Dendritic cell-based vaccines and their uses
A dendritic cell-based vaccine activated with IL-15 and a p38 MAPK inhibitor, combined with immune checkpoint inhibitors, effectively remodels the tumor microenvironment and enhances immune response against ovarian and breast cancer, overcoming treatment resistance and improving survival.
Patent Information
- Application Number
- JP2025545814
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-07
- Filing Date
- 2024-02-07
- Publication Date
- 2026-02-17
AI Technical Summary
Current treatments for ovarian and breast cancer, such as immune checkpoint inhibitors, have shown limited success in preventing disease progression and recurrence, and there is a need for therapies that can harness the immune system more effectively.
Administering a dendritic cell-based vaccine, matured with IL-15 and a p38 MAPK inhibitor, pulsed with cancer antigens, to activate IL-17-secreting T cells, optionally combined with immune checkpoint inhibitors, to remodel the tumor microenvironment and enhance immune response.
The Th17 DC vaccine enhances tumor-specific immunity, sensitizes cancer to immune checkpoint blockade, and improves survival by overcoming resistance to ICB therapy, particularly through CD4 T cell activation and preventing IL-10-mediated adaptive resistance.
Smart Images

Figure 2026505662000003 
Figure 2026505662000004 
Figure 2026505662000005
Abstract
Description
[Technical Field]
[0001] REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 443,942, filed February 7, 2023. The disclosure of the prior application is considered part of (and incorporated by reference into) the disclosure of this application.
[0002] Statement Regarding Federally Sponsored Research This invention was made with government support under CA136393 awarded by the National Institutes of Health. The government has certain rights in this invention.
[0003] Array List This application contains a Sequence Listing that has been submitted electronically as an XML file entitled "07039-2177WO2_SL_ST26.xlm". The size of this XML file, created on February 7, 2024, is 15,842 bytes. The material within the XML file is hereby incorporated by reference in its entirety.
[0004] This document relates to methods and materials for treating cancer (e.g., ovarian cancer) using one or more vaccine compositions, optionally in combination with one or more immune checkpoint inhibitors, capable of activating T cells in a mammal to form activated IL-17-secreting T cells. [Background technology]
[0005] Ovarian cancer (OC) causes approximately 14,000 deaths annually in the United States (Siegel et al., CA Cancer J Clin, 69:7-34, 2019). Although significant advances in treatment have been made (e.g., PARP inhibitors, anti-VEGF antibodies, neoadjuvant chemotherapy, and hyperthermic intraperitoneal chemotherapy), disease progression is common and cure rates remain low (Ledermann, Lancet Oncol 20:470-472, 2019; Mirza et al., Ann Oncol 29:1366-1376, 2018; Killock, Nat Rev Clin Oncol 14:713, 2017; Dizon, Lancet 390:1929-1930, 2017; Colombo et al., Crit Rev Oncol Hematol 97:335-48, 2016; van Driel et al., N Engl J Med 378:1363-1364, 2018; and Wright et al., J Clin Oncol 34:3460-3473, 2018). 2016). The adaptive and innate immune systems are believed to be important for patient outcomes (Li et al., Oncotarget 8:15621-15631, 2017; Santoiemma and Powell, Cancer Biol Ther 16:807-820, 2015; Worzfeld et al., Front Oncol 7:24, 2017; Odunsi, Ann Oncol 28:viii1-viii7, 2017; and Turner et al., Gynecol Oncol 142:349-356, 2016). However, despite significant efforts, therapies designed to harness the immune system and prevent ovarian cancer progression have generally met with limited success. For example, clinical trials have tested immune checkpoint inhibitors (ICIs) alone or in combination with other agents, primarily in patients with recurrent disease, but overall response rates have been unremarkable. Summary of the Invention
[0006] This document provides methods and materials for treating cancer (e.g., ovarian or breast cancer). For example, this document provides methods and materials for administering to a mammal with cancer (e.g., ovarian or breast cancer) (a) one or more vaccine compositions capable of activating T cells in the mammal to form activated IL-17-secreting T cells, and, optionally, (b) one or more agents for immune checkpoint blockade (ICB, also referred to herein as immune checkpoint inhibitors or ICIs). As described herein, vaccine compositions can be designed to include dendritic cells (DCs) exposed to an IL-15 polypeptide and a p38 MAPK inhibitor and pulsed with one or more antigens (e.g., one or more antigens expressed by the cancer to be treated). Such vaccine compositions can be capable of activating T cells in the mammal to form activated IL-17-secreting T cells, and such activated IL-17-secreting T cells can be capable of recognizing one or more antigens expressed by the cancer. For convenience, (a) DCs matured by exposure to at least IL-15 and a p38 MAPK inhibitor may be referred to as Th17 DCs, (b) a vaccine composition comprising Th17 DCs and capable of activating T cells in a mammal to form activated IL-17-secreting T cells capable of recognizing one or more antigens expressed by the cancer being treated may be referred to as a Th17 DC vaccine, and (c) activated IL-17-secreting T cells may be referred to as Th17 T cells.
[0007] As demonstrated herein, Th17 DC vaccines can be generated to activate T cells to form activated IL-17-secreting T cells in vivo, remodel the immune microenvironment, and reduce the likelihood of cancer progression or recurrence. Th17 DC vaccines containing antigen-binding mouse DCs capable of activating Th17 T cells in mice were generated by stimulating the IL-15 pathway and simultaneously blocking the p38 MAPK pathway in otherwise normal bone marrow-derived DCs, followed by antigen pulsing with tumor cell lysate. Treatment of tumor-bearing mice with the Th17 DC vaccine resulted in increased levels of IL-17-producing T cells in the tumor microenvironment, remodeling the bone marrow microenvironment, and improving survival of tumor-bearing mice compared with treatment with a DC vaccine containing DCs not activated by IL-15 stimulation and p38 MAPK inhibition. Treatment of mice with the Th17 DC vaccine sensitized ovarian cancer to anti-PD-1 ICB treatment and prevented cytokine-mediated resistance, resulting in durable progression-free survival. Treatment of mice with Th17 DC vaccines also sensitized triple-negative breast cancer to anti-PD-1 ICB treatment and resulted in increased survival. The efficacy of Th17 DC vaccines alone or in combination with ICB for OC treatment was dependent on CD4 T cells but not on the production of the cytokine IL-17 or the induction of CD8 T cell infiltration. These results demonstrate that vaccination with Th17 DC vaccines can overcome resistance to ICB therapy in ovarian tumor-bearing mice by generating new tumor-specific immunity, remodeling the tumor immune microenvironment, and preventing the development of adaptive IL-10-mediated resistance. These results were surprising, particularly with regard to CD4 T cell activation and dependency, prevention of IL-10-mediated adaptive resistance, and the synergistic effect of combined treatment with Th17 DC vaccines and ICB.
[0008] The results presented herein demonstrate that biologically relevant immunomodulatory agents (such as Th17 DC vaccines) can be used in cancer treatment (e.g., the treatment of OC or breast cancer) to condition the tumor microenvironment for improved clinical response to ICB therapy. Having the ability to treat certain cancers (e.g., OC) that are typically treatment-resistant may provide clinicians with a more likely to be effective approach, thereby improving disease-free and / or overall survival and / or minimizing patient exposure to ineffective treatments.
[0009] In general, one aspect of this document features a method of treating a mammal with cancer. The method can include, or consist essentially of, administering to the mammal an effective amount of a vaccine composition capable of activating T cells in the mammal to form activated IL-17-secreting T cells capable of recognizing one or more antigens expressed by the cancer. The mammal can be a human. The cancer can be ovarian cancer, melanoma, chronic lymphocytic leukemia, gastric cancer, cervical cancer, colorectal cancer, breast cancer, or lung cancer. The vaccine composition can include dendritic cells (DCs) presenting one or more folate receptor alpha (FRα) antigens. The one or more FRα antigens can include one or more peptides having the amino acid sequence set forth in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:14. The method can include administering to the mammal approximately 5×10 6 From about 50 x 10 6The method may include administering a dose of the DC composition to the mammal. The method may include administering the vaccine composition to the mammal two or more times over a period of about two weeks to about sixteen weeks. The method may further include monitoring the mammal after the administering step to determine the efficacy of the vaccine composition in the mammal. The monitoring may include using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging. The monitoring may include measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after the administering step, wherein the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4. The method may further include administering to the mammal an effective amount of an immune checkpoint inhibitor (ICI). The ICI may be selected from the group consisting of pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, ipilimumab, and cemiplimab. The method may include administering to the mammal a dose of about 50 mg to about 1500 mg of the ICI. The method may include administering to the mammal two or more doses of the ICI over a period of about 2 weeks to about 16 weeks. The method may further include monitoring the mammal after the administering step to determine the effect of the vaccine composition and the ICI in the mammal. The monitoring may include using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging. The monitoring can include measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after the administering step, wherein the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4.
[0010] In another aspect, this document features a method of treating a mammal having cancer, the method comprising, or consisting essentially of: (a) administering to the mammal an effective amount of a vaccine composition capable of activating T cells in the mammal to form activated IL-17-secreting T cells capable of recognizing one or more antigens expressed by the cancer; and (b) administering to the mammal an effective amount of an immune checkpoint inhibitor (ICI). The mammal may be a human. The cancer may be ovarian cancer, melanoma, chronic lymphocytic leukemia, gastric cancer, cervical cancer, colorectal cancer, breast cancer, or lung cancer. The vaccine composition may comprise dendritic cells (DCs) presenting one or more folate receptor alpha (FRα) antigens. The one or more FRα antigens may comprise one or more peptides having the amino acid sequence set forth in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:14. The method comprises administering to the mammal approximately 5×10 6 From about 50 x 10 6 The method may include administering to the mammal a dose of the DC composition. The method may include administering the vaccine composition to the mammal two or more times over a period of about 2 weeks to about 16 weeks. The ICI may be selected from the group consisting of pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, ipilimumab, and cemiplimab. The method may include administering to the mammal a dose of the ICI from about 50 mg to about 1500 mg. The method may include administering to the mammal two or more times over a period of about 2 weeks to about 16 weeks. The method may further include monitoring the mammal after administering steps (a) and (b) to determine the effect of the vaccine composition and the ICI in the mammal. The monitoring may include using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging. The monitoring may include measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after administering steps (a) and (b), wherein the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4.
[0011] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described in this document can be used to practice the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this document are incorporated by reference in their entirety. In case of conflicts, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are merely illustrative and not intended to be limiting.
