Immunogenic compositions and methods for inducing an immune response against varicella-zoster virus

An RNA-based immunogenic composition encoding VZV gE polypeptide induces effective antibodies, addressing the limitations of existing HZ vaccines by improving tolerability and efficacy in preventing VZV infections and conditions.

JP2026504080APending Publication Date: 2026-02-03PFIZER INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025540923
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-10
Filing Date
2024-01-16
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Existing HZ vaccines have limitations such as increasing incidence, limited availability, contraindications in immunosuppressed individuals, and a poorly tolerated safety profile, necessitating improved tolerability and availability for preventing varicella-zoster virus (VZV) infections and conditions like shingles and postherpetic neuralgia.

Method used

Administering an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide to induce VZV gE-binding antibodies, which can be formulated in a lipid nanoparticle (LNP) for effective prevention and treatment of VZV-associated conditions.

Benefits of technology

The immunogenic composition induces robust VZV gE-binding antibodies, demonstrating improved safety, tolerability, and efficacy comparable to existing vaccines, with potential for single or multiple dose schedules to prevent HZ and postherpetic neuralgia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026504080000206
    Figure 2026504080000206
  • Figure 2026504080000207
    Figure 2026504080000207
  • Figure 2026504080000208
    Figure 2026504080000208
Patent Text Reader

Abstract

The present disclosure provides a method for inducing an immune response against varicella-zoster virus (VZV) in a human subject. The method provided herein includes administering to the human subject an immunogenic composition (e.g., a vaccine) comprising an RNA molecule formulated in a lipid nanoparticle. The present disclosure further relates to the use of the immunogenic composition to prevent or treat shingles in a human subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing Reference This application contains a Sequence Listing which has been filed electronically in .xml format and is incorporated herein by reference in its entirety. The .xml file is named "PC072942A Sequence Listing.xml", was created on January 8, 2024, and is 791 KB in size. [Background technology]

[0002] Herpes zoster (HZ) (i.e., shingles) is caused by reactivation of varicella-zoster virus (VZV), also known as human herpesvirus 3 (HHV-3), in individuals with a primary infection (chickenpox or "varicella"). A significant proportion of individuals (approximately 33%) will develop HZ during their lifetime, and many will experience painful postherpetic neuralgia (PHN). Elderly individuals are at greatest risk for developing HZ, which can result in reduced quality of life and increased economic burden on the healthcare system. Two vaccines have been developed and licensed in various countries to prevent HZ. The first is ZOSTAVAX® (Merck & Co., Inc., Kenilworth, NJ, USA), a live-attenuated VZV vaccine. The U.S. Food and Drug Administration approved ZOSTAVAX® in 2006, but as of November 2020, ZOSTAVAX® is no longer available in the U.S. The second is SHINGRIX® (GlaxoSmithKline, Rockville, MD, USA), AS01 B It is an adjuvanted VZV gE subunit protein vaccine. The U.S. Food and Drug Administration approved SHINGRIX® in 2017. Summary of the Invention [Problem to be solved by the invention]

[0003] Although licensed vaccines exist for the prevention of HZ, the incidence of HZ continues to increase. Furthermore, HZ vaccines are not widely available in many countries, have other limitations, such as contraindications in immunosuppressed individuals, and have a poorly tolerated safety profile compared with other adult vaccines. Therefore, there remains an unmet medical need for improved tolerability and availability of HZ vaccines. [Means for solving the problem]

[0004] The present disclosure provides a method for inducing an immune response against varicella-zoster virus (VZV) in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, thereby inducing VZV gE-binding antibodies in the subject. Further provided is a method for preventing, treating, ameliorating, and / or reducing the risk of a VZV-associated infection, disease, or condition in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, thereby inducing VZV gE-binding antibodies in the subject. In one aspect, the present disclosure provides a method for preventing shingles in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, thereby inducing VZV gE-binding antibodies in the subject. In another aspect, the disclosure provides a method for preventing postherpetic neuralgia in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

[0005] In some embodiments, the geometric mean concentration (GMC) of VZV gE antibodies in the subject about one month after the first dose is higher than the GMC of VZV gE antibodies in the subject at baseline.

[0006] In some embodiments, the GMC of VZV gE antibodies in the subject about one month after the first dose is at least 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000 mIU / mL or higher.

[0007] In some embodiments, the dose response is observed in the subject about one month after the first dose.

[0008] In some embodiments, the GMC of VZV gE antibodies in a subject about one month after the first dose is at least 1.1x (i.e., 1.1-fold), 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, or 100x higher than baseline. In some embodiments, the GMC of VZV gE antibodies in a subject about one month after the first dose is at least 5x, 10x, 15x, 20x, 25x, 30x, 35x, or 40x higher than baseline.

[0009] In some embodiments, the percentage of subjects having at least a 4-fold increase in GMC about one month after the first dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0010] In some embodiments, the geometric mean fold rise (GMFR) of VZV gE antibodies at about one month after the first dose is about 15, 20, 25, 30, 35, or 40, or higher. In some embodiments, the GMFR of VZV gE antibodies at about one month after at least the first dose is about 16, 18, 20, 28, 33, 38, or 43.

[0011] In some embodiments, the second dose is administered after the first dose.

[0012] In some embodiments, the GMC of VZV gE antibodies in the subject about one month after the second dose is higher than the GMC of antibodies in the subject at baseline and one month after the first dose.

[0013] In some embodiments, the GMC of VZV gE antibodies in the subject one month after the second dose is at least 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, 100,000, 105,000, 110,000, or 115,000 mIU / mL, or higher.

[0014] In some embodiments, the dose response is observed in the subject about one month after the second dose.

[0015] In some embodiments, the GMC of VZV gE antibodies in the subject about one month after the second dose is at least 1.1× (i.e., 1.1-fold), 1.2×, 1.3×, 1.4×, 1.5×, 1.6×, 1.7×, 1.8×, 1.9×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, 10×, 15×, 20×, 25×, 30×, 35×, 40×, 45×, 50×, 55×, 60×, 65×, 70×, 75×, 80×, 85×, 90×, 95×, or 100× higher than baseline. In some embodiments, the GMC of VZV gE antibodies in the subject about one month after the second dose is at least 5x, 10x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, or 60x higher than baseline.

[0016] In some embodiments, the percentage of subjects having at least a 4-fold increase in GMC about 1 month after the second dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0017] In some embodiments, the geometric mean fold rise (GMFR) of VZV gE antibodies about one month after the second dose is at least or greater than 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75. In some embodiments, the GMFR of VZV gE antibodies about one month after the second dose is about 25, 36, 52, 54, 55, or 76.

[0018] In some embodiments, the GMC of VZV gE antibodies in a subject about one month after the first dose is about 1.1×, 1.2×, 1.3×, or 1.4× higher than the GMC of VZV gE antibodies in a human subject about one month after the first dose of SHINGRIX®.

[0019] In some embodiments, the GMC of VZV gE antibodies in the subject about one month after the second dose is about 1.1x higher than the GMC of VZV gE antibodies in a human subject about one month after the second dose of SHINGRIX®.

[0020] In some embodiments, the GMFR at about one month after the first dose is about 1.1×, 1.2×, or 1.3× higher than the GMFR of a human subject at one month after the first dose of SHINGRIX®.

[0021] In some embodiments, the GMFR at about one month after the second dose is about 1.1×, 1.2×, 1.3×, 1.4×, 1.5×, 1.6×, 1.7×, 1.8×, or 1.9× higher than the GMFR of a human subject at one month after the second dose of SHINGRIX®.

[0022] In some embodiments, the GMFR at about one month after the first dose is similar to that of a human subject at one month after the second dose of SHINGRIX®.

[0023] In one embodiment, the immunogenic composition is administered in a single dose. In one embodiment, the immunogenic composition is administered in a two-dose schedule. In one embodiment, the second dose is administered about two months after the first dose. In another embodiment, the second dose is administered about six months after the first dose. In one embodiment, the immunogenic composition is administered at a dose of about 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or more per administration. In one embodiment, the immunogenic composition is administered at a dose ranging from about 1 μg to 90 or more per administration. In one embodiment, the immunogenic composition is administered at a dose ranging from about 15 μg to 90 or more per administration.

[0024] In one embodiment, the subject is an adult, hi one embodiment, the subject is an adult 18 years of age or older, about 20 years of age or older, about 30 years of age or older, about 40 years of age or older, about 45 years of age or older, about 50 years of age or older, about 55 years of age or older, about 60 years of age or older, about 65 years of age or older, about 70 years of age or older, or older.

[0025] The present disclosure provides a method for inducing VZV gE-binding antibodies and / or cell-mediated immune responses with an immunogenic composition. In one embodiment, the immunogenic composition is administered as a vaccine. In one embodiment, the immunogenic composition is administered by intramuscular injection. In some embodiments, the immunogenic composition is frozen / liquid. In some embodiments, the immunogenic composition is lyophilized.

[0026] In one embodiment, the VZV gE polypeptide is full-length, a truncation, fragment, or variant thereof. In one embodiment, the VZV gE polypeptide comprises at least one mutation. In one embodiment, the VZV gE polypeptide has at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the amino acid sequences selected from SEQ ID NOs: 1-11. In one embodiment, the VZV gE polypeptide comprises any one of the amino acid sequences selected from SEQ ID NOs: 1-11. In one embodiment, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In one embodiment, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In one embodiment, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 4.

[0027] In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from SEQ ID NOs: 12-145. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising any one of the sequences selected from SEQ ID NOs: 12-145. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 14. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 23. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 19.

[0028] In one embodiment, the RNA molecule comprises a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from SEQ ID NOs: 146-279. In one embodiment, the RNA molecule comprises a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from SEQ ID NOs: 146-279. In one embodiment, the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146-279. In one embodiment, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 148. In one embodiment, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 157. In one embodiment, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 153.

[0029] In one embodiment, the VZV gE polypeptide is localized to the trans-Golgi network (TGN). In another embodiment, the VZV gE polypeptide is secreted (localized in the supernatant). In another embodiment, the VZV gE polypeptide is localized to the plasma membrane (surface expressed).

[0030] In one embodiment, the RNA molecule comprises a 5' untranslated region (5'UTR) comprising a sequence selected from any one of SEQ ID NOs: 281, 312, or 313. In one embodiment, the RNA molecule comprises a 3' untranslated region (3'UTR) comprising a sequence selected from any one of SEQ ID NOs: 284, 314, or 317. In one embodiment, the RNA molecule comprises a poly-A tail comprising a sequence selected from any one of SEQ ID NOs: 287 or 315. In one embodiment, the RNA molecule comprises a modified RNA in which a uridine is replaced by an N1-methylpseudouridine (Ψ).

[0031] The method of the present disclosure further provides for administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (LNP). In one embodiment, the lipid nanoparticle comprises at least one of a cationic lipid, a PEGylated lipid, a neutral lipid, and a steroid or steroid analog. In one embodiment, the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315). In one embodiment, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the steroid or steroid analog is cholesterol.

[0032] The methods of the present disclosure further provide for administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule encodes a VZV gE polypeptide comprising any one of the amino acid sequences selected from SEQ ID NOs: 1-11.

[0033] The methods of the present disclosure further provide for administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146-279.

[0034] The methods of the present disclosure further provide for administering an immunogenic composition comprising an RNA molecule encoding a VZV gE protein produced from codon-optimized (CO) DNA. In some embodiments, the codon-optimized DNA contains about 58% G / C content (CO1). In some embodiments, the codon-optimized DNA contains about 66% G / C content (CO2). In some embodiments, the codon-optimized DNA contains about 62% G / C content (CO3).

[0035] The methods of the present disclosure further provide for administering an immunogenic composition comprising about 5-15 mM Tris buffer, 200-400 mM sucrose, and a pH of about 7.0-8.0. In some embodiments, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, and a pH of about 7.4. In some embodiments, the immunogenic composition is lyophilized. In some embodiments, the immunogenic composition is reconstituted with 0.9% sodium chloride.

[0036] In some embodiments, the immunogenic compositions of the present disclosure may be used or co-administered with one or more other vaccines. In some embodiments, a VZV modRNA vaccine may be co-administered with an influenza vaccine, a pneumococcal vaccine (e.g., a pneumococcal conjugate vaccine (PCV) such as the Prevnar vaccine), a tetanus vaccine, a diphtheria vaccine, a pertussis vaccine (e.g., Tdap), a respiratory syncytial virus (RSV) vaccine, and / or a COVID-19 vaccine. [Brief explanation of the drawings]

[0037] [Figure 1]

[0023] Figure 1 is a schematic diagram illustrating wild-type (WT) varicella-zoster virus (VZV) gE protein (gE WT) and mutant VZV gE proteins, where SP refers to the signal peptide sequence, ectodomain refers to the peptide sequence corresponding to the portion of the protein that extends into the extracellular space, TM refers to the transmembrane peptide sequence corresponding to the portion of the protein that spans the cell membrane, and CT refers to the cytoplasmic tail peptide sequence corresponding to the portion of the protein that extends into the cell cytoplasm. Mutant VZV gE proteins with cytoplasmic tail modifications are designated ms4, ms5, ms8, ms9, ms10, ms11, and ms12. Secreted mutant VZV gE proteins with TM modifications are designated ms3 and ms6. VZV gE RNA constructs encoding the VZV gE protein were generated from codon-optimized (CO) DNA, with CO1 representing a CO construct with a G / C content of approximately 58%, CO2 representing a CO construct with a G / C content of approximately 66%, and CO3 representing a CO construct with a G / C content of approximately 62%. [Figure 2] Figure 1 shows gE-binding IgG antibody concentrations (GMCs) assessed at Day 1 / Dose 1 (n=approximately 50), 1 month after Dose 1 (1M-PD1) (n=approximately 50), Dose 2 (D2) / 2 months after Dose 1 (2M-PD1) (n=approximately 15), and 1 month after Dose 2 (1M-PD2) (n=approximately 15) in participants receiving two doses (0- and 2-month schedule) of lyophilized VZV modRNA candidate 1 at 15 μg, 30 μg, or 60 μg. A dose response was observed for 1M-PD1 and 1M-PD2. [Figure 3]

[0023] Figure 1 shows gE-binding IgG antibody concentrations (GMCs) assessed at Day 1 / Dose 1 (n = approx. 50), 1 month after Dose 1 (1M-PD1) (n = approx. 50), Dose 2 (D2) / 2 months after Dose 1 (2M-PD1) (n = approx. 15), and 1 month after Dose 2 (1M-PD2) (n = approx. 15) in participants receiving two doses (0 and 2 month schedule) of frozen VZV modRNA candidate 1, 2, or 3 at 30 μg or SHINGRIX®. Robust immunogenic responses were observed in participants receiving VZV modRNA vaccines. [Figure 4]

[0023] Figure 1 shows the GMFR of gE-binding IgG antibodies one month after dose 1 (1M-PD1) in participants (n = approximately 15) receiving one dose (single dose) of lyophilized VZV modRNA candidate 1 at 90 μg, and one month after dose 2 (1M-PD2) in participants (n = approximately 50) receiving two doses (0- and 2-month schedules) of lyophilized VZV modRNA candidate 1 (C1) at 15 μg, 30 μg, or 60 μg, or SHINGRIX®. The GMFR observed at 1M-PD1 in participants receiving 90 μg of the VZV modRNA vaccine was similar to the GMFR observed at 1M-PD2 in participants receiving SHINGRIX®. DETAILED DESCRIPTION OF THE INVENTION

[0038] The present disclosure provides a modRNA vaccine against varicella-zoster virus (VZV) that induces a robust glycoprotein E (gE)-binding antibody response in humans. Preliminary Phase 1 results provided herein demonstrate that the VZV modRNA vaccine induces high levels of gE-binding antibodies in humans.

[0039] The present disclosure provides immunogenic compositions for the prevention of herpes zoster (HZ) (i.e., shingles) in a human subject. The present disclosure further provides a method for preventing HZ in a human subject, comprising administering the immunogenic composition described herein. The present disclosure further provides use of the immunogenic composition described herein for preventing HZ in a human subject.

[0040] The present disclosure further provides an immunogenic composition for preventing postherpetic neuralgia (PHN) in a human subject. The present disclosure provides a method for preventing PHN in a human subject, comprising administering the immunogenic composition described herein. The present disclosure provides the use of the immunogenic composition described herein for preventing PHN in a human subject.

[0041] In one embodiment, the immunogenic composition comprises a varicella-zoster virus (VZV) RNA molecule, which comprises (as an active ingredient) an RNA that can be translated into a protein in the recipient's cells. In one embodiment, the immunogenic composition comprises a VZV RNA molecule formulated in, encapsulated, complexed with, bound to, or adsorbed onto a lipid nanoparticle (LNP) (e.g., a VZV RNA-LNP). In a preferred embodiment, the VZV RNA-LNP comprises a modified RNA (modRNA) in which a uridine in the RNA molecule is replaced by an N1-methylpseudouridine (Ψ). Thus, in a preferred embodiment, the immunogenic composition is a VZV modRNA-LNP (used interchangeably as a "VZV modRNA vaccine" or "VZV modRNA").

[0042] The present disclosure further provides a method of inducing an immune response against VZV in a human subject, comprising administering an immunogenic composition described herein. The present disclosure further provides a use of the immunogenic composition described herein for inducing an immune response against VZV in a human subject.

[0043] The present disclosure further provides a method of inducing an immune response against VZV in a human subject, comprising administering an immunogenic composition described herein. The present disclosure further provides a use of the immunogenic composition described herein for inducing an immune response against VZV in a human subject.

[0044] The present disclosure also provides methods for preventing, treating, ameliorating, and / or reducing the risk of a VZV-associated infection, disease, or condition in a human subject, comprising administering an immunogenic composition described herein. The present disclosure also provides uses of the immunogenic compositions described herein for preventing, treating, ameliorating, and / or reducing the risk of a VZV-associated infection, disease, or condition in a human subject.

[0045] The present disclosure provides methods of eliciting and / or inducing glycoprotein E (gE) antibodies in a human subject, comprising administering an immunogenic composition described herein. The present disclosure further provides uses of the immunogenic compositions described herein for eliciting and / or inducing glycoprotein E (gE) antibodies in a human subject.

[0046] The present disclosure provides methods of eliciting and / or inducing a cell-mediated immune response in a human subject, comprising administering an immunogenic composition described herein. The present disclosure further provides uses of the immunogenic compositions described herein for eliciting and / or inducing a cell-mediated immune response in a human subject.

[0047] The present disclosure provides methods of administering the immunogenic compositions described herein, wherein the compositions demonstrate improved or comparable / similar safety, tolerability, reactogenicity, efficacy, antibody response, cell-mediated immune response, immunogenicity, and / or duration of immunity compared to existing HZ treatments / vaccines. The present disclosure also provides uses of the immunogenic compositions described herein, wherein the compositions demonstrate improved or comparable / similar safety, tolerability, reactogenicity, efficacy, antibody response, cell-mediated immune response, immunogenicity, and / or duration of immunity compared to existing HZ treatments / vaccines.

[0048] For example, the Phase 1 study described herein compares the immune response induced / elicited by the VZV modRNA vaccine of the present disclosure to SHINGRIX® (GlaxoSmithKline). SHINGRIX® is a two-dose adjuvanted vaccine consisting of recombinant VZV gE and AS01B adjuvant. Prescribing information for SHINGRIX® is available at https: / / www.fda.gov / media / 108597 / download.

[0049] The present disclosure provides methods or uses that include administering the immunogenic composition in a single dose (i.e., a single-dose schedule). The present disclosure further provides methods or uses that include administering the immunogenic composition twice (i.e., a two-dose schedule), for example, at days 0 and about 7, 0 and about 14, 0 and about 21, 0 and about 28, 0 and about 60, 0 and about 90, 0 and about 120, 0 and about 150, 0 and about 180, 0 and about 1 month later, 0 and about 2 months later, 0 and about 3 months later, 0 and about 6 months later, 0 and about 9 months later, 0 and about 12 months later, 0 and about 18 months later, 0 and about 2 years later, 0 and about 5 years later, or 0 and about 10 years later.

[0050] The present disclosure further provides methods or uses comprising administering the immunogenic composition twice (i.e., a two-dose schedule), for example, on day 1 and about day 7, day 1 and about day 14, day 1 and about day 21, day 1 and about day 28, day 1 and about day 60, day 1 and about day 90, day 1 and about day 120, day 1 and about day 150, day 1 and about day 180, day 1 and about 1 month later, day 1 and about 2 months later, day 1 and about 3 months later, day 1 and about 6 months later, day 1 and about 9 months later, day 1 and about 12 months later, day 1 and about 18 months later, day 1 and about 2 years later, day 1 and about 5 years later, or day 1 and about 10 years later.

[0051] In a preferred embodiment, the immunogenic composition is administered in a single dose schedule. In another preferred embodiment, the immunogenic composition is administered in a two dose schedule at day 0 and about 2 months later. In another preferred embodiment, the immunogenic composition is administered in a two dose schedule at day 1 and about 2 months later. In another preferred embodiment, the immunogenic composition is administered in a two dose schedule at day 0 and about 6 months later. In another preferred embodiment, the immunogenic composition is administered in a two dose schedule at day 1 and about 6 months later. The present disclosure further provides for the administration of at least one booster dose.

[0052] The present disclosure provides methods or uses comprising administering an immunogenic composition to a human subject at a dose of about 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or more per administration. In one embodiment, the immunogenic composition is administered to a human subject at a dose of about 15 μg, 30 μg, 60 μg, or 90 μg per administration. In some embodiments, the immunogenic composition comprises a VZV modRNA described herein at a dose ranging from about 1 μg to 100 μg or more per administration. In some embodiments, the immunogenic composition comprises a VZV modRNA described herein at a dose ranging from about 15 μg to 90 μg per administration. In some embodiments, the immunogenic composition comprises a VZV modRNA described herein at a dose of about 15 μg, 30 μg, 60 μg, or 90 μg per administration.

[0053] In one embodiment, the immunogenic composition comprises a VZV modRNA described herein at a dose of about 15 μg per administration. In one embodiment, the immunogenic composition comprises a VZV modRNA described herein at a dose of about 30 μg per administration. In one embodiment, the immunogenic composition comprises a VZV modRNA described herein at a dose of about 60 μg per administration. In one embodiment, the immunogenic composition comprises a VZV modRNA described herein at a dose of about 90 μg per administration. In one embodiment, the immunogenic composition comprises a VZV modRNA described herein at a dose greater than 90 μg per administration.

[0054] In one embodiment, a human subject is administered an effective amount of an immunogenic composition described herein to induce an immune response against VZV.

[0055] In one embodiment, the effective amount is a single dose administration of about 15 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is a single dose administration of about 30 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is a single dose administration of about 60 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is a single dose administration of about 90 μg of an immunogenic composition comprising a VZV modRNA described herein.

[0056] In another embodiment, the effective amount is two doses of about 15 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is two doses of about 30 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is two doses of about 60 μg of an immunogenic composition comprising a VZV modRNA described herein. In one embodiment, the effective amount is two doses of about 90 μg of an immunogenic composition comprising a VZV modRNA described herein.

[0057] In some embodiments, the immunogenic composition is administered in an injection volume of about 0.25 to 1 mL (e.g., about 0.25, 0.5, 1 mL). In some embodiments, the immunogenic composition is presented as a frozen / liquid (non-lyophilized) or lyophilized formulation. In some embodiments, dilution with sterile 0.9% sodium chloride (normal saline) may be necessary.

[0058] In some embodiments, the human subject is at least or at most about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older. In some embodiments, the human subject is about 50 years old or older. In some embodiments, the human subject is an adult 18 years old or older. In some embodiments, the human subject is an adult 45 years old or older, 50 years old or older, 55 years old or older, 60 years old or older, or 65 years old or older. In some embodiments, the human subject is immunocompetent. In some embodiments, the human subject is immunocompromised.

[0059] The immunogenic compositions provided herein are administered in an effective amount to induce an immune response against VZV. The methods or uses of the present disclosure provide for administering an immunogenic composition, such as a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising an immunogenic RNA polynucleotide encoding an immunogenic antigen, e.g., an RNA molecule, e.g., an amino acid sequence, e.g., a varicella-zoster virus (VZV) protein, its immunogenic variant, or an immunogenic fragment or immunogenic variant of a VZV protein, e.g., an antigenic peptide or protein. Thus, the immunogenic antigen comprises an epitope of a VZV protein for inducing an immune response against VZV in a human subject. The RNA polynucleotide encoding the immunogenic antigen is administered to provide an antigen for inducing, e.g., stimulating, priming, and / or expanding, an immune response, e.g., antibody and / or immune effector cells (after expression of the polynucleotide by appropriate target cells). In one embodiment, the immune response induced according to the present disclosure is a B cell-mediated immune response, e.g., an antibody-mediated immune response. Additionally or alternatively, the immune response induced in accordance with the present disclosure can be a T cell-mediated immune response, such as a cytokine immune response. In one embodiment, the immune response is an anti-VZV immune response. In one embodiment, the immune response is an anti-VZV gE immune response.

[0060] In one embodiment, the immune response induces a VZV glycoprotein E (gE) antibody binding immune response. In some embodiments, the immune response is measured by determining gE binding antibody levels in the subject (participant).

[0061] In some embodiments, the immune response is measured by the geometric mean concentration (GMC) of glycoprotein E antibodies in a proportion of evaluable immunogenic participants, e.g., the GMC of glycoprotein E-binding antibody levels pre-vaccination and at each collection time point in each vaccine group.

