PSMA and CA9 targeting system

Abstract

Provided herein are antibodies and chimeric priming receptors that bind to PSMA, and antibodies and chimeric antigen receptors that bind to CA9. Also provided are systems for chimeric priming receptors that bind to PSMA and chimeric antigen receptors that bind to CA9, cells expressing such systems, and methods for their use.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 488,386, filed March 3, 2023, U.S. Provisional Application No. 63 / 489,837, filed March 13, 2023, U.S. Provisional Application No. 63 / 495,869, filed April 13, 2023, U.S. Provisional Application No. 63 / 578,854, filed August 25, 2023, U.S. Provisional Application No. 63 / 601,617, filed November 21, 2023, U.S. Provisional Application No. 63 / 613,712, filed December 21, 2023, and U.S. Provisional Application No. 63 / 618,233, filed January 5, 2024, each of which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing, which is incorporated herein by reference in its entirety. The XML copy was created on February 23, 2024, is named ANB-221WO_SL.XML, and is 443,727 bytes in size. [Background technology]

[0003] background Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches to treating cancer have been attempted, including drug and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells the new ability to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.

[0004] Immunotherapy using CAR-T cells holds promise because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them.

[0005] After engineering T cells with CARs, the resulting CAR-T cells are introduced into patients to attack tumor cells. CAR-T cells can be derived either from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). When CAR-T cells are infused into a patient, they come into contact with target antigens on cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate anti-tumor cytokine production, and target tumor cell killing.

[0006] However, several concerns and limitations remain with CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of the target antigen, resulting in off-target toxicity. For example, both primary and metastatic sites of ccRCC are highly vascularized, and the majority of tumor cells express elevated levels of carbonic anhydrase IX (CA9). However, CA9 is also expressed in healthy bile duct and stomach tissues, which resulted in on-target, off-tumor toxicity in patients treated with constitutive CA9 CAR T cells. Therefore, additional therapies that reduce off-target toxicity remain desirable. Summary of the Invention

[0007] overview In one aspect, an isolated antibody or antigen-binding fragment thereof that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1), comprising a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; Provided herein are isolated antibodies or antigen-binding fragments thereof.

[0008] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:99 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:100.

[0009] In some embodiments, the antibody comprises an scFv.

[0010] In some embodiments, the scFv comprises the sequence set forth in SEQ ID NO:98.

[0011] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:110.

[0012] In one aspect, an isolated receptor comprising an extracellular antigen-binding domain that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1), said receptor comprising a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; An isolated receptor is provided herein.

[0013] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:99 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:100.

[0014] In some embodiments, the CAR comprises an scFv.

[0015] In some embodiments, the scFv comprises the sequence set forth in SEQ ID NO:98.

[0016] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:110.

[0017] In some embodiments, the receptor is, in the N-terminal to C-terminal direction, i. an extracellular antigen-binding domain; ii. a transmembrane domain; iii. an optional intracellular costimulatory domain; and iv. Intracellular activation domain and It is a chimeric antigen receptor (CAR) comprising:

[0018] In some embodiments, the CAR further comprises a hinge domain.

[0019] In some embodiments, the hinge domain comprises a CD8α, or a truncated CD8α, or a CD28 hinge domain.

[0020] In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain or a CD28 transmembrane domain.

[0021] In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain.

[0022] In some embodiments, the intracellular activation domain comprises a CD3 zeta domain.

[0023] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 108, 115, 250, or 251.

[0024] In one aspect, an isolated antibody or antigen-binding fragment thereof that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; Provided herein are isolated antibodies or antigen-binding fragments thereof.

[0025] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:118 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:119.

[0026] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:130 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:131.

[0027] In some embodiments, the antibody comprises an scFv.

[0028] In some embodiments, the scFv comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0029] In one aspect, an isolated receptor comprising an extracellular antigen-binding domain that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; An isolated receptor is provided herein.

[0030] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:118 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:119.

[0031] In some embodiments, the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:130 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:131.

[0032] In some embodiments, the priming receptor comprises an scFv.

[0033] In some embodiments, the scFv comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0034] In some embodiments, the receptor is, in the N-terminal to C-terminal direction, i. an extracellular antigen-binding domain; ii. a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and iii. an intracellular domain comprising a human or humanized transcriptional effector; wherein binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

[0035] In some embodiments, the priming receptor further comprises a hinge domain disposed between the extracellular antigen-binding domain and the transmembrane domain.

[0036] In some embodiments, the hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0037] In some embodiments, the hinge domain comprises the sequence set forth in SEQ ID NO:85.

[0038] In some embodiments, the transmembrane domain comprises a Notch1 transmembrane domain.

[0039] In some embodiments, the transmembrane domain comprises the sequence set forth in SEQ ID NO:86.

[0040] In some embodiments, the intracellular domain comprises an HNF1α / p65 domain or a Gal4 / VP64 domain.

[0041] In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO: 88, 89, or 90.

[0042] In some embodiments, the priming receptor further comprises a stop transport sequence or juxtamembrane domain between the transmembrane domain and the intracellular domain.

[0043] In some embodiments, the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:87.

[0044] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 127, 138, 252, or 253.

[0045] In one aspect, i. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2); ii. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1); and iii. optionally, a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and iv. Below: 1. A nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3, and 2. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4 and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides complementary to Provided herein is a system comprising:

[0046] In some embodiments, the first extracellular antigen-binding domain comprises a first variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a first variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137.

[0047] In some embodiments, the first VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

[0048] In some embodiments, the first VL chain sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

[0049] In some embodiments, the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0050] In some embodiments, the second extracellular antigen-binding domain comprises a second variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a second variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113.

[0051] In some embodiments, the second VH comprises the sequence set forth in SEQ ID NO: 99 or 110.

[0052] In some embodiments, the second VL comprises the sequence set forth in SEQ ID NO:100.

[0053] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

[0054] In one aspect, i. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131, and optionally ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125; or iii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; a first chimeric polypeptide; and iv. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and v. optionally, a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and vi. Below: 1. A nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3, and 2. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4 and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides complementary to Provided herein is a system comprising:

[0055] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

[0056] In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

[0057] In some embodiments, the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0058] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1).

[0059] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113.

[0060] In some embodiments, the VH comprises the sequence set forth in SEQ ID NO:99 or 110.

[0061] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:100.

[0062] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

[0063] In one aspect, i. a first chimeric polypeptide comprising a priming receptor; ii. A second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds carbonic anhydrase IX (CA9) (SEQ ID NO: 1), wherein the extracellular antigen-binding domain comprises a single domain antibody, wherein the single domain antibody comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 110, and optionally iii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106; or iv. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; a second chimeric polypeptide; and v. optionally, a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and vi. Below: 1. A nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3, and 2. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4 and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides complementary to Provided herein is a system comprising:

[0064] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:99 or 110.

[0065] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:100.

[0066] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

[0067] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA).

[0068] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137.

[0069] In some embodiments, the VH comprises the sequence set forth in SEQ ID NO: 118 or 130.

[0070] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 119 or 131.

[0071] In some embodiments, the first extracellular domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0072] In some embodiments, the priming receptor comprises, in the N-terminal to C-terminal direction: i. a first extracellular antigen-binding domain; and ii. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and iii. an intracellular domain comprising a human or humanized transcriptional effector; wherein binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

[0073] In some embodiments, the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain.

[0074] In some embodiments, the first hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0075] In some embodiments, the first hinge comprises the sequence set forth in SEQ ID NO:85.

[0076] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.

[0077] In some embodiments, the transmembrane domain comprises the sequence set forth in SEQ ID NO:86.

[0078] In some embodiments, the intracellular domain comprises an HNF1α / p65 domain or a Gal4 / VP64 domain.

[0079] In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO: 88, 89, or 90.

[0080] In some embodiments, the priming receptor further comprises a stop transport sequence or a juxtamembrane domain between the first transmembrane domain and the intracellular domain.

[0081] In some embodiments, the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:87.

[0082] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 127, 138, 252, or 253.

[0083] In some embodiments, the CAR comprises, from N-terminus to C-terminus: i. a second extracellular antigen-binding domain; and ii. a second transmembrane domain; and iii. an intracellular costimulatory domain; and iv. Intracellular activation domain and Includes:

[0084] In some embodiments, the CAR comprises a second hinge domain.

[0085] In some embodiments, the second hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0086] In some embodiments, the second transmembrane domain comprises a CD8α transmembrane domain.

[0087] In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain.

[0088] In some embodiments, the intracellular activation domain comprises a CD3 zeta domain.

[0089] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 108, 115, 250, or 251.

[0090] In some embodiments, the priming receptor and the CAR are capable of binding to the same target cell if the target cell expresses PSMA and CA9.

[0091] In some embodiments, at least one or more nucleic acid sequences are at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0092] In some embodiments, the at least one or more nucleic acid sequences is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0093] In some embodiments, at least one or more nucleic acid sequences is an shRNA.

[0094] In some embodiments, the at least one or more nucleic acid sequences comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-82.

[0095] In some embodiments, the nucleic acid sequence complementary to human FAS comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20.

[0096] In some embodiments, the nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0097] In some embodiments, the nucleic acid sequence complementary to human TGFBR2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82.

[0098] In some embodiments, the nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0099] In some embodiments, the system comprises at least two nucleic acid sequences complementary to human TGFBR2 selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82.

[0100] In some embodiments, the system includes at least one first nucleic acid sequence complementary to a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:3, and a second nucleic acid sequence complementary to a nucleic acid encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:4.

[0101] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0102] In some embodiments, the first nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid, and the second nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0103] In some embodiments, the system further comprises a third nucleic acid sequence complementary to an mRNA encoding human TGF-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:4.

[0104] In some embodiments, the third nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the third nucleic acid.

[0105] In some embodiments, the antibody further comprises at least one nucleic acid sequence complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:5.

[0106] In some embodiments, the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:5.

[0107] In some embodiments, the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33.

[0108] In some embodiments, the nucleic acid reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0109] In some embodiments, the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3, and / or STAT5 phosphorylation.

[0110] In some embodiments, the SPA comprises an extracellular domain linked to an intracellular signaling domain.

[0111] In some embodiments, the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

[0112] In some embodiments, the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

[0113] In some embodiments, the cytokine receptor comprises interleukin-6 signal transducer (IL6ST).

[0114] In some embodiments, the SPA comprises the sequence set forth in SEQ ID NO: 141 or 254.

[0115] In some embodiments, the extracellular domain transmits constitutive activity to the intracellular signaling domain.

[0116] In some embodiments, the target cell is a human cell.

[0117] In some embodiments, the target cells are cancer cells.

[0118] In some embodiments, the cancer cells are solid cancer cells or liquid cancer cells.

[0119] In some embodiments, the cancer cells are kidney cells, colon cells, or lung cells.

[0120] In one aspect, provided herein is a nucleic acid comprising a nucleotide sequence encoding an antibody disclosed herein.

[0121] In one aspect, provided herein is a nucleic acid comprising a nucleotide sequence encoding an antibody disclosed herein.

[0122] In one aspect, provided herein is a nucleic acid comprising a nucleotide sequence encoding a chimeric antigen receptor disclosed herein.

[0123] In one aspect, provided herein is a nucleic acid comprising a nucleotide sequence encoding a priming receptor disclosed herein.

[0124] In one aspect, provided herein is one or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system disclosed herein.

[0125] In one aspect, i. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA); ii. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9); and iii. optionally, a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and iv. Below: 1. A nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3, and 2. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4 and at least one nucleic acid sequence of at least 15 nucleotides in length complementary to Provided herein are one or more nucleic acids encoding

[0126] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0127] In some embodiments, the first extracellular antigen-binding domain comprises a heavy chain comprising a first variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a light chain comprising a first variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137.

[0128] In some embodiments, the first VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 118 or 130, and the first VL chain sequence comprises the VL sequence set forth in SEQ ID NO: 119 or 131.

[0129] In some embodiments, the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

[0130] In some embodiments, the second extracellular antigen-binding domain comprises a heavy chain comprising a second variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a light chain comprising a second variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113.

[0131] In some embodiments, the second VH comprises the sequence set forth in SEQ ID NO: 99 or 110.

[0132] In some embodiments, the second VL comprises the sequence set forth in SEQ ID NO:100.

[0133] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

[0134] In some embodiments, at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0135] In some embodiments, the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0136] In some embodiments, at least one nucleic acid sequence is an shRNA.

[0137] In some embodiments, the at least one or more nucleic acid sequences comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-82.

[0138] In some embodiments, the at least one or more nucleic acid sequences comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20.

[0139] In some embodiments, at least one or more nucleic acids reduce expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0140] In some embodiments, the at least one or more nucleic acid sequences comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82.

[0141] In some embodiments, at least one or more nucleic acids reduce expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0142] In some embodiments, the at least one or more nucleic acids further comprise at least one nucleic acid sequence complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:5.

[0143] In some embodiments, the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:5.

[0144] In some embodiments, the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33.

[0145] In some embodiments, the nucleic acid reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0146] In some embodiments, at least one or more nucleic acid sequences are encoded in at least one intron region of a nucleic acid.

[0147] In some embodiments, the nucleic acid is selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

[0148] In one aspect, provided herein are one or more nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds PSMA; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9; a synthetic pathway activator (SPA); and at least one nucleic acid sequence at least 15 nucleotides in length, wherein the at least one nucleic acid sequence comprises one or more of: (1) a first nucleic acid sequence complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3; and (2) a second nucleic acid sequence complementary to a nucleic acid encoding a human transforming growth factor (TGF)-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:4.

[0149] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0150] In one aspect, provided herein is one or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleic acid disclosed herein.

[0151] In some embodiments, the nucleic acid comprises two or more nucleic acid fragments.

[0152] In some embodiments, the nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

[0153] In some embodiments, the nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0154] In some embodiments, the nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0155] In some embodiments, the constitutive promoter is EF1α.

[0156] In some embodiments, the EF1α promoter comprises the sequence set forth in SEQ ID NO:179.

[0157] In some embodiments, the inducible promoter comprises one or more hepatocyte nuclear factor 1α (HNF1α) enhancer elements.

[0158] In some embodiments, the inducible promoter further comprises a YB-TATA promoter sequence.

[0159] In some embodiments, the inducible promoter comprises the sequence set forth in SEQ ID NO:256.

[0160] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: i. a constitutive promoter; ii. a nucleotide sequence encoding a priming receptor; iii. an inducible promoter; iv. a nucleotide sequence encoding a chimeric antigen receptor; v. optionally, a nucleotide sequence encoding an SPA; Includes:

[0161] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: i. an inducible promoter; ii. a nucleotide sequence encoding a chimeric antigen receptor; iii. a constitutive promoter; iv. a nucleotide sequence encoding a priming receptor; v. optionally, a nucleotide sequence encoding an SPA; Includes:

[0162] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: i. a first constitutive promoter; ii. a nucleotide sequence encoding a priming receptor; iii. a second constitutive promoter; and iv. a nucleotide sequence encoding at least one nucleic acid complementary to human FAS or human TGFBR2; v. an inducible promoter; vi. optionally, a nucleotide sequence encoding a chimeric antigen receptor; and vii. a nucleotide sequence encoding SPA; Includes:

[0163] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: i. a first constitutive promoter; ii. a nucleotide sequence encoding a priming receptor; iii. a second constitutive promoter; and iv. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; v. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; vi. an inducible promoter; vii. a nucleotide sequence encoding a chimeric antigen receptor; and viii. optionally, a nucleotide sequence encoding an SPA; and Includes:

[0164] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction: i. an inducible promoter; ii. a nucleotide sequence encoding a chimeric antigen receptor; iii. a second constitutive promoter; and iv. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; v. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; vi. a first constitutive promoter; vii. a nucleotide sequence encoding a priming receptor; viii. optionally, a nucleotide sequence encoding an SPA; and Includes:

[0165] In some embodiments, the nucleic acid is selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

[0166] In some embodiments, the nucleic acid further comprises 5' and 3' homology directed repair arms that are complementary to the insertion site in the host cell chromosome.

[0167] In some embodiments, the nucleic acid further comprises a nucleotide sequence encoding a self-cleaving 2A peptide (P2A).

[0168] In some embodiments, P2A is present at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0169] In some embodiments, P2A is present at the 3' end of the nucleotide sequence encoding the priming receptor.

[0170] In some embodiments, the nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).

[0171] In some embodiments, a WPRE is present at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor, or a WPRE is present at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0172] In some embodiments, the nucleic acid further comprises an SV40 or human growth hormone (GH1) polyA element.

[0173] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector.

[0174] In some embodiments, the expression vector is a non-viral vector.

[0175] In one aspect, provided herein is a vector comprising a nucleic acid disclosed herein.

[0176] In some embodiments, the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

[0177] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0178] In one aspect, i. a system as disclosed herein; ii. at least one nucleic acid disclosed herein, and / or iii. Vectors disclosed herein Provided herein is a cell comprising:

[0179] In some embodiments, the cell is an immune cell.

[0180] In one aspect, i. a system as disclosed herein; ii. at least one nucleic acid disclosed herein, and / or iii. Vectors disclosed herein Provided herein is an immune cell comprising:

[0181] In some embodiments, the immune cells are primary human immune cells.

[0182] In some embodiments, the immune cells are allogeneic immune cells.

[0183] In some embodiments, the immune cells are autoimmune cells.

[0184] In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors.

[0185] In some embodiments, the primary immune cells are primary T cells.

[0186] In some embodiments, the primary immune cells are primary human T cells.

[0187] In some embodiments, the primary immune cells are virus-free. The primary immune cells contain at least one nucleic acid comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, and optionally a synthetic pathway activator inserted into a target region of the genome of the primary immune cells, and the primary immune cells do not contain a viral vector for introducing the nucleic acid into the primary immune cells.

[0188] In one aspect, provided herein is a primary immune cell comprising at least one nucleic acid, wherein the at least one nucleic acid comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA, a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9, and optionally a synthetic pathway activator inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the nucleic acid into the primary immune cell.

[0189]

[0009] In one aspect, provided herein are virus-free viable primary cells comprising a ribonucleoprotein complex (RNP)-nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the nucleic acid comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA, a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9, and optionally a synthetic pathway activator, wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0190] In some embodiments, the cell further comprises at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: a first nucleic acid sequence complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3; and a second nucleic acid sequence complementary to a nucleic acid encoding a human transforming growth factor (TGF)-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:4.

[0191] In some embodiments, the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

[0192] In one aspect, provided herein is a population of cells comprising a plurality of cells or immune cells disclosed herein.

[0193] In one aspect, provided herein is a pharmaceutical composition comprising a cell or immune cell disclosed herein or a population of cells or immune cells disclosed herein and a pharmaceutically acceptable excipient.

[0194] In one aspect, provided herein is a pharmaceutical composition comprising a nucleic acid disclosed herein or a vector disclosed herein and a pharmaceutically acceptable excipient.

[0195] In one aspect, provided herein is a method of editing a cell, the method comprising inserting a nucleic acid disclosed herein into an insertion site in the genome of the cell.

[0196] In some embodiments, the nucleic acid is introduced into the cell non-virally.

[0197] In one embodiment, there is provided a method of editing a cell, comprising: i. providing a nuclease domain and a guide RNA, wherein the nucleic acid comprises a nucleic acid disclosed herein, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of a cell; ii. introducing a nuclease domain and a nucleic acid into a cell, wherein the guide RNA specifically hybridizes to a target region of the cell's genome and the nuclease domain cleaves the target region to create an insertion site within the cell's genome; iii. Editing the cell via insertion of a nucleic acid into an insertion site in the genome of the cell; A method is provided herein, comprising:

[0198] In some embodiments, the nuclease domain and nucleic acid are introduced into the cell non-virally.

[0199] In one embodiment, there is provided a method for editing immune cells, comprising: i. providing a ribonucleoprotein complex (RNP)-nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the nucleic acid comprises a nucleic acid disclosed herein, wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of an immune cell; ii. Non-virally introducing an RNP-nucleic acid complex into an immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell, and the nuclease domain cleaves the target region to create an insertion site within the genome of the immune cell; iii. editing an immune cell via insertion of a nucleic acid disclosed herein into an insertion site in the genome of the immune cell; A method is provided herein, comprising:

[0200] In some embodiments, the non-viral introducing comprises electroporation.

[0201] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0202] In some embodiments, the target region of the cell's genome is the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0203] In some embodiments, the nucleic acid is a double-stranded nucleic acid or a single-stranded nucleic acid.