[0012] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]
[0013] [Figure 1A-1B] Figures 1A-1M show that IL-15 costimulation and p38 MAPK blockade selectively upregulate MHC class II and IFN-γ expression while suppressing IL-10 and IL-12 production. Figure 1A shows representative Western blots of phosphorylated ATF-2 and β-actin in DCs treated with IL-15 and SB203580 ("SB203580" in Figure 1A; also referred to herein as "Th17 DCs") or without IL-15 and SB203580 ("Control" in Figure 1A; also referred to herein as "cDCs"). Figure 1B is a graph plotting the average relative numbers of DCs generated using conventional DC maturation (cDCs) or Th17 DC maturation (n=3). [Figure 1C] Figure 1C is a graph plotting the mean (+s.e.m., n = 3-4) percentages of CD11C+ DCs for MHC class II, MHC class I, CD80, CD86, and OX40L positivity. DCs were prepared under cDC or Th17 DC conditions and pulsed with or without tumor lysate (Ag). [Figure 1D]FIG. 1D is a graph from FIG. 1C plotting relative mean (+sem, n=3-4) fluorescence intensity showing surface expression of MHC class II, MHC class I, CD80, CD86, and OX40L on cells. [Figures 1E-1F] Figures 1E-1J are boxplots (n = 4) showing cell culture supernatant concentrations of IL-10 (Figure 1E), IL-12 (Figure 1F), IFN-γ (Figure 1G), IL-6 (Figure 1H), IL-1β (Figure 1I), and TGF-β (Figure 1J) in cDC or DC stimulated under Th17 conditions with or without tumor cell lysate (Ag). Each symbol represents a unique replicate. P values above the lines and bars were calculated by one-way ANOVA followed by Tukey's multiple comparison test. [Figure 1G-1J] This is a continuation of Figures 1E-1F. [Figure 1K-1M] Figures 1K-1M are boxplots showing densitometric units derived from dot blots of IL-13 (Figure 1K), BAFF (Figure 1L), and LIX (Figure 1M) from three independent experiments (n = 6). P values were calculated using the Mann-Whitney test. Data shown represent a representative example of three independent experiments. [Figure 2A] Figures 2A-2B show that Th17 DCs increased MHC class II levels. Figure 2A contains density plots of MHC class II staining of mature CD11c DCs in the presence or absence of tumor antigen (Ag) under cDC or Th17 DC conditions. Numbers in the inset reflect the percentage of cells stained for both CD11c and MHC II. [Figure 2B] Figure 2B contains flow cytometry histograms (open histograms) of MHC I, CD80, CD86, and OX-40L. Staining of irrelevant antibodies is shown in black histograms. [Figure 3] Figure 3 shows that DCs matured under Th17-inducing conditions differ in the production of selected cytokines. The panels show heatmap summaries of cytokines detected by dot blotting from three independent experiments. P values were calculated using the Mann-Whitney test. [Figure 4] Figure 4 shows that Th17 DCs phagocytose antigen at a higher rate than cDCs. Bar graphs represent the mean (+sem, n=4) of PKH26-labeled cDCs or Th17 DCs after 24 hours of exposure to PKH26-labeled tumor cell lysates. [Figure 5A] Figures 5A-5E show that IL-15 costimulation and p38-MAPK blockade specifically enhance DC vaccine-induced IL-17+ T cell and high-avidity antibody production in vivo, in addition to IFN-γ+ and IL-4+ T cells. Figures 5A-5C include images of representative ELIspot wells and min / max boxplots representing the number of antigen-specific IFN-γ+ (Figure 5A), IL-4+ (Figure 5B), and IL-17+ (Figure 5C) T cells per million splenocytes after vaccination with PBS or tumor lysate antigen (Ag)-pulsed or unpulsed cDCs or Th17 DCs (n = 9-18). P values shown in Figures 5A-5C compare Ag+ DCs with Ag+ Th17 DCs. P values were calculated by one-way ANOVA followed by Tukey's multiple comparison test (Figures 5A-5C) or Fisher's LSD test (Figures 5D-5E). [Figure 5B] This is a continuation of Figure 5A. [Figure 5C] This is a continuation of Figure 5A. [Figure 5D-5E] Figures 5D-5E are min / max boxplots (n=12-18) showing the levels of total tumor antigen-specific IgG antibodies (Figure 5D) and higher avidity antigen-specific IgG antibodies (Figure 5E) in the blood. Results shown are from three independent experiments. Each symbol represents a unique replicate. [Figure 6A]Figures 6A-6F show that IL-15 costimulation and p38-MAPK blockade enhance DC vaccination for rapid generation of antigen-specific Th17 T cells in vitro and in vivo. Figures 6A and 6B include representative images of ELIspot wells and bar graphs plotting the mean (+s.e.m., n=3) number of antigen-specific IL-17 T cells / well 72 hours after in vitro DC vaccination (with or without SB203580 / IL-15 and tumor cell lysate (Ag)) at DC / spleen cell ratios of 1:2 (Figure 6A) and 1:1 (Figure 6B). [Figure 6B] This is a continuation of Figure 6A. [Figure 6C] Figure 6C includes representative images of IL-17 ELIspot assay wells and a bar graph depicting the mean (+sem, n=3) number of antigen-specific IL-17+ T cells per million splenocytes in mice immunized in vivo with or without SB / IL-15 and tumor cell lysate (Ag). [Figure 6D] Figure 6D includes representative images showing ELIspot wells and a bar graph plotting the mean (+sem, n=3) number of Th17 T cells per million CD4+ T cells isolated from the splenocytes shown in Figure 6C. [Figure 6E] Figure 6E shows min / max boxplots of IL-17 and IL-10 levels in the peripheral blood of tumor-bearing mice vaccinated with PBS, non-antigen-pulsed cDCs (cDCs), non-antigen Th17 DCs (Th17 DCs), antigen-pulsed cDCs (Ag+cDCs), or antigen-pulsed Th17 DCs (Ag+Th17 DCs) on day 42 after tumor challenge and vaccination with PBS, cDCs, or Th17 DCs pulsed with or without antigen (n=8). [Figure 6F]Figure 6F is a graph plotting IL-17 levels in the blood of tumor-bearing mice immunized in vivo with PBS or antigen-pulsed Th17 DC vaccines, without or with anti-CD4 or anti-CD8 antibodies to deplete CD4 or CD8 T cells, respectively. P values were calculated by one-way ANOVA followed by Tukey's multiple comparison test. [Figure 7] Figure 7 shows that Th17 DCs induce T cells to produce a unique cytokine profile compared with cDCs after stimulation with antigen-presenting cells. The panels show heatmap summaries of cytokines detected by dot blotting after cDC stimulation of purified CD4 T cells derived from splenocytes of mice immunized with PBS, antigen-pulsed cDCs, or antigen-pulsed Th17 DCs. Each box represents the median value of 6–8 replicates. Adjusted P values (two rightmost columns) were calculated using one-way ANOVA followed by Tukey's multiple comparison test. The median value of 0 is marked. [Figure 8A-8B] Figures 8A and 8B show that Th17-inducing vaccines eliminate shedding into the peritoneal cavity. Figures 8A-8B show representative immunohistochemistry (IHC) analyses of Ki67 (Figure 8A) or SP17 (Figure 8B) in peritoneal lavage fluids from tumor-bearing mice on day 42 immunized with PBS, non-antigen-pulsed cDCs (cDCs), non-antigen-pulsed Th17 DCs (Th17 DCs), antigen-pulsed cDCs (Ag+cDCs), and antigen-pulsed Th17 DCs (Ag+Th17 DCs). Brown spots indicate positive staining. The inset graphs in each panel show the mean (±s.e.m., n = 3-4) percentage of Ki-67+ or SP17+ cells plotted as a percentage of total cells. P values were calculated using an unpaired Student's t-test. [Figure 9A]Figures 9A-9I show that vaccination induces T cell infiltration into tumor tissue and extends the lifespan of ovarian cancer-bearing mice. Figure 9A shows Kaplan-Meier survival analysis of mice (n = 13-16 / group) immunized with PBS control, non-antigen-pulsed cDCs (cDCs), non-antigen-pulsed Th17-inducing DCs (Th17 DCs), antigen-pulsed cDCs (Ag+cDCs), or antigen-pulsed Th17 DCs (Ag+Th17 DCs). **P<0.01, ****P<0.0001. P values in Figures 9A, 9B, and 9I were calculated using the Mantel-Cox log-rank test. P values in Figures 9C-9H were calculated using one-way ANOVA followed by Fisher's LSD test. [Figure 9B-9C] Figure 9B shows Kaplan-Meier survival analysis of mice (n = 14–25 / group) immunized with PBS control or antigen-pulsed Th17 DCs (Ag+Th17 DCs) with or without depletion of CD4 (αCD4) or CD8 (αCD8) T cells. Figure 9C is a graph plotting the mean (±s.e.m., n = 6) levels of IL-17 in the ascites fluid of representative tumor-bearing mice at the time of sacrifice within the same groups shown in Figure 9A. [Figure 9D] FIG. 9D contains representative images showing IHC analysis of CD3, CD4, and CD8 in tumor tissues collected at sacrifice in mice treated with PBS, antigen-pulsed cDCs, or antigen-pulsed Th17 DCs. [Figures 9E-9G] Figures 9E-9G are min / max box plots representing the levels of CD3 (Figure 9E), CD4 (Figure 9F), and CD8 (Figure 9G) T cells per field analyzed. [Figure 9H] FIG. 9H contains min-max boxplots showing the levels of antigen-specific antibodies in blood and ascites (n=12-18). [Figure 9I] Figure 9I shows Kaplan-Meier survival analysis of wild-type (WT) or IL-17 knockout (KO) mice (n = 5–10 / group) immunized with PBS or antigen-pulsed Th17 DCs (Th17 DCs). [Figure 10]Figure 10 shows that ID8-SP17 tumor cells express MHC class II in vivo. Images show MHC class II staining of peritoneum-derived tumor cells obtained from mice immunized with antigen-loaded cDCs or Th17 DC vaccine. [Figure 11] Figure 11 shows that tumor-bearing mice vaccinated with Th17 DC vaccines generate sustained high-avidity antibody responses. The minimum / maximum box plots represent the levels of high-avidity antigen-specific antibodies in the blood and ascites from moribund mice (n = 12-18) that died of ovarian cancer. Inset P values (above plots) were calculated by one-way ANOVA followed by Fisher's LSD test. [Figures 12A-12B] Figures 12A and 12B show that Il17acre mice do not have a functional IL17A gene. Figure 12A is a representative image showing PCR products of DNA from Il17acre (mice 1-5) and B6 / J (mice 23-25) using mutant primers. Figure 12B is a representative image showing PCR products of the same mice using wild-type primers. [Figures 13A-13B] Figures 13A-13F show that Th17 DC vaccination synergizes with immune checkpoint blockade in a CD4 T cell-dependent manner. Figure 13A includes images showing PD-L1 staining of tumor cells from the peritoneal cavity on day 42. Figure 13B shows Kaplan-Meier curves comparing the survival of tumor-bearing mice (n = 8 / group) immunized with PBS, antigen-pulsed Th17 DC vaccine, anti-PD-1 (αPD-1), or a combination of anti-PD-1 and Th17 DC vaccine (* = P < 0.05). P values in Figures 13C and 13D were calculated by one-way ANOVA followed by Fisher's LSD test. P values in Figures 13B and 13F were calculated using the Mantel-Cox log-rank test. [Figure 13C] Figure 13C, similar to Figure 13B, shows min / max boxplots representing the levels of splenic antigen-specific IFN-γ+, IL-4+, and IL-17+ T cells at day 42 in tumor-bearing mice immunized and treated with αPD-1 (n=9-18). [Figures 13D-13E] Figure 13D is a graph plotting the levels of serum antibodies targeting tumor antigens on day 42. Figure 13E is a minimum / maximum box plot of IL-10 levels (pg / ml) in the ascites fluid of moribund mice (n=3-10) after treatment similar to that in Figure 13A. P values were calculated by unpaired Student's t-test. [Figure 13F] Figure 13F shows Kaplan-Meier curves comparing survival in tumor-bearing mice immunized with antigen-pulsed Th17 DC vaccines and treated with αPD-1 with or without anti-CD4 antibodies (n=5-15 / group). ** = p<0.01. [Figures 14A-14B] Figures 14A and 14B show that anti-PD-1 does not increase the avidity of antibodies induced by the Th17 DC vaccine. Figure 14A shows a min-max boxplot representing the levels of high-avidity antigen-specific antibodies in the blood on day 42 from ovarian cancer-bearing mice treated with PBS, anti-PD-1 (αPD-1), Th17 DC vaccine, or Th17 DC vaccine plus anti-PD-1 (n = 12). Figure 14B shows a min-max boxplot representing the % high-affinity tumor antigen-specific antibodies (n = 12). P values in Figure 14A were calculated using one-way ANOVA and Fisher's LSD post-hoc test. P values in Figure 14B were calculated using the Mann-Whitney test. [Figures 