CLL-1 antibodies and uses thereof
By developing single-chain scFv antibodies that specifically bind to human CLL-1 and their compositions, the problem of lacking highly specific CLL-1-targeting antibodies in existing technologies has been solved, achieving highly effective treatment for diseases such as AML.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-03-13
AI Technical Summary
The lack of highly specific and high-affinity antibodies targeting CLL-1 in current technologies has led to slow progress in immunotherapy for AML, and existing drugs targeting CLL-1 have not performed well in clinical studies. There is an urgent need to develop more effective CLL-1-specific antibodies to improve the treatment outcomes of AML.
An antibody or antigen-binding fragment thereof that specifically binds to human CLL-1 has been developed, comprising a heavy chain variable region (VH) and a light chain variable region (VL), which are linked by a flexible linker peptide to form a single-chain scFv antibody. This antibody can be combined with other antigen-binding modules for the preparation of multispecific antigen-binding molecules and chimeric antigen receptors, and can be applied to the preparation of immune effector cells and nucleic acid fragments for the treatment of related diseases.
It provides antibodies or antigen-binding fragments with high affinity for CLL-1, which can effectively kill AML cells and are used for the detection and treatment of myeloid leukemia and related diseases, filling a market gap and improving the treatment effect of AML.
Smart Images

Figure BDA0005669930680000021 
Figure BDA0005669930680000022 
Figure BDA0005669930680000031
Abstract
Description
[0001] Citation of relevant applications
[0002] This invention claims priority to Chinese patent application No. 202411576977.8, filed on November 6, 2024, entitled "CLL-1 Antibody and Its Application", the entire contents of which are incorporated herein by reference. Technical Field
[0003] This application relates to the field of biomedicine, and more specifically, to an anti-CLL-1 antibody or its antigen-binding fragment and its applications. Background Technology
[0004] CLL-1 belongs to family V of the C-type lectin-like receptor family and is also known as CLEC12A, MICL, DCAL-2, or CD371. The human gene encoding CLL1 maps to 12p13 and is located within the NK gene complex containing NKG2R, low-density lipoprotein receptor-1 (LOX-1), and β-glucan receptor (BGR). CLL-1 is highly homologous to LOX-1 and BGR. The CLL-1 gene is approximately 31 kDa in size and encodes a polypeptide containing 265 amino acids. CLL-1 is a type II transmembrane glycoprotein consisting of a single extracellular carbohydrate recognition domain with six N-glycosylation sites, a transmembrane region, and an intracellular NH2 terminus with I / VXYXXL and YXXM sequences. I / VXYXXL functions as ITIM and negatively impacts cell activation by recruiting the inhibitory Src homology region 2 domain phosphatases (SHP)-1 and SHP-2.
[0005] Acute myeloid leukemia (AML) is the most common and deadliest hematologic malignancy in adult patients, with a poor prognosis for most. Although immunotherapy plays an important role in the field of hematologic malignancies and solid tumors, progress in immunotherapy for AML has been very slow due to the lack of highly specific target antigens and the heterogeneity of AML. Current treatments for AML still mainly rely on chemotherapy and hematopoietic stem cell transplantation, and there is an urgent need to develop new methods to improve the prognosis of AML.
[0006] CLL-1 is primarily expressed in myeloid cells, such as granulocytes and monocytes, and is almost not expressed in T, B, NK cells, erythrocytes, or their precursors. CLL-1 is highly expressed in most AML leukemia cells, and is present in the CD34+ of AML cells. + CD38 - High expression in stem cells, while in normal individuals CD34 + CD38 -CLL-1 is not expressed on stem cells. CD33 and CD34 are classic biomarkers for AML. In AML patients, CLL-1 expression is significantly higher than CD34 and comparable to CD33. CLL-1 expression in hematopoietic stem cell leukemia cells (LSCs) is significantly higher than in normal hematopoietic stem cells (HSCs). Larsen et al. found that, compared with other stem cell antigens, CLL-1 expression is limited to myeloid cells, suggesting that CLL-1 can serve as a biomarker for AML diagnosis. Furthermore, CLL-1 expression is relatively stable throughout the disease course, with no difference in expression between diagnostic and relapsed samples from the same patient. Therefore, CLL-1 can serve as one of the important molecular markers for detecting minimal residual disease (MRD) at the stem cell level in AML. CLL-1 expression may also be associated with other myeloid leukemias, such as acute myeloid monocytic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, chronic myeloid leukemia (CML), and myelodysplastic syndromes (MDS).
[0007] Despite increasing understanding of the molecular genetics of related diseases, relatively few novel therapies have been approved for AML. Therefore, there remains a need for novel therapeutic agents for AML, such as those targeting CLL-1. Zhao et al. developed a monoclonal antibody targeting CLL-1 that exhibits strong killing activity against AML cell lines through complement-dependent cytotoxicity (CDC) and antibody-dependent cytotoxicity (ADCC) mechanisms. The unique expression pattern of CLL-1 makes it a potential target for AML immunotherapy. However, there is currently a lack of highly specific and high-affinity antibodies targeting CLL-1 on the market. Four CLL1×CD3 bispecific antibodies are currently in development, with QLF32101 (Qilu Pharmaceutical) progressing most advanced in Phase I clinical trials. Another product, Tepoditamab, failed to meet expectations in Phase I clinical trials and has had its development terminated. The other two have not yet entered clinical trials. Therefore, there remains an urgent need to develop next-generation, more effective CLL-1-specific antibodies and antibody-based biotherapeutic products. Summary of the Invention
[0008] This application provides an antibody that specifically binds to human CLL-1 or its antigen-binding fragment, a multispecific antigen-binding molecule, a chimeric antigen receptor, an immune effector cell, a nucleic acid fragment, a vector, a host cell, a pharmaceutical composition, a kit, a preparation method, and their applications in treating diseases and detecting CLL-1.