[0204] In some embodiments, the nucleic acid is a linear nucleic acid or a circular nucleic acid, and optionally the circular nucleic acid is a plasmid.

[0205] In some embodiments, the immune cells are primary human immune cells.

[0206] In some embodiments, the immune cells are autoimmune cells.

[0207] In some embodiments, the immune cells are allogeneic immune cells.

[0208] In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0209] In some embodiments, the immune cells are primary T cells.

[0210] In some embodiments, the immune cells are primary human T cells.

[0211] In some embodiments, the immune cells are virus-free.

[0212] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the nucleic acid in vitro.

[0213] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell disclosed herein or a pharmaceutical composition disclosed herein.

[0214] In some embodiments, the disease is cancer.

[0215] In some embodiments, the cancer is a solid or liquid cancer.

[0216] In some embodiments, the cancer is kidney cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0217] In some embodiments, by administration of immune cells, by an immune response in the subject.

[0218] In some embodiments, the enhanced immune response is an adaptive immune response.

[0219] In some embodiments, the enhanced immune response is an innate immune response.

[0220] In some embodiments, the enhanced immune response is an increase in expression of at least one cytokine or chemokine.

[0221] In some embodiments, the cytokine is interferon-gamma (IFNγ).

[0222] In some embodiments, the method further comprises administering to the subject immunotherapy, either simultaneously with or after the immune cells.

[0223] In one aspect, provided herein is a method of inhibiting target cells in a subject, the method comprising administering to the subject an immune cell disclosed herein, wherein the immune cell inhibits the target cells.

[0224] In some embodiments, the target cells express PSMA and CA9.

[0225] In some embodiments, the target cells are cancer cells.

[0226] In one embodiment, there is provided a method of inducing expression of a chimeric antigen receptor in a cell or immune cell with a priming receptor, comprising: i. Below: ii. a system as disclosed herein; iii. a nucleic acid disclosed herein, and / or iv. Vectors Disclosed herein Obtaining cells or immune cells comprising the v. contacting the immune cells with target cells that express PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cells induces activation of the priming receptor and expression of the chimeric antigen receptor; A method is provided herein, comprising:

[0227] In one embodiment, there is provided a method of modulating the activity of a cell or immune cell, comprising: i. Below: ii. a system as disclosed herein; iii. a nucleic acid disclosed herein, and / or iv. Vectors Disclosed herein Obtaining cells or immune cells comprising the v. contacting a cell or immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of a chimeric antigen receptor, and binding of the chimeric antigen receptor to CA9 on the target cell modulates the activity of the immune cell; A method is provided herein, comprising:

[0228] In some embodiments, modulating immune cell activity comprises enhancing an immune response.

[0229] In some embodiments, the enhanced immune response is an adaptive immune response.

[0230] In some embodiments, the enhanced immune response is an innate immune response.

[0231] In some embodiments, the immune cell activity is increased expression of at least one cytokine or chemokine.

[0232] In some embodiments, the cytokine is interferon-gamma (IFNγ).

[0233] In one embodiment, there is provided a method of treating a disease in a subject, comprising: i. The presence of PSMA-positive (PSMA+) cells is or has been determined from a cancer sample obtained from the subject; and ii. The presence of CA9-positive (CA+) cells is or has been determined from a cancer sample obtained from the subject; and iii. administering to a subject a cell or immune cell disclosed herein, or a pharmaceutical composition disclosed herein; A method is provided herein, comprising:

[0234] In some embodiments, the disease is cancer.

[0235] In some embodiments, the cancer is a solid or liquid cancer.

[0236] In some embodiments, the cancer is kidney cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0237] In some embodiments, administration of the immune cells enhances the immune response in the subject.

[0238] In some embodiments, the enhanced immune response is an adaptive immune response.

[0239] In some embodiments, the enhanced immune response is an innate immune response.

[0240] In some embodiments, the enhanced immune response is an increase in expression of at least one cytokine or chemokine.

[0241] In some embodiments, the cytokine is interferon-gamma (IFNγ).

[0242] In some embodiments, the method further comprises administering to the subject immunotherapy, either simultaneously with or after the immune cells. [Brief explanation of the drawings]

[0243] These and other features, aspects, and advantages of the present disclosure will become better understood with regard to the following description and accompanying drawings. [Figure 1A] Diagrams of various ICT transgene cassettes expressing logic gates 1-5 integrated circuits (ICs), shRNA, and SPA are provided. [Figure 1B] An exemplary insert cassette encoding the logic gates (priming receptor (primeR) and CAR) and shRNA module is shown. [Figure 2A] Binding of CA9 1 antigen synthetic fragments to HEK293T-CA9 cells (expressing human CA9) but not to parental HEK293T cells is shown. [Figure 2B] 1 shows that the CA9 1 antigen-binding fragment did not bind to HEK293T-mCA9 cells (expressing mouse CA9). [Figure 2C] 1 shows that the CA9 1 antigen-binding fragment had no interaction with HEK293T-ASGR1+ cells over a range of concentrations up to 5 ug / mL. [Figure 2D]Both CA9 1 and CA9 2 are shown to bind to cells expressing wt CA9 (293T-LP81-CA9) as well as cells expressing three different isoforms of CA9:91-96del CA9, R131Q CA9, and Q326R CA9. [Figure 3A] 1 shows binding of PSMA 1 antigen-binding fragments to HEK293T-PSMA (expressing human PSMA) cells but not to parental HEK293T cells. [Figure 3B] 1 shows that the PSMA 1 antigen-binding fragment did not bind to HEK293T-mPSMA cells (expressing mouse PSMA9). [Figure 3C] Shown are both PSMA 1 scFv and PSMA 2 scFv bound to cells expressing PSMA isoform SNP Y75H and cells expressing wt PSMA (293T-LP81-PSMA). [Figure 4A] All ICT cells constitutively expressed the priming receptor (PrimeR) construct. [Figure 4B] 1 shows that ICT cells induced CA9 CAR expression when co-cultured with a cell line expressing PSMA. [Figure 5] Figure 1 shows that inclusion of the shRNA module in ICT cells resulted in a decrease in the MFI of both FAS and TGFBR2 in ICT cells expressing the primed receptor-CAR logic gate (PrimeR+) normalized to non-edited cells (PrimeR-). [Figure 6] The results show that SPA-expressing ICT cells exhibit approximately 2 logs higher pSTAT3 expression compared to PrimeR-cells (EGFRt) lacking SPA. [Figure 7] Figure 7A shows cytotoxicity against parental K562 cells that do not express either CA9 or PSMA. Figure 7B shows cytotoxicity against K562 cells that express only CA9. Figure 7C shows cytotoxicity against K562 cells that express only PSMA. Figure 7D shows cytotoxicity against K562 cells that express both PSMA and CA9. [Figure 8] IFN-γ production from ICTs expressing logic gates 1–5 only in supernatants harvested from cocultures in which target cells expressed either PSMA alone (left bar) and target cells with PSMA and CA9 (right bar) is shown. [Figure 9A] We show that ICTs expressing logic gates 1–5 demonstrated in vitro cytotoxicity against the A498-PSMAmed cell line expressing endogenous CA9 antigen. [Figure 9B] IFNγ, TNFα, GM-CSF, and IL-2 secretion by ICT cells after co-culture with A498-PSMA cells is shown. [Figure 10] 1 shows that co-culture with HUVEC-PSMA induced the expression of CAR protein on ICT cells and the specific killing of CA9+ cells. [Figure 11] Figure 11A shows that ICT cytotoxicity was unaffected by soluble CA9, and Figure 11B shows that ICT cytotoxicity was unaffected by soluble PSMA. [Figure 12A] Shown are tumor volumes after tumor implantation in mice treated with ICTs expressing Logic Gates 1-5, RNP, or PBS generated from donor 1. [Figure 12B] Expansion of total T cells and ICTs at day 12 post-inoculation, followed by contraction by day 21, is shown. [Figure 12C] Total T cells expressing the priming receptor on days 12 and 21 are shown. [Figure 12D] Shown are tumor volumes after tumor implantation in mice treated with ICTs expressing Logic Gates 1-5, RNP, or PBS generated from donor 2. [Figure 12E] Expansion of total T cells and ICTs at day 12 post-inoculation, followed by contraction by day 21, is shown. [Figure 12F] Total T cells expressing the priming receptor on days 12 and 21 are shown. [Figure 13]Figure 13A shows tumor growth inhibition (TGI) in single-positive CA9 only flanks, and Figure 13B shows tumor growth inhibition (TGI) in double-positive PSMA-CA9 flanks. [Figure 14] We show that TGFBR knockdown protects ICT cells from TGFβ-mediated inhibition. [Figure 15] 1 shows exemplary synthetic pathway activators and demonstrates that synthetic pathway activators increase potency and T stem memory phenotypes. [Figure 16] This shows that ICT was more powerful than traditional CAR-T benchmarks. [Figure 17A] We show that ICT cells can be primed during transmigration and are capable of killing CA9+ tumor cells. [Figure 17B] We show that T cells can be primed during transmigration and are able to kill CA9+ tumor cells, whereas unprimed ICT cells do not exhibit cytotoxicity. [Figure 18-1] FIG. 18 shows co-expression of PSMA and CA9 mRNA in ccRCC, with limited overlapping expression in normal tissues. [Figure 18-2] See description of Figure 18-1. [Figure 19] Representative images of endothelial cells in ccRCC tumor samples stained with anti-PSMA at different staining intensities at 40x magnification and maximum PSMA intensity according to different ccRCC stages are shown. [Figure 20] Representative images of endothelial cells in ccRCC tumor samples stained with anti-CA9 at different staining intensities at 40x magnification and the percent positivity of CA9 in ccRCC tumor samples according to different ccRCC stages are shown. [Figure 21] Figure 21A provides representative images of ccRCC tumor samples co-stained for PSMA and CA9 at 20x magnification. Figure 21B shows co-expression of PSMA and CA9 in ccRCC via IHC (n=416). Figure 21C provides co-positive measurements of PSMA and CA9 in metastatic specimens. [Figure 22] 1 provides images of CA9 and PSMA IHC staining in ccRCC samples relative to normal adjacent kidney samples. [Figure 23] 1 shows the percentage of colorectal cancer patient samples based on the CO1922 tissue microarray (TMA) that showed expression of both PSMA and CA9. [Figure 24] The percentage of lung cancer patients based on the LC819a TMA who exhibited both PSMA and CA9 expression is shown. The number of patient specimens positive for both PSMA and CA9 is listed as n, with the percentage (%) below. [Figure 25] Provided are estimated numbers of patients who could benefit from treatment with the PSMA primeR / CA9 CAR logic-gated T cells described herein. These numbers are calculated based on estimated new deaths from cancer types from the American Cancer Society in 2023. [Figure 26] The design of the phase I study is provided. DETAILED DESCRIPTION OF THE INVENTION

[0244] Detailed Description definition Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0245] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a segment of DNA located along a chromosome that encodes a specific protein or segment of a protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. A gene may further include a terminator, an enhancer, and / or a silencer.

[0246] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0247] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene, as defined herein, may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.

[0248] As used herein, the term "insert" refers to a nucleotide sequence that is integrated (inserted) into a target locus or a safe harbor site. Inserts can be used to refer to genes or genetic elements that are integrated into a target locus or a safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into a genomic region known to those skilled in the art.

[0249] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create a compatible overlap, and then joining the molecules together using ligase. Those skilled in the art will be very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, drawings, and tables.

[0250] The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are referred to as small guide RNAs (sgRNAs).

[0251] Cas9 homologs are found in a wide variety of fungi, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737; Nat. Rev. Microbiol. 2011 June;9(6):467-477; Hou, et al., Proc Natl Acad Sci USA. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.

[0252] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin or derived therefrom). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex comprising a Cas9 protein, a tracrRNA, and a crRNA-guide RNA).

[0253] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0254] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, optionally sorted, and used directly, for example, without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-γ, or a combination thereof.

[0255] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and identified a specific foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or T cells from mammals. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +T cells can be any type of T cell, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral, including, but not limited to, blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδ T cells, and the like. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells) and effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem or progenitor cells.

[0256] "CD4+ T cells" refer to a subset of T cells that express CD4 on their surface and are involved in cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II-restricted immune responses. On T lymphocytes, the CD4 antigen defines helper / inducer subsets.

[0257] "CD8+ T cells" refer to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.

[0258] As used herein, the phrase "hematopoietic stem cells" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can also be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells express c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 -、 CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells express CD150 + CD48 - CD244 - is.

[0259] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic cells can be obtained or provided by isolating hematopoietic stem cells and differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into additional cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.

[0260] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.

[0261] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, i.e., covalently linking them to a nucleic acid sequence in the chromosomal DNA of the cell. It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" can further include the replacement of the deleted endogenous sequence or nucleotides with one or more inserted nucleotides.

[0262] As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, e.g., by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in connection with expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in connection with expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.

[0263] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequences, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.

[0264] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0265] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a native polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a naturally occurring polypeptide having less than 100% sequence identity to the native polypeptide) or a fragment thereof.

[0266] As used herein, the terms "complementary" or "complementarity" refer to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described herein can include a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a sequence, e.g., a genomic sequence in a cell.

[0267] As used herein, the term "transgene" refers to a polynucleotide that is transferred from one organism to another, either naturally or by any of several genetic engineering techniques, and that is optionally translated into a polypeptide. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0268] "Protein," "polypeptide," and "peptide" are used interchangeably herein.

[0269] As used herein, the terms "operably linked" or "operably linked" refer to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if it is capable of affecting the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a control sequence in both sense and antisense orientations.

[0270] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively developing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).

[0271] As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG) and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of skill in the art.

[0272] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.

[0273] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived entirely from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0274] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, a hepatocyte nuclear factor 1 alpha (HNF1α), etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter, an EF1α promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.). See, e.g., U.S. Publication No. 2018 / 0127786, the disclosure of which is incorporated herein by reference in its entirety.

[0275] As contemplated herein, gene editing can involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such a knocked-in DNA sequence may include an entire gene or multiple genes, and may include regulatory sequences associated with the gene or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a protein can be inserted into the genome of a cell carrying a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either deleting or adding a nucleotide sequence, which leads to a disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.

[0276] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nick ends of DNA strands are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination of one or more nucleotides at the repair site.

[0277] As used herein, the term "homologous recombination repair" or HDR refers to the cellular process in which the broken or nick ends of DNA strands are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the template sequence. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repetitive region on the same or different chromosome) located elsewhere in the genome. Alternatively, an exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in the sequence at the target site. In this way, specific mutations can be introduced at the break site.

[0278] As used herein, the terms "DNA template," "DNA template insert," "single-stranded DNA template," "single-stranded DNA template insert," "double-stranded DNA template," or "double-stranded DNA template insert" refer to a DNA oligonucleotide that can be used by a cell as a template for HDR. Generally, a single-stranded DNA template or a double-stranded DNA template has at least one region of homology to a target site. In some cases, a single-stranded DNA template or a double-stranded DNA template has two regions of homology flanking a region containing a heterologous sequence to be inserted at the target cleavage site. In some embodiments, a DNA template or a DNA template insert comprises a cassette or expression cassette containing one or more modules encoding a transgene and / or an RNAi molecule as disclosed herein.

[0279] The terms "expression vector," "vector," and "plasmid" are used interchangeably and, as used herein, refer to a polynucleotide vehicle useful for introducing genetic material into cells. Vectors can be linear or circular. Vectors can integrate into a target genome of a host cell or replicate independently within the host cell. Vectors can include, for example, an origin of replication, a multicloning site, and / or a selectable marker. Expression vectors typically include an expression cassette or cassettes. Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0280] As used herein, the term "introduce" in the context of introducing a nucleic acid or a complex containing a nucleic acid, such as an RNP-DNA template complex, refers to the translocation of a nucleic acid sequence or an RNP-DNA template complex from outside the cell to inside the cell.In some cases, introducing refers to the translocation of a nucleic acid or complex from outside the cell to the nucleus of the cell.Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.

[0281] As used herein, the term "expression cassette" or "cassette" refers to a recombinantly produced or chemically synthesized polynucleotide construct comprising regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. Such a cassette may include one or more modules comprising a selected polynucleotide, e.g., a transgene disclosed herein (e.g., a CAR, priming receptor, and / or synthetic pathway activator described herein) and / or an RNAi molecule (e.g., shRNA). For example, the regulatory sequence can facilitate transcription of the selected polynucleotide in the host cell, or transcription and translation of the selected polynucleotide in the host cell. The expression cassette can, for example, be integrated into the genome of the host cell or be present in an expression vector. In some embodiments, the cassette is part of a DNA template insert.

[0282] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder described herein.

[0283] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0284] The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, a composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and that does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0285] The term "in situ" refers to processes that occur within living cells grown isolated from an organism, for example, grown in tissue culture.

[0286] The term "in vivo" refers to a process that occurs within a living organism.

[0287] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.

[0288] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0289] The term "percent identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have the same specified percentage of nucleotide or amino acid residues when compared and aligned for maximum correspondence, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the "percent identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0290] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequence is compared.When using sequence comparison algorithm, test and reference sequences are input into computer, and subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated.Then, sequence comparison algorithm calculates the percent sequence identity of test sequence to reference sequence based on designated program parameters.

[0291] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally Ausubel et al., infra).

[0292] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov / ).

[0293] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0294] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of the disease.

[0295] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.

[0296] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0297] As used herein, the term "treating" includes any effect that results in the improvement of a condition, disease, disorder, etc., e.g., lessening, reducing, modulating, ameliorating, or eliminating, or the amelioration of a symptom thereof.

[0298] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively activating or increasing, the recited variable.

[0299] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0300] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0301] With respect to antibody binding to a target molecule, the terms "binds to," "specific binding to," "specifically binds to," "specific for," "selectively binds to," and "selective for" a particular antigen (e.g., a polypeptide target) or epitope on a particular antigen refer to binding that is measurably different from nonspecific or nonselective interactions (e.g., with non-target molecules). For example, an antibody that "selectively binds to" or "specifically binds to" an antigen is an antigen-binding moiety that binds to the antigen with high affinity and does not significantly bind to other, unrelated antigens. Specific binding can be measured, for example, by measuring binding to the target molecule and comparing it to binding to non-target molecules. Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule. In this case, specific binding is indicated if the binding of the antibody to the target molecule is competitively inhibited by the control molecule.

[0302] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X for its partner Y is determined by the dissociation equilibrium constant (K D) The kinetic factors that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including, but not limited to, surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0303] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Generally, a naturally occurring four-chain antibody comprises six HVRs, three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs generally comprise amino acid residues from the hypervariable loops and / or from the complementarity-determining regions (CDRs), the latter of which have the highest sequence variability and / or are involved in antigen recognition. With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity-determining regions" (CDRs), and these terms are used interchangeably herein with respect to the portions of the variable regions that form the antigen-binding region. This particular region is described by Kabat et al., US Department of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and Chothia et al., J Mol Biol 196:901-917 (1987), and the definitions include overlapping or subsets of amino acid residues when compared with each other. Nevertheless, application of either definition to refer to a CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The exact residue numbers encompassing a particular CDR will vary depending on the sequence and size of the CDR. One of ordinary skill in the art can routinely determine which residues comprise a particular CDR given the amino acid sequence of an antibody variable region.

[0304] The term "CDR" refers to a complementarity determining region defined by at least one distinguishing feature to one skilled in the art.

[0305] The amino acid sequence boundaries of the CDRs can be determined by one of skill in the art using any of several known numbering schemes, including those described in Kabat et al. supra (the "Kabat" numbering scheme), Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (the "Chothia" numbering scheme), Martin (Enhanced Chothia or AbM) Abhinandan and Martin, Mol Immunol. 2008 Aug:45(14):3832-9, MacCallum et al., 1996, J. Mol. Biol. 262:732-745 (the "Contact" numbering scheme), Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 (the "IMGT" numbering scheme), and Honegger and Plueckthun, J. Mol. Biol., 2001, 309:657-70 ("AHo" numbering scheme), each of which is incorporated by reference in its entirety.

[0306] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat, Chothia, AbM, Contact, and IMGT schemes. For CDR-H1, residue numbering is provided using both the Kabat and Chothia numbering schemes.

[0307] CDRs can be assigned using, for example, antibody numbering software, such as AbYsis, where Abnum is available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839 (incorporated by reference in its entirety), and available at abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi.