[0062] In some embodiments, the immune response is measured by the geometric mean fold rise (GMFR) of glycoprotein E-binding antibody levels in evaluable immunogenic participants from pre-vaccination to each subsequent time point after each vaccination.

[0063] In some embodiments, immune response is measured by the proportion of evaluable immunogenic participants who have a vaccine response in glycoprotein E-binding antibodies from baseline (pre-vaccination) to each subsequent time point after each vaccination. For example, a vaccine response can be defined as a ≧4-fold increase in gE IgG levels from pre-vaccination to each subsequent scheduled time point after each vaccination.

[0064] In some embodiments, the immune response is measured relative to the immune response induced or elicited by SHINGRIX®. For example, the immune response (e.g., GMC, GMFR, and / or vaccine response) induced by an immunogenic composition provided herein is compared to the immune response induced by administration of SHINGRIX®.

[0065] The present disclosure provides a method or use as described herein, comprising administering an immunogenic composition comprising an RNA molecule and an RNA-LNP to induce an immune response in a human subject. In addition to a wild-type or codon-optimized sequence encoding an antigen sequence, the RNA molecule may contain one or more structural elements (5' cap, 5' UTR, 3' UTR, polyA tail) optimized for maximum RNA effectiveness in terms of stability and translation efficiency. In a preferred embodiment, the RNA molecule contains all of these elements. In a preferred embodiment, the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ) (e.g., modRNA).

[0066] The RNA molecule and RNA-LNP may contain at least one open reading frame (ORF) encoding a VZV glycoprotein. In some embodiments, the VZV glycoprotein is VZV gE. In some embodiments, the VZV polypeptide is full-length, a truncated form, a fragment, or a variant thereof. In some embodiments, the VZV polypeptide contains at least one mutation.

[0067] The RNA molecules and RNA-LNPs can comprise at least one ORF encoding a VZV polypeptide of Table 1. In some embodiments, the VZV polypeptide has 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98%, or 99% or more, or at least, or up to, identity to any of the amino acid sequences of Table 1, e.g., any of SEQ ID NOS: 1-11. In some embodiments, the VZV polypeptide comprises an amino acid sequence selected from SEQ ID NOS: 1-11. In some embodiments, the VZV polypeptide consists of any of the amino acid sequences of Table 1, e.g., any of SEQ ID NOS: 1-11. In one embodiment, the VZV polypeptide comprises the amino acid sequence of SEQ ID NOS: 1. In one embodiment, the VZV polypeptide comprises the amino acid sequence of SEQ ID NOS: 1. In one embodiment, the VZV polypeptide comprises the amino acid sequence of SEQ ID NOS: 5. In one embodiment, the VZV polypeptide comprises the amino acid sequence of SEQ ID NOS: 5.

[0068] RNA molecules and RNA-LNPs comprise at least one ORF transcribed from at least one DNA nucleic acid of Table 2. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98%, or 99% or more, or at least, or up to, identity to any of the nucleic acid sequences of Table 2, e.g., any of SEQ ID NOS: 12-145. In some embodiments, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NOS: 12-145. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any of the nucleic acid sequences of Table 2, e.g., any of SEQ ID NOS: 12-145. In one embodiment, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NOS: 13. In one embodiment, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NOS: 22. In one embodiment, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NOS: 19.

[0069] RNA molecules and RNA-LNPs comprise at least one ORF comprising an RNA nucleic acid sequence of Table 3. In some embodiments, the RNA molecule comprises a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98%, or 99% or more, or at least, or up to, identity to any of the nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 146-279. In some embodiments, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NOs: 146-279. In some embodiments, the RNA molecule comprises a nucleic acid sequence consisting of any of the nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 146-279. In some embodiments, each uridine in any of SEQ ID NOs: 146-279 is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA, modRNA).

[0070] In one embodiment, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148. In one embodiment, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157. In one embodiment, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 153.

[0071] In preferred embodiments, the RNA molecules (constructs) generated herein encode VZV gE wild-type (WT) and gE mutant proteins with modifications in the cytoplasmic tail (CT) and / or transmembrane (TM) domains. Figure 1 and Table 4 show the WT gE protein (gE WT), mutant gE proteins with cytoplasmic tail modifications (ms4, ms5, ms8, ms9, ms10, ms11, and ms12), and mutant gE proteins with TM modifications (ms3 and ms6).

[0072] [Table 1]

[0073] RNA molecules and RNA-LNPs may comprise a 5' untranslated region (5'-UTR) and / or a 3' untranslated region (3'-UTR). In some embodiments, the RNA molecule comprises a 5' untranslated region (5'-UTR). In some embodiments, the 5' UTR comprises a sequence selected from any of SEQ ID NOs: 281 (SEQ ID NO: 280 - DNA, SEQ ID NO: 282 - RNA with Ψ) and 312-313. In some embodiments, the 5' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98%, or 99% identity or higher to any of SEQ ID NOs: 281 and 312-313. In some embodiments, the 5' UTR comprises a sequence selected from any of SEQ ID NOs: 281 and 312-313. In some embodiments, the 5' UTR comprises a sequence consisting of any of SEQ ID NOs: 281 and 312-313.

[0074] In some embodiments, the RNA molecules and RNA-LNPs comprise a 3' untranslated region (3'-UTR). In some embodiments, the 3' UTR comprises a sequence selected from any of SEQ ID NOs: 284 (DNA SEQ ID NO: 283, RNA with SEQ ID NO: 285), 314, and 317 (RNA with SEQ ID NO: 318). In some embodiments, the 3' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98%, or 99% or more identity to any of SEQ ID NOs: 284, 314, and 317. In some embodiments, the 3' UTR comprises a sequence selected from any of SEQ ID NOs: 284, 314, and 317. In some embodiments, the 3' UTR comprises a sequence consisting of any of SEQ ID NOs: 284, 314, and 317.

[0075] The RNA molecules and RNA-LNPs may comprise a 5' cap moiety. In some embodiments, the 5' cap moiety is (3'OMe)-m2 7,3’-O Gppp(m1 2’-O ) ApG. RNA molecules and RNA-LNPs can include a 3' poly-A tail. In some embodiments, the poly-A tail comprises a sequence selected from any of SEQ ID NOs: 287 (DNA with SEQ ID NO: 286, RNA with SEQ ID NO: 288) and 315 (RNA with SEQ ID NO: 316). In preferred embodiments, the poly-A tail comprises a sequence selected from any of SEQ ID NOs: 287 and 315 + / - 1 adenosine (A) or + / - 2 adenosines (A).

[0076] In some embodiments, the RNA molecule comprises a 5'UTR and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, a 3'UTR, and a poly-A tail. In some embodiments, the RNA molecule comprises a 5'UTR, a 3'UTR, and a poly-A tail. In preferred embodiments, each uridine in any of the 5'UTR, 3'UTR, and poly-A tail is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA, modRNA).

[0077] The RNA molecule may comprise at least one open reading frame generated from codon-optimized DNA. In some embodiments, the open reading frame comprises a G / C content of at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, about 50%-75%, or about 55%-70%. In some embodiments, the G / C content is about 58%, about 66%, or about 62%. The present disclosure further provides RNA molecules encoding plasma membrane-localized, Golgi-localized, and / or membrane-anchored, and secreted VZV polypeptides. The present disclosure further provides RNA molecules comprising stabilized RNA. The present disclosure further provides RNA molecules comprising RNA with at least one modified nucleotide (e.g., modified RNA, modRNA). In some embodiments, the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modified nucleotide is N1-methylpseudouridine (Ψ).

[0078] The present disclosure further provides RNA molecules that are messenger RNA (mRNA) or self-replicating RNA. In some embodiments, the RNA is mRNA.

[0079] The disclosed methods or uses provide for administering immunogenic compositions, such as VZV RNA-LNPs (e.g., VZV modRNA vaccines), comprising the RNA molecules described in Table 5. DNA sequences encoding VZV proteins were prepared and utilized in in vitro transcription reactions to generate RNA. In vitro transcription of RNA is known in the art and described herein. The DNA template was cloned into a plasmid vector with backbone sequence elements (T7 promoter, 5' and 3' UTRs, polyA tail) for improved RNA stability and translation efficiency. DNA was purified, quantified spectrophotometrically, and synthesized by T7 RNA polymerase with a trinucleotide cap 1 analog ((m2 7,3’-O )Gppp(m 2’-O The RNA was in vitro transcribed in the presence of N1-methylpseudouridine (Ψ) replacing uridine (modified RNA, modRNA) in the presence of )ApG) (TriLink).

[0080] VZV RNA was generated from codon-optimized (CO) DNA for stability and superior protein expression. As used herein, CO1 exhibits a G / C content of approximately 58%, CO2 exhibits a G / C content of approximately 66%, and CO3 exhibits a G / C content of approximately 62%. Table 5 shows the RNA constructs of the present disclosure and the corresponding sequences, including the 5' UTR, open reading frame encoding a varicella-zoster virus (VZV) polypeptide, 3' UTR, and polyA tail.

[0081] [Table 2-1]

[0082] [Table 2-2]

[0083] In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:146, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (gE WT). In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:147, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (gE WT CO1). In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:148, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (gE WT CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:149, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms3 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:150, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms3 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:151, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms4 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 152, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315 (ms4 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 153, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315 (ms5 CO1).In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:154, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms5 CO2). In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:155, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms5 CO2 v2). In some embodiments, the RNA molecule comprises a 5'UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:156, a 3'UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms6 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:157, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms6 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:158, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms8 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:159, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms9 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 160, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315 (ms9 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 161, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315 (ms10 CO1).In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:162, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms10 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:163, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms10 CO3). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:164, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms11 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:165, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms11 CO2). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:166, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms12 CO1). In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO:281 or 312, a VZV ORF of SEQ ID NO:167, a 3' UTR of SEQ ID NO:284 or 317, and / or a poly-A tail of SEQ ID NO:287 or 315 (ms12 CO2).

[0084] In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 168, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 169, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 170, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 171, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 172, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 173, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 174, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 175-238, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 239, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315.In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 240-254, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 255-267, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 268-279, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some embodiments, the VZV ORF further comprises a stop codon as described herein. In some embodiments, the length of the poly-A tail may contain +1 / -1 A or +2 / -2 A. In some embodiments, the uridines of each RNA molecule are replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA, modRNA).

[0085] In a preferred embodiment, the method or use of the present disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising an RNA molecule comprising a 5'UTR of SEQ ID NO:281, a VZV ORF of SEQ ID NO:148, a 3'UTR of SEQ ID NO:284, and a poly-A tail of SEQ ID NO:287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ) (gE WT CO2, candidate 1). In another preferred embodiment, the method or use of the present disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising an RNA molecule comprising a 5'UTR of SEQ ID NO:281, a VZV ORF of SEQ ID NO:157, a 3'UTR of SEQ ID NO:284, and a poly-A tail of SEQ ID NO:287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ) (ms6 CO2, candidate 2). In another preferred embodiment, the method or use of the disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising an RNA molecule comprising the 5' UTR of SEQ ID NO: 281 or 312, the VZV ORF of SEQ ID NO: 153, the 3' UTR of SEQ ID NO: 284 or 317, and / or the poly-A tail of SEQ ID NO: 287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ) (ms5 CO1, candidate 3).

[0086] The disclosed methods or uses provide for administering an immunogenic composition, such as a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising an RNA molecule formulated in, encapsulated, complexed with, bound to, or adsorbed onto the LNP. In some embodiments, the LNP comprises at least one of a cationic lipid, a PEGylated lipid, and at least one structural lipid (e.g., a neutral lipid and a steroid or steroid analog).

[0087] In some embodiments, the lipid nanoparticles comprise a cationic lipid. In some embodiments, the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0088] In some embodiments, the lipid nanoparticles comprise a lipid conjugated to a polymer. In some embodiments, the lipid nanoparticles comprise a PEGylated lipid, also referred to as a PEG-lipid. In some embodiments, the PEGylated lipid is a glycol-lipid, including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG), e.g., 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol. (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-s-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-s-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecaneoxy)propyl)carbamate or 2,3-di(tetradecaneoxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. In some embodiments, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0089] In some embodiments, the lipid nanoparticles comprise at least one structural lipid, such as a neutral lipid. In some embodiments, the neutral lipid is selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N In some embodiments, the neutral lipid is selected from 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-di-(2-hydroxy-2-methyl-1-propanol ...

[0090] In some embodiments, the lipid nanoparticles comprise a second structural lipid, such as a steroid or steroid analog. In some embodiments, the steroid or steroid analog is cholesterol.

[0091] In some embodiments, the lipid nanoparticles have an average diameter of about 1 to about 500 nm.

[0092] In a preferred embodiment, purified RNA (listed in Table 5) was formulated / encapsulated into lipid nanoparticles (RNA-LNPs) using an ethanolic lipid mixture of ionizable cationic lipids and transferred via diafiltration into an aqueous buffer system to obtain the lipid nanoparticle compositions described herein. The RNA-LNPs comprise VZV RNA molecules, a cationic lipid, ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), a PEGylated lipid, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and two structural lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol; see Table 6.

[0093] [Table 3]

[0094] In a preferred embodiment, the method or use of the present disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising an RNA molecule comprising the 5' UTR of SEQ ID NO: 281, the VZV ORF of SEQ ID NO: 148, the 3' UTR of SEQ ID NO: 284, and the poly-A tail of SEQ ID NO: 287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising the cationic lipid, ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), the PEGylated lipid, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and two structural lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol (gE WT CO2, candidate 1). In another preferred embodiment, the method or use of the present disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising an RNA molecule comprising the 5' UTR of SEQ ID NO: 281, the VZV ORF of SEQ ID NO: 157, the 3' UTR of SEQ ID NO: 284, and the poly-A tail of SEQ ID NO: 287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising the cationic lipid, ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), the PEGylated lipid, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and two structural lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol (ms6 CO2, candidate 2).In another preferred embodiment, the method or use of the present disclosure provides for administering an immunogenic composition, such as a VZV modRNA vaccine, comprising RNA molecules comprising the 5' UTR of SEQ ID NO: 281 or 312, the VZV ORF of SEQ ID NO: 153, the 3' UTR of SEQ ID NO: 284 or 317, and / or the poly-A tail of SEQ ID NO: 287 or 315, wherein the uridine of each RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising the cationic lipid, ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)), the PEGylated lipid, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and two structural lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol (ms5 CO1, candidate 3).

[0095] The disclosed methods or uses provide for administering an immunogenic composition, such as a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein encapsulated in an LNP at about 0.01 to 0.18 mg / mL, and comprising about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0.

[0096] The disclosed methods or uses provide for administering an immunogenic composition, such as a VZV RNA-LNP (e.g., a VZV modRNA vaccine), presented as a liquid composition comprising an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly at, or between any two of those values, preferably about 0.01 to about 0.09 mg / mL, e.g., about 0.06 mg / mL, encapsulated in an LNP using a lipid composition comprising a cationic lipid at a concentration of about 0.8-0.95 mg / mL, a PEGylated lipid at a concentration of about 0.05-0.15 mg / mL, a first structural lipid at a concentration of about 0.1-0.25 mg / mL, and a second structural lipid at a concentration of about 0.3-0.45 mg / mL. In some embodiments, the liquid composition further comprises a buffer composition comprising a first buffering agent at a concentration of about 0.15-0.3 mg / mL, a second buffering agent at a concentration of about 1.25-1.4 mg / mL, and a stabilizer at a concentration of about 95-110 mg / mL. In some embodiments, the immunogenic composition of the present disclosure comprises about 5-15 mM Tris buffer, 200-400 mM sucrose, and a pH of about 7.0-8.0. In some embodiments, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, and a pH of about 7.4.

[0097] In certain embodiments, liquid RNA-LNP immunogenic compositions comprise an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly, or between any two of those values, preferably about 0.01 to about 0.09 mg / mL, e.g., about 0.06 mg / mL, in a ((4-hydroxybutyl) acetone) at a concentration of about 0.8 to 0.95 mg / mL. The lipid composition includes a lipid composition containing 2-[(2-hexyldecanoate)-N,N-diisopropyl ether]-N,N-diisopropyl ether (ALC-0315), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) at a concentration of about 0.05-0.15 mg / mL, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a concentration of about 0.1-0.25 mg / mL, and cholesterol at a concentration of about 0.3-0.45 mg / mL. In some embodiments, the liquid composition further includes a Tris buffer composition containing tromethamine at a concentration of about 0.1-0.3 mg / mL, Tris hydrochloride (HCl) at a concentration of about 1.25-1.4 mg / mL, and sucrose at a concentration of about 95-110 mg / mL. In some embodiments, the immunogenic compositions of the present disclosure comprise about 5-15 mM Tris buffer, 200-400 mM sucrose, pH about 7.0-8.0, or 10 mM Tris buffer and 300 mM sucrose, pH about 7.4.

[0098] In some embodiments, a liquid RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein, encapsulated in an LNP at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly at, or between any two of those values, preferably about 0.01 to about 0.09 mg / mL, e.g., about 0.06 mg / mL, and further comprises about 5-15 mM Tris buffer, 200-400 mM sucrose, pH about 7.0-8.0. In some embodiments, the liquid composition further comprises 10 mM Tris buffer and 300 mM sucrose, pH about 7.4.

[0099] The frozen / liquid composition used in the studies described herein contains 0.06 mg / mL RNA in 10 mM Tris buffer, 300 mM sucrose, pH 7.4.

[0100] The liquid immunogenic compositions of the present disclosure may be presented as a frozen suspension and thawed and / or diluted prior to injection.

[0101] The disclosed methods or uses include VZV RNA-LNPs (e.g., VZV RNA-LNPs) presented as lyophilized (and subsequently reconstituted) compositions comprising an RNA molecule / polynucleotide encoding a VZV polypeptide as disclosed herein, encapsulated in LNPs with a lipid composition comprising a cationic lipid at a concentration of about 0.8-0.95 mg / mL, a PEGylated lipid at a concentration of about 0.05-0.15 mg / mL, a first structural lipid at a concentration of about 0.1-0.25 mg / mL, and a second structural lipid at a concentration of about 0.3-0.45 mg / mL, at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly at, or between any two of those values, preferably about 0.01 to about 0.18 mg / mL, e.g., about 0.06 mg / mL or 0.18 mg / mL. The present disclosure provides for the administration of immunogenic compositions, such as modRNA vaccines. In some embodiments, the lyophilized composition further comprises a first buffer at a concentration of about 0.01 to 0.15 mg / mL, a second buffer at a concentration of about 0.5 to 0.65 mg / mL, a stabilizer at a concentration of about 35 to 50 mg / mL, and a salt diluent at a concentration of about 5 to 15 mg / mL for reconstitution. In certain embodiments, the lyophilized composition is reconstituted in about 0.6 to 0.75 mL of salt diluent. In some embodiments, the immunogenic composition of the present disclosure comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, pH about 7.0 to 8.0. In some embodiments, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, pH about 7.4. The concentration in the lyophilized RNA-LNP composition is determined after reconstitution.

[0102] In certain embodiments, the lyophilized (and subsequently reconstituted) RNA-LNP compositions contain an RNA polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly at, or between any two of those values, preferably about 0.01 to about 0.18 mg / mL, e.g., about 0.06 mg / mL or about 0.18 mg / mL, and / or ALC-0315 at a concentration of about 0.8 to 0.95 mg / mL. The immunogenic composition of the present disclosure further comprises a Tris buffer composition for reconstitution, comprising tromethamine at a concentration of about 0.01 to 0.15 mg / mL, TrisHCl at a concentration of about 0.5 to 0.65 mg / mL, sucrose at a concentration of about 35 to 50 mg / mL, and sodium chloride (NaCl) diluent at a concentration of about 5 to 15 mg / mL. In certain embodiments, the lyophilized composition is reconstituted in about 0.6 to 0.75 mL of sodium chloride. In some embodiments, the immunogenic composition of the present disclosure comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, and a pH of about 7.0 to 8.0. In some embodiments, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, pH about 7.4.

[0103] In some embodiments, the lyophilized RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein, encapsulated in an LNP at a concentration of at least 0.01, 0.15, 0.30, 0.43, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to, exactly at, or between any two of those values, preferably about 0.01-0.18 mg / mL, e.g., about 0.06 mg / mL or 0.18 mg / mL, and further comprises about 5-15 mM Tris buffer, 200-400 mM sucrose, pH about 7.0-8.0. In some embodiments, the lyophilized composition further comprises 10 mM Tris buffer and 300 mM sucrose, pH about 7.4, and is reconstituted with a 0.9% sodium chloride diluent.

[0104] The lyophilized compositions used in the studies described herein contain 0.06 mg / mL RNA after reconstitution or 0.18 mg / mL RNA after reconstitution and are reconstituted using 10 mM Tris buffer, 300 mM sucrose, and 0.9% sodium chloride diluent.

[0105] The concentration in the lyophilized RNA-LNP composition is determined after reconstitution.

[0106] The immunogenic composition is administered in an injection volume of about 0.25 to 1 mL (e.g., about 0.25, 0.5, 1 mL) as needed. In some embodiments, dilution with sterile 0.9% sodium chloride (normal saline) may be necessary.

[0107] The VZV RNA molecules / constructs and RNA-LNPs evaluated in the Examples in the clinical studies described herein comprise modified RNA (modRNA) containing an RNA sequence in which all uridines are replaced by N1-methylpseudouridine (Ψ) (i.e., VZV modRNA vaccine).

[0108] In the present disclosure, the immunogenic compositions provided herein may be used or co-administered with one or more other vaccines, for example, an influenza vaccine along with a pneumococcal vaccine (e.g., a pneumococcal conjugate vaccine (PCV) such as Prevenar 7, 13, or 20), a tetanus vaccine, a diphtheria vaccine, a pertussis vaccine (e.g., Tdap), a respiratory syncytial virus (RSV) vaccine, or a COVID-19 vaccine.

[0109] As used herein, the VZV RNA molecules, RNA-LNPs (e.g., VZV modRNA vaccines), and related embodiments thereof may be any of those described in PCT / IB2022 / 059774, the complete disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0110] The present disclosure provides a method as described herein, comprising administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule encodes a VZV gE polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1-11, and wherein VZV gE-binding antibodies are induced in the human subject. In one embodiment, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 1. In one embodiment, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 5. In one embodiment, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 4.

[0111] The present disclosure further provides a method as described herein, comprising administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule encodes a VZV gE polypeptide that is accumulated in the trans-Golgi network (TGN), secreted and / or expressed in the cell membrane, and wherein VZV gE-binding antibodies are induced in the human subject.

[0112] The present disclosure further provides a method as described herein, comprising administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146-279, and wherein VZV gE-binding antibodies are induced in the human subject. In one embodiment, the RNA molecule comprises the open reading frame (ORF) nucleic acid sequence of SEQ ID NO: 148. In one embodiment, the RNA molecule comprises the ORF nucleic acid sequence of SEQ ID NO: 157. In one embodiment, the RNA molecule comprises the ORF nucleic acid sequence of SEQ ID NO: 153.

[0113] In one embodiment, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the composition is administered at a dose ranging from about 15 μg to about 90 μg. In one embodiment, the composition is administered at a dose of about 15 μg. In one embodiment, the composition is administered at a dose of about 30 μg. In one embodiment, the composition is administered at a dose of about 60 μg. In one embodiment, the composition is administered at a dose of about 90 μg.

[0114] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and the composition is administered in a single dose or a two-dose schedule (at 0 and 2 months or 0 and 6 months).

[0115] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the geometric mean concentration (GMC) of VZV gE antibodies in the subject about one month after the first dose is at least 5x, 10x, 15x, 20x, 25x, 30x, 35x, or 40x higher than baseline.

[0116] In one embodiment, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the percentage of subjects having at least a 4-fold increase in GMC about one month after the first dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0117] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the geometric mean fold rise (GMFR) of VZV gE antibodies about one month after the first dose is at least 15, 20, 25, 30, 35, or 40, or more.

[0118] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is higher than the GMC of the antibody in the subject at baseline and one month after the first dose.

[0119] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is at least 5x, 10x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, or 60x higher than baseline.

[0120] In one embodiment, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and the percentage of subjects having at least a 4-fold increase in GMC about 1 month after the second dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0121] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the geometric mean fold rise (GMFR) of VZV gE antibodies about one month after the second dose is at least 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75, or more.

[0122] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMC of VZV gE antibodies in the subject about one month after the first dose is at least about 1.1x, 1.2x, 1.3x, or 1.4x higher than the GMC of VZV gE antibodies in the human subject about one month after the first dose of SHINGRIX®.

[0123] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is at least about 1.1x higher than the GMC of VZV gE antibodies in the human subject about one month after the second dose of SHINGRIX®.

[0124] In one embodiment, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMFR at about one month after the first dose is at least about 1.1x, 1.2x, or 1.3x higher than the GMFR of the human subject at one month after the first dose of SHINGRIX®. In one embodiment, the GMFR at about one month after the first dose is about 1.3x higher than the GMFR of the human subject at one month after the first dose of SHINGRIX®.

[0125] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, and the GMFR at about one month after the second dose is at least about 1.1x, 1.2x, 1.3x higher than the GMFR of the human subject at one month after the second dose of SHINGRIX®.