[0009] In some embodiments, this application provides an antibody or antigen-binding fragment thereof that specifically binds to human CLL-1, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein:
[0010] 1) The heavy chain variable region (VH) comprises HCDR1, HCDR2, and HCDR3; HCDR1 comprises any sequence of SEQ ID NO.1–4, SEQ ID NO.44–47, or SEQ ID NO.70–73, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; HCDR2 comprises any sequence of SEQ ID NO.5–8, SEQ ID NO.48–51, or SEQ ID NO.74–77, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; and HCDR3 comprises any sequence of SEQ ID NO.9–12, or SEQ ID NO.52–55, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; and
[0011] 2) The light chain variable region (VL) comprises LCDR1, LCDR2, and LCDR3; LCDR1 comprises any sequence of SEQ ID NO.13-23, SEQ ID NO.56-64, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; LCDR2 comprises any sequence of SEQ ID NO.24-31, SEQ ID NO.65-69, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; and HCDR3 comprises any sequence of SEQ ID NO.32-43, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; each of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 is encoded according to a common analytical method of KABAT, Chothia, or IMGT.
[0012] In some embodiments, this application provides an antibody or antigen-binding fragment thereof that specifically binds to human CLL-1, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region (VL) and a light chain variable region (VH), and wherein:
[0013] (1) The heavy chain variable region comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 has any of the HCDR1 sequences shown in Table 1 below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; HCDR2 has any of the HCDR2 sequences shown below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; and HCDR3 has any of the HCDR3 sequences shown below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below:
[0014] Table 1. Amino acid sequence of the CDR region of the heavy chain of mouse anti-human CLL-1 antibody
[0015]
[0016] and,
[0017] (2) The light chain variable region comprises LCDR1, LCDR2, and LCDR3, wherein LCDR1 has any of the LCDR1 sequences shown in Table 2 below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; LCDR2 has any of the LCDR2 sequences shown below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; and LCDR3 has any of the LCDR3 sequences shown below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below:
[0018] Table 2. Amino acid sequence of the CDR region of the light chain of mouse anti-human CLL-1 antibody
[0019]
[0020]
[0021] Specifically, for example, the specific human CLL-1 binding antibody or antigen-binding fragment of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), encoded according to the KABAT analytical method, wherein,
[0022] The heavy chain variable region (VH) contains HCDR1, HCDR2, and HCDR3 selected from any of the following sequences (1)-(4) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences:
[0023] (1) The HCDR1, HCDR2 and HCDR3 are as shown in SEQ ID NO.1, 5 and 9 respectively;
[0024] (2) The HCDR1, HCDR2 and HCDR3 are as shown in SEQ ID NO.2, 6 and 10 respectively;
[0025] (3) The HCDR1, HCDR2, and HCDR3 are respectively the sequences shown in SEQ ID NO.3, 7, and 11; or
[0026] (4) The HCDR1, HCDR2 and HCDR3 are as shown in SEQ ID NO.4, 8 and 12 respectively;
[0027] Furthermore, according to the KABAT analysis method, the LCDR1, LCDR2, and LCDR3 contained in the light chain variable region (VL) are selected from any of the following sequences (5)-(17) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences:
[0028] (5) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.13, 24 and 32;
[0029] (6) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.14, 25 and 33;
[0030] (7) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.15, 26 and 34;
[0031] (8) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.16, 27 and 35;
[0032] (9) The LCDR1, LCDR2 and LCDR3 are respectively in the sequences shown in SEQ ID NO.13, 28 and 36;
[0033] (10) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.17, 24 and 32;
[0034] (11) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.18, 29 and 37;
[0035] (12) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.19, 25 and 38;
[0036] (13) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.18, 29 and 39;
[0037] (14) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.20, 24 and 40;
[0038] (15) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.21, 30 and 41;
[0039] (16) The LCDR1, LCDR2, and LCDR3 are respectively in the sequences shown in SEQ ID NO.22, 25, and 42; or
[0040] (17) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.23, 31 and 43.
[0041] Specifically, for example, the specific human CLL-1 binding antibody or antigen-binding fragment of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein, according to the analytical method of IMGT,
[0042] The heavy chain variable region (VH) contains HCDR1, HCDR2, and HCDR3 selected from any of the following sequences (18)-(21) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences:
[0043] (18) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.44, 48 and 52;
[0044] (19) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences of SEQ ID NO.45, 49 and 53;
[0045] (20) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.46, 50 and 54;
[0046] (21) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.47, 51 and 55;
[0047] Furthermore, according to the IMGT analysis method, the LCDR1, LCDR2, and LCDR3 contained in the light chain variable region (VL) are selected from any of the following sequences (22)-(33) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences:
[0048] (22) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.56, 65 and 32;
[0049] (23) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.57, 65 and 33;
[0050] (24) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.58, 66 and 34;
[0051] (25) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.59, 66 and 35;
[0052] (26) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.56, 67 and 36;
[0053] (27) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.58, 66 and 37;
[0054] (28) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.60, 65 and 38;
[0055] (29) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.58, 66 and 39;
[0056] (30) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.61, 65 and 40;
[0057] (31) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences of SEQ ID NO.62, 68 and 41;
[0058] (32) The LCDR1, LCDR2, and LCDR3 are respectively in the sequences shown in SEQ ID NO. 63, 65, and 42; or
[0059] (33) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.64, 69 and 43.
[0060] Specifically, for example, the CLL-1 antibody or antigen-binding fragment of the present invention, said antibody or antigen-binding fragment comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein, according to Chothia's analytical method,
[0061] The heavy chain variable region (VH) contains HCDR1, HCDR2, and HCDR3 selected from any of the following sequences (34)-(37) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences:
[0062] (34) The HCDR1, HCDR2 and HCDR3 are respectively as shown in SEQ ID NO.70, 74 and 9;
[0063] (35) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences of SEQ ID NO.71, 75 and 10;
[0064] (36) The HCDR1, HCDR2, and HCDR3 are respectively in the sequences shown in SEQ ID NO. 72, 76, and 11; or
[0065] (37) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences of SEQ ID NO.73, 77 and 12;
[0066] Furthermore, according to Chothia's analytical method, the LCDR1, LCDR2 and LCDR3 contained in the light chain variable region (VL) are selected from any of the sequences in (5)-(17) above or sequences with 1, 2, 3 or more amino acid insertions, deletions and / or substitutions compared to the sequences.