[0308] Table A. Residues in the CDRs according to the Kabat, Chothia, AbM, Contact, and IMGT numbering schemes TIFF2026507228000002.tif65165*The C-terminus of CDR-H1 when numbered using the Kabat numbering convention varies between H32 and H34 depending on the length of the CDR.

[0309] The "EU numbering scheme" is generally used when referring to residues in antibody heavy chain constant regions (e.g., as reported in Kabat et al., supra). Unless otherwise stated, the EU numbering scheme is used to refer to residues in antibody heavy chain constant regions described herein.

[0310] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In certain such embodiments, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain in the single-chain Fab molecule. As described in more detail herein, an scFv has a variable domain of a light chain (VL), which is connected from its C-terminus to the N-terminus of the variable domain of a heavy chain (VH) by a polypeptide chain. Alternatively, an scFv comprises a polypeptide chain, and the C-terminus of the VH is connected to the N-terminus of the VL by a polypeptide chain.

[0311] A "Fab fragment" (also called fragment antigen binding) contains the constant domain of the light chain (CL) and the first constant domain of the heavy chain (CH1), as well as the variable domains VL and VH on the light and heavy chains, respectively. The variable domains contain the complementarity-determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0312] An "F(ab')2" fragment contains two Fab' fragments joined near the hinge region by a disulfide bond. F(ab')2 fragments can be produced, for example, by recombinant or synthetic methods, or by pepsin digestion of an intact antibody. F(ab')2 fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0313] An "Fv" fragment comprises a non-covalently associated dimer of one heavy- and one light-chain variable domain.

[0314] A "single-chain Fv" or "scFv" comprises the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of scFvs, see Plückthun in *The Pharmacology of Monoclonal Antibodies*, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO 93 / 16185, U.S. Patent No. 5,571,894, and U.S. Patent No. 5,587,458.

[0315] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen, without the presence of other variable domains. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also known as sdAbs or nanobodies. sdAbs are fairly stable and easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, De Haard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol. Biotechnol. 77(1):13-22). The terms "single domain antibody" and "sdAb" are used interchangeably herein to refer to an antibody comprising at least one monomer domain, such as a VHH domain, or a VNAR domain (derived from shark antibodies) without a light chain, and an Fc region.

[0316] As used herein, the term "VHH" or "VHH domain" or "VHH antigen-binding domain" refers to the antigen-binding portion of a single domain antibody (sdAb), such as a camelid antibody. In some embodiments, a VHH comprises three CDRs and four framework regions, designated FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.

[0317] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0318] Antibodies and antigen-binding fragments PSMA antibodies, antigen-binding fragments, CDRs, VH, and VL domains In some embodiments, the present invention provides an isolated antibody or antigen-binding fragment thereof that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2). PSMA is also known as FOLH1 or folate hydrolase 1 (HGNC: 3788, NCBI Entrez Gene: 2346, Ensemble: ENSG00000086205, UniProtKB / Swiss-Prot: Q04609). The amino acid sequence of PSMA is provided in SEQ ID NO: 3.

[0319] In some embodiments, provided herein are antibodies or antigen-binding fragments thereof that bind to PSMA. In some embodiments, provided herein are means for binding to PSMA. In some embodiments, the means for binding to PSMA comprises an antibody or antigen-binding fragment provided herein. In some embodiments, the PSMA antibody or antigen-binding fragment or equivalent comprises a means for binding to PSMA protein, optionally binding to human PSMA protein in the region of human PSMA bound by the PSMA-binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to PSMA protein. In some embodiments, the means binds to human PSMA protein. In some embodiments, the means is a PSMA antibody or antigen-binding fragment or equivalent (e.g., a full-length antibody or a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) means for binding PSMA protein. In some embodiments, the means for binding to PSMA comprises an anti-PSMA antibody and antigen-binding fragments thereof or equivalents described herein.

[0320] In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, bind to human PSMA. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, do not bind to mouse PSMA. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, bind to isoforms of human PSMA, including, but not limited to, PSMA proteins containing a Y75H single nucleotide polymorphism (SNP) compared to SEQ ID NO:2.

[0321] In some embodiments, the PSMA antibody, or antigen-binding fragment or equivalent thereof, comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131. In some embodiments, CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125. In some embodiments, CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137. In some embodiments, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 comprise the sequences set forth in Table B.

[0322] Table B: PSMA binder CDR sequences according to different definitions TIFF2026507228000003.tif203165TIFF2026507228000004.tif235165TIFF2026507228000005.tif48165

[0323] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 118. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 130. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 119. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 131. In some embodiments, the PSMA antibody, or antigen-binding fragment or equivalent thereof, comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 117. In some embodiments, the PSMA antibody, or antigen-binding fragment or equivalent thereof, comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 129.

[0324] In some embodiments, the CDR-H3 of the PSMA antibody, or antigen-binding fragment or equivalent, has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H3 of SEQ ID NO: 122 or 134, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H2 of SEQ ID NO: 121 or 133, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H1 of SEQ ID NO: 120 or 132. , 90%, or 95% identity to CDR-L3 of SEQ ID NO: 125 or 137; CDR-L2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-L2 of SEQ ID NO: 124 or 136; and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-L1 of SEQ ID NO: 123 or 135. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 122 or 134 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 121 or 133 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H1 is CDR-H1 of SEQ ID NO: 120 or 132 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, the CDR-L3 is CDR-L3 of SEQ ID NO: 125 or 137 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, the CDR-L2 is CDR-L2 of SEQ ID NO: 124 or 136 with a maximum of 1, 2, 3, or 4 amino acid substitutions, and the CDR-L1 is CDR-L1 of SEQ ID NO: 123 or 135 with a maximum of 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0325] In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, comprise one to three CDRs of the VH domain set forth in SEQ ID NO: 118 or 130. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, comprise two to three CDRs of the VH domain set forth in SEQ ID NO: 118 or 130. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents provided herein, comprise three CDRs of the VH domain set forth in SEQ ID NO: 118 or 130. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0326] In some embodiments, the PSMA antibodies or antigen-binding fragments provided herein comprise a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 118 or 130. In some embodiments, the antigen-binding domains provided herein comprise a VH sequence provided in SEQ ID NO: 118 or 130 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0327] In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents thereof, provided herein comprise one to three CDRs of the VL domain set forth in SEQ ID NO: 119 or 131. In some embodiments, the antigen-binding domains provided herein comprise two to three CDRs of the VL domain set forth in SEQ ID NO: 119 or 131. In some embodiments, the antigen-binding domains provided herein comprise three CDRs of the VL domain set forth in SEQ ID NO: 119 or 131. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0328] In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents, provided herein comprise a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO: 119 or 131. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents, provided herein comprise a VL sequence provided in SEQ ID NO: 119 or 131 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0329] In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents, provided herein comprise a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the sequence set forth in SEQ ID NO: 117 or 129. In some embodiments, the PSMA antibodies, or antigen-binding fragments or equivalents, provided herein comprise an scFv sequence provided in SEQ ID NO: 117 or 129 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0330] In some embodiments, the PSMA antibody or antigen-binding fragment or equivalent comprises a means for binding PSMA protein, optionally binding to human PSMA protein in the region of human PSMA bound by the PSMA 1 or PSMA 2 binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to human PSMA protein. In some embodiments, the means is a PSMA antibody or antigen-binding fragment or equivalent (e.g., a full-length antibody or a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) means for binding human PSMA protein. In some embodiments, the means for binding PSMA comprises an anti-PSMA antibody and antigen-binding fragment thereof or equivalent described herein.

[0331] CA9 antibody, antigen-binding fragment, CDR, VH, and VL domains In some embodiments, provided herein is an isolated antibody or antigen-binding fragment thereof that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1). The amino acid sequence of CA9 (HGNC: 1383, NCBI Entrez Gene: 768, Ensembl: ENSG00000107159, UniProtKB / Swiss-Prot: Q16790) is provided in SEQ ID NO: 1.

[0332] In some embodiments, provided herein are antibodies or antigen-binding fragments thereof that bind to CA9. In some embodiments, provided herein are means for binding to CA9. In some embodiments, the means for binding to CA9 comprises an antibody or antigen-binding fragment provided herein. In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent comprises the means for binding CA9 protein, optionally binding to human CA9 protein in the region of human CA9 bound by the CA9 binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to CA9 protein. In some embodiments, the means binds to human CA9 protein. In some embodiments, the means is a CA9 antibody or antigen-binding fragment or equivalent (e.g., a full-length antibody or a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) for binding CA9 protein. In some embodiments, the means for binding to CA9 comprises an anti-CA9 antibody and antigen-binding fragments or equivalents thereof described herein.

[0333] In some embodiments, the CA9 antibodies, or antigen-binding fragments or equivalents thereof provided herein bind to human CA9. In some embodiments, the CA9 antibodies, or antigen-binding fragments or equivalents thereof provided herein do not bind to mouse CA9. In some embodiments, the CA9 antibodies, or antigen-binding fragments or equivalents thereof provided herein bind to isoforms of human CA9, including, but not limited to, CA9 proteins containing the R131W single nucleotide polymorphism (SNP), the Q326R SNP, or a 91-96 deletion (91-96del) compared to SEQ ID NO: 1.

[0334] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, comprises a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100. In some embodiments, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 comprise the sequences set forth in Table C. In some embodiments, CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106. In some embodiments, CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113.

[0335] (Table C) CA9 binding substance CDR sequence TIFF2026507228000006.tif192165TIFF2026507228000007.tif157165

[0336] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 99. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 110. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 98. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 110.

[0337] In some embodiments, the CDR-H3 of the CA9 antibody or antigen-binding fragment or equivalent thereof has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H3 of SEQ ID NO: 103 or 113, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H2 of SEQ ID NO: 102 or 112, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to the CDR-H1 of SEQ ID NO: 101 or 111. , 80%, 85%, 90%, or 95% identity to CDR-L3 of SEQ ID NO: 106, CDR-L2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-L2 of SEQ ID NO: 105, and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity to CDR-L1 of SEQ ID NO: 104. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 103 or 113 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 102 or 112 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions, the CDR-H1 is CDR-H1 of SEQ ID NO: 101 or 111 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, the CDR-L3 is CDR-L3 of SEQ ID NO: 106 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions, the CDR-L2 is CDR-L2 of SEQ ID NO: 105 with a maximum of 1, 2, 3, or 4 amino acid substitutions, and the CDR-L1 is CDR-L1 of SEQ ID NO: 104 with a maximum of 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0338] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 99 or 110. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 99 or 110. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 99 or 110. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0339] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 99 or 110. In some embodiments, the antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 99 or 110 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0340] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO: 100. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 100. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 100. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0341] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO: 100. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises a VL sequence provided in SEQ ID NO: 100 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0342] In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the sequence set forth in SEQ ID NO: 98 or 110. In some embodiments, the CA9 antibody, or antigen-binding fragment or equivalent thereof, provided herein comprises an scFv sequence provided in SEQ ID NO: 98 or 110 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0343] In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent comprises a means for binding CA9 protein, optionally binding to human CA9 protein in the region of the human CA9 protein bound by the CA91 or CA92 binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to human CA9. In some embodiments, the means is a CA9 antibody or antigen-binding fragment or equivalent (e.g., a full-length antibody or F(ab')2 fragment, Fab fragment, single-chain variable fragment (scFv), VHH, and single-domain antibody (sdAb), or functional fragment thereof) means for binding to CA9. In some embodiments, the means for binding to CA9 comprises an anti-CA9 antibody and antigen-binding fragment thereof or equivalent described herein.

[0344] Logic Gate System As used herein, "logic gate," "circuit," "circuit receptor," "system," or "system receptor" refers to a bipartite protein expression system comprising a priming receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, and the priming receptor is expressed in the cell. The intracellular domain of the priming receptor is cleaved from the transmembrane domain when the priming receptor binds to its target antigen. The intracellular domain is then able to translocate into the cell nucleus, where it induces expression of the chimeric antigen receptor.

[0345] In one embodiment, a system is provided herein, comprising a priming receptor that binds PSMA and a chimeric antigen receptor that binds CA9, wherein a transcription factor in the intracellular domain of the priming receptor is capable of inducing CAR expression. Such a system is alternatively referred to as a "logic gate" or "circuit." In some embodiments, the system is encoded by a nucleic acid transgene inserted into an immune cell. The system may be encoded on a single nucleic acid insert or fragment containing both transgenes, or on two nucleic acids that individually encode the system transgenes. The priming receptor and CAR of the system may be arranged in any order on a single nucleic acid. For example, the priming receptor may be at the 5' end and the CAR may be at the 3' end, or the CAR may be at the 5' end and the priming receptor may be at the 3' end.

[0346] A constitutive promoter can be operably linked to a nucleotide sequence encoding a priming receptor. An inducible promoter can also be operably linked to a nucleotide sequence encoding a CAR. In some embodiments, when the system is encoded on a single nucleic acid insert or fragment containing both transgenes, the nucleic acid can comprise, from 5' to 3', a constitutive promoter, a nucleotide sequence encoding a priming receptor, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor. Alternatively, the nucleic acid can comprise, from 5' to 3', an inducible promoter, a nucleotide sequence encoding a chimeric antigen receptor, a constitutive promoter, and a nucleotide sequence encoding a priming receptor.

[0347] In some embodiments, the constitutive promoter is an EF1α promoter. In some embodiments, the constitutive promoter comprises the sequence of SEQ ID NO: 179.

[0348] In some embodiments, the inducible promoter comprises one or more hepatocyte nuclear factor 1 alpha (HNF1α) enhancer elements. For example, the inducible promoter can comprise 1, 2, 3, 4, 5, 6, 7, or more HNF1α enhancer elements. In some embodiments, the inducible promoter further comprises a YB-TATA promoter sequence. In some embodiments, the inducible promoter comprises the sequence set forth in SEQ ID NO: 256.

[0349] In some embodiments, the logic gate is encoded on a nucleic acid. In some embodiments, the nucleic acid is selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147. In some embodiments, the nucleic acid is the sequence set forth in SEQ ID NO: 143. In some embodiments, the nucleic acid is the sequence set forth in SEQ ID NO: 144. In some embodiments, the nucleic acid is the sequence set forth in SEQ ID NO: 145. In some embodiments, the nucleic acid is the sequence set forth in SEQ ID NO: 146. In some embodiments, the nucleic acid is the sequence set forth in SEQ ID NO: 147.

[0350] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 143. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 143.

[0351] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 144. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 144.

[0352] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 145. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 145.

[0353] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 146. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 146.

[0354] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 147. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 147.

[0355] Synthetic receptors In one aspect, a synthetic receptor disclosed herein comprises a domain that specifically binds to prostate-specific membrane antigen (PSMA). In one aspect, a synthetic receptor disclosed herein comprises a specific binding domain (CA9). In some embodiments, the domain is an extracellular domain. In some embodiments, the domain comprises the ligand-binding portion of a receptor. In some embodiments, the domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody, or functional antigen-binding fragment or equivalent thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH, and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0356] In some embodiments, the synthetic receptor is a chimeric antigen receptor or a priming receptor.

[0357] PSMA receptor In some embodiments, the antigen binding domain specifically binds to prostate specific membrane antigen. In some embodiments, the antigen binding domain comprises an antigen binding portion that binds to prostate specific membrane antigen.

[0358] In some embodiments, provided herein is an isolated synthetic receptor comprising an antigen binding domain that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2).

[0359] In some embodiments, the isolated synthetic receptor comprises a PSMA antibody or antigen-binding fragment disclosed herein. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 127. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 138. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 252. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 253.

[0360] In some embodiments, the extracellular antigen-binding domain of the isolated receptor comprises a variable heavy (VH) chain sequence that includes three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence that includes three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of a PSMA antibody or antigen-binding fragment disclosed herein.

[0361] CA9 receptor In some embodiments, the antigen-binding domain specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1). In some embodiments, the domain comprises an antigen-binding portion that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1).

[0362] In some embodiments, provided herein is an isolated synthetic receptor comprising an antigen-binding domain that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1).

[0363] In some embodiments, the isolated synthetic receptor comprises any CA9 antibody or antigen-binding fragment disclosed herein. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 98. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 108. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 250. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 110. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 115. In some embodiments, the isolated synthetic receptor comprises the sequence set forth in SEQ ID NO: 251.

[0364] In some embodiments, the extracellular antigen-binding domain of the isolated synthetic receptor comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of any CA9 antibody or antigen-binding fragment disclosed herein. In some embodiments, the extracellular antigen-binding domain of the isolated receptor comprises a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of any CA9 antibody or antigen-binding fragment disclosed herein.

[0365] Priming Receptors Provided herein is a priming receptor comprising an extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA). In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA). PSMA is also known as FOLH1 or folate hydrolase 1 (HGNC: 3788, NCBI Entrez Gene: 2346, Ensemble: ENSG00000086205, UniProtKB / Swiss-Prot: Q04609). The amino acid sequence of PSMA is provided in SEQ ID NO: 2.

[0366] In certain embodiments of the present disclosure, the priming receptor is a synthetic receptor based on the Notch protein. Binding of a natural Notch receptor to its cognate ligand, such as one from the Delta family of proteins, causes intramembrane proteolysis, cleaving an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that functions only when cleaved from Notch. Cleavage can occur through sequential proteolysis by ADAM metalloproteases and the gamma-secretase complex. This intracellular fragment enters the cell's nucleus and activates cell-cell signaling genes. In contrast to natural Notch proteins, synthetic Notch priming receptors replace the natural Notch intracellular fragment with one that causes a gene encoding a selected protein, such as a CAR, to be transcribed upon release of the intracellular fragment from the priming receptor.

[0367] Notch receptors have a modular domain organization. The ectodomain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats responsible for ligand binding. In synthetic or priming Notch receptors, the Notch ligand-binding domain is replaced with a ligand-binding domain that binds to a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors and have been widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notch1 is split by furin cleavage, whereby the N-terminal portion terminates the extracellular subunit and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor contains a transmembrane segment and an intracellular domain (ICD) containing transcriptional regulators.

[0368] Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids described herein. One type of priming receptor contemplated for use in the methods and cells herein comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Notch receptor, including an NRR, a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Notch receptor (lacking an NRR), a TMD, and an ICD. A "minimal Linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide lacking substantial sequence identity to a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD. A "hinge Notch" receptor comprises a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher-order multimerization with synthetic receptors and / or existing host receptors), a TMD, and a hinge sequence comprising an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature. In some embodiments, the non-naturally occurring receptors disclosed herein bind to a ligand displayed on the target cell surface, which triggers proteolytic cleavage of the receptor and release of a transcriptional regulator that regulates a custom transcriptional program within the cell. In some embodiments, the priming receptor does not comprise the LIN-12-Notch repeat (LNR) and / or heterodimerization domain (HD) of a Notch receptor.

[0369] Priming receptor extracellular domain The priming receptors disclosed herein comprise an extracellular domain that specifically binds to prostate-specific membrane antigen (PSMA). In some embodiments, provided herein are priming receptors comprising an extracellular antigen-binding domain that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2). In some embodiments, the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of any PSMA antibody or antigen-binding fragment disclosed herein.

[0370] In some embodiments, the extracellular domain comprises a ligand-binding portion of a receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody, or a functional antigen-binding fragment or equivalent thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH, and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0371] In some embodiments, the extracellular antigen-binding domain specifically binds to prostate-specific membrane antigen. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to prostate-specific membrane antigen.

[0372] In some embodiments, the priming receptor comprises a PSMA antibody or antigen-binding fragment disclosed herein. In some embodiments, the isolated receptor comprises the sequence set forth in SEQ ID NO: 127. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 138. In some embodiments, the isolated receptor comprises the sequence set forth in SEQ ID NO: 252. In some embodiments, the isolated receptor comprises the sequence set forth in SEQ ID NO: 253.

[0373] The PSMA priming receptor sequence provided in SEQ ID NO: 127 includes a leader sequence, while the PSMA priming receptor sequence provided in SEQ ID NO: 252 excludes a leader sequence. The PSMA priming receptor sequence provided in SEQ ID NO: 138 includes a leader sequence, while the PSMA priming receptor sequence provided in SEQ ID NO: 253 excludes a leader sequence.

