Compositions and methods for controlling MAPT
AAV particles encoding siRNA duplexes target and inhibit MAPT expression to address tauopathies, providing a more effective treatment for tau-related neurodegenerative disorders than current methods.
Patent Information
- Application Number
- JP2025537899
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-29
- Filing Date
- 2023-12-28
- Publication Date
- 2026-02-03
AI Technical Summary
Current treatments for tauopathies, such as Alzheimer's disease and frontotemporal dementia, are limited to symptom relief and supportive care, with no effective methods to prevent or treat the underlying tau protein misfolding and aggregation that leads to neuronal cell degeneration.
The use of AAV particles encoding RNA agents, such as siRNA duplexes, to target and inhibit microtubule-associated protein tau (MAPT) gene expression and protein production, providing a method for treating tauopathies and related neurodegenerative disorders.
This approach effectively inhibits MAPT expression, potentially slowing or reversing neuronal cell degeneration and associated cognitive impairments, offering a more direct therapeutic strategy than existing treatments.
Smart Images

Figure 2026503963000169 
Figure 2026503963000170 
Figure 2026503963000171
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 477,736, filed December 29, 2022, the entire contents of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing This application has been filed with an electronic Sequence Listing. The Sequence Listing file, named V2071-3010PCT_SL.xml, was created on December 13, 2023, and is 2,478,152 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0003] The present disclosure relates generally to compositions and methods for vector delivery of agents, e.g., RNA agents, that inhibit mutant, variant, or wild-type human microtubule-associated protein tau (MAPT) gene, mRNA, and / or protein. [Background technology]
[0004] Tauopathies, which may also be referred to herein as tau-related diseases, are a heterogeneous group of neurodegenerative diseases characterized by dysfunction and / or aggregation of the microtubule-associated protein tau (MAPT), which may also be referred to herein as tau and is encoded by the MAPT gene. Tau is typically a highly soluble protein known to bind to microtubules based on its degree of phosphorylation. In tauopathies, tau becomes hyperphosphorylated, misfolds, and aggregates into neurofibrillary tangles (NFTs) of paired helical filaments (PHFs), twisted ribbons, or straight filaments. These NFTs are generally considered to indicate impending neuronal cell degeneration, which may contribute to widespread neuronal cell loss and result in a variety of behavioral and cognitive impairments, and may be fatal. Currently, very limited treatment options are available for tauopathies, often with only symptom relief and supportive care available. Thus, there is a medical need for improved compositions and methods for the prevention, treatment, and diagnosis of diseases associated with abnormal tau expression, including tauopathies and related neurodegenerative disorders. Summary of the Invention
[0005] The present disclosure provides AAV particles encoding agents, e.g., RNA agents, for targeting MAPT that regulate, e.g., inhibit, MAPT gene expression and / or MAPT protein production, and methods of use thereof. In some embodiments, the agent for targeting MAPT, e.g., the MAPT gene, mRNA, or protein (e.g., tau protein), is an RNA agent for targeting MAPT, e.g., an siRNA duplex for targeting MAPT. In some embodiments, the agent for targeting MAPT comprises a regulatory polynucleotide encoding an siRNA duplex for targeting MAPT. Methods for treating a disease associated with, e.g., aberrant expression of MAPT, such as a tauopathy, including, but not limited to, Alzheimer's disease (AD), frontotemporal dementia (FTD), and / or Dravet syndrome (DS), in a subject in need thereof.
[0006] Thus, in one aspect, the present disclosure provides a short interfering ribonucleic acid (siRNA) for inhibiting expression of microtubule-associated protein tau (MAPT), comprising a sense strand sequence and an antisense strand sequence, wherein the antisense sequence is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides comprising 0, 1, 2, or 3 mismatches of a MAPT sequence comprising the nucleotide sequence of SEQ ID NO: 5024 or the nucleotide sequence provided in Table 3 or 19. In some embodiments, the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the antisense strand sequences provided in Tables 3, 4, 5, 9A, or 9B; the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the sense strand sequences provided in Tables 3, 4, 5, 9A, or 9B, and the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides. In some embodiments, the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides from any one of the antisense strand sequences provided in Tables 3, 4, 5, 9A, or 9B; the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides from any one of the sense strand sequences provided in Tables 3, 4, 5, 9A, or 9B, and the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides. In some embodiments, the antisense strand sequence comprises the nucleotide sequence of any one of the antisense strand sequences provided in Tables 3, 4, 5, 9A, or 9B; the sense strand sequence comprises the nucleotide sequence of any one of the sense strand sequences provided in Tables 3, 4, 5, 9A, or 9B, and the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0007] In yet another aspect, the present disclosure provides a short interfering ribonucleic acid (siRNA) for inhibiting expression of microtubule-associated protein tau (MAPT), comprising a sense strand sequence and an antisense strand sequence, wherein (i) the antisense strand sequence comprises at least 20 or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; and (ii) the sense strand sequence comprises at least 20 or 21 contiguous nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 502 5132, 5136, 5140, 5144, or 5146; and wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0008] In yet another aspect, the disclosure provides an adeno-associated virus (AAV) viral genome comprising a nucleotide sequence disposed between two inverted terminal repeats (ITRs), wherein the nucleotide sequence encodes an siRNA for inhibiting MAPT, the siRNA comprising a sense strand sequence and an antisense strand sequence, wherein (i) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; (ii) the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4938, 4958, 4978, 4998, 4922, 4938, 4946 ... 942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 5014, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 511 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; and the sense strand sequence and antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0009] In another aspect, the present disclosure provides a regulatory polynucleotide encoding an siRNA for targeting MAPT as described herein. In some embodiments, the regulatory polynucleotide further comprises a 5' flanking region, a loop region, and / or a 3' flanking region.
[0010] In another aspect, the present disclosure provides an AAV particle comprising a promoter operably linked to a nucleic acid encoding a regulatory polynucleotide comprising an siRNA for targeting MAPT as described herein.
[0011] In another aspect, the present disclosure provides a method for producing an AAV particle comprising an AAV capsid protein, e.g., an AAV capsid variant, encoding an siRNA for targeting MAPT described herein. In some embodiments, the method includes providing a host cell comprising a viral genome encoding an siRNA described herein, and incubating the host cell under conditions suitable for encapsulating the viral genome into an AAV capsid protein, e.g., an AAV capsid variant, thereby producing an AAV particle.
[0012] In yet another aspect, the present disclosure provides a method for delivering siRNA to cells to inhibit MAPT. In some embodiments, the method comprises administering an effective amount of the siRNA or AAV particles encoding the siRNA described herein.
[0013] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a genetic disorder, such as a monogenic or polygenic disorder, comprising administering an effective amount of an siRNA or an AAV particle encoding the siRNA described herein.
[0014] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a neurological disorder, e.g., a neurodegenerative disorder, comprising administering an effective amount of an siRNA or an AAV particle encoding the siRNA described herein.
[0015] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a disorder associated with tau expression, e.g., aberrant tau expression, comprising administering an effective amount of an siRNA or an AAV particle encoding the siRNA described herein.
[0016] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a tauopathy, the method comprising administering an effective amount of an siRNA or an AAV particle encoding the siRNA described herein.
[0017] In some embodiments, the genetic disorder, neurological disorder (e.g., a neurodegenerative disorder), disorder associated with tau expression (e.g., aberrant tau expression), and / or tauopathy is Alzheimer's disease, frontotemporal dementia (FTD), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome, neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), prion disease, CJD, multiple system atrophy, mild cognitive impairment, tangle-only dementia, or progressive subcortical gliosis.
[0018] Enumerated Embodiments 1. A short interfering ribonucleic acid (siRNA) for inhibiting expression of microtubule-associated protein tau (MAPT), comprising a sense strand sequence and an antisense strand sequence, wherein the antisense sequence is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides containing 0, 1, 2, or 3 mismatches of a MAPT sequence comprising the nucleotide sequence of SEQ ID NO: 5024 or the nucleotide sequence provided in Table 3 or 19.
[0019] 2. The siRNA of embodiment 1, wherein the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides with 0, 1, 2, or 3 mismatches to an exon of the MAPT sequence, wherein the exon comprises nucleotides 1277 to 1332 of SEQ ID NO: 5024, nucleotides 1712 to 1977 of SEQ ID NO: 5024, or nucleotides 2266 to 6644 of SEQ ID NO: 5024.
[0020] 3. The siRNA of embodiment 1 or 2, wherein the antisense strand is complementary to at least 15, 16, 17, or 18 contiguous nucleotides with 0, 1, 2, or 3 mismatches to nucleotides 1300-1317, 1305-1322, 1860-1877, 2279-2297, 2286-2303, 2402-2419, 2581-2958, 2584-2601, 2633-2650, or 2634-2653 of SEQ ID NO: 5024.
[0021] 4. The sense strand is (i) at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides containing 0, 1, 2, or 3 mismatches of a MAPT sequence comprising the nucleotide sequence of SEQ ID NO: 5024 or a nucleotide sequence provided in Table 3 or 19; (ii) at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides having 0, 1, 2, or 3 mismatches with an exon of the MAPT sequence, wherein the exon comprises nucleotides 1277 to 1332 of SEQ ID NO: 5024, nucleotides 1712 to 1977 of SEQ ID NO: 5024, or nucleotides 2266 to 6644 of SEQ ID NO: 5024; or (iii) at least 15, 16, 17, or 18 consecutive nucleotides having 0, 1, 2, or 3 mismatches with nucleotides 1300 to 1317, 1305 to 1322, 1860 to 1877, 2279 to 2297, 2286 to 2303, 2402 to 2419, 2581 to 2958, 2584 to 2601, 2633 to 2650, or 2634 to 2653 of SEQ ID NO: 5024; The siRNA according to any one of embodiments 1 to 3, comprising:
[0022] 5. The siRNA of any one of embodiments 1-4, wherein the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the antisense strand sequences provided in Tables 3, 4, 5, 9A, or 9B.
[0023] 6. The siRNA of any one of embodiments 1-5, wherein the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the sense strand sequences provided in Tables 4, 5, 9A, or 9B.
[0024] 7. The siRNA of any one of embodiments 1-6, wherein the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the antisense strand sequences provided in Tables 3, 4, 5, 9A, or 9B; and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any one of the sense strand sequences provided in Tables 3, 4, 5, 9A, or 9B, and wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0025] 8. The siRNA of embodiment 7, wherein the region of complementarity is 15 to 30, 19 to 21, or 25 to 30 nucleotides in length, for example, 17, 18, 20, 21, 22, 25, or 30 nucleotides in length.
[0026] 9. (i) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4700, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4502-4505; (ii) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4697, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4495-4499; (iv) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4690, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4480 to 4484; (vi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (vii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4694 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4492 by 3, 2, 1, or 0 nucleotides; (viii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4691, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4485 to 4489; (ix) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4916 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014 by 3, 2, 1, or 0 nucleotides; (x) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of SEQ ID NO: 4701, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4506-4510; (xi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4912 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010 by 3, 2, 1, or 0 nucleotides; (xii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4687 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4477 by 3, 2, 1, or 0 nucleotides; (xiii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4712 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4521 by 3, 2, 1, or 0 nucleotides; (xiv) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4696 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4494 by 3, 2, 1, or 0 nucleotides; or (xv) The siRNA of any one of embodiments 1 to 8, wherein the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4718 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4527 by 3, 2, 1, or 0 nucleotides.
[0027] 10. (i) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4700, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4502-4505; (ii) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4697, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4495 to 4499; (iv) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4690, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4480-4484; (vi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (vii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4694, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4492; (viii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4691, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4485 to 4489; (ix) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (x) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4701, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4506-4510; (xi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (xii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4687, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4477; (xiii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4712, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4521; (xiv) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4696, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4494; or (xv) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4718, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4527; 10. The siRNA according to claim 1.
[0028] 11. A short interfering ribonucleic acid (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), comprising a sense strand sequence and an antisense strand sequence, (i) the antisense strand sequence comprises at least 20 or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; (ii) the sense strand sequences are SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 5 comprising at least 20 or 21 consecutive nucleotides of any one of 014, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; The short interfering ribonucleic acid (siRNA), wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0029] 12. An adeno-associated virus (AAV) viral genome comprising a nucleotide sequence disposed between two inverted terminal repeats (ITRs), the nucleotide sequence encoding an siRNA for inhibiting MAPT, the siRNA comprising a sense strand sequence and an antisense strand sequence; (i) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; (ii) the sense strand sequences are selected from the group consisting of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 501 comprising at least 19, 20, or 21 consecutive nucleotides of any one of 4, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; The adeno-associated virus (AAV) viral genome, wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides.
[0030] 13. The siRNA of any one of embodiments 8 to 11 or the AAV viral genome of embodiment 12, wherein the region of complementarity comprises at least 18, 19, or 20 nucleotides.
[0031] 14. The siRNA of any one of embodiments 1 to 10, or the AAV viral genome of embodiment 12 or 13, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.
[0032] 15. The siRNA of any one of embodiments 1-10 or the AAV viral genome of any one of embodiments 12-14, wherein the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.
[0033] 16. (i) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (ii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (iv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (v) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (vi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122; (vii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5125, 5132, 5136, 5140, 5144, or 5146; (viii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5077, 5084, 5088, 5092, 5096, or 5098; or (ix) the siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 15, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5054, 5060, 5064, 5066, 5070, or 5074.
[0034] 17. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4906.
[0035] 18. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4918.
[0036] 19. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4922.
[0037] 20. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4966.
[0038] 21. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4970.
[0039] 22. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4978.
[0040] 23. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4982.
[0041] twenty four. (i) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4910; (ii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4914; (iii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5054; (iv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4926; (v) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4930; (vi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4934; (vii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4938; (viii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4942; (ix) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5060; (x) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4946; (xi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4950; (xii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4954; (xiii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xiv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4962; (xv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5064; (xvi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4974; (xvii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5066; (xviii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4986; (xix) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4990; (xx) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4994; (xxi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4998; (xxii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5002; (xxiii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5070; (xxiv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5006; (xxv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5010; (xxvi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5014; (xxvii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxviii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5022; (xxvii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5074; (xxix) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5077; (xxx) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5084; (xxxi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5088; (xxxii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5092; (xxxiii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5096; (xxxiv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5098; (xxxv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5101; (xxxvi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5108; (xxxvii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5112; (xxxviii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5116; (xxxix) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5120; (xl) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5122; (xli) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5125; (xlii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5132; (xliii) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5136; (xliv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5140; (xlv) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or (xlvi) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5146. The siRNA according to any one of embodiments 1 to 10 or the AAV viral genome according to any one of embodiments 12 to 16.
[0042] 25. The siRNA of any one of embodiments 1 to 11 or 13, or the AAV viral genome of any one of embodiments 12 to 24, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.
[0043] 26. The siRNA of any one of embodiments 1 to 11, 13, or 25, or the AAV viral genome of any one of embodiments 12 to 25, wherein the sense strand sequence comprises at least 20 contiguous nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.
[0044] 27. (i) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (ii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (iv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (v) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (vi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122; (vii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5125, 5132, 5136, 5140, 5144, or 5146; (viii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5077, 5084, 5088, 5092, 5096, or 5098; or (ix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5054, 5060, 5064, 5066, 5070, or 5074. The siRNA of any one of embodiments 1 to 11, 13, 25, or 26, or the AAV viral genome of any one of embodiments 12 to 26.
[0045] 28. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 17 or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4906.
[0046] 29. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 18, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4918.
[0047] 30. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 19, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4922.
[0048] 31. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 20, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4966.
[0049] 32. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 21, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4970.
[0050] 33. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 22, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4978.
[0051] 34. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 23, or 25 to 27, wherein the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4982.
[0052] 35. (i) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4910; (ii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4914; (iii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5054; (iv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4926; (v) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912 and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4930; (vi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4934; (vii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4938; (viii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4942; (ix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5060; (x) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4946; (xi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4950; (xii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4954; (xiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4962; (xv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5064; (xvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4974; (xvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5066; (xviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4986; (xix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4990; (xx) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4994; (xxi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4998; (xxii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5002; (xxiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5070; (xxiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5006; (xxv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5010; (xxvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5014; (xxvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5022; (xxvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5074; (xxix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5077; (xxx) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5084; (xxxi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5088; (xxxii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5092; (xxxiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5096; (xxxiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5098; (xxxv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5101; (xxxvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5108; (xxxvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5112; (xxxviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5116; (xxxix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5120; (xl) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5122; (xli) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5125; (xlii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5132; (xliii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5136; (xliv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5140; (xlv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or (xlvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5146. An siRNA according to any one of embodiments 1 to 11, 13, or 25 to 27, or an AAV viral genome according to any one of embodiments 11 to 16, or 24 to 27.