[0126] In one embodiment, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMFR at about one month after the second dose is at least about 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, or 1.9x higher than the GMFR of the human subject at one month after the second dose of SHINGRIX®. In one embodiment, the GMFR at about one month after the second dose is about 1.9x higher than the GMFR of the human subject at one month after the second dose of SHINGRIX®.

[0127] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 153, and the GMFR at about one month after the second dose is at least about 1.1x, 1.2x, 1.3x higher than the GMFR of the human subject at one month after the second dose of SHINGRIX®.

[0128] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMFR at about one month after the first dose is similar to the GMFR of the human subject at one month after the second dose of SHINGRIX®.

[0129] In one aspect, the methods described herein include administering to a human subject an immunogenic composition (e.g., a VZV modRNA vaccine) comprising an RNA molecule formulated in 90 μg of lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, and wherein the GMFR at about 1 month after the first dose is similar to the GMFR of the human subject at 1 month after the second dose of SHINGRIX®.

[0130] I. Definition Examples Throughout this application, the term "about" is used according to its plain and ordinary meaning within the art of cell and molecular biology to indicate a deviation of ±10% of the value with which it is associated.

[0131] The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, and unless otherwise stated herein, each separate value is incorporated herein to the same extent as if it were individually recited herein.

[0132] The use of the words "a" or "an," when used in conjunction with the term "comprising," may mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more than one."

[0133] The phrase "and / or" means "and" or "or." By way of example, A, B, and / or C includes A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination. In other words, "and / or" functions as an inclusive "or."

[0134] The phrase "essentially all" is defined as "at least 95%." If essentially all members of a group have a particular property, then at least 95% of the members of the group have that property. In some embodiments, essentially all means that at least any one of, equal to, any one of 95, 96, 97, 98, 99, or 100% of the members of the group, or between any two of those values, have that property.

[0135] The compositions and methods of use thereof may "comprise," "consist essentially of," or "consist of" any of the components or steps disclosed throughout this specification. Unless otherwise required by context, throughout this specification the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of containing, e.g., "contains" and "contain") will be understood to be inclusive or open-ended and to imply the inclusion of a stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. It is contemplated that aspects described herein in the context of the term "comprising" may also be implemented in the context of the term "consisting of" or "consisting essentially of." Compositions and methods "consisting essentially of" any of the disclosed components or steps limit the scope of the claim to the specified materials or steps without materially affecting the basic and novel characteristics of the claimed disclosure. The word "consisting" (and any forms of consisting, e.g., "consist of" and "consists of") is meant to be inclusive and limited to what follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0136] References throughout this specification to "one aspect," "an aspect," "a particular aspect," "related aspect," "a certain aspect," "an additional aspect," or "a further aspect," or combinations thereof, mean that the particular feature, structure, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. Thus, appearances of such phrases in various places throughout this specification are not necessarily all referring to the same aspect. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more aspects.

[0137] The terms "inhibiting," "reducing," or "lowering," or any variation of these terms, include any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve a desired result. The terms "improve," "promote," or "increase," or any variation of these terms, include any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule.

[0138] As used herein, the term "reference," "standard," or "control" describes the value that is compared to.For example, a target agent, subject, population, sample, or value is compared to a reference, standard, or control of the target agent, subject, population, sample, or value.The reference, standard, or control can be tested and / or determined substantially simultaneously and / or together with the target test or determination of the target agent, subject, population, sample, or value, and / or can be determined or characterized for the target agent, subject, population, sample, or value that is being evaluated under comparable conditions or circumstances.

[0139] The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free of its original cellular, bacterial, viral, or culture medium (if produced by recombinant DNA techniques), or chemical precursors or other chemicals (if chemically synthesized). Furthermore, an isolated compound refers to one that can be administered to a subject as an isolated compound. In other words, a compound may not be considered "isolated" simply because it is attached to a column or embedded in an agarose gel. Furthermore, an "isolated nucleic acid fragment" or "isolated peptide" is a nucleic acid or protein fragment that does not naturally occur as a fragment and / or is not typically in a functional state and / or has been altered or removed from its natural state through human intervention. For example, DNA that naturally occurs in a living animal is not "isolated," but synthetic DNA or DNA that is partially or completely separated from the coexisting materials of its natural state is "isolated." Isolated nucleic acids can exist in a substantially purified form or can exist in a non-native environment, such as a cell into which the nucleic acid has been delivered.

[0140] As used herein, "nucleic acid" refers to a molecule containing a nucleic acid component, and refers to a DNA or RNA molecule. It may be used interchangeably with the term "polynucleotide." A nucleic acid molecule is a polymer comprising or consisting of nucleotide monomers covalently linked to each other by sugar / phosphate-backbone phosphodiester bonds. Nucleic acids may also contain modified nucleic acid molecules, such as DNA or RNA molecules with base, sugar, or backbone modifications. Nucleic acids may exist in various forms, such as isolated segments of integrated sequences or recombinant polynucleotides encoding polypeptides and recombinant vectors, e.g., antigens, or one or both chains of antibodies, or fragments, derivatives, muteins, or variants thereof; polynucleotides sufficient for use as hybridization probes, PCR primers, or sequencing primers to identify, analyze, mutate, or amplify polynucleotides encoding polypeptides; polynucleotides, mRNAs, saRNAs, and antisense nucleic acids for inhibiting expression of complementary sequences of the foregoing described herein. The nucleic acid may encode an epitope to which an antibody can bind.

[0141] The term "epitope" refers to a site that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding entity. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are groups that are physically separated from each other when the antigen adopts an alternative conformation (e.g., linear).

[0142] Nucleic acids may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids). In some cases, nucleic acid sequences may encode polypeptide sequences with additional heterologous coding sequences to allow, for example, purification, transport, secretion, post-translational modification, or therapeutic benefits such as targeting or efficacy of the polypeptide. Tags or other heterologous polypeptides may be added to the coding sequence of the modified polypeptide, where "heterologous" refers to a polypeptide that is not the same as the modified polypeptide.

[0143] The term "polynucleotide" refers to a nucleic acid molecule that may be recombinant or that has been isolated from total genomic nucleic acid. The term "polynucleotide" includes oligonucleotides (nucleic acids of 100 residues or less in length), recombinant vectors, including, for example, plasmids, cosmids, phages, viruses, and the like. In certain embodiments, a polynucleotide includes a regulatory sequence that has been substantially isolated from its naturally occurring gene or protein-coding sequence. A polynucleotide may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide.

[0144] In certain embodiments, polynucleotide variants exist that have substantial identity to the sequences disclosed herein, including at least, up to, or between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity compared to the polynucleotide sequences provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). In certain embodiments, the isolated polynucleotide comprises a nucleotide sequence that encodes a polypeptide having at least 90% identity to the amino acid sequences set forth herein over the entire length of the sequence, or a nucleotide sequence complementary to said isolated polynucleotide. In some embodiments, the isolated polynucleotide comprises a nucleotide sequence that is complementary to the nucleotide sequence encoding a polypeptide having at least 95% identity to the amino acid sequences set forth herein over the entire length of the sequence, or said isolated polynucleotide.

[0145] Regardless of the length of the coding sequence itself, a nucleic acid segment may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, etc., and its overall length may vary considerably. The nucleic acid may be of any length. They may be, for example, equal to, at least equal to, up to, or between any two of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length; and / or may include one or more additional sequences, e.g., regulatory sequences, and / or may be part of a larger nucleic acid, e.g., a vector. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, the total length being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol.

[0146] In this regard, the term "gene" is used to refer to a nucleic acid that encodes a protein, polypeptide, or peptide (including any sequences necessary for proper transcription, post-translational modification, or localization). As will be understood by those of skill in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or can be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid that encodes all or a portion of a polypeptide can contain a contiguous nucleic acid sequence that encodes all or a portion of such a polypeptide. It is also contemplated that a particular polypeptide can be encoded by a nucleic acid that contains variants that have slightly different nucleic acid sequences but nonetheless encode the same or substantially similar polypeptide.

[0147] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from the nucleic acid sequence. In some embodiments, the gene product can be a transcript. In some embodiments, the gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence includes one or more of the following: (1) generation of an RNA template from the DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, etc.), (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein.

[0148] Generally, the term "engineered" refers to aspects that have been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when two or more sequences that are not naturally linked together in that order have been manipulated by the hand of man so that they are directly linked to each other in the manipulated polynucleotide, and / or when particular residues in the polynucleotide have been linked, through the action of the hand of man, to entities or moieties that do not occur in nature and / or are not naturally linked.

[0149] As used herein, the term "DNA" refers to nucleic acid molecules containing nucleotides such as deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, which are composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety and polymerized with a characteristic backbone structure. The backbone structure, typically formed by a phosphodiester bond between the sugar moiety of a first nucleotide monomer, e.g., deoxyribose, and the phosphate moiety of a second, adjacent monomer, is called the DNA sequence. DNA can be single-stranded or double-stranded. In the double-stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T and G / C base pairing. DNA can contain all or a majority of deoxyribonucleotide residues. As used herein, the term "deoxyribonucleotide" refers to a nucleotide lacking a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. Without any limitation, DNA can include double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinantly produced DNA, and modified DNA.

[0150] As used herein, the term "RNA" refers to a nucleic acid molecule comprising nucleotides such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers connected to one another along a so-called backbone. The backbone is formed by a phosphodiester bond between the sugar, e.g., ribose, of a first monomer and the phosphate moiety of a second adjacent monomer. RNA can be obtained, for example, by transcription of a DNA sequence inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or mitochondria. In vivo, transcription of DNA can result in premature RNA, which is processed into messenger RNA (mRNA). For example, processing of premature RNA in eukaryotes involves various post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. Mature messenger RNA is processed to provide a nucleotide sequence that can be translated into the amino acid sequence of a peptide or protein. Mature mRNA may include a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a poly-A tail sequence. RNA may contain all or a majority of ribonucleotide residues. As used herein, the term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. In one embodiment, the RNA may be messenger RNA (mRNA) associated with an RNA transcript encoding a peptide or protein. As known to those skilled in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without any limitation, RNA may include double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA (modRNA).

[0151] "Isolated RNA" is defined as an RNA molecule that may be recombinant or that has been isolated from total genomic nucleic acid. An isolated RNA molecule or protein may exist in a substantially purified form or may exist in a non-native environment, such as a host cell.

[0152] "Modified RNA" or "mod RNA" refers to an RNA molecule that has at least one addition, deletion, substitution, and / or alteration of one or more nucleotides compared to naturally occurring RNA. Such alterations can refer to internal RNA nucleotides or the addition of non-nucleotide material to the 5' and / or 3' ends of the RNA. In one embodiment, such mod RNA contains at least one modified nucleotide, such as a change to the base of a nucleotide. For example, modified nucleotides can replace one or more uridine and / or cytidine nucleotides. For example, these substitutions can occur for all instances of uridine and / or cytidine in the RNA sequence, or can occur only for selected uridine and / or cytidine nucleotides. Such alterations in standard nucleotides in RNA can include non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide can be replaced with N1-methylpseudouridine in the RNA sequence. Other such modified nucleotides are known to those skilled in the art. Such modified RNA molecules are considered analogs of naturally occurring RNA. In some embodiments, RNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid containing deoxyribonucleotides. In some embodiments, RNA can be a replicon RNA (replicon), particularly a self-replicating RNA, or a self-amplifying RNA (saRNA).

[0153] As contemplated herein, without any limitation, RNA can be used as a therapeutic modality to treat and / or prevent several conditions in mammals, including humans. The methods described herein include administering the RNA described herein to a mammal, such as a human. For example, in one embodiment, such a method of using RNA includes an RNA vaccine encoding an antigen to induce robust neutralizing antibodies and concomitant / concurrent T cell responses to achieve protective immunization. In some embodiments, a minimal vaccine dose is administered to induce robust neutralizing antibodies and concomitant / concurrent T cell responses to achieve protective immunization. In one embodiment, the administered RNA is in vitro transcribed RNA. For example, such RNA can be used to encode at least one antigen intended to generate an immune response in the mammal. The pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In a specific embodiment, the pathogen is a peptide or protein antigen derived from VZV. Conditions and / or diseases that may be treated using the RNA disclosed herein include, but are not limited to, those caused and / or affected by viral infections, including, but not limited to, VZV.

[0154] As used herein, "preventing" or "prevention," when used in reference to the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of the occurrence of the disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of the disease, disorder, or condition. Prevention may be considered complete when the onset of the disease, disorder, or condition has been delayed for a predefined period of time.

[0155] As understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is at least, or at most, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%. In some embodiments, risk is expressed relative to the risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from an individual comparable to the particular individual. In some embodiments, risk may reflect, for example, one or more genetic attributes that may predispose (or not) an individual to developing a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptible: An individual who is "susceptible to" a disease, disorder, and / or condition is an individual who is at a higher risk of developing the disease, disorder, and / or condition than members of the public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition develops the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not develop the disease, disorder, and / or condition.

[0156] The terms "protein," "polypeptide," or "peptide" are used synonymously herein and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single molecule or a multimolecular complex, such as a dimer, trimer, or tetramer. A protein comprises one or more peptides or polypeptides and can fold into a three-dimensional form, which may be necessary for the protein to perform its biological function.

[0157] As used herein, the terms "wild-type" or "WT" or "native" refer to the endogenous version of a molecule that occurs naturally in an organism. In some embodiments, a wild-type version of a protein or polypeptide is used, while in other embodiments of the present disclosure, a modified protein or polypeptide is used to generate an immune response. The above terms may be used interchangeably.

[0158] A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, has been altered relative to the wild-type protein or polypeptide. In some embodiments, the modified / variant protein or polypeptide has at least one altered activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function but retain wild-type activity or function in other respects, such as immunogenicity. When specifically referred to herein, this generally refers to a native (wild-type) or recombinant (modified) protein. The protein may be isolated directly from the organism in which it is native, produced by recombinant DNA / exogenous expression methods, or produced by solid-phase peptide synthesis (SPPS) or other in vitro methods. In certain embodiments, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding polypeptides (e.g., antigens or fragments thereof). The term "recombinant" may be used in conjunction with the name of a specific polypeptide, and generally refers to a polypeptide that is produced from a nucleic acid molecule that has been manipulated in vitro or is the product of replication of such a molecule.

[0159] The term "fragment" with reference to an amino acid sequence (peptide or protein) relates to a portion of the amino acid sequence, for example, a sequence representing an N-terminally and / or C-terminally truncated amino acid sequence. C-terminally truncated fragments (N-terminal fragments) can be obtained, for example, by translating a truncated open reading frame lacking the 3' end of the open reading frame. N-terminally truncated fragments (C-terminal fragments) can be obtained, for example, by translating a truncated open reading frame lacking the 5' end of the open reading frame, as long as the truncated open reading frame contains the initiation codon that serves to initiate translation. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In this disclosure, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of those values, sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0160] In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 70% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 80% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 85% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 90% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 95% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 97% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence that has at least 99% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0161] As used herein, the term "variant" in the context of a molecule, e.g., a nucleic acid, protein, or small molecule, refers to a molecule that exhibits significant structural identity with the reference molecule, e.g., in the presence or absence or level of one or more chemical moieties, compared to the reference entity, but that is structurally distinct from the reference molecule. In some embodiments, a variant also differs functionally from its reference molecule. Generally, whether a particular molecule is properly considered a "variant" of a reference molecule is based on its degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule possesses certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one aspect. In some embodiments, a variant polypeptide or nucleic acid can differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalent components of the polypeptide or nucleic acid (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, a variant polypeptide or nucleic acid exhibits an overall sequence identity with a reference polypeptide or nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or up to, exactly, or between any two of these values. In some embodiments, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some embodiments, a reference polypeptide or nucleic acid has one or more biological activities. In some embodiments, a variant polypeptide or nucleic acid shares one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to a reference polypeptide or nucleic acid.In some embodiments, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference except for minor sequence changes at specific positions. Preferably, the variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, compared to the reference polypeptide or nucleic acid sequence. In one embodiment, the variant polypeptide or nucleic acid sequence has 1 to about 10 modifications compared to the reference polypeptide or nucleic acid sequence. In one embodiment, the variant polypeptide or nucleic acid sequence has 1 to about 5 modifications compared to the reference polypeptide or nucleic acid sequence. Typically, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in the variant are substituted, inserted, or deleted compared to the reference. Often, a variant polypeptide or nucleic acid contains very few (e.g., less than about 5, about 4, about 3, about 2, or about 1) substituted, inserted, or deleted functional residues (e.g., residues involved in a particular biological activity) compared to the reference. In some embodiments, a variant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residues compared to the reference. In some embodiments, a variant polypeptide or nucleic acid contains less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, typically less than about 5, about 4, about 3, or about 2 additions or deletions compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains no more than about 5, about 4, about 3, about 2, or about 1 additions or deletions compared to the reference, and in some embodiments, no additions or deletions.

[0162] In some embodiments, a reference polypeptide or nucleic acid is a "wild-type" or "WT" or "native" sequence found in nature, including allelic variants. A wild-type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For purposes of this disclosure, a "variant" of an amino acid sequence (peptide, protein, or polypeptide) includes an amino acid insertion variant, an amino acid addition variant, an amino acid deletion variant, and / or an amino acid substitution variant. A "variant" of a nucleotide sequence includes a nucleotide insertion variant, a nucleotide addition variant, a nucleotide deletion variant, and / or a nucleotide substitution variant. The term "variant" includes all mutants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants, and species homologs, particularly those that occur naturally. The term "variant" specifically includes fragments of an amino acid or nucleic acid sequence.

[0163] Changes can be introduced by mutation into a nucleic acid, resulting in a change in the amino acid sequence of the polypeptide (e.g., antigen or antibody or antibody derivative) that it encodes. Mutations can be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are altered, for example, using a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are altered, for example, using a random mutagenesis protocol. In some embodiments, regardless of how it is made, the mutant polypeptide can be expressed and screened for desired properties.

[0164] Mutations can be introduced into nucleic acids without significantly altering the biological activity of the polypeptides encoded by the nucleic acids. For example, nucleotide substitutions can be made that result in amino acid substitutions at non-essential amino acid residues. Alternatively, one or more mutations can be introduced into nucleic acids that selectively alter the biological activity of the polypeptides encoded by the nucleic acids. For example, mutations can quantitatively or qualitatively alter biological activity. Examples of quantitative changes include increasing, reducing, or eliminating activity. Examples of qualitative changes include altering the antigen specificity of antibodies.

[0165] "Sequence similarity" refers to the percentage of amino acids that are either identical or that are conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

[0166] The terms "% identical", "% identity", or similar terms are intended to refer specifically to the percentage of nucleotides or amino acids that are identical between the sequences being compared in optimal alignment. The percentage is purely statistical, and the differences between the two sequences may, but are not necessarily, randomly distributed over the entire length of the sequences being compared. Comparison of two sequences is usually performed by comparing the sequences after optimal alignment over a segment or "comparison window" to identify local regions of corresponding sequences. Optimal alignment for comparison can be performed manually or with the aid of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math., 2, 482, with the aid of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol., 48, 443, with the aid of the similarity search algorithm of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA, 88, 2444, or with the aid of a computer program using the above algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). In some embodiments, the percent identity of two sequences is determined using the BLASTN or BLASTP algorithm available on the National Center for Biotechnology Information (NCBI) website.

[0167] Percent identity is obtained by determining the number of identical positions where the compared sequences correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0168] In some embodiments, the degree of similarity or identity is provided for at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence, or for a region that is at most, exactly, or between any two of these values. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is provided for at least about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or for at most, exactly, or between any two of these values, in some embodiments, consecutive nucleotides. In some embodiments, the degree of similarity or identity is provided for the entire length of the reference sequence.

[0169] A homologous amino acid sequence may exhibit at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of the amino acid residues, up to, exactly, or between any two of those values. In one embodiment, a homologous amino acid sequence exhibits at least 95% identity of the amino acid residues. In one embodiment, a homologous amino acid sequence exhibits at least 98% identity of the amino acid residues. In one embodiment, a homologous amino acid sequence exhibits at least 99% identity of the amino acid residues.

[0170] A fragment or variant of an amino acid sequence (peptide or protein) may be a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, e.g., it is functionally equivalent. With respect to an antigen or antigen sequence, one particular function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. As used herein, the term "functional fragment" or "functional variant" particularly refers to a variant molecule or sequence that includes an amino acid sequence that is modified by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, yet is still able to fulfill one or more of the parent molecule or sequence functions, e.g., inducing an immune response. In one aspect, modifications in the amino acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence.

[0171] An amino acid sequence (peptide, protein, or polypeptide) "derived from" a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the initial amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of the particular sequence or a fragment thereof. For example, one of skill in the art will understand that antigens suitable for use herein may be modified to vary in sequence from the naturally occurring or native sequence from which they are derived while retaining the desired activity of the native sequence.

[0172] In this disclosure, a vector refers to a nucleic acid molecule, such as an artificial nucleic acid molecule. A vector can be used to incorporate a nucleic acid sequence, such as a nucleic acid sequence containing an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, and transfer vectors. A vector can be an RNA vector or a DNA vector. In some embodiments, a vector is a DNA molecule. In some embodiments, a vector is a plasmid vector. In some embodiments, a vector is a viral vector. Typically, an expression vector contains a desired coding sequence along with other appropriate sequences required for expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify specific desired fragments (typically DNA fragments) and may lack functional sequences required for expression of the desired fragment.

[0173] As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. The pharmaceutical composition may be an immunogenic composition. In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specially formulated for parenteral administration, for example, as a sterile solution or suspension, for example, by subcutaneous, intramuscular, intravenous, or epidural injection, or as a sustained-release formulation.

[0174] As used herein, the term "vaccination" refers to the administration of an immunogenic composition intended to generate an immune response, for example, an immune response against a disease-associated (e.g., disease-causing) agent (e.g., a virus). In some embodiments, vaccination may be administered before, during, and / or after exposure to the disease-associated agent, and in certain embodiments, before, during, and / or shortly after exposure to the agent. In some embodiments, vaccination involves multiple administrations of the vaccine composition, appropriately spaced apart. In some embodiments, vaccination generates an immune response against an infectious agent. In some embodiments, vaccination generates an immune response against a tumor. In some such embodiments, vaccination is "personalized" in that it is partially or completely directed to epitopes (e.g., which may be or may include one or more neoepitopes) determined to be present in a particular individual's tumor.

[0175] An immune response refers to a humoral response, a cellular response, or both a humoral and a cellular response in an organism. Immune responses can be measured by assays including, but not limited to, assays that measure the presence or amount of antibodies that specifically recognize a protein or cell surface protein (e.g., glycoprotein E (gE)-binding antibodies), assays that measure T-cell activation or proliferation, and / or assays that measure modulation associated with the activity or expression of one or more cytokines.

[0176] As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously. In some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered before any doses of a second regimen). In some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, "administration" of a combination therapy may include administration of one or more agents or modalities to a subject receiving other agents or modalities in the combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily simultaneously), although in some embodiments, two or more agents, or active portions thereof, may be administered together in a combination composition or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0177] Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a set of unit doses (typically multiple) that are individually administered to a subject, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen that can include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each of which is separated in time from the other doses. In some embodiments, the individual doses are separated from each other by periods of the same length. In some embodiments, a dosing regimen includes multiple doses, with at least two different periods separating the individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is different from the first dose amount. In some embodiments, a dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is the same as the first dose amount. In some embodiments, the dosing regimen correlates to a desired or beneficial outcome when administered across a relevant population (e.g., a therapeutic dosing regimen).

[0178] II. Varicella-zoster virus (VZV) The present disclosure provides RNA molecules (e.g., RNA polynucleotides) comprising at least one open reading frame encoding a varicella-zoster virus (VZV) polypeptide. The present disclosure further provides immunogenic compositions comprising at least one RNA molecule encoding a VZV polypeptide complexed with, encapsulated in, or formulated with one or more lipids to form a lipid nanoparticle (LNP).

[0179] Varicella-zoster virus (VZV), also known as human herpesvirus 3 (HHV-3), is a human pathogen that causes chickenpox or varicella in children and later re-emerges as herpes zoster or shingles. VZV has an inner capsid that encloses a linear, double-stranded DNA genome. Surrounding the capsid is a glycoprotein-containing membrane, and the outermost layer is a lipid-rich glycoprotein-containing envelope. Glycoproteins have various functions, from DNA replication or capsid assembly to interacting with cell surface molecules and assisting fusion into the plasma membrane. For example, glycoprotein E is an integral membrane protein that is thought to be important for T-cell infection and cell-to-cell spread of the virus. VZV exhibits tropism for neurons and T cells.

[0180] During primary VZV infection (e.g., chickenpox or "varicella"), VZV establishes a latent state in sensory ganglia. VZV-specific T cells are required to clear the primary infection and prevent reactivation. The mechanism of reactivation is unknown, but VZV cell-mediated immunity is thought to play a role. Deficient cell-mediated immunity (e.g., advanced age, immunocompromised status) is a risk factor for reactivation. Reactivation allows VZV replication and transport to the skin, potentially manifesting as herpes zoster (HZ).

[0181] Shingles most commonly manifests as a painful, unilateral, vesicular rash, typically limited to one dermatome or a few contiguous dermatomes. Within a few days of the onset of the rash, clusters of vesicles, blisters, or pustules may develop. These lesions contain VZV and are considered infectious. The characteristic pain of shingles includes a burning sensation or numbness, pruritus, or allodynia. Many people develop prodromal pain 2–3 days before the rash appears. In immunocompetent individuals, the lesions crust over 7–10 days, and once crusted, they are no longer infectious.