[0374] In various embodiments, the priming receptor comprises a means for binding PSMA protein, optionally comprising a means for binding human PSMA protein to a region of human PSMA bound by the PSMA-binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to PSMA protein. In some embodiments, the means binds to human PSMA protein. In some embodiments, the means is a PSMA antibody or an antigen-binding fragment or equivalent thereof (e.g., a full-length antibody or an F(ab')2 fragment, an Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof). In some embodiments, the means for binding PSMA comprises an anti-PSMA antibody and an antigen-binding fragment or equivalent thereof described herein.

[0375] The extracellular domain of the priming receptor can further comprise a signal sequence, such as the CD8α signal sequence. In some embodiments, the priming receptor comprises the CD8α signal sequence set forth in SEQ ID NO:91.

[0376] Transmembrane domain In some embodiments, the priming receptor comprises a hinge domain. In some embodiments, the hinge domain is a CD8 or CD8α hinge. In some embodiments, the priming receptor hinge domain comprises the sequence set forth in SEQ ID NO:85.

[0377] As noted above, priming receptors contain a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0378] In some embodiments, the TMD comprises a Notch1 transmembrane domain.

[0379] In general, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor that contains at least one gamma-secretase cleavage site. A detailed description of the structure and function of the gamma-secretase complex and its substrate proteins, including amyloid precursor protein (APP) and Notch, can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, wherein the TMD comprises at least one gamma secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as alcadein alpha and alcadein gamma. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a known TMD for a Notch receptor. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a different Notch receptor.For example, in a Mini Notch based on human Notch1, the Notch1 TMD can be replaced with a Notch2 TMD, a Notch3 TMD, a Notch4 TMD, or a Notch TMD from a non-human animal such as Danio rerio, Drosophila melanogaster Xenopus laevis, or Gallus gallus.

[0380] In some embodiments, the priming receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of ADAM10, i.e., MMPs selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences for uPA and tPA include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 264), where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 265), where cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg (SEQ ID NO: 266).Additional suitable linkers that contain a protease cleavage site include sequences cleavable by the following proteases: PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; Examples of receptor-specific proteins include tepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases not native to the host cells in which the receptor is expressed (e.g., TEV) can be used as an additional regulatory mechanism, reducing receptor activation until the protease is expressed or otherwise provided. Additionally, proteases can be tumor- or disease-associated (expressed to a significantly higher degree than normal tissue) and serve as an independent regulatory mechanism. For example, several matrix metalloproteinases are highly expressed in certain cancer types.

[0381] In some embodiments, the amino acid substitutions within the TMD include one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitutions includes a substitution to alanine. Additional sequences and substitutions are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0382] In some embodiments, the TMD domain comprises the sequence set forth in SEQ ID NO:86.

[0383] Intracellular domain In some embodiments, the priming receptor comprises one or more intracellular domains derived from or derived from a transcriptional regulator and / or a DNA-binding domain. In some embodiments, the intracellular domain comprises a means for regulating transcription of one or more genes. In some embodiments, the means for regulating transcription of one or more genes comprises a transcriptional regulator, such as a transcriptional regulator provided herein or its equivalent. In some embodiments, the priming receptor comprises one or more intracellular domains derived from or derived from a transcriptional regulator and / or a DNA-binding domain. In some embodiments, the intracellular domain comprises an HNF1α / p65 domain or a Gal4 / VP64 domain.

[0384] Transcriptional regulators activate or repress transcription from their cognate promoters. Transcriptional activators typically bind to nearby transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and sterically inhibit transcription initiation by RNA polymerase. Other transcriptional regulators function as either activators or repressors, depending on where they bind and the cellular conditions. Thus, as used herein, "transcriptional activation domain" or "TAD" refers to the domain of a transcription factor that interacts with transcriptional control elements and / or transcriptional regulatory proteins (i.e., transcription factors, RNA polymerases, etc.) to increase and / or activate transcription of one or more genes. Non-limiting examples of transcriptional activation domains include herpes simplex virus VP16 activation domain, VP64 (a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcriptional activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to those of skill in the art. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. In some embodiments, the transcriptional regulator is p65. The transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutated, or derivative version of the original transcriptional activation domain that has the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator can further comprise a nuclear localization signal.

[0385] In some embodiments, the priming receptor comprises one or more intracellular "DNA-binding domains" (or "DB domains"). Such "DNA-binding domains" refer to sequence-specific DNA-binding domains that bind to specific DNA sequence elements. Thus, as used herein, a "sequence-specific DNA-binding domain" refers to a protein domain portion that has the ability to selectively bind to DNA having a specific, predetermined sequence. The sequence-specific DNA-binding domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to the desired sequence. In some embodiments, the sequence-specific DNA-binding domain is engineered to bind to the desired sequence. Non-limiting examples of proteins having sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1α, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5′, AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Examples include Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, as well as TALES. In some embodiments, the DNA binding domain (DBD) is HNF1α.

[0386] In embodiments in which a CRISPR / Cas-like protein is used, the CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the systems described herein. For example, a CRISPR enzyme used as a DNA-binding protein or domain thereof can be mutated relative to the corresponding wild-type enzyme so that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing the DNA-binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that lacks substantially all DNA cleavage activity.

[0387] In some embodiments, the intracellular domain comprises a sequence set forth in SEQ ID NO: 88, 89, or 90. In some embodiments, the intracellular domain comprises an HNF1α DNA-binding domain (DBD) sequence set forth in SEQ ID NO: 88. In some embodiments, the intracellular domain comprises a p65 transcription activation domain (TAD) sequence set forth in SEQ ID NO: 89. In some embodiments, the intracellular domain comprises an HNF1α / p65 DBD-TAD domain sequence set forth in SEQ ID NO: 90.

[0388] Juxtamembrane domain The ECD and TMD, or the TMD and ICD, can be linked to each other with a linking polypeptide such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including an NRR), a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD but lacking an NRR (a LIN-12-Notch repeat (LNR) module and a heterodimerization domain), a TMD, and an ICD. A "minimal linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide (such as, but not limited to, a synthetic (GGS)) that lacks substantial sequence identity with the Notch receptor. n "Hinge Notch" receptors comprise a hinge sequence comprising a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or pre-existing host receptors), a TMD, and an ICD.

[0389] In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of an LWF motif in receptor constructs is described in U.S. Patent No. 10,858,443, which is incorporated herein by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity to the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD but does not include the LIN-12-Notch repeat (LNR) and / or heterodimerization domain (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD. In some embodiments, the JMD peptide comprises an oligomerization domain that promotes the formation of receptor dimers, trimers, or higher order aggregates. Such JMD peptides are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0390] In mini-Notch receptors, the linking polypeptide is derived from the Notch JMD sequence after deletion of the NRR and HD domains. The Notch JMD sequence may be from Notch1, Notch2, Notch3, or Notch4, or may be derived from a non-human homologue, such as from Drosophila, Junglefly, or Danio. The remaining 4-50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptide, such as the level of signal transduction upon ligand induction or in the absence of ligand.

[0391] In minimal linker Notch receptors, the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence (including a Notch JMD sequence from Notch1, Notch2, Notch3, or Notch4, or a non-human homolog thereof). Between 4 and 50 amino acid residues can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve the desired activity of the chimeric polypeptides of the present disclosure. The minimal linker sequence can be designed to include or omit a protease cleavage site and can include or omit a glycosylation site or sites for other types of post-translational modifications. In some embodiments, the minimal linker does not include a protease cleavage site or a glycosylation site.

[0392] In some embodiments, the priming receptor further comprises a hinge. Hinge linkers that can be used in priming receptors can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomerization of chimeric polypeptides through intermolecular disulfide bonds. In these cases, within the chimeric receptors disclosed herein, the hinge domain generally comprises a flexible polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD and also provides a site for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain comprises a motif that promotes dimerization of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain comprises a motif that promotes trimerization of the chimeric polypeptides disclosed herein (e.g., a hinge domain from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure can be naturally occurring hinge polypeptide sequences (e.g., derived from naturally occurring immunoglobulins) or can be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or functional variants thereof. In some embodiments, the hinge polypeptide sequence comprises one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence comprises one or more CPPC motifs (SEQ ID NO: 267).

[0393] The hinge polypeptide sequence may also be derived from the CD8α hinge domain, CD28 hinge domain, CD152 hinge domain, PD-1 hinge domain, CTLA4 hinge domain, OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the IgG4 hinge domain or a functional variant thereof.

[0394] The Fn-Notch-linked polypeptide is derived from the Robo1 JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeat and the TMD. The Fn-Notch-linked polypeptide does not contain a Notch negative regulatory region (NRR) or a Notch HD domain. The Fn-linked polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises an Fn-linked polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeat and the TMD can be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence, but with no more than one proline. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with about 50% or more of the amino acids being glycine. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with the amino acids selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn-linked polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptides of the present disclosure.

[0395] Transport stop sequence In some embodiments, the priming receptor further comprises a stop transport sequence (STS) between the transmembrane domain and the intracellular domain. The STS comprises a charged lipophobic sequence. Without being bound by any theory, it is believed that the STS functions as a membrane anchor and prevents the intracellular domain from passing through the plasma membrane. The use of an STS domain in a priming receptor is described in WO2021061872 (incorporated herein by reference in its entirety). Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, S Examples of STS sequences include DC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3, and Notch4. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0396] In some embodiments, the STS domain comprises the sequence set forth in SEQ ID NO:87.

[0397] Chimeric Antigen Receptor In another embodiment, the present invention provides a chimeric antigen receptor comprising an extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9). The CAR can be a human CAR comprising a completely human sequence, for example, a natural human sequence. The amino acid sequence of CA9 (HGNC:1383, NCBI Entrez Gene:768, Ensembl:ENSG00000107159, UniProtKB / Swiss-Prot:Q16790) is provided in SEQ ID NO:1.

[0398] In some embodiments, a chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain. The antigen-recognition domain of a receptor, such as a CAR, can be linked to one or more intracellular signaling components, such as a signaling component that mimics activation via an antigen receptor complex, e.g., a TCR complex, in the case of a CAR, and / or to a signal via another cell surface receptor. Thus, in some embodiments, the extracellular binding component (e.g., a ligand-binding or antigen-binding domain) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, one of the domains within the receptor, e.g., the transmembrane domain naturally associated with the CAR, is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and minimize interaction with other members of the receptor complex.

[0399] In some embodiments, the chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, VH, or single-domain VH antibody, and the intracellular domain comprises an ITAM. In some embodiments, the intracellular signaling domain comprises the signaling domain of the zeta chain of the CD3-zeta (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting the extracellular domain and the intracellular signaling domain.

[0400] In some embodiments, the transmembrane domain comprises the transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane can be directly or indirectly linked. In some embodiments, the extracellular domain and the transmembrane are linked by a spacer, such as any of those described herein. In some embodiments, the chimeric antigen receptor comprises the intracellular domain of a T cell costimulatory molecule, for example, between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB.

[0401] Chimeric antigen receptor extracellular domain The chimeric antigen receptors disclosed herein comprise an extracellular domain that specifically binds to carbonic anhydrase IX (CA9). In some embodiments, provided herein is a chimeric antigen receptor comprising an extracellular antigen-binding domain that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1). In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain comprises a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of any CA9 antibody or antigen-binding fragment disclosed herein.

[0402] In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 98. In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 108 or 250. In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 110. In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 115 or 251. The CA9 CAR sequence provided in SEQ ID NO: 108 includes a leader sequence, while the CA9 CAR sequence provided in SEQ ID NO: 250 excludes the leader sequence. The CA9 CAR sequence provided in SEQ ID NO: 115 includes a leader sequence, while the CA9 CAR sequence provided in SEQ ID NO: 251 excludes the leader sequence.

[0403] In some embodiments, the extracellular domain comprises a ligand-binding portion of a receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH, and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0404] In some embodiments, the extracellular antigen-binding domain specifically binds to carbonic anhydrase IX (CA9). In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to carbonic anhydrase IX (CA9).

[0405] In various embodiments, the CAR comprises a means for binding CA9 protein, optionally binding human CA9 protein in a region of human CA9 bound by a CA9 binding agent (e.g., as described in the Examples below). In some embodiments, the means binds to CA9 protein. In some embodiments, the means binds to human CA9 protein. In some embodiments, the means is a CA9 antibody or an antigen-binding fragment or equivalent thereof (e.g., a full-length antibody or a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) for binding CA9 protein. In some embodiments, the means for binding CA9 comprises an anti-CA9 antibody and an antigen-binding fragment or equivalent thereof described herein.

[0406] The extracellular domain of the CAR can further comprise a signal sequence, such as the CD8α signal sequence. In some embodiments, the CAR comprises the CD8α signal sequence set forth in SEQ ID NO:91.

[0407] CAR transmembrane domain In some embodiments, the transmembrane domain is derived from either a natural or synthetic source. If the source is natural, in some aspects, the domain is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e., comprising at least the transmembrane region of) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and / or CD154. Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, synthetic transmembrane domains comprise primarily hydrophobic residues such as leucine and valine. In some aspects, triplets of phenylalanine, tryptophan, and valine are found at each end of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain.

[0408] In some embodiments, the transmembrane domain (TMD) of a receptor, e.g., a CAR, is the transmembrane domain of human CD28 or a variant thereof, e.g., the 27 amino acid transmembrane domain of human CD28 (UniProt Accession Number: P10747).

[0409] In some embodiments, the transmembrane domain (TMD) of a receptor, e.g., a CAR, is the transmembrane domain of human CD8α or a variant thereof, e.g., the 24 amino acid transmembrane domain of human CD8α (UniProt Accession Number: P01732).

[0410] In some embodiments, the CAR comprises a CD8α or CD28 TMD. In some embodiments, the CD8α TMD comprises the sequence set forth in SEQ ID NO: 93. In some embodiments, the CD28 TMD comprises the sequence set forth in SEQ ID NO: 95.

[0411] CAR hinge In some embodiments, the CAR further comprises a spacer, which may be or include at least a portion of an immunoglobulin constant region, or a variant or modified version thereof, such as a hinge region, e.g., a CD8a hinge, a CD28 hinge, an IgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is that of a human IgG, such as IgG4 or IgG1. In some aspects, the portion of the constant region functions as a spacer region between the antigen-recognition component, e.g., an scFv, and the transmembrane domain. The spacer may be of a length that results in increased cellular responsiveness after antigen binding compared to the absence of the spacer. In some examples, the spacer is about 12 amino acids in length, or 12 amino acids or less in length. Exemplary spacers include those having at least about 10-229 amino acids, about 10-200 amino acids, about 10-175 amino acids, about 10-150 amino acids, about 10-125 amino acids, about 10-100 amino acids, about 10-75 amino acids, about 10-50 amino acids, about 10-40 amino acids, about 10-30 amino acids, about 10-20 amino acids, or about 10-15 amino acids, including any integer between any of the endpoints of the recited ranges. In some embodiments, the spacer region has no more than about 12 amino acids, no more than about 119 amino acids, or no more than about 229 amino acids. Exemplary spacers include a CD8a hinge, a CD28 hinge, an IgG4 hinge alone, an IgG4 hinge linked to CH2 and CH3 domains, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or International Patent Application Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8α or CD28 hinge domain. In some embodiments, the hinge domain comprises a CD8α hinge comprising the sequence set forth in SEQ ID NO:92.In some embodiments, the hinge domain comprises a CD28 hinge comprising the sequence set forth in SEQ ID NO:94.

[0412] Intracellular signaling domains include those that mimic or approximate signaling through a natural antigen receptor, signaling through such a receptor in combination with a costimulatory receptor, and / or signaling through a costimulatory receptor alone. In some embodiments, a short oligo- or polypeptide linker, e.g., a linker 2-10 amino acids in length, such as one containing glycine and serine, e.g., a glycine-serine doublet, is present to form the link between the transmembrane domain and the cytoplasmic signaling domain of the receptor.

[0413] CAR intracellular domain In some embodiments, upon ligation of the CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of an immune cell, e.g., a T cell engineered to express the receptor. In some embodiments, the CAR comprises a means for activating at least one of the normal effector functions or responses of an immune cell, e.g., a T cell engineered to express the receptor. For example, in some contexts, the receptor induces a T cell function, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, e.g., when it transduces an effector function signal. In some embodiments, the intracellular signaling domain or domains comprise the cytoplasmic sequence of a T cell receptor (TCR), and in some aspects, any derivative or variant of such a molecule that acts in concert with such a receptor in its natural context to signal following antigen receptor engagement, and / or any derivative or variant of such a molecule, and / or any synthetic sequence having the same functional capability. In some embodiments, the means for at least one of a normal effector function or response of an immune cell comprises a CAR intracellular activation domain, e.g., an intracellular activation domain provided herein or an equivalent thereof. In some embodiments, the means for at least one of a normal effector function or response of an immune cell comprises a CAR intracellular activation domain and a CAR costimulatory domain, e.g., a costimulatory domain provided herein or an equivalent thereof.

[0414] In some embodiments, the receptor comprises a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. Primary cytoplasmic signaling sequences that act in a stimulatory manner can comprise signaling motifs known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of primary cytoplasmic signaling sequences containing ITAMs include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d.

[0415] A receptor, e.g., a CAR, can comprise at least one intracellular signaling component or multiple intracellular signaling components. In some embodiments, the receptor comprises an intracellular component of the TCR complex, such as a TCR CD3 chain, e.g., a CD3 zeta chain, which mediates T cell activation and cytotoxicity. Thus, in some embodiments, the extracellular domain is linked to one or more cell signaling modules. In some embodiments, the cell signaling module comprises a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., a CAR, further comprises a portion of one or more additional molecules, such as Fc receptor-gamma, CD8, CD4, CD25, or CD16. For example, in some embodiments, the CAR comprises a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25, or CD16.

[0416] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112 AA cytoplasmic domain of human CD3 zeta isoform 3 (UniProt Accession Number: P20963.2) or a CD3 zeta signaling domain described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0417] In some embodiments, the cytoplasmic signaling molecule in the CAR comprises a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta. In some embodiments, the intracellular activation domain comprises a CD3 zeta domain. In some embodiments, the intracellular activation domain comprises a CD3 zeta domain set forth in SEQ ID NO:97.

[0418] In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of 41BB, or a functional variant or portion thereof, such as the 42 amino acid cytoplasmic domain of human 4-1BB (UniProt Accession No. Q07011.1), or a functional variant or portion thereof.

[0419] In some embodiments, the receptor includes one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., a primary activation domain, in the cytoplasmic portion. Exemplary receptors include CD3-zeta, CD28, and the intracellular component of 4-1BB. In some embodiments, the chimeric antigen receptor comprises the intracellular domain of a T cell costimulatory molecule. In some aspects, the T cell costimulatory molecule is 4-1BB.

[0420] In some embodiments, the receptor comprises the signaling domain and / or transmembrane portion of a costimulatory receptor such as CD28, 4-1BB, OX40, DAP10, and ICOS. In some aspects, the same receptor comprises both an activating component and a costimulatory component.

[0421] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) costimulatory domain linked to a CD3 zeta intracellular domain. In some embodiments, the CAR comprises a 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises the sequence set forth in SEQ ID NO:96.

[0422] In some embodiments, the CAR or other antigen receptor further comprises a marker, such as a cell surface marker, which can be used to confirm the transduction or engineering of cells to express a receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some embodiments, the marker comprises all or a portion (e.g., a truncated form) of CD34, nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a linker sequence, e.g., a cleavable linker sequence or a ribosomal skip sequence, e.g., a polynucleotide encoding T2A. See WO2014031687. In some embodiments, introduction of a construct encoding CAR and EGFRt separated by a T2A ribosomal switch allows expression of the two proteins from the same construct, such that EGFRt can be used as a marker to detect cells expressing such a construct. In some embodiments, the marker, and optionally the linker sequence, can be any of the sequences disclosed in published patent application WO2014031687. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence such as a T2A ribosomal skip sequence.

[0423] In some embodiments, the marker is a molecule that is not naturally found on T cells or that is not naturally found on the surface of T cells, for example, a cell surface protein, or portion thereof.

[0424] In some embodiments, the molecule is a non-self molecule, eg, a non-self protein, ie, one that is not recognized as "self" by the immune system of the host into which the cells are adoptively transferred.

[0425] In some embodiments, the marker does not serve a therapeutic function and / or produce any effect other than being used as a marker for genetic manipulation, e.g., to select successfully engineered cells. In other embodiments, the marker may be a therapeutic molecule or a molecule that exerts some desired effect in other ways, e.g., a ligand for cells encountered in vivo, e.g., a costimulatory or immune checkpoint molecule to enhance and / or attenuate the response of cells upon adoptive transfer and encounter with the ligand.