[0053] 36. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 35, or the AAV viral genome of any one of embodiments 12 to 35, wherein the antisense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.
[0054] 37. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 36, or the AAV viral genome of any one of embodiments 12 to 36, wherein the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.
[0055] 38. (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5125, 5132, 5136, 5140, 5144, or 5146; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5077, 5084, 5088, 5092, 5096, or 5098; or (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5054, 5060, 5064, 5066, 5070, or 5074; An siRNA according to any one of embodiments 1 to 11, 13, or 25 to 37, or an AAV viral genome according to any one of embodiments 12 to 37.
[0056] 39. The siRNA of any one of embodiments 1 to 11, 13, 25 to 28, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 17, 25 to 28, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4906.
[0057] 40. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 29, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 18, 25 to 27, 29, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4918.
[0058] 41. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 30, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 30, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4922.
[0059] 42. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 31, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 31, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4966.
[0060] 43. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 32, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 62, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4970.
[0061] 44. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 33, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 33, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4978.
[0062] 45. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 34, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 34, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4982.
[0063] 46. (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4910; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4914; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5054; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4926; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4930; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4934; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4938; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4942; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5060; (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4946; (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4950; (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4954; (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4962; (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5064; (xvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4974; (xvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5066; (xviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4986; (xix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4990; (xx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4994; (xxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4998; (xxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5002; (xxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5070; (xxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5006; (xxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5010; (xxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5014; (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5022; (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5074; (xxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5077; (xxx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5084; (xxxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5088; (xxxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5092; (xxxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5096; (xxxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5098; (xxxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5101; (xxxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5108; (xxxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5112; (xxxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5116; (xxxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5120; (xl) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5122; (xli) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5125; (xlii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5132; (xliii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5136; (xlv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5140; (xliv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5144; or (xlvi) The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 35, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 35, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5146.
[0064] 47. (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4700, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4502 to 4505; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4697, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4495 to 4499; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4690, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4480-4484; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4694 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4492; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4691, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4485 to 4489; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4701, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4506 to 4510; (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4687 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4477; (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4712 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4521; (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4696 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4494; or (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4718, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4527; An siRNA according to any one of embodiments 1 to 11 or 13 to 46, or an AAV viral genome according to any one of embodiments 12 to 46.
[0065] 48. (i) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4420, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (ii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (iii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4421, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (iv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4909, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (v) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4422, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (vi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4913, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (vii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4423, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4437; (viii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4919; (ix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4424, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (x) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (xi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4410, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (xii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4925, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (xiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4411, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (xiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4929, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (xv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4412, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (xvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4933, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (xvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4413, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4437; (xviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4937, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4419; (xix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4414, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (xx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4941, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (xxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4415, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (xxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4945, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (xxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4416, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (xxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4949, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (xxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4417, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (xxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4953, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (xxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4418, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4437; (xxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4957, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4919; (xxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4419, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (xxx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4961, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (xxxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4420, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (xxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (xxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4421, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (xxxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (xxxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4422, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (xxxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4973, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (xxxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4423, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4437; (xxxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4919; (xxxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4424, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (xxxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (xl) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4425, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (xli) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4985, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (xlii) the nucleotide sequence encoding the sense strand comprises the nucleotide sequence of SEQ ID NO: 4426, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (xliii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4989, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (xliv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4427, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (xlv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4993, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (xlvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4428, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4437; (xlvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4997, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4919; (xlviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4429, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (xlix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5001, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (l) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4430, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4434; (li) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5005, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4907; (lii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4431, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4435; (liii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5009, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4911; (liv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4432, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4436; (lv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5013, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4915; (lvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4433, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4438; (lvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5021, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4923; (lviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5053, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5059, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5063, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5065, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5069, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5073, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5056; (lxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5076, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5083, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5087, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5091, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5095, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5097, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5079; (lxx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5100, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5107, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5111, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5115, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5119, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5121, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5103; (lxxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5124, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127; (lxxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5131, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127; (lxxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5135, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127; (lxxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5139, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127; (lxxx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5143 and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127; or (lxxxi) The siRNA of any one of embodiments 1 to 11 or 13 to 47, or the AAV viral genome of any one of embodiments 12 to 47, wherein the nucleotide sequence encoding the sense strand comprises the nucleotide sequence of SEQ ID NO: 5145, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127.
[0066] 49. The siRNA of any one of embodiments 1 to 11, 13, 25 to 28, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 17, 25 to 28, 36 to 39, or 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905.
[0067] 50. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 29, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 18, 25 to 27, 29, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917.
[0068] 51. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 30, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 30, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921.
[0069] 52. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 31, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 31, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965.
[0070] 53. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 32, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 62, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969.
[0071] 54. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 33, 36 to 39, 47, or 48; or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 33, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977.
[0072] 55. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 34, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 34, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981.
[0073] 56. The siRNA of any one of embodiments 1 to 11 or 13 to 55, or the AAV viral genome of any one of embodiments 12 to 55, wherein the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise at least 15 to 30, 19 to 21, or 25 to 30 nucleotides in length, for example, 17, 18, 20, 21, 22, 25, or 30 nucleotides in length.
[0074] 57. The siRNA of any one of embodiments 1 to 11 or 13 to 56, or the AAV viral genome of any one of embodiments 12 to 56, wherein the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise an overhang of 1 or 2 nucleotides, for example an overhang at the 5' end of the sense strand sequence and / or at the 3' end of the antisense strand sequence.
[0075] 58. (i) the sense strand and the antisense strand contain one mismatch; and / or (ii) The siRNA of any one of embodiments 1 to 11 or 13 to 57, or the AAV viral genome of any one of embodiments 12 to 57, wherein the antisense strand and the target sequence contain one mismatch.
[0076] 59. A regulatory polynucleotide comprising an siRNA according to any one of embodiments 1 to 12 or 13 to 58.
[0077] 60. An AAV viral genome according to any one of embodiments 13 to 58, wherein the nucleotide sequence further encodes a regulatory polynucleotide comprising the sense strand sequence and the antisense strand sequence.
[0078] 61. The regulatory polynucleotide is (i) 5′ flanking region; (ii) a loop region; and (iii) 3' flanking region 61. The regulatory polynucleotide of embodiment 59, or the AAV viral genome of embodiment 60, further comprising one, two, three or all of:
[0079] 62. (i) the 5' flanking region comprises a nucleotide sequence of any one of SEQ ID NOs: 4878-4886; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; (ii) the loop region comprises a nucleotide sequence of any of SEQ ID NOs: 4887-4896; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of any of SEQ ID NOs: 4887-4896; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4887-4896; and / or (iii) the 3' flanking region comprises a nucleotide sequence of any one of SEQ ID NOs: 4897 to 4904; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4897 to 4904; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10 modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4897 to 4904, A regulatory polynucleotide according to embodiment 61, or an AAV viral genome according to embodiment 61.
[0080] 63. (i) the nucleotide sequence encoding the 5' flanking region comprises a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 4353 to 4361; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to any one of SEQ ID NOs: 4353 to 4361; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to any one of SEQ ID NOs: 4353 to 4361; (ii) the nucleotide sequence encoding the loop region comprises a nucleotide sequence of any one of SEQ ID NOs: 4362 to 4371; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of any one of SEQ ID NOs: 4362 to 4371; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4362 to 4371; and / or (iii) the nucleotide sequence encoding the 3' flanking region comprises a nucleotide sequence of any one of SEQ ID NOs: 4372 to 4379; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of any one of SEQ ID NOs: 4372 to 4379; or a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4372 to 4379, A regulatory polynucleotide according to embodiment 61 or 62 or an AAV viral genome according to embodiment 61 or 62.
[0081] 64. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, which contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4887, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4887, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; and (iii) SEQ ID NO: 4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4898, or a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4898. A regulatory polynucleotide according to any one of embodiments 59 or 61 to 63 or an AAV viral genome according to any one of embodiments 60 to 63, comprising:
[0082] 65. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; and (iii) SEQ ID NO: 4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4898, or a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4898. A regulatory polynucleotide according to any one of embodiments 59 or 61 to 63 or an AAV viral genome according to any one of embodiments 60 to 63, comprising:
[0083] 66. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4887, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4887, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4887; and (iii) SEQ ID NO: 4899, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4899, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4899, or a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4899. A regulatory polynucleotide according to any one of embodiments 59 or 61 to 63 or an AAV viral genome according to any one of embodiments 60 to 63, comprising:
[0084] 67. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4880, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; and (iii) SEQ ID NO: 4900, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4900, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4900, or a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO: 4900. A regulatory polynucleotide according to any one of embodiments 59 or 61 to 63 or an AAV viral genome according to any one of embodiments 60 to 63, comprising:
[0085] 68. The regulatory polynucleotide comprises, in 5' to 3' order: (i) the 5' flanking region, the sense strand sequence, the loop region, the antisense strand sequence, and the 3' flanking region; or (ii) the 5' flanking region, the antisense strand sequence, the loop region, the sense strand sequence, and the 3' flanking region A regulatory polynucleotide according to any one of embodiments 59 or 61 to 67 or an AAV viral genome according to any one of embodiments 62 to 67, comprising:
[0086] 69. The regulatory polynucleotide is (i) a 5' flanking region comprising a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4906; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4908; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900. A regulatory polynucleotide according to any one of embodiments 59, 61 to 63, 67, 68 or an AAV viral genome according to any one of embodiments 60 to 63, 67, 68, comprising:
[0087] 70. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4905; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4907; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375. A regulatory polynucleotide according to any one of embodiments 59, 61 to 63, or 67 to 69, or an AAV viral genome according to any one of embodiments 60 to 63, or 67 to 69, comprising:
[0088] 71. The regulatory polynucleotide is (i) a 5' flanking region comprising a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4918; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4920; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 67, or 68, comprising:
[0089] 72. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4917; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4919; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375. A regulatory polynucleotide according to any one of embodiments 59, 61 to 63, 67, 68, or 71, or an AAV viral genome according to any one of embodiments 60 to 63, 67, 68, or 71, comprising:
[0090] 73. The regulatory polynucleotide is (i) a 5' flanking region comprising a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4922; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4924; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 67, or 68, comprising:
[0091] 74. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a 5' flanking region comprising a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4921; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4923; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, or 73, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, or 73, comprising:
[0092] 75. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4966; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and (v) SEQ ID NO:4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4898 The regulatory polynucleotide of any one of embodiments 59, 60 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, comprising:
[0093] 76. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4965; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4373. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 76, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 76, comprising:
[0094] 77. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4970; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and (v) SEQ ID NO:4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4898 The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, comprising:
[0095] 78. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4969; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4373. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 77, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 77, comprising:
[0096] 79. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4978; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and (v) SEQ ID NO:4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4898 The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, comprising:
[0097] 80. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4977; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4373. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 79 or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 79, comprising:
[0098] 81. The regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4982; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and (v) SEQ ID NO:4898, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4898 The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, comprising:
[0099] 82. The nucleotide sequence encoding the regulatory polynucleotide is (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4981; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4373. A regulatory polynucleotide according to any one of embodiments 59, 61 to 63, 65, 68, or 81, or an AAV viral genome according to any one of embodiments 60 to 63, 65, 68, or 81, comprising:
[0100] 83. The regulatory polynucleotide of any one of embodiments 59 or 61 to 82 or the AAV viral genome of any one of embodiments 62 to 82, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs: 4380 to 4409 or 5027 to 5050, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0101] 84. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67 to 70, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 67 to 70, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4405, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0102] 85. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, 71, 72, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, 71, 72, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4408, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0103] 86. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, 73, 74, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, 73, 74, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4409, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0104] 87. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 75, 76, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 75, 76, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4390, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0105] 88. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 77, 78, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 77, 78, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4391, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0106] 89. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 79, 80, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 79, 80, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4393, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0107] 90. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 81, 82, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 81, 82, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4394, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0108] 91. An adeno-associated virus (AAV) viral genome comprising a promoter operably linked to a nucleic acid encoding a regulatory polynucleotide according to any one of embodiments 59 to 90 or an siRNA according to any one of embodiments 1 to 11 or 13 to 58.
[0109] 92. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 90, wherein the AAV viral genome further comprises a promoter operably linked to the sense strand sequence and the antisense strand sequence or the nucleotide sequence encoding the regulatory polynucleotide.
[0110] 93. An AAV viral genome according to embodiment 92, wherein the promoter is a ubiquitous promoter.
[0111] 94. The AAV viral genome of embodiment 92, wherein the promoter is a cell- or tissue-specific promoter.
[0112] 95. The promoter may be selected from the group consisting of human elongation factor 1 α-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) and its derivatives CAG, β-glucuronidase (GUSB), or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synapsin (Syn), methyl-CpG-binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), and neurofibromatosis factor 1 (NF-κB). 95. The AAV viral genome of any one of embodiments 92 to 94, wherein the AAV viral genome is selected from neurofilament light chain (NFL) or neurofilament heavy chain (NFH), beta-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT, and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or functional fragments, e.g., truncated forms, or functional variants thereof.
[0113] 96. An AAV viral genome described in any one of embodiments 92 to 95, wherein the promoter comprises a CBA promoter or a variant thereof.
[0114] 97. The AAV viral genome of any one of embodiments 92 to 95, wherein the promoter comprises a nucleotide sequence of any one of the nucleotide sequences provided in Table 2; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to any one of the nucleotide sequences provided in Table 2; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the nucleotide sequences provided in Table 2.
[0115] 98. The AAV viral genome of any one of embodiments 92 to 97, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5199; or a nucleotide sequence that has at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5199.
[0116] 99. An AAV viral genome described in any one of embodiments 92 to 97, wherein the AAV viral genome further comprises a polyA signal sequence.
[0117] 100. The AAV viral genome of embodiment 99, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476.
[0118] 101. An AAV viral genome according to any one of embodiments 26 to 32, wherein the AAV viral genome further comprises an inverted terminal repeat (ITR) sequence.
[0119] 102. The AAV viral genome of embodiment 101, wherein the ITRs comprise the nucleotide sequence of SEQ ID NO: 5197, 5200, 4469, or 4470; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5197, 5200, 4469, or 4470; or a nucleotide sequence that has at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5197, 5200, 4469, or 4470.
[0120] 103. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 102, wherein the AAV viral genome comprises an ITR sequence positioned 5' to the nucleic acid encoding the regulatory polynucleotide or the siRNA.
[0121] 104. The AAV viral genome of embodiment 103, wherein the ITR positioned 5' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5197 or 4469; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5197 or 4469; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5197 or 4469.
[0122] 105. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 104, wherein the AAV viral genome comprises an ITR sequence positioned 3' to the nucleic acid encoding the regulatory polynucleotide or the siRNA.
[0123] 106. The AAV viral genome of embodiment 103, wherein the ITR located 3' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5200 or 4470; a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200 or 4470; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5200 or 4470.
[0124] 107. An AAV viral genome particle described in any one of embodiments 12 to 58 or 60 to 106, wherein the AAV viral genome comprises an ITR sequence positioned 5' to the regulatory polynucleotide or the nucleic acid encoding the siRNA and an ITR sequence positioned 3' to the regulatory polynucleotide or the nucleic acid encoding the siRNA.
[0125] 108. (i) the ITRs located 5' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprise the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5197; (ii) the ITRs located 3' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprise the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200. An AAV viral genome according to any one of embodiments 105 to 107.
[0126] 109. (i) the ITRs located 5' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprise the nucleotide sequence of SEQ ID NO: 4469; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4469; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4469; (ii) the ITRs located 3' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprise the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4470. An AAV viral genome according to any one of embodiments 105 to 107.
[0127] 110. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 109, wherein the AAV viral genome further comprises an enhancer, a Kozak sequence, an intron region, and / or an exon region.
[0128] 111. The enhancer comprises: (i) a CMVie enhancer or a variant thereof; or (ii) the nucleotide sequence of SEQ ID NO: 4471 or 4472; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471 or 4472; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4471 or 4472. 111. The AAV viral genome of embodiment 110, comprising:
[0129] 112. The AAV viral genome of embodiment 110 or 111, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, such as substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4471.
[0130] 113. An AAV viral genome according to any one of embodiments 12 to 58 or 60 to 112, comprising a CMVie enhancer or a variant thereof; and a CBA promoter or a variant thereof; optionally, the CMVie enhancer or a variant thereof is located 5' to the CBA promoter or a variant thereof.
[0131] 114. The AAV viral genome of any one of embodiments 110 to 113, wherein the enhancer and promoter comprise a nucleotide sequence of SEQ ID NO: 4473 or 4474; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4473 or 4474; or a nucleotide sequence that has at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4473 or 4474.
