity in a mammal, comprising administering to the mammal an immune cell expressing a CAR molecule of any one of claims 1 to 84.

86. 86. The method of claim 85, wherein the immune cells are autologous T cells.

87. 85. The method of claim 84, wherein the immune cells are allogeneic T cells.

88. 74. Use of a recombinant nucleic acid according to any one of claims 1 to 12 or 20 to 30, a CAR according to claim 13, a CD8 blocking polypeptide according to claim 31, a vector according to any one of claims 14 to 16 or 32 to 34, an engineered immune cell according to any one of claims 36 to 71, or a pharmaceutical composition according to claim 73 in the manufacture of a medicament for the treatment of cancer in a subject in need thereof.

89. 1. A method of reducing and / or preventing fratricide during the manufacturing of immune cells expressing an anti-CD8 CAR, the method comprising functional inhibition of CD8 signaling during the manufacturing process of said cells.

90. 90. The method of claim 89, wherein the functional inhibition of CD8 signaling comprises reducing the expression of endogenous CD8 on an immune cell.

91. 91. The method of claim 89 or 90, wherein the endogenous CD8 of the immune cell is knocked out or knocked down.

92. 92. The method of any one of claims 89 to 91, wherein the endogenous CD8 of the immune cells is knocked out via zinc finger endonuclease, TALEN, or CRISPR-Cas9.

93. 93. The method of any one of claims 89 to 92, wherein the endogenous CD8 of the immune cells is knocked down via siRNA or shRNA.

94. 94. The method of claim 89 or 93, wherein the endogenous CD8 of the immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localization domain, wherein the intracellular localization domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteasome localization sequence.

95. 95. The method of claim 94, wherein the anti-CD8 binding domain is an scFv or a single domain antibody.

96. 96. The method of any one of claims 89 to 95, wherein the survival rate of cytotoxic T cells in the immune cells is at least about 1.1 fold, at least about 5 fold, at least about 10 fold, at least about 25 fold, at least about 50 fold, at least about 75 fold, at least about 100 fold, at least about 200 fold, or at least about 500 fold higher compared to otherwise identical cytotoxic T cells that express an anti-CD8 CAR without reduced expression of endogenous CD8.

97. 97. The method of any one of claims 89 to 96, wherein the cytotoxicity of the immune cells against a target cell is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, or at least about 3-fold greater than that of otherwise identical immune cells expressing an anti-CD8 CAR without reduced expression of endogenous CD8.

98. 98. The method of claim 97, wherein the cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1:

2.

99. 99. The method of claim 97 or 98, wherein the target cell is a CD8 positive cell.

100. The method of any one of claims 89 to 96, wherein the cytotoxicity of the immune cells against the target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 1.7-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, or at least about 4-fold greater than that of otherwise identical immune cells that express the anti-CD8 CAR without reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culture with the target cells.

101. 101. The method of claim 100, wherein the cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1:4, or 1:

8.

102. 102. The method of claim 100 or 101, wherein the target cells are CD8-positive cells.

103. 103. The method of any one of claims 89-102, wherein proliferation of said immune cells in the presence of target cells is at least about 1.2 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold, or at least about 5 fold greater compared to immune cells in the absence of said presently claimed target cells.

104. 103. The method of any one of claims 89 to 102, wherein proliferation of the immune cells in the presence of target cells is at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least 5-fold, or at least about 10-fold greater compared to identical immune cells but with enforced reduced CD8 expression but without expression of the anti-CD8 CAR.

105. 105. The method of claim 103 or 104, wherein the immune cells and the target cells are tested at an effector-target ratio of 1:

1.

106. 106. The method of any one of claims 103-105, wherein the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days after culturing the immune cells in the presence or absence of the target cells.

107. The method of any one of claims 103 to 106, wherein the target cells are CD8-positive cells.

108. 1. A method for producing engineered immune cells, comprising: (i) transducing immune cells with a vector comprising a polynucleotide sequence encoding a CD8-blocking polypeptide comprising a CD8-binding domain and a subcellular localization domain; and (ii) transducing the immune cells with a vector comprising a polynucleotide sequence encoding a CD8 chimeric antigen receptor (anti-CD8 CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain. A method comprising:

109. 109. The method of claim 108, wherein the CD8 binding domain of the CD8 blocking polypeptide or the CD8 binding domain of the anti-CD8 CAR comprises an scFv or a single domain antibody.

110. 110. The method of claim 108 or 109, wherein the intracellular localization domain comprises an amino acid sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteasome localization sequence.

111. 111. The method of any one of claims 108-110, wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds to endogenous CD8 within the engineered immune cell.

112. 112. The method of any one of claims 109-111, wherein the CD8 blocking polypeptide is expressed prior to the anti-CD8 CAR.

113. 113. The method of claim 112, wherein said CD8 blocking polypeptide is expressed about 1 day before said anti-CD8 CAR.

114. 114. The method of claim 113, wherein said CD8 blocking polypeptide is expressed at least one day prior to said anti-CD8 CAR.

115. 112. The method of any one of claims 108-111, wherein the CD8 blocking polypeptide is co-expressed with the anti-CD8 CAR.

116. 116. The method of claim 115, wherein a bicistronic vector comprises sequences encoding the CD8 blocking polypeptide and the anti-CD8 CAR.

Images