[0426] A CAR may contain one or more modified synthetic amino acids in place of one or more naturally occurring amino acids. Exemplary modified amino acids include aminocyclohexanecarboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 3-phenylserine, 3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1, These include, but are not limited to, 2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbomane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine, and α-tertbutylglycine.

[0427] For example, in some embodiments, a CAR comprises an antibody or fragment thereof comprising a single chain antibody (sdAb, e.g., containing only a VH region, also referred to as a VHH), a VH domain, and an scFv described herein, a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain. In some embodiments, a CAR comprises an antibody or fragment thereof comprising a sdAb and scFv described herein, a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.

[0428] The transgenes expressing the priming receptor and CAR system can be introduced into cells, e.g., T cells, using, for example, site-specific techniques. For site-specific integration of the transgene (e.g., the priming receptor and CAR), the transgene can be targeted to a safe harbor locus or TRAC. Examples of site-specific techniques for integration into a safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0429] The engineered cells have applications in immuno-oncology. For example, priming receptors and CARs can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells include blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0430] Synthetic pathway activators In various embodiments, the systems disclosed herein employ one or more "synthetic pathway activators" (SPAs). CAR-expressing immune cells may be limited by the need for in vivo expansion after infusion. For T cells to achieve robust expansion, three signals are required: antigen stimulation, costimulation, and cytokine-induced stimulation. CAR activation is sufficient to induce the first two signals but cannot recapitulate cytokine signaling. Furthermore, the tumor microenvironment is often immunosuppressive and lacks pro-inflammatory cytokines. Therefore, SPAs can be used to stimulate robust in vivo expansion of T cells expressing the priming receptors and / or CARs described herein, enhancing desirable properties (e.g., increased survival, persistence, and efficacy).

[0431] SPA Structure In various embodiments, SPAs mimic the activation of interleukin signaling. Interleukin receptors are cytokine receptors that signal through signal transducer and activator of transcription (STAT) transcription factors (e.g., STAT3 and STAT5). Interleukin receptors typically function by dimerization in response to ligand binding. Once dimerized, the receptor can bind to Janus-associated kinases (JAKs) and induce JAK cross-phosphorylation and downstream "JAK / STAT" signaling. Thus, induced receptor agonism or ligand-independent dimerization of the receptor can be used to induce constitutive receptor activity and, therefore, constitutive cytokine signaling.

[0432] In various embodiments, the SPA comprises an interleukin receptor or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin receptor intracellular signaling domain or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin-6 signal transducer (IL6ST) polypeptide or a functional fragment thereof. Interleukin-6 signal transducer (IL6ST) is also known as glycoprotein 130 (gp130).

[0433] In various embodiments, one or more structural modifications can be made to confer constitutive activity to an SPA or functional fragment thereof. In some embodiments, structures or mutations can be added to induce SPA multimerization. In some embodiments, one or more amino acids can be mutated to cysteine, for example, to allow the formation of one or more disulfide bonds between two receptor monomers. In some embodiments, one or more amino acids can be inserted into a wild-type receptor polypeptide to promote dimerization, for example, through the formation of one or more disulfide bonds.

[0434] In some embodiments, the exogenous polypeptide is operably linked to a cytokine receptor or a functional fragment thereof to cause multimerization thereof. In some embodiments, a leucine zipper polypeptide is operably linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the leucine zipper polypeptide is a c-Jun leucine zipper. In some embodiments, the exogenous scaffold is operably linked to a cytokine receptor or a functional fragment thereof (e.g., IL6ST or gp130).

[0435] In some embodiments, the SPA can include a ligand agonist (e.g., a cytokine, e.g., an interleukin) that allows for constitutive activation of the SPA. In some embodiments, the cytokine receptor and soluble agonist are co-expressed. In some embodiments, the cytokine receptor and membrane-bound agonist are co-expressed.

[0436] In various embodiments, the SPA is anchored to a cell membrane. In some embodiments, the SPA comprises an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the SPA comprises the transmembrane domain of an interleukin receptor.

[0437] Exemplary SPA In some embodiments, the SPA comprises leucine zipper-gp130 (referred to herein as "L-gp130") or the L-gp130 intracellular signaling domain. L-gp130 comprises a homodimer, with each monomer comprising (a) an extracellular domain containing an inserted cysteine ​​residue and a c-Jun leucine zipper that forms a disulfide bond with another monomer, and (b) an IL6ST transmembrane domain and an intracellular signaling domain. The cysteine ​​residues and leucine zipper on each polypeptide can induce the formation of a stable homodimer that mimics constitutive IL-6R activation. Additional details regarding the construction of L-gp130 are described in Stuhlmann-Laeisz et al. Mol Biol Cell. 2006 Jul. 17(7):2986-95 and WO2020200325, which are incorporated herein by reference in their entireties. The sequence of L-gp130 is provided in SEQ ID NO: 259. In some embodiments, the SPA comprises an L-gp130 comprising the sequence set forth in SEQ ID NO:259.

[0438] In some embodiments, the SPA comprises an extracellular domain comprising a CD34 epitope or a CD34 extracellular domain or a fragment thereof. In some embodiments, the SPA comprises an extracellular domain comprising a CD34 epitope, an unpaired cysteine ​​residue for multimerization, an IL6ST (gp130) transmembrane domain, and an IL6ST (gp130) intracellular domain. In some embodiments, the SPA comprises the sequence set forth in SEQ ID NO: 141 or 254. The IL6ST (gp130) transmembrane domain sequence is provided in SEQ ID NO: 258. In some embodiments, the SPA comprises the IL6ST (gp130) transmembrane sequence set forth in SEQ ID NO: 258. The IL6ST (gp130) intracellular signaling domain sequence is provided in SEQ ID NO: 257. In some embodiments, the SPA comprises the IL6ST (gp130) intracellular signaling domain sequence set forth in SEQ ID NO: 257. In some embodiments, the SPA comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 260. A nucleotide sequence encoding an exemplary SPA is provided in SEQ ID NO: 261. A nucleotide sequence encoding an exemplary SPA protein having an N-terminal leader sequence is provided in SEQ ID NO: 262. In some embodiments, the one or more nucleic acids encoding the systems disclosed herein comprise an SPA comprising the nucleic acid set forth in SEQ ID NO: 261 or 262.

[0439] Nucleic acids and vectors In another aspect, provided herein are one or more nucleic acids encoding a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds prostate-specific membrane antigen (PSMA), a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds carbonic anhydrase IX (CA9), an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA), and at least one or more nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3, and a nucleic acid encoding a human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid sequence at least 15 nucleotides in length is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding a human FAS comprising the sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 5.

[0440] RNA interference molecules Transforming growth factor beta receptor 1 (TGF-βR1 or TGFBR1; HGNC:11772, NCBI Entrez Gene:7046, UniProtKB / Swiss-Prot:P36897) is a transmembrane serine / threonine protein kinase that, upon binding to TGF-beta, forms a heteromeric complex with TGF-beta receptor type II (TGFRB2) and transduces TGF-beta signals from the cell surface to the cytoplasm.

[0441] Transforming growth factor beta receptor 2 (TGF-βR2 or TGFBR2; HGNC:11773, NCBI Entrez Gene:7048, UniProtKB / Swiss-Prot:P37173) is a transmembrane serine / threonine protein kinase that forms a heterodimeric complex with TGF-beta receptor type 1 (TGFBR1) upon binding to TGF-beta, resulting in the transduction of TGF-beta signals from the cell surface to the cytoplasm.

[0442] The Fas cell surface death receptor (or Fas receptor, FAS, CD95, or TNFRSF6; HGNC:11920, NCBI Entrez Gene:355; UniProtKB / Swiss-Prot:P25445) is a member of the apoptosis-inducing TNF receptor superfamily.

[0443] Protein tyrosine phosphatase non-receptor type 2 (PTPN2; HGNC:9650, NCBI Entrez Gene:5771, UniProtKB / Swiss-Prot:P17706) is a phosphatase that regulates interferon and many other signaling pathways.

[0444] As used herein, "target gene" refers to a nucleic acid sequence in a cell whose expression can be specifically and effectively regulated using the nucleic acid molecules and methods described herein. In certain embodiments, the target gene may be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of an individual's immune cells. In some embodiments, the target gene is FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is transforming growth factor beta receptor 2 (TGFBR2). In some embodiments, two or more nucleic acid molecules target the TGFBR2 gene. In some embodiments, the target gene is transforming growth factor beta receptor 1 (TGFBR1). In some embodiments, more than one target gene is regulated using the nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are regulated using the nucleic acid molecules and methods described herein. In some embodiments, the nucleic acid molecule is an shRNA. In some embodiments, the target genes are at least TGFBR1 and TGFBR2. In some embodiments, the target genes are at least FAS and TGFBR2. In some embodiments, the target genes are at least FAS, TGFBR1, and TGFBR2. In some embodiments, the target genes are at least FAS, TGFBR2, and PTPN2. In some embodiments, the target genes are at least FAS, PTPN2, TGFBR1, and TGFBR2.

[0445] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human transforming growth factor beta receptor 2 (TGFBR2) (SEQ ID NO: 4). In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length complementary to nucleotides 2215-2236, 4430-4451, or 3761-3782 of a nucleic acid encoding human transforming growth factor beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82. In some embodiments, the nucleic acid comprises at least two sequences selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82.

[0446] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human transforming growth factor beta receptor 2 (TGFBR2) (SEQ ID NO: 4), wherein the at least 15 nucleotide sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding human transforming growth factor beta receptor 2 (TGFBR2) (SEQ ID NO: 4). In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82. In some embodiments, the nucleic acid comprises at least two sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34-82.

[0447] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human transforming growth factor beta receptor 1 (TGFBR1) (SEQ ID NO: 148). In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 149-178.

[0448] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human transforming growth factor beta receptor 1 (TGFBR1) (SEQ ID NO: 148), wherein the at least 15 nucleotide sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding human transforming growth factor beta receptor 1 (TGFBR1) (SEQ ID NO: 148). In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 149-178. In some embodiments, the nucleic acid comprises at least two sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 149-178.

[0449] In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20. In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126-1364 of a nucleic acid encoding a human FAS comprising the sequence set forth in SEQ ID NO: 3.

[0450] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding a human FAS comprising the sequence set forth in SEQ ID NO: 3, wherein the at least 15 nucleotides in length nucleic acid sequence is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding a human FAS comprising the sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20. In some embodiments, the nucleic acid comprises at least two sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20.

[0451] In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of a nucleic acid encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 5.

[0452] In one aspect, provided herein is a nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5, wherein the nucleic acid is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid comprises at least two sequences having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of a nucleic acid encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 5.

[0453] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 79. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 79. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 83. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 83. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 84. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 84.

[0454] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 182. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 182.

[0455] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 181, 183, 193, 194, or 195. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 181, 183, 193, 194, or 195.

[0456] In some embodiments, the nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0457] In some embodiments, the nucleic acid can reduce expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0458] In some embodiments, the nucleic acid can reduce PTPN2 expression in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0459] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0460] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule.Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is shRNA.

[0461] Single-stranded hairpin ribonucleic acid (shRNA) is a short double-stranded nucleic acid in which the sense and antisense strands are connected by a hairpin loop. They consist of a stem-loop structure, which can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. When expressed, shRNA is processed into an RNAi species. Expression of shRNA from a plasmid is known to be relatively stable, thereby offering a significant advantage over the use of, for example, synthetic siRNA. shRNA expression units can be incorporated into various plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. Expression of shRNA from a plasmid can be stably integrated for constitutive expression. shRNA is synthesized in the cell nucleus, further processed, transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. The shRNA is converted into an active siRNA molecule (capable of binding to and sequestering the mRNA transcript encoded by the target gene and / or preventing its translation).

[0462] The Argonaute family of proteins is a major component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that can cleave and release the passenger strand from the stem portion of the shRNA molecule. The remaining three members of the Argonaute family, Ago1, Ago3, and Ago4, which do not have discernible endonuclease activity, also assemble to form RISC and are thought to function in a cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0463] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. WO2018232356A1, WO2019084552A1, WO2019226998A1, WO2020014235A1, WO2020123871A1, and WO2020186219A1, each of which is incorporated by reference herein for all purposes.

[0464] Antisense oligonucleotide structure and chemical modifications are described in International PCT Publication No. WO 20 / 132521, which is incorporated herein by reference.

[0465] dsRNA and shRNA molecules, as well as methods of use and production, are described in US Pat. No. 8,829,264, US Pat. No. 9,556,431, and US Pat. No. 8,252,526, each of which is incorporated herein by reference.

[0466] siRNA molecules, as well as methods of use and production, are described in US Pat. No. 7,361,752 and US Patent Application No. US20050048647, both of which are incorporated herein by reference.

[0467] Additional methods and compositions for RNA interference, e.g., shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, International PCT Publication No. WO00 / 44895, International PCT Publication No. WO01 / 36646, International PCT Publication No. WO99 / 32619, International PCT Publication No. WO00 / 01846, International PCT Publication No. WO01 / 29058, International PCT Publication No. WO00 / 44914, and International PCT Publication No. WO04 / 030634, each of which is incorporated herein by reference.

[0468] Nucleic acid sequences (or constructs) that can be used to encode the RNAi molecules, e.g., shRNAs, described herein can include a promoter operably linked (or connected) directly or indirectly to the sequence encoding the RNAi molecule. Such promoters can be selected based on the host cell and the desired effect. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as EF1α or inducible hepatocyte nuclear factor 1α (HNF1α)-YB TATA or RNA polymerase II (pol II)-based promoters. In some embodiments, the constitutive promoter is EF1α. In some embodiments, the EF1α promoter comprises the sequence set forth in SEQ ID NO: 179. Non-limiting examples of suitable promoters further include tetracycline-inducible or repressible promoters, RNA polymerase I or III-based promoters, pol II-dependent viral promoters, such as the CMV-IE promoter, and pol III U6 and H1 promoters, as well as the hepatocyte nuclear factor 1α (HNF1α)-YB TATA promoter provided in SEQ ID NO: 256. Also, a bacteriophage T7 promoter can be used (it will be understood that in this case, T7 polymerase must also be present). In particular, the nucleic acid sequence need not be limited to the use of any single promoter, as it can contain two or more shRNAs (i.e., combinations of effectors), including, but not limited to, integrated shRNA molecules. Each integrated promoter can control one or any combination of the shRNA molecule components.

[0469] In certain embodiments, the promoter may be preferentially active in target cells; for example, it may be desirable to preferentially express at least one nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such a construct into a host cell may be performed under conditions in which two or more nucleic acids contained within a nucleic acid precursor transcript are initially present within a single primary transcript, whereby separate RNA molecules (e.g., shRNAs, each containing its own stem-loop structure) are subsequently excised from such precursor transcript by endogenous ribonucleases. The resulting mature nucleic acid (e.g., shRNA) can then induce degradation and / or translational repression of target gene mRNA transcripts produced in the cell. Alternatively, each of the precursor stem-loop structures may be produced as part of a separate transcript, in which case each nucleic acid sequence preferably contains its own promoter and transcription termination sequence. Additionally, multiple nucleic acid precursor transcripts may be present within a single primary transcript.

[0470] The stem-loop structure of the shRNA nucleic acids described herein may be about 40-100 nucleotides in length, or preferably about 50-75 nucleotides in length. The stem region may be about 15-45 nucleotides (or more), or about 20-30 nucleotides in length. In some embodiments, the stem region is 22 nucleotides in length. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.

[0471] The stem may contain a fully complementary duplex (but for either 3' tail), but a bulge or internal loop may be present on either arm of the stem. The number of such bulges and asymmetric internal loops is preferably small (e.g., 1, 2, or 3) and about 3 or less nucleotides in size. The terminal loop portion may contain about 4 or more nucleotides, but preferably about 25 or less. The loop portion is preferably 6 to 15 nucleotides in size.

[0472] As described herein, the stem region of shRNA comprises a passenger strand and a guide strand, whereby the guide strand comprises a sequence complementary to the target mRNA transcript encoded by the target gene.Preferably, the GC content and matching of the guide strand and the passenger strand are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage.Furthermore, the specificity of the guide strand is preferably confirmed through BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0473] The disclosure herein provides that the expression levels of multiple target genes can be regulated using the methods and nucleic acids described herein. For example, the disclosure herein provides that a first set of nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a first target gene, and a second set of nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a second target gene. The different sets of nucleic acids can be expressed and present within the same or separate pre-transcripts. In certain embodiments, such a multiplex approach, i.e., the use of the nucleic acids described herein to regulate the expression levels of two or more target genes, can have an enhanced therapeutic effect on patients. For example, when a patient is provided with cells expressing the nucleic acid molecules described herein to treat, prevent, or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of nucleic acid molecules designed to reduce the expression levels of multiple genes involved in immune cell activation or suppression.

[0474] The nucleic acid molecules described herein can reduce target gene expression in cells by at least about 50% compared to control cells that do not contain the nucleic acid molecule. For example, the nucleic acid molecule (e.g., shRNA) can reduce the expression of a target gene selected from the group consisting of FAS and TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to control cells that do not contain the nucleic acid molecule. The nucleic acid molecule can be capable of reducing expression of a target gene selected from the group consisting of FAS and TGFBR2 in immune cells by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or by at least about 50-100%, 50-95%, 50-9 ...95%, 50-90%, In some embodiments, the nucleic acid molecule can reduce expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid molecule. In some embodiments, the nucleic acid molecule can reduce expression of TGBFR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid molecule.

[0475] The nucleic acid molecule can be chemically synthesized or in vitro transcribed and can further contain one or more modifications to the sugar phosphate backbone or nucleoside residues.

[0476] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transport and chemical-mediated transport, such as calcium phosphate. Thus, the nucleic acid molecule construct can be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, promoting annealing of the shRNA duplex, stabilizing the annealed shRNA strand, or otherwise increasing inhibition of the target gene.

[0477] Additional Elements In some embodiments, the one or more nucleic acids further comprise 5' and / or 3' homology-directed repair arms that are complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more nucleic acids comprise 5' and 3' homology-directed repair arms. In some embodiments, the one or more nucleic acids are incorporated into an expression cassette or expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more nucleic acids.

[0478] In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are integrated into a single expression cassette or a single expression vector. In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are integrated into two or more expression cassettes or expression vectors. In some embodiments, the expression vector is a non-viral vector.

[0479] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 184. In some embodiments, the expression cassette comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 184. An expression cassette or expression vector comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 184 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein. In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 185 or 186. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NOs: 185 and 186. An expression cassette or expression vector comprising the sequence set forth in SEQ ID NOs: 185 and 186 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein.

[0480] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 187. In some embodiments, the expression cassette or expression vector comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 187. An expression cassette or expression vector comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 187 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein. In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NOs: 188 and 189. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NOs: 188 and 189. An expression cassette or expression vector comprising the sequence set forth in SEQ ID NOs: 188 and 189 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein.

[0481] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 190. In some embodiments, the expression cassette or expression vector comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 190. An expression cassette or expression vector comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 190 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein. In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NOs: 191 and 192. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NOs: 191 and 192. An expression cassette or expression vector comprising the sequence set forth in SEQ ID NOs: 191 and 192 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein.

[0482] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 196. In some embodiments, the expression cassette comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 196. An expression cassette or expression vector comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 196 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein. In some embodiments, the expression cassette or expression vector comprises the sequences set forth in SEQ ID NOs: 197 and 198. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NOs: 197 and 198. An expression cassette or expression vector comprising the sequence set forth in SEQ ID NOs: 197 and 198 can further comprise one or more transgenes encoding any priming receptor or CAR disclosed herein.

[0483] For example, the transgene contained in any one of the cassettes provided in any one of the sequences set forth in SEQ ID NOs: 184, 187, 190, or 196 can comprise an extracellular domain that specifically binds to prostate-specific membrane antigen (PSMA) and / or a chimeric antigen receptor (CAR) that specifically binds to carbonic anhydrase IX (CA9). For example, the transgene containing the priming receptor can include a variable heavy (VH) chain sequence that includes three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of any PSMA antibody or antigen-binding fragment disclosed herein, and a variable light (VL) chain sequence that includes three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3. Similarly, a transgene comprising a chimeric antigen receptor (CAR) can comprise a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of any CA9 antibody or antigen-binding fragment disclosed herein, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3.