[0132] 115. The intron is (i) the human beta globin intron (hBG intron) or a variant thereof; or (ii) the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4475. 115. An AAV viral genome according to any one of embodiments 110 to 114, comprising:
[0133] 116. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 115, wherein the AAV viral genome further comprises a nucleotide sequence encoding an miR binding site, e.g., an miR binding site that regulates, e.g., reduces, expression of the payload encoded by the viral genome in cells or tissues in which the corresponding miRNA is expressed.
[0134] 117. An AAV viral genome described in embodiment 116, wherein the encoded miR binding site regulates, e.g., reduces, expression of the encoded payload in cells or tissues of the DRG, liver, heart, hematopoietic lineage, or a combination thereof.
[0135] 118. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 117, wherein the AAV viral genome comprises at least 1 to 5 copies, for example, at least 1, 2, 3, 4, or 5 copies, of the encoded miR binding site, and optionally the at least 1 to 5 copies are contiguous (for example, not separated by a spacer) or the at least 1 to 5 copies are separated by a spacer.
[0136] 119. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 118, wherein the AAV viral genome is self-complementary.
[0137] 120. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 118, wherein the AAV viral genome is single-stranded.
[0138] 121. An AAV viral genome described in any one of embodiments 12 to 58 or 60 to 120, wherein the AAV viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a nonstructural protein, and the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 and a Rep52 protein).
[0139] 122. The AAV viral genome comprises, in 5' to 3' order: (i) ITR; (ii) an enhancer (e.g., a CMVie enhancer or a variant thereof); (iii) a promoter (e.g., a CBA promoter or a variant thereof); (iv) an intron (e.g., the hBG intron or a variant thereof); (v) a nucleic acid sequence encoding a regulatory polynucleotide (e.g., a regulatory polynucleotide described in any one of embodiments 59 to 90); (vi) a polyA signal sequence; and (vii)ITR An AAV viral genome according to any one of embodiments 12 to 58 or 60 to 121, comprising:
[0140] 123. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, the nucleotide sequence comprising any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0141] 124. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NOs: 4405, 4408, 4409, 4390, 4391, 4393, or 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0142] 125. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4405, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0143] 126. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4408, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0144] 127. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4409, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0145] 128. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4390, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0146] 129. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4391, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0147] 130. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4393, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0148] 131. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0149] 132. The AAV viral genome comprises, in 5' to 3' order: (i) an ITR, said ITR comprising the nucleotide sequence of SEQ ID NO: 4469; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4469; or a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4469; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4472; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4472; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4472; (iii) a promoter, said promoter comprising the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, said intron comprising the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, the nucleotide sequence comprising any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, the polyA signal sequence comprising the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4470. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, comprising:
[0150] 133. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 132, comprising the nucleotide sequence of any one of SEQ ID NOs: 4439 to 4468 or 5149 to 5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 4439 to 4468 or 5149 to 5196.
[0151] 134. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, or 110 to 133, comprising the nucleotide sequence of any one of SEQ ID NOs: 5149 to 5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 5149 to 5196.
[0152] 135. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-133, or 134, comprising the nucleotide sequence of any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, or 5185, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, or 5185.
[0153] 136. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-125, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5173, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5173.
[0154] 137. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 126, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5195, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5195.
[0155] 138. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 127, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5196.
[0156] 139. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 128, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5182, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5182.
[0157] 140. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 129, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5183, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5183.
[0158] 141. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 130, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5184, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5184.
[0159] 142. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-108, 110-124, 131, or 133-135, comprising the nucleotide sequence of SEQ ID NO: 5185, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5185.
[0160] 143. The AAV viral genome of any one of embodiments 12-58, 60-96, 98-107, 109-122, or 133, comprising the nucleotide sequence of any one of SEQ ID NOs: 4439-4468, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 4439-4468.
[0161] 144. An AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, an AAV viral genome encoding a regulatory polynucleotide according to any one of embodiments 59 to 90, or an AAV viral genome encoding a siRNA according to any one of embodiments 11 or 13 to 58, and an AAV capsid protein.
[0162] 145. The AAV particle of embodiment 48, wherein the AAV capsid protein comprises an AAV5 capsid protein, an AAV9 capsid protein, a VOY101 capsid protein, a PHPeB capsid protein, a PHP.B capsid protein, a PHP.N capsid protein, an AAV1 capsid protein, a VOY9P39 capsid protein, an AAV2 capsid protein, an AAVrhlO capsid protein, or a variant thereof (e.g., an AAV9 capsid protein or a variant thereof or an AAV5 capsid protein or a variant thereof).
[0163] 146. The AAV particle of embodiment 144 or 145, wherein the AAV capsid protein comprises an AAV9 capsid or a variant thereof.
[0164] 147. The AAV particle of embodiment 144 or 145, wherein the AAV capsid protein comprises an AAV5 capsid or a variant thereof.
[0165] 148. (i) the AAV capsid protein comprises an amino acid sequence provided in Table 1, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical thereto; or (ii) the nucleotide sequence encoding the AAV capsid protein comprises any one of the nucleotide sequences in Table 1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical thereto; An AAV particle described in any one of embodiments 144 to 147.
[0166] 149. A vector comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a nucleotide sequence encoding a regulatory polynucleotide according to any one of embodiments 59 to 90, or a nucleotide sequence encoding an siRNA according to any one of embodiments 11 or 13 to 58.
[0167] 150. A cell comprising an AAV particle according to any one of embodiments 144 to 148, an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58.
[0168] 151. The cell of embodiment 150, wherein the cell is a mammalian cell or an insect cell.
[0169] 152. The cell of embodiment 150 or 151, wherein the cell is a cell of the brain region or spinal cord region (e.g., a CNS cell).
[0170] 153. The cell according to any one of embodiments 150 to 152, wherein the cell is a cell of the cortex, hippocampus, thalamus, or brainstem.
[0171] 154. The cell according to any one of embodiments 150 to 153, wherein the cell is a neuron, a glial cell, or an oligodendrocyte.
[0172] 155. A method for producing AAV particles, comprising: (i) providing a host cell comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, an AAV viral genome encoding a regulatory polynucleotide according to any one of embodiments 59 to 90, or a viral genome encoding an siRNA according to any one of embodiments 11 or 13 to 58; (ii) incubating the host cells under conditions suitable for packaging the AAV viral genome into AAV capsid proteins. thereby producing the AAV particles.
[0173] 156. The method of embodiment 155, further comprising, prior to step (i), introducing into the host cell a first nucleic acid molecule comprising the viral genome.
[0174] 157. The method of embodiment 155 or 156, wherein the host cell comprises a second nucleic acid encoding the AAV capsid protein.
[0175] 158. The method of embodiment 157, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule.
[0176] 159. A pharmaceutical composition comprising an AAV particle according to any one of embodiments 144 to 148, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58, and a pharmaceutically acceptable excipient.
[0177] 160. A method for delivering siRNA to a cell for inhibiting MAPT expression (e.g., MAPT gene, mRNA, or protein expression), comprising administering an effective amount of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby delivering siRNA for inhibiting the MAPT expression to the cell.
[0178] 161. The method of embodiment 160, wherein the cells are cells of the brain region or spinal cord region.
[0179] 162. The method of embodiment 160 or 161, wherein the cell is a cell of the cortex, hippocampus, thalamus, or brainstem.
[0180] 163. The method of any one of embodiments 160 to 162, wherein the cells are neurons, astrocytes, glial cells, or oligodendrocytes.
[0181] 164. The method of any one of embodiments 160-163, wherein the delivery reduces (e.g., inhibits) MAPT mRNA levels, e.g., in cells of a brain region (e.g., cortex, hippocampus, or brainstem), by at least 40%, 44%, 45%, 50%, 55%, 60%, 64%, 65%, 70%, 75%, 76%, 79%, 80%, 84%, 85%, 87%, or 90%, e.g., as measured by an assay (e.g., an assay described in Example 6), e.g., compared to a reference level (e.g., mRNA levels in cells not delivered, or prior to delivery of the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition).
[0182] 165. The method of any one of embodiments 160-164, wherein the delivery reduces (e.g., inhibits) MAPT protein levels, e.g., in cells of a brain region (e.g., cortex, hippocampus, thalamus, or brainstem), e.g., by at least 15%, 17%, 20%, 25%, 30%, 35%, 37%, 40%, 44%, 45%, 46%, 50%, 53%, 55%, 60%, 63%, 64%, 65%, 70%, 72%, 74%, or 75%, e.g., when measured by an assay (e.g., an assay described in Example 6), e.g., compared to a reference level (e.g., protein levels in cells not delivered, or prior to delivery of the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition).
[0183] 166. The method of any one of embodiments 160 to 165, wherein the cell is in a subject.
[0184] 167. The method of embodiment 166, wherein the subject has or has been diagnosed with a genetic disorder (e.g., a monogenic or polygenic disorder).
[0185] 168. The method of embodiment 166 or 167, wherein the subject has or has been diagnosed with a neurological disorder (e.g., a neurodegenerative disorder).
[0186] 169. The method of any one of embodiments 166-168, wherein the subject has or has been diagnosed with a disorder associated with tau expression, e.g., aberrant tau expression.
[0187] 170. The method of any one of embodiments 166-169, wherein the subject has or has been diagnosed with a tauopathy.
[0188] 171. A method for treating a subject having or diagnosed as having a genetic disorder, such as a monogenic or polygenic disorder, comprising administering to the subject an effective amount of a pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58, thereby treating the subject having or diagnosed as having the genetic disorder, such as the monogenic or polygenic disorder.
[0189] 172. A method for treating a subject having or diagnosed as having a neurological disorder (e.g., a neurodegenerative disorder), comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144-159, the AAV particle comprising the AAV viral genome of any one of embodiments 12-58 or 60-143, the regulatory polynucleotide of any one of embodiments 59-90, or the siRNA of any one of embodiments 11 or 13-58, thereby treating the subject having or diagnosed as having the neurological disorder (e.g., the neurodegenerative disorder).
[0190] 173. A method for treating a subject having or diagnosed as having a disorder associated with tau expression, e.g., aberrant tau expression, comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144-159, the AAV particle comprising the AAV viral genome of any one of embodiments 12-58 or 60-143, the regulatory polynucleotide of any one of embodiments 59-90, or the siRNA of any one of embodiments 11 or 13-58, thereby treating the subject having or diagnosed as having a disorder associated with tau expression, e.g., aberrant tau expression.
[0191] 174. A method for treating a subject having or diagnosed as having a tauopathy, comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144-159, the AAV particle comprising the AAV viral genome of any one of embodiments 12-58 or 60-143, the regulatory polynucleotide of any one of embodiments 59-90, or the siRNA of any one of embodiments 11 or 13-58, thereby treating the subject having or diagnosed as having the tauopathy.
[0192] 175. The method of any one of embodiments 167-174, wherein the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy is Alzheimer's disease (AD), frontotemporal dementia (FTD), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome (DS), neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), prion disease, CJD, multiple system atrophy, mild cognitive impairment, tangle-only dementia, or progressive subcortical gliosis.
[0193] 176. The method of any one of embodiments 171-175, wherein the treating comprises preventing progression of the genetic disorder, the neurological disorder (e.g., a neurodegenerative disorder), the disorder associated with tau expression (e.g., aberrant tau expression), and / or the tauopathy in the subject.
[0194] 177. The method of any one of embodiments 171 to 176, further comprising performing a blood test, an imaging test (e.g., a PET scan or a biomarker, e.g., a PET scan combined with serum biomarker staining), a CNS biopsy sample, or an aqueous cerebrospinal fluid biopsy, optionally wherein the blood test, imaging test, biopsy sample, or aqueous cerebrospinal fluid biopsy is performed before, during, or after treatment with the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition.
[0195] 178. The method of any one of embodiments 160 to 177, wherein the administration decreases, e.g., reduces or inhibits, the expression of the MAPT gene, mRNA, and / or protein.
[0196] 179. The method of embodiment 178, wherein the MAPT gene, mRNA, and / or protein is a wild-type MAPT gene, mRNA, or protein.
[0197] 180. The method of embodiment 178 or 179, wherein the MAPT gene, the mRNA, and / or the protein comprises a mutated MAPT gene, mRNA, or protein (e.g., comprises at least one mutation).
[0198] 181. The administration of the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition results in a reduction and / or prevention of tau pathology, e.g., a biomarker of tau pathology (e.g., a marker of tau pathology), e.g., as measured by a PET scan or a PET scan in combination with Braak neuropathology classification and / or serum biomarker staining, e.g., when compared to a reference (e.g., a subject not receiving the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition). 18 F-flortaucipir, plasma ptau181, or 18 The method of any one of embodiments 171-180, resulting in a decrease in F-PM-PBB3).
[0199] 182. The method of any one of embodiments 171-181, wherein the administration reduces MAPT mRNA levels in the subject, e.g., in cells of a brain region (e.g., cortex, hippocampus, or brainstem), by at least 40%, 44%, 45%, 50%, 55%, 60%, 64%, 65%, 70%, 75%, 76%, 79%, 80%, 84%, 85%, 87%, or 90%, e.g., as measured by an assay (e.g., an assay described in Example 6), e.g., compared to a reference level (e.g., the mRNA level in a subject that has not received, or prior to receiving, the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition).
[0200] 183. The method of any one of embodiments 171-182, wherein the administration reduces MAPT protein levels in the subject, e.g., in cells of a brain region (e.g., cortex, hippocampus, thalamus, or brainstem), e.g., by at least 15%, 17%, 20%, 25%, 30%, 35%, 37%, 40%, 44%, 45%, 46%, 50%, 53%, 55%, 60%, 63%, 64%, 65%, 70%, 72%, 74%, or 75%, e.g., as measured by an assay (e.g., an assay described in Example 6), e.g., compared to a reference level (e.g., the protein level in a subject that has not received, or prior to receiving, the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition).
[0201] 184. The method of any one of embodiments 166-183, wherein the subject is a human.
[0202] 185. The method of any one of embodiments 166 to 184, wherein the pharmaceutical composition, the AAV particle, the regulatory polynucleotide, or the siRNA is administered to the subject intravenously, intramuscularly, via intraparenchymal administration, intracerebroventricularly, via intracisternal magna (ICM) injection, intrathecally, via focused ultrasound (FUS), for example, focused ultrasound combined with intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS combined with intravenous administration.
[0203] 186. The method of any one of embodiments 166 to 185, wherein the pharmaceutical composition, the AAV particle, the regulatory polynucleotide, or the siRNA is administered intravenously to the subject.
[0204] 187. The method of any one of embodiments 166 to 186, wherein the pharmaceutical composition, the AAV particle, the regulatory polynucleotide, or the siRNA is administered to the subject via intracisternal injection (ICM).
[0205] 188. The method of any one of embodiments 166 to 187, wherein the pharmaceutical composition, the AAV particle, the regulatory polynucleotide, or the siRNA is administered intrathecally to the subject.
[0206] 189. A pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58, for use in a method for delivering siRNA to a cell to inhibit MAPT expression.
[0207] 190. A pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58, for use in the manufacture of a medicament.
[0208] 191. A pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58, for use in treating a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., aberrant tau expression), and / or a tauopathy.
[0209] 192. Use of a pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58 in the manufacture of a medicament for delivering an siRNA to a cell to inhibit MAPT expression.
[0210] 193. Use of a pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58 in the manufacture of a medicament.