15A-15B] Figures 15A–15E show that Th17 DC vaccination alone or in combination results in the infiltration of CD4 T cell-driven macrophages and eosinophils into the peritoneal cavity of tumor-bearing mice. Figure 15A shows the minimum / maximum box plots representing the number of cells recovered from the peritoneal cavity on day 42 in mice immunized with PBS, Th17 DC vaccine, αPD-1, or the combination of Th17 DC vaccine and αPD-1 (n = 2–7 per group). NS = not significant, ** = p < 0.01 by Mann-Whitney test. Figure 15B shows the minimum / maximum box plots representing the distribution of peritoneal immune cells in the lymphocyte (lymphs), monocyte (DCs / MACs), and granulocyte (Gran) gates from mice treated as in Figure 15A (n = 4–6 per group). [Figure 15C] Figure 15C is a min / max box plot showing the relative levels of total and activated (CD69) CD4+ and CD8+ T cells, B cells, and NK cells in the lymphocyte gate at day 42 after treatment in mice described in Figure 15A (n = 4-6 / group). [Figure 15D] Figure 15D is a graph plotting the relative levels of CD11b+CD11c+ DCs, CD11b+F4 / 80+ macrophages (MACs), and CD11b+GR-1+ myeloid-derived suppressor cells (MDSCs) in the monocyte gate 42 days after treatment of mice described in Figure 15A (n=4-6 / group). [Figure 15E] Figure 15E is a graph plotting the relative levels of CD11b+Ly6G+ (neutrophils, Neut), CD11b+CD193+SiglecF+ (eosinophils, Eosin), and CD11b+CD200R3+FcεRIα+ (basophils, Baso) in the granulocyte gate on day 42 after treatment in mice described in Figure 15A (n = 4-6 / group). P values were calculated by one-way ANOVA followed by Fisher's LSD post-hoc test. [Figure 16A] Figures 16A-16D show that the subset of patients who developed sustained broad immunity to FRα appeared to be protected from disease recurrence. Figure 16A is a Kaplan-Meier plot showing recurrence-free survival (RFS) and overall survival (OS) from study enrollment (4-20 weeks after completion of first-line chemotherapy) for all patients eligible for efficacy analysis. [Figures 16B-16D] Figures 16B-16D are graphs plotting IFN-γ, IL-17, and antibody immune response scores (sum of mean immune responses to epitopes) for patients who relapsed (squares, n=11) and patients who did not relapse (circles, n=8), respectively. Plotted scores are mean cumulative T cell or antibody responses by ELIspot or ELISA. T cells are antigen-specific T cells per million PBMCs, and antibodies are reported in μg / ml. [Figures 17A-17C]Figures 17A-17C show that the Th17-inducing DC vaccine generated T cell responses in the majority of patients. In particular, Figures 17A-17C are graphs plotting the percentage of patients who responded to the vaccine epitopes with Th1 T cell responses (ELIspot, Figure 17A), Th17 T cell responses (ELIspot, Figure 17B), or antibody responses (ELISA, Figure 17C). [Figure 18] Figure 18 shows that patients who did not relapse had higher ADCC-inducing antibodies. The graph is a scatter plot of the % dead FRα+ K562 tumor cells coated with patient serum (from Phase I) and cultured with ADCC-competent NK cells from healthy blood donors. Each point represents a unique patient. Line = mean and SEM. [Figures 19A-19C] Figures 19A-19C compare tumor specimens before and after treatment with Th17 DC vaccines among patients who relapsed after treatment. Specifically, Figures 19A-19C plot tumor FRα expression, Treg infiltration, and PD-L1 expression, respectively, in primary tumors and corresponding recurrent tumors from n=5-6 patients who relapsed. P values were calculated using a two-tailed, paired Student's t-test. Overlapping symbols obscure the number of patients. [Figure 20] Figure 20 is a Kaplan-Meier plot showing that the combination of Th17 DC vaccination and anti-PD-1 antibody resulted in long-term survival in mice bearing triple-negative breast cancer (TNBC). TNBC-bearing mice were untreated (no treatment, n = 10) or treated with Th17-DC vaccine (DC treatment, n = 10), anti-PD-1 (PD-1 treatment, n = 10), or a combination of anti-PD-1 and Th17 DC vaccine (DC / PD-1 treatment, n = 8). DETAILED DESCRIPTION OF THE INVENTION
[0014] Detailed Description Dendritic cells are efficient antigen-presenting cells that express class I and class II major histocompatibility complex (MHC) peptide-presenting molecules on their surface along with a series of costimulatory molecules (Banchereau and Steinman, Nature 392:245-252, 1998). Naive T cells express receptors for these dendritic cell ligands. After recognition of the presented peptide antigen in the context of class I or class II molecules, the T cell membrane undergoes structural rearrangements, bringing together elements of the T cell receptor with other cell surface molecules, such as coreceptors CD4 or CD8, and costimulatory receptors CD28 and CTLA-4 (Monks et al. Nature 395:82-86, 1998; and Wulfing and Davis, Science 282:2266-2269, 1998). Interactions within the newly formed macromolecular complex determine the outcome of the induction events transduced into T cells by dendritic cells.
[0015] This document provides methods and materials for treating a mammal with cancer. For example, this document provides a method comprising administering to a mammal with cancer: (a) a Th17 DC vaccine targeting an antigen such as an FRα polypeptide, and, optionally, (b) an ICI. Any suitable mammal can be treated using the methods described herein. For example, humans or other primates, such as monkeys, can be treated with a Th17 DC vaccine and (optionally) an ICI as described herein. In some cases, dogs, cats, horses, cows, pigs, sheep, mice, or rats can be treated with a Th17 DC vaccine and an ICI as described herein. The mammal to be treated can be identified as having a cancer that is not (or is unlikely to be) effectively treatable with ICI alone. For example, the mammal can have ovarian cancer, melanoma, chronic lymphocytic leukemia, gastric cancer, cervical cancer, colorectal cancer, breast cancer, or lung cancer.
[0016] This document also provides Th17 DC vaccines (e.g., Th17 DC vaccines capable of activating IL-17-secreting T cells that target an antigen, such as an FRα polypeptide) and compositions comprising one or more Th17 DC vaccines. Any suitable method can be used to produce a Th17 DC vaccine. Generally, a DC vaccine can be produced by isolating DCs or DC precursor cells from blood or peripheral blood mononuclear cells (PBMCs) obtained from a mammal to be treated. For example, PBMCs can be obtained from whole blood using Ficoll density gradient centrifugation (see, e.g., Disis et al., Clin Cancer Res 5: 1289-1297, 1999), and DCs and / or DC precursor cells (CD14) can be isolated from the blood or PBMCs by magnetic bead positive selection. +
[0003] Alternatively, DCs and / or DC precursor cells (monocytes) may be isolated. The isolated DCs and / or DC precursor cells can be further matured and activated ex vivo using one or more cytokines and then incubated with one or more antigens (e.g., one or more autologous tumor antigens) to generate a Th17 DC vaccine. After maturation and binding to the selected antigen(s), the DC vaccine can be administered to a mammal. Any suitable agent can be used to promote DC maturation to activate Th17 cells. For example, to generate Th17 DCs that activate Th17 cells, DC maturation can be induced by contacting DCs with IL-15 in combination with an inhibitor of the p38 MAPK pathway (e.g., adesumapimod / SB203580, commercially available from Sigma Aldrich, St. Louis, MO). Other agents that can be used in combination with IL-15 to generate Th17 DCs that activate Th17 cells include, but are not limited to, methylsulanilimidazole, dormapimod, SB202190, ralimetinib, VX-702, PH-797804, neflamapimod, and TAK-715. 4 From about 2 x 10 6The cells) may be incubated with an appropriate concentration of IL-15 (e.g., about 1 ng / mL to about 100 ng / mL) and an appropriate concentration of a p38 MAPK inhibitor (e.g., about 0.15 μM to about 15 μM) for an appropriate length of time (e.g., about 1 to about 7 days).
[0017] The mature DCs can then be contacted with one or more antigens. In some cases, the one or more antigens can be peptides derived from human FRα polypeptides. For example, one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten) FRα peptides having any of the amino acid sequences listed in Table 1 can be incubated with DCs.
[0018] [Table 1]
[0019] In some cases, mature Th17 DCs can be contacted with one or more (e.g., two, three, four, or all five) peptides having any of the amino acid sequences set forth in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:14 to generate Th17 DCs capable of activating Th17 cells against FRα when administered to a mammal. For example, Th17 DCs can be contacted with a peptide having the sequence set forth in SEQ ID NO:3, a peptide having the sequence set forth in SEQ ID NO:4, a peptide having the sequence set forth in SEQ ID NO:5, a peptide having the sequence set forth in SEQ ID NO:7, and a peptide having the sequence set forth in SEQ ID NO:14. However, it should be noted that Th17 DCs can be contacted with any suitable tumor antigen, such as HER2, NY-ESO-1, IGFBP-2, hTERT, p53, survivin, or one or more antigens from the Mage antigen family. Furthermore, antigens can be used in any suitable form (e.g., peptide, protein, mRNA, DNA, lipid, carbohydrate, etc.). After incubation with the selected antigen for a suitable length of time (eg, from about 1 hour to about 5 days), the Th17 DC vaccine can be administered to the mammal from which the DCs or DC precursors were obtained.
[0020] In some cases, in addition to one or more Th17 DC vaccines, the composition may include one or more agents (e.g., cytokines) that can promote T cell activation (e.g., IL-2), T cell proliferation (e.g., IL-15), and / or T cell survival (e.g., IL-7). In some cases, the compositions provided herein may also contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, pharmaceutically acceptable solvents, suspending agents, or any other pharmacologically inert vehicles for delivering the vaccine to a subject.
[0021] The methods provided herein include administering a Th17 DC vaccine to a mammal by any suitable route. Administration can be, for example, parenteral (e.g., by intrathecal, intracerebroventricular, intramuscular, intrapleural, or intraperitoneal injection, or by intravenous (iv) infusion). Administration can be rapid (e.g., by injection) or over a period of time (e.g., by slow infusion). A Th17 DC vaccine composition for parenteral administration can be a sterile aqueous solution, which can also include buffers, diluents, and / or other suitable additives (e.g., penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers).
[0022] In some cases, the methods provided herein may include administering one or more ICIs to a mammal. Any suitable ICI, or combination of ICIs, may be administered to a mammal using the methods provided herein. For example, the methods provided herein may include administering one or more ICIs selected from, but not limited to, pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, ipilimumab, cemiplimab, and combinations thereof (e.g., a combination of ipilimumab with pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, or cemiplimab, or a combination of tremelimumab with pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, ipilimumab, or cemiplimab). The one or more ICIs may be administered to a mammal by a suitable route. For example, administration may be parenteral (e.g., intrathecal, intraventricular, intramuscular, intrapleural, or intraperitoneal injection, or intravenous (iv) infusion). Administration may be rapid (e.g., by injection) or may occur over a period of time (e.g., by slow infusion). ICI compositions for parenteral administration may be sterile aqueous solutions, which may also contain buffers, diluents, and / or other suitable additives (e.g., penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers).