[0484] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 143. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 143.

[0485] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 144. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO:144.

[0486] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 145. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO: 145.

[0487] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 146. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO:146.

[0488] In some embodiments, the expression cassette or expression vector comprises the sequence set forth in SEQ ID NO: 147. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence set forth in SEQ ID NO:147.

[0489] One or more interfering nucleic acid sequences (e.g., one or more shRNAs) can be encoded in an intron region of a nucleic acid insert, DNA template, module, cassette, single expression cassette, or single expression vector, which also encodes a priming receptor and / or a CAR. For example, if the DNA template includes a promoter such as EF1α or an inducible promoter such as the HNF1α-YB TATA promoter described herein to drive expression of a CAR or priming receptor, one or more nucleic acid sequences (e.g., shRNA sequences) can be encoded in a promoter intron region. In some embodiments, one or more nucleic acid sequences are encoded in at least one intron region of a nucleic acid insert, module, cassette, or DNA template. In some embodiments, one or more nucleic acid sequences are encoded in at least one EF1α intron region of a nucleic acid insert, module, cassette, or DNA template.

[0490] In some embodiments, the present disclosure contemplates a nucleic acid, module, cassette, or DNA template insert comprising one or more transgenes encoding a priming receptor and / or a CAR described herein. In some embodiments, the DNA template insert or cassette encodes a priming receptor transgene. In some embodiments, the DNA template insert or cassette encodes a chimeric antigen receptor transgene. In some embodiments, the DNA template insert or cassette encodes a first nucleic acid complementary to at least 15 nucleotides of the human FAS mRNA sequence and a second nucleic acid complementary to at least 15 nucleotides of the human TGBFR2 mRNA sequence. In some embodiments, the DNA template insert or cassette comprises a priming receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid complementary to at least 15 nucleotides of the human TGBFR2 mRNA sequence. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid that is complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid that is complementary to at least 15 nucleotides of the human TGBFR2 mRNA sequence.

[0491] In some embodiments, one or more nucleic acids are encoded on a single DNA template insert or cassette. In some embodiments, one or more nucleic acids are encoded on multiple DNA template inserts or cassettes. For example, one or more nucleic acids can be encoded on two, three, or four DNA template inserts.

[0492] The DNA template insert can also contain a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine teschovirus-1 (P2A) peptide, Thosea asigna virus (T2A) peptide, equine rhinitis A virus (E2A) peptide, or foot-and-mouth disease virus (F2A) peptide. Self-cleaving 2A peptides enable the expression of multiple gene products from a single construct. (See, for example, Chang et al. "Cleavage efficient 2A peptides for high-level monoclonal antibody expression in CHO cells," MAbs 7(2):403-412 (2015)).

[0493] The DNA template insert may also contain a WPRE element, which is generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007) and Zufferey, R., et al. J Virol. 1999 Apr;73(4):2886-92, both of which are incorporated herein by reference.

[0494] The DNA template insert can also include an SV40 or human growth hormone (GH1) polyA tail.

[0495] cell Also provided herein is a cell or immune cell comprising at least one DNA template non-virally inserted into a target region of the cell's genome, wherein the DNA template encodes the priming receptor and CAR system described herein.Also provided herein is a cell or immune cell comprising a priming receptor that specifically binds to prostate-specific membrane antigen (PSMA) and a chimeric antigen receptor that specifically binds to CA9.

[0496] A cell containing a DNA template insert at a target locus or safe harbor site, as described in this disclosure, may be referred to as an engineered cell. In some embodiments, the cell or immune cell is any cell that can give rise to a pluripotent immune cell. In some embodiments, the immune cell is a primary immune cell. In some embodiments, the immune cell may be an induced pluripotent stem cell (iPSC) or a human pluripotent stem cell (HSPC). In some embodiments, the immune cell comprises a primary hematopoietic cell or a primary hematopoietic stem cell. In some embodiments, the engineered cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell precursor. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, an effector T cell, or a naive T cell. In some embodiments, the T cell is a CD8 + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0497] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, hematopoietic stem cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. Non-limiting examples of immune cells contemplated in this disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated in this disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other stem cells, including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tenocytes, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.

[0498] Also provided herein are populations of cells comprising a plurality of cells or immune cells, in some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise the priming receptor and CAR system described herein.

[0499] Methods of Treating Immune-Related Conditions of Disease In another aspect, the disclosure herein provides a method of treating an immune-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, e.g., a cellular composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9. In another aspect, the disclosure herein provides a method of enhancing an immune response in an individual, comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, e.g., a cellular composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0500] In some embodiments, the target cell is a cell that expresses both PSMA and CA9. In some embodiments, the target cell is a cancer cell that expresses both PSMA and CA9. In some embodiments, the cancer cell or diseased cell expresses PSMA and CA9.

[0501] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0502] In some embodiments, the methods provided herein (e.g., methods of enhancing an immune response) are useful for treating cancer, and thus, an individual who receives a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is immunoevasive. In some embodiments, the cancer is immunoresponsive. In certain embodiments, the cancer is renal carcinoma, renal cell carcinoma, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0503] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing cancer volume compared to the cancer volume before administration of the antibody. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing cancer growth rate compared to the cancer growth rate before administration of the antibody. In some embodiments, the treatment is effective in eliminating the cancer.

[0504] In some embodiments, CA9 and PSMA are expressed at higher levels in cancer cells compared to non-cancer cells.The level of CA9 and PSMA can be evaluated by any technique known in the art, including but not limited to protein assay or nuclear assay, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection method, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology, and FISH, and combinations thereof.

[0505] In some embodiments, provided herein are methods of inhibiting target cells in a subject, comprising administering to the subject an immune cell or population of immune cells disclosed herein, wherein the immune cells inhibit the target cells. Inhibition of target cells includes killing cancer cells or preventing or reducing cancer cell growth, proliferation, or metastasis.

[0506] In some embodiments, the subject receives 30 mg / m 2 of fludarabine and 300 mg / m 2The subject is conditioned with cyclophosphamide. Administration of the immune cells or populations of immune cells disclosed herein to the subject without conditioning may also be performed. In some embodiments, the subject is conditioned on one or more of day -3, day -4, and / or day -5 prior to administration of the immune cells or populations of immune cells disclosed herein.

[0507] In some embodiments, the subject receives 100×10 6 , 300×10 6 or 1000 x 10 6 of an immune cell or population of immune cells disclosed herein.

[0508] Immunomodulatory methods The method of administering cells comprising the system described herein, comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, can result in modulation of the immune response. The modulation can be an increase or decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0509] In one aspect, administration of cells comprising the system described herein, comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, can result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. Generally, the induced pro-inflammatory molecules are present at levels exceeding those achieved with isotype controls. Such pro-inflammatory molecules then lead to the activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9 can induce multiple anti-tumor immune mechanisms that result in tumor destruction.

[0510] In some embodiments, the target cells are cells that express both PSMA and CA9, hi some embodiments, the diseased cells express both PSMA and CA9.

[0511] In another aspect, provided herein is a method for increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9. In some embodiments, the method for increasing an immune response in a subject comprises administering to the subject cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0512] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0513] In any of the embodiments described herein that increase an immune response, any increase, decrease, or alteration in any aspect of a characteristic or function is compared to cells that do not contain a composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0514] Increasing an immune response can be both enhancing an immune response or inducing an immune response. For example, increasing an immune response encompasses both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9. In some embodiments, the immune response is enhanced by administration of cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0515] In another aspect, the present application provides a method for gene editing a cell using a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, which results in modulation of the immune function of the cell. The modulation can be an increase in immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in expression of a CA9 CAR. In some embodiments, the modulation of function results in activation of the cell comprising the system.

[0516] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0517] In some embodiments, modulation of the function of cells comprising a priming receptor and a CAR system described herein results in an increase in the ability of the cells to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by cells expressing the priming receptor and a CAR system. In some embodiments, modulation of function enhances or increases the ability of the cells to produce cytokines, chemokines, CARs, or costimulatory or activating receptors. In some embodiments, modulation increases the T cell stimulatory function of cells expressing the priming receptor and a CAR system, where T cell stimulatory function includes, for example, the ability of the cells to trigger T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0518] In some embodiments, the increased immune response is cytokine and chemokine secretion. In some embodiments, the priming receptor and CAR system induces increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells. In some embodiments, the at least one cytokine or chemokine is selected from the group consisting of IL-2 and IFNγ. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNγ. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2 and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNγ and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0519] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0520] In some embodiments, cells expressing the priming receptor and CAR system induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0521] How to edit cells

[0010] In some embodiments, provided herein is a method of editing a cell, the method comprising: providing a nuclease domain and a guide RNA, wherein the nucleic acid comprises a nucleic acid disclosed herein, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the cell; introducing the nuclease domain and nucleic acid into the cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and editing the cell via insertion of the nucleic acid into the insertion site in the genome of the cell.

[0522] The term "gene editing" or "genome editing," as used herein, refers to a type of genetic engineering in which DNA is inserted into, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effects of sequence-specific genes or proteins or for modifying cellular behavior (e.g., for therapeutic purposes).

[0523] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0524] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

[0525] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.

[0526] Also provided herein is a method for producing immune cells, comprising introducing a nucleic acid comprising the priming receptor and CAR system described herein into primary immune cells. In some embodiments, the immune cells are isolated cells. In some embodiments, the immune cells are mammalian cells (e.g., human cells).

[0527] Provided herein is a method for inserting a nucleotide sequence of more than about 5 kilobases in length into the genome of a cell in the absence of a viral vector. In some embodiments, a nucleotide sequence of more than about 5 bases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0528] The integration of large nucleic acids, e.g., nucleic acids greater than 5 kilobases in size, into cells can be limited by low integration efficiency, off-target effects, and / or loss of cell viability. Methods and compositions for achieving integration of nucleotide sequences, e.g., nucleotide sequences greater than about 5 bases in size, into the genome of a cell are described herein. Some methods improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.

[0529] The plasmid can be introduced into immune cells using a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced into a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cleaves the genomic DNA at this specific site. The specific site can be a portion of the genome that encodes an endogenous immune cell receptor. Therefore, by cleaving the genome at this site, the immune cell no longer expresses the endogenous immune cell receptor.

[0530] The plasmid may contain 5' and 3' homologous recombination repair arms complementary to sequences at specific sites on the genome of the immune cell. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site on the genome of the immune cell. Once the plasmid is integrated, the cell expresses the priming receptor. However, as described, the design of the transgene cassette ensures that the non-viral delivery system receptor does not express the CAR until the priming receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0531] First, T cells are isolated and optionally activated. The T cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells such as T cells are harvested from a patient. A plasmid encoding a CAR and a priming receptor is then introduced into the T cells. Advantageously, the plasmid of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. The T cells are then expanded and co-cultured to generate a sufficient amount of engineered immune cells for use as a therapeutic treatment.

[0532] A method for editing the genome of a cell can include a) providing a Cas9 ribonucleoprotein complex (RNP) and nucleic acid, the complex comprising: (i) an RNP, the RNP comprising a Cas9 nuclease domain and a guide RNA, the guide RNA specifically hybridizing to a target region of the genome of the cell, and the Cas9 nuclease domain cleaving the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded nucleic acid, such as a DNA template, the nucleic acid (e.g., the DNA template) being greater than about 200 nucleotides in size, the 5' and 3' ends of the nucleic acid (e.g., the DNA template) comprising nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and the molar ratio of RNP to nucleic acid (e.g., the DNA template) in the complex being between about 3:1 and about 100:1; and b) introducing the RNP complex and the nucleic acid (e.g., the DNA template) into the cell.

[0533] In some embodiments, the methods described herein provide an efficiency of delivery of RNP complexes and nucleic acids (e.g., DNA templates) of at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP complexes and nucleic acids (e.g., DNA templates) into cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or non-viable) into which the RNP complexes and nucleic acids (e.g., DNA templates) are introduced.

[0534] As another example, the efficiency of delivery can be determined by quantifying the number of genome-edited cells in a cell population (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing are available. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.

[0535] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these. In some embodiments, the off-target effects of integration are reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these.

[0536] In some cases, the methods described herein provide high cell viability of cells into which RNPs and nucleic acids (e.g., DNA templates) have been introduced. In some cases, the viability of cells into which RNPs and nucleic acids (e.g., DNA templates) have been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which RNP and nucleic acid (e.g., DNA template) have been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0537] In the methods provided herein, the molar ratio of RNP to nucleic acid (e.g., DNA template) can be about 3:1 to about 100:1. For example, the molar ratio can be about 3:1 to 10:1, about 3:1 to about 15:1, 3:1 to about 20:1, 3:1 to about 25:1, about 3:1 to about 50:1, about 3:1 to 75:1, about 3:1 to 100:1, about 5:1 to 10:1, about 5:1 to about 15:1, 5:1 to about 20:1, 5:1 to about 25:1, about 5:1 to 50:1, about 5:1 to 75:1, or about 5:1 to 100:1. , about 8:1 to about 12:1, about 8:1 to about 15:1, about 8:1 to about 20:1, about 8:1 to about 25:1, about 8:1 to about 50:1, about 8:1 to 75:1, about 8:1 to 100:1, about 10:1 to about 15:1, 10:1 to about 20:1, 10:1 to about 25:1, about 10:1 to 50:1, about 10:1 to 75:1, or about 10:1 to 100:1.

[0538] In some embodiments, the nucleic acid (e.g., DNA template) is at a concentration of about 2.5 pM to about 25 pM. For example, the concentration of the nucleic acid (e.g., DNA template) can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration therebetween.

[0539] In some embodiments, the size or length of a nucleic acid (e.g., a DNA template) is about 4.5 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb, 7.5 kb, 7.6 kb, 7.7 kb , 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, 10kb, 11kb, 12kb, 13kb, 14kb, 15kb, or greater than 16kb, or any size in between these sizes. For example, the size of the DNA template may be about 4.5 kb to about 15 kb, about 4.5 kb to about 14 kb, about 4.5 kb to about 10 kb, about 5 kb to about 15 kb, about 5 kb to about 14 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about 6 kb to about 15 kb, about 6 kb to about 14 kb, about 6 kb to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 15 kb, about 7 kb to about 1 It may be 4 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 15 kb, about 8 kb to about 14 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, about 9 kb to about 15 kb, about 9 kb to about 14 kb, about 9 kb to about 13 kb, about 9 kb to about 12 kb, about 9 kb to about 11 kb, about 9 kb to about 10 kb, about 10 kb to about 15 kb, about 10 kb to about 14 kb, about 10 kb to about 13 kb, about 10 kb to about 12 kb, or about 10 kb to about 11 kb.

[0540] In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 1 μg to about 10 μg. For example, the amount of nucleic acid (e.g., DNA template) can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0541] In some cases, the size of the nucleic acid (e.g., DNA template) is large enough and abundant enough to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or fragment thereof. In some embodiments, the nucleic acid (e.g., DNA template) encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the nucleic acid (e.g., DNA template) encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes.

[0542] In some embodiments, the nucleic acid (e.g., a DNA template) comprises a regulatory sequence, such as a promoter sequence and / or an enhancer sequence, for regulating expression of a heterologous protein or fragment thereof after insertion into the genome of a cell. In some embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter comprises one or more HNF1α enhancer elements. In some embodiments, the inducible promoter comprises a YB-TATA promoter element. In some embodiments, the inducible promoter comprises the sequence set forth in SEQ ID NO: 256. In some embodiments, the promoter is an inducible promoter. In some embodiments, the constitutive promoter is an EF1α promoter. In some embodiments, the constitutive promoter comprises the sequence of SEQ ID NO: 179.

[0543] In some cases, the nucleic acid (e.g., DNA template) is a linear DNA template. In some cases, the nucleic acid (e.g., DNA template) is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of the other or opposite strand of DNA. "Substantially devoid" means that the pure single-stranded DNA is devoid of one DNA strand at least 100 times more than another DNA strand.

[0544] In some cases, the RNP and nucleic acid (e.g., DNA template) complex is formed by incubating the RNP with the nucleic acid (e.g., DNA template) at a temperature of about 20°C to about 25°C for less than about 1 minute to about 30 minutes. For example, the RNP can be incubated with the DNA template at a temperature of about 20°C, 21°C, 22°C, 23°C, 24°C, or 25°C for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any amount of time therebetween. In another example, RNPs can be incubated with nucleic acid (e.g., DNA template) at a temperature of about 20°C to about 25°C for about less than 1 minute to about 1 minute, about less than 1 minute to about 5 minutes, about less than 1 minute to about 10 minutes, about 5 to 10 minutes, about 5 to 15 minutes, about 10 to about 15 minutes, about 10 to about 20 minutes, or about 10 to about 30 minutes. In some embodiments, the RNP-DNA template complex and cells are mixed before introducing the RNP-DNA template complex into cells. In some embodiments, the RNP and nucleic acid (e.g., DNA template) and cells are mixed before introducing the RNP and nucleic acid (e.g., DNA template) into cells.

[0545] In some embodiments, introducing the RNP complex and nucleic acid (e.g., a DNA template) comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce RNP and nucleic acid (e.g., a DNA template) can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP and nucleic acid (e.g., a DNA template) can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP and nucleic acid (e.g., a DNA template) can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L. Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNPs and nucleic acids (e.g., DNA templates) can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.

[0546] In some embodiments, the Cas9 protein can be in an active endonuclease form so that when bound to a target nucleic acid as part of a complex with a guide RNA or a nucleic acid (e.g., a DNA template), a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or by HDR to introduce specific mutations. Various Cas9 nucleases can be utilized in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be utilized. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be utilized to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).

[0547] In some cases, Cas9 protein is a nickase, so that when it binds to target nucleic acid as part of a complex with guide RNA, it introduces single-strand breaks or nicks into target nucleic acid.A pair of Cas9 nickases, each bound to a structurally different guide RNA, can target two adjacent sites in the target genome region, thus introducing a pair of adjacent single-strand breaks into the target genome region.Nickase pairs can increase specificity because off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0548] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.

[0549] In some cases, multiple RNPs comprising structurally distinct ribonucleoprotein complexes and nucleic acids (e.g., DNA templates) are introduced into cells. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the nucleic acids (e.g., DNA templates) at multiple structurally distinct target genomic regions.

[0550] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. Progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - The modified cells are T cells. Also provided are any populations of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0551] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to the patient. In other cases, any of the constructs described herein are delivered to the patient in vivo. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both incorporated herein by reference).

[0552] In some embodiments, the RNP and nucleic acid (e.g., DNA template) are mixed at about 1×10 5 ~Approx. 2×10 6 For example, the RNP-DNA template complex is introduced into approximately 1 × 10 cells. 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~Approx. 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells, or approximately 1 x 10 6 ~Approx. 2×10 6 can be introduced into

[0553] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express heterologous proteins (e.g., chimeric antigen receptors (CARs) or priming receptors).

[0554] Insertion site Methods for editing the genome of a T cell specifically include methods for editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human T cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the TCR-α transmembrane domain.

[0555] Methods for editing the genome of a T cell also include methods for editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0556] Methods for editing the genome of T cells specifically include methods for editing the genome of human T cells, comprising inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0557] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges, such as low knock-in efficiency, risk of insertional oncogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by identifying and using safe harbor loci or safe harbor sites (SHSs), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0558] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in an increasing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, whose disruption confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, similar to the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are located near many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.)

[0559] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55,625,241-55,629,351. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019):814-828 (the relevant disclosure of which is incorporated herein by reference). Exemplary AAVS1-targeting gRNAs and target sequences are provided below. AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 268) AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 269)

[0560] CCR5, located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus for CCR5 is chr3:46,414,443-46,414,942. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, Vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference).

[0561] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 ("Identification and targeting of the ROSA26 locus in human embryonic stem cells." Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which is incorporated herein by reference) identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

[0562] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Additional examples of integration sites are provided in Table D.

[0563] In some embodiments, safe harbor sites allow for high transgene expression (sufficient to enable transgene functionality or treatment of the disease of interest) and stable expression of the transgene over days, weeks, or months. In some embodiments, knockout of the gene at the safe harbor locus confers a benefit to cellular function, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.

[0564] When used, "neighboring genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).