[0067] In some embodiments, this application provides an antibody or antigen-binding fragment thereof that specifically binds to human CLL-1, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein:
[0068] 1) The heavy chain variable region (VH) is selected from any of the sequences in SEQ ID NO.78 to SEQ ID NO.84 or the heavy chain variable region having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with it, as shown in Table 3;
[0069] Table 3. Amino acid sequence of the variable region of the heavy chain of mouse anti-human CLL-1 antibody
[0070]
[0071] 2) The light chain variable region (VL) is selected from any of the sequences in SEQ ID NO.85 to SEQ ID NO.97 or the light chain variable region having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with the amino acid sequence, as shown in Table 4.
[0072] Table 4. Amino acid sequence of the light chain variable region of mouse anti-human CLL-1 antibody
[0073]
[0074]
[0075] In a preferred aspect, the antibody of the present invention is a single-chain scFv antibody.
[0076] In this invention, "single-chain scFv antibody" or "scFv" or "single-chain scFv" refers to a single polypeptide chain containing a heavy chain variable region (VH) and a light chain variable region (VL) of an immunoglobulin or antibody, in which the VH and VL regions pair to provide antigen binding sites.
[0077] In a preferred embodiment, the VH and VL regions of the single-chain scFv antibody of the present invention are covalently linked together by a linker peptide, such as a flexible linker peptide. The term "flexible linker peptide" is a peptide linker composed of amino acids. Such a peptide linker allows the connection of various variable domains in the antibody, such as the VH and VL regions. Peptide linkers are typically rich in glycine, which exhibits flexibility, and serine or threonine, which exhibits solubility. Glycine and / or serine residues may be used alone or in combination, for example. Non-limiting examples of flexible linkers or peptide linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008), WO2012 / 138475 and WO2014 / 087010, the contents of which are incorporated herein by reference in their entirety. As is known in the art, in the construction of scFv, preferably, the linker will facilitate the pairing of VH and VL without interfering with the formation of functional antigen-binding sites by VH and VL.
[0078] In some embodiments, the scFv single-chain antibody of the present invention comprises a flexible linker peptide or peptide linker composed of amino acid residues linked by peptide bonds. In some embodiments, the amino acids are selected from twenty natural amino acids. In some other embodiments, one or more amino acids are selected from glycine, serine, threonine, alanine, proline, asparagine, glutamine, and lysine. In a preferred embodiment, one or more amino acids are selected from Gly, Ser, Thr, Lys, Pro, and Glu.
[0079] In some embodiments, the linker length is about 1-30 amino acids, or about 10 to about 25 amino acids, about 15 to about 20 amino acids, or any amino acid length in between. In a preferred embodiment, the linker has a length of 15-25 amino acid residues, and in a more preferred embodiment, it has a length of 15-18 amino acid residues. In some embodiments, the linker length is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids.
[0080] Examples of peptide linkers that can be used in this invention include: glycine polymers (G). n Glycine-serine polymer (G 1-5 S 1-5 ) n , where n is an integer of at least 1, 2, 3, 4, or 5; glycine-alanine polymers; alanine-serine polymers; and other flexible connectors known in the art. Those skilled in the art will understand that in some embodiments, the connector between VH and VL may consist entirely of a flexible linker peptide, or the connector may consist of a flexible linker peptide portion and one or more portions imparting a smaller flexible structure.
[0081] In a preferred embodiment, the peptide linker is GGGGSGGGGSGGGGS (SEQ ID NO: 132).
[0082] In one embodiment, the nucleotide sequence encoding the amino acid sequence SEQ ID NO: 132 is in SEQ ID NO: 133.
[0083] (GGAGGAGGAGGCAGCGGAGGAGGAGGCAGCGGAGGAGGAGGCAGC).
[0084] In the single-chain scFv antibody of the present invention, VH and VL can be in either orientation. In some embodiments, the scFv comprises, from the N-terminus to the C-terminus: VH-connector-VL; or VL-connector-VH. In a preferred embodiment, the single-chain scFv antibody of the present invention comprises, from the N-terminus to the C-terminus: VH-connector-VL. In a preferred embodiment, VH is covalently linked to the N-terminus of VL via a connector at its C-terminus.
[0085] In some implementations, in addition to the linker, other polypeptide fragments with specific functions may be inserted between the VL and VH domains, such as polypeptide fragments that regulate immune responses or polypeptide fragments that induce cell solubilization or cell killing.
[0086] In some implementations, single-chain antibodies can be stabilized by introducing disulfide bonds into the scFv. For example, the VH and VL framework regions of the scFv can be linked by introducing intra-chain or inter-chain disulfide bonds.
[0087] The single-chain scFv polypeptide antibody of the present invention can be expressed by nucleic acids including VH and VL coding sequences, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85: 5879–5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publications Nos. 20050196754 and 20050196754.
[0088] In some embodiments, the single-chain scFv antibody of the present invention is expressed in eukaryotic cells, such as yeast cells, mammalian cells, etc.
[0089] HEK293 cells or CHO cells.
[0090] In some embodiments, the anti-CLL-1scFv antibody comprises: a heavy chain variable region containing any amino acid sequence of SEQ ID NO: 78-84 or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or higher identity therewith; a light chain variable region containing any amino acid sequence of SEQ ID NO: 85-97 or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or higher identity therewith; and optionally a linker, such as a linker peptide, between the heavy chain variable region and the light chain variable region. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 132.