[0023] When the methods provided herein include administering to a mammal both a Th17 DC vaccine and one or more ICIs, the Th17 DC vaccine and one or more ICIs can be administered to the mammal simultaneously, sequentially, or a combination thereof. Optionally, one or more doses of the Th17 DC vaccine can be administered to the mammal prior to administration of the ICIs. For example, one or more administrations of the Th17 DC vaccine (e.g., 1, 2 to 4, 3 to 5, 4 to 6, 5 to 7, 6 to 8, 7 to 8, or more than 8 administrations) may be administered about 1 to 8 weeks (e.g., 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 to 3 weeks, 2 to 4 weeks, 3 to 5 weeks, 4 to 6 weeks, 5 to 7 weeks, 6 to 8 weeks) before one or more administrations of the ICI (e.g., 1, 2 to 4, 3 to 5, 4 to 6, 5 to 7, 6 to 8 administrations). In some cases, administration of the Th17 DC vaccine and the ICI may begin simultaneously (e.g., on the same day). In some cases, one or more administrations of Th17 DC vaccine (e.g., 1, 2 to 4, 3 to 5, 4 to 6, 5 to 7, 6 to 8, 7 to 8, or more than 8 administrations) may be administered, followed by one or more administrations of ICI (e.g., 1, 2 to 4, 3 to 5, 4 to 6, 5 to 7, 6 to 8, 7 to 8, or more than 8 administrations) along with one or more booster administrations of Th17 DC vaccine (e.g., 1, 2 to 4, 3 to 5, 4 to 6, 5 to 7, 6 to 8, 7 to 8, or more than 8 administrations).
[0024] A method of treating a mammal (e.g., a human) with cancer (e.g., OC) can include administering to the mammal an effective amount of a Th17 DC vaccine and, optionally, an effective amount of an ICI. In some cases, the effective amount of the Th17 DC vaccine and the effective amount of the ICI can be amounts that, in combination, reduce one or more symptoms associated with cancer in the mammal, reduce the number of tumor cells in the mammal, reduce the size of a tumor in the mammal, or extend the progression-free survival, recurrence-free survival, and / or overall survival of the mammal, without causing significant toxicity to the mammal. In some cases, an effective amount of a Th17 DC vaccine comprising Th17 DCs can be about 5×10 5 Th17 DC to about 5 × 10 8 Th17 DCs (e.g., approximately 5 × 10 5 Th17 DC to about 5 × 10 6 Th17 DC, approx. 5×10 6 Th17 DC to about 5 × 10 7 Th17 DCs, or approximately 5 × 10 7 Th17 DC to about 5 × 10 8The effective amount of ICI can be about 50 mg to about 1500 mg (e.g., about 50 mg to about 100 mg, about 100 mg to about 250 mg, about 250 mg to about 500 mg, about 500 mg to about 750 mg, about 750 mg to about 1000 mg, about 1000 mg to about 1250 mg, or about 1250 mg to about 1500 mg). The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal's response to treatment. Various factors can affect the actual effective amount used for a particular application. For example, when treating a mammal with such a disease, the severity of the cancer, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of co-administration with other therapeutic treatments, such as the use of other anti-cancer agents (e.g., chemotherapeutic agents), and the judgment of the treating physician may necessitate an increase or decrease in the actual effective amount of the Th17 DC vaccine and / or ICI administered. After treatment, the mammal can be monitored for both responsiveness to treatment and toxic symptoms.If a certain mammal does not respond to a certain amount, then the amount of Th17 DC vaccine and / or ICI administered can be increased, for example, doubled.After receiving a higher amount, the mammal can be further monitored for both responsiveness to treatment and toxic symptoms, and further adjustments can be made accordingly.
[0025] In some cases, an effective administration frequency of the Th17 DC vaccine described herein, and optionally an ICI, may be a frequency that reduces one or more symptoms associated with cancer in a mammal, reduces the number of tumor cells in a mammal, reduces the size of a tumor in a mammal, or extends the progression-free survival, recurrence-free survival, and / or overall survival of a mammal, without causing significant toxicity to the mammal. In some cases, an effective administration frequency of the Th17 DC vaccine described herein and (optionally) an ICI may be a frequency that reduces one or more symptoms associated with cancer in a mammal compared to the mammal before treatment. For example, an effective administration frequency of the Th17 DC vaccine described herein and (optionally) an ICI (e.g., a Th17 DC vaccine targeting FRα and pembrolizumab), independently or in combination, may be about three times per week to about once per month (e.g., twice per week, once per week, once every 14 days, once every 21 days, or once every 28 days). Note that the effective administration frequency of the Th17 DC vaccine is not necessarily the same as the effective administration frequency of the ICI. The administration frequency of the Th17 DC vaccine and (optionally) ICI described herein may remain constant or may vary throughout the treatment period. Various factors affect the actual effective frequency used for a particular application. For example, the effective amount, the severity of the cancer when treating a mammal with such cancer, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of coadministration with other therapeutic or prophylactic treatments, such as the use of other anti-cancer agents (e.g., chemotherapeutic agents), and the judgment of the treating physician may necessitate an increase or decrease in the actual effective administration frequency of the Th17 DC vaccine provided herein and, if necessary, an ICI.
[0026] In some cases, the effective administration period of the Th17 DC vaccines described herein, and optionally an ICI, can be a period that reduces one or more symptoms associated with cancer in a mammal, reduces the number of tumor cells in a mammal, reduces the size of a tumor in a mammal, or extends the progression-free survival, recurrence-free survival, and / or overall survival of a mammal, without causing significant toxicity to the mammal. In some cases, the effective administration period of the Th17 DC vaccines described herein, and (optionally) an ICI, can be a period that reduces one or more symptoms associated with cancer in a mammal with such cancer, compared to the mammal before treatment. For example, the effective administration period of the Th17 DC vaccines and (optionally) an ICI provided herein (e.g., a Th17 DC vaccine targeting FRα and pembrolizumab), alone or in combination, can vary from a single administration time point to administration over the course of several weeks to several months (e.g., 2-4 weeks, 4-8 weeks, 8-12 weeks, 12-16 weeks, or more than 16 weeks). It should be noted that the effective administration period of the Th17 DC vaccine is not necessarily the same as that of the ICI. Several factors affect the actual effective administration period for a particular application. For example, the severity of the cancer, the effective frequency, the effective dose, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of coadministration with other therapeutic or prophylactic treatments, such as other anti-cancer agents (e.g., chemotherapeutic agents), and the judgment of the treating physician may necessitate an increase or decrease in the actual effective administration period of the Th17 DC vaccine provided herein and, if necessary, the ICI. In some cases, for example, the Th17 DC vaccine may be administered once every 3-6 months for approximately 1-2 years, and the ICI may be administered once every 2-6 weeks for approximately 1-5 years.
[0027] In some cases, the methods provided herein may include monitoring the mammal after treatment with the Th17 DC vaccine or after treatment with the Th17 DC vaccine and an ICI to assess the effectiveness of the treatment. In some cases, for example, the course of treatment and / or the severity of one or more symptoms associated with the cancer being treated may be monitored. Any appropriate method can be used to determine whether a mammal with cancer is responding to treatment. For example, clinical scanning techniques (e.g., computed tomography (CT), positron emission tomography (PET) / CT, bone scan, and magnetic resonance imaging (MRI)) may be used to assess the presence or absence or physical characteristics (e.g., size) of cancer in a mammal (e.g., a human) treated with the methods provided herein. In some cases, the effectiveness of treatment with the Th17 DC vaccine and, optionally, an ICI may be assessed based on the length of RFS, PFS, or OS compared to the average RFS, PFS, or OS of mammals with the same type of cancer who have not been treated with the Th17 DC vaccine and, optionally, an ICI.
[0028] In some cases, the methods provided herein may include monitoring the mammal after treatment for expression of one or more markers indicative of the interaction between T cells and antigen-presenting cells induced by the Th17 DC vaccine. For example, as described herein, administration of a Th17 DC vaccine induced CD4 T cells that stimulated elevated levels of myeloid cells regulating cytokines / chemokines (such as CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4). Thus, in some cases, the methods provided herein may include monitoring the mammal after treatment for elevated expression of one or more cytokines / chemokines (such as, but not limited to, CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4), where elevated expression of one or more cytokines / chemokines indicates effective treatment. As used herein, an "elevated" level of a marker refers to a level of the marker (mRNA or protein) that is higher than the level of the marker in a mammal before administration of a Th17 DC vaccine. For example, the level of a cytokine / chemokine mRNA or protein (e.g., one or more of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4) in a sample (e.g., a blood sample) can be considered "increased" if the level is at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, or more than 100%) higher than the level in a corresponding sample from a mammal before administration of a Th17 vaccine.
[0029] Illustrative Embodiments Embodiment 1 is a method of treating a mammal having cancer, the method comprising administering to the mammal an effective amount of a vaccine composition capable of activating T cells in the mammal to form activated IL-17-secreting T cells capable of recognizing one or more antigens expressed by the cancer.
[0030] Embodiment 2 is the method of embodiment 1, wherein the mammal is a human.
[0031] Embodiment 3 is the method of embodiment 1, wherein the cancer is ovarian cancer, melanoma, chronic lymphocytic leukemia, gastric cancer, cervical cancer, colorectal cancer, breast cancer, or lung cancer.
[0032] Embodiment 4 is the method of embodiment 1, wherein the vaccine composition comprises dendritic cells (DCs) that present one or more folate receptor alpha (FRα) antigens.
[0033] Embodiment 5 is the method of embodiment 4, wherein the one or more FRα antigens comprise one or more peptides having the amino acid sequence set forth in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, or SEQ ID NO:14.
[0034] Embodiment 6 provides a method for administering to a mammal about 5 x 10 6 From about 50 x 10 6 2. The method of embodiment 1, comprising administering a dose of the DC composition.
[0035] Embodiment 7 is the method of embodiment 1, comprising administering the vaccine composition to the mammal two or more times over a period of about 2 weeks to about 16 weeks.
[0036] Embodiment 8 is the method of embodiment 1, further comprising the step of monitoring the mammal after the administering step to determine the efficacy of the vaccine composition in the mammal.
[0037] Embodiment 9 is the method of embodiment 8, wherein the monitoring comprises using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging.
[0038] Embodiment 10 is the method of embodiment 8, wherein the monitoring comprises measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after administering steps (a) and (b), wherein the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4.
[0039] Embodiment 11 is the method of embodiment 1, further comprising administering to the mammal an effective amount of an immune checkpoint inhibitor (ICI).
[0040] Embodiment 12 is the method of embodiment 11, wherein the ICI is selected from the group consisting of pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, ipilimumab, and cemiplimab.
[0041] Embodiment 13 is the method of embodiment 11, comprising administering to the mammal a dose of about 50 mg to about 1500 mg of an ICI.
[0042] Embodiment 14 is the method of embodiment 11, comprising administering the ICI to the mammal two or more times over a period of about 2 weeks to about 16 weeks.
[0043] Embodiment 15 is the method of embodiment 11, further comprising the step of monitoring the mammal after the administering step to determine the efficacy of the vaccine composition and ICI in the mammal.