[0182] The most common complication of shingles is postherpetic neuralgia (PHN), which occurs in up to 15% of people with shingles. PHN is significant pain in the area affected by shingles after the rash has crusted. Older age and prodromal symptoms are considered risk factors for PHN. Other complications of shingles include ocular complications (shingles ophthalmic or keratitis, acute retinal necrosis), neurological complications (shingles oticus, meningitis, encephalitis, myelitis, peripheral motor neuropathy, Guillain-Barré syndrome, and stroke), and secondary bacterial skin and soft tissue infections.

[0183] The VZV genome encodes at least 71 unique proteins (ORFs 0 to 68), with three additional open reading frames (ORFs 69 to 71) that duplicate the previous open reading frames (ORFs 64 to 62, respectively). The encoded proteins form the structure of the viral particle, which contains nine glycoproteins: ORF 5 (gK), ORF 9A (gN), ORF 14 (gC), ORF 31 (gB), ORF 37 (gH), ORF 50 (gM), ORF 60 (gL), ORF 67 (gI), and ORF 68 (gE). The encoded glycoproteins gE, gI, gB, gH, gK, gL, gC, gN, and gM function in different stages of the viral replication cycle. The most abundant glycoprotein found in infected cells and mature virions is glycoprotein E (gE, ORF68), a major component of the virion envelope and essential for viral replication. Glycoprotein I (gI, ORF67) forms a complex with gE in infected cells, which promotes endocytosis of both glycoproteins and targets them to the trans-Golgi network (TGN), where the final viral envelope is acquired. VZV gE, a 623-amino acid type I membrane protein encoded by open reading frame 68 (ORF68), is the most abundant viral glycoprotein expressed on the surface of VZV-infected cells. Glycoprotein I (gI) is required within the TGN for VZV envelope formation and efficient membrane fusion during VZV replication. VZV gE and gI are found complexed together on the surface of infected host cells. Glycoprotein B (ORF31), the second most abundant glycoprotein and thought to play a role in viral entry, binds neutralizing antibodies. Glycoprotein H is thought to have a fusion function that facilitates cell-to-cell spread of the virus. Antibodies to gE, gB, and gH are common after natural infection and vaccination and have been shown to neutralize viral activity in vitro. As used herein, the term "varicella-zoster virus" or "VZV" is not limited to any particular strain or variant.

[0184] In some embodiments, the RNA molecule comprises an open reading frame encoding a VZV antigen. In some embodiments, the VZV antigen is a VZV polypeptide. In some embodiments, the VZV polypeptide is a VZV glycoprotein (e.g., gK, gN, gC, gB, gH, gM, gL, gI, and gE), or a fragment or variant thereof. In some embodiments, the RNA molecule encodes a VZV gK polypeptide, an RNA molecule encodes a VZV gN polypeptide, an RNA molecule encodes a VZV gC polypeptide, an RNA molecule encodes a VZV gB polypeptide, an RNA molecule encodes a VZV gH polypeptide, an RNA molecule encodes a VZV gM polypeptide, an RNA molecule encodes a VZV gL polypeptide, an RNA molecule encodes a VZV gI polypeptide, and / or an RNA molecule encodes a VZV gE polypeptide. In one embodiment, the RNA molecule encodes a VZV gE polypeptide. In some embodiments, the VZV polypeptide comprises two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, or more) VZV polypeptides.

[0185] In some embodiments, the VZV polypeptide is a full-length VZV polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV polypeptide.

[0186] In some embodiments, the VZV polypeptide is a full-length gK polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gK polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gK polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gK polypeptide.

[0187] In some embodiments, the VZV polypeptide is a full-length gN polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gN polypeptide. In some embodiments, the VZV polypeptide is a variant of the VZV gN polypeptide. In some embodiments, the VZV polypeptide is a fragment of the VZV gN polypeptide.

[0188] In some embodiments, the VZV polypeptide is a full-length gC polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gC polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gC polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gC polypeptide.

[0189] In some embodiments, the VZV polypeptide is a full-length gB polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gB polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gB polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gB polypeptide.

[0190] In some embodiments, the VZV polypeptide is a full-length gH polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gH polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gH polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gH polypeptide.

[0191] In some embodiments, the VZV polypeptide is a full-length gM polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gM polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gM polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gM polypeptide.

[0192] In some embodiments, the VZV polypeptide is a full-length gL polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gL polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gL polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gL polypeptide.

[0193] In some embodiments, the VZV polypeptide is a full-length gI polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gI polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gI polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gI polypeptide.

[0194] In some embodiments, the VZV polypeptide is a full-length gE polypeptide. In some embodiments, the VZV polypeptide is a truncated VZV gE polypeptide. In some embodiments, the VZV polypeptide is a variant of a VZV gE polypeptide. In some embodiments, the VZV polypeptide is a fragment of a VZV gE polypeptide.

[0195] In some embodiments, the VZV polypeptide comprises at least one mutation. In some embodiments, the VZV polypeptide is a VZV gK polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gN polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gC polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gB polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gH polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gM polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gL polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gI polypeptide comprising at least one mutation. In some embodiments, the VZV polypeptide is a VZV gE polypeptide comprising at least one mutation.

[0196] In some embodiments, the RNA molecule encodes a VZV gE polypeptide comprising an amino acid sequence according to any one of GENBANK® Accession Nos. AAG32558.1, ABE03086.1, AAK01047.1, Q9J3M8.1, AEW88548.1, AGY33616.1, AEW89124.1, AIT53150.1, CAA25033.1, NP_040190.1, AKG56356.1, AEW89412.1, ABF21714.1, ABF21714.1, AAT07749.1, AEW88764.1, AAG48520.1, and / or AEW88980.1, or a fragment or variant thereof, the sequences of each of which are incorporated herein by reference. In some embodiments, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence according to GENBANK® Accession No. AH009994.2 (ORF68), the sequence of which is incorporated herein by reference, or a fragment or variant thereof.

[0197] In some embodiments, the RNA molecule encodes a VZV polypeptide of Table 1. In some embodiments, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of any of SEQ ID NOs: 1-11, or a fragment or variant thereof. In some embodiments, the VZV gE polypeptide can have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of, the amino acid sequences of Table 1, e.g., any of SEQ ID NOs: 1-11. In some embodiments, the VZV gE polypeptide consists of any of the amino acid sequences in Table 1, eg, any of SEQ ID NOs: 1-11.

[0198] In some embodiments, the sequence of the RNA molecule is transcribed from a DNA nucleic acid sequence (DNA polynucleotide) in Table 2. In some embodiments, the RNA molecule comprises an ORF transcribed from the nucleic acid sequence of any of SEQ ID NOs: 12-145, or a fragment or variant thereof. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that can have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of the values, identity to any of the nucleic acid sequences in Table 2, e.g., any of SEQ ID NOs: 12-145. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any of the nucleic acid sequences in Table 2, eg, any of SEQ ID NOs: 12-145.

[0199] In some embodiments, an RNA molecule comprises an ORF comprising an RNA nucleic acid sequence (RNA polynucleotide) of Table 3. In some embodiments, an RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 146-279, or a fragment or variant thereof. In some embodiments, an RNA molecule comprises an ORF comprising a nucleic acid sequence that may have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of, any of the Table 3 RNA nucleic acid sequences, e.g., any of SEQ ID NOs: 146-279. In some embodiments, the RNA molecule comprises an ORF comprising a nucleic acid sequence consisting of any of the RNA nucleic acid sequences in Table 3, eg, any of SEQ ID NOs: 146-279.

[0200] In some embodiments, the RNA molecule comprises a stabilized RNA. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudouridine. In some embodiments, the RNA molecule comprises a sequence in which all uridines are replaced by N1-methylpseudouridine (designated "Ψ"). In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 146-279 in which all uridines are replaced by N1-methylpseudouridine (designated "Ψ").

[0201] In some embodiments, the RNA molecule comprises an open reading frame encoding a VZV polypeptide amino acid sequence that can be at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of, the VZV polypeptide sequences of SEQ ID NOs: 1-11 (Table 1), or any other VZV polypeptide described herein. In some embodiments, the RNA molecule comprises an open reading frame encoding a VZV polypeptide amino acid sequence consisting of the VZV polypeptide sequences of SEQ ID NOs: 1-11 (Table 1), or any other VZV polypeptide described herein.

[0202] In some embodiments, an RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that can be at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of, the nucleic acid sequences of SEQ ID NOs: 12-145 (Table 2) or any other nucleic acid described herein. In some embodiments, an RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence consisting of the nucleic acid sequences of SEQ ID NOs: 12-145 (Table 2) or any other nucleic acid described herein.

[0203] In some embodiments, an RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence that may be at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, up to, exactly, or between any two of, the nucleic acid sequence of SEQ ID NOs: 146-279 (Table 3) or any other nucleic acid described herein. In some embodiments, an RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence consisting of the nucleic acid sequence of SEQ ID NOs: 146-279 (Table 3) or any other nucleic acid described herein. In some embodiments, an RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 146-279 (Table 3) in which all uridines have been replaced by N1-methylpseudouridine (designated "Ψ").

[0204] III.RNA molecule In some embodiments, the RNA molecule described herein is a coding RNA molecule. Coding RNA includes functional RNA molecules that can be translated into peptides or polypeptides. In some embodiments, coding RNA molecules include at least one open reading frame (ORF) that encodes at least one peptide or polypeptide. An open reading frame includes a sequence of codons that can be translated into a peptide or protein. Coding RNA molecules can include one (monocistronic), two (dicistronic), or more (polycistronic) ORFs, which can be a sequence of codons that can be translated into a polypeptide or protein of interest.

[0205] The coding RNA molecule can be a messenger RNA (mRNA) molecule, a viral RNA molecule, or a self-amplifying RNA molecule (saRNA, also called replicon).In some embodiments, the RNA molecule is mRNA.Preferably, the RNA molecule of the present disclosure is mRNA.In some embodiments, the RNA molecule is saRNA.In some embodiments, the saRNA molecule can be a coding RNA molecule.

[0206] An RNA molecule may encode one or more polypeptides of interest, such as one antigen or multiple antigens, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polypeptides. Alternatively, or in addition, a single RNA molecule may encode multiple polypeptides of interest, such as antigens, e.g., bicistronic, tricistronic RNA molecules encoding different or identical antigens.

[0207] The sequence of the RNA molecule may be codon-optimized or deoptimized for expression in a desired host, such as a human cell. In some embodiments, the genes of interest (e.g., antigens) described herein are encoded by coding sequences that are codon-optimized and / or have an increased guanosine / cytidine (G / C) content compared to a wild-type coding sequence. In some embodiments, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of a wild-type coding sequence. In some embodiments, codon optimization and / or increasing the G / C content does not change the sequence of the encoded amino acid sequence.

[0208] The term "codon-optimized" is understood by those skilled in the art to refer to the modification of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism, without changing the amino acid sequence encoded by the nucleic acid molecule.In the context of the present disclosure, in some embodiments, the coding region is codon-optimized for optimal expression in a subject treated with the RNA polynucleotide described herein.Codon optimization is based on the discovery that translation efficiency is also determined by the different occurrence frequencies of tRNA molecules in cells.Therefore, the sequence of RNA can be modified so that codons that are available for frequently occurring tRNA molecules are inserted instead of "rare codons".

[0209] In some embodiments, the G / C content of the coding region of the RNA (e.g., a gene sequence of interest, an open reading frame (ORF)) is increased compared to the G / C content of the corresponding coding sequence of a wild-type RNA encoding the gene of interest, and in some embodiments, the amino acid sequence encoded by the RNA is unmodified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that mRNA. Sequences with an increased G (guanosine) / C (cytidine) content are more stable than sequences with an increased A (adenosine) / U (uridine) content. In light of the fact that several codons encode the same amino acid (the so-called degeneracy of the genetic code), the most favorable codons in terms of stability can be determined (the so-called alternative codon usage). Depending on the amino acid encoded by the RNA, various modifications of the RNA sequence compared to its wild-type sequence are possible. In particular, codons containing A and / or U nucleosides can be modified by replacing them with other codons that encode the same amino acids but that do not contain A and / or U or that contain a lower content of A and / or U nucleosides. Thus, in some embodiments, the G / C content of the coding region of the RNA described herein is increased by at least 10%, 20%, 30%, 40%, 50%, 55%, or even more, up to, exactly, or between any two of these values, compared to the G / C content of the coding region of a wild-type RNA. In some embodiments, the coding region of a VZV RNA described herein comprises a G / C content of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%. In some embodiments, the coding regions of the VZV RNAs described herein comprise a G / C content of about 50% to 75%, about 55% to 70%, about 50% to 60%, about 60% to 70%, about 70% to 80%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 70% to 75%, or about 75% to 80%.In some embodiments, the coding regions of the VZV RNAs described herein comprise a G / C content of at least about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, or about 75%. In some embodiments, the coding regions of the VZV RNAs described herein comprise a G / C content of about 58%, about 66%, or about 62%.

[0210] In some embodiments, the RNA molecule is from about 20 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100-1 ,500, 100~3,000, 100~5,000, 100~7,000, 100~10,000, 100~25,000, 100~50,000, 100~70,000, 100~100,000, 500~1,000, 500~1,500, 500~2,000, 500~3,000, 500~5,000, 500~7,000, 500~10,000, 500~25,000, 500~50,000, 500~70,000, 500~100,000, 1,000~1,500, 1,000~2,000, 1,000~3,000, 1,000~5,000, 1,000~7,000, 1,000~10,000, 1,000~25,000, 1,000~50,000, 1,000~70,000, 1,000~100,000, 1,500~3,000, 1,500~5,000, 1,500~7,000 , 1,500–10,000, 1,500–25,000, 1,500–50,000, 1,500–70,000, 1,500–100,000, 2,000–3,000, 2,000–5,000, 2,000–7,000, 2,000–10,000, 2,000–25,000, 2,000–50,000, 2,000–70,000, and 2,000–100,000 nucleotides).

[0211] In some embodiments, the RNA molecule is at least about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 90 0, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 78 00, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 5400 0, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000 nucleotides, up to, exactly, or between any two of those values.

[0212] In some embodiments, the RNA molecule comprises at least 100 nucleotides. For example, in some embodiments, the RNA has a length of 100 to 15,000 nucleotides, 7,000 to 16,000 nucleotides, 8,000 to 15,000 nucleotides, 9,000 to 12,500 nucleotides, 11,000 to 15,000 nucleotides, 13,000 to 16,000 nucleotides, or 7,000 to 25,000 nucleotides. In some embodiments, the RNA molecule has a length of at least about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 400 0, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6 000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950,8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 101 00, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11 900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 1 3700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 nucleotides, or a maximum of those values, exactly those values, or a value between any two of those values.

[0213] In some embodiments of the present disclosure, the RNA is or comprises a messenger RNA (mRNA) that relates to an RNA transcript that encodes a polypeptide. In some embodiments, the RNA disclosed herein comprises a 5' cap, a 5' untranslated region (5' UTR) that comprises a cap-proximal sequence, a protein (e.g., polypeptide) coding sequence, a 3' untranslated region (3' UTR), and / or a polyadenylation (polyA) sequence, including a 5' cap disclosed herein.

[0214] In some embodiments, the RNA disclosed herein comprises the following components in a 5' to 3' orientation: a 5' cap comprising a 5' cap disclosed herein, a 5' untranslated region (5' UTR) comprising a cap-proximal sequence, a sequence encoding a protein (e.g., a polypeptide), a 3' untranslated region (3' UTR), and a polyA sequence.

[0215] A. Modified Nucleobases In the present disclosure, RNA molecule can comprise modified nucleoside and modified nucleic acid base that can be incorporated into nucleotide.In some embodiments, RNA molecule can comprise one or more modified nucleotides.Naturally occurring nucleotide modifications are known in the art.

[0216] In some embodiments, RNA molecules may contain modified nucleotides. Non-limiting examples of modified nucleotides that may be contained in RNA molecules include pseudouridine, N1-methylpseudouridine, 5-methyluridine, 3-methyluridine, 5-methoxyuridine, 5-azauridine, 6-azauridine, 2-thio-5-azauridine, 2-thiouridine, 4-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 5-aminoallyluridine, and 5-halouridine. (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine , 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-1-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-Dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl Examples include leupseudouridine, 2-thio-2'-O-methyluridine, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 3,2'-O-dimethyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 1-thiouridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine], any other modified uridine known in the art, or a combination thereof.

[0217] In some aspects of the present disclosure, the modified nucleotide comprises any one of N1-methylpseudouridine or pseudouridine.

[0218] In some embodiments, the RNA molecule comprises N1-methylpseudouridine modified nucleotides. In some embodiments, the RNA molecule comprises pseudouridine modified nucleotides.

[0219] In some embodiments, the RNA contains a modified nucleoside in place of at least one uridine. In some embodiments, the RNA contains a modified nucleoside in place of each uridine. In some embodiments, the RNA molecule contains a sequence in which at least one uridine is replaced by N1-methylpseudouridine. In some embodiments, the RNA molecule contains a sequence in which all uridines are replaced by N1-methylpseudouridine. N1-methylpseudouridine is designated "Ψ" in the sequence. As used herein, the term "uracil" describes one of the nucleobases that can occur in RNA nucleic acids. As used herein, the term "uridine" describes one of the nucleosides that can occur in RNA. "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine, in which uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0220] In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudouridine or pseudouridine. In some embodiments, the RNA molecule contains at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59% of uridines. , 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to, exactly, or between any two of those values, are replaced by N1-methylpseudouridine or pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which all uridines are replaced by N1-methylpseudouridine or pseudouridine.

[0221] Modifications that may be present in an RNA molecule include, for example, m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-O-methyluridine), m1A (1-methyladenosine), m2A (2-methyladenosine), Am (2-1-O-methyladenosine), ms2m6A (2-methylthio-N6-methyladenosine), i6A (N6-isopentenyladenosine), ms2i6A (2-methylthio-N6-isopentenyladenosine), io6A (N6-(cis-hydroxyisopentenyl)adenosine), ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine), g6A (N6-glycinylcarbamoyladenosine), t6A (N6-threonylcarbamoyladenosine), ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine), m6t6A (N6-methyl-N6-threonylcarbamoyladenosine), hn6A (N6-hydroxynorvalylcarbamoyladenosine), ms2hn6A( 2-methylthio-N6-hydroxynorvalylcarbamoyl adenosine), Ar(p) (2'-O-ribosyladenosine (phosphate)), I (inosine), mil (1-methylinosine), m'lm (1,2'-O-dimethylinosine), m3C (3-methylcytidine), Cm (2T-O-methylcytidine), s2C (2-thiocytidine), ac4C (N4-acetylcytidine), f5C (5-formylcytosine), m5Cm (5,2-O-dimethylcytidine), ac4Cm (N4-acetyl2T-O-methylcytidine) , k2C (lysidine), m1G (1-methylguanosine), m2G (N2-methylguanosine), m7G (7-methylguanosine), Gm (2'-O-methylguanosine), m22G (N2,N2-dimethylguanosine), m2Gm (N2,2'-O-dimethylguanosine), m22Gm (N2,N2,2'-O-trimethylguanosine), Gr(p) (2'-O-ribosylguanosine (phosphate)), yW (wibutosine), o2yW (peroxywibutosine), OHyW (hydroxywibutosine), OHyW *(undermodified hydroxywybutosine), imG (wybutosine), mimG (methylguanosine), Q (queuosine), oQ (epoxyqueuosine), galQ (galactosyl-queuosine), manQ (mannosyl-queuosine), preQo (7-cyano-7-deazaguanosine), preQi (7-aminomethyl-7-deazaguanosine), G *(Archaeosin), D (dihydrouridine), m5Um (5,2'-O-dimethyluridine), s4U (4-thiouridine), m5s2U (5-methyl-2-thiouridine), s2Um (2-thio-2'-O-methyluridine), acp3U (3-(3-amino-3-carboxypropyl)uridine), ho5U (5-hydroxyuridine), mo5U (5-methoxyuridine), cmo5U (uridine 5-oxyacetic acid), mcmo5U (uridine 5-oxyacetic acid methyl ester), chm5U (5-(carboxyhydroxymethyl)uridine)), m chm5U (5-(carboxyhydroxymethyl)uridine methyl ester), mcm5U (5-methoxycarbonylmethyluridine), mcm5Um (S-methoxycarbonylmethyl-2-O-methyluridine), mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine), nm5s2U (5-aminomethyl-2-thiouridine), mnm5U (5-methylaminomethyluridine), mnm5s2U (5-methylaminomethyl-2-thiouridine), mnm5se2U (5-methylaminomethyl-2-selenouridine), ncm5U (5- carbamoylmethyluridine), ncm5Um (5-carbamoylmethyl-2'-O-methyluridine), cmnm5U (5-carboxymethylaminomethyluridine), cnmm5Um (5-carboxymethylaminomethyl-2-LO-methyluridine), cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine), m62A (N6,N6-dimethyladenosine), Tm (2'-O-methylinosine), m4C (N4-methylcytidine), m4Cm (N4,2-O-dimethylcytidine), hm5C (5 -hydroxymethylcytidine), m3U (3-methyluridine), cm5U (5-carboxymethyluridine), m6Am (N6,TO-dimethyladenosine), rn62Am (N6,N6,O-2-trimethyladenosine), m2'7G (N2,7-dimethylguanosine), m2'2'7G (N2,N2,7-trimethylguanosine), m3Um (3,2T-O-dimethyluridine), m5D (5-methyldihydrouridine), f5Cm (5-formyl-2'-O-methylcytidine), m1Gm (1,2'-O-dimethylguanosine), m'Am (1,2-O-dimethyladenosine (irinomethyluridine), tm5s2U (S-taurinomethyl-2-thiouridine), imG-14 (4-demethylguanosine), imG2 (isoguanosine), ac6A (N6-acetyladenosine), hypoxanthine, inosine, 8-oxo-adenine, its 7-substituted derivatives, dihydrouracil, pseudouracil, 2-thiouracil, 4 -thiouracil, 5-aminouracil, 5-(C1-C6)-alkyluracil, 5-methyluracil, 5-(C2-Ce)-alkenyluracil, 5-(C2-Ce)-alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(C1-C6)-alkylcytosine, 5-methyluracil cytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)-alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N2-dimethylguanine, 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine, 7-deaza-7-(C2-C6)alkynylguanine, 7-deaza-8-substituted guanine, 8-hydroxy Further examples include guanine, 6-thioguanine, 8-oxoguanine, 2-aminopurine, 2-amino-6-chloropurine, 2,4-diaminopurine, 2,6-diaminopurine, 8-azapurine, substituted 7-deazapurine, 7-deaza-7-substituted purine, 7-deaza-8-substituted purine, hydrogen (abasic residue), mC, mU, mA, sU, W, or 2'-O-methyl-U.

[0222] In some embodiments, the RNA molecules may include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages.

[0223] The sequence of an RNA molecule can be modified, if desired, to increase the efficiency of expression or replication of the RNA, or to provide additional stability or resistance to degradation. For example, an RNA sequence can be modified with respect to its codon usage, e.g., to increase the translation efficiency and half-life of the RNA.

[0224] In some embodiments, the RNA molecule of the present disclosure comprises an open reading frame with at least one codon-modified sequence.The codon-modified sequence refers to a coding sequence that has at least one codon (a triplet of nucleotides that encodes one amino acid) different from the corresponding wild-type coding sequence.The codon-modified sequence can show improved resistance to degradation, improved stability, and / or improved translatability.

[0225] The sequence of the RNA molecule may be codon-optimized or deoptimized for expression in a desired host, such as a human cell.

[0226] In some embodiments, an RNA molecule may contain one or more structural and / or chemical modifications or alterations that confer useful properties to the polynucleotide, including, in some embodiments, a lack of substantial induction of an innate immune response in cells into which the polynucleotide is introduced. As used herein, a "structural" feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized in an RNA molecule without significant chemical modification to the nucleotides themselves. Because chemical bonds are necessarily broken and reformed to affect the structural modification, the structural modification is chemical in nature and is therefore a chemical modification. However, the structural modification results in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G." The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG," where the dinucleotide "CC" is inserted, resulting in a structural modification to the polynucleotide.

[0227] In some embodiments, the RNA molecule may include one or more modified nucleotides in addition to any 5' cap structure. Naturally occurring nucleotide modifications are known in the art.

[0228] In some embodiments, the RNA molecule does not include modified nucleotides, e.g., does not include modified nucleobases, and with the exception of an optional 5' cap which may include, e.g., 7-methylguanosine, as described further below, all nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G, and C. In some embodiments, the RNA may include a 5' cap which includes 7'-methylguanosine, and the first one, two, or three 5' ribonucleotides may be methylated at the 2' position of the ribose.

[0229] In some embodiments, the RNA molecule described herein is a non-coding RNA molecule.Non-coding RNA (ncRNA) molecules include functional RNA molecules that are not translated into peptides or polypeptides.Non-coding RNA molecules can include highly abundant and functionally important RNA molecules.In some embodiments, non-coding RNA is a functional mRNA molecule that is not translated into peptides or polypeptides.Non-coding RNA can include modified nucleotides as described herein.Preferably, the RNA molecule is mRNA.