[0091] In some embodiments, the antibody of the present invention is CLL-1scFv or an antigen-binding fragment thereof, which comprises an antigen-binding region of any of the amino acid sequences SEQ ID NO: 98 to 114 or a variant thereof.
[0092] In some embodiments, the antibody CLL-1scFv of the present invention has at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with any of the sequences in SEQ ID NO: 98 to 114.
[0093] In one embodiment, anti-CLL-1scFv is encoded by nucleotides of SEQ ID NO: 115-131.
[0094] In a preferred embodiment, the antibody or antigen-binding fragment of the present invention comprises a sequence of a constant region of any one of antibodies IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, or IgD; preferably, it comprises a sequence of a constant region of human or mouse antibody IgG1, IgG2, IgG3, or IgG4.
[0095] In a preferred embodiment, the antibody or antigen-binding fragment of the present invention further comprises a heavy chain constant region sequence in which the CH1 fragment is absent.
[0096] In a preferred embodiment, the antibody or antigen-binding fragment of the present invention further comprises a heavy chain constant region sequence having CH2 and CH3 fragments, or the antibody or antigen-binding fragment further comprises an antibody Fc region; the antibody constant region or antibody Fc region is linked to the antibody or antigen-binding fragment by or without a linker peptide.
[0097] Optionally, the antibody constant region or antibody Fc region is derived from camels, mice, rats, rabbits, sheep, or humans;
[0098] Optionally, the antibody constant region or antibody Fc region is derived from IgG, IgA, IgM, IgD, or IgE.
[0099] In a preferred embodiment, the antibody or antigen-binding fragment of the present invention is chimeric, humanized, or fully human; preferably, the antibody or antigen-binding fragment is selected from monoclonal antibodies, polyclonal antibodies, natural antibodies, engineered antibodies, monospecific antibodies, multispecific antibodies (e.g., bispecific antibodies), monovalent antibodies, multivalent antibodies, full-length antibodies, antibody fragments, naked antibodies, conjugated antibodies, humanized antibodies, fully human antibodies, Fab, Fab', F(ab')2, Fd, Fv, scFv, and diabody.
[0100] In a preferred embodiment, the antibody or its antigen-binding fragment of the present invention is further coupled with a therapeutic agent or a tracer; preferably, the therapeutic agent is selected from radioactive isotopes, chemotherapeutic agents or immunomodulators, and the tracer is selected from radiographic contrast agents, paramagnetic ions, metals, fluorescent labels, chemiluminescent labels, ultrasound contrast agents or photosensitizers.
[0101] In a preferred embodiment, the present invention also provides a multispecific antigen-binding molecule; preferably, the multispecific antigen-binding molecule includes a first antigen-binding module and a second antigen-binding module, the first antigen-binding module including an antibody or antigen-binding fragment as described in any of the above, and the second antigen-binding module specifically binding to antigens other than human CLL-1 or binding to CLL-1 antigen epitopes different from those of the first antigen-binding module.
[0102] Preferably, the other antigens are selected from CD3, PD-1, PD-L1, Her2, EpCAM, CD16, CD20, CD30, CD33, CD47, CD52, CD64, CD133, CEA, gpA33, Mucins, TAG-72, CIX, PSMA, folate-binding protein, GD2, GD3, GM2, VEGF, VEGFR, Integrin, αVβ3, α5β1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, or FAP;
[0103] Preferably, the multispecific antibody is "bispecific", "trispecific", or "quadrispecific".
[0104] In a preferred embodiment, the present invention provides a chimeric antigen receptor (CAR); preferably, the chimeric antigen receptor includes at least an extracellular antigen-binding domain, a transmembrane domain and an intracellular signal transduction domain, wherein the extracellular antigen-binding domain includes any of the CLL-1 antibody or antigen-binding fragments described above.
[0105] In a preferred embodiment, the present invention provides an immune effector cell; preferably, the immune effector cell comprises the chimeric antigen receptor described above or a nucleic acid fragment comprising the chimeric antigen receptor described above;
[0106] Preferably, the immune effector cells are selected from T cells, NK cells (natural killer cells), NKT cells (natural killer cells), monocytes, macrophages, dendritic cells, or mast cells; the T cells can be selected from inflammatory T cells, cytotoxic T cells, regulatory T cells (Tregs), or helper T cells.
[0107] Preferably, the immune effector cells are allogeneic immune effector cells or autologous immune cells.
[0108] In a preferred embodiment, the present invention provides an isolated nucleic acid molecule that encodes an antibody, antigen-binding fragment, or any combination thereof as described in any of the preceding claims of the present invention, a multispecific antigen-binding molecule, or a chimeric antigen receptor.
[0109] In some embodiments, the present invention provides an expression vector comprising the nucleic acid molecules isolated as described above.
[0110] In some embodiments, the present invention provides a host cell comprising the nucleic acid molecules or expression vectors isolated by the present invention as described above.
[0111] In a preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell; more preferably, the host cell is derived from mammalian cells, yeast cells, insect cells, Escherichia coli, and / or Bacillus subtilis; even more preferably, the host cell is selected from HEK293E or Chinese hamster ovary cells (CHO).
[0112] In some embodiments, the present invention provides a method for preparing an antibody or antigen-binding fragment or a multispecific antigen-binding molecule, wherein the host cells described above are cultured under appropriate conditions, and the antibody or antigen-binding fragment or multispecific antigen-binding molecule is isolated.
[0113] In some embodiments, the present invention provides a method for preparing immune effector cells, wherein the nucleic acid fragment of the CAR described above is introduced into the immune effector cells, and preferably, the method further includes initiating the expression of the CAR described above in the immune effector cells.
[0114] In some embodiments, the present invention provides a pharmaceutical composition comprising the antibody or antigen-binding fragment described above, the multispecific antigen-binding molecule described above, the chimeric antigen receptor described above, the immune effector cell described above, the isolated nucleic acid molecule described above, the expression vector described above, the cell described above, or a product prepared by the method described above (e.g., antibody and antigen-binding fragment), and a pharmaceutically acceptable carrier.