[0044] Embodiment 16 is the method of embodiment 15, wherein the monitoring comprises using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging.
[0045] Embodiment 17 is the method of embodiment 15, wherein the monitoring comprises measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after administering steps (a) and (b), wherein the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4. [Example]
[0046] The present invention is further described in the following examples, which do not limit the scope of the invention described in the embodiments.
[0047] Example 1 – Th17 T cell-inducing vaccines break ovarian cancer resistance to immune checkpoint blockade Materials and Methods Generation of DC vaccine: Bone marrow cells were obtained from C57BL / 6J mice as described elsewhere (Lamichhane et al., Cancer Res 77:6667-6678, 2017). Cells were cultured at 0.2 × 10 cells / mL in RPMI medium (containing 10% FBS) containing mouse GM-CSF (50 ng / mL, R&D Systems, Minneapolis, MN, Cat. # 415-ML-050 / CF) and IL-4 (20 ng / mL, R&D Systems, Cat. # 404-ML-100 / CF) with or without (Th17 DC vaccine) or conventional DC vaccine (cDC) IL-15 (10 ng / mL, R&D Systems, #447-ML-010 / CF) and p38 MAPK inhibitor SB203580 (1.5 μM, Sigma Aldrich, St. Louis, MO, Cat. # S8307). 6 On days 4 and 6, half the volume of fresh medium was added. On day 7, DCs were pulsed with tumor cell lysate (1:10 dilution) from ID8 ovarian cancer cells, followed by stimulation with LPS (200 μg / mL) for 16 hours. Cells were removed from the plate by gentle scraping, washed twice with PBS, and then resuspended in 10 mL of PBS. 7The cells were resuspended at 1000 cells / mL and used as a vaccine.
[0048] p38 MAP kinase assay: Dendritic cells treated with or without SB203580 (1.5 μM, Sigma-Aldrich) were washed with cold PBS, scraped into 0.5 mL of cold 1X cell lysis buffer (Cell Signaling Technologies, Danvers, MA, Cat. # 9803) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF), and sonicated. Beads containing immobilized antibody (phosphorylated p38 MAPK (Thr180 / Tyr182)) were incubated with DC cell lysate overnight at 4°C with gentle shaking. The beads were then centrifuged at 14,000 x g for 30 seconds at 4°C and washed twice with 500 μL of 1X cell lysis buffer and twice with 500 μL of 1X kinase buffer (Cell Signaling Technologies, Cat. # 9802). All assays were performed on ice. The pellet was resuspended in 50 μL of 1X kinase buffer supplemented with 200 μM ATP, and the kinase substrate (ATF-2 fusion protein) was added and incubated at 30°C for 30 minutes. The reaction was stopped with 25 μL of 3X SDS sample buffer, vortexed, and centrifuged at 14,000 x g for 30 seconds. The sample was heated at 95°C for 2–5 minutes and subsequently probed for phosphorylated ATF-2 (Thr71) by standard immunoblotting as described below.
[0049] Immunoblotting: Cells were harvested and lysed using 1X cell lysis buffer (Cell Signaling Technologies). Samples were sonicated and a BioRad protein assay was performed to quantify the amount of protein in each sample. Proteins were denatured at 70°C for 10 minutes, and 30 μg of protein was loaded onto an SDS-PAGE gel. Proteins were transferred to a PVDF membrane using iBlot and blocked with Li-Cor Odyssey buffer (Li-Cor Biosciences, Lincoln, NE, Cat. # 927-40000) for 1 hour at room temperature. Primary antibodies (anti-phosphorylated ATF-2 (Thr271), Cell Signaling Technologies, Cat. # 9221, or β-actin, Li-Cor Bioscience, Cat. # 926-42212) were added (dilutions of 1:500–1:1000) and incubated either overnight at 4°C or for 2 hours at room temperature. The membrane was then washed three times with 1X PBST and incubated with an HRP-conjugated secondary antibody against IgG for 1 hour at room temperature. The membrane was then washed and developed using Odyssey.
[0050] Flow cytometry: Staining of cell surface immune markers was performed on ascites and peritoneal cells. Cells were cultured at 1 × 10 per 100 μL in U-bottom plates. 6Cells were resuspended, spun down directly in a U-bottom plate, and incubated with fixable viability staining for 20 minutes. Cells were washed with PBS and incubated with CD16 / 32 blocking antibody (Miltenyi Biotech, Cat. # 130-092-574) for 10 minutes at 4°C to add cell surface antibodies to the samples. Samples were measured on an Attune flow cytometer (Invitrogen, Waltham, MA), and data analysis was performed using FlowJo software (FlowJo 10.6.2). Similar numbers of events, typically 200,000 to 400,000, were collected for all groups. Appropriate FMOs were used as controls.The antibodies used were as follows: anti-CD3 (Invitrogen, clone 145-2C11, Cat. # 17-0031-82), anti-CD4 (BD Pharmingen, San Diego, CA, clone GK1.5, Cat. # 552051), anti-CD8 (BioLegend, San Diego, CA, clone 53.6.7, Cat. # 100748), anti-CD69 (BioLegend, clone H1.2F3, Cat. # 104530), anti-GR1 (BioLegend, clone RB6-8C5, Cat. # 108456), anti-CD11b (BioLegend, clone M1-70, Cat. # 101263), and anti-CD19 (BioLegend, clone 6D5, Cat. # 115546), anti-CD11c (Invitrogen, clone N418, Cat. # 17-0114-82), anti-F4 / 80 (Bio-Rad, Hercules, CA, clone A3-1, Cat. # MCA497A700), anti-CD45 (BioLegend, clone 30-F11, Cat. # 103128), anti-CD80 (BioLegend, clone 16-10A1, Cat. # 104706), anti-CD86 (BioLegend, clone GL-1, Cat. # 105024), anti-OX40L (BioLegend, clone RM134, Cat. # 108812), anti-MHCI (BioLegend, clone AF6-88.5, Cat. # 116509), anti-MHCII (BioLegend, clone M5 / 114.15.2, Cat. # 107632), anti-CD193 (BioLegend, clone J073E5, Cat. # 144510), anti-Siglec-F (BioLegend, clone S17007L, Cat. # 155509), anti-Ly-6G (Tonbo Biosciences, San Diego, CA, clone 1A8, Cat. # 85-1276-U100), anti-CD200R3 (BioLegend, clone Ba13, Cat. # 142207), anti-FceR1a (BioLegend, clone MAR-1, Cat. # 134305), and anti-NK1.1 (BioLegend, clone PK136, Cat. # 108732).
[0051] Cytokine ELISA: ELISA kits were used to detect IL-10 (Cat. # 88-7105-86), IL-17A (Cat. # 88-7371-86), IL-12p70 (Cat. # 88-7121-88), IL-6 (Cat. # 88-7064-88), IL-1β (ThermoFisher Scientific, Cat. # 88-7013-88), TGF-β (Cat. # 88-8350-88), and IFN-γ (Cat. # 88-7314-88). All kits were purchased from ThermoFisher Scientific (Waltham, MA). 96-well plates were coated overnight with coating antibodies diluted in coating buffer. Plates were washed three times using an AquaMax 4000 (Molecular Devices, San Jose, CA) plate washer and blocked with 200 μL of ELISA diluent (ThermoFisher Scientific, Cat. # 00-4202-56) for 1 hour. Plates were washed, and samples were added to the standards. Culture medium samples were added neat, while serum from blood or ascites fluid was added at a 1:10 dilution and incubated overnight. Plates were washed, and detection antibodies diluted in ELISA buffer were added and incubated for 1 hour. Plates were washed, and avidin / streptavidin was added for 30 minutes, followed by washing and development with TMB substrate. The reaction was stopped with 1N HCl. Absorbance was measured at 450 nm. Values were then converted to cytokine concentrations using a standard curve.
[0052] Antibody ELISA and urea treatment: Flat-bottom polystyrene 96-well plates were coated overnight at 4°C with 100 μL / well of 1X PBS containing 10 μg / mL ID8 tumor cell lysate. Mouse IgG (Sigma, St. Louis, MO) was used as a protein standard and added at concentrations ranging from 0.195 to 1000 ng / well. All washing steps were performed using an AquaMax 4000 plate washer with PBS containing 0.05% TWEEN® 20. PBS containing 1% BSA was used as the blocking and assay buffer. Wells were blocked with 200 μL / well of blocking / assay buffer and incubated on a shaking platform at room temperature for 1 hour. After washing again, mouse serum from control or treated mice was added to the plate at a 1:25 dilution in triplicate and incubated at 37°C for 1 hour. The plates were washed, and one set of mouse sera was treated with 200 μL of 6 M urea (Sigma Aldrich, Cat# U5378-100g), and the other set of mouse sera was treated with 200 μL of wash buffer. The plates were incubated at 37°C for 30 minutes with vigorous shaking. After washing, 100 μL / well of goat anti-mouse IgG HRP (Santa Cruz Biotechnology, Dallas, TX) diluted 1:2,000 was added and incubated at 37°C for 1 hour. After the final wash, each well was incubated with 100 μL of TMB substrate (BD Biosciences, Mississauga, Ontario, Canada). Color development was stopped by adding 50 μL / well of diluted HCl. Absorbance was measured at 450 nm on a plate reader. Wells not coated with tumor cell lysate were used to subtract background from the mouse serum samples. These values were then converted to antibody concentrations using an IgG standard curve generated within the same assay.
[0053] IL-4, IFN-γ, and IL-17 ELISA: Spleen cells (0.5 × 10) from C57BL / 6J mice 6On day 1, tumor cells (cells) were incubated in 96-well U-bottom plates with and without tumor cell lysate at 37°C. IFN-γ (MabTech, Cincinnati, OH, Cat. # 3321-2H) and IL-4 (MabTech, Cat. # 3311-2H) ELISpot plates (MSIP4510, MilliporeSigma, Burlington, MA) were treated with 35% ethanol for 1 minute and then washed five times with water. Anti-IFN-γ (clone AN18) or anti-IL-4 (clone 11B11) coating antibodies purchased from MabTech were diluted and coated onto the plates, sealed, and incubated overnight at 4°C. After 24 hours, the plates were blocked with 200 μL of medium for 1 hour. Cells were transferred from the U-bottom plates to ELIspot plates and incubated overnight at 37°C. Plates were washed and incubated with biotinylated anti-IFN-γ antibody (clone # R4-6A2-Biotin, MabTech) or anti-IL-4 antibody (clone # BVD6-24G2-Biotin, MabTech) for 1 hour, followed by avidin-conjugated HRP for 30 minutes. Plates were washed and developed with 3-amino-9-ethylcarbazole (AEC) substrate until distinct spots were visible. For IL-17 ELISA, precoated 96-well plates obtained from R&D Systems (Cat # EL421) were blocked with 200 μL of medium for 20 minutes at room temperature. The medium was aspirated, and cells were seeded onto the plates with stimulators, incubated at 37°C for 48 hours, washed, and then incubated with 100 μL of detection antibody overnight at 4°C. The plates were washed, and 100 μL of diluted streptavidin-conjugated alkaline phosphatase was added to each well, followed by incubation at room temperature for 2 hours. The plates were washed, and 100 μL of BCIP / NBT color developer was added to each well, followed by incubation in the dark for 1 hour and then washing with water. All plates were dried overnight, and the spots were read the next day using an Advanced Imaging Devices (AID) ELISpot software (version 7, AID GmbH, Germany) ELISpot reader.