[0211] 194. Use of a pharmaceutical composition according to embodiment 159, an AAV particle according to any one of embodiments 144 to 159, an AAV particle comprising an AAV viral genome according to any one of embodiments 12 to 58 or 60 to 143, a regulatory polynucleotide according to any one of embodiments 59 to 90, or an siRNA according to any one of embodiments 11 or 13 to 58 in the manufacture of a medicament for the treatment of a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., aberrant tau expression), and / or a tauopathy. [Brief explanation of the drawings]
[0212] [Figure 1]1 is a graph showing relative R / F activity as % of non-targeting control (NTC) on the Y-axis after transfection with regulatory polynucleotide constructs targeting MAPT indicated on the X-axis (from left to right: VOYTaumiR-102-530 (SEQ ID NO: 4380), VOYTaumiR-102-556 (SEQ ID NO: 4381), VOYTaumiR-102-579 (SEQ ID NO: 4383), VOYTaumiR-102-580 (SEQ ID NO: 4384), VOYTaumiR-102-590 (SEQ ID NO: 4385), VOYTaumiR-102-591 (SEQ ID NO: 4386), VOYTaumiR-102-592 (SEQ ID NO: 4387), VOYTaumiR-102-593 (SEQ ID NO: 4388), VOYTaumiR-102-594 (SEQ ID NO: 4389), VOYTaumiR-102-595 (SEQ ID NO: 4390), VOYTaumiR-102-596 (SEQ ID NO: 4391), VOYTaumiR-102-597 (SEQ ID NO: 4392), VOYTaumiR-102-598 (SEQ ID NO: 4393), VOYTaumiR-102-599 (SEQ ID NO: 4394), VOYTaumiR-102-599 (SEQ ID NO: 4395), VOYTaumiR-102-599 (SEQ ID NO: 4396), VOYTaumiR-102-598 (SEQ ID NO: 4397), VOYTaumiR-102-599 ( 2-586 (SEQ ID NO: 4384), VOYTaumiR-104-530 (SEQ ID NO: 4385), VOYTaumiR-104-556 (SEQ ID NO: 4386), VOYTaumiR-104-579 (SEQ ID NO: 4388), VOYTaumiR-104-586 (SEQ ID NO: 4389), VOYTaumiR-109-530 (SEQ ID NO: 4390), VOYTaumiR-109-556 (SEQ ID NO: 4391), VOYTaumiR -109-579 (SEQ ID NO: 4393), VOYTaumiR-109-586 (SEQ ID NO: 4394), VOYTaumiR-114-530 (SEQ ID NO: 4395), VOYTaumiR-114-556 (SEQ ID NO: 4396), VOYTaumiR-114-579 (SEQ ID NO: 4398), VOYTaumiR-114-586 (SEQ ID NO: 4399), VOYTaumiR-116-530 (SEQ ID NO: 4400), VOYTau miR-116-556 (SEQ ID NO: 4401), VOYTaumiR-116-579 (SEQ ID NO: 4403), VOYTaumiR-116-586 (SEQ ID NO: 4404), VOYTaumiR-127-530 (SEQ ID NO: 4405), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-579 (SEQ ID NO: 4408), and VOYTaumiR-127-586 (SEQ ID NO: 4409)). [Figure 2]4409, VOYTaumiR-127-530 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127-579 (SEQ ID NO: 4408), VOYTaumiR-127-586 (SEQ ID NO: 4409), VOYTaumiR-127-530 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127-579 (SEQ ID NO: 4409 ...56 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127-556 (SEQ ID NO: 4409), VOYTaumiR-127- (SEQ ID NO: 4400), VOYTaumiR-116-556 (SEQ ID NO: 4401), VOYTaumiR-116-579 (SEQ ID NO: 4403), VOYTaumiR-116-586 (SEQ ID NO: 4404), VOYTaumiR-114-530 (SEQ ID NO: 4395), VOYTaumiR-114-556 (SEQ ID NO: 4396), VOYTaumiR-114-579 (SEQ ID NO: 4398), VOY TaumiR-114-586 (SEQ ID NO: 4399), VOYTaumiR-109-530 (SEQ ID NO: 4390), VOYTaumiR-109-556 (SEQ ID NO: 4391), VOYTaumiR-109-579 (SEQ ID NO: 4393), VOYTaumiR-109-586 (SEQ ID NO: 4394), VOYTaumiR-104-530 (SEQ ID NO: 4385), VOYTaumiR-104-556 (SEQ ID NO: 4386), VOYTaumiR-104-579 (SEQ ID NO: 4388), VOYTaumiR-104-586 (SEQ ID NO: 4389), VOYTaumiR-102-530 (SEQ ID NO: 4380), VOYTaumiR-102-556 (SEQ ID NO: 4381), VOYTaumiR-102-579 (SEQ ID NO: 4383), and VOYTaumiR-102-586 (SEQ ID NO: 4384)). [Figure 3]4409, VOYTaumiR-127-530 (SEQ ID NO: 4408), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-579 (SEQ ID NO: 4408), VOYTaumiR-127-586 (SEQ ID NO: 4409), VOYTaumiR-127-530 (SEQ ID NO: 4409 ...56 (SEQ ID NO: 4406), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127- (SEQ ID NO: 4390), VOYTaumiR-109-556 (SEQ ID NO: 4391), VOYTaumiR-109-579 (SEQ ID NO: 4393), VOYTaumiR-109-586 (SEQ ID NO: 4394), VOYTaumiR-116-579 (SEQ ID NO: 4403), VOYTaumiR-104-556 (SEQ ID NO: 4386), and VOYTaumiR-104-586 (SEQ ID NO: 4389)). [Figure 4]1 is a graph showing the fold change in residual MAPT mRNA for each vectored regulatory polynucleotide compared to a non-targeting control on the Y-axis (fold change relative to NTC) following transfection with regulatory polynucleotide at the indicated concentration (0.5 μg or 1.0 μg) on the X-axis (from left to right: mock, GFP, NTC, MAPT antisense oligonucleotide (ASO) positive control, VOYTaumiR-127-530 (SEQ ID NO: 4405), VOYTaumiR-109-530 (SEQ ID NO: 4390), VOYTaumiR-102-582 (SEQ ID NO: 5027), VOYTaumiR-104-582 (SEQ ID NO: 5031), VOYTaumiR-109-582 (SEQ ID NO: 5035), VOY TaumiR-114-582 (SEQ ID NO: 5039), VOYTaumiR-127-582 (SEQ ID NO: 5047), VOYTaumiR-102-587 (SEQ ID NO: 5028), VOYTaumiR-109-587 (SEQ ID NO: 5036), VOYTaumiR-114-587 (SEQ ID NO: 5040), VOYTaumiR-104-552 (SEQ ID NO: 5033), VOYTaumiR-104-549 (SEQ ID NO: 5034), and VOYTaumiR-116-549 (SEQ ID NO: 5046). [Figure 5A] 12 is a series of graphs showing vector genome copies per diploid cell in the cortex of mice following intravenous injection of vehicle control or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (VOY9P39_127-530) at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 5B] 1 is a series of graphs showing vector genome copies per diploid cell in the hippocampus of mice following intravenous injection of vehicle control or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (VOY9P39_127-530) at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 5C]FIG. 10 is a series of graphs showing vector genome copies per diploid cell in the brainstem of mice following intravenous injection of vehicle control or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (VOY9P39_127-530) at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 5D] FIG. 10 is a series of graphs showing vector genome copies per diploid cell in the thalamus of mice following intravenous injection of vehicle control or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (VOY9P39_127-530) at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 5E]
[0023] Figure 1 is a series of graphs showing vector genome copies per diploid cell in the liver of mice after intravenous injection of vehicle control or AAV particles (VOY9P39_127-530) containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. Statistical significance was assessed by one-way ANOVA with Tukey's multiple comparison post-hoc test; *, **, ***, and **** indicate p<0.05, 0.005, 0.0005, and 0.0001, respectively. Data are presented as group mean ± SEM. Numbers above the bars indicate group means in vg / dg (biodistribution). [Figure 6A]1 is a series of graphs showing the fold change in MAPT mRNA levels remaining after treatment in each treatment group compared to vehicle on the Y-axis in the cortex of mice following intravenous injection of AAV particles containing the payload and capsid combinations indicated on the X-axis, from left to right: vehicle control, VOY9P39 capsid at 3e13vg / kg and mCherry reporter control, VOY9P39 capsid at 3e13vg / kg and non-targeting control (NTC), VOY9P39 capsid at 3e12vg / kg and VOYTaumiR-127-530 regulatory polynucleotide (127-530), VOY9P39 capsid at 1e13vg / kg and VOY TaumiR-127-530 regulatory polynucleotide(127-530), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg, VOY101 capsid and mCherry reporter control at 3e13vg / kg, and VOY101 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg. [Figure 6B]
[0023] Figure 1 is a series of graphs showing the fold change in MAPT mRNA levels remaining after treatment in each treatment group compared to vehicle on the Y-axis in the hippocampus of mice following intravenous injection of AAV particles containing the payload and capsid combinations indicated on the X-axis, from left to right: vehicle control, VOY9P39 capsid at 3e13vg / kg and mCherry reporter control, VOY9P39 capsid at 3e13vg / kg and non-targeting control (NTC), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530) at 3e12vg / kg, VOY9P39 capsid at 1e13vg / kg and VOY TaumiR-127-530 regulatory polynucleotide(127-530), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg, VOY101 capsid and mCherry reporter control at 3e13vg / kg, and VOY101 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg. [Figure 6C]
[0023] Figure 1 is a series of graphs showing the fold change in MAPT mRNA levels remaining after treatment in each treatment group compared to vehicle on the Y-axis in the thalamus of mice following intravenous injection of AAV particles containing the payload and capsid combinations indicated on the X-axis, from left to right: vehicle control, VOY9P39 capsid at 3e13vg / kg and mCherry reporter control, VOY9P39 capsid at 3e13vg / kg and non-targeting control (NTC), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530) at 3e12vg / kg, VOY9P39 capsid at 1e13vg / kg and VOY TaumiR-127-530 regulatory polynucleotide(127-530), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg, VOY101 capsid and mCherry reporter control at 3e13vg / kg, and VOY101 capsid and VOYTaumiR-127-530 regulatory polynucleotide(127-530) at 3e13vg / kg. [Figure 6D]
[0023] Figure 1 is a series of graphs showing the fold change in MAPT mRNA levels remaining after treatment in each treatment group compared to vehicle on the Y-axis in the brainstem of mice following intravenous injection of AAV particles containing the payload and capsid combinations indicated on the X-axis, from left to right: vehicle control, VOY9P39 capsid at 3e13vg / kg and mCherry reporter control, VOY9P39 capsid at 3e13vg / kg and non-targeting control (NTC), VOY9P39 capsid at 3e12vg / kg and VOYTaumiR-127-530 regulatory polynucleotide (127-530), VOY9P39 capsid at 1e13vg / kg and VOY TaumiR-127-530 regulatory polynucleotide (127-530), VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530) at 3e13vg / kg, VOY101 capsid and mCherry reporter control at 3e13vg / kg, and VOY101 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530) at 3e13vg / kg. Statistical significance was assessed by one-way ANOVA with Tukey's multiple comparisons, with p-values shown on the graphs. [Figure 7A] 1 is a series of graphs showing the remaining MAPT protein levels after treatment in each treatment group compared to vehicle in the cortex of mice following intravenous injection of vehicle control (Vehicle); or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (127-530) administered at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 7B] FIG. 10 is a series of graphs showing the remaining MAPT protein levels after treatment in each treatment group compared to vehicle in the hippocampus of mice following intravenous injection of vehicle control (Vehicle); or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (127-530) administered at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 7C]1 is a series of graphs showing the remaining MAPT protein levels after treatment in each treatment group compared to vehicle in the thalamus of mice following intravenous injection of vehicle control (Vehicle); or AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (127-530) administered at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. [Figure 7D]
[0023] Figure 1 is a series of graphs showing the residual MAPT protein levels after treatment in each treatment group compared to vehicle in the brainstem of mice following intravenous injection of AAV particles containing VOY9P39 capsids encoding the VOYTaumiR-127-530 regulatory polynucleotide (127-530) administered at doses of 3e12vg / kg, 1e13vg / kg, or 3e13vg / kg. The percentages above the bars represent the rate of tau protein knockdown after treatment. Statistical significance was assessed by one-way ANOVA with Tukey's multiple comparisons. [Figure 8A] MAPT remaining after treatment in each treatment group compared to vehicle in the cortex of mice following intravenous injection of vehicle control (Vehicle); AAV particles containing VOY9P39 capsids encoding non-targeting control (NTC) at a dose of 1e13vg / kg (C9P39-NTC_1E13); AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-530 regulatory polynucleotides at a dose of 1e12vg / kg (C9P39-127.530_1E12) or 1e13vg / kg (C9P39-127.530_1E13); or AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-579 regulatory polynucleotides at a dose of 1e13vg / kg (C9P39-127.579_1E13). 1 is a series of graphs showing mRNA levels. [Figure 8B]MAPT remaining after treatment in each treatment group compared to vehicle in the hippocampus of mice following intravenous injection of vehicle control (Vehicle); AAV particles containing VOY9P39 capsids encoding non-targeting control (NTC) at a dose of 1e13vg / kg (C9P39-NTC_1E13); AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-530 regulatory polynucleotides at a dose of 1e12vg / kg (C9P39-127.530_1E12) or 1e13vg / kg (C9P39-127.530_1E13); or AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-579 regulatory polynucleotides at a dose of 1e13vg / kg (C9P39-127.579_1E13). 1 is a series of graphs showing mRNA levels. [Figure 8C] MAPT remaining after treatment in each treatment group compared to vehicle in the thalamus of mice following intravenous injection of vehicle control (Vehicle); AAV particles containing VOY9P39 capsids encoding non-targeting control (NTC) at a dose of 1e13vg / kg (C9P39-NTC_1E13); AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-530 regulatory polynucleotides at a dose of 1e12vg / kg (C9P39-127.530_1E12) or 1e13vg / kg (C9P39-127.530_1E13); or AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-579 regulatory polynucleotides at a dose of 1e13vg / kg (C9P39-127.579_1E13). 1 is a series of graphs showing mRNA levels. [Figure 8D]MAPT remaining after treatment in each treatment group compared to vehicle in the brainstem of mice following intravenous injection of vehicle control (Vehicle); AAV particles containing VOY9P39 capsids encoding non-targeting control (NTC) at a dose of 1e13vg / kg (C9P39-NTC_1E13); AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-530 regulatory polynucleotides at a dose of 1e12vg / kg (C9P39-127.530_1E12) or 1e13vg / kg (C9P39-127.530_1E13); or AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-579 regulatory polynucleotides at a dose of 1e13vg / kg (C9P39-127.579_1E13).
[0023] Figure 1 is a series of graphs showing mRNA levels. Statistical significance was assessed by one-way ANOVA with Tukey's multiple comparisons, with p-values indicated on the graphs. DETAILED DESCRIPTION OF THE INVENTION
[0213] Described herein, inter alia, are compositions comprising isolated, e.g., recombinant viral particles, e.g., AAV particles, for delivery, e.g., vector delivery, of an RNA agent (e.g., an siRNA duplex for targeting MAPT) for targeting MAPT. In some embodiments, the RNA agent for targeting MAPT is an siRNA duplex that regulates, e.g., inhibits, MAPT expression, e.g., an siRNA duplex for targeting MAPT described herein. Typically, the recombinant AAV particle will include a viral genome including a nucleotide sequence encoding a transgene encoding, e.g., an RNA agent for targeting MAPT (e.g., an siRNA duplex for targeting MAPT), and an AAV capsid protein, e.g., an AAV capsid variant described herein.
[0214] Mutations in the MAPT gene have been identified in frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), an autosomal dominant tauopathy, demonstrating that mutations in the MAPT gene and / or tau protein can lead to neurodegenerative changes in the brain. Mutant tau is considered more amyloidogenic than wild-type tau, meaning it is more likely to hyperphosphorylate and aggregate as NFTs (Hutton, M. et al., 1998, Nature 393(6686):702-5). These NFTs may consist of pathological forms of tau, including, but not limited to, hyperphosphorylated, misfolded, and aggregated tau species, each of which has created a set of intensively pursued targets. Hyperphosphorylation of tau inhibits its binding to microtubules and microtubule assembly / stabilization activity. Furthermore, hyperphosphorylation of tau predisposes it to misfolding and aggregation. Without wishing to be bound by theory, in some embodiments, it is believed that administration of siRNA targeting MAPT (e.g., a mutated MAPT gene or a wild-type MAPT gene), e.g., an siRNA for targeting MAPT described herein, and vectorized forms thereof, may reduce tau, e.g., pathological tau, protein expression, aggregation, hyperphosphorylation, and / or misfolding, thereby modulating, e.g., reducing or slowing down, pathologies and / or tauopathies associated with abnormal tau expression (e.g., Alzheimer's disease (AD), frontotemporal dementia (FTD), and / or Dravet syndrome (DS)).
[0215] Without wishing to be bound by theory, it is believed that in some embodiments, the use of an AAV particle or multiple AAV particles for vector delivery of an RNA agent targeting MAPT described herein (e.g., an siRNA duplex targeting MAPT) will result in increased exposure and robust expression of the RNA agent targeting MAPT in the central nervous system (CNS) in a subject, e.g., a subject having or diagnosed with a disease associated with tau expression or a neurological disorder described herein (e.g., a tauopathy).
[0216] I. Composition According to the present disclosure, a composition is provided for delivering a functional RNA agent for targeting MAPT by adeno-associated virus particles (AAV), for example, AAV particles comprising AAV capsid polypeptides. In some embodiments, AAV particles, for example, AAV particles comprising the AAV capsid polypeptides described herein, or a plurality of particles, can be provided, for example, delivered, for example, to cells, tissues, organs, or organisms in vivo, ex vivo, or in vitro, for example, via any of several administration routes (e.g., via intravenous administration).
[0217] Adeno-associated virus (AAV) and AAV particles Described herein, inter alia, are compositions comprising isolated, e.g., recombinant viral particles, e.g., AAV particles, for delivery, e.g., vector delivery, of polynucleotides, e.g., siRNAs targeting MAPT, as well as methods of making and using the same.