[0115] In a preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, diluent, or adjuvant; more preferably, the pharmaceutical composition further comprises an additional antitumor agent.
[0116] In some embodiments, the present invention provides a method for preventing and / or treating CLL-1-mediated diseases, comprising administering to a patient in need an antibody or antigen-binding fragment described above, a multispecific antigen-binding molecule described above, a chimeric antigen receptor described above, an immune effector cell described above, an isolated nucleic acid molecule described above, an expression vector described above, a cell described above, a product prepared by the method described above, or a pharmaceutical composition described above; wherein the CLL-1-mediated disease is myeloid leukemia, acute myeloid monocytic leukemia, acute monocytic leukemia, acute primary myeloid leukemia, chronic myeloid leukemia (CML), or myelodysplastic syndrome (MDS)-related disease.
[0117] In some embodiments, the present invention provides the use of the antibodies or antigen-binding fragments described above, the multispecific antigen-binding molecules described above, the chimeric antigen receptors described above, the immune effector cells described above, the isolated nucleic acid molecules described above, the expression vectors described above, the cells described above, products prepared by the methods described above (e.g., antibodies and antigen-binding fragments), or the pharmaceutical compositions described above in the preparation of medicaments for the prevention and / or treatment of CLL-1-mediated diseases, preferably myeloid leukemia, acute myeloid monocytic leukemia, acute monocytic leukemia, acute primary myeloid leukemia, chronic myeloid leukemia (CML), or myelodysplastic syndrome (MDS)-related diseases.
[0118] In some embodiments, the present invention provides the antibody or antigen-binding fragment described above, the multispecific antigen-binding molecule described above, the chimeric antigen receptor described above, the immune effector cell described above, the isolated nucleic acid molecule described above, the expression vector described above, the cell described above, the product prepared by the method described above (e.g., antibody and antigen-binding fragment), or the pharmaceutical composition described above for the prevention and / or treatment of CLL-1-mediated diseases; wherein the CLL-1-mediated diseases are preferably myeloid leukemias, such as acute myeloid monocytic leukemia, acute monocytic leukemia, acute primary myeloid leukemia, chronic myeloid leukemia (CML), or myelodysplastic syndrome (MDS)-related diseases.
[0119] In some embodiments, the present invention provides a kit comprising the antibody or antigen-binding fragment described above, the multispecific antigen-binding molecule described above, the chimeric antigen receptor described above, the immune effector cells described above, the isolated nucleic acid molecule described above, the expression vector described above, the cells described above, or a product prepared by the methods described above (e.g., antibody and antigen-binding fragment), or a pharmaceutical composition described above, and instructions for use.
[0120] This application provides antibodies or antigen-binding fragments thereof with high affinity for the CLL-1 target, thus offering a better option for CLL-1 antibody drugs and cell therapy products. This is of great significance for filling the gap in the treatment of myeloid leukemia, acute myeloid monocytic leukemia, acute monocytic leukemia, acute primary myeloid leukemia, chronic myeloid leukemia (CML), and myelodysplastic syndrome (MDS).
[0121] This invention provides an scFv antibody with high affinity for CLL-1 protein, which can specifically bind to human CLL-1 positive cells and can be used to detect CLL-1 expression in patient cells of CLL-1-related diseases. The scFv antibody of this invention can also be formulated into immune complexes or pharmaceutical compositions for the prevention or treatment of CLL-1-related diseases, or as a detection reagent or kit for CLL-1 protein, and has broad application prospects in clinical diagnosis, prevention and treatment.
[0122] Terminology Definitions and Explanations
[0123] Unless otherwise stated, the terms used herein have the meanings commonly understood by one of ordinary skill in the art. For terms explicitly defined herein, their meanings shall be as defined herein.
[0124] As used herein, the term “antibody” (Ab) refers to an immunoglobulin molecule that specifically binds to or is immunoreactive with a target antigen, including polyclonal, monoclonal, genetically engineered, and other modified forms of antibodies (including, but not limited to, chimeric antibodies, humanized antibodies, fully human antibodies, heterologous conjugates (e.g., bispecific, trispecific, and tetraspecific antibodies, biantibodies, triantibodies, and tetraantibodies), antibody conjugates, and antigen-binding fragments of antibodies (including, for example, Fab', F(ab')2, Fab, Fv, rIgG, and scFv fragments). Furthermore, unless otherwise stated, the term “monoclonal antibody” (mAb) means both complete antibody molecules capable of specifically binding to a target protein and incomplete antibody fragments (e.g., Fab and F(ab')2 fragments, which lack the Fc fragment of the complete antibody (which is cleared more quickly from animal circulation) and therefore lack Fc-mediated effector function (see Wahl et al., J. Nucl. Med. 24:316, 1983; the contents of which are incorporated herein by reference).
[0125] The “antibody” in this article can be derived from any animal, including but not limited to humans and non-human animals. The non-human animals can be selected from primates, mammals, rodents and vertebrates, such as camels, llamas, ostriches, alpacas, sheep, rabbits, mice, rats or cartilaginous fish (e.g., sharks).
[0126] The term "natural antibody" in this article refers to antibodies produced and paired by the immune system of multicellular organisms. The term "engineered antibody" in this article refers to non-natural antibodies obtained through techniques such as genetic engineering and antibody engineering. For example, "engineered antibodies" include humanized antibodies, small molecule antibodies (such as scFv), bispecific antibodies, etc.
[0127] The term "monospecific" in this article refers to having one or more binding sites, where each binding site binds to the same epitope of the same antigen.
[0128] The term "multispecific" in this article refers to having at least two antigen-binding sites, each of which binds to a different epitope of the same antigen or to a different epitope of a different antigen. Therefore, terms such as "bispecific," "trispecific," and "quadrispecific" refer to the number of different epitopes that an antibody / antigen binding molecule can bind to.