[0565] In some embodiments, the present disclosure contemplates inserts containing one or more transgenes. The transgenes can encode therapeutic proteins, antibodies, peptides, or any other gene of interest. Transgene incorporation can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. Therapeutic properties of immune cells can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells can also be manifested by expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the tumor microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity through reduction, and resistance to treatments such as chemotherapy.

[0566] As used herein, the term "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into a target locus or safe harbor site. In some embodiments, the insert size comprises at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size comprises about 5,000 or more nucleotide base pairs. In some embodiments, the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilobase pairs), or any size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp, or any size therebetween. In some embodiments, the insert size is in the range of 4.5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.8-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.5-20 kbp, or any number within that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, or 9-10 kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp.In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp. In some embodiments, the insert size is 4.5 to 17, 6 to 17, 7 to 17, 8 to 17, 9 to 17, 10 to 17, 11 to 17, 12 to 17, 13 to 17, or 14 to 17, 15 to 17, or 16 to 17 kbp. In some embodiments, the insert size is 4.5 to 18, 6 to 18, 7 to 18, 8 to 18, 9 to 18, 10 to 18, 11 to 18, 12 to 18, 13 to 18, 14 to 18, 15 to 18, 16 to 18, or 17 to 18 kbp. In some embodiments, the insert size is 4.5 to 19, 6 to 19, 7 to 19, 8 to 19, 9 to 19, 10 to 19, 11 to 19, 12 to 19, 13 to 19, 14 to 19, 15 to 19, 16 to 19, 17 to 19, or 18 to 19 kbp. In some embodiments, the insert size is 4.5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, or 19 to 20 kbp.

[0567] An insert, as used herein, refers to a nucleic acid molecule or polynucleotide inserted into a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. Nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or may comprise non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.

[0568] An insert can have coding and / or non-coding regions. An insert can include non-coding sequences (e.g., regulatory elements, e.g., promoter sequences). In some embodiments, an insert encodes a transcription factor. In some embodiments, an insert encodes an antigen-binding receptor, e.g., a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, an insert is a human sequence. In some embodiments, an insert is chimeric. In some embodiments, an insert is a multigene / multimodule therapeutic cassette. A multigene / multimodule therapeutic cassette refers to an insert or cassette having one or more receptors (e.g., a synthetic receptor such as a CAR or priming receptor), other exogenous protein-coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0569] In some embodiments, nucleic acid sequences are inserted into the genome of cells such as immune cells or T cells via non-viral delivery.In non-viral delivery methods, nucleic acids can be naked DNA or can be in non-viral plasmids or vectors.Non-viral delivery techniques can be site-specific integration techniques described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0570] In some embodiments, the insert is integrated into the safe harbor site by introducing into the engineered cell (a) a target nuclease that cleaves the target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (insert), which is integrated into the insertion site, for example, by HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in U.S. Application Nos. US11033584B2 and US11814624B2, the relevant disclosures of which are incorporated herein by reference in their entireties.

[0571] Examples of contemplated integration sites are provided in Table D.

[0572] Table D. sgRNA sequences TIFF2026507228000008.tif211165TIFF2026507228000009.tif226165TIFF202 6507228000010.tif226165TIFF2026507228000011.tif226165TIFF20265072280 00012.tif226165TIFF2026507228000013.tif224165TIFF2026507228000014.t if228165TIFF2026507228000015.tif210165TIFF2026507228000016.tif205165

[0573] CRISPR-Cas editing One effective example of gene editing is the CRISPR-Cas approach (e.g., CRISPR-Cas9), which incorporates the use of a guide polynucleotide (e.g., a guide ribonucleic acid or gRNA) and a cas endonuclease (e.g., Cas9 endonuclease).

[0574] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, which is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks in DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0575] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can complex with a Cas endonuclease and enable the Cas endonuclease to recognize and cleave a DNA target site. A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide that contains only ribonucleic acid is also referred to as a "guide RNA." In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a nuclease such as a cas endonuclease (e.g., Cas9 endonuclease).

[0576] The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide sequence that interacts with a Cas endonuclease polypeptide. The guide polynucleotide may be a duplex molecule (also referred to as a double-stranded guide polynucleotide) that comprises a sequence domain (also referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this duplex guide polynucleotide comprises two separate molecules that hybridize along complementary regions. The two separate molecules may be RNA sequences, DNA sequences, and / or RNA-DNA combination sequences.

[0577] Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonuclease). Homologous recombination repair (HDR) of these DSBs allows for precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Traditional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homologous arms matching the locus of interest.

[0578] HITI (homology-independent targeted insertion) uses a homology-independent strategy based on non-homologous end joining (NHEJ), which can be more efficient than HDR. A guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to contain Cas9 cleavage sites adjacent to the gene or sequence to be inserted. This results in Cas9 cleavage in both the donor plasmid and the genomic target sequence. Both the target and donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway, which leads to integration into the genomic DSB site. (See, for example, Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149 (the relevant disclosure of which is incorporated herein in its entirety).)

[0579] Methods for gene editing using CRISPR-Cas approaches are known to those skilled in the art. (See, for example, U.S. Application Nos. US16 / 312,676, US15 / 303,722, and US15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties.) Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in U.S. Application No. 13 / 036,343, the disclosure of which is incorporated herein by reference in its entirety.

[0580] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamine or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and lipid moieties such as octadecylamine or hexylamino-carbonyl-t-oxycholesterol moieties. See, e.g., U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0581] therapeutic use For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered in an effective amount to a subject, generally a mammal, generally a human. The engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other modes of administration known to those skilled in the art.

[0582] The engineered cells provided herein find use in gene therapy as well as non-pharmaceutical uses, such as, for example, the production of animal models and the production of recombinant cell lines expressing a protein of interest.

[0583] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by incorporating a transgene at a safe harbor locus as described herein. Exemplary cells are provided in the recombinant cell section.

[0584] The engineered cells, compositions, and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy. In some embodiments, insertion of a sequence encoding a transgene within a safe harbor locus maintains TCR expression relative to the absence of the insertion, allowing transgene expression while maintaining TCR function.

[0585] In some embodiments, the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. This effect can be a partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment includes any treatment of a disease in a subject (e.g., a mammal, e.g., a human). Additionally, treatment can stabilize or reduce undesirable clinical symptoms in a subject (e.g., a patient). The cells, populations thereof, or compositions thereof provided herein can be administered during or after the onset of a disease.

[0586] In certain embodiments, a subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, a subject in need of cell therapy is a subject with an injury, disease, or condition that triggers cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that the severity of at least one symptom associated with the injury, disease, or condition can be treated, ameliorated, and / or reduced.

[0587] Method of administration An effective amount of the immune cells comprising the system can be administered for the treatment of cancer. The appropriate dosage of the immune cells comprising the system can be determined based on the type of cancer being treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0588] Determination of PSMA and / or CA9 expression levels Also provided herein is a method of treating cancer in a subject in need thereof, comprising determining or having determined the expression level of PSMA in the subject, determining or having determined the expression level of CA9 in the subject, and administering or having administered to the subject a system comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds PSMA and a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9.

[0589] Also provided herein is a method of treating cancer in a subject in need thereof, the method comprising: determining or having determined the expression level of PSMA in the subject; determining or having determined the expression level of CA9 in the subject; and administering or having administered to the subject a cell comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9, and optionally a synthetic pathway activator inserted into a target region of the genome of the cell. In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a primary immune cell.

[0590] In some embodiments, the method further includes determining or has been determined the expression level of PSMA and / or CA9 in a biological sample from the individual. In some embodiments, the biological sample includes, but is not limited to, a body fluid, a tissue sample, an organ sample, urine, feces, blood, saliva, CSF, and any combination thereof. In some embodiments, the biological sample is derived from tumor tissue. In some embodiments, the expression level of PSMA and / or CA9 includes the mRNA expression level of PSMA and / or CA9. In some embodiments, the expression level of PSMA and / or CA9 includes the protein expression level of PSMA and / or CA9. In some embodiments, the expression level of PSMA and / or CA9 is detected in the sample using a method selected from the group consisting of FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, monoplex immunohistochemistry, multiplex immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectroscopy, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology, Luminex, MSD, and FISH, and combinations thereof.

[0591] In some embodiments, provided herein are methods for determining the expression level of PSMA and / or CA9 protein in a sample from a subject, the method comprising contacting the sample with an anti-PSMA and / or CA9 antibody and performing an immunohistoche...

Claims

1. 1. An isolated antibody or antigen-binding fragment thereof that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1), a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; The isolated antibody or antigen-binding fragment thereof.

2. 2. The isolated antibody of claim 1, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 99 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

100.

3. The isolated antibody of claim 1 , wherein the antibody comprises an scFv.

4. The isolated antibody of claim 3, wherein the scFv comprises the sequence set forth in SEQ ID NO:

98.

5. The isolated antibody of claim 1, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:

110.

6. 1. An isolated receptor comprising an extracellular antigen-binding domain that binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1), a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; The isolated receptor.

7. The receptor of claim 6, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 99 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

100.

8. The receptor of claim 6 or 7, comprising an scFv.

9. The receptor of claim 6, wherein the scFv comprises the sequence set forth in SEQ ID NO:

98.

10. The receptor of claim 6, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:

110.

11. From the N-terminus to the C-terminus a. the extracellular antigen-binding domain; b. a transmembrane domain; c. an optional intracellular costimulatory domain; and d. an intracellular activation domain; The receptor according to any one of claims 6 to 10, which is a chimeric antigen receptor (CAR) comprising:

12. The receptor of claim 11 , wherein the CAR further comprises a hinge domain.

13. The receptor of claim 12, wherein the hinge domain comprises a CD8α, a truncated CD8α, or a CD28 hinge domain.

14. The receptor according to any one of claims 11 to 13, wherein the transmembrane domain comprises the CD8α transmembrane domain or the CD28 transmembrane domain.

15. The receptor of any one of claims 11 to 14, wherein the intracellular costimulatory domain comprises a 4-1BB domain.

16. The receptor according to any one of claims 11 to 15, wherein the intracellular activation domain comprises the CD3ζ domain.

17. The receptor of any one of claims 11 to 16, wherein the CAR comprises a sequence set forth in SEQ ID NO: 108, 115, 250, or 251.

18. 1. An isolated antibody or antigen-binding fragment thereof that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; The isolated antibody or antigen-binding fragment thereof.

19. 19. The isolated antibody of claim 18, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 118 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

119.

20. 19. The isolated antibody of claim 18, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 130 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

131.

21. 20. The isolated antibody of claim 18, wherein the antibody comprises an scFv.

22. 22. The isolated antibody of claim 21, wherein the scFv comprises the sequence set forth in SEQ ID NO: 117 or 129.

23. 1. An isolated receptor comprising an extracellular antigen-binding domain that binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; The isolated receptor.

24. 24. The receptor of claim 23, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 118 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

119.

25. 24. The receptor of claim 23, wherein the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 130 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

131.

26. The receptor of any one of claims 23 to 25, wherein the priming receptor comprises an scFv.

27. The receptor of claim 26, wherein the scFv comprises the sequence set forth in SEQ ID NO: 117 or 129.

28. The receptor is arranged in the N-terminal to C-terminal direction as follows: a. the extracellular antigen-binding domain; b. a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain comprising a human or humanized transcriptional effector; Including, binding of PSMA by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites; A receptor according to any one of claims 23 to 27.

29. 29. The receptor of claim 28, wherein the priming receptor further comprises a hinge domain disposed between the extracellular antigen-binding domain and the transmembrane domain.

30. 30. The receptor of claim 29, wherein the hinge domain comprises CD8α or a truncated CD8α hinge domain.

31. The receptor of claim 30 , wherein the hinge domain comprises the sequence set forth in SEQ ID NO:

85.

32. A receptor according to any one of claims 28 to 31, wherein the transmembrane domain comprises a Notch1 transmembrane domain.

33. The receptor according to any one of claims 28 to 32, wherein the transmembrane domain comprises the sequence set forth in SEQ ID NO:

86.

34. The receptor according to any one of claims 28 to 33, wherein the intracellular domain comprises an HNF1α / p65 domain or a Gal4 / VP64 domain.

35. The receptor of claim 34, wherein the intracellular domain comprises a sequence set forth in SEQ ID NO: 88, 89, or 90.

36. The receptor of any one of claims 28 to 35, wherein the priming receptor further comprises a stop transport sequence or a juxtamembrane domain between the transmembrane domain and the intracellular domain.

37. The receptor of claim 36, wherein the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:

87.

38. The receptor of any one of claims 28 to 37, wherein the priming receptor comprises the sequence set forth in SEQ ID NO: 127, 138, 252, or 253.

39. a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1); and Including, the system.

40. the first extracellular antigen-binding domain comprises a first variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a first variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; 40. The system of claim 39.

41. 41. The system of claim 39 or 40, wherein the first VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

42. The system of any one of claims 39 to 41, wherein the first VL chain sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

43. The system of any one of claims 39 to 42, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

44. the second extracellular antigen-binding domain comprises a second variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a second variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; A system according to any one of claims 39 to 43.

45. 45. The system of claim 44, wherein the second VH comprises a sequence set forth in SEQ ID NO: 99 or 110.

46. 46. ​​The system of claim 44 or 45, wherein the second VL comprises the sequence set forth in SEQ ID NO:

100.

47. The system of any one of claims 44 to 46, wherein the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

48. 48. The system of any one of claims 39 to 47, further comprising an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA).

49. a. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and b. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:4 The system of any one of claims 39 to 48, further comprising at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to

50. 50. The system of any one of claims 39 to 49, wherein the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

51. 51. The system of any one of claims 39 to 50, encoded by a nucleic acid comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

52. 52. The system of claim 50 or 51, wherein the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

53. a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1); and c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. below: i. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and ii. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4. and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to Including, the system.

54. the first extracellular antigen-binding domain comprises a first variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a first variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; 54. The system of claim 53.

55. 55. The system of claim 53 or 54, wherein the first VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

56. 56. The system of any one of claims 53 to 55, wherein the first VL chain sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

57. 57. The system of any one of claims 53 to 56, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

58. the second extracellular antigen-binding domain comprises a second variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a second variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; A system according to any one of claims 53 to 57.

59. 59. The system of claim 58, wherein the second VH comprises a sequence set forth in SEQ ID NO: 99 or 110.

60. 60. The system of claim 58 or 59, wherein the second VL comprises the sequence set forth in SEQ ID NO:

100.

61. The system of any one of claims 58 to 60, wherein the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

62. a. A first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA) (SEQ ID NO: 2), wherein the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; the first chimeric polypeptide; and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. below: i. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and ii. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4. and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to Including, the system.

63. 63. The system of claim 62, wherein the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

64. 64. The system of claim 62 or 63, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

65. The system of any one of claims 62 to 64, wherein the VL chain sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

66. The system of any one of claims 62 to 65, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

67. The system of any one of claims 62 to 66, wherein the CAR comprises a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9) (SEQ ID NO: 1).

68. the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; 68. The system of claim 67.

69. The system of claim 68, wherein the VH comprises a sequence set forth in SEQ ID NO: 99 or 110.

70. 70. The system of claim 68 or 69, wherein the VL comprises the sequence set forth in SEQ ID NO:

100.

71. The system of any one of claims 62 to 70, wherein the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

72. a. a first chimeric polypeptide comprising a priming receptor; b. A second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds carbonic anhydrase IX (CA9) (SEQ ID NO: 1), wherein the extracellular antigen-binding domain comprises a single domain antibody, wherein the single domain antibody comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 110, and optionally i. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; the second chimeric polypeptide; and c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. below: i. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and ii. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4. and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to Including, the system.

73. 73. The system of claim 72, wherein the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

74. 74. The system of claim 72 or 73, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO: 99 or 110.

75. The system of any one of claims 72 to 74, wherein the VL comprises the sequence set forth in SEQ ID NO:

100.

76. The system of any one of claims 72 to 75, wherein the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

77. The system of any one of claims 72 to 76, wherein the priming receptor comprises a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA).

78. the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; 78. The system of claim 77.

79. The system of claim 78, wherein the VH comprises the sequence set forth in SEQ ID NO: 118 or 130.

80. 80. The system of claim 78 or 79, wherein the VL comprises the sequence set forth in SEQ ID NO: 119 or 131.

81. The system of any one of claims 77 to 80, wherein the first extracellular domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

82. The priming receptor is, in the N-terminal to C-terminal direction, a. the first extracellular antigen-binding domain; and b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain comprising a human or humanized transcriptional effector; Including, binding of PSMA by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites; A system according to any one of claims 39 to 81.

83. 83. The system of claim 82, wherein the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain.

84. 84. The system of claim 83, wherein the first hinge domain comprises CD8α or a truncated CD8α hinge domain.

85. 85. The system of claim 84, wherein the first hinge comprises the sequence set forth in SEQ ID NO:

85.

86. The system of any one of claims 82 to 85, wherein the first transmembrane domain comprises a Notch1 transmembrane domain.

87. The system of any one of claims 82 to 86, wherein the transmembrane domain comprises the sequence set forth in SEQ ID NO:

86.

88. The system of any one of claims 82 to 86, wherein the intracellular domain comprises an HNF1α / p65 domain or a Gal4 / VP64 domain.

89. 89. The system of claim 88, wherein the intracellular domain comprises a sequence set forth in SEQ ID NO: 88, 89, or 90.

90. The system of any one of claims 82 to 88, wherein the priming receptor further comprises a stop transport sequence or a juxtamembrane domain between the first transmembrane domain and the intracellular domain.

91. The system of claim 90, wherein the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:

87.

92. The system of any one of claims 39 to 91, wherein the priming receptor comprises a sequence set forth in SEQ ID NO: 127, 138, 252, or 253.

93. The CAR is, in an N-terminal to C-terminal direction, a. a second extracellular antigen-binding domain; and b. a second transmembrane domain; and c. an intracellular costimulatory domain; d. an intracellular activation domain; The system of any one of claims 39 to 90, comprising:

94. The system of any one of claims 39 to 93, wherein the CAR comprises a second hinge domain.

95. 95. The system of claim 94, wherein the second hinge domain comprises CD8α or a truncated CD8α hinge domain.

96. The system of any one of claims 93 to 95, wherein the second transmembrane domain comprises a CD8α transmembrane domain.

97. The system of any one of claims 93 to 96, wherein the intracellular costimulatory domain comprises a 4-1BB domain.

98. The system of any one of claims 93 to 97, wherein the intracellular activation domain comprises a CD3ζ domain.

99. The system of any one of claims 39 to 98, wherein the CAR comprises a sequence set forth in SEQ ID NO: 108, 115, 250, or 251.

100. The system of any one of claims 39 to 99, wherein the priming receptor and the CAR are capable of binding to the same target cell when the target cell expresses PSMA and CA9.

101. 101. The system of any one of claims 39 to 100, encoded by a nucleic acid comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

102. 102. The system of claim 101, wherein the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

103. 101. The system of any one of claims 39 to 100, wherein at least one or more of the nucleic acid sequences is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

104. 104. The system of any one of claims 49 to 103, wherein at least one of the nucleic acid sequences is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

105. The system of claim 104, wherein at least one of the nucleic acid sequences is an shRNA.

106. The system of any one of claims 49 to 105, wherein the at least one or more nucleic acids comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 82.

107. The system of any one of claims 49 to 106, wherein the nucleic acid sequence complementary to human FAS comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 20.

108. 108. The system of any one of claims 49-107, wherein the nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

109. The system of any one of claims 49 to 108, wherein the nucleic acid sequence complementary to human TGFBR2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34 to 82.

110. 110. The system of any one of claims 49-109, wherein the nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

111. The system of any one of claims 49 to 110, comprising at least two nucleic acid sequences complementary to human TGFBR2 selected from the group consisting of the sequences set forth in SEQ ID NOs: 34 to 82.

112. 109. The system of any one of claims 49 to 108, comprising at least one first nucleic acid sequence complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and a second nucleic acid sequence complementary to a nucleic acid encoding a human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

113. 113. The system of claim 112, wherein the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

114. 114. The system of claim 112 or 113, wherein the first nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid, and the second nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

115. 110. The system of any one of claims 112 to 109, further comprising a third nucleic acid sequence complementary to a nucleic acid encoding human TGF-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

116. 116. The system of claim 115, wherein the third nucleic acid reduces expression of TGFBR2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the third nucleic acid.

117. 117. The system of any one of claims 49 to 116, further comprising at least one nucleic acid sequence complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

118. 118. The system of claim 117, wherein the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

119. The system of claim 117 or 118, wherein the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33.

120. The system of claim 117 or 119, wherein the nucleic acid reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

121. The system of any one of claims 48 to 120, wherein the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3, and / or STAT5 phosphorylation.