[0230] The RNA molecules of the present disclosure can be prepared by any method known in the art, including chemical synthesis and in vitro methods such as RNA in vitro transcription. In some embodiments, the RNA of the present disclosure is prepared using in vitro transcription.

[0231] In some embodiments, the RNA molecules of the disclosure are purified, such as, for example, by ultrafiltration, diafiltration, or filtration that occurs, for example, via tangential flow ultrafiltration / diafiltration.

[0232] In some embodiments, the RNA molecules of the present disclosure are lyophilized to render them temperature stable.

[0233] B.5' Cap In some embodiments, the RNA molecules described herein comprise a 5' cap, which generally "caps" the 5' end of the RNA and stabilizes the RNA molecule.

[0234] In some embodiments, the 5' cap moiety is a natural 5' cap. A "natural 5' cap" is defined as a cap comprising a 7-methylguanosine connected to the 5' end of an mRNA molecule through a 5'-to-5' triphosphate linkage. In some embodiments, the guanosine nucleoside comprised in the 5' cap can be modified, for example, by methylation at one or more positions (e.g., position 7) on the base (guanine) and / or by methylation at one or more positions on the ribose. In some embodiments, the guanosine nucleoside comprised in the 5' cap comprises a 3'O-methylation at the ribose (3'OMeG). In some embodiments, the guanosine nucleoside comprised in the 5' cap comprises a methylation at position 7 of the guanine (m7G). In some embodiments, the guanosine nucleoside comprised in the 5' cap comprises a methylation at position 7 of the guanine and a 3'O-methylation at the ribose (m7(3'OMeG)). The 5' cap can be incorporated during RNA synthesis (e.g., co-transcriptional capping) or can be enzymatically engineered after RNA transcription (e.g., post-transcriptional capping). In some embodiments, co-transcriptional capping using a cap disclosed herein improves the capping efficiency of the RNA compared to co-transcriptional capping using an appropriate reference comparator. In some embodiments, improving capping efficiency may increase the translation efficiency and / or translation rate of the RNA and / or increase expression of the encoded polypeptide. In some embodiments, capping is performed after purification of the RNA molecule, e.g., tangential flow filtration.

[0235] In some embodiments, the RNA described herein comprises a 5' cap or a 5' cap analog, e.g., Cap 0, Cap 1, or Cap 2. In some embodiments, the provided RNA does not have an uncapped 5'-triphosphate. In some embodiments, the 5' end of the RNA is capped with a modified ribonucleotide. In some embodiments, the 5' cap moiety is a 5' cap analog. In some embodiments, the RNA can be capped with a 5' cap analog. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (Cap 0) and 7mG(5')ppp(5')N1mpNp (Cap 1). In some embodiments, the RNA described herein comprises Cap 0. Cap 0 is an N7-methylguanosine connected to the 5' nucleotide through a 5'-to-5' triphosphate linkage, typically referred to as m7G cap or m7Gppp. In cells, the Cap 0 structure is essential for efficient translation of mRNAs bearing a cap. An additional methylation on the 2'O position of the initiating nucleotide generates Cap 1, or referred to as m7GpppNm, where Nm represents any nucleotide with a 2'O methylation. In some embodiments, the RNAs described herein include Cap 1, e.g., as described herein. In some embodiments, the RNAs described herein include Cap 2.

[0236] In some embodiments, the Cap 0 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G). In some embodiments, the Cap 0 structure is connected to the RNA via a 5' to 5'-triphosphate linkage, also referred to herein as m7Gppp or m7G(5')ppp(5'). The 5' cap may be methylated with the structure m7G(5')ppp(5')N (Cap-0 structure) or a derivative thereof, where N is the terminal 5' nucleotide of the nucleic acid bearing the 5' cap, typically the 5' end of an mRNA. An exemplary enzymatic reaction for capping may include the use of vaccinia virus capping enzyme (VCE), which includes mRNA triphosphatase, guanylyltransferase, and guanine-7-methyltransferase, to catalyze the construction of the N7-monomethylated Cap 0 structure. The Cap 0 structure plays an important role in maintaining the stability and translational efficacy of RNA molecules.

[0237] The 5' cap of an RNA molecule may be further modified by a 2'-O-methyltransferase, resulting in the generation of a Cap 1 structure (m7Gppp[m2'-O]N), which may increase translation efficiency. In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and a 2'O-methylated first nucleotide in the RNA (2'OmeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-to-5'-triphosphate linkage, also referred to herein as m7Gppp(2'OMeN1) or m7G(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7G(5')ppp(5')(2'OmeN1) Cap 1 structure includes a second nucleotide, N2, which is the cap-proximal nucleotide at position 2 and is selected from A, G, C, or U (m7G(5')ppp(5')(2'OmeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0238] In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and one or more additional modifications, e.g., methylation, on the ribose, and a 2'O-methylated first nucleotide in the RNA. In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine, a 3'O-methylation on the ribose (m7(3'OMeG)), and a 2'O-methylated first nucleotide in the RNA (2'OMeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-to-5'-triphosphate linkage, also referred to herein as m7(3'OMeG)ppp(2'OMeN1) or m7(3'OMeG)(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7(3'OMeG)(5')ppp(5')(2'OMeN1) Cap 1 structure includes a second nucleotide, N2, which is the cap-proximal nucleotide at position 2 and is selected from A, G, C, or U (m7(3'OMeG)(5')ppp(5')(2'OMeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0239] In some embodiments, the second nucleotide in the Cap 1 structure can include one or more modifications, such as methylation. In some embodiments, a Cap 1 structure that includes a second nucleotide that includes a 2'O methylation is a Cap 2 structure.

[0240] In some embodiments, RNA molecules can be enzymatically capped at the 5' end using vaccinia guanylyltransferase, guanosine triphosphate, and S-adenosyl-L-methionine to yield a Cap 0 structure. An inverted 7-methylguanosine cap is added via a 5' to 5' triphosphate bridge. Alternatively, 2'O-methyltransferase can be used with vaccinia guanylyltransferase to yield a Cap 1 structure in which the 2'OH group on the penultimate nucleotide is methylated in addition to the Cap 0 structure. S-adenosyl-L-methionine (SAM) is the cofactor utilized as the methyl transfer reagent. Non-limiting examples of 5' cap structures are those that have, among other things, enhanced binding of cap-binding polypeptides, increased half-life, reduced susceptibility to 5' endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures known in the art (or wild-type, natural, or physiological 5' cap structures).

[0241] For example, recombinant vaccinia virus capping enzyme and recombinant 2'O-methyltransferase can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of an mRNA and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is called a Cap 1 structure. This cap confers greater translational competence and cellular stability and reduces cellular proinflammatory cytokine activation, for example, compared to other 5'-cap analog structures known in the art.

[0242] In some embodiments, the 5'-end cap comprises a cap analog, for example, the 5'-end cap can comprise a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0243] In some embodiments, the capping region can include a single cap or a series of nucleotides that form a cap. In this embodiment, the capping region can be 1 to 10, e.g., 2 to 9, 3 to 8, 4 to 7, 1 to 5, 5 to 10, or at least 2, or no more than 10, nucleotides in length. In this embodiment, the capping region is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or up to, exactly, or between any two of these values ​​in length. In some embodiments, no cap is present. In some embodiments, the first and second operable regions can range in length from 3 to 40, e.g., 5 to 30, 10 to 20, 15, or at least 4, or no more than 30, nucleotides in length and can include one or more signal and / or restriction sequences in addition to start and / or stop codons. In some embodiments, the first and second operable regions are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length, up to, exactly, or between any two of those values, and may include one or more signal and / or restriction sequences in addition to start and / or stop codons.

[0244] Further examples of 5' cap structures include, but are not limited to, glyceryl, inverted deoxyabasic residue (moiety), 4',5' methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thionucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seconucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3' phosphorothioate, phosphorodithioate, or a bridged or non-bridged methylphosphonate moiety.

[0245] In some embodiments, the RNA molecules of the present disclosure comprise at least one 5' cap structure. In some embodiments, the RNA molecules of the present disclosure do not comprise a 5' cap structure.

[0246] In one embodiment, the 5' capping structure comprises a modified 5' Cap 1 structure (m 7 G + m 3’ In one embodiment, the 5' capping structure is (3'OMe)-m2 7,3’-O Gppp(m1 2’-O ) ApG (TriLink BioTechnologies). This molecule is identical to the natural RNA cap structure in that it starts with a guanosine methylated at N7, joined to the first coded nucleotide of the transcribed RNA (adenosine in this case) by a 5' to 5' triphosphate linkage. This guanosine is also methylated at the 3' hydroxyl of the ribose to mitigate potential back-incorporation of the cap molecule. The 2' hydroxyl of the ribose on the adenosine is methylated, giving the cap 1 structure.

[0247] C. Untranslated region (UTR) A 5'UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence, or into a corresponding region in an RNA polynucleotide such as an mRNA molecule. Untranslated regions (UTRs) can be 5' (upstream) of an open reading frame (5'UTR) and / or 3' (downstream) of an open reading frame (3'UTR).

[0248] In some embodiments, UTRs are derived from mRNAs that are naturally abundant in the specific tissues (e.g., lymphatic tissues) where mRNA expression is targeted. In some embodiments, UTRs increase protein synthesis. Without being bound by mechanism or theory, UTRs can increase protein synthesis by increasing the time that mRNA remains in translating polysomes (message stability) and / or the rate at which ribosomes begin translating messages (message translation efficiency). Thus, UTR sequences can extend protein synthesis in a tissue-specific manner.

[0249] In some embodiments, the 5'UTR and 3'UTR sequences are derived by computer. In some embodiments, the 5'UTR and 3'UTR are derived from mRNA that is naturally abundant in a tissue. The tissue may be, for example, a liver, a stem cell, or a lymphoid tissue. The lymphoid tissue may include, for example, any one of lymphocytes (e.g., B-lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils, and reticulocytes. In some embodiments, the 5'UTR and 3'UTR are derived from an alphavirus. In some embodiments, the 5'UTR and 3'UTR are from a wild-type alphavirus.

[0250] i.5'UTR In some embodiments, the RNA disclosed herein comprises a 5'UTR. If present, the 5'UTR is located at the 5' end and starts from the transcription initiation site upstream of the start codon of the protein-coding sequence region. The 5'UTR is downstream of the 5'cap (if present), for example, directly adjacent to the 5'cap. The 5'UTR may contain various regulatory elements that may play a role in regulating translation initiation, such as a 5'cap structure, a stem-loop structure, and an internal ribosome entry site (IRES).

[0251] In some embodiments, a 5' UTR disclosed herein comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0252] In some embodiments, the cap structure comprises one or more polynucleotides of a cap-proximal sequence. In some embodiments, the cap structure comprises an M7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the cap structure comprises an M7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the cap structure comprises an M7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide.

[0253] Those skilled in the art will understand, upon reading this disclosure, that in some embodiments, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by virtue of being included in a cap entity (e.g., a cap 1 structure), or in some embodiments, at least some of the residues in the cap-proximal sequence may be added enzymatically (e.g., by a polymerase such as T7 polymerase). For example, (m2 7,3’-O )Gppp(m 2’-OIn certain exemplified embodiments where an ApG cap is utilized, the +1 and +2 residues are the (m2 7,3’-O ) A and G residues, and +3, +4, and +5 residues are added by a polymerase (e.g., T7 polymerase).

[0254] In some embodiments, the cap-proximal sequence comprises cap structures N1 and / or N2, where N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, the cap-proximal sequence comprises cap structures N1 and N2 and N3, N4, and N5, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, e.g., A, C, G, or U. In some embodiments, N1N2 comprises any one of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some embodiments, N1N2 comprises AG and N3N4N5 comprises any one of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, CAU, CCU, CGU, CUU, GAA, GCA, GGA, GUA, GAG, GGG, GCG, GUG, GAC, GCC, GGC, GUC, GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU.

[0255] In some embodiments, the cap-proximal sequence comprises cap structure N1 and N2, and a sequence comprising A3A4X5 (SEQ ID NO:307, where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0256] In some embodiments, the cap-proximal sequence comprises cap structure N1 and N2, and a sequence comprising C3A4X5 (SEQ ID NO:308, where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0257] In some embodiments, the cap-proximal sequence comprises a sequence comprising the cap structure N1 and N2, and X3Y4X5 (SEQ ID NO:309, where X3 or X5 are each independently selected from A, G, C, or U, and Y4 is not C). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are each independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 are A. In some embodiments, X3 and / or X5 are C. In some embodiments, X3 and / or X5 are G. In some embodiments, X3 and / or X5 are U. In some embodiments, Y4 is C. In other embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In other embodiments, Y4 is not G. In some embodiments, Y4 is U.

[0258] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3C4A5 (SEQ ID NO: 310). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0259] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3U4G5 (SEQ ID NO: 311). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0260] Exemplary 5'UTRs include human alpha globin (hAg) 5'UTR or a fragment thereof, TEV 5'UTR or a fragment thereof, HSP70 5'UTR or a fragment thereof, or c-Jun 5'UTR or a fragment thereof.

[0261] In some embodiments, the RNA disclosed herein comprises an hAg 5'UTR or a fragment thereof. In some embodiments, the RNA disclosed herein comprises an hAg 5'UTR that has 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the human alpha globin 5'UTR provided in SEQ ID NO: 312. In some embodiments, the RNA disclosed herein comprises an hAg 5'UTR provided in SEQ ID NO: 312. SEQ ID NO: 312 AGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC

[0262] In some embodiments, the RNA disclosed herein comprises an hAg 5'UTR having 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the human alpha globin 5'UTR provided in SEQ ID NO: 313. In some embodiments, the RNA disclosed herein comprises an hAg 5'UTR provided in SEQ ID NO: 313. SEQ ID NO: 313 AAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC

[0263] In one embodiment, a sequence DNA encoding a 5'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%, up to, exactly, or between any two of those values, identity to SEQ ID NO: 280. In one embodiment, a sequence DNA encoding a 5'UTR comprises the sequence of SEQ ID NO: 280. In one embodiment, a RNA disclosed herein comprises a 5'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%, up to, exactly, or between any two of those values, identity to a 5'UTR provided in any of SEQ ID NOs: 281-282, with the transcribed 5' cap structure underlined. In one embodiment, a 5'UTR comprises the sequence of any of SEQ ID NOs: 281-282, with the transcribed 5' cap structure underlined. SEQ ID NO: 280 (DNA) AG AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC SEQ ID NO: 281 (RNA) AG AAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC SEQ ID NO: 282 (RNA) AG AAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC

[0264] In some embodiments, the RNA disclosed herein comprises a 3'UTR. If present, the 3'UTR is located downstream of the protein-coding sequence open reading frame, for example, downstream of the stop codon of the protein-coding sequence region. The 3'UTR is typically a part of the mRNA located between the protein-coding sequence and the polyA tail of the mRNA. Thus, in some embodiments, the 3'UTR is upstream of the polyA sequence (if present), for example, directly adjacent to the polyA sequence. The 3'UTR may be involved in regulatory processing, including transcript cleavage, stability, and polyadenylation, translation, and mRNA localization.

[0265] The 3'UTR may also contain elements that are not encoded in the template from which the RNA is transcribed, but are added during post-transcriptional maturation, such as a polyA tail. The 3'UTR of an mRNA is not translated into an amino acid sequence. In some embodiments, the RNA disclosed herein contains a 3'UTR that includes an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereof contains a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.

[0266] In some embodiments, the RNA disclosed herein comprises a 3'UTR that has at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%, up to, exactly, or between any two of those values, identity to the 3'UTR provided in SEQ ID NO: 314. In some embodiments, the RNA disclosed herein comprises a 3'UTR provided in SEQ ID NO: 314. SEQ ID NO: 314 CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAA GCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC

[0267] In one embodiment, a sequence DNA encoding a 3'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%, up to, exactly, or between any two of those values, identity to SEQ ID NO: 283. In one embodiment, a sequence DNA encoding a 5'UTR comprises the sequence of SEQ ID NO: 283. In one embodiment, an RNA disclosed herein comprises a 3'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%, up to, exactly, or between any two of those values, identity to a 3'UTR provided in any of SEQ ID NOs: 284-285 and 317-318. In one embodiment, the 3'UTR comprises the sequence of any of SEQ ID NOs: 284-285 and 317-318. SEQ ID NO: 283 (DNA) CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC SEQ ID NO: 284 (RNA) CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC SEQ ID NO: 285 (RNA) CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGC SEQ ID NO: 317 (RNA) CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC SEQ ID NO: 318 (RNA) CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACC

[0268] D. Open Reading Frame (ORF) The 5' and 3' UTRs may be operably linked to an open reading frame (ORF), which may be a sequence of codons that can be translated into a polypeptide of interest. The open reading frame may be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. The ORF may begin with a start codon at its 5' end, for example, a combination of three consecutive nucleotides (ATG or AUG) that usually encodes the amino acid methionine, and a subsequent region that usually has a length that is a multiple of three nucleotides. The open reading frame may end with at least one stop codon, including, but not limited to, TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some aspects, an open reading frame may terminate in one, two, three, four, or more stop codons, including, but not limited to, TAATAA (SEQ ID NO:289), TAATAG (SEQ ID NO:290), TAATGA (SEQ ID NO:291), TAGTGA (SEQ ID NO:292), TAGTAA (SEQ ID NO:293), TAGTAG (SEQ ID NO:294), TGATGA (SEQ ID NO:295), TGATAG (SEQ ID NO:296), TGATAA (SEQ ID NO:297), or UAAUAA (SEQ ID NO:298), UAAUAG (SEQ ID NO:299), UAAUGA (SEQ ID NO:300), UAGUGA (SEQ ID NO:301), UAGUAA (SEQ ID NO:302), UAGUAG (SEQ ID NO:303), UGAUGA (SEQ ID NO:304), UGAUAG (SEQ ID NO:305), UGAUAA (SEQ ID NO:306), or any combination thereof. An open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be called a "(protein) coding region" or "coding sequence."

[0269] As described herein, an RNA molecule can contain one (monocistronic), two (dicistronic), or more (polycistronic) open reading frames.

[0270] In some embodiments, the ORF encodes a non-structural viral gene. In some embodiments, the ORF further comprises one or more subgenomic promoters. In some embodiments, the RNA molecule comprises a subgenomic promoter operably linked to the ORF. In some embodiments, the first RNA molecule does not comprise an ORF encoding any polypeptide of interest, while the second RNA molecule comprises an ORF encoding a polypeptide of interest. In some embodiments, the first RNA molecule does not comprise a subgenomic promoter.

[0271] The present disclosure provides RNA molecules comprising at least one open reading frame encoding a varicella-zoster virus (VZV) polypeptide, hi some embodiments, the RNA molecule comprises at least one open reading frame encoding a VZV gE polypeptide.

[0272] E. Gene of interest The RNA molecules described herein may contain a gene of interest. The gene of interest encodes a polypeptide of interest. Non-limiting examples of polypeptides of interest include, for example, biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell-penetrating peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane-associated polypeptides, nuclear polypeptides, polypeptides associated with human diseases, targeting moieties, polypeptides encoded by the human genome that have not yet been identified as therapeutic targets but are still useful in the fields of research and discovery, or combinations thereof. The sequence of a particular gene of interest can be easily identified by those skilled in the art using public and private databases, such as GENBANK®.

[0273] In some embodiments, the RNA molecule comprises the coding region of a gene of interest. In some embodiments, the gene of interest is or comprises an antigenic polypeptide or an immunogenic variant or fragment thereof. In some embodiments, the antigenic polypeptide comprises one epitope from one antigen. In some embodiments, the antigenic polypeptide comprises multiple distinct epitopes from one antigen. In some embodiments, an antigenic polypeptide comprising multiple distinct epitopes from one antigen is polyepitopic. In some embodiments, the antigenic polypeptide comprises an antigenic polypeptide from an allergen, a viral antigenic polypeptide, a bacterial antigenic polypeptide, a fungal antigenic polypeptide, a parasitic antigenic polypeptide, an antigenic polypeptide from an infectious agent, an antigenic polypeptide from a pathogen, a tumor antigenic polypeptide, or an autoantigenic polypeptide.

[0274] The term "antigen" may refer to a substance that can be recognized by the immune system, e.g., the adaptive immune system, and can induce an antigen-specific immune response, e.g., by the formation of antibodies and / or antigen-specific T cells as part of the adaptive immune response. An antigen may be or include a peptide or protein that can be presented to T cells by MHC. An antigen may be the product of translation of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence described herein. Furthermore, antigen fragments, variants, and derivatives, such as peptides or proteins, that comprise at least one epitope are understood as antigens.

[0275] In some embodiments, RNA encoding a gene of interest, e.g., an antigen, is expressed in cells of a subject treated to provide the gene of interest, e.g., antigen. In some embodiments, the RNA is transiently expressed in the cells of the subject. In some embodiments, expression of the gene of interest, e.g., antigen, is at the cell surface. In some embodiments, the gene of interest, e.g., antigen, is expressed and presented in the context of MHC. In some embodiments, expression of the gene of interest, e.g., antigen, is into the extracellular space, e.g., the antigen is secreted.

[0276] In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen, derived from a pathogen associated with an infectious disease. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen, derived from varicella-zoster virus (VZV).

[0277] In some embodiments, the RNA molecule encodes a VZV gE protein, or a fragment or variant thereof. In some embodiments, the RNA molecule encodes a VZV gE protein comprising an amino acid sequence according to any one of GENBANK® Accession Nos. AAG32558.1, ABE03086.1, AAK01047.1, Q9J3M8.1, AEW88548.1, AGY33616.1, AEW89124.1, AIT53150.1, CAA25033.1, NP_040190.1, AKG56356.1, AEW89412.1, ABF21714.1, ABF21714.1, AAT07749.1, AEW88764.1, AAG48520.1, and / or AEW88980.1, the sequences of which are incorporated herein by reference. In some embodiments, the RNA molecule encodes a VZV gE protein comprising the amino acid sequence according to GENBANK® Accession No. AH009994.2, the sequence of which is incorporated herein by reference.

[0278] In some embodiments, the RNA polynucleotides described herein, or compositions or pharmaceutical preparations comprising same, comprise a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence at least 80% identical to a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence encoding a polypeptide at least 80% identical to a polypeptide sequence disclosed herein. In some embodiments, the RNA polynucleotides described herein, or compositions or pharmaceutical preparations comprising same, are transcribed from a DNA template. In some embodiments, the DNA template used to transcribe the RNA polynucleotides described herein comprises a sequence complementary to the RNA polynucleotide. In some embodiments, the genes of interest described herein are encoded by the RNA polynucleotides described herein, comprising a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide encodes a polypeptide at least 80% identical to a polypeptide sequence disclosed herein. In some embodiments, the polypeptides described herein are encoded by RNA polynucleotides transcribed from a DNA template comprising a sequence complementary to the RNA polynucleotide.

[0279] In some embodiments, the RNA molecule encodes a VZV glycoprotein comprising the sequence of any one of SEQ ID NOs: 1-11, or a fragment or variant thereof.

[0280] In some embodiments, the RNA molecule encodes a VZV glycoprotein synthesized from a nucleic acid sequence comprising the sequence of any one of SEQ ID NOs: 12-145, or a fragment or variant thereof.

[0281] F. Poly A tail In some embodiments, the RNA molecules disclosed herein comprise a polyadenylation (polyA) sequence, e.g., as described herein. In some embodiments, the polyA sequence is located downstream of the 3'UTR, e.g., adjacent to the 3'UTR. A "polyA tail" or "polyA sequence" refers to a stretch of consecutive adenine residues that may be attached to the 3' end of an RNA molecule. PolyA sequences are known to those skilled in the art and may follow the 3'UTR in the RNA molecules described herein. A polyA tail may increase the half-life of an RNA molecule.

[0282] The RNA molecules disclosed herein can have a polyA sequence attached to the free 3' end of the RNA after transcription by a template-independent RNA polymerase, or a polyA sequence encoded by DNA and transcribed by a template-dependent RNA polymerase. In some embodiments, the polyA sequence is attached during RNA transcription, e.g., during preparation of the in vitro transcribed RNA, based on a DNA template containing repeated dT nucleotides (deoxythymidylic acid) in the strand complementary to the coding strand.

[0283] A DNA sequence (coding strand) that encodes a polyA sequence is called a polyA cassette. In some embodiments, the polyA cassette present in the coding strand of DNA consists essentially of dA nucleotides, but is interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such a random sequence can be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or up to, exactly, or between any two of these values. Such cassettes are disclosed in WO 2016 / 005324 A1, which is incorporated herein by reference. Any polyA cassette disclosed in WO 2016 / 005324 A1 may be used in the present invention. However, polyA cassettes consisting essentially of dA nucleotides, with an equal distribution of the four nucleotides (dA, dC, dG, dT) and interrupted by random sequences having a length of, for example, 5 to 50 nucleotides, are encompassed, which, at the DNA level, exhibit steady-state propagation of plasmid DNA in Escherichia coli (E. coli) and, at the RNA level, are still associated with beneficial properties related to supporting RNA stability and translation efficiency. In some embodiments, the polyA sequences contained in the RNA polynucleotides described herein consist essentially of adenosine nucleotides but are interrupted by random sequences of the four nucleotides (A, C, G, U). Such random sequences can be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, up to, exactly, or between any two of those values.