[0054] Immunohistochemistry of ascites and peritoneal cells: Ascites fluid obtained from ovarian tumor-bearing C57BL / 6J mice was gently layered on top of a discontinuous Ficoll density gradient consisting of a lower 100% layer and an upper 75% layer. The ascites and Ficoll gradient were centrifuged at 280 x g for 30–45 min at 4°C, followed by two washes in Hank's balanced salt solution. Tumor-infiltrating lymphocytes (TILs) were collected from the top layer. To obtain peritoneal cells, mice were euthanized, and the peritoneum was washed intraperitoneally with 20 mL of PBS, which was then drained into a centrifuge tube. Both ascites and peritoneal cells were washed in PBS and subjected to ammonium chloride-potassium (ACK) treatment for 1 min at room temperature. ACK was diluted in PBS, and the cells were centrifuged at 300 x g for 5 min to count the cells. The cells were fixed in formalin (4% formaldehyde) for 20 min at room temperature and washed 2–3 times in PBS. After removing the supernatant, 500 μL of Epredia Histogel (Fisher Scientific, Waltham, MA, USA, Cat. # HG-4000-012) was added to the cell pellet, which was then air-dried for 15 minutes. The gel was transferred to a cassette and sent to the Mayo Clinic Histochemistry Core for staining. Cells were stained for Ki67 (Abcam, Cambridge, UK, Cat. # 15580), Sp17 (Proteintech, Rosmont, IL, Cat. # 13367-1-AP), MHC-II (Thermo Fisher Scientific, Cat. # 14-5321-82), PD-L1 (Cell Signaling Technology, Cat. # 13684), CD3 (Abcam, Cat. # ab166689), CD4 (Abcam, Cat. # ab183685), and CD8 (Invitrogen, Cat. # ab14-0808-82). Stained sections were scanned using an AT2 slide scanner (Leica Biosystems, Inc., Buffalo Grove, IL) and analyzed using eSlide Manager software (Leica Biosystems, version # v.12.4.3.5008).
[0055] T cell coculture and Proteome Profiler Mouse XL Cytokine Array: T cells primed in vivo with vaccine were simulated ex vivo with antigen-pulsed cDCs. Briefly, mice were inoculated with tumor, vaccinated four weeks later, and then harvested after two weeks of rest. Spleens, peripheral blood, and peritoneal cells were collected from these mice. Spleen cells were processed into single-cell suspensions, and CD4+ T cells were depleted using an AutoMacs CD4+ isolation kit (Miltenyi Biotech). These cells were then cocultured with antigen-pulsed cDCs at a 1:1 ratio in 1 mL of medium in 12-well plates for 72 hours. The medium was collected and centrifuged, and the supernatant was used to determine which cytokines were secreted by the different groups of vaccinated mice. Cytokines secreted within the coculture experiments were examined using the Proteome Profiler Mouse XL Cytokine Array Kit (R&D Systems, Cat. # ARY028) according to the manufacturer's instructions.
[0056] Animals: For the experiments described in this document, 6-8 week old female C57BL / 6J (B / 6J) and STOCK IL17a mice were used. tm1.1(icre)Stck / J (Il17a cre ) mice were used. Both strains were purchased from Jackson Laboratory (Bar Harbor, ME) and were transgenic for Il17a cre were maintained as colonies.
[0057] Ovarian Cancer Cell Line and Tumor Testing: ID8 tumor cells were obtained from Dr. K. Roby (University of Kansas; Lawrence, KS) and authenticated by IDEXX Bioanalytics (Columbia, MO). The ID8 cell line was transfected with SP17 for biomarker purposes. SP17 is a cancer-testis antigen overexpressed in ovarian cancer (Brunette et al., BMC Cancer 18:970, 2018). The SP17 gene was cloned into the pCDH lentiviral vector and transfected into ID8 cells along with the psPAX2 and pMD2.G packaging vectors. Cells were screened using puromycin, and SP17 gene expression was confirmed by Western blotting. To establish peritoneal carcinomatosis, ID8-SP17 tumor cells (4 × 10 cells) were cultured in 400 μL of PBS. 6 Mice were intraperitoneally injected with 1000-20 ...
[0058] Preparation of tumor cell lysates: ID8-SP17 cell line was grown in DMEM supplemented with 10% FBS and 1 mg / mL puromycin was added for selection. Cells were harvested and lysed at 10 7 The cells were resuspended in PBS at 1000 cells / mL. Cells were subjected to five freeze cycles on dry ice for 30-60 minutes, followed by thawing at 37°C. The supernatant was collected and the protein concentration was measured using a BSA assay. When tumor lysates were used, 70-100 mg / mL of protein was typically added to bone marrow DC cultures at a 1:10 dilution on day 7.
[0059] Vaccination and immune checkpoint blockade therapy: Dendritic cell vaccines (DC vaccines) were harvested from bone marrow cultures (described above), washed twice in PBS, and cells were counted and adjusted to a final concentration of 10 in PBS. 7The cells were adjusted to 100 cells / mL. 100 μL of cells were injected subcutaneously (sc) or intraperitoneally (ip) into mice. 200 mg of hamster IgG (Jackson ImmunoResearch, West Grove, PA) or 200 mg of G4 clone PD-1 blocking monoclonal antibody were administered intraperitoneally twice weekly for 10 weeks, 13–15 days after tumor inoculation (Lamichhane et al., supra, and Karyampudi et al., Cancer Res 74:2974–85, 2014). For in vivo T cell depletion studies, anti-CD4 antibody (GK1.5) or anti-CD8 antibody (53.6.7) were administered intraperitoneally at 0.5 mg / ip once weekly for 4 weeks, starting 1 week after tumor inoculation, in parallel with the vaccination. Anti-PD-1 and depletion antibodies were provided by the Mayo Clinic Antibody Hybridoma Core.
[0060] Phagocytosis assay: ID8-Sp17 tumor cells were labeled with PKH26 red fluorescent cell linker according to the manufacturer's instructions (Sigma Aldrich, Cat. # PKH26GL). Tumor cell lysates were generated using these cells as described above. Dendritic cells were co-cultured with these labeled tumor cell lysates at a 1:1 cell ratio for 24 hours at 37°C, followed by stimulation with LPS for 16 hours. Cells were harvested and stained for dendritic cell markers, and uptake was measured by flow cytometry.
[0061] Genotyping:IL-17a cre Mice were genotyped at the IL-17a locus by standard polymerase chain reaction (PCR) using the mutant reverse B primer ACTCCCTCACATCCTCAGGTT (SEQ ID NO: 15), the wild-type reverse A primer CTTAGTGGGTTAGTTTCACAGC (SEQ ID NO: 16), and the consensus A and B primers CAAGTGCACCCAGCACCAGCTGATC (SEQ ID NO: 17). cre The expected result for β / 6J was a 300 bp product and for B / 6J was a 304 bp product.
[0062] Statistical analysis: All statistical tests were two-sided, with a p value of <0.05 considered statistically significant. Statistical tests were calculated using GraphPad Prism V.8.
[0063] result IL-15 costimulation and p38 MAPK blockade selectively upregulate MHC class II and IFN-γ expression while suppressing IL-10 and IL-12 production: p38 MAPK activity in DCs was blocked using SBA203580 (adezmapimod), a selective inhibitor of the p38 MAPK isoform with little activity against other MAPKs, such as p44 / p42 MAPK and SAPK / JNK (Kumar et al., Biochem Biophys Res Commun 263:825-831, 1999). Initial studies focused on validating efficacy in mouse DCs demonstrated nearly complete abolition of phosphorylation of the p38 MAPK target activating transcription factor 2 (ATF-2), with little toxicity and improved DC recovery compared to conventional DC methods (Figures 1A and 1B) (Sreekanth et al., PLoS One 11:e0149486, 2016). The addition of p38 MAPK inhibitors and IL-15 significantly reduced MHC class II +Both the number of DCs and the magnitude of MHC class II expression were selectively upregulated (Figures 1C, 1D, and 2A). The effect of T cell activating factors on cell surface expression was highly specific, with no significant increase in the expression of MHC I, CD80, CD86, or OX40L (Figures 1C, 1D, and 2B). Exposure to tumor antigens did not affect the expression of MHC class II or other T cell activating factors overall (Figures 1C, 1D, 2A, and 2B). Similarly, exposure of DCs to IL-15 and p38 MAPK inhibitors demonstrated highly selective cytokine production responses. The release of both IL-10 (a Treg inducer) and IL-12 (a Th17 inhibitor) was significantly suppressed, whereas the release of IFN-γ was elevated (Figures 1E–1G). Levels of IL-6, IL-1β, and TGF-β, known inducers of Th17 T cell responses (Harbour et al. Sci Immunol 5(49):eaaw2262, 2020; Chung et al., Immunity 30:576-587, 2009; and Mangan et al., Nature 441:231-234, 2006), were maintained at high levels by DCs and were unaffected by IL-15 or p38 MAPK inhibitors (Figures 1H-1J). Again, antigen exposure had little effect on cytokine release. Additional qualitative proteomic analysis of cytokines produced by myeloid cells revealed extensive similarities between conventional DC maturation and DCs matured in the presence of p38 MAPK inhibitors and IL-15 costimulation, with notable exceptions (Figure 3 and Table 1). Specifically, in the presence of p38-MAPK inhibitors and IL-15, both B cell regulatory factors BAFF and IL-13 were significantly elevated (Figures 1K and 1L). Meanwhile, the Treg chemoattractant LIX (CXCL5) was suppressed (Figure 1M) (Shi et al., Eur J Immunol 44:420-430, 2014). In addition, blockade of p38 MAPK and costimulation with IL-15 slightly increased phagocytosis (Figure 4). Thus, the combination of IL-15 and p38-MAPK inhibitors induces a DC phenotype that promotes Th17 T cell and B cell activation rather than Treg activation.
[0064] IL-15 costimulation and p38-MAPK blockade inhibit IFN-γ + or IL-4 + DC vaccine-induced IL-17 upregulation with little effect on T cell generation + Specifically enhance in vivo generation of T cells and high-affinity antibodies: To determine the ability of Th17 DCs to generate Th17 cells in vivo, DCs were prepared and pulsed with tumor antigen or left unpulsed. ID8-SP17 tumor-bearing mice (minimal tumor burden 1 week after tumor challenge) were vaccinated and treated with IFN-γ for 2 weeks following 4 weeks of immunization. + , IL-4 + , and IL-17 + Both antigen-pulsed conventional DCs (cDCs) and Th17 DCs produced antigen-specific IFN-γ + and IL-4 + This resulted in a striking and statistically significant increase in the number of T cells, which was not observed when antigen was omitted (Figures 5A and 5B). Only antigen-pulsed Th17 DCs were able to express tumor antigen-specific IL-17. + The vaccine reliably resulted in the generation of T cell immunity (Figure 5C). Vaccine-induced tumor-specific antibody levels were robust in serum, but no difference was observed between the cDC vaccine and the Th17 DC vaccine (Figure 5D). However, antibody assays under strong dissociation conditions (i.e., 6 M urea) revealed that the Th17 DC vaccine tended to induce an antibody repertoire with higher avidity (Figure 5E). Overall, these results suggest that IL-15 costimulation and p38 MAPK blockade result in highly selective DC modification that specifically leads to antigen-specific Th17 T cell activation and increased antibody avidity, with little effect on the frequencies of Th1 and Th2 T cells.