[0218] In some embodiments, adeno-associated viruses (AAVs) include small, non-enveloped, icosahedral-capsid viruses of the Parvoviridae family, characterized by a single-stranded DNA viral genome. Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996), the contents of which are incorporated by reference in their entirety. In some embodiments, AAVs are capable of replication in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.
[0219] In some embodiments, AAV particles are used as biological tools due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replication, and their relatively benign immunogenic profile. The viral genome can be engineered to contain minimal components for the construction of functional recombinant viruses or viral particles loaded with a desired payload, e.g., a polynucleotide encoding an siRNA for targeting MAPT, or engineered to target specific tissues and express or deliver a desired payload, e.g., a polynucleotide encoding an siRNA for targeting MAPT.
[0220] In some embodiments, the AAV particle is a naturally occurring (e.g., wild-type) AAV or recombinant AAV. In some embodiments, the wild-type AAV viral genome is a linear single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) in length. In some embodiments, inverted terminal repeats (ITRs) cap the viral genome at both the 5' and 3' ends and provide origins of replication for the viral genome. In some embodiments, the AAV viral genome typically contains two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by self-complementary regions (145 nt in wild-type AAV) at the 5' and 3' ends of the ssDNA that form an energetically stable double-stranded region. The double-stranded hairpin structure has multiple functions, including, but not limited to, acting as an origin for DNA replication by serving as a primer for the endogenous DNA polymerase complex of the host viral replication cell.
[0221] In some embodiments, AAV particles, e.g., AAV particles described herein (e.g., ssAAV), comprise a viral genome that is self-complementary (scAAV). In some embodiments, ssAAV comprises nucleic acid molecules, e.g., DNA strands, that anneal to each other to form double-stranded DNA. In some embodiments, scAAV bypasses second-strand synthesis, allowing for rapid expression in transduced cells.
[0222] In some embodiments, the wild-type AAV viral genome further comprises nucleotide sequences for two open reading frames: one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, and Rep40, encoded by Rep genes) and one for three capsid, i.e., structural, proteins (VP1, VP2, and VP3, encoded by capsid or Cap genes). The Rep proteins are used for replication and packaging, while the capsid proteins assemble to generate the protein shell of AAV, i.e., AAV capsid polypeptides, e.g., AAV capsid variants. Alternative splicing and alternative start codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. While this varies depending on the AAV serotype, as a non-limiting example, for AAV9 (SEQ ID NO: 138), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. That is, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, sequence changes in the VP3 region are also changes to VP1 and VP2, but the percentage difference compared to the parent sequence is greatest for VP3 (because it is the shortest sequence of the three). While described here in terms of amino acid sequence, the nucleic acid sequences encoding these proteins may be similarly described. Collectively, the three capsid proteins assemble to produce the "AAV capsid" protein. Without wishing to be bound by theory, AAV capsid proteins typically comprise a 1:1:10 molar ratio of VP1:VP2:VP3. In some embodiments, the viral genome of a wild-type, e.g., naturally occurring, AAV can be modified to replace the rep / cap sequence with a nucleic acid comprising a transgene encoding a payload, e.g., an antibody molecule, wherein the genetic element comprises at least one ITR region.In some embodiments, the viral genome of the recombinant AAV comprises two ITR regions, e.g., a 5' ITR or a 3' ITR. In some embodiments, a rep / cap sequence can be provided in trans during production to generate AAV particles. In some embodiments, the viral genome of the AAV is comprised in an AAV vector that further encodes capsid proteins, e.g., structural proteins, including VP1 polypeptide, VP2 polypeptide, and / or VP3 polypeptide; and / or Rep proteins, e.g., nonstructural proteins, including Rep78 protein, Rep68 protein, Rep52 protein, and / or Rep40 protein.
[0223] In some embodiments, the AAV particles of the present disclosure are recombinant AAV particles that are replication-deficient and lack nucleotide sequences encoding functional Rep and Cap proteins. In some embodiments, these defective AAV particles lack most or all of the parent coding sequences and may retain only one or two AAV ITR sequences and a nucleic acid of interest for delivery to a cell, tissue, organ, or organism.
[0224] Methods for generating and / or modifying AAV particles, such as pseudotyped AAV particles, have been disclosed in the art (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO2005005610; and WO2005072364, the contents of each of which are incorporated herein by reference in their entirety).
[0225] As described herein, the AAV particles of the present disclosure, comprising an AAV capsid polypeptide and a viral genome, are capable of providing, e.g., delivering, a transgene to a cell, e.g., a mammalian cell, and / or a subject. In some embodiments, the recombinant AAV particles of the present disclosure are capable of vector delivery of siRNA (e.g., siRNA for targeting MAPT).
[0226] AAV capsids and their variants In some embodiments, AAV particles, e.g., AAV particles for vector delivery of siRNA described herein (e.g., siRNA for targeting MAPT), may comprise an AAV capsid polypeptide, e.g., an AAV capsid variant.
[0227] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, is capable of penetrating the blood-brain barrier after intravenous administration. In some embodiments, the AAV capsid, e.g., an AAV capsid variant, is capable of penetrating the blood-brain barrier after focused ultrasound (FUS), e.g., focused ultrasound combined with intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS combined with intravenous administration. In some embodiments, the AAV capsid, e.g., an AAV capsid variant, is capable of increased distribution to brain regions. In some embodiments, the brain regions include the frontal cortex, sensory cortex, motor cortex, caudate nucleus, dentate nucleus, cerebellar cortex, cerebral cortex, brainstem, hippocampus, thalamus, putamen, or a combination thereof. In some embodiments, the AAV capsid, e.g., an AAV capsid variant, is capable of preferential transduction in brain regions compared to transduction in the dorsal root ganglion (DRG).
[0228] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, enables increased distribution to spinal cord regions, hi some embodiments, the spinal cord regions include the cervical spinal cord region, the thoracic spinal cord region, and / or the lumbar spinal cord region.
[0229] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises a VOY101 capsid polypeptide, a PHPeB capsid polypeptide, an AAVPHP.B (PHP.B) capsid polypeptide, an AAVPHP.N (PHP.N) capsid polypeptide, an AAV1 capsid polypeptide, an AAV2 capsid polypeptide, an AAV5 capsid polypeptide, an AAV9 capsid polypeptide, an AAV9 K449R capsid polypeptide, an AAVrhlO capsid polypeptide, or a functional variant thereof. In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence of any of the AAV capsid polypeptides in Table 1, or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding the AAV capsid polypeptide comprises any one of the nucleotide sequences in Table 1, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14
[0230] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence of any of SEQ ID NOs: 1, 3, 11, 138, 12, 13, 14, 16, 18, 20, 5147, 3636, or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that contains at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but no more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, compared to the amino acid sequence of any of SEQ ID NOs: 1, 3, 11, 138, 12, 13, 14, 16, 18, 20, or 3636. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence encoded by the nucleotide sequence of any of SEQ ID NOs: 137, 15, 17, 19, 21, 3623, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).
[0231] In some embodiments, a nucleotide sequence encoding an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the nucleotide sequence of any of SEQ ID NOs: 137, 15, 17, 19, 21, 5148, or 3623, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, a nucleotide sequence encoding an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises a nucleotide sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of any of SEQ ID NOs: 137, 15, 17, 19, 21, or 3623.
[0232] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 138. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises a substitution at position K449, numbered according to SEQ ID NO: 138, e.g., a K449R substitution.
[0233] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence of SEQ ID NO: 11, or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 11, and optionally, position 449 is not R.
[0234] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 1.
[0235] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 3.
[0236] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 5147 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence that includes at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 5147.
[0237] In some embodiments, an AAV capsid variant disclosed herein comprises a modification in loop VIII of AAV9 at positions 580-599, e.g., at positions 587, 588, 589, and / or 590, numbered relative to, e.g., SEQ ID NOs: 5, 8, 138, or 3636-3647. In some embodiments, loop (e.g., loop VIII) is used interchangeably herein with the term variable region (e.g., variable region VIII) or VR (e.g., VR-VIII). In some embodiments, loop VIII comprises positions 580-599, numbered according to SEQ ID NO: 138 (e.g., amino acids VATNHQSAQAQAQTGWVQNQ (SEQ ID NO: 1195)). In some embodiments, loop VIII comprises positions 582-593, numbered according to SEQ ID NO: 138 (e.g., amino acids TNHQSAQAQAQT (SEQ ID NO: 1196)). In some embodiments, loop VIII comprises positions 587-593, numbered according to SEQ ID NO: 138 (e.g., amino acids AQAQAQT (SEQ ID NO: 1197)). In some embodiments, loop VIII comprises positions 587-590, numbered according to SEQ ID NO: 138 (e.g., amino acids AQAQ (SEQ ID NO: 5026)). In some embodiments, loop VIII or variable region VIII (VR-VIII) is as described in DiMattia et al. "Structural Insights into the Unique Properties of the Adeno-Associated Virus Serotype 9," Journal of Virology, 12(86):6947-6958 (the contents of which are incorporated herein by reference in their entirety), e.g., comprises positions 581-593, numbered according to SEQ ID NO: 138 (e.g., ATNHQSAQAQAQT (SEQ ID NO: 1198)).
[0238] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262). In some embodiments, the peptide is located immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the capsid polypeptide comprises amino acid substitutions A587D and Q588G, numbered according to SEQ ID NO: 138.
[0239] In some embodiments, the AAV capsid polypeptide, e.g., the AAV capsid variant, comprises an amino acid substitution of K449R, numbered according to SEQ ID NO: 138; and a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), wherein the peptide is located immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138.
[0240] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid substitution K449R, numbered according to SEQ ID NO: 138; a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262) (the insert is located immediately after position 588 compared to the reference sequence numbered according to SEQ ID NO: 138); and the amino acid substitutions A587D and Q588G, numbered according to SEQ ID NO: 138.
[0241] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262) (the insert is located immediately after position 588 compared to the reference sequence numbered according to SEQ ID NO: 138); and the amino acid substitutions A587D and Q588G numbered according to SEQ ID NO: 138.
[0242] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises at least 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648). In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), an amino acid sequence containing at least one, two, or three but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, compared to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), or an amino acid sequence containing at least one, two, or three but not more than four different amino acids compared to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), optionally where position 7 is H. In some embodiments, the amino acid sequence is located in loop VIII. In some embodiments, the amino acid sequence is located immediately after position 586 compared to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces positions 587 and 588 (e.g., A587 and Q588) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence immediately follows position 586 numbered according to SEQ ID NO: 138 and replaces positions 587 and 588 (e.g., A587 and Q588).
[0243] In some embodiments, three consecutive amino acids comprise PLN. In some embodiments, four consecutive amino acids comprise PLNG (SEQ ID NO: 3678). In some embodiments, five consecutive amino acids comprise PLNGA (SEQ ID NO: 3679). In some embodiments, six consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680). In some embodiments, seven consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681). In some embodiments, eight consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682). In some embodiments, nine consecutive amino acids comprise PLNGAVHLY (SEQ ID NO: 3648).
[0244] In some embodiments, the four consecutive amino acids comprise NGAV (SEQ ID NO: 3683). In some embodiments, the four consecutive amino acids comprise GAVH (SEQ ID NO: 3684). In some embodiments, the five consecutive amino acids comprise NGAVH (SEQ ID NO: 3685). In some embodiments, the five consecutive amino acids comprise GAVHL (SEQ ID NO: 3686). In some embodiments, the five consecutive amino acids comprise AVHLY (SEQ ID NO: 3687). In some embodiments, the six consecutive amino acids comprise NGAVHL (SEQ ID NO: 3688). In some embodiments, the seven consecutive amino acids comprise NGAVHLY (SEQ ID NO: 3689).
[0245] In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant (e.g., an AAV capsid variant described herein), comprises an amino acid sequence encoded by a nucleotide sequence of CCGCTTAATGGTGCCGTCCATCTTTAT (SEQ ID NO: 3660), or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, an AAV capsid, e.g., an AAV capsid variant described herein, comprises an amino acid sequence encoded by a nucleotide sequence that includes at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of CCGCTTAATGGTGCCGTCCATCTTTAT (SEQ ID NO: 3660). In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant (e.g., an AAV capsid variant described herein), comprises an amino acid sequence encoded by a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of CCGCTTAATGGTGCCGTCCATCTTTAT (SEQ ID NO: 3660).
[0246] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid P at position 587, an amino acid L at position 588, and the amino acid sequence NGAVHLY (SEQ ID NO: 3689) located immediately after position 588, corresponding to or numbered according to SEQ ID NO: 3636.
[0247] In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, e.g., an AAV capsid variant described herein, comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, e.g., an AAV capsid variant described herein, comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence at least 95% identical thereto. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, e.g., an AAV capsid variant described herein, comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence at least 99% identical thereto.
[0248] In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, e.g., an AAV capsid variant described herein, comprises an amino acid sequence that contains at least one, two, or three modifications, substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20, or 10 modifications, substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 3636. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, e.g., an AAV capsid variant described herein, comprises an amino acid sequence that has at least one, two, or three, but not more than 30, 20, or 10, different amino acids, relative to the amino acid sequence of SEQ ID NO: 3636.
[0249] In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence corresponding to positions 138-743 of SEQ ID NO: 3636, e.g., VP2, or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, an AAV capsid variant comprises an amino acid sequence corresponding to positions 203-743 of SEQ ID NO: 3636, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, an AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence corresponding to positions 138-736 of SEQ ID NO: 138, e.g., VP2, or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, an AAV capsid variant comprises an amino acid sequence corresponding to positions 203-736 of SEQ ID NO: 138, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the amino acid sequence occurs immediately after position 586 numbered according to any one of SEQ ID NOs: 138 or 3636, and optionally, the amino acids replace positions 587 and 588 numbered according to SEQ ID NO: 138 (e.g., A587 and Q588). In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO:3636.
[0250] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises one or two, but not more than three, different amino acids (e.g., substitutions, e.g., conservative substitutions) compared to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), and the AAV capsid variant comprises: (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or 3636; (b) a VP2 protein comprising the amino acid sequence of positions 138-736 of SEQ ID NO: 138 or positions 138-743 of SEQ ID NO: 5, 8, or 3636; (c) a VP3 protein comprising the amino acid sequence of positions 203-736 of SEQ ID NO: 138 or positions 203-743 of SEQ ID NO: 5, 8, or 3636; or (d) an amino acid sequence having at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) sequence identity to any of the amino acid sequences in (a)-(c). In some embodiments, the amino acid sequence is located immediately after position 586 numbered according to any one of SEQ ID NOs: 138 or 3636, and optionally the amino acids replace positions 587 and 588 (e.g., A587 and Q588) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.
[0251] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises one or two, but not more than three, different amino acids (e.g., substitutions, e.g., conservative substitutions) compared to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), and the AAV capsid variant comprises the amino acid sequence of any one of SEQ ID NOs: 5, 8, 138, or 3636, or an amino acid sequence having at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) sequence identity to SEQ ID NO: 3636. In some embodiments, the amino acid sequence occurs immediately after position 586 numbered according to any one of SEQ ID NOs: 138 or 3636, and optionally, the amino acids replace positions 587 and 588 (e.g., A587 and Q588) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.
[0252] In some embodiments, the AAV capsid polypeptide, e.g., an AAV capsid variant, comprises an amino acid sequence comprising at least 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein (i) 5 consecutive amino acids comprise PLNGA (SEQ ID NO: 3679); (ii) 6 consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680); (iii) 7 consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681); (iv) 8 consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682); or (v) 9 consecutive amino acids comprise PLNGAVH LY (SEQ ID NO:3648), wherein the AAV capsid variant comprises: (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO:138 or SEQ ID NO:3636; (b) a VP2 protein comprising the amino acid sequence of positions 138-736 of SEQ ID NO:138 or positions 138-743 of SEQ ID NO:3636; (c) a VP3 protein comprising the amino acid sequence of positions 203-736 of SEQ ID NO:138 or positions 203-743 of SEQ ID NO:3636; or (d) an amino acid sequence having at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) sequence identity to any of the amino acid sequences in (a)-(c). In some embodiments, the amino acid sequence occurs immediately after position 586 numbered according to any one of SEQ ID NOs:138 or 3636, and optionally the amino acids replace positions 587 and 588 numbered according to SEQ ID NO:138 (e.g., A587 and Q588). In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO:3636.