[0284] In some embodiments, no nucleotides other than adenosine nucleotides flank the 3' end of the polyA sequence, e.g., the polyA sequence is not interrupted or otherwise followed by nucleotides other than adenosine at its 3' end.

[0285] In some embodiments, the RNA molecule may further comprise an endonuclease recognition site sequence immediately downstream of the poly-A tail sequence. The RNA molecule may further comprise a poly-A polymerase recognition sequence (e.g., AAUAAA) near its 3' end.

[0286] The poly-A sequence can be of any length. In some embodiments, the poly-A tail can comprise a length of 5 to 300 nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail comprising, consisting essentially of, or consisting of a sequence of about 25 to about 400 adenosine nucleotides, a sequence of about 50 to about 400 adenosine nucleotides, a sequence of about 50 to about 300 adenosine nucleotides, a sequence of about 50 to about 250 adenosine nucleotides, a sequence of about 60 to about 250 adenosine nucleotides, or a sequence of about 40 to about 100 adenosine nucleotides. In some embodiments, the poly-A tail is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285 , 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500 adenosine nucleotides, up to, exactly, or between any two of those values. In this context, "consisting essentially of" means that most of the nucleotides in the polyA sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, by number of nucleotides in the polyA sequence, are adenosine nucleotides, while allowing the remaining nucleotides to be nucleotides other than adenosine nucleotides, such as uridine, guanosine, or cytosine.In this context, "consisting of" means that all nucleotides in the polyA sequence, eg, 100% by number of nucleotides in the polyA sequence, are adenosine nucleotides.

[0287] In some embodiments, the RNA molecule comprises a poly-A tail containing a sequence of more than 30 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail containing about 40 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail containing about 80 adenosine nucleotides. In some embodiments, the 3' poly-A tail has a stretch of at least 10 consecutive adenosine residues and up to 300 consecutive adenosine residues. In some specific embodiments, the RNA molecule contains about 40 consecutive adenosine residues. In some embodiments, the RNA molecule contains about 80 consecutive adenosine residues. The poly-A tail may play a key regulatory role in enhancing translation efficiency and regulating the efficiency of mRNA quality control and degradation. Short sequences or excessive polyadenylation may signal RNA degradation. Some designs include a poly-A tail of about 40 adenosine nucleotides, about 80 adenosine nucleotides.

[0288] In some embodiments, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, e.g., in a vector, e.g., a vector that serves as a template for production of an RNA, e.g., an mRNA, e.g., by transcription of the vector. In some embodiments, an RNA molecule may not comprise a poly-A tail.

[0289] In one embodiment, DNA encoding a poly-A tail disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 286, up to, exactly, or between any two of those values. In one embodiment, DNA encoding a poly-A tail comprises the sequence of SEQ ID NO: 286. In one embodiment, RNA disclosed herein comprises a poly-A tail comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to any of SEQ ID NOs: 287-288 and 315-316, up to, exactly, or between any two of those values. In one embodiment, the poly-A tail comprises a sequence of any of SEQ ID NOs: 287-288 + / - 2 adenosine (A) nucleotides. In one embodiment, the poly-A tail comprises the sequence of any of SEQ ID NOs: 287-288 + / - 1 adenosine (A) nucleotide. In one embodiment, the poly-A tail comprises the sequence of any of SEQ ID NOs: 287-288. In one embodiment, the poly-A tail comprises the sequence of any of SEQ ID NOs: 315-316 + / - 2 adenosine (A) nucleotides. In one embodiment, the poly-A tail comprises the sequence of any of SEQ ID NOs: 315-316 + / - 1 adenosine (A) nucleotide. In one embodiment, the poly-A tail comprises the sequence of any of SEQ ID NOs: 315-316. SEQ ID NO: 286 (DNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 287 (RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 288 (RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAΨAΨGACΨAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 315 (RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 316 (RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAΨAΨGACΨAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0290] G. Self-amplifying RNA (saRNA) In some embodiments, the RNA molecule may be saRNA. "Self-amplifying RNA," "self-amplifying RNA," and "replicon" refer to RNA capable of replicating itself. Self-amplifying RNA molecules can be generated by, for example, using replication elements derived from alphaviruses to replace structural viral polypeptides with nucleotide sequences encoding a polypeptide of interest. Self-amplifying RNA molecules are typically positive-strand molecules that can be directly translated after delivery to cells; this translation provides an RNA-dependent RNA polymerase, which then generates both antisense and sense transcripts from the delivered RNA. The delivered RNA results in the production of multiple daughter RNA molecules. These daughter RNA molecules and colinear subgenomic transcripts can themselves be translated to provide in situ expression of the encoded gene of interest, such as a viral antigen, or can be transcribed to provide additional transcripts with the same sense as the delivered RNA that are translated to provide in situ expression of the antigen. The overall result of this transcriptional sequence is an amplification of the number of introduced saRNA molecules, so that the encoded gene of interest, such as a viral antigen, becomes the major polypeptide product of the cell.

[0291] IV. RNA transcription In some embodiments, the RNA disclosed herein is produced by in vitro transcription or chemical synthesis.In the context of this disclosure, the term "transcription" refers to the process by which the genetic code in the DNA sequence is transcribed into RNA.The RNA can then be translated into peptides or proteins.

[0292] According to the present disclosure, "transcription" includes "in vitro transcription" or "IVT," which refers to a process in which transcription occurs in a non-cellular system in vitro to generate synthetic RNA products for use in various applications, including, for example, the production of proteins or polypeptides. Cloning vectors can be applied to generate transcripts. These cloning vectors are generally designated as transcription vectors and are encompassed by the term "vector" according to the present invention. According to certain embodiments, the RNA used is in vitro transcribed RNA (IVT-RNA), which can be obtained by in vitro transcription of a suitable DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. Specific examples of RNA polymerases are T7, T3, and SP6 RNA polymerases. Preferably, in vitro transcription according to the present invention is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription can be obtained by cloning a nucleic acid, particularly cDNA, and introducing it into an appropriate vector for in vitro transcription. cDNA can be obtained by reverse transcription of RNA.

[0293] Synthetic IVT RNA products can be translated in vitro or directly introduced into cells, where they can be translated. With respect to RNA, the terms "expression" or "translation" refer to the process in cellular ribosomes in which an mRNA chain directs the assembly of a sequence of amino acids to make a peptide or protein. Such synthetic RNA products include, but are not limited to, mRNA molecules, saRNA molecules, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNA molecules (e.g., for CRISPR), ribosomal RNA molecules, small nuclear RNA molecules, small nucleolar RNA molecules, etc. IVT reactions typically utilize a DNA template (e.g., a linear DNA template), ribonucleotides (e.g., unmodified or modified ribonucleotide triphosphates), and an appropriate RNA polymerase as described and / or utilized herein.

[0294] In some embodiments, mRNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid containing deoxyribonucleotides. In some embodiments, the RNA disclosed herein is in vitro transcribed RNA (IVT-RNA), which can be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. The DNA template for in vitro transcription can be obtained by cloning a nucleic acid, particularly cDNA, and introducing it into a suitable vector for in vitro transcription. cDNA can be obtained by reverse transcription of RNA.

[0295] In some embodiments, starting materials for IVT may include a linearized DNA template, nucleotides, RNase inhibitors, pyrophosphatase, and / or T7 RNA polymerase. In some embodiments, the IVT process is carried out in a bioreactor. The bioreactor may include a mixer. In some embodiments, nucleotides may be added to the bioreactor throughout the IVT process.

[0296] In some embodiments, one or more post-IVT agents are added to the IVT mixture containing RNA in the bioreactor after the IVT process. Exemplary post-IVT agents can include DNAse I, configured to digest the linearized DNA template, and proteinase K, configured to digest DNAse I and T7 RNA polymerase. In some embodiments, the post-IVT agent is incubated with the mixture in the bioreactor after IVT. In some embodiments, the bioreactor can contain at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500 liters or more of IVT mixture up to, exactly at, or between any two of those values. The IVT mixture can have an RNA concentration of at least 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL or more, up to, exactly at, or between any two of those values.

[0297] In some embodiments, the IVT mixture may include residual spermidine, residual DNA, residual proteins, peptides, HEPES, EDTA, ammonium sulfate, cations (e.g., Mg2+, Na+, Ca2+), RNA fragments, residual nucleotides, free phosphate, or any combination thereof.

[0298] In some embodiments, at least a portion of the IVT mixture is filtered. The IVT mixture may be filtered via ultrafiltration and / or diafiltration to remove at least some impurities from the IVT mixture, and / or at least a portion of the IVT mixture may be buffer changed to produce a concentrated RNA solution as a retentate.

[0299] In some embodiments, " ultrafiltration " and " diafiltration " both refer to membrane filtration process.Ultrafiltration typically uses membranes with pore sizes of at least 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 and 0.1 μm, or up to these values, exactly these values, or between any two of these values.In some embodiments, ultrafiltration membranes are typically classified by molecular weight cut-off (MWCO) rather than pore size. For example, the MWCO may be at least 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 110 kDa, 120 kDa, 130 kDa, 140 kDa, 150 kDa, 160 kDa, 170 kDa, 180 kDa, 190 kDa, 200 kDa, 210 kDa, 220 kDa, 230 kDa, 240 kDa, 250 kDa, 260 kDa, 270 kDa, 280 kDa, 290 kDa, 300 kDa, 310 kDa, 320 kDa , 330 kDa, 340 kDa, 350 kDa, 360 kDa, 370 kDa, 380 kDa, 390 kDa, 400 kDa, 500 kDa, 600 kDa, 700 kDa, 800 kDa, 900 kDa, 1000 kDa, 2000 kDa, 3000 kDa, 4000 kDa, 5000 kDa, 6000 kDa, 7000 kDa, 8000 kDa, 9000 kDa, and 10000 kDa, or between any two of those values. Those skilled in the art will appreciate that the filtration membrane can be of a variety of suitable materials, including, for example, polymers, cellulose, ceramics, etc., depending on the application. In some embodiments, membrane filtration may be more desirable for large volume purification processes.

[0300] In some embodiments, ultrafiltration and diafiltration of IVT mixtures to purify RNA may include (1) direct flow filtration (DFF), also known as "dead-end" filtration, in which the feed stream is applied perpendicular to the membrane plane and attempts to pass 100% of the fluid through the membrane, and / or (2) tangential flow filtration (TFF), also known as cross-flow filtration, in which the feed stream is passed parallel to the membrane plane, with a portion passing through the membrane (permeate) while the remainder (retentate) is retained in the feed tank and / or recycled back to the feed tank.

[0301] In some embodiments, the filtration of IVT mixture is carried out through TFF, which comprises ultrafiltration step, first diafiltration step and second diafiltration step.In some embodiments, the first diafiltration step is carried out in the presence of ammonium sulfate.The first diafiltration step can be configured to remove most impurities from IVT mixture.In some embodiments, the second diafiltration step is carried out without ammonium sulfate.The second diafiltration step can be configured to transfer RNA into DS buffer formulation.

[0302] A filtration membrane with an appropriate MWCO can be selected for ultrafiltration in the TFF process. The MWCO of the TFF membrane determines which solutes can pass through the membrane into the filtrate and which solutes will be retained in the retentate. The MWCO of the TFF membrane can be selected so that substantially all of the target solutes (e.g., the desired synthesized RNA species) remain in the retentate, while undesired components (e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA templates, peptide fragments such as digested proteins, and / or other impurities) pass into the filtrate. In some embodiments, the retentate containing the desired synthesized RNA species can be recycled back to the feed reservoir and re-filtered in additional cycles. In some embodiments, the TFF membrane can have a MWCO equal to, at most, exactly, or between any two of 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, or higher. In some embodiments, TFF membranes can have a MWCO equal to, at most, exactly, or between any two of 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, or higher. In some embodiments, TFF membranes can have a MWCO of about 250-350 kDa. In some embodiments, TFF membranes (e.g., cellulose-based membranes) can have a MWCO of about 30-300 kDa, or in some embodiments, about 50-300 kDa, about 100-300 kDa, or about 200-300 kDa.

[0303] Diafiltration can be performed either discontinuously or continuously. For example, in continuous diafiltration, a diafiltration solution can be added to the sample supply reservoir at the same rate as filtrate is produced. In this way, the volume in the sample reservoir remains constant, but small molecules (e.g., salts, solvents, etc.) that can freely permeate the membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) further reduces the solvent concentration. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g., salts, solvents, etc.) remaining in the reservoir is reached. Each additional diafiltration volume (DV) further reduces the concentration of small molecules (e.g., solvents). Continuous diafiltration typically requires a minimum volume for a given reduction in the molecule to be filtered. On the other hand, discontinuous diafiltration allows for rapid changes in retentate conditions such as pH, salt content, etc. In some embodiments, the first diafiltration step is carried out using a diafiltration volume equal to, up to, exactly at, or between any two of these values, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. In some embodiments, the second diafiltration step is carried out using a diafiltration volume equal to, up to, exactly at, or between any two of these values, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, the first diafiltration step is carried out using 5 diafiltration volumes and the second diafiltration step is carried out using 10 diafiltration volumes.

[0304] In some embodiments, for ultrafiltration and / or diafiltration, the IVT mixture is filtered at a rate equal to, up to, exactly at, or between any two of at least 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m2 of filtration area / hour, or higher. The concentrated RNA solution can contain at least 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL of single-stranded RNA, up to, exactly, or between any two of those values.

[0305] In some embodiments, the bioburden of the concentrated RNA solution can also be reduced by filtering to obtain an RNA product solution.The filtering to reduce the bioburden can be performed using one or more filters.The one or more filters can include a filter with a pore size of at least 0.2 μm, 0.45 μm, 0.65 μm, 0.8 μm, or up to, exactly, or between any two of these values, or any other pore size that is configured to remove bioburden.

[0306] As an example, reducing the bioburden may include draining a retentate tank containing retentate obtained from ultrafiltration and / or diafiltration to obtain retentate. Reducing the bioburden may include flushing a filtration system for ultrafiltration and / or diafiltration with a wash buffer solution to obtain a wash pool solution containing residual RNA remaining in the filtration system. The retentate may be filtered to obtain filtered retentate. The wash pool solution may be filtered using a first 0.2 μm filter to obtain a filtered wash pool solution. The retentate may be filtered using the first 0.2 μm filter or another 0.2 μm filter.

[0307] The filtered wash pool solution and the filtered retentate can be combined to form a combined pool solution, which can be filtered using a second 0.2 μm filter to obtain a filtered combined pool solution, which can be further filtered using a third 0.2 μm filter to produce an RNA product solution.

[0308] V. RNA Encapsulation The RNA in the RNA product solution may be encapsulated, and the RNA solution may further comprise at least one encapsulating agent. In one embodiment, the encapsulating agent comprises a lipid, a lipid nanoparticle (LNP), a lipoplex, a polymer particle, a polyplex, and a monolithic delivery system, and combinations thereof.

[0309] In one embodiment, the encapsulating agent is a lipid, resulting in RNA encapsulated in lipid nanoparticles (LNPs). Without intending to be bound by any theory, it is believed that cationic or cationizable lipids or lipid-like materials and / or cationic polymers combine with nucleic acids to form aggregates, which result in colloidally stable particles. The lipids can be naturally occurring or synthetic. However, lipids are typically biological substances. Biological lipids are well known in the art and include, for example, neutral lipids, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glucolipids, sulfatides, lipids with ethers and ester-linked fatty acids, and polymerizable lipids, as well as combinations thereof. Lipids are substances that are insoluble in water and extractable with organic solvents. Compounds other than those specifically described herein are understood by those skilled in the art as lipids and are encompassed by the compositions and methods of the present disclosure. The lipid components and non-lipids can be attached to each other either covalently or non-covalently.

[0310] In some embodiments, LNPs can be designed to protect RNA molecules (e.g., saRNA, mRNA) from extracellular RNases and / or can be engineered for systemic delivery of RNA to target cells. In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., saRNA, mRNA) when the RNA molecules are administered intravenously to a human subject in need thereof. In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., saRNA, mRNA) when the RNA molecules are administered intramuscularly to a human subject in need thereof.

[0311] In one embodiment, the RNA in the RNA solution is at a concentration of <1 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.05 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least about 1 mg / mL. In another embodiment, the RNA concentration is between about 0.05 mg / mL and about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least 10 mg / mL. In another embodiment, the RNA is at a concentration of at least 50 mg / mL. In some embodiments, the RNA is at a concentration of at least about 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or higher, up to, exactly at, or between any two of these values.

[0312] The present disclosure provides an RNA solution and lipid preparation mixture or composition thereof, comprising at least one RNA encoding, for example, an antigen (e.g., a VZV polypeptide), complexed with, encapsulated in, and / or combined with one or more lipids to form a lipid nanoparticle (LNP), liposome, lipoplex, and / or nanoliposome. In some embodiments, the composition comprises a lipid nanoparticle.

[0313] Lipid nanoparticles or LNPs refer to particles of any morphology produced when cationic lipids and, optionally, one or more additional lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. In some embodiments, lipid nanoparticles are included in formulations that can be used to deliver active agents or therapeutic agents, such as nucleic acids (e.g., mRNA), to a desired target site (e.g., cell, tissue, organ, tumor, etc.). In some embodiments, the lipid nanoparticles of the present disclosure contain nucleic acids. Such lipid nanoparticles typically contain cationic lipids and one or more excipients, such as one or more neutral lipids, charged lipids, steroids, lipids conjugated with polymers, or combinations thereof. In some embodiments, active agents or therapeutic agents, such as nucleic acids (e.g., mRNA), can be encapsulated in the lipid portion of the lipid nanoparticle, or in the aqueous space enveloped by part or all of the lipid portion of the lipid nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by the host organism's or cell's machinery, such as a harmful immune response. Nucleic acids (e.g., mRNA) or portions thereof can also be associated with and complexed to lipid nanoparticles. Lipid nanoparticles can include any lipid capable of forming particles having nucleic acids attached thereto or encapsulating one or more nucleic acids.

[0314] In some embodiments, the provided RNA molecules (e.g., saRNA, mRNA) can be formulated using LNPs. In some embodiments, the lipid nanoparticles can have an average diameter of about 1 to 500 nm. In some embodiments, the lipid nanoparticles can have an average diameter of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or at least 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, The particles have an average diameter of 5 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, at most, exactly at, or between any two of those values, and are substantially non-toxic. The term "average diameter" refers to the average hydrodynamic diameter of the particles as measured by dynamic laser light scattering (DLS) and data analysis using a so-called cumulant algorithm, which results in the so-called Z-average using the length dimension and the dimensionless polydispersity index (PI) (Koppel, D., J. Chem. Phys., 57, 1972, pp. 4814-4820, ISO 13321). Herein, the "average diameter," "diameter," or "size" of a particle is used synonymously with this value of the Z-average.

[0315] The LNPs described herein can exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or less. By way of example, the LNPs may exhibit a polydispersity index of at least, up to, exactly, or between any two of the values ​​of 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5. In some embodiments, the polydispersity index is calculated based on dynamic light scattering measurements by the so-called cumulant analysis mentioned in the definition of "average diameter." Under certain required conditions, this can be taken as a measure of the size distribution of an ensemble of nanoparticles.

[0316] In certain embodiments, nucleic acids (e.g., RNA molecules) are resistant to degradation by nucleases in aqueous solution when present in the provided LNPs. In some embodiments, the LNPs are liver-targeting lipid nanoparticles. In some embodiments, the LNPs are cationic lipid nanoparticles comprising one or more cationic lipids (e.g., those described herein). In some embodiments, cationic LNPs may comprise at least one cationic lipid, at least one lipid conjugated with a polymer, and at least one helper lipid (e.g., at least one neutral lipid).

[0317] In certain embodiments, the RNA solution and lipid preparation mixture or composition thereof may have, or may have at least about 1%, about 2%, about 3%, about 4%, or more of a non-lipid component such as a particular lipid, lipid type, or lipid-like material and / or cationic polymer, or an adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid, or other material disclosed herein or known to those of skill in the art. About 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, about 101%, about 102%, about 103%, about 104%, about 105%, about 106 7%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, approximately 55%, approximately 56%, approximately 57%, approximately 58%, approximately 59%, approximately 60%, approximately 61%, approximately 62%, approximately 63%, approximately 64%, approximately 65%, approximately 66%, approximately 67%, approximately 68% , about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, up to, exactly at, or between any two of, a particular lipid, lipid type, or non-lipid component such as a lipid-like material and / or cationic polymer, or an adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid, or other material disclosed herein or that would be known to one of skill in the art.

[0318] The LNPs described herein can be prepared using a wide variety of methods, including obtaining a colloid from at least one cationic or cationizable lipid or lipid-like material and / or at least one cationic polymer, and then mixing the colloid with nucleic acid to obtain nucleic acid particles. As used herein, the term "colloid" refers to a type of homogeneous mixture in which the dispersed particles do not settle. The insoluble particles in the mixture are microscopic and have a particle size of 1 to 1,000 nanometers. The mixture may be referred to as a colloid or colloidal suspension. In some cases, the term "colloid" refers only to the particles in the mixture, rather than the entire suspension.

[0319] For the preparation of colloids comprising at least one cationic or cationizable lipid or lipid-like material and / or at least one cationic polymer, methods customarily used for the use of liposome vesicles and appropriately adapted thereto can be applied herein.The most commonly used methods for preparing liposome vesicles share the following basic steps: (i) dissolving lipids in an organic solvent, (ii) drying the resulting solution, and (iii) hydrating the dried lipids (using various aqueous media).In the film hydration method, lipids are first dissolved in a suitable organic solvent and dried to obtain a thin film on the bottom of a flask.The resulting lipid film is hydrated using a suitable aqueous medium to produce a liposome dispersion.In addition, additional scale-down steps may also be included.

[0320] Reverse phase evaporation is an alternative method to film hydration for preparing liposomal vesicles, involving the formation of a water-in-oil emulsion between an aqueous phase and a lipid-containing organic phase. Brief sonication of this mixture is required to homogenize the system. Removal of the organic phase under reduced pressure results in a milky gel, which then becomes a liposomal suspension.

[0321] The term "ethanol injection technique" refers to a process in which an ethanol solution containing lipids is rapidly injected through a needle into an aqueous solution. This action disperses the lipids throughout the solution and promotes the formation of lipid structures, such as lipid vesicle formation, e.g., liposome formation. Generally, the RNA lipoplex particles described herein can be obtained by adding RNA to a colloidal liposome dispersion. In some embodiments, using the ethanol injection technique, such a colloidal liposome dispersion is formed as follows: an ethanol solution containing lipids, such as cationic lipids and additional lipids, is injected into an aqueous solution under stirring. In some embodiments, the RNA lipoplex particles described herein can be obtained without using an extrusion step.

[0322] The term "extrusion" or "extrusion" refers to the creation of particles with a fixed cross-sectional profile. In particular, it refers to the reduction in size of particles by forcing them through a filter with defined pores.

[0323] Other methods that have the characteristic of not using organic solvents may also be used in accordance with the present disclosure to prepare colloids.

[0324] In some embodiments, RNA encapsulated in LNPs can be produced by rapidly mixing an RNA solution (e.g., an RNA product solution) described herein with a lipid preparation (e.g., comprising at least one cationic lipid and optionally one or more other lipid components in an organic solvent) described herein under conditions that direct a sudden change in the solubility of the lipid components, driving the lipids toward self-assembly in the form of NPs. In some embodiments, suitable buffers include Tris, histidine, citrate, acetate, phosphate, or succinate. The pH of the liquid formulation is related to the pKa of the encapsulating agent (e.g., cationic lipid). The pH of the acidifying buffer can be at least half a pH lower than the pKa of the encapsulating agent (e.g., cationic lipid), and the pH of the final buffer can be at least half a pH higher than the pKa of the encapsulating agent (e.g., cationic lipid). In some embodiments, the properties of the cationic lipids are selected such that nascent particle formation occurs through association with the oppositely charged backbone of the nucleic acid (e.g., RNA). In this way, particles are formed around the nucleic acid that in some embodiments can result in, for example, much higher encapsulation efficiencies than would be achieved in the absence of an interaction between the nucleic acid and at least one of the lipid components.

[0325] In certain embodiments, when nucleic acid is present in lipid nanoparticles, it is resistant to degradation by nuclease in aqueous solution.Lipid nanoparticles containing nucleic acid and their preparation methods are described in, for example, U.S. Patent Publication Nos. 2004 / 0142025 and 2007 / 0042031, and PCT Publication Nos. WO2013 / 016058 and WO2013 / 086373, the complete disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0326] Some embodiments described herein relate to compositions, methods, and uses that contain multiple nucleic acid species, such as RNA species, for example, two, three, four, five, six, or even more. Within an LNP formulation, each nucleic acid species can be formulated separately as an individual LNP formulation. In this case, each individual LNP formulation contains one nucleic acid species. The individual LNP formulations can exist as separate entities, for example, in separate containers. Such formulations can be obtained by providing each nucleic acid species separately (typically each in the form of a nucleic acid-containing solution) with appropriate cationic or cationizable lipids or lipid-like materials and cationic polymers that allow for the formation of LNPs. Each particle, when formed (individual particulate formulation), exclusively contains the specific nucleic acid species provided.