[0129] The term "valence" in this article refers to the presence of a specified number of binding sites in an antibody / antigen binding molecule. Therefore, the terms "monovalent," "divalent," "tetravalent," and "hexavalent" represent the presence of one, two, four, and six binding sites in an antibody / antigen binding molecule, respectively.
[0130] In this article, "full-length antibody," "intact antibody," and "complete antibody" can be used interchangeably, referring to antibodies that have a structure that is essentially similar to that of natural antibodies.
[0131] As used herein, the term "antigen-binding fragment" refers to one or more antibody fragments that retain the ability to specifically bind to a target antigen. The antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Antibody fragments can be Fab, F(ab')2, scFv, SMIP, biantibodies, triantibodies, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments encompassing the term "antigen-binding fragment" of an antibody include, but are not limited to: (i) a Fab fragment, a monovalent fragment consisting of VL, VH, CL, and CH1 domains; (ii) an F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by disulfide bonds in a hinge region; (iii) an Fd fragment consisting of VH and CH1 domains; (iv) an Fv fragment consisting of VL and VH domains of an antibody arm; (v) a dAb containing VH and VL domains; (vi) a dAb fragment consisting of a VH domain (Ward et al., Nature 341:544-546, 1989); (vii) a dAb consisting of either a VH or VL domain; (viii) a separate complementarity-determining region (CDR); and (ix) a combination of two or more separate CDRs, which may optionally be linked by synthetic linkers. Furthermore, although the two domains VL and VH of the Fv fragment are encoded by independent genes, these two domains can be joined using recombination methods via a linker that enables the creation of a single protein chain in which the VL and VH regions pair to form a monovalent molecule (referred to as a single-chain Fv (scFv); see, for example, Bird et al., Science 242:423-426, 1988 and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883, 1988). These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and these fragments are screened for use in the same manner as intact antibodies. Antigen-binding fragments can be generated by recombinant DNA techniques, enzymatic or chemical cleavage of intact immunoglobulins, or, in some embodiments, by chemical peptide synthesis procedures known in the art.
[0132] As used herein, the term "CLL-1" refers to C-type lectin-like molecule-1, an antigenic determinant detectable on leukemia precursor cells and normal immune cells. C-type lectin-like molecule-1 (CLL-1) is also known as MICL, CLEC12A, CLEC-1, dendritic cell-associated lectin 1, and DCAL-2. Human and mouse amino acid and nucleic acid sequences can be found in public databases such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human CLL-1 can be found with UniProt / Swiss-Prot accession number Q5QGZ9, and the nucleotide sequence encoding human CLL-1 can be found with accession numbers NM 001207010.1, NM138337.5, NM 201623.3, and NM 201625.1. In one embodiment, the antigen-binding portion of the CAR recognizes and binds to an epitope within the extracellular domain of the human CLL-1 protein or a fragment thereof. In one implementation, the human CLL-1 protein is expressed on cancer cells.
[0133] As used herein, the term "bispecific antibody" refers to an antibody that has monoclonal binding specificity against at least two different antigens, and is typically a human or humanized antibody. In this invention, one of the binding specificities may be detected against an antigenic epitope of human CLL-1, and the other may be detected against another antigenic epitope of human CLL-1 or any other antigen other than human CLL-1, such as cell surface proteins, receptors, receptor subunits, tissue-specific antigens, viral-derived proteins, virus-encoded envelope proteins, bacterial-derived proteins, or bacterial surface proteins.
[0134] As used herein, the term "chimeric" antibody refers to an antibody having a variable sequence derived from an immunoglobulin of one source organism (such as rat or mouse) and a constant region derived from an immunoglobulin of a different organism (such as human). Methods for producing chimeric antibodies are known in the art. See, for example, Morrison, 1985, Science 229(4719):1202-7; Oi et al., 1986, Bio Techniques 4:214-221; Gillies et al., 1985 J Immunol Methods 125:191-202; the above are incorporated herein by reference.
[0135] As used herein, the term "heavy chain antibody" refers to an antibody that lacks the light chain of a conventional antibody. This term specifically includes, but is not limited to, homodimeric antibodies containing a VH antigen-binding domain and constant CH2 and CH3 domains in the absence of a CH1 domain.
[0136] As used herein, the term "complementarity-determining region" (CDR) refers to a hypervariable region found in both the light and heavy chain variable domains. A more conserved portion of the variable domain is called a frame region (FR). As understood in the art, the amino acid position representing the hypervariable region of an antibody can vary depending on the context and various definitions known in the art. Some positions within a variable domain can be considered heterozygous hypervariable positions because these positions can be considered within a set of standards (such as IMGT or KABAT) but outside a set of standards (such as KABAT or IMGT). One or more of these positions can also be found in extended hypervariable regions. The present invention includes antibodies containing modifications at these heterozygous hypervariable positions. The variable domains of the natural heavy and light chains each contain four frame regions predominantly employing a sheet configuration, linked by three CDRs (CDR1, CDR2, and CDR3) that form loops connecting sheet structures and, in some cases, form part of a sheet structure. The CDRs in each chain are tightly held together by the FR regions in the sequence FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and together with CDRs from other antibody chains, contribute to the formation of the antibody's antigen-binding site (see Kabat et al., Sequences of Protein of Immunological Interest, National Institute of Health, Bethesda, Md. 1987; incorporated herein by reference). For example, in this paper, CDR1-VH, CDR2-VH, and CDR3-VH refer to the first, second, and third CDRs of the heavy chain variable region (VH), which together constitute the CDR combination (VHCDR combination) of the heavy chain (or its variable region); CDR1-VL, CDR2-VL, and CDR3-VL refer to the first, second, and third CDRs of the light chain variable region (VL), which together constitute the CDR combination (VLCDR combination) of the light chain (or its variable region).