[0065] IL-15 costimulation and p38-MAPK blockade specifically enhance the rapid generation of antigen-specific Th17 T cells by DC vaccines in vitro and in vivo: Th17-inducing DCs express IL-17 +To determine whether Th17 DCs directly induce T cell proliferation, we performed in vitro experiments in which Th17 DCs stimulated spleen cells from tumor-free naive mice. As shown in Figures 6A and 6B, Th17 DCs stimulated antigen-specific IL-17 production from freshly prepared spleen cells within 72 hours. + Rapid generation of T cells. In vivo generated antigen-specific IL-17. + To confirm that the T cells were CD4 T cells, spleen cells were harvested from immunized mice, magnetically purified, and then restimulated ex vivo with antigen. As demonstrated in Figures 6C and 6D, CD4 T cells fractionated directly from spleen cells of immunized mice were highly enriched for antigen-specific Th17 T cells. Further analysis showed that vaccination resulted in high levels of circulating IL-17, but not IL-10, in tumor-bearing animals after vaccination (Figure 6E). This demonstrates that vaccination likely does not result in Treg17 or rTh17 cells, as reported elsewhere in the small intestine and other tissues (Esplugues et al., Nature 475:514-518, 2011). Additionally, to further demonstrate that CD4 T cells are the source of IL-17 in vivo, mice were immunized with antigen-pulsed Th17 DCs with or without depletion of CD4 or CD8 T cells, as shown in Figure 6E. As shown in Figure 6F, depletion of CD4 T cells, but not CD8 T cells, abolished IL-17 release. Unexpectedly, it is also noteworthy that depletion of CD8 T cells resulted in statistically significantly elevated IL-17 levels, suggesting that CD8 T cells may negatively regulate Th17 T cell-inducing activity in vivo. These results support the finding that IL-15 costimulation and p38 blockade in DCs significantly increased the release of IL-17, as reported elsewhere. + CD4 T cells, but not Tc17 T cells (Hamada et al., J Immunol 182:3469-3481, 2009) + demonstrated that it resulted in the rapid priming and expansion of Th17 T cells.
[0066] Th17 DC-induced T cell immunity induces a distinct myeloid cytokine signature: To determine whether Th17 DC-induced T cell immunity is associated with a distinct cytokine / chemokine profile, we performed proteomic analysis (Table 1) on medium derived from cocultures in which tumor antigen-loaded cDCs were incubated with purified CD4 T cells from mice immunized four times with either PBS, cDCs, or Th17 DCs. As shown in Figure 7, Th17 DC vaccination induced CD4 T cells capable of stimulating elevated levels of various myeloid cell-regulatory cytokines / chemokines, such as CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4, compared with T cells from cDC vaccination (adjusted P < 0.05). Thus, vaccination with Th17 DC vaccines resulted in a distinct cytokine profile following the interaction of vaccine-induced T cells with antigen-presenting cells.
[0067] Th17-inducing vaccines eliminate peritoneal shedding: Ovarian cancer is unique among other cancers in that metastasis is mediated through tumor cell detachment and accumulation, followed by dissemination to the omentum, peritoneum, and abdominal organs (Lengyel, Am J Pathol 177:1053-1064, 2010). To determine whether Th17 DC vaccines affect tumor cell accumulation, we analyzed peritoneal tumor burden by Ki-67 and Sp17 IHC staining of exfoliated cells from the peritoneal cavity following tumor challenge. Figures 8A and 8B show representative images and quantitative analysis of Ki-67 and Sp17 tumor marker staining in peritoneal cells (inset). A key finding was the suppression of the formation of large tumor cell clusters in mice immunized with the antigen-pulsed vaccine. While clusters were abundant in control animals, they were generally not observed in samples from vaccinated mice. The number of Ki-67- or Sp17-staining-positive cells (both clusters and single cells) was rapidly reduced in animals immunized with either antigen-pulsed cDCs or antigen-pulsed Th17 DCs. Th17 DCs appeared superior to cDC vaccines using both assessments. The reduction was entirely dependent on the presence of tumor antigens (Ag) in the vaccine and was not observed with unpulsed cDCs or Th17 DCs. Thus, Th17 DC vaccines can reduce carcinomatosis associated with ovarian cancer.
[0068] Th17 DC vaccination induces T cell infiltration into solid tumor tissue and extends the lifespan of ovarian cancer-bearing mice: To evaluate the impact of the Th17 vaccine on survival, tumor-bearing mice were immunized and followed until moribund. Tumor-bearing mice in the groups vaccinated with PBS, unpulsed cDCs, and unpulsed Th17 DCs died of disease between 60 and 80 days. However, mice immunized with antigen-pulsed cDCs or antigen-pulsed Th17 DCs showed prolonged survival (p<0.0001) (Figure 9A). Antigen-pulsed Th17 DCs outperformed the antigen-pulsed cDC vaccine, with a median survival of 148 days versus 84 days (p<0.01). The survival advantage conferred by the Th17 DC vaccine was reversed by depletion of CD4 T cells, but not CD8 T cells (Figure 9B). Ascites fluid from moribund animals showed IL-17 accumulation, suggesting that the results were due to an evasion strategy and not to a loss of Th17 immunity (Figure 9C). Furthermore, when Th17 DC-vaccinated mice became moribund, intraperitoneal tumor tissue revealed high levels of CD4 T cell infiltration, but relatively sparse infiltration of CD8 T cells, regardless of whether the mice were vaccinated with cDCs or Th17 DCs (Figures 9D–9G). Tumors were also observed to express MHC class II (Figure 10). At the time of death, Th17 DC-vaccinated mice had higher antigen-specific antibody levels in the blood than mice vaccinated with cDCs, but similar levels were observed in the ascites (Figure 9H). The increased antibody levels in the blood were likely due to differences in the time of collection. At the time the animals became moribund, the avidity of the antibody repertoire was similar between animals treated with cDCs and Th17 DCs (Figure 11). To determine whether IL-17A cytokine is required for the efficacy of Th17 DC vaccines, tumor-bearing Il17a creWe also examined survival in mice in which Cre-Recombinase was knocked into the endogenous Il17a gene to silence IL-17a expression (Figures 12A and 12B). As shown in Figure 9I, elimination of IL-17A did not affect vaccine efficacy, suggesting that other cytokines released by Th17 are more important. Thus, Th17 DC vaccination induces sustained tumor-infiltrating immunity in a CD4 T cell-dependent, IL-17-independent manner and improves survival to a greater extent than cDC vaccination. However, ultimately, mice die due to the development of an unknown immune evasion mechanism.
[0069] Th17 DC vaccination synergizes with immune checkpoint blockade in a CD4 T cell-dependent manner: Th17 vaccination can significantly improve survival in tumor-bearing mice, although the mice (with rare exceptions) generally succumb to disease. Studies described elsewhere suggest that this pathway is a potentially important immunomodulatory pathway in ovarian cancer, despite the finding that specific targeting of the PD-1 / PD-L1 axis with immune checkpoint blockade molecules has had limited results in the clinic (Hamanishi et al., J Clin Oncol 33:4015-4022, 2015; Matulonis et al., Ann Oncol 30:1080-1087, 2019; Krempski et al., J Immunol 186:6905-6913, 2011; Lamichhane et al., supra; and Wang, J Ovarian Res 12:37, 2019). To examine whether this axis regulated the activity of vaccination, or vice versa, we included periodic anti-PD-1 injections during vaccination in tumor-bearing mice. ID8-SP17 cells expressed PD-L1 in vivo in both control animals and animals treated with cDC and Th17 DC vaccines (Figure 13A). Figure 13B shows that PD-1 therapy alone had little activity, resulting in only a small increase in survival compared to no treatment, consistent with our findings elsewhere (Krempski et al., supra; Lamichhane et al., supra). Although statistically significant (p = 0.003), survival was only slightly improved by approximately 20 days (78 days in the PD-1 group vs. 58 days in the PBS group). In contrast, the addition of anti-PD-1 nearly doubled median survival compared to Th17 DC vaccination alone (p = 0.02). One possible explanation for the enhanced survival observed with the addition of anti-PD-1 antibody treatment is that it increased the number of antigen-specific effectors induced by the vaccine, although ELISpot analysis revealed that anti-PD-1 treatment may have induced similar or even slightly reduced (e.g., Th1) T cell immune responses (Figure 13C).Similarly, the inclusion of anti-PD-1 did not alter the levels or avidity of antibodies induced by Th17 DCs (Figures 13D, 14A, and 14B).
[0070] In a study described elsewhere (Lamichhane et al., supra), we observed that administration of single-agent anti-PD-1, which sustained local immunosuppression of T cell responses, strongly induced IL-10 production within the ovarian cancer microenvironment (Lamichhane et al., supra). In this study, blockade of PD-1 and IL-10 with anti-IL-10 and anti-IL-10 receptor antibodies resulted in improved survival, demonstrating that IL-10 release is a major mediator of adaptive resistance after anti-PD-1 treatment. Studies were performed to determine whether IL-10 was present in the tumor microenvironment (ascites) when the animals were moribund. IL-10 concentrations were highly elevated in the ascites of mice treated with anti-PD-1 antibody alone, but not when administered in combination with a vaccine (Figure 13E). Thus, Th17 vaccination overcame IL-10-mediated resistance to intraperitoneal anti-PD-1 therapy.
[0071] To specifically determine the role of CD4 T cell responses in the efficacy of Th17 DC vaccination alone or in combination with anti-PA-1, T cells were depleted with anti-CD4 monoclonal antibody during vaccination and immune checkpoint blockade therapy. Depletion was maintained by weekly booster injections of anti-CD4 antibody. As shown in Figure 13F, the inclusion of anti-CD4 significantly, though not completely, reversed the protection conferred by the combination of Th17 DC vaccination and anti-PD-1, indicating a clear role for CD4 T cells in the efficacy of the treatment.
[0072] Vaccination with Th17 DCs alone or in combination resulted in CD4 T cell-driven macrophage and eosinophil infiltration into the peritoneal cavity of tumor-bearing mice. Understanding the tumor immune microenvironment during treatment may be useful in several ways, including identifying mechanisms of action and biomarkers. Because no increased immune potency was observed with the inclusion of anti-PD-1, we further examined the immune microenvironment of peritoneal tumors in treated and untreated mice. Treatment of tumor-bearing mice with monotherapy or combination therapy resulted in measurable shifts in cell numbers and immune cell infiltration into the peritoneal cavity 42 days after four vaccinations, as shown in Figures 15A–15E. Induction of peritoneal infiltration was required for vaccination, and anti-PD-1 had little effect on the number of immune cells harvested from the peritoneal cavity (Figure 15A). In control (PBS) and anti-PD-1-treated mice, lymphocytes were the predominant immune effector population (approximately 50-60%), followed by monocytes (DCs and macrophages, approximately 20%) and a minor granulocyte fraction (approximately 5-10%) (Figure 15B). Immunization with the Th17 DC vaccine significantly shifted the distribution, decreasing the proportion of lymphocytes (approximately 20%) and increasing the proportion of monocytes and granulocytes to approximately 50% and 20%, respectively. Inclusion of anti-PD-1 with the vaccine further decreased the lymphocyte fraction to approximately 10% and significantly increased granulocytes to approximately 40-45%.