[0327] In some embodiments, a composition, such as a pharmaceutical composition, comprises multiple individual LNP formulations. Each pharmaceutical composition is referred to as a mixed LNP formulation. A mixed LNP formulation according to the present invention can be obtained by separately forming the individual LNP formulations described above, followed by mixing the individual LNP formulations. The mixing step can result in a formulation comprising a mixed population of nucleic acid-containing LNPs. The individual LNP populations can be together in one container containing a mixed population of individual LNP formulations.

[0328] Alternatively, different nucleic acid species can be combined as a combined LNP formulation.This type of formulation can be obtained by providing a combined formulation (typically a combined solution) of different RNA species together with suitable cationic or cationizable lipid or lipid-like material and cationic polymer that allows LNP formation.In contrast to mixed LNP formulations, combined LNP formulations typically comprise LNPs that contain multiple RNA species.In combined LNP compositions, different RNA species typically exist together in a single particle.

[0329] A. Cationic polymer materials Given their high degree of chemical flexibility, polymeric materials are commonly used for nanoparticle-based delivery. Cationic materials are typically used to electrostatically condense negatively charged nucleic acids into nanoparticles. These positively charged groups often consist of amines that change their protonation state in the pH range of 5.5 to 7.5, which is thought to create an ionic imbalance that leads to endosomal rupture. Polymers such as poly-L-lysine, polyamidoamine, protamine, and polyethyleneimine, as well as naturally occurring polymers such as chitosan, have all been applied to nucleic acid delivery and are suitable as useful cationic materials in some embodiments herein. Furthermore, some investigators have synthesized polymeric materials specifically for nucleic acid delivery. In particular, poly(p-amino ester) has gained widespread use in nucleic acid delivery due to its ease of synthesis and biodegradability. In some embodiments, such synthetic materials may be suitable for use as cationic materials herein.

[0330] As used herein, "polymeric material" is given its ordinary meaning, e.g., a molecular structure comprising one or more repeating units (monomers) connected by covalent bonds. In some embodiments, all such repeating units may be identical. Alternatively, in some cases, multiple types of repeating units may be present within the polymeric material. In some cases, the polymeric material is biologically derived, e.g., a biopolymer such as a protein. In some cases, additional moieties, e.g., targeting moieties such as those described herein, may also be present in the polymeric material.

[0331] Those skilled in the art will recognize that when more than one type of repeat unit is present within a polymer (or polymer portion), the polymer (or polymer portion) is said to be a "copolymer." In some embodiments, a polymer (or polymer portion) utilized in accordance with the present disclosure may be a copolymer. The repeat units forming the copolymer may be arranged in any manner. For example, in some embodiments, the repeat units may be arranged in a random order. Alternatively or additionally, in some embodiments, the repeat units may be arranged in an alternating order, or as a "block" copolymer, for example, including one or more regions (e.g., first blocks) each including a first repeat unit and one or more regions (e.g., second blocks) each including a second repeat unit. A block copolymer may have two (diblock copolymer), three (triblock copolymer), or more distinct blocks.

[0332] In certain embodiments, the polymeric materials for use according to the present disclosure are biocompatible. Biocompatible materials typically do not cause significant cell death at moderate concentrations. In certain embodiments, the biocompatible materials are biodegradable, e.g., capable of chemically and / or biologically degrading in a physiological environment, such as within the body. In certain embodiments, the polymeric material may be or include protamine or a polyalkyleneimine, particularly protamine.

[0333] As those skilled in the art will recognize, the term "protamine" is often used to refer to any of a variety of relatively low molecular weight, strongly basic proteins that are rich in arginine and are found in the sperm cells of various animals (such as fish) in place of somatic histones, particularly in association with DNA. In particular, the term "protamine" is often used to refer to a protein found in fish sperm that is strongly basic, soluble in water, does not coagulate with heat, and yields primarily arginine upon hydrolysis. In purified form, they are used in long-acting formulations of insulin and to neutralize the anticoagulant effect of heparin.

[0334] In some aspects, the term "protamine" as used herein refers to a protamine amino acid sequence obtained or derived from a natural or biological source, including fragments thereof and / or multimeric forms of said amino acid sequence or fragments thereof, as well as (synthetic) polypeptides that are man-made, specifically designed for a particular purpose, and cannot be isolated from a native or biological source.

[0335] In some embodiments, the polyalkyleneimine comprises polyethyleneimine and / or polypropyleneimine. In some embodiments, the polyalkyleneimine is polyethyleneimine (PEI). In some embodiments, the polyalkyleneimine is a linear polyalkyleneimine, such as linear polyethyleneimine (PEI).

[0336] Cationic materials (e.g., polymeric materials such as polycationic polymers) contemplated for use herein include those that can electrostatically bind to nucleic acids. In some aspects, cationic polymeric materials contemplated for use herein include any cationic polymeric material with which nucleic acids can associate, for example, by forming a complex with the nucleic acid or by forming a vesicle in which the nucleic acid is entrapped or encapsulated.

[0337] In some embodiments, the particles described herein can include polymers other than cationic polymers, such as non-cationic and / or anionic polymeric materials. Together, anionic and neutral polymeric materials are referred to herein as non-cationic polymeric materials.

[0338] B. Lipids and Lipid-Like Materials As used herein, the terms "lipid" and "lipid-like material" refer to molecules that contain one or more hydrophobic moieties or groups and may also contain one or more hydrophilic moieties or groups. According to the present disclosure, lipids and lipid-like materials can be cationic, anionic, or neutral. Neutral lipids or lipid-like materials exist in an uncharged or neutral zwitterionic form at a selected pH.

[0339] The term "lipid" refers to a group of organic compounds characterized by being insoluble in water but soluble in many organic solvents. Generally, lipids can be classified into eight categories: fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides, sterol-containing metabolites such as sterol lipids and cholesterol, and prenol lipids. Examples of fatty acids include, but are not limited to, fatty acid esters and fatty acid amides. Examples of glycerolipids include, but are not limited to, glycosylglycerol and glycerophospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine). Examples of sphingolipids include, but are not limited to, ceramides, phosphosphingolipids (e.g., sphingomyelin, phosphocholine), and glycosphingolipids (e.g., cerebrosides, gangliosides). Examples of sterol lipids include, but are not limited to, cholesterol and its derivatives and tocopherol and its derivatives.

[0340] The term "lipid-like material," "lipid-like compound," or "lipid-like molecule" refers to a substance that is structurally and / or functionally related to lipids, but may not be considered a lipid in the strict sense. For example, this term includes compounds that can form amphiphilic layers, such as those present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment, and includes surfactants or synthetic compounds that have both hydrophilic and hydrophobic portions. Generally speaking, this term refers to molecules that contain hydrophilic and hydrophobic portions with various structural organizations that may or may not be similar to those of lipids.

[0341] In some embodiments, the RNA solution and lipid preparation mixture or composition thereof may include cationic lipids, neutral lipids, cholesterol, and / or lipids conjugated with polymers (e.g., polyethylene glycol) to form lipid nanoparticles that encase the RNA molecules. Thus, in some embodiments, the LNPs may include cationic lipids and one or more excipients, such as one or more neutral lipids, charged lipids, steroids or steroid analogs (e.g., cholesterol), lipids conjugated with polymers (e.g., PEG-lipids), or combinations thereof. In some embodiments, the LNPs encase or encapsulate nucleic acid molecules.

[0342] i. Cationic lipids Cationic or cationizable lipid or lipid-like material refers to lipid or lipid-like material that can be positively charged and can electrostatically bind with nucleic acid.As used herein, "cationic lipid" or "cationic lipid-like material" refers to lipid or lipid-like material that has a net positive charge.Cationic lipid or lipid-like material binds with negatively charged nucleic acid through electrostatic interaction.Generally, cationic lipid has a lipophilic part such as sterol, acyl chain, diacyl or more acyl chain, and the head group of lipid typically carries a positive charge.Exemplary cationic lipid includes one or more amine groups that carry a positive charge.Cationic lipid can encapsulate negatively charged RNA.

[0343] In some embodiments, cationic lipid can be ionized, so that it can exist in positively charged or neutral form depending on pH.The ionization of cationic lipid affects the surface charge of lipid nanoparticles under various pH conditions.Without wishing to be bound by theory, it is believed that this ionizable behavior enhances efficacy by helping endosomal escape and reducing toxicity compared with particles that remain cationic at physiological pH.For the purpose of the present disclosure, such " cationizable " lipid or lipid-like material is included by the term " cationic lipid " or " cationic lipid-like material ", unless otherwise contradicted by the context.

[0344] In some embodiments, the cationic lipids may comprise about 10 mol% to about 100 mol%, about 20 mol% to about 100 mol%, about 30 mol% to about 100 mol%, about 40 mol% to about 100 mol%, or about 50 mol% to about 100 mol% of the total lipid present in the particle. In some embodiments, the cationic lipids may comprise at least 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol% of the total lipid present in the particle, or any range or value derivable therein, up to, exactly at, or between any two of those values.

[0345] Examples of cationic lipids include, but are not limited to, ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecyl methyl ester (DMSO ... Tadecylammonium (DDAB), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1,2-diacyloxy-3-dimethylammonium propane, 1,2-dialkyloxy-3-dimethylammonium propane, dioctadecyldimethylammonium chloride (DODAC), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), 1,2-dimyristoyl-sn-glycero-3 -ethylphosphocholine (DMEPC), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), and 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA ... Pan (DLenDMA), dioctadecylamidoglycylspermine (DOGS, 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane (CLinDMA), 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',12'-octadecadienooxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-Dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-Dilinoleyl-4-dimethylaminomethyl -[1,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DM A), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyloxy)-1-propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)-1-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (GAP-DM RIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (bAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propanaminium (DOBAQ), 2-({8-[(3b)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), 1,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), 1,2-Dipalmitoyl-3-dimethylammonium-propane (DPDAP), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropan-1-ammonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-ammonium bromide (DORIE), di((Z)-non-2-en-1-yl)8,8'-((((2(dimethylamino)ethyl)thio)carbonyl )azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-amine (DMDMA), di((Z)-non-2-en-1-yl)-9-((4-(dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-dodecyl -3-((2-dodecylcarbamoyl-ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}-ethylamino)propionamide (Lipidoid 98N12-5), 1-[2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2 hydroxydodecyl)amino]ethyl]piperazin-1-yl]ethyl]amino]dodecan-2-ol (Lipidoid 02-200), or heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102).

[0346] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids. In one embodiment, the lipid nanoparticles comprise (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), having the following formula:

[0347] [ka] Cationic lipids are disclosed, for example, in US Pat. No. 10,166,298, the complete disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0348] In some embodiments, RNA-LNPs comprise cationic lipids, RNA molecules as described herein, and one or more of neutral lipids, steroids, PEGylated lipids, or combinations thereof.When multiple cationic lipids are incorporated into LNPs, these percentages apply to the total cationic lipids.In one embodiment, each cationic lipid is present in LNPs at least about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mole percent, or at most, exactly, or between any two of these values.

[0349] In some embodiments of the present disclosure, the LNPs comprise a combination or mixture of any of the lipids described above.

[0350] ii. Polymer-conjugated lipids In some embodiments, the LNP comprises a lipid conjugated to a polymer. The term "polymer-conjugated lipid" refers to a molecule comprising both a lipid portion and a polymer portion. One example of a polymer-conjugated lipid is a pegylated lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art and include 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-s-DMG), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and the like.

[0351] In certain embodiments, the LNP comprises an additional stabilizing lipid that is a polyethylene glycol-lipid (pegylated lipid). A polymer-conjugated lipid (e.g., a PEG-lipid) refers to a molecule that contains both a lipid portion and a polymer portion. An example of a polymer-conjugated lipid is a PEG-lipid. A PEG-lipid refers to a molecule that contains both a lipid portion and a polyethylene glycol portion. PEG-lipids include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol. Representative polyethylene glycol-lipids include PEG-c-DOMG, PEG-c-DMA, and PEG-s-DMG. In one embodiment, the polyethylene glycol-lipid is N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxylpropyl-3-amine (PEG-c-DMA). In one embodiment, the polyethylene glycol-lipid is PEG-2000-DMG. In one embodiment, the polyethylene glycol-lipid is PEG-c-DOMG. In other embodiments, the LNP comprises a PEGylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), a PEG succinate diacylglycerol (PEG-s-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-s-DMG), a PEGylated ceramide (PEG-cer), or a PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecaneoxy)propyl)carbamate or 2,3-di(tetradecaneoxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate.PEG-lipids are disclosed, for example, in US Pat. No. 9,737,619, the complete disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0352] In some embodiments, the lipid nanoparticles comprise a lipid conjugated to a polymer. In one embodiment, the lipid nanoparticles comprise 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), having the following formula:

[0353] [ka]

[0354] In various embodiments, the molar ratio of cationic lipid to pegylated lipid is from about 100:1 to about 20:1, e.g., about 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1, or 100:1, or any range or value derivable therein.

[0355] In certain embodiments, the PEG-lipid is present in the LNP in an amount of about 1 to about 10 mole percent (mol%) (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mole%, up to, exactly at, or between any two of those values) relative to the total lipid content of the nanoparticle.

[0356] iii. Additional lipids In certain embodiments, LNPs comprise one or more additional lipids or lipid-like materials that stabilize the particle during its formation.Suitable stabilizing or structural lipids include non-cationic lipids, such as neutral lipids and anionic lipids.Without being bound by any theory, optimizing the formulation of LNPs by adding other hydrophobic moieties, such as cholesterol and lipids, in addition to ionizable / cationic lipids or lipid-like materials, can enhance particle stability and the effectiveness of nucleic acid delivery.

[0357] As used herein, "anionic lipid" refers to any lipid that is negatively charged at a selected pH. The term "neutral lipid" refers to any one of several lipid species that exist in either uncharged or neutral zwitterionic form at physiological pH. In some embodiments, the additional lipid comprises one of the following neutral lipid components: (1) phospholipid, (2) cholesterol or its derivative, or (3) a mixture of phospholipid and cholesterol or its derivative.

[0358] Representative neutral lipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, ceramide, sphingomyelin, dihydro-sphingomyelin, cephalin, and cerebrosides. Exemplary phospholipids include, for example, phosphatidylcholines, such as diacylphosphatidylcholines, e.g., distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphosphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), and 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), and phosphatidylethanolamines, such as diacylphosphatidylethanolamines, for example, dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), Examples of neutral lipids include dilauroyl-phosphatidylethanolamine (DLPE), distearoyl-phosphatidylethanolamine (DSPE), iphytanoyl-phosphatidylethanolamine (DpyPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanolamine (SOPE), and 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) having the following formula:

[0359] [ka]

[0360] In some embodiments, the LNP comprises a neutral lipid, wherein the neutral lipid comprises one or more of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, or SM.

[0361] In various embodiments, the LNP further comprises a steroid or steroid analog. A "steroid" is a compound that contains the following carbon skeleton:

[0362] [ka] In certain embodiments, the steroid or steroid analog is cholesterol. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol, and derivatives thereof, and mixtures thereof. In one embodiment, cholesterol has the formula:

[0363] [ka]

[0364] Without being bound by any theory, the amount of at least one cationic lipid relative to the amount of at least one additional lipid can affect important nucleic acid particle characteristics, such as nucleic acid charge, particle size, stability, tissue selectivity, and biological activity. Thus, in some embodiments, the molar ratio of cationic lipid to neutral lipid ranges from about 2:1 to about 8:1, or from about 10:0 to about 1:9, from about 4:1 to about 1:2, or from about 3:1 to about 1:1.

[0365] In some embodiments, non-cationic lipids, e.g., neutral lipids (e.g., one or more phospholipids and / or cholesterol), can comprise from about 0 mol% to about 90 mol%, about 0 mol% to about 80 mol%, about 0 mol% to about 70 mol%, about 0 mol% to about 60 mol%, or about 0 mol% to about 50 mol% of the total lipid present in the particle. In some embodiments, non-cationic lipids, e.g., neutral lipids (e.g., one or more phospholipids and / or cholesterol), can comprise at least 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol%, of the total lipid present in the particle, up to, exactly at, or between any two of these values.

[0366] VI. RNA Molecular Characterization and Analysis The RNA molecules described herein can be analyzed and characterized using various methods. Analysis can be performed before or after capping. Alternatively, analysis can be performed before or after affinity purification based on polyA capture. In another embodiment, analysis can be performed before or after additional purification steps, such as anion exchange chromatography. For example, the quality of the RNA template can be determined using a Bioanalyzer chip-based electrophoresis system. In other embodiments, the purity of the RNA template is analyzed using analytical reverse-phase HPLC, respectively. Capping efficiency can be analyzed, for example, using total nuclease digestion followed by MS / MS quantification of dinucleotide-capped species versus uncapped GTP species. In vitro efficacy can be analyzed, for example, by transfecting the RNA molecules into human cell lines. Protein expression of the polypeptide of interest can be quantified using methods such as ELISA or flow cytometry. Immunogenicity can be analyzed, for example, by transfecting the RNA molecules into cell lines that exhibit innate immune stimulation, such as PBMCs. Cytokine induction may be analyzed, for example, using methods such as ELISA to quantify cytokines, for example interferon-α. Biodistribution may be analyzed, for example, by bioluminescence measurements.

[0367] In some aspects, the RNA polynucleotides disclosed herein are characterized by observing, when evaluated in an organism to which a composition or pharmaceutical preparation comprising the RNA polynucleotide has been administered, elevated expression of a gene of interest (e.g., an antigen), increased duration of expression (e.g., prolonged expression) of the gene of interest (e.g., an antigen), elevated expression and increased duration of expression (e.g., prolonged expression) of the gene of interest (e.g., an antigen), decreased interaction of the RNA polynucleotide with IFIT1, or increased translation of the RNA polynucleotide, as compared to a suitable reference.

[0368] In some embodiments, the reference includes an organism administered an otherwise similar RNA polynucleotide without the m7(3'OMeG)(5')ppp(5')(2'OMeAi)pG2 cap. In some embodiments, the reference includes an organism administered an otherwise similar RNA polynucleotide without the cap-proximal sequence disclosed herein. In some embodiments, the reference includes an organism administered an otherwise similar RNA polynucleotide without the self-hybridizing sequence.

[0369] In some embodiments, elevated expression is determined at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression is determined at least 24 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression is determined at least 48 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression is determined at least 72 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression is determined at least 96 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression is determined at least 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide.

[0370] In some embodiments, elevated expression is determined about 24-120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide, hi some embodiments, elevated expression is determined about 24-110 hours, about 24-100 hours, about 24-90 hours, about 24-80 hours, about 24-70 hours, about 24-60 hours, about 24-50 hours, about 24-40 hours, about 24-30 hours, about 30-120 hours, about 40-120 hours, about 50-120 hours, about 60-120 hours, about 70-120 hours, about 80-120 hours, about 90-120 hours, about 100-120 hours, or about 110-120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide.

[0371] In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 2-fold to at least 10-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 2-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 3-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 4-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 6-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 8-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 10-fold.

[0372] In some embodiments, the increased expression of the gene of interest (e.g., antigen) is about 2-fold to about 50-fold. In some embodiments, the increased expression of the gene of interest (e.g., antigen) is about 2-fold to about 45-fold, about 2-fold to about 40-fold, about 2-fold to about 30-fold, about 2-fold to about 25-fold, about 2-fold to about 20-fold, about 2-fold to about 15-fold, about 2-fold to about 10-fold, about 2-fold to about 8-fold, about 2-fold to about 5-fold, about 5-fold to about 50-fold, about 10-fold to about 50-fold, about 15-fold to about 50-fold, about 20-fold to about 50-fold, about 25-fold to about 50-fold, about 30-fold to about 50-fold, about 40-fold to about 50-fold, or about 45-fold to about 50-fold. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold, 48-fold, 49-fold, or 50-fold, or any range or value inducible therein, up to, exactly at, or between any two of those values.

[0373] In some embodiments, elevated expression (e.g., increased duration of expression) of the gene of interest (e.g., antigen) persists for at least 24 hours, 48 ​​hours, 72 hours, 96 hours, or 120 hours, up to, exactly at, or between any two of those values, following administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, elevated expression of the gene of interest (e.g., antigen) persists for at least 24 hours following administration. In some embodiments, elevated expression of the gene of interest (e.g., antigen) persists for at least 48 hours following administration. In some embodiments, elevated expression of the gene of interest (e.g., antigen) persists for at least 72 hours following administration. In some embodiments, elevated expression of the gene of interest (e.g., antigen) persists for at least 96 hours following administration. In some embodiments, elevated expression of the gene of interest (e.g., antigen) persists for at least 120 hours following administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide.

[0374] In some embodiments, elevated expression of a gene of interest (e.g., an antigen) persists for about 24-120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide, hi some embodiments, elevated expression persists for about 24-110 hours, about 24-100 hours, about 24-90 hours, about 24-80 hours, about 24-70 hours, about 24-60 hours, about 24-50 hours, about 24-40 hours, about 24-30 hours, about 30-120 hours, about 40-120 hours, about 50-120 hours, about 60-120 hours, about 70-120 hours, about 80-120 hours, about 90-120 hours, about 100-120 hours, or about 110-120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the elevated expression of the gene of interest (e.g., antigen) persists for at least 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, or 120 hours, or any range or value inducible therein, up to those values, exactly those values, or between any two of those values.

[0375] VII. Immune Responses and Assays As described herein, the present disclosure relates to eliciting or inducing an immune response in a human subject against a VZV protein, such as a wild-type or mutant VZV glycoprotein. In one aspect, the immune response can protect against or treat a human subject having, suspected of having, or at risk of developing an infection or related disease, particularly one associated with VZV. One use of the immunogenic compositions of the present disclosure is to prevent VZV infection by inoculation or vaccination of a human subject.

[0376] A. Immunoassay The present disclosure includes the implementation of serological assays to assess whether and to what extent an immune response is induced or elicited by the compositions of the present disclosure. There are many types of immunoassays that can be implemented. Immunoassays encompassed by the present disclosure include, but are not limited to, those described in U.S. Patent No. 4,367,110 (double monoclonal antibody sandwich assay) and U.S. Patent No. 4,452,901 (Western blot). Other assays include immunoprecipitation and immunocytochemistry of labeled ligands, both in vitro and in vivo.

[0377] Immunoassays are generally binding assays. In some embodiments, immunoassays are various types of enzyme-linked immunosorbent assays (ELISAs) and radioimmunoassays (RIAs) known in the art. Immunohistochemical detection using tissue sections is also particularly useful. In one example, an antibody or antigen is immobilized on a selected surface, such as a well in a polystyrene microtiter plate, a dipstick, or a column support. A test composition suspected of containing the desired antigen or antibody, such as a clinical sample, is then added to the well. After binding and washing to remove nonspecifically bound immune complexes, the bound antigen or antibody can be detected. Detection is generally achieved by adding another antibody specific for the desired antigen or antibody and linked to a detectable label. This type of ELISA is known as a "sandwich ELISA." Detection can also be achieved by adding a second antibody specific for the desired antigen, followed by a third antibody linked to a detectable label that has binding affinity for the second antibody.

[0378] A possible implementation is competitive ELISA, in which a test sample competes for binding with a known amount of labeled antigen or antibody. The amount of reactive species in an unknown sample is determined by mixing the sample with a known labeled species before or during incubation with the coated well. The presence of reactive species in the sample reduces the amount of labeled species available for binding to the well, thus reducing the final signal. Regardless of the format used, ELISAs share certain features, such as coating, incubation or binding, washing to remove non-specifically bound species, and detection of bound immune complexes.

[0379] The antigen or antibody may also be linked to a solid support, such as a plate, bead, dipstick, membrane, or column matrix, and the sample to be analyzed is applied to the immobilized antigen or antibody. When coating a plate with either an antigen or antibody, the wells of the plate are generally incubated with a solution of the antigen or antibody, either overnight or for a specified period of time. The wells are then washed to remove incompletely adsorbed material. Any remaining available surface of the wells is then "coated" with a nonspecific protein that is antigenically neutral with respect to the test antiserum. These include bovine serum albumin (BSA), casein, and a powdered milk solution. The coating allows for blocking of nonspecific adsorption sites on the immobilizing surface, thus reducing the background caused by nonspecific binding of the antiserum to the surface.

[0380] B. Diagnosis of VZV infection The present disclosure contemplates the use of VZV polypeptides, proteins, and / or peptides in various methods, including detecting the presence of VZV to diagnose infectious diseases. According to the present disclosure, a method of detecting the presence of an infectious disease includes obtaining a sample from an individual suspected of being infected with one or more VZV strains, such as a sample taken from the individual's blood, saliva, tissue, bone, muscle, cartilage, or skin. Following isolation of the sample, a diagnostic assay utilizing the polypeptides, proteins, and / or peptides of the present disclosure may be performed to detect the presence of VZV; such assay techniques for determining such presence in a sample are well known to those skilled in the art and include methods such as radioimmunoassay, Western blot analysis, and ELISA assay.

[0381] Generally, in accordance with the present disclosure, methods of diagnosing infection are contemplated, in which a polypeptide, protein, or peptide in accordance with the present disclosure is added to a sample suspected of being infected with VZV, and VZV is indicated by antibody binding to the polypeptide, protein, and / or peptide, or binding of the polypeptide, protein, and / or peptide to an antibody in the sample.

[0382] Thus, RNA molecules encoding VZV polypeptides, proteins, and / or peptides in accordance with the present disclosure may be used to treat, prevent, or reduce the severity of disease from infection caused by VZV infection (e.g., active or passive immunization), or for use as research tools.