[0137] As used herein, the term "monoclonal antibody" refers to an antibody derived from a single clone (including any eukaryotic, prokaryotic, or phage clone), and is not limited to the method of antibody production.
[0138] As used herein, the term "VH" refers to the variable region of the immunoglobulin heavy chain (including the heavy chain of Fv, scFv, or Fab) of an antibody. The term "VL" refers to the variable region of the immunoglobulin light chain (including the light chain of Fv, scFv, dsFv, or Fab).
[0139] The term "heavy chain constant region" in this document refers to the carboxyl-terminal portion of the antibody heavy chain, which does not directly participate in antibody-antigen binding but exhibits effector functions, such as interaction with the Fc receptor. It has a more conserved amino acid sequence compared to the variable domains of the antibody. A "heavy chain constant region" contains at least one of the following: a CH1 domain, a hinge region, a CH2 domain, a CH3 domain, or a variant or fragment thereof. "Heavy chain constant region" includes a "full-length heavy chain constant region" and a "heavy chain constant region fragment," the former having a structure substantially similar to the natural antibody constant region, while the latter includes only a portion of the full-length heavy chain constant region. Exemplarily, a typical "full-length antibody heavy chain constant region" consists of a CH1 domain-hinge region-CH2 domain-CH3 domain; when the antibody is IgE, it also includes a CH4 domain; when the antibody is a heavy chain antibody, it does not include the CH1 domain. Exemplarily, a typical "heavy chain constant region fragment" may be selected from the CH1, Fc, or CH3 domains.
[0140] The term "light chain constant region" in this article refers to the carboxyl terminus of the antibody light chain, which does not directly participate in the binding of the antibody to the antigen. The light chain constant region can be selected from the constant κ domain or the constant λ domain.
[0141] The term "Fc" in this document refers to the carboxyl-terminal portion of an antibody derived from papain hydrolysis, typically containing the CH3 and CH2 domains of the antibody. Fc regions include, for example, native sequence Fc regions, recombinant Fc regions, and variant Fc regions. Although the boundaries of the Fc region in immunoglobulin heavy chains can vary slightly, the Fc region in human IgG heavy chains is generally defined as extending from the amino acid residue at Cys226 or from Pro230 to its carboxyl terminus. The C-terminal lysine of the Fc region (residue 447 according to the EU numbering system) can be removed, for example, during antibody production or purification, or through recombinant engineering of the nucleic acid encoding the antibody heavy chain; therefore, the Fc region may or may not include Lys447.
[0142] The term "humanized antibody" in this article refers to a genetically engineered non-human antibody whose amino acid sequence has been modified to increase its homology with that of a human antibody. Typically, all or part of the CDR region of a humanized antibody is derived from a non-human antibody (donor antibody), while all or part of the non-CDR region (e.g., the variable region FR and / or constant region) is derived from a human immunoglobulin (receptor antibody). Humanized antibodies generally retain or partially retain the intended properties of the donor antibody, including but not limited to antigen specificity, affinity, reactivity, the ability to enhance immune cell activity, and the ability to strengthen the immune response.
[0143] The term "fully human antibody" in this document refers to an antibody having variable regions in which both the FR and CDR are derived from human germline immunoglobulin sequences. Furthermore, if the antibody contains a constant region, that constant region is also derived from a human germline immunoglobulin sequence. Fully human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced through random or site-specific mutagenesis in vitro or through somatic mutations in vivo). However, the term "fully human antibody" in this document is not intended to include antibodies in which a CDR sequence derived from another mammalian species (e.g., mouse) has been grafted onto a human frame sequence.
[0144] The term "naked antibody" as used herein refers to an antibody that is not linked, fused to, or conjugated with another agent or molecule (e.g., a label or drug), peptide, or polypeptide. In specific embodiments, naked antibodies expressed by mammalian host cells may be glycosylated by the host cell's glycosylation machinery (e.g., glycosylation enzymes). In some embodiments, naked antibodies are not glycosylated when expressed by host cells that do not possess their own glycosylation machinery (e.g., glycosylation enzymes). In some embodiments, naked antibodies are intact antibodies, while in other embodiments, naked antibodies are antigen-binding fragments of intact antibodies, such as Fab antibodies.
[0145] The term "conjugated antibody" refers to an antibody that can associate with a pharmaceutically acceptable carrier or diluent, and it can be a monoclonal antibody, chimeric antibody, humanized antibody, or human antibody.
[0146] The term "biantibody" in this article refers to a bivalent, bispecific antibody that can bind to different epitopes on the same or different antigens.
[0147] As used herein, the term "percentage (%) sequence identity" refers to the percentage of amino acid (or nucleotide) residues in a candidate sequence that are identical to those in a reference sequence after alignment to achieve the maximum percentage sequence identity and the introduction of vacancies (if necessary) (e.g., for optimal alignment, vacancies may be introduced in one or both of the candidate and reference sequences, and non-homologous sequences may be ignored for comparison purposes). Alignments can be performed in a variety of ways well known to those skilled in the art for the purpose of determining percentage sequence identity, such as using publicly available computer software like BLAST, ALIGN, or Megalign (DNASTAIi) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For example, a reference sequence used for alignment against a candidate sequence may show sequence identity from 50% to 100% across the full length of the candidate sequence or selected portions of consecutive amino acid (or nucleotide) residues of the candidate sequence. The length of a candidate sequence for comparison purposes can be at least 30% (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of the length of a reference sequence. Molecules are considered identical at that position when a position in a candidate sequence is occupied by the same amino acid (or nucleotide) residue as the corresponding position in the reference sequence.