[0073] A more detailed analysis of lymphocyte subpopulations revealed that the natural lymphocyte response (in control mice) consisted primarily of B cell infiltrates (approximately 60%), while CD4 (15-20%) and CD8 (approximately 10%) T cells comprised smaller subpopulations. Treatment of mice with anti-PD-1 monotherapy slightly increased the B cell subpopulation and had little effect on the proportion of T cells (total or activated) (Figure 15C). Treatment of mice with the Th17 DC vaccine significantly increased the proportion of total and activated CD4 T cells and decreased the proportion of B cells. It is noteworthy that inclusion of anti-PD-1 along with the vaccine did not alter this distribution. The proportions of CD8 T cells and NK cells, which comprise only minor subpopulations of lymphocytes, were also unaffected by either the vaccine or anti-PD-1, although there was a low-level increase in the number of activated CD8 T cells, as assessed by CD69 expression. Thus, the primary impact of vaccination overall, with or without anti-PD-1 therapy, was to shift lymphocyte immunity in favor of CD4 T cell responses and reduce B cell infiltration.
[0074] Given the observation that the vaccine significantly induced shifts within the myeloid cell compartment, we performed additional analysis evaluating the monocyte gate by flow cytometry. In untreated mice, monocytes, representing approximately 20% of the peritoneal infiltrate (Figure 15B), were primarily composed of DCs (approximately 25-30%) and macrophages (approximately 60%), with a smaller proportion of MDSCs (approximately 3-4%) and CD19 cells. + Treatment with anti-PD-1 alone reduced the proportion of DCs (approximately 5%) and eliminated MDSCs (less than 1%), but not CD19, accompanied by a smaller compartment of putative plasma or activated B cells (approximately 15%) (Figure 15D). +The proportion of plasma / activated B cells increased significantly (from approximately 15% to 45%), while the proportion of macrophages remained similar. Th17 DC vaccination alone or in combination with anti-PD-1 significantly reduced the proportion of DCs (approximately 5%), MDSCs (less than 1%), and CD19+ plasma cells (approximately 2-3%), while the proportion of macrophages significantly increased to approximately 90-100% of the total monocytes. Thus, treatment with anti-PD-1 promoted the expansion of B cells, while Th17 vaccination promoted the expansion of macrophages. In the combination approach, the effect of the vaccine appears to be dominant. While granulocytes were a minor fraction (less than 10%) in the control and anti-PD-1 monotherapy groups, vaccination alone or without anti-PD-1 resulted in a significant increase, particularly in the combination treatment group, where granulocytes accounted for approximately 45% of the total immune cell infiltrate (Figure 15B). Subsequent analysis of the granulocyte population revealed that the predominant cell types were eosinophils, CD193+ granulocytes, identified as Siglec-F+, while Ly6G+ neutrophils and FceR1a+, CD200R3+ basophils were minor components.
[0075] FRα-specific Th17 T cell responses can be safely generated in OC patients with minimal residual disease after conventional cytoreductive surgery and adjuvant chemotherapy. To evaluate the safety and immunogenicity of Th17 DC vaccination, we conducted a phase I study in patients with stage IIIC / IV OC in first remission after standard therapy. In contrast to tumor lysates used in mouse studies, this clinical trial targeted folate receptor alpha (FRα), which is overexpressed 80-90-fold in more than 90% of OCs (Li et al., J Nucl Med. 37(4):665-672, 1996). cGMP-grade autologous DCs were generated from peripheral monocytes with p38 MAPK inhibitor and IL-15 and pulsed with five degenerate subdominant MHC class II epitopes from FRα (Kalli et al., Clin Cancer Res. 24(13):3014-3025, 2018). Five immunizations and up to seven boosters were given intradermally. Nineteen patients were enrolled over the 16-month study period. No adverse events of grade 3 or higher were observed. RFS and OS are shown in Figure 16A. At the time of data cutoff, 38.9% of patients were alive and relapse-free, and patients who did not relapse during the vaccine maintenance period remain relapse-free to date (median follow-up: 49.2 months). RFS was very favorable compared with that observed in other recent trials, such as EORTC 55971 and CHORUS (progression-free survival of approximately 10% at 36 months after randomization) and the GOG-0218 bevacizumab phase III clinical trial (progression-free survival of 15% or less at 36 months after randomization) (Vergote et al., Lancet Oncol. 19(12):1680-1771, 2018; Burger et al., N Engl J Med. 365(26):2473-2483, 2011; and Perren et al., N Engl J Med. 365(26):2484-2496, 2011). There was no correlation between survival and MRD or BRCA1 / 2 mutation status.
[0076] Vaccination induced Th17, Th1, and antibody immunity against constitutive FRα epitopes as well as against the entire FRα protein over the 19-week vaccination period; immunity was generally higher among patients who did not relapse (Figures 16B-16D). Comparison of pre- and post-vaccine T cell frequencies showed that the frequency of Th17 responses against FRα increased in 78% (14 / 18) of patients, with responses against all individual epitopes seen in 72-94% of patients. Similar results were observed for Th1 cells specific to each FRα peptide and FRα protein, with 89% (16 / 18) of patients demonstrating Th1 cell responses against FRα. Th1 response rates against the five FRα peptides ranged from 89-100% (Figures 17A-17C). Most patients demonstrated elevated antibodies against the epitope at one or more time points during immunization, with antibody responses targeting the native FRα protein observed in 50% of patients and antibody responses against each vaccine peptide observed in 39-94% of patients. FRα-specific T cell and antibody levels remained elevated compared to baseline throughout study participation (27-104 weeks), suggesting the induction of immunological memory.
[0077] In addition to the high levels of T cell and antibody immunity in relapse-free patients, patients who did not relapse also exhibited higher levels of circulating cytotoxic IgG antibodies against the native FRα protein compared with patients who relapsed (Figure 18). Comparison of other pretreatment biomarkers between relapsed and protected patients revealed no significant differences in circulating Tregs, tumor-infiltrating Tregs, tumor-infiltrating CD8 T cells, tumor PD-L1 expression, or tumor FRα expression. Relapsed patients did not exhibit antigen loss, but showed some evidence that immunization affected the tumor microenvironment by decreasing Treg levels and increasing tumor PD-L1 expression (Figures 19A–19C). These studies indicate that Th17-inducing DC vaccines are safe, induce antigen-specific immunity in most individuals, and are associated with prolonged RFS in some patients.
[0078] In summary, data from humans and mouse modeling suggested the following: (1) Th17 T cells coordinate otherwise ineffective Th1 and Th2 immunity and eliminate tumors independently of CD8 T cells and MHC class I; (2) Th17 T cells release myeloid mediators (MCP5 and LIF), which recruit macrophages and eosinophils to directly kill antibody-coated tumor cells; (3) Th17 T cells release CST3, which elevates IFN-γ levels and sensitizes macrophages and eosinophils; (4) Th17 T cells release RBP4, which prevents M2 (immunosuppressive) polarization of macrophages; (5) Th17 DC vaccines remodel the tumor immune microenvironment; and (6) Th17 DC vaccines prevent anti-PD-1-mediated adaptive resistance and sensitize OCs to ICB therapy. Based on the results described herein, the combination of Th17 DC vaccines and ICB may be an effective treatment strategy to extend the lifespan of women with recurrent ovarian cancer.
[0079] Example 2 – Th17 T cell-inducing vaccines break breast cancer resistance to immune checkpoint blockade In a further study, mice bearing triple-negative breast cancer (TNBC) were treated with Sp17 antigen-loaded Th17-DC vaccine, anti-PD-1, or a combination of antigen-loaded Th17-DC vaccine and anti-PD-1. SP17 is a TNBC tumor antigen. Murine Sp17 antigen was formulated as a series of 32-amino acid peptides overlapping by 10 amino acids, covering residues 1-142 of the Sp17 sequence (the full-length sequence is 151 amino acids long). Th17-DCs were loaded with 50 μg / mL of individual peptides on day 5 (when maturation cytokines were also added) and harvested and pooled on day 7. Mice were treated with 1x10 5 E0771 TNBC was subcutaneously implanted in or around the mammary fat pad. Mice were then treated with Th17 DC vaccine (n=10), anti-PD-1 (n=10), Th17 DC vaccine and anti-PD-1 (n=8), or no treatment (n=10). Th17-DC vaccination (1x10 6Th17-DC cells (intraperitoneally administered) were administered every 7 days starting on day 7 after tumor implantation for a total of four vaccinations, and anti-PD-1 (Bio X Cell) was administered intraperitoneally at a dose of 200 μg in 0.1 mL of PBS on days 3 and 5 after each Th17-DC vaccination. Mice were sacrificed when tumors exceeded 1 cm in diameter. As shown in the Kaplan-Meier plot in Figure 20, mice treated with the combination therapy showed significantly extended survival compared to the control (untreated) group (p=0.0112, Mantel-Cox) and the group treated with anti-PD-1 alone (p=0.0005).
[0080] [Table 2]
[0081] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the above description is intended to be illustrative and not limiting of the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. 1. A method of treating a mammal having cancer, the method comprising administering to the mammal an effective amount of a vaccine composition capable of activating T cells in the mammal to form activated IL-17-secreting T cells capable of recognizing one or more antigens expressed by the cancer.
2. The method of claim 1, wherein the mammal is a human.
3. 10. The method of claim 1, wherein the cancer is ovarian cancer, melanoma, chronic lymphocytic leukemia, gastric cancer, cervical cancer, colon cancer, breast cancer, or lung cancer.
4. 2. The method of claim 1, wherein the vaccine composition comprises dendritic cells (DCs) that present one or more folate receptor alpha (FRα) antigens.
5. The method of claim 4, wherein the one or more FRα antigens comprise one or more peptides having the amino acid sequence set forth in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:
14.
6. Mammals, approximately 5 x 10 6 From about 50 x 10 6 The method of claim 1, comprising administering a dose of the DC composition.
7. 10. The method of claim 1, comprising administering the vaccine composition to the mammal two or more times over a period of about 2 weeks to about 16 weeks.
8. 10. The method of claim 1, further comprising the step of monitoring the mammal after the administering step to determine the efficacy of the vaccine composition in the mammal.
9. 10. The method of claim 8, wherein the monitoring comprises using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging.
10. 9. The method of claim 8, wherein the monitoring comprises measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after administering steps (a) and (b), and the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4.
11. 10. The method of claim 1, further comprising administering to the mammal an effective amount of an immune checkpoint inhibitor (ICI).
12. 12. The method of claim 11, wherein the ICI is selected from the group consisting of pembrolizumab, atezolizumab, nivolumab, durvalumab, avelumab, tremelimumab, ipilimumab, and cemiplimab.
13. 12. The method of claim 11, comprising administering to the mammal a dose of about 50 mg to about 1500 mg of an ICI.
14. 12. The method of claim 11, comprising administering the ICI to the mammal two or more times over a period of about 2 weeks to about 16 weeks.
15. The method of claim 11, further comprising the step of monitoring the mammal after the administering step to determine the efficacy of the vaccine composition and ICI in the mammal.
16. 16. The method of claim 15, wherein the monitoring comprises using computed tomography, positron emission tomography / computed tomography, bone scan, or magnetic resonance imaging.
17. 16. The method of claim 15, wherein the monitoring comprises measuring the level of one or more biomarkers in a tumor biopsy obtained from the mammal after administering steps (a) and (b), and the one or more biomarkers are selected from the group consisting of CCL6, CX3CL1, CXCL16, GM-CSF, ICAM-1, IL-1a, LIX, osteoprotegerin, and RBP-4.