[0383] Any of the above-mentioned polypeptides, proteins, and / or peptides can be directly labeled with a detectable label for the identification and quantification of VZV. Labels for use in immunoassays are generally known to those skilled in the art and include enzymes, radioisotopes, and fluorescent, luminescent, and chromogenic substances, including colored particles such as colloidal gold or latex beads. Suitable immunoassays include enzyme-linked immunosorbent assays (ELISA).

[0384] C. Protective immunity In some embodiments of the present disclosure, RNA molecules encoding VZV polypeptides, RNA-LNPs, and compositions thereof confer protective immunity to human subjects. Protective immunity refers to the body's ability to mount a specific immune response that protects a human subject from developing a specific disease or condition, including a drug against which an immune response exists. An immunogenic effective amount can confer protective immunity to a human subject.

[0385] As used herein, the phrase "immune response" or its equivalent, "immunological response," refers to a humoral (antibody-mediated), cellular (mediated by antigen-specific T cells or their secretory products), or both humoral and cellular responses directed against an antigen. Such responses can be active or passive. A cellular immune response is elicited by the presentation of a polypeptide epitope in association with class I or class II MHC molecules, activating antigen-specific CD4(+) T helper cells and / or CD8(+) cytotoxic T cells. The response may also include activation of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglial cells, eosinophils, or other components of innate immunity. As used herein, "active immunity" refers to any immunity conferred on a human subject from the production of antibodies in response to the presence of an antigen, e.g., a VZV polypeptide encoded by an RNA molecule of the present disclosure.

[0386] As used herein, "passive immunization" includes the administration of activated immune effectors, including, but not limited to, cellular or protein mediators of the immune response (e.g., monoclonal and / or polyclonal antibodies). Monoclonal or polyclonal antibody compositions may be used in passive immunization to treat, prevent, or reduce the severity of disease caused by infection with an organism bearing the antigen recognized by the antibody. The antibody composition may contain antibodies that bind to various antigens, which in turn may be associated with various organisms. The antibody component may be a polyclonal antiserum. In certain embodiments, the antibody or antibodies are affinity purified from an animal or second subject immunized with the antigen. Alternatively, antibody mixtures may be used, which are mixtures of monoclonal and / or polyclonal antibodies against antigens present in the same, related, or different microorganisms or organisms, such as viruses, including, but not limited to, VZV.

[0387] Passive immunity can be conferred to a patient or human subject by administering to the patient immunoglobulins (Ig) and / or other immunological factors obtained from a donor or other non-patient source with known immunoreactivity. In other embodiments, the immunogenic compositions of the present disclosure may be administered to a human subject, who then serves as a source or donor of globulins ("hyperimmune globulins") produced in response to immunostimulation with an immunogenic composition containing antibodies directed against VZV or other organisms. A human subject so treated provides plasma from which hyperimmune globulins can then be obtained via conventional plasma fractionation methods and administered to another human subject to confer resistance to or treat VZV infection.

[0388] For purposes of this specification and the appended claims, the terms "epitope" and "antigenic determinant" are used interchangeably to refer to a site on an antigen to which B and / or T cells respond or recognize. B cell epitopes can be formed from either contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids typically survive exposure to denaturing solvents, while epitopes formed by tertiary folding are typically lost upon treatment with denaturing solvents. Epitopes typically contain at least three, more usually at least five, or 8-10 amino acids in a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, Epitope Mapping Protocols (1996). Antibodies that recognize the same epitope can be identified in a simple immunoassay demonstrating the ability of one antibody to block the binding of another antibody to a target antigen. T cells recognize continuous epitopes of approximately 9 amino acids for CD8 cells or approximately 13-15 amino acids for CD4 cells. T cells that recognize an epitope are expressed by primed T cells that have responded to the epitope. 3They can be identified by in vitro assays that measure 3H-thymidine incorporation (Burke et al., 1994), antigen-dependent killing (cytotoxic T lymphocyte assay, Tigges et al., 1996), or antigen-dependent proliferation as determined by cytokine secretion.

[0389] The presence of a cell-mediated immunological response can be determined by proliferation assays (CD4(+) T cells) or CTL (cytotoxic T lymphocyte) assays. The relative contribution of humoral and cellular responses to the protective or therapeutic effect of an immunogenic composition can be distinguished by separately isolating IgG and T cells from immunized syngeneic animals and measuring the protective or therapeutic effect in a second human subject.

[0390] As used herein, the terms "antibody" or "immunoglobulin" are used interchangeably and refer to any of several classes of structurally related proteins that function as part of an animal's or recipient's immune response, including IgG, IgD, IgE, IgA, IgM, and related proteins. Under normal physiological conditions, antibodies are found in plasma and other body fluids and in the membranes of certain cells and are produced by a type of lymphocyte designated B cells or their functional equivalents.

[0391] As used herein, the terms "immunogenic agent" or "immunogen" or "antigen" are used interchangeably to describe a molecule that is capable of inducing an immunological response against self when administered to a recipient either alone, in conjunction with an adjuvant, or presented on a display vehicle.

[0392] VIII. Composition In some embodiments, the RNA molecules and / or RNA-LNPs disclosed herein may be administered in pharmaceutical compositions or medicaments, and may be administered in the form of any suitable pharmaceutical composition. In some embodiments, the pharmaceutical composition is for therapeutic or prophylactic treatment. In one embodiment, the present disclosure relates to a composition for administration to a host. In some embodiments, the host is human. In other embodiments, the host is non-human.

[0393] In some embodiments, the RNA molecules and / or RNA-LNPs disclosed herein may be administered in pharmaceutical compositions that may be formulated into preparations in solid, semi-solid, liquid, lyophilized, frozen, or gaseous form. In some embodiments, the RNA molecules and / or RNA-LNPs disclosed herein may be administered in pharmaceutical compositions that may include a pharmaceutically acceptable carrier and may optionally include one or more adjuvants, stabilizers, salts, buffers, preservatives, and optionally other therapeutic agents. In some embodiments, the pharmaceutical compositions disclosed herein include one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In some embodiments, the pharmaceutical compositions do not include an adjuvant (e.g., they are adjuvant-free).

[0394] Suitable preservatives for use in the pharmaceutical compositions of the present disclosure include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens, and thimerosal.As used herein, the term "excipient" refers to a substance that may be present in the pharmaceutical compositions of the present disclosure but is not an active ingredient.Examples of excipients include, but are not limited to, carriers, binders, diluents, lubricants, thickeners, surfactants, preservatives, stabilizers, emulsifiers, buffers, flavorings, or coloring agents.

[0395] The term "diluent" refers to a diluent and / or thinning agent. Furthermore, the term "diluent" includes any one or more of a fluid, liquid, or solid suspension, and / or mixed medium. Examples of suitable diluents include ethanol, glycerol, saline, and water.

[0396] The term "carrier" refers to a component, which may be natural, synthetic, organic, or inorganic, with which the active component is combined to facilitate, enhance, or enable the administration of a pharmaceutical composition. As used herein, a carrier can be one or more compatible solid or liquid fillers, diluents, or encapsulating substances suitable for administration to a subject. Suitable carriers include, but are not limited to, sterile water, Ringer's, lactated Ringer's, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes, and in particular, biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxy-propylene copolymers. In some embodiments, the pharmaceutical composition of the present disclosure includes sodium chloride.

[0397] Pharmaceutically acceptable carriers, excipients, or diluents for therapeutic use are well known in the pharmaceutical art and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro, ed., 1985).

[0398] Pharmaceutical carriers, excipients, or diluents can be selected with regard to the intended route of administration and standard pharmaceutical practice.

[0399] In some embodiments, the composition comprises an RNA molecule comprising an open reading frame encoding an immunogenic polypeptide. In some embodiments, the immunogenic polypeptide comprises a VZV antigen. In some embodiments, the VZV antigen is a VZV polypeptide. In some embodiments, the VZV polypeptide is a VZV glycoprotein (e.g., gK, gN, gC, gB, gH, gM, gL, gI, and gE), or a fragment or variant thereof. In some embodiments, the RNA molecule encodes a VZV gK polypeptide, an RNA molecule encodes a VZV gN polypeptide, an RNA molecule encodes a VZV gC polypeptide, an RNA molecule encodes a VZV gB polypeptide, an RNA molecule encodes a VZV gH polypeptide, an RNA molecule encodes a VZV gM polypeptide, an RNA molecule encodes a VZV gL polypeptide, an RNA molecule encodes a VZV gI polypeptide, and / or an RNA molecule encodes a VZV gE polypeptide. In one embodiment, the RNA molecule encodes a VZV gE polypeptide. In some embodiments, the VZV polypeptide comprises two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, or more) VZV polypeptides.

[0400] In some embodiments, the composition comprises an RNA molecule comprising an open reading frame encoding a full-length VZV polypeptide. In some embodiments, the encoded immunogenic polypeptide is a truncated VZV polypeptide. In some embodiments, the encoded immunogenic polypeptide is a variant of a VZV polypeptide. In some embodiments, the encoded immunogenic polypeptide is a fragment of a VZV polypeptide.

[0401] A. Immunogenic Compositions Comprising LNPs In some embodiments, a pharmaceutical composition comprises an RNA molecule (e.g., a polynucleotide) disclosed herein formulated with a lipid-based delivery system. Thus, in some embodiments, the composition comprises a lipid-based delivery system (e.g., LNP) that delivers the nucleic acid molecule to the interior of a cell (e.g., a lipid-based vaccine), where it can then replicate, inhibit expression of a protein of interest, and / or express the encoded polypeptide of interest. The delivery system may have an adjuvant effect that enhances the immunogenicity of the encoded antigen. In some embodiments, the composition comprises at least one RNA molecule encoding a VZV polypeptide complexed with, encapsulated in, and / or formulated with one or more lipids to form a lipid nanoparticle (LNP), liposome, lipoplex, and / or nanoliposome. In some embodiments, the composition comprises a lipid nanoparticle. Thus, in certain embodiments, the present disclosure relates to a composition comprising one or more lipids associated with a nucleic acid or polypeptide / peptide (e.g., VZV RNA-LNP).

[0402] In some cases, the immunogenic composition comprising a lipid-based delivery system further comprises one or more salts, and / or one or more pharmaceutically acceptable surfactants, preservatives, carriers, diluents, and / or excipients. In some embodiments, the immunogenic composition comprising a lipid-based delivery system further comprises a pharmaceutically acceptable vehicle. In some embodiments, a buffer, a stabilizer, and optionally a salt may each be included in the immunogenic composition comprising a lipid-based delivery system. In other embodiments, any one or more of the buffer, stabilizer, salt, surfactant, preservative, and excipient may be excluded from the immunogenic composition comprising a lipid-based delivery system.

[0403] In a further embodiment, the immunogenic composition comprising a lipid-based delivery system further comprises a stabilizer. In some embodiments, the stabilizer comprises sucrose, mannose, sorbitol, raffinose, trehalose, mannitol, inositol, sodium chloride, arginine, lactose, hydroxyethyl starch, dextran, polyvinylpyrrolidone, glycine, or a combination thereof. In some embodiments, the stabilizer is a disaccharide or sugar. In one embodiment, the stabilizer is sucrose. In another embodiment, the stabilizer is trehalose. In a further embodiment, the stabilizer is a combination of sucrose and trehalose. In some embodiments, the total concentration of the stabilizer in the composition is about 5% to about 10% w / v. For example, the total concentration of stabilizer(s) can be at least equal to, can be up to, can be exactly at, or can be between any two of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% w / v, or any range or value derivable therein. In some embodiments, the concentration of the stabilizer includes, but is not limited to, about 10 mg / mL to about 400 mg / mL, about 100 mg / mL to about 200 mg / mL, about 100 mg / mL to about 150 mg / mL, about 100 mg / mL to about 140 mg / mL, about 100 mg / mL to about 130 mg / mL, about 100 mg / mL to about 120 mg / mL, about 100 mg / mL to about 110 mg / mL, or about 100 mg / mL to about 105 mg / mL. In some embodiments, the concentration of the stabilizer is at least equal to, up to, exactly at, or between any two of 10 mg / mL, 20 mg / mL, 50 mg / mL, 100 mg / mL, 101 mg / mL, 102 mg / mL, 103 mg / mL, 104 mg / mL, 105 mg / mL, 106 mg / mL, 107 mg / mL, 108 mg / mL, 109 mg / mL, 110 mg / mL, 150 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, or more.

[0404] In a further embodiment, the total amount of stabilizer to the total amount of RNA is in a specific ratio. In one embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 5,000. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 2,000. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 1,000. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 500. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 100. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 1. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 0.5. In another embodiment, the ratio of the total amount of stabilizer to the total amount of RNA does not exceed 0.1. In another embodiment, the stabilizer and RNA comprise a mass ratio of stabilizer:RNA of about 200-2,000 to 1.

[0405] In some aspects, the immunogenic composition comprising a lipid-based delivery system further comprises a buffering agent. Examples of buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, Tris hydrochloride (HCl), amino-sulfonic acid buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof. In some embodiments, the buffer is a HEPES buffer, a Tris buffer, or a PBS buffer. In one embodiment, the buffer is a Tris buffer. In another embodiment, the buffer is a HEPES buffer. In a further embodiment, the buffer is a PBS buffer. For example, the concentration of the buffer can be at least equal to, up to, exactly at, or between any two of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, or 20 mM, or any range or value derivable therein. The buffer can be neutral pH, pH 6.5-8.5, pH 7.0-8.0, or pH 7.2-7.6.For example, the buffer can be at least pH 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, or 8.5, or any range or value derivable therein, up to, exactly at, or between any two of those values. In certain embodiments, the buffer is pH 7.4.

[0406] In some embodiments, the immunogenic composition comprising a lipid-based delivery system may further comprise a salt. Examples of salts include, but are not limited to, sodium salts and / or potassium salts. In one embodiment, the salt is a sodium salt. In a specific embodiment, the sodium salt is sodium chloride. In one embodiment, the salt is a potassium salt. In some embodiments, the potassium salt comprises potassium chloride. The concentration of the salt in the composition may be from about 70 mM to about 140 mM. For example, the salt concentration may be at least equal to, at most, exactly equal to, or between any two of 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 120 mM, 130 mM, 140 mM, 150 mM, 160 mM, 170 mM, 180 mM, 190 mM, or 200 mM.

[0407] In some embodiments, the salt concentration includes, but is not limited to, about 1 mg / mL to about 100 mg / mL, about 1 mg / mL to about 50 mg / mL, about 1 mg / mL to about 40 mg / mL, about 1 mg / mL to about 30 mg / mL, about 1 mg / mL to about 20 mg / mL, about 1 mg / mL to about 10 mg / mL, or about 1 mg / mL to about 15 mg / mL. In some embodiments, the concentration of the salt is at least equal to, up to, exactly at, or between any two of 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, 15 mg / mL, 16 mg / mL, 17 mg / mL, 18 mg / mL, 19 mg / mL, 20 mg / mL, or more. The salt may be at a neutral pH, a pH of 6.5-8.5, a pH of 7.0-8.0, or a pH of 7.2-7.6. For example, the salt can be at a pH that is at least equal to, up to, exactly at, or between any two of 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, or 8.5.

[0408] In some embodiments, the immunogenic composition comprising a lipid-based delivery system further comprises a surfactant, a preservative, any other excipient, or a combination thereof. As used herein, "any other excipient" includes, but is not limited to, antioxidants, glutathione, EDTA, methionine, desferal, antioxidants, metal scavengers, or free radical scavengers. In one embodiment, the surfactant, preservative, excipient, or a combination thereof is sterile water for injection (sWFI), bacteriostatic water for injection (BWFI), saline, dextrose solution, polysorbate, poloxamer, Triton, divalent cations, lactated Ringer's, amino acids, sugars, polyols, polymers, or cyclodextrin.

[0409] Examples of excipients, which refer to ingredients in an immunogenic composition that are not the active ingredient, include, but are not limited to, carriers, binders, diluents, lubricants, thickeners, surfactants, preservatives, stabilizers, emulsifiers, buffers, flavorings, disintegrants, coatings, plasticizers, compression agents, wet granulation agents, or colorants. Preservatives for use in the compositions disclosed herein include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens, and thimerosal. As used herein, "pharmaceutically acceptable carriers" includes any and all aqueous solvents (e.g., water, alcoholic / aqueous solutions, saline, parenteral vehicles such as sodium chloride, Ringer's dextrose, and the like), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters such as ethyl oleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, antioxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavorings, dyes, fluid and nutrient replenishers, and combinations of such similar materials as would be known to one of ordinary skill in the art. Diluents, or diluents or thinning agents, include, but are not limited to, ethanol, glycerol, water, sugars such as lactose, sucrose, mannitol, and sorbitol, starches derived from wheat, corn, rice, and potato, and celluloses such as microcrystalline cellulose. The amount of diluent in the composition can range from about 10% to about 90% by weight, from about 25% to about 75%, from about 30% to about 60% by weight, or from about 12% to about 60% of the total composition.

[0410] The pH and precise concentration of various components in the immunogenic composition, comprising lipid-based delivery system, are adjusted according to well-known parameters.The use of such media and agents for pharmaceutically active substances is well known in the art.As long as any conventional media or agent is not incompatible with active ingredient, it can be contemplated to be used in immunogenic, preventive and / or therapeutic compositions.

[0411] In one embodiment, the pharmaceutical composition comprises a VZV RNA molecule encoding a VZV polypeptide disclosed herein, complexed with, encapsulated in, and / or combined with one or more lipids to form a VZV RNA-LNP. In some embodiments, the VZV RNA-LNP composition is liquid. In some embodiments, the VZV RNA-LNP composition is frozen. In some embodiments, the VZV RNA-LNP composition is lyophilized. In some embodiments, the VZV RNA-LNP composition comprises a VZV RNA polynucleotide molecule encoding a VZV polypeptide disclosed herein, encapsulated in a LNP using a lipid composition of a cationic lipid, a PEGylated lipid (i.e., a PEG-lipid), and one or more structural lipids (e.g., a neutral lipid).

[0412] In some embodiments, the VZV RNA-LNP composition comprises a cationic lipid. The cationic lipid can include any one or more of the cationic lipids disclosed herein. In certain embodiments, the cationic lipid comprises ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315). In some embodiments, the cationic lipid (e.g., ALC-0315) has a carboxyl group of at least 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0. 36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0 .79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12,...

Claims

1. A method for inducing an immune response to varicella-zoster virus (VZV) in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

2. A method for preventing, treating, ameliorating, and / or reducing the risk of a VZV-associated infection, disease, or condition in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

3. A method for preventing shingles in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

4. A method for preventing post-herpetic neuralgia in a human subject, comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE antibodies are induced in the subject.

5. 5. The method of any one of claims 1 to 4, wherein the geometric mean concentration (GMC) of VZV gE antibodies in the subject about one month after the first dose is higher than the GMC of VZV gE antibodies in the subject at baseline.

6. 6. The method of any one of claims 1 to 5, wherein the GMC of VZV gE antibodies in the subject about one month after the first dose is at least 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000 mIU / mL, or higher.

7. 7. The method of any one of claims 1 to 6, wherein a dose response is observed in the subject about one month after the first dose.

8. 8. The method of any one of claims 1 to 7, wherein the GMC of VZV gE antibodies in the subject about one month after the first dose is at least 5x, 10x, 15x, 20x, 25x, 30x, 35x, or 40x higher than baseline.

9. 9. The method of any one of claims 1 to 8, wherein the percentage of subjects having at least a 4-fold increase in GMC about one month after the first dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

10. 10. The method of any one of claims 1 to 9, wherein the geometric mean fold rise (GMFR) of VZV gE antibodies about one month after the first dose is at least 15, 20, 25, 30, 35, or 40, or higher.

11. 11. The method of any one of claims 1 to 10, wherein the second dose is administered after the first dose.

12. 12. The method of any one of claims 1 to 11, wherein the second dose is administered about 2 months or 6 months after the first dose.

13. 13. The method of any one of claims 1 to 12, wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is higher than the GMC of antibodies in the subject at baseline and one month after the first dose.

14. 14. The method of any one of claims 1 to 13, wherein the GMC of VZV gE antibodies in the subject one month after the second dose is at least 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, 100,000, 105,000, 110,000, or 115,000 mIU / mL, or higher.

15. 15. The method of any one of claims 1 to 14, wherein a dose response is observed in the subject about one month after the second dose.

16. 16. The method of any one of claims 1 to 15, wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is at least 5x, 10x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, or 60x higher than baseline.

17. 17. The method of any one of claims 1 to 16, wherein the percentage of subjects having at least a 4-fold increase in GMC about one month after the second dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

18. 18. The method of any one of claims 1 to 17, wherein the geometric mean fold rise (GMFR) of VZV gE antibodies about one month after the second dose is at least 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75, or higher.

19. 19. The method of any one of claims 1-18, wherein the GMC of VZV gE antibodies in the subject about one month after the first dose is about 1.1x, 1.2x, 1.3x, or 1.4x higher than the GMC of VZV gE antibodies in a human subject about one month after the first dose of SHINGRIX®.

20. 20. The method of any one of claims 1-19, wherein the GMC of VZV gE antibodies in the subject about one month after the second dose is about 1.1x higher than the GMC of VZV gE antibodies in a human subject about one month after the second dose of SHINGRIX®.

21. 21. The method of any one of claims 1-20, wherein the GMFR at about one month after the first dose is about 1.1x, 1.2x, or 1.3x higher than the GMFR of a human subject at one month after the first dose of SHINGRIX®.

22. 22. The method of any one of claims 1-21, wherein the GMFR at about one month after the second dose is about 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, or 1.9x higher than the GMFR of a human subject at one month after the second dose of SHINGRIX®.

23. 23. The method of any one of claims 1-22, wherein the GMFR at about one month after the first dose is similar to the GMFR of a human subject at one month after the second dose of SHINGRIX®.

24. 24. The method of any one of claims 1 to 23, wherein the immunogenic composition is administered in a single dose or a two-dose schedule.

25. 25. The method of any one of claims 1 to 24, wherein the immunogenic composition is administered at a dose ranging from about 1 μg to 100 μg or more per administration.

26. 26. The method of any one of claims 1 to 25, wherein the immunogenic composition is administered at a dose of about 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or higher per administration.

27. 27. The method of any one of claims 1 to 26, wherein the human subject is an adult.

28. 28. The method of any one of claims 1 to 27, wherein the human subject is an adult 18 years of age or older, about 20 years of age or older, about 30 years of age or older, about 40 years of age or older, about 45 years of age or older, about 50 years of age or older, about 55 years of age or older, about 60 years of age or older, about 65 years of age or older, about 70 years of age or older.

29. 29. The method of any one of claims 1 to 28, wherein the immunogenic composition induces a VZV gE-binding antibody and / or a cell-mediated immune response.

30. 30. The method of any one of claims 1 to 29, wherein the immunogenic composition is administered as a vaccine.

31. 31. The method of any one of claims 1 to 30, wherein the immunogenic composition is administered by intramuscular injection.

32. 32. The method of any one of claims 1 to 31, wherein the immunogenic composition is lyophilized.

33. 33. The method of any one of claims 1 to 32, wherein the VZV gE polypeptide is full-length, a truncation, a fragment, or a variant thereof.

34. 34. The method of any one of claims 1 to 33, wherein the VZV gE polypeptide comprises at least one mutation.

35. 35. The method of any one of claims 1 to 34, wherein the VZV gE polypeptide has at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the amino acid sequences selected from SEQ ID NOs: 1-11.

36. 36. The method of any one of claims 1 to 35, wherein the VZV gE polypeptide is transcribed from a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from SEQ ID NOs: 12-145.

37. 37. The method of any one of claims 1 to 36, wherein the RNA molecule comprises a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from SEQ ID NOs: 146-279.

38. 38. The method of any one of claims 1 to 37, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146 to 279.

39. 39. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is localized to the trans-Golgi network (TGN).

40. 39. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is secreted.

41. 39. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is localized to the cell membrane.

42. 42. The method of any one of claims 1 to 41, wherein the RNA molecule comprises a 5' untranslated region (5'UTR) comprising a sequence selected from any one of SEQ ID NOs: 281, 312, or 313.

43. 43. The method of any one of claims 1 to 42, wherein the RNA molecule comprises a 3' untranslated region (3'UTR) comprising a sequence selected from any one of SEQ ID NOs: 284, 314, or 317.

44. 44. The method of any one of claims 1 to 43, wherein the RNA molecule comprises a poly-A tail comprising a sequence selected from any one of SEQ ID NOs: 287 or 315.

45. 45. The method of any one of claims 1 to 44, wherein the RNA molecule comprises a modified RNA in which uridine has been replaced by N1-methylpseudouridine (Ψ).

46. 46. ​​The method of any one of claims 1 to 45, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle (LNP).

47. 47. The method of claim 46, wherein the lipid nanoparticles comprise at least one of a cationic lipid, a PEGylated lipid, a neutral lipid, and a steroid or steroid analog.

48. 48. The method of claim 47, wherein the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

49. 48. The method of claim 47, wherein the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

50. 48. The method of claim 47, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

51. 48. The method of claim 47, wherein the steroid or steroid analog is cholesterol.

52. 52. The method of any one of claims 1 to 51, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule encodes a VZV gE polypeptide comprising any one of the amino acid sequences selected from SEQ ID NOs: 1 to 11.

53. 53. The method of any one of claims 1 to 52, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle, and the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146-279.