[0253] In some embodiments, the AAV capsid polypeptide, e.g., the AAV capsid variant, comprises an amino acid sequence comprising at least 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein (i) 5 consecutive amino acids comprise PLNGA (SEQ ID NO: 3679); (ii) 6 consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680); (iii) 7 consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681); (iv) 8 consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682); or (v) 9 consecutive amino acids comprise PLNGAVHLY (SEQ ID NO: 3648), and the AAV capsid variant comprises the amino acid sequence of any one of SEQ ID NOs: 5, 8, or 3636 or an amino acid sequence having at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) sequence identity to any one of SEQ ID NOs: 3636. In some embodiments, the amino acid sequence is located immediately after position 586 numbered according to any one of SEQ ID NOs: 138 or 3636, and optionally the amino acids replace positions 587 and 588 (e.g., A587 and Q588) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.
[0254] In some embodiments, a nucleotide sequence encoding an AAV capsid polypeptide described herein, e.g., an AAV capsid variant, comprises the nucleotide sequence of SEQ ID NO: 3623, or a nucleotide sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, a nucleotide sequence encoding an AAV capsid variant comprises a nucleotide sequence that includes at least one, two, or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20, or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 3623. In some embodiments, a nucleotide sequence encoding an AAV capsid variant comprises a nucleotide sequence that includes at least one, two, or three, but not more than 30, 20, or 10, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 3623. In some embodiments, a nucleic acid sequence encoding an AAV capsid polypeptide described herein, e.g., an AAV capsid variant, is codon-optimized.
[0255] In some embodiments, the AAV capsid polypeptides described herein, e.g., AAV capsid variants, have increased tropism for CNS cells or tissues, e.g., brain cells, brain tissue, spinal cord cells, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138.
[0256] In some embodiments, the AAV capsid polypeptides, e.g., AAV capsid variants, of the present disclosure have reduced tropism for the liver. In some embodiments, the AAV capsid variants comprise modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, that result in reduced tropism (e.g., detargeting) and / or activity in the liver. In some embodiments, the reduced tropism in the liver is compared to an otherwise similar capsid, e.g., a wild-type capsid polypeptide, that does not contain the modification. In some embodiments, the described AAV capsid variants comprise modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, that result in one or more of the following properties: (1) reduced tropism in the liver; (2) detargeted expression in the liver; (3) reduced activity in the liver; and / or (4) reduced binding to galactose. In some embodiments, the reduction in any one or all of properties (1)-(3) is compared to an otherwise similar AAV capsid variant that does not contain the modification. Exemplary modifications are provided in WO2018 / 119330; Pulicherla et al. (2011) Mol. Ther. 19(6):1070-1078; Adachi et al. (2014) Nature Communications 5(3075), DOI: 10.1038 / ncomms4075; and Bell et al. (2012) J. Virol. 86(13):7326-33, the contents of which are incorporated herein by reference in their entireties. In some embodiments, the AAV capsid variant comprises a modification, e.g., a substitution (e.g., a conservative substitution), insertion, or deletion, at positions N470 (e.g., N470A), D271 (e.g., D271A), N272 (e.g., N272A), Y446 (e.g., Y446A), N498 (e.g., N498Y or N498I), W503 (e.g., W503R or W503A), L620 (e.g., L620F), or a combination thereof, relative to a reference sequence numbered according to SEQ ID NO: 138.In some embodiments, the AAV capsid variant includes one, two, three, four, five, or all of the following compared to a reference sequence numbered according to SEQ ID NO: 138: an amino acid other than N (e.g., A) at position 470, an amino acid other than D (e.g., A) at position 271, an amino acid other than N (e.g., A) at position 272, an amino acid other than Y (e.g., A) at position 446, and an amino acid other than N (e.g., Y or I) at position 498, and an amino acid other than W (e.g., R or A) at position 503, and an amino acid other than L (e.g., F) at position 620. In some embodiments, the AAV capsid variant comprises a modification, e.g., a substitution (e.g., a conservative substitution), insertion, or deletion, at positions N470 (e.g., N470A), D271 (e.g., D271A), N272 (e.g., N272A), Y446 (e.g., Y446A), and W503 (e.g., W503R or W03A) relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises a modification, e.g., a substitution (e.g., a conservative substitution), insertion, or deletion, at N498 (e.g., N498Y) and L620 (e.g., L620F).
[0257] In some embodiments, the AAV capsid variants included herein comprise modifications described in Adachi et al. (2014) Nature Communications 5(3075), DOI: 10.1038 / ncomms4075, the contents of which are hereby incorporated by reference in their entirety. Exemplary modifications that may or may not alter tissue transduction in at least the brain, liver, heart, lung, and / or kidney can be found in Supplementary Data 2, which shows AAV Barcode-Seq data obtained in the AAV9-AA-VBCLib of Adachi et al. (supra), the contents of which are hereby incorporated by reference in their entirety.
[0258] In some embodiments, the AAV capsid polypeptides, e.g., AAV capsid variants, of the present disclosure are isolated, e.g., recombinant. In some embodiments, the polynucleotides encoding the AAV capsid polypeptides, e.g., AAV capsid variants, of the present disclosure are isolated, e.g., recombinant.
[0259] The present disclosure refers to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural shell (i.e., capsid) of viral vectors, such as AAV. VP capsid proteins synthesized from Cap polynucleotides typically contain a methionine (Met1) as the first amino acid in the peptide sequence, relative to the initiation codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue, or typically any first amino acid (AA1), is commonly cleaved after or during polypeptide synthesis by a protein processing enzyme, e.g., a Met-aminopeptidase. This "Met / AA-clipping" process often correlates with the corresponding acetylation of a second amino acid (e.g., alanine, valine, serine, threonine, etc.) in the polypeptide sequence. Met-clipping occurs commonly in the VP1 and VP3 capsid proteins, but can also occur in the VP2 capsid protein.
[0260] If Met / AA-clipping is incomplete, a mixture of one or more (1, 2, or 3) VP capsid proteins comprising the viral capsid may be produced, some of which may contain the Met1 / AA1 amino acid (Met+ / AA+) and some of which may lack the Met1 / AA1 amino acid as a result of Met / AA-clipping (Met- / AA-). For further discussion of Met / AA-clipping in capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5):255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968):973-977, the contents of which are each incorporated herein by reference in their entireties.
[0261] According to the present disclosure, reference to a capsid protein is not limited to either clipped (Met- / AA-) or unclipped (Met+ / AA+) and, in context, may refer to individual capsid proteins, viral capsids comprising mixtures of capsid proteins, and / or polynucleotide sequences (or fragments thereof) that encode, describe, produce, or result in the capsid proteins of the present disclosure. Direct reference to a "capsid protein" or "capsid polypeptide" (e.g., VP1, VP2, or VP2) can also include VP capsid proteins that include the Met1 / AA1 amino acids (Met+ / AA+) and the corresponding VP capsid protein that lacks the Met1 / AA1 amino acids as a result of Met / AA- clipping (Met- / AA-).
[0262] Further, according to the present disclosure, reference to a particular SEQ ID NO: (whether protein or nucleic acid) that each comprises or encodes one or more capsid proteins (Met+ / AA+) that comprise the Met1 / AA1 amino acids should be understood to teach a VP capsid protein that lacks the Met1 / AA1 amino acids, as, upon confirmation of the sequence, it is readily apparent that any sequence merely lacks the first listed amino acid (whether Met1 / AA1 or not).
[0263] As a non-limiting example, reference to a VP1 polypeptide sequence that is 736 amino acids in length and that includes the "Met1" amino acid (Met+) encoded by an AUG / ATG start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "Met1" amino acid (Met-) of the 736 amino acid Met+ sequence. As a second non-limiting example, reference to a VP1 polypeptide sequence that is 736 amino acids in length and that includes the "AA1" amino acid (AA1+) encoded by any NNN start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "AA1" amino acid (AA1-) of the 736 amino acid AA1+ sequence.
[0264] Reference to a viral capsid formed from VP capsid proteins (e.g., reference to a particular AAV capsid serotype) can include VP capsid proteins that include the Met1 / AA1 amino acids (Met+ / AA1+), the corresponding VP capsid proteins that lack the Met1 / AA1 amino acids as a result of Met / AA1-clipping (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).
[0265] As non-limiting examples, AAV capsid serotypes can include VP1(Met+ / AA1+), VP1(Met- / AA1-), or a combination of VP1(Met+ / AA1+) and VP1(Met- / AA1-). AAV capsid serotypes can also include VP3(Met+ / AA1+), VP3(Met- / AA1-), or a combination of VP3(Met+ / AA1+) and VP3(Met- / AA1-); and any similar combination of VP2(Met+ / AA1) and VP2(Met- / AA1-).
[0266] Also provided herein are polynucleotide sequences encoding any of the above-described AAV capsid variants, as well as AAV particles, vectors, and cells containing the same.
[0267] viral genome In some embodiments, an AAV particle of the present disclosure, e.g., an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant described herein, comprises an agent for targeting MAPT, e.g., a viral genome encoding an siRNA duplex for targeting MAPT or a regulatory polynucleotide encoding an siRNA duplex for targeting MAPT.
[0268] In some embodiments, the AAV particles described herein comprising an AAV capsid polypeptide described herein, e.g., an AAV capsid variant, can be used for delivery of a viral genome to a tissue (e.g., the CNS, DRG, and / or muscle). In some embodiments, the AAV particles comprising an AAV capsid polypeptide described herein, e.g., an AAV capsid variant, can be used for delivery of a viral genome to a tissue or cell, e.g., a CNS, DRG, or muscle cell or tissue. In some embodiments, the AAV particles of the present disclosure are recombinant AAV particles. In some embodiments, the AAV particles of the present disclosure are isolated AAV particles.
[0269] In some embodiments, the AAV particles described herein are used to deliver agents for targeting MAPT (e.g., siRNA duplexes or regulatory polynucleotides encoding siRNA duplexes targeting MAPT) to cells of the CNS following intravenous delivery.
[0270] In some embodiments, the viral genome of an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant, described herein comprises a nucleic acid comprising a transgene encoding an agent for targeting MAPT (e.g., a regulatory polynucleotide encoding an siRNA duplex or an siRNA duplex (e.g., an siRNA duplex for targeting MAPT) targeting MAPT). In some embodiments, the viral genome comprises an inverted terminal repeat (ITR) sequence. In some embodiments, the viral genome comprises two ITR sequences, for example, one at the 5' end of the viral genome (e.g., 5' to the encoded payload) and one at the 3' end of the viral genome (e.g., 3' to the encoded payload). In some embodiments, the viral genome of an AAV particle described herein (e.g., comprising an AAV capsid variant described herein) can include regulatory elements (e.g., promoters), untranslated regions (UTRs), miR binding sites, polyadenylation sequences (polyA), filler or stuffer sequences, introns, and / or linker sequences, e.g., to improve transgene expression.
[0271] In some embodiments, the viral genome components are selected and / or engineered for expression of an agent (e.g., a siRNA duplex targeting MAPT or a regulatory polynucleotide encoding an siRNA duplex (e.g., a siRNA duplex for targeting MAPT)) to target MAPT in a target tissue (e.g., a CNS tissue, e.g., brain tissue or spinal cord tissue) or target cell (e.g., a cell of the CNS, e.g., a brain cell or spinal cord cell).
[0272] Viral genome components: Inverted terminal repeats (ITRs) In some embodiments, the viral genome comprises an ITR and a transgene encoding a payload. In some embodiments, the viral genome comprises two ITRs. In some embodiments, the two ITRs flank a nucleotide sequence encoding the payload at the 5' and 3' ends. In some embodiments, the ITRs function as origins of replication containing recognition sites for replication. In some embodiments, the ITRs contain sequence regions that may be complementary and may be symmetrically arranged. In some embodiments, the ITRs incorporated into the viral genomes described herein may comprise naturally occurring or recombinantly derived polynucleotide sequences.
[0273] In some embodiments, the ITRs can be of the same serotype as the capsid polypeptide, e.g., a capsid variant, selected from any of the known serotypes or variants thereof. In some embodiments, the ITRs can be of a different serotype from the capsid. In one embodiment, the viral genome comprises two ITR sequence regions, and the ITRs are of the same serotype as each other. In another embodiment, the viral genome comprises two ITR sequence regions, and the ITRs are of different serotypes. Non-limiting examples include either or both of the ITRs having the same serotype as the capsid. In one embodiment, both ITRs in the viral genome of the AAV particle are AAV2 ITRs.
[0274] In some embodiments, the ITRs comprise the nucleotide sequence of SEQ ID NO: 5197, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the ITRs comprise the nucleotide sequence of SEQ ID NO: 5200, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the AAV viral genome comprises an ITR comprising the nucleotide sequence of SEQ ID NO: 5197, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto, and an ITR comprising the nucleotide sequence of SEQ ID NO: 5200, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0275] In some embodiments, the ITRs comprise the nucleotide sequence of SEQ ID NO: 4469, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the ITRs comprise the nucleotide sequence of SEQ ID NO: 4470, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the AAV viral genome comprises an ITR comprising the nucleotide sequence of SEQ ID NO: 4469, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto, and an ITR comprising the nucleotide sequence of SEQ ID NO: 4470, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0276] Viral genome components: promoter In some embodiments, the viral genome comprises at least one element for improving payload target specificity and expression (see Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015, the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of elements for improving payload target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (polyA) signal sequences and upstream enhancers (USEs), CMV enhancers, and introns.
[0277] In some embodiments, an AAV particle comprising an AAV capsid variant described herein comprises a viral genome comprising a nucleic acid comprising a transgene encoding a payload, the transgene being operably linked to a promoter. In some embodiments, the promoter is a species-specific promoter, an inducible promoter, a tissue-specific promoter, or a cell cycle-specific promoter (e.g., a promoter described in Parr et al., Nat. Med. 3:1145-9 (1997) (the contents of which are incorporated herein by reference in their entirety)).
[0278] In some embodiments, the promoter may be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include those derived from viruses, plants, mammals, or humans. In some embodiments, the promoter may be derived from a human cell or system. In some embodiments, the promoter may be truncated or mutated (e.g., promoter variants).
[0279] In some embodiments, the promoter is a ubiquitous promoter, e.g., capable of expression in multiple tissues. In some embodiments, the promoter is the human elongation factor 1 α-subunit (EF1α) promoter, the cytomegalovirus (CMV) immediate early enhancer and / or promoter, the chicken β-actin (CBA) promoter and its derivative CAG, the β-glucuronidase (GUSB) promoter, or the ubiquitin C (UBC) promoter. In some embodiments, the promoter is a cell- or tissue-specific promoter, e.g., capable of expression in tissues or cells of the central or peripheral nervous system, targeted regions therein (e.g., the frontal cortex), and / or subsets of cells therein (e.g., excitatory neurons). In some embodiments, the promoter is a cell type-specific promoter capable of expressing the payload in excitatory neurons (e.g., glutamatergic), inhibitory neurons (e.g., GABAergic), neurons of the sympathetic or parasympathetic nervous system, sensory neurons, neurons of the dorsal root ganglion, motor neurons, or support cells of the nervous system, such as microglia, glial cells, astrocytes, oligodendrocytes, and / or Schwann cells.
[0280] In some embodiments, the promoter is a liver-specific promoter (e.g., hAAT, TBG), a skeletal muscle-specific promoter (e.g., desmin, MCK, C512), a B cell promoter, a monocyte promoter, a leukocyte promoter, a macrophage promoter, a pancreatic acinar cell promoter, an endothelial cell promoter, a lung tissue promoter, and / or a cardiac or cardiovascular promoter (e.g., αMHC, cTnT, and CMV-MLC2k).
[0281] In some embodiments, the promoter is a tissue-specific promoter for payload expression in tissues or cells of the central nervous system. In some embodiments, the promoter is a synapsin (Syn) promoter, a vesicular glutamate transporter (VGLUT) promoter, a vesicular GABA transporter (VGAT) promoter, a parvalbumin (PV) promoter, a sodium channel Na promoter, or a VEGF promoter. v 1.8 promoter, tyrosine hydroxylase (TH) promoter, choline acetyltransferase (ChaT) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) or heavy chain (NFH) promoter, neuron-specific enolase (NSE) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, and excitatory amino acid transporter 2 (EAAT2) promoter, or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter capable of expression in astrocytes, such as the glial fibrillary acidic protein (GFAP) promoter and the EAAT2 promoter, or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter capable of expression in oligodendrocytes, such as the myelin basic protein (MBP) promoter, or fragments thereof.
[0282] In some embodiments, the promoter is a GFAP promoter. In some embodiments, the promoter is a synapsin (syn or syn1) promoter, or a fragment thereof.
[0283] In some embodiments, the promoter comprises a CBA promoter or a variant thereof, e.g., a functional variant thereof. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 5199, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0284] In some embodiments, the AAV viral genome comprises an enhancer. In some embodiments, the enhancer comprises a CMVie enhancer or a variant thereof. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 4472, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0285] In some embodiments, the AAV viral genome comprises an enhancer and a promoter. In some embodiments, the enhancer comprises a CMVie enhancer and the promoter comprises a CBA promoter. In some embodiments, the enhancer and promoter comprise the nucleotide sequence of SEQ ID NO: 4474, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0286] In some embodiments, the promoter comprises an insulin promoter or a fragment thereof.