122. The system of any one of claims 48 to 121, wherein the SPA comprises an extracellular domain linked to an intracellular signaling domain.

123. The system of claim 122, wherein the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

124. 124. The system of claim 122 or 123, wherein the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

125. The system of claim 122 or 123, wherein the cytokine receptor comprises interleukin-6 signal transducer (IL6ST).

126. The system of any one of claims 48 to 125, wherein the SPA comprises a sequence set forth in SEQ ID NO: 141 or 254.

127. 126. The system of any one of claims 122 to 125, wherein the extracellular domain conveys constitutive activity to the intracellular signaling domain.

128. 101. The system of claim 100, wherein the target cell is a human cell.

129. The system of claim 100 or 128, wherein the target cell is a cancer cell.

130. The system of claim 129, wherein the cancer cells are solid cancer cells or liquid cancer cells.

131. 131. The system of claim 129 or 130, wherein the cancer cells are renal cells, colon cells, or lung cells.

132. A nucleic acid comprising a nucleotide sequence encoding the antibody of any one of claims 1 to 5.

133. A nucleic acid comprising a nucleotide sequence encoding the antibody of any one of claims 18 to 22.

134. A nucleic acid comprising a nucleotide sequence encoding the chimeric antigen receptor of any one of claims 6 to 17.

135. A nucleic acid comprising a nucleotide sequence encoding the priming receptor of any one of claims 23 to 38.

136. One or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of any one of claims 39 to 131.

137. 137. The nucleic acid of claim 136, comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

138. 138. The nucleic acid of claim 136 or 137, comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

139. a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9); and One or more nucleic acids encoding

140. 140. The nucleic acid of claim 139, further comprising a third chimeric polypeptide comprising a synthetic pathway activator (SPA).

141. i. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and ii. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

141. The nucleic acid of claim 139 or 140, further comprising at least one nucleic acid sequence of at least 15 nucleotides in length complementary to:

142. a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9); and c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. below: i. a nucleic acid encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and ii. A nucleic acid encoding human transforming growth factor (TGF)-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4. and at least one nucleic acid sequence of at least 15 nucleotides in length complementary to One or more nucleic acids encoding

143. the first extracellular antigen-binding domain comprises a heavy chain comprising a first variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 118 or 130, and a light chain comprising a first variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 119 or 131; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 120, CDR-H2 comprises the sequence set forth in SEQ ID NO: 121, CDR-H3 comprises the sequence set forth in SEQ ID NO: 122, CDR-L1 comprises the sequence set forth in SEQ ID NO: 123, CDR-L2 comprises the sequence set forth in SEQ ID NO: 124, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 125, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 132, CDR-H2 comprises the sequence set forth in SEQ ID NO: 133, CDR-H3 comprises the sequence set forth in SEQ ID NO: 134, CDR-L1 comprises the sequence set forth in SEQ ID NO: 135, CDR-L2 comprises the sequence set forth in SEQ ID NO: 136, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 137; A nucleic acid according to any one of claims 139 to 142.

144. The nucleic acid of any one of claims 139 to 143, wherein the first VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 118 or 130, and the first VL chain sequence comprises the VL sequence set forth in SEQ ID NO: 119 or 131.

145. 145. The nucleic acid of any one of claims 139 to 144, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

146. the second extracellular antigen-binding domain comprises a heavy chain comprising a second variable heavy (VH) chain sequence comprising the three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, of the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a light chain comprising a second variable light (VL) chain sequence comprising the three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, of the VL sequence set forth in SEQ ID NO: 100; and optionally a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 101, CDR-H2 comprises the sequence set forth in SEQ ID NO: 102, CDR-H3 comprises the sequence set forth in SEQ ID NO: 103, CDR-L1 comprises the sequence set forth in SEQ ID NO: 104, CDR-L2 comprises the sequence set forth in SEQ ID NO: 105, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 106, or b. CDR-H1 comprises the sequence set forth in SEQ ID NO: 111, CDR-H2 comprises the sequence set forth in SEQ ID NO: 112, and CDR-H3 comprises the sequence set forth in SEQ ID NO: 113; A nucleic acid according to any one of claims 139 to 145.

147. The nucleic acid of any one of claims 139 to 146, wherein the second VH comprises the sequence set forth in SEQ ID NO: 99 or 110.

148. The nucleic acid of any one of claims 139 to 147, wherein the second VL comprises the sequence set forth in SEQ ID NO:

100.

149. 149. The nucleic acid of any one of claims 139 to 148, wherein the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

150. 143. The nucleic acid of any one of claims 139 to 142, wherein the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

151. 144. The nucleic acid of any one of claims 139 to 143, wherein the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

152. 152. The nucleic acid of claim 151, wherein the at least one nucleic acid sequence is an shRNA.

153. 153. The nucleic acid of any one of claims 139-152, wherein at least one or more of the nucleic acids comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-82.

154. 154. The nucleic acid of any one of claims 139 to 153, wherein at least one of the nucleic acids comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 82.

155. 155. The nucleic acid of any one of claims 139 to 154, wherein at least one of the nucleic acids comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 20.

156. 156. The nucleic acid of any one of claims 139-155, wherein at least one or more of the nucleic acids reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

157. 155. The nucleic acid of any one of claims 139 to 154, wherein at least one of the nucleic acids comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 34 to 82.

158. 158. The nucleic acid of any one of claims 139-154 or 157, wherein at least one or more of the nucleic acids reduces expression of TGFBR2 in an immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the nucleic acid.

159. 159. The nucleic acid of any one of claims 139 to 158, further comprising at least one nucleic acid sequence complementary to a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

160. 160. The nucleic acid of claim 159, wherein said nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

161. 161. The nucleic acid of claim 159 or 160, wherein the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33.

162. The nucleic acid of claim 159 or 161, which reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

163. 163. The nucleic acid of any one of claims 139 to 162, wherein the at least one or more nucleic acid sequences are encoded in at least one intron region of the nucleic acid.

164. 164. The nucleic acid of any one of claims 139 to 163, comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

165. 165. The nucleic acid of any one of claims 139 to 164, comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143 to 147.

166. 164. The nucleic acid of any one of claims 139 to 163, comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 182 to 198.

167. one or more nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds PSMA; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9; a synthetic pathway activator (SPA); and at least one nucleic acid sequence at least 15 nucleotides in length; The one or more nucleic acids, wherein the at least one nucleic acid sequence comprises one or more of: (1) a first nucleic acid sequence complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3; and (2) a second nucleic acid sequence complementary to a nucleic acid encoding a human transforming growth factor (TGF)-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

168. 167. One or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleic acid according to any one of claims 139 to 166.

169. 168. The nucleic acid of any one of claims 136 to 167, comprising two or more nucleic acid fragments.

170. The nucleic acid of any one of claims 136 to 169, further comprising an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

171. 171. The nucleic acid of any one of claims 136 to 170, further comprising a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

172. 172. The nucleic acid of any one of claims 136 to 171, further comprising an inducible promoter operably linked to a nucleotide sequence encoding said chimeric antigen receptor and a constitutive promoter operably linked to a nucleotide sequence encoding said priming receptor.

173. The nucleic acid of any one of claims 136 to 172, wherein the constitutive promoter is EF1α.

174. The nucleic acid of claim 173, wherein the EF1α promoter comprises the sequence set forth in SEQ ID NO:

179.

175. 175. The nucleic acid of any one of claims 136 to 174, wherein the inducible promoter comprises one or more hepatocyte nuclear factor 1 alpha (HNF1α) enhancer elements.

176. 176. The nucleic acid of any one of claims 136 to 175, wherein the inducible promoter further comprises a YB-TATA promoter sequence.

177. 177. The nucleic acid of any one of claims 136 to 176, wherein the inducible promoter comprises the sequence set forth in SEQ ID NO:

256.

178. In the 5' to 3' direction, a. the constitutive promoter; b. the nucleotide sequence encoding a priming receptor; c. the inducible promoter; d. the nucleotide sequence encoding a chimeric antigen receptor; e. optionally, a nucleotide sequence encoding said SPA; The nucleic acid according to any one of claims 140 to 177, comprising:

179. In the 5' to 3' direction, a. the inducible promoter; b. the nucleotide sequence encoding a chimeric antigen receptor; c. the constitutive promoter; d. the nucleotide sequence encoding a priming receptor; e. optionally, a nucleotide sequence encoding said SPA; The nucleic acid according to any one of claims 140 to 177, comprising:

180. In the 5' to 3' direction, a. a first constitutive promoter; b. a nucleotide sequence encoding the priming receptor; c. a second constitutive promoter; d. a nucleotide sequence encoding at least one nucleic acid complementary to human FAS or human TGFBR2; e. the inducible promoter; f. optionally, a nucleotide sequence encoding the chimeric antigen receptor; g. a nucleotide sequence encoding said SPA; The nucleic acid according to any one of claims 141 to 177, comprising:

181. In the 5' to 3' direction, a. a first constitutive promoter; b. a nucleotide sequence encoding the priming receptor; c. a second constitutive promoter; d. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; e. a nucleotide sequence encoding the first nucleic acid complementary to human FAS or a nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; f. the inducible promoter; g. a nucleotide sequence encoding the chimeric antigen receptor; h. optionally, a nucleotide sequence encoding said SPA; The nucleic acid according to any one of claims 141 to 177, comprising:

182. In the 5' to 3' direction, a. the inducible promoter; b. a nucleotide sequence encoding the chimeric antigen receptor; c. a second constitutive promoter; d. a nucleotide sequence encoding a first nucleic acid complementary to human FAS or a nucleotide sequence encoding a second nucleic acid complementary to human TGFBR2; e. a nucleotide sequence encoding the first nucleic acid complementary to human FAS or a nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; f. a first constitutive promoter; g. a nucleotide sequence encoding the priming receptor; h. optionally, a nucleotide sequence encoding said SPA; The nucleic acid according to any one of claims 141 to 177, comprising:

183. 183. The nucleic acid of any one of claims 132 to 182, further comprising 5' and 3' homology directed repair arms complementary to the insertion site in the host cell chromosome.

184. 184. The nucleic acid of any one of claims 132 to 183, further comprising a nucleotide sequence encoding a self-cleaving 2A peptide (P2A).

185. 185. The nucleic acid of any one of claims 132 to 184, wherein the P2A is present at the 3' end of the nucleotide sequence encoding a chimeric antigen receptor.

186. 185. The nucleic acid of any one of claims 132 to 184, wherein the P2A is present at the 3' end of the nucleotide sequence encoding a priming receptor.

187. 187. The nucleic acid of any one of claims 132 to 186, further comprising a woodchuck hepatitis virus post-translational regulatory element (WPRE).

188. The nucleic acid of Claim 187, wherein the WPRE is present at the 3' end of the nucleotide sequence encoding a chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding a priming receptor, or the WPRE is present at the 3' end of the nucleotide sequence encoding a priming receptor and at the 5' end of the nucleotide sequence encoding a chimeric antigen receptor.

189. 188. The nucleic acid of any one of claims 132 to 187, further comprising an SV40 or human growth hormone (GH1) polyA element.

190. The nucleic acid of any one of claims 136 to 189, which is incorporated into an expression cassette or an expression vector.

191. 191. The nucleic acid of claim 190, wherein the expression vector is a non-viral vector.

192. A vector comprising the nucleic acid of any one of claims 132 to 191.

193. 193. The vector of claim 192, wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

194. 194. The vector of claim 193, wherein the insertion site is located in the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

195. a. the system of any one of claims 39 to 131; b. at least one nucleic acid according to any one of claims 132 to 191, and / or c. The vector according to any one of claims 192 to 194. including, cells.

196. The cell of claim 195, which is an immune cell.

197. a. the system of any one of claims 39 to 131; b. at least one nucleic acid according to any one of claims 132 to 191, and / or c. The vector according to any one of claims 192 to 194. including immune cells.

198. 198. The cell of claim 196 or 197, wherein the immune cell is a primary human immune cell.

199. The cell of any one of claims 196 to 198, wherein the immune cell is an allogeneic immune cell.

200. The cell of any one of claims 196 to 198, wherein the immune cell is an autoimmune cell.

201. 201. The cell of any one of claims 196-200, wherein the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

202. The cell of any one of claims 196 to 201, wherein the primary immune cell is a primary T cell.

203. The cell of any one of claims 196 to 202, wherein the primary immune cell is a primary human T cell.

204. The cell of any one of claims 196 to 203, wherein the primary immune cell is virus-free.

205. A primary immune cell comprising at least one nucleic acid, 1. A primary immune cell, wherein the at least one nucleic acid comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9, and optionally a synthetic pathway activator inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the nucleic acid into the primary immune cell.

206. Virus-free viable primary cells containing ribonucleoprotein complexes (RNPs) and nucleic acids, the RNP comprises a nuclease domain and a guide RNA; the nucleic acid comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA, a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9, and optionally a synthetic pathway activator; and the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

207. 207. The primary cell of claim 205 or 206, further comprising at least one nucleic acid sequence at least 15 nucleotides in length, said at least one nucleic acid sequence comprising one or more of: a first nucleic acid sequence complementary to a nucleic acid encoding a human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3; and a second nucleic acid sequence complementary to a nucleic acid encoding a human transforming growth factor (TGF)-beta receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

208. 208. The primary cell of any one of claims 205-207, wherein the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147.

209. A population of cells comprising a plurality of cells or immune cells according to any one of claims 195 to 208.

210. 209. A pharmaceutical composition comprising a cell or immune cell according to any one of claims 195 to 208 or a population of cells according to claim 209, and a pharmaceutically acceptable excipient.

211. A pharmaceutical composition comprising the nucleic acid of any one of claims 136 to 191 or the vector of any one of claims 192 to 194 and a pharmaceutically acceptable excipient.

212. 1. A method for editing a cell, comprising: a. Inserting the nucleic acid of any one of claims 132 to 191 into an insertion site in the genome of said cell. The method comprising:

213. 213. The method of claim 212, wherein the nucleic acid is introduced into the cell non-virally.

214. 1. A method for editing a cell, comprising: a. providing a nuclease domain and a guide RNA, wherein the nucleic acid comprises the nucleic acid of any one of claims 132 to 191, and the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the cell; b. introducing the nuclease domain and nucleic acid into the cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell and the nuclease domain cleaves the target region to create the insertion site within the genome of the cell; c. editing the cell via insertion of the nucleic acid into the insertion site within the genome of the cell; The method comprising:

215. 215. The method of claim 214, wherein the nuclease domain and nucleic acid are introduced into the cell non-virally.

216. 1. A method for editing immune cells, comprising: a. Providing a ribonucleoprotein complex (RNP) and a nucleic acid, wherein the RNP comprises a nuclease domain and a guide RNA, and the nucleic acid comprises the nucleic acid of any one of claims 132-191, wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; b. Non-virally introducing the RNP complex and nucleic acid into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of a primary immune cell, and the nuclease domain cleaves the target region to create the insertion site within the genome of the immune cell; c. editing the immune cell via insertion of the nucleic acid of any one of claims 132-191 into the insertion site in the genome of the immune cell; The method comprising:

217. 217. The method of any one of claims 213, 215, or 216, wherein non-virally introducing comprises electroporation.

218. 218. The method of any one of Claims 214-217, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

219. 219. The method of any one of claims 214-218, wherein the target region of the genome of the cell is the T-cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

220. 220. The method of any one of claims 212 to 219, wherein the nucleic acid is a double-stranded nucleic acid or a single-stranded nucleic acid.

221. 221. The method of any one of claims 212 to 220, wherein the nucleic acid is a linear nucleic acid or a circular nucleic acid, optionally wherein the circular nucleic acid is a plasmid.

222. 222. The method of any one of claims 212 to 221, wherein the cells are immune cells, optionally primary human immune cells.

223. The method of any one of claims 216 to 222, wherein the immune cells are autoimmune cells.

224. 223. The method of any one of claims 216 to 222, wherein the immune cells are allogeneic immune cells.

225. 225. The method of any one of claims 216 to 224, wherein the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

226. 226. The method of any one of claims 216 to 225, wherein the immune cells are primary T cells.

227. 227. The method of any one of claims 216 to 226, wherein the immune cells are primary human T cells.

228. 228. The method of any one of claims 212 to 227, wherein the cells are virus-free.

229. 229. The method of any one of claims 212 to 228, further comprising obtaining said cells from a patient and introducing said nucleic acid in vitro.

230. 1. A method of treating a disease in a subject, comprising: administering to said subject a cell or immune cell or population of cells or immune cells according to any one of claims 195 to 209, or a pharmaceutical composition according to claim 210 or 211. The method comprising:

231. 231. The method of claim 230, wherein the disease is cancer.

232. 232. The method of claim 231, wherein the cancer is a solid cancer or a liquid cancer.

233. 233. The method of claim 231 or 232, wherein the cancer is kidney cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

234. 234. The method of any one of claims 231 to 233, wherein administration of the immune cells enhances an immune response in the subject.

235. 235. The method of claim 234, wherein the enhanced immune response is an adaptive immune response.

236. 235. The method of claim 234, wherein the enhanced immune response is an innate immune response.

237. 237. The method of any one of claims 231 to 236, wherein the enhanced immune response is increased expression of at least one cytokine or chemokine.

238. 238. The method of claim 237, wherein the cytokine is interferon-gamma (IFNγ).

239. 234. The method of any one of claims 230-233, further comprising administering to the subject an immunotherapy either simultaneously with or subsequent to the immune cells.

240. 1. A method of inhibiting target cells in a subject, comprising: administering to said subject an immune cell or population of immune cells according to any one of claims 197 to 209. wherein the immune cells inhibit the target cells.

241. 241. The method of claim 240, wherein the target cells express PSMA and CA9.

242. 242. The method of claim 240 or 241, wherein the target cell is a cancer cell.

243. 1. A method for inducing expression of a chimeric antigen receptor in a cell with a priming receptor, comprising: a. below: b. The system of any one of claims 39 to 131; c. A nucleic acid according to any one of claims 132 to 191, and / or d. The vector according to any one of claims 192 to 194. Obtaining cells or immune cells comprising the e. contacting the cell or immune cell with a target cell that expresses PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor; The method comprising:

244. 1. A method for modulating the activity of a cell or immune cell, comprising: a. below: b. The system of any one of claims 39 to 131; c. A nucleic acid according to any one of claims 132 to 191, and / or d. The vector according to any one of claims 192 to 194. Obtaining cells or immune cells comprising the e. contacting the cell or immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, and binding of the chimeric antigen receptor to CA9 on the target cell modulates activity of the immune cell; The method comprising:

245. 245. The method of claim 244, wherein modulating immune cell activity comprises enhancing an immune response.

246. 246. The method of claim 245, wherein the enhanced immune response is an adaptive immune response.

247. 246. The method of claim 245, wherein the enhanced immune response is an innate immune response.

248. The method of any one of claims 244 to 247, wherein the immune cell activity is increased expression of at least one cytokine or chemokine.

249. 249. The method of claim 248, wherein the cytokine is interferon-gamma (IFNγ).

250. 1. A method of treating a disease in a subject, comprising: a. determining or having determined the presence of PSMA-positive (PSMA+) cells from a cancer sample obtained from the subject; b. determining or having determined the presence of CA9-positive (CA+) cells from a cancer sample obtained from said subject; c. administering to said subject a cell or immune cell according to any one of claims 197-209 or a pharmaceutical composition according to claim 210 or 211; The method comprising:

251. 251. The method of claim 250, wherein the disease is cancer.

252. 252. The method of claim 251, wherein the cancer is a solid cancer or a liquid cancer.

253. 253. The method of claim 251 or 252, wherein the cancer is renal cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

254. 254. The method of any one of claims 250 to 253, wherein administration of the cells or immune cells enhances an immune response in the subject.

255. 255. The method of claim 254, wherein the enhanced immune response is an adaptive immune response.

256. 255. The method of claim 254, wherein the enhanced immune response is an innate immune response.

257. 257. The method of any one of claims 250 to 256, wherein the enhanced immune response is increased expression of at least one cytokine or chemokine.

258. 258. The method of claim 257, wherein the cytokine is interferon gamma (IFNγ).

259. 259. The method of any one of claims 250-258, further comprising administering to the subject immunotherapy either simultaneously with or subsequent to the immune cells.

Images