[0287] In some embodiments, the viral genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV, CBA (including derivatives CAG, CB6, CBh, etc.), EF-1α, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). In some embodiments, the viral genome comprises an EF-1α promoter or an EF-1α promoter variant, for example, as provided in Table 2. In some embodiments, the EF-1α promoter comprises a nucleotide sequence of any one of SEQ ID NOs: 1874-1889 or any of the sequences provided in Table 40, a nucleotide sequence that contains at least one, two, or three but not more than four modifications, e.g., substitutions, compared to the nucleotide sequence of SEQ ID NOs: 1874-1889 or any of the sequences provided in Table 40, or a nucleotide sequence that has at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 1874-1889 or any of the sequences provided in Table 2. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]
[0288] Viral genome components: introns In some embodiments, the viral genome includes elements to improve payload target specificity and expression, such as introns (Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, Discov. Med. 2015, 19(102):49-57; the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of introns include MVM (67-97 bp), F.IX cleavage intron 1 (300 bp), β-globin SD / immunoglobulin heavy chain splice acceptor (250 bp), adenovirus splice donor / immunoglobulin splice acceptor (500 bp), SV40 late splice donor / splice acceptor (19S / 16S) (180 bp), and hybrid adenovirus splice donor / IgG splice acceptor (230 bp). In some embodiments, the intron comprises a human beta-globin intron or a variant thereof.
[0289] In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 4475, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
[0290] Viral genome components: untranslated regions (UTRs) In some embodiments, the wild-type untranslated region (UTR) of a gene is transcribed but not translated. Typically, the 5' UTR begins at the transcription start site and ends at the start codon, and the 3' UTR begins immediately after the stop codon and continues to the termination signal for transcription.
[0291] Features typically found in abundantly expressed genes of particular target organs can be engineered into UTRs to improve stability and protein production. As a non-limiting example, the 5' UTR from an mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII) can be used in the viral genome of an AAV particle of the present disclosure to improve expression in liver cell lines or the liver.
[0292] In some embodiments, the viral genome encoding the transgene described herein (e.g., a transgene encoding a GBA protein) contains a Kozak sequence. Without wishing to be bound by theory, wild-type 5' untranslated regions (UTRs) contain features that play a role in translation initiation. The Kozak sequence, which is generally known to be involved in the process by which ribosomes initiate translation of many genes, is usually contained in the 5'UTR. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG) (followed by another "G").
[0293] In some embodiments, the 5'UTR in the viral genome comprises a Kozak sequence.
[0294] In some embodiments, the 5'UTR in the viral genome does not comprise a Kozak sequence.
[0295] Without wishing to be bound by theory, wild-type 3'UTRs are known to have stretches of adenosines and uridines embedded therein. These AU-rich signatures are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al., 1995, the contents of which are incorporated herein by reference in their entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of the AUUUA motif within the U-rich region. Class II AREs, such as, but not limited to, GM-CSF and TNF-α, possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III AREs, such as, but not limited to, c-Jun and myogenin, are less well defined. These U-rich regions do not contain the AUUUA motif. While most proteins that bind to AREs are known to destabilize messengers, members of the ELAV family, most notably HuR, have been documented to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule will result in HuR binding and, therefore, message stabilization in vivo.
[0296] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) can be used to regulate the stability of polynucleotides. When manipulating a particular polynucleotide, such as the payload region of a viral genome, one or more copies of AREs can be introduced to make the polynucleotide less stable, thereby suppressing translation and reducing the production of the resulting protein. Similarly, AREs can be identified, removed, or mutated to increase intracellular stability, thereby increasing the translation and production of the resulting protein.
[0297] In some embodiments, the 3'UTR of the viral genome may contain an oligo(dT) sequence for templated addition of a poly-A tail.
[0298] Any UTR from any gene known in the art can be incorporated into the viral genome of an AAV particle. These UTRs, or portions thereof, can be placed in the same orientation as the gene they are selected from, or they can be modified in orientation or position. In some embodiments, the UTRs used in the viral genome of an AAV particle can be reversed, shortened, extended, or created with one or more other 5'UTRs or 3'UTRs known in the art. As used herein, the term "modified," when referring to a UTR, means that the UTR can be altered in some way relative to the reference sequence. For example, the 3' or 5' UTR can be modified compared to the wild-type or native UTR by changing its orientation or position as taught above, or by including additional nucleotides, deleting nucleotides, exchanging nucleotides, or transposing nucleotides.
[0299] In some embodiments, the viral genome of the AAV particle comprises at least one artificial UTR that is not a variant of a wild-type UTR.
[0300] In some embodiments, the viral genome of the AAV particle comprises UTRs selected from a family of transcripts whose proteins share a common function, structure, feature, or characteristic.
[0301] Viral genome components: miR binding sites Tissue- or cell-specific expression of the AAV viral particles of the present invention can be improved by introducing tissue- or cell-specific regulatory sequences, such as promoters, enhancers, microRNA binding sites, e.g., detargeting sites. Without wishing to be bound by theory, it is believed that the encoded miR binding site can regulate, e.g., prevent, suppress, or otherwise inhibit, the expression of a gene of interest on the viral genome of the present invention based on the expression of a corresponding endogenous microRNA (miRNA) or a corresponding regulated exogenous miRNA in a tissue or cell, e.g., a non-target cell or tissue. In some embodiments, the miR binding site regulates, e.g., reduces, the expression of a payload encoded by the viral genome of the AAV particles described herein in cells or tissues in which the corresponding mRNA is expressed. In some embodiments, the miR binding site regulates, e.g., reduces, the expression of the encoded GBA protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof.
[0302] In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a microRNA binding site, e.g., a detargeting site. In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a miR binding site, a microRNA binding site series (miR BS), or its reverse complement.
[0303] In some embodiments, the miR binding site series or nucleotide sequences encoding the miR binding sites are located in the 3'-UTR region of the viral genome (e.g., 3' to the nucleic acid sequence encoding the payload), e.g., before the polyA sequence, in the 5'-UTR region of the viral genome (e.g., 5' to the nucleic acid sequence encoding the payload), or both.
[0304] In some embodiments, the encoded miR binding site series contains at least 1-5 copies of the miR binding site (miR BS), e.g., at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5, or more copies. In some embodiments, the encoded miR binding site series contains 4 copies of the miR binding site. In some embodiments, all copies are identical, e.g., contain the same miR binding site. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, e.g., a non-coding sequence. In some embodiments, the spacer is about 1-6 nucleotides or about 5-10 nucleotides in length, e.g., about 7-8 nucleotides. In some embodiments, the spacer is about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three, but no more than four, modifications of GATAGTTA.
[0305] In some embodiments, the encoded miR binding site series contains at least 1-5 copies of the miR binding site (miR BS), e.g., at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5, or more copies. In some embodiments, at least 1, 2, 3, 4, 5, or all copies are different, e.g., contain different miR binding sites. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, e.g., a non-coding sequence. In some embodiments, the spacer is about 1-6 nucleotides or about 5-10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; or (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 but no more than 4 modifications of GATAGTTA.
[0306] In some embodiments, the encoded miR binding site is substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical) to a miR in the host cell. In some embodiments, the encoded miR binding site contains at least 1, 2, 3, 4, or 5 mismatches or no more than 6, 7, 8, 9, or 10 mismatches with a miR in the host cell. In some embodiments, the mismatched nucleotides are consecutive. In some embodiments, the mismatched nucleotides are non-consecutive. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, for example, at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% identical to a miR in the host cell.
[0307] In some embodiments, the nucleotide sequence encoding the miR binding site is substantially complementary (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementary) to an miR in a host cell. In some embodiments, the sequence complementary to the nucleotide sequence encoding the miR binding site contains at least 1, 2, 3, 4, or 5 mismatches or no more than 6, 7, 8, 9, or 10 mismatches compared to the corresponding miR in a host cell. In some embodiments, the mismatched nucleotides are consecutive. In some embodiments, the mismatched nucleotides are non-consecutive. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, for example, at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% complementary to an miR in a host cell.
[0308] In some embodiments, the encoded miR binding site or series of encoded miR binding sites is about 10 to about 125 nucleotides in length, e.g., about 10 to 50 nucleotides, 10 to 100 nucleotides, 50 to 100 nucleotides, 50 to 125 nucleotides, or 100 to 125 nucleotides in length. In some embodiments, the encoded miR binding site or series of encoded miR binding sites is about 7 to about 28 nucleotides in length, e.g., about 8 to 28 nucleotides, 7 to 28 nucleotides, 8 to 18 nucleotides, 12 to 28 nucleotides, 20 to 26 nucleotides, 22 nucleotides, 24 nucleotides, or 26 nucleotides in length, and optionally includes at least one contiguous region (e.g., 7 or 8 nucleotides) complementary (e.g., fully complementary or partially complementary) to a seed sequence of a miRNA (e.g., miR122, miR142, miR-1, miR183).
[0309] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the liver or hepatocytes, e.g., miR122. In some embodiments, the encoded miR binding site or encoded miR binding site series comprises a miR122 binding site sequence. In some embodiments, the encoded miR122 binding site comprises a nucleotide sequence of ACAAACACCATTGTCACACTCCA (SEQ ID NO: 1865), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1865, or having at least 1, 2, 3, 4, 5, 6, or 7 modifications but no more than 10 modifications, e.g., modifications may result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises an encoded miR122-binding site, e.g., at least 3, 4, or 5 copies of an encoded miR122-binding site series, optionally wherein the encoded miR122-binding site series comprises a nucleotide sequence of ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCA (SEQ ID NO: 1866), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1866, or at least 1, 2, 3, 4, 5, 6, 7, but no more than 10 modifications, e.g., modifications that may result in mismatches between the encoded miR-binding site and the corresponding miRNA. In some embodiments, at least two of the encoded miR122-binding sites are directly connected, e.g., without a spacer.In other embodiments, at least two of the encoded miR122-binding sites are separated by a spacer, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, disposed between two or more consecutive encoded miR122-binding site sequences. In embodiments, the spacer is about 1-6 nucleotides or about 5-10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; or (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but no more than four modifications, of GATAGTTA.
[0310] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in the heart. In embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR-1 binding site. In some embodiments, the encoded miR-1 binding site comprises a nucleotide sequence of ATACATACTTCTTTACATTCCA (SEQ ID NO:5025), a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:5025, or having at least 1, 2, 3, 4, 5, 6, or 7 modifications but no more than 10 modifications, e.g., modifications may result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 2, 3, 4, or 5 copies of an encoded miR-1 binding site, e.g., a series of encoded miR-1 binding sites. In some embodiments, the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR-1 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; or (iii) GCATGC, or repeats of one or more of (i) to (iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but no more than four modifications, of GATAGTTA.
[0311] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the hematopoietic lineage, including immune cells (e.g., antigen-presenting cells or APCs, including dendritic cells (DCs), macrophages, and B lymphocytes). In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the hematopoietic lineage, e.g., comprises a nucleotide sequence disclosed in US2018 / 0066279, the contents of which are incorporated herein by reference in their entirety.
[0312] In some embodiments, the encoded miR-binding site or encoded miR-binding site series comprises a miR-142-3p binding site sequence. In some embodiments, the encoded miR-142-3p binding site comprises a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 1869), SEQ ID NO: 1842, or at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., modifications may result in mismatches between the encoded miR-binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, 4, or 5 copies of the encoded miR-142-3p binding site, e.g., the encoded miR-142-3p binding site series. In some embodiments, at least 3, 4, or 5 copies (e.g., 4 copies) of the encoded miR-142-3p binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; or (iii) GCATGC, or repeats of one or more of (i) to (iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but no more than four modifications, of GATAGTTA.
[0313] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG (dorsal root ganglion) neurons, e.g., miR183, miR182, and / or miR96 binding site. In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG neurons. In some embodiments, the encoded miR binding site comprises a nucleotide sequence disclosed in, e.g., WO2020 / 132455, the contents of which are incorporated herein by reference in their entirety.
[0314] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR183 binding site sequence. In some embodiments, the encoded miR183 binding site comprises a nucleotide sequence of AGTGAATTCTACAGTGCCATA (SEQ ID NO: 1847), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1847, or at least 1, 2, 3, 4, 5, 6, or 7 modifications but no more than 10 modifications, e.g., modifications may result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the sequence complementary (e.g., fully complementary or partially complementary) to the seed sequence corresponds to the double-underlined portion of the encoded miR-183 binding site sequence. In some embodiments, the viral genome includes at least an encoded miR183 binding site, e.g., at least 3, 4, or 5 copies (e.g., 4 copies) of the encoded miR183 binding site. In some embodiments, the viral genome includes at least 4 copies of the encoded miR183 binding site, e.g., an encoded miR183 binding site comprising 4 copies of the miR183 binding site. In some embodiments, the at least 3, 4, or 5 copies (e.g., 4 copies) of the encoded miR183 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer includes a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, but no more than 4 modifications, of GATAGTTA.In some ...
Claims
1. A short interfering ribonucleic acid (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), comprising a sense strand sequence and an antisense strand sequence, (i) the antisense strand sequence comprises at least 20 or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; (ii) the sense strand sequences are selected from the group consisting of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 5 comprising at least 20 or 21 contiguous nucleotides of any one of: 014, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; The short interfering ribonucleic acid (siRNA), wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15, 16, 17, 18, 19, or 20 nucleotides.
2. An adeno-associated virus (AAV) viral genome comprising a nucleotide sequence disposed between two inverted terminal repeats (ITRs), the nucleotide sequence encoding an siRNA for inhibiting MAPT, the siRNA comprising a sense strand sequence and an antisense strand sequence; (i) the antisense strand sequence comprises at least 19, 20, or 21 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; (ii) the sense strand sequence is selected from the group consisting of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 501 comprising at least 19, 20, or 21 contiguous nucleotides of any one of 4, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; The adeno-associated virus (AAV) viral genome, wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15, 16, 17, 18, 19, or 20 nucleotides.
3. (i) the antisense strand comprises at least 20 contiguous nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912; and / or the sense strand comprises at least 20 contiguous nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010; (ii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (iii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (v) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (vi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (vii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122; (viii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5125, 5132, 5136, 5140, 5144, or 5146; (ix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5077, 5084, 5088, 5092, 5096, or 5098; or (x) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5054, 5060, 5064, 5066, 5070, or 5074. The siRNA of claim 1 or the AAV viral genome of claim 2.
4. (i) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4906; (ii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4918; (iii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4922; (iv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4966; (v) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4970; (vi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4978; (vii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4982; (viii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4910; (ix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4914; (x) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5054; (xi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4926; (xii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4930; (xiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4934; (xiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4938; (xv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4942; (xvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5060; (xvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4946; (xviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4950; (xix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4954; (xx) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4962; (xxii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5064; (xxiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4974; (xxiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5066; (xxv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4986; (xxvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4990; (xxvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4994; (xxviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4998; (xxix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5002; (xxx) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5070; (xxxi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5006; (xxxii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:4912; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5010; (xxxiii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:4916; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5014; (xxxiv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxxv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:4924; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5022; (xxxvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5074; (xxxvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5077; (xxxviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5084; (xxxix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5088; (xl) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5092; (xli) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5096; (xlii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5098; (xliii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5101; (xliv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5108; (xlv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO:5112; (xlvi) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5116; (xlvii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5120; (xlviii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5122; (xlix) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5125; (l) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5132; (li) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5136; (lii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5140; (liii) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or (liv) the antisense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 5146.
10. The siRNA of claim 1 or 3, or the AAV viral genome of claim 2 or 3.
5. (i) the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912; and / or the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5125, 5132, 5136, 5140, 5144, or 5146; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5077, 5084, 5088, 5092, 5096, or 5098; or (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 5054, 5060, 5064, 5066, 5070, or 5074. An siRNA according to any one of claims 1, 3, or 4, or an AAV viral genome according to any one of claims 2 to 4.
6. (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4906; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4918; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4922; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4966; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4970; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4978; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924 and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4982; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4910; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4914; (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO:5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO:5054; (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4926; (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4930; (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4934; (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4938; (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4942; (xvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5060; (xvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4946; (xviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4950; (xix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4954; (xx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4962; (xxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5064; (xxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4974; (xxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5066; (xxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4986; (xxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4990; (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4994; (xxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4998; (xxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5002; (xxx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5070; (xxxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5006; (xxxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5010; (xxxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5014; (xxxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xxxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO:4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO:5022; (xxxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5074; (xxxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5077; (xxxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5084; (xxxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5088; (xl) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5092; (xli) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5096; (xlii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5098; (xliii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5101; (xliv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5108; (xlv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5112; (xlvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5116; (xlvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5120; (xlviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5122; (xlix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5125; (l) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5132; (li) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5136; (lii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5140; (liii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5144; or (liv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5146. An siRNA according to any one of claims 1 or 3 to 5, or an AAV viral genome according to any one of claims 2 to 5.
7. (i) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905; (ii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917; (iii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921; (iv) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965; (v) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969; (vi) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977; or (vii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981; An siRNA according to any one of claims 1 or 3 to 6, or an AAV viral genome according to any one of claims 2 to 6.
8. (i) the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise at least 15-30, 19-21, or 25-30 nucleotides in length, e.g., 17, 18, 20, 21, 22, 25, or 30 nucleotides in length; (ii) the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise an overhang of 1 or 2 nucleotides, e.g., an overhang at the 5' end of the sense strand sequence and / or at the 3' end of the antisense strand sequence; (iii) the sense strand and the antisense strand contain one mismatch; and / or (iv) the antisense strand and the target sequence contain one mismatch; An siRNA according to any one of claims 1 or 3 to 7, or an AAV viral genome according to any one of claims 2 to 7.
9. A regulatory polynucleotide comprising the siRNA of any one of claims 1 or 3 to 8.
10. The AAV viral genome according to any one of claims 2 to 8, wherein the viral genome further encodes a regulatory polynucleotide comprising the sense strand and the antisense strand of the siRNA.
11. The regulatory polynucleotide (i) the 5′ flanking region; (ii) a loop region; and (iii) 3' flanking region 11. The regulatory polynucleotide of claim 9 or the AAV viral genome of claim 10, further comprising one, two, three or all of:
12. (A)(i) the 5' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs:4878-4886; a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of any of SEQ ID NOs:4878-4886; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of any of SEQ ID NOs:4878-4886; (ii) the loop region comprises a nucleotide sequence of any of SEQ ID NOs: 4887-4896; a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of any of SEQ ID NOs: 4887-4896; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4887-4896; and / or (iii) the 3' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4897-4904; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4897-4904; and / or (B)(i) the nucleotide sequence encoding the 5' flanking region comprises a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of any of SEQ ID NOs: 4353-4361; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of any of SEQ ID NOs: 4353-4361; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4353-4361; (ii) the nucleotide sequence encoding the loop region comprises the nucleotide sequence of any of SEQ ID NOs: 4362-4371; a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of any of SEQ ID NOs: 4362-4371; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of any of SEQ ID NOs: 4362-4371; and / or (iii) the regulatory polynucleotide of claim 11 or the AAV viral genome of claim 11, wherein the nucleotide sequence encoding the 3' flanking region comprises: a nucleotide sequence of any one of SEQ ID NOs: 4372-4379; a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379.
13. The regulatory polynucleotide (A) (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, which contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4887, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4887, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; and (iii) SEQ ID NO:4898, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of the nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4898; (B)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; and (iii) SEQ ID NO:4898, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of the nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4898; (C)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4887, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4887, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4887; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4887; and (iii) SEQ ID NO:4899, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4899, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4899, a 3' flanking region of the nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4899; or (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4880, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4880, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4891, a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; and (iii) SEQ ID NO: 4900, a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4900, or a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO: 4900. The regulatory polynucleotide of any one of claims 9, 11 or 12, or the AAV viral genome of any one of claims 10 to 12, comprising:
14. The regulatory polynucleotide comprises, in 5' to 3' order: (i) the 5' flanking region, the sense strand sequence, the loop region, the antisense strand sequence, and the 3' flanking region; or (ii) the 5' flanking region, the antisense strand sequence, the loop region, the sense strand sequence, and the 3' flanking region. A regulatory polynucleotide according to any one of claims 9 or 11 to 13 or an AAV viral genome according to any one of claims 10 to 13, comprising:
15. The regulatory polynucleotide comprises, in 5' to 3' order: (A)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4906; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4908; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900; (B)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4918; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4920; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900; (C)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4880; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4880; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4880; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4880; (ii) the sense strand sequence of SEQ ID NO: 4922; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4891; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4891; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4891; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4891; (iv) the antisense strand sequence of SEQ ID NO: 4924; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4900; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4900; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4900; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4900; (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4966; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and (v) SEQ ID NO:4898, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of the nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4898; (E)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4970; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and (v) SEQ ID NO:4898, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of the nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4898; (F)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4978; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and (v) SEQ ID NO:4898, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4898, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4898, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4898; or (G)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4879, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4879; (ii) the sense strand sequence of SEQ ID NO: 4982; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4888, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4888, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4888; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4888; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and (v) SEQ ID NO: 4898, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4898, a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4898, a 3' flanking region of a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4898 A regulatory polynucleotide according to any one of claims 9 or 11 to 14 or an AAV viral genome according to any one of claims 10 to 14, comprising:
16. The nucleotide sequence encoding the regulatory polynucleotide comprises, in 5' to 3' order: (A)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4905; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4907; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375; (B)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4917; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4919; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375; (C)(i) a 5' flanking region comprising: a nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4355; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4355; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4355; (ii) the sense strand sequence of SEQ ID NO: 4921; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4366; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4366; a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4366; or a nucleotide sequence that contains 1, 2, 3, or 4, but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4366; (iv) the antisense strand sequence of SEQ ID NO: 4923; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4375; a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to SEQ ID NO:4375; (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4965; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907; and (v) SEQ ID NO:4373, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4373; (E)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4969; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911; and (v) SEQ ID NO:4373, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO:4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO:4373; (F)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4977; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7, but not more than 10, modifications compared to the nucleotide sequence of SEQ ID NO: 4373; or (G)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4354, a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that contains 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO:4354; (ii) the sense strand sequence of SEQ ID NO: 4981; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO:4363, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4363, a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 different nucleotides compared to the nucleotide sequence of SEQ ID NO:4363; or a nucleotide sequence that contains 1, 2, 3, or 4 but not more than 5 modifications compared to the nucleotide sequence of SEQ ID NO:4363; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923; and (v) SEQ ID NO: 4373, a nucleotide sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4373, a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 different nucleotides compared to the nucleotide sequence of SEQ ID NO: 4373, a 3' flanking region of a nucleotide sequence containing 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications compared to the nucleotide sequence of SEQ ID NO: 4373 A regulatory polynucleotide according to any one of claims 9 or 11 to 15 or an AAV viral genome according to any one of claims 10 to 15, comprising:
17. 17. The regulatory polynucleotide of any one of claims 9 or 11-16, or the AAV viral genome of any one of claims 10-16, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs: 4405, 4408, 4409, 4390, 4391, 4393, 4394, 4380-4389, 4392, 4395-4404, 4406, or 4407, or a nucleotide sequence at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.
18. An AAV viral genome comprising a promoter operably linked to a nucleic acid encoding a regulatory polynucleotide according to any one of claims 9 or 11 to 17 or an siRNA according to any one of claims 1 or 3 to 8.
19. The AAV viral genome of any one of claims 3 to 8 or 10 to 17, wherein the AAV viral genome further comprises a promoter operably linked to the nucleotide sequence encoding the sense strand sequence and the antisense strand sequence or the nucleotide sequence encoding the regulatory polynucleotide.
20. The promoter is (i) a ubiquitous promoter; (ii) is a cell- or tissue-specific promoter; (iii) human elongation factor 1 α-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) and its derivatives CAG, β-glucuronidase (GUSB), or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mG luR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT, and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or functional fragments, e.g., truncated forms, or functional variants thereof; (iii) a CBA promoter or a variant thereof; (iv) a nucleotide sequence of any one of the nucleotide sequences provided in Table 2; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to any one of the nucleotide sequences provided in Table 2; or a nucleotide sequence having at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the nucleotide sequences provided in Table 2; or (v) the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence having at least 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5199; 20. An AAV viral genome according to claim 18 or 19.
21. The AAV viral genome (i) at least one or two inverted terminal repeat (ITR) sequences, optionally wherein the AAV viral genome comprises an ITR sequence located 5′ to the nucleic acid encoding the regulatory polynucleotide or the siRNA and / or an ITR sequence located 3′ to the nucleic acid encoding the regulatory polynucleotide or the siRNA; (ii) a polyadenylation (polyA) signal sequence; (iii) enhancers, Kozak sequences, intronic regions, and / or exonic regions; and / or (iv) a nucleotide sequence encoding a microRNA (miR) binding site, e.g., a miR binding site that regulates, e.g., reduces, expression of a payload encoded by the viral genome in cells or tissues in which the corresponding miRNA is expressed, optionally wherein the encoded miR binding site regulates, e.g., reduces, expression of the encoded payload in cells or tissues of the DRG, liver, heart, hematopoietic lineage, or a combination thereof. The AV virus genome of any one of claims 2 to 8 or 10 to 20, further comprising:
22. (i) the ITR located 5' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprises the nucleotide sequence of SEQ ID NO: 5197 or 4469; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5197 or 4469; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5197 or 4469; (ii) the ITR located 3' to the nucleic acid encoding the regulatory polynucleotide or the siRNA comprises the nucleotide sequence of SEQ ID NO: 5200 or 4470; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5200 or 4470; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5200 or 4470; (iii) the poly A signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence having at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 4476; (iv) the enhancer comprises a CMVie enhancer or a variant thereof; (v) the enhancer is a nucleotide sequence of SEQ ID NO: 4471 or 4472; a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471 or 4472; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4471 or 4472; and / or (vi) the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4475; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4475.
22. The AAV viral genome of claim 21.
23. The AAV viral genome of any one of claims 2 to 8 or 10 to 22, wherein the AAV viral genome is self-complementary or single-stranded.
24. 24. The AAV viral genome of any one of claims 2 to 8 or 10 to 23, wherein the AAV viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a nonstructural protein, wherein the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 and a Rep52 protein).
25. In the order 5' to 3', (A)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, said nucleotide sequence comprising any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; or (B)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:4469; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4469; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4469; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4472; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4472; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4472; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, said nucleotide sequence comprising any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4470. The AAV viral genome of any one of claims 2 to 8 or 10 to 24, comprising:
26. In the order 5' to 3', (A)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4405, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; (B)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4408, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; (C)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4409, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; (D)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4390, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; (E)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4391, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; (F)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4393, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200; or (G)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO:5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5197; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO:4476; a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO:4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4476; (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but not more than 10 modifications, e.g., substitutions, insertions, or deletions, compared to SEQ ID NO: 5200. The AAV viral genome of any one of claims 2 to 8 or 10 to 25, comprising:
27. 27. The AAV viral genome of any one of claims 2-8 or 10-26, comprising the nucleotide sequence of any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, 5185, 5149-5172, 5174-5181, 5186-5194 or 4439-4468, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, 5185, 5149-5172, 5174-5181, 5186-5194 or 4439-4468.
28. An AAV particle comprising an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, an AAV viral genome encoding a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or a viral genome encoding an siRNA according to any one of claims 1 or 3 to 8, and an AAV capsid protein.
29. The AAV capsid protein is (i) an AAV5 capsid protein or variant thereof, an AAV9 capsid protein or variant thereof, a VOY101 capsid protein or variant thereof, a PHPeB capsid protein or variant thereof, a PHP.B capsid protein or variant thereof, a PHP.N capsid protein or variant thereof, an AAV1 capsid protein or variant thereof, an AAV2 capsid protein or variant thereof, an AAVrhlO capsid protein or variant thereof, or a VOY9P39 capsid protein or variant thereof; (ii) an AAV9 capsid protein or a variant thereof; (iii) AAV5 capsid protein or a variant thereof; (iv) an amino acid sequence provided in Table 1 or an amino acid sequence at least 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical thereto; or (v) comprising a nucleotide sequence encoding an AAV capsid protein comprising any one of the nucleotide sequences in Table 1, or a nucleotide sequence at least 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical thereto; 29. The AAV particle of claim 28.
30. A vector comprising an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, a nucleotide sequence encoding a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or a nucleotide sequence encoding an siRNA according to any one of claims 1 or 3 to 8.
31. 10. A cell comprising an AAV particle according to claim 28 or 29, an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or an siRNA according to any one of claims 1 or 3 to 8, optionally comprising: (a) a mammalian or insect cell; (b) cells of the brain or spinal cord region (e.g., CNS cells); (c) a cell of the cortex, hippocampus, thalamus, or brainstem; or (d) neurons, glial cells, or oligodendrocytes The cell,
32. 1. A method of producing AAV particles, comprising: (i) providing a host cell comprising an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, an AAV viral genome encoding a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or a viral genome encoding an siRNA according to any one of claims 1 or 3 to 8; (ii) incubating the host cells under conditions suitable for packaging the viral genome into AAV capsid proteins; thereby producing the AAV particles.
33. A pharmaceutical composition comprising an AAV particle according to claim 28 or 29, an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or an siRNA according to any one of claims 1 or 3 to 8, and a pharmaceutically acceptable excipient.
34. A method for delivering siRNA to a cell for inhibiting MAPT expression, the method comprising administering to the cell an effective amount of the pharmaceutical composition of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, thereby delivering the siRNA for inhibiting MAPT expression to the cell.
35. The cells (a) a mammalian or insect cell; (b) cells of the brain or spinal cord region (e.g., CNS cells); (c) cells of the cortex, hippocampus, thalamus, or brainstem; (d) a neuron, glial cell, or oligodendrocyte; and / or (e) In the subject 35. The method of claim 34, wherein:
36. 36. The method of claim 35, wherein the subject has or has been diagnosed with a genetic disorder (e.g., a monogenic or polygenic disorder); a neurological disorder (e.g., a neurodegenerative disorder); a disorder associated with tau expression, e.g., aberrant tau expression; and / or a tauopathy.
37. 10. A method of treating a subject having or diagnosed as having a genetic disorder (e.g., a monogenic or polygenic disorder); a neurological disorder (e.g., a neurodegenerative disorder); a disorder associated with tau expression, e.g., aberrant tau expression; and / or a tauopathy, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2-8 or 10-27, the regulatory polynucleotide of any one of claims 9 or 11-17, or the siRNA of any one of claims 1 or 3-8.
38. 38. The method of claim 36 or 37, wherein the genetic disorder, neurological disorder (e.g., a neurodegenerative disorder), disorder associated with tau expression (e.g., aberrant tau expression), and / or tauopathy is Alzheimer's disease (AD), frontotemporal dementia (FTD), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome (DS), neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), prion disease, CJD, multiple system atrophy, mild cognitive impairment, tangle-only dementia, or progressive subcortical gliosis.
39. 39. The method of claim 37 or 38, wherein the treating comprises preventing progression of the genetic disorder, the neurological disorder (e.g., a neurodegenerative disorder), the disorder associated with tau expression (e.g., aberrant tau expression), and / or the tauopathy in the subject.
40. 40. The method of any one of claims 37-39, further comprising performing a blood test, an imaging test (e.g., a PET scan or a biomarker, e.g., a PET scan combined with serum biomarker staining), a CNS biopsy sample, or an aqueous cerebrospinal fluid biopsy, optionally wherein the blood test, the imaging test, the biopsy sample, or the aqueous cerebrospinal fluid biopsy is performed before, during, or after the treatment with the AAV particles, the regulatory polynucleotide, the siRNA, or the pharmaceutical composition.
41. The pharmaceutical composition, the AAV particles, the regulatory polynucleotide, and the siRNA are administered to the subject. (i) intravenously, via intracisternal injection (ICM), intracerebrally, intrathecally, intracerebroventricularly, via intraparenchymal administration, or intramuscularly; (ii) via focused ultrasound (FUS), e.g., focused ultrasound combined with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS combined with intravenous administration; (iii) Intravenously The method according to any one of claims 37 to 4, wherein the
42. 34. The pharmaceutical preparation of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, for use in a method of delivering siRNA to a cell to inhibit MAPT expression.
43. 34. The pharmaceutical crude of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, for use in the manufacture of a medicament.
44. 34. The pharmaceutical crude of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, for use in the treatment of a genetic disorder, a neurological disorder (e.g. a neurodegenerative disorder), a disorder associated with tau expression (e.g. aberrant tau expression), and / or a tauopathy.
45. Use of the pharmaceutical crude of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8 in the manufacture of a medicament for delivering siRNA to a cell to inhibit MAPT expression.
46. 20. Use of the pharmaceutical crude of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8 in the manufacture of a medicament.
47. 34. Use of the pharmaceutical crude of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8 in the manufacture of a medicament for treating a genetic disorder, a neurological disorder (e.g. a neurodegenerative disorder), a disorder associated with tau expression (e.g. aberrant tau expression), and / or a tauopathy.