[0148] The term "conservative amino acid" in this document generally refers to amino acids that belong to the same class or have similar characteristics (e.g., charge, side chain size, hydrophobicity, hydrophilicity, main chain conformation, and rigidity). For example, the amino acids in each of the following groups are conserved amino acid residues, and substitutions of amino acid residues within a group constitute substitutions of conserved amino acids:
[0149] (1) Acidic amino acids: Asp (D) and Glu (E);
[0150] (2) Basic amino acids: Lys(K), Arg(R) and His(H);
[0151] (3) Hydrophilic, uncharged amino acids: Ser(S), Thr(T), Asn(N), and Gln(Q);
[0152] (4) Aliphatic uncharged amino acids: Gly (G), Ala (A), Val (V), Leu (L) and Ile (I);
[0153] (5) Nonpolar, uncharged amino acids: Cys (C), Met (M), and Pro (P);
[0154] (6) Aromatic amino acids: Phe (F), Tyr (Y) and Trp (W).
[0155] The term "Kabat numbering system" in this article usually refers to the immunoglobulin alignment and numbering system proposed by Elvin A. Kabat (see, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991).
[0156] The term “Chothia numbering system” in this article usually refers to the immunoglobulin numbering system proposed by Chothia et al., which is a classic rule for identifying the boundaries of CDR regions based on the location of structural loop regions (see, for example, Chothia & Lesk (1987) J. Mol. Biol. 196: 901-917; Chothia et al. (1989) Nature 342: 878-883).
[0157] The term "IMGT numbering system" in this article usually refers to the immunoglobulin numbering system proposed by Chothia et al., which is a classic rule for identifying the boundaries of CDR regions based on the location of structural loop regions (see, for example, Chothia & Lesk (1987) J. Mol. Biol. 196: 901-917; Chothia et al. (1989) Nature 342: 878-883).
[0158] As used herein, the term "specific binding" refers to a binding reaction that determines the presence of an antigen within a heterogeneous population of proteins and other biomolecules, which are specifically recognized, for example, by an antibody or its antigen-binding fragment. Antibodies or their antigen-binding fragments that specifically bind to an antigen will bind at a Kc concentration of less than 100 nM. D Binding to antigens. For example, antibodies or antigen-binding fragments that specifically bind to antigens will have a K+ concentration up to 100 nM (e.g., between 1 pM and 100 nM). D Binding to antigens. Antibodies or antigen-binding fragments that do not show specific binding to a particular antigen or its epitope will show a K+ greater than 100 nM (e.g., greater than 500 nM, 1 μM, 100 μM, 500 μM, or 1 mM) for that particular antigen or its epitope. DVarious immunoassays can be used to select antibodies that specifically react with particular proteins or carbohydrates. For example, solid-phase ELISA is routinely used to select antibodies that specifically react with proteins or carbohydrates. See Harlow & Lane, Antibodies, A Laboratory
[0159] The manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999) describe the immunoassay methods and conditions that can be used to determine specific immune reactivity.
[0160] As used herein, the term "antibody conjugate" refers to a conjugate / conjugate formed by the direct or linker-mediated chemical bonding of an antibody molecule to another molecule. An example is an antibody-drug conjugate (ADC), in which the drug molecule is the other molecule.
[0161] The term "chimeric antigen receptor (CAR)" in this document refers to a recombinant protein comprising at least (1) an extracellular antigen-binding domain, such as a variable heavy or light chain of an antibody, (2) a transmembrane domain anchoring the CAR into immune effector cells, and (3) an intracellular signaling domain. In some embodiments, the extracellular antigen-binding domain of the CAR comprises a scFv. The scFv may be derived from the variable heavy and light regions of a fusion antibody. Alternatively or additionally, the scFv may be derived from Fab's (instead of an antibody, e.g., from a Fab library). In some embodiments, the scFv is fused to the transmembrane domain and then to the intracellular signaling domain.
[0162] The term "nucleic acid" in this document includes any compound and / or substance comprising a polymer containing nucleotides. Each nucleotide consists of a base, particularly a purine or pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T), or uracil (U)), a sugar (i.e., deoxyribose or ribose), and a phosphate group. Typically, nucleic acid molecules are described by the sequence of bases, whereby the bases represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is typically represented as 5′ to 3′. In this document, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), including, for example, complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), particularly messenger RNA (mRNA), synthetic forms of DNA or RNA, and polymers containing mixtures of two or more of these molecules. Nucleic acid molecules can be linear or circular. Furthermore, the term nucleic acid molecule includes both sense and antisense strands, as well as single-stranded and double-stranded forms. Moreover, the nucleic acid molecules described herein may contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include modified nucleotide bases having residues with derived sugar or phosphate backbones or chemical modifications. Nucleic acid molecules also encompass DNA and RNA molecules suitable as carriers for the direct expression of the antibodies of the present invention in vitro and / or in vivo, such as in a host or patient. Such DNA (e.g., cDNA) or RNA (e.g., mRNA) carriers can be unmodified or modified. For example, mRNA can be chemically modified to enhance the stability of the RNA carrier and / or the expression of the encoded molecule, thereby allowing the mRNA to be injected into a subject to generate antibodies in vivo (see, for example, Stadler et al., Nature Medicine 2017, published online June 12, 2017, doi: 10.1038 / nm.4356 or EP 2 101 823 B1).
[0163] As used herein, the term "vector" includes nucleic acid vectors, such as DNA vectors (e.g., plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). Various vectors have been developed for delivering polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. The expression vectors of the present invention contain polynucleotide sequences and additional sequence elements, for example, for expressing proteins and / or integrating these polynucleotide sequences into the genome of mammalian cells. Some vectors that can be used to express the antibodies and antibody fragments of the present invention include plasmids containing regulatory sequences (e.g., promoter and enhancer regions) that guide gene transcription. Other useful vectors for expressing antibodies and antibody fragments contain polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of mRNA produced by gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signal sites to guide efficient transcription of the gene carried on the expression vector. The expression vectors of the present invention may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or norsocrine.
[0164] The term "host cell" in this article refers to a cell in which foreign nucleic acids have been introduced, including the progeny of such cells. Host cells include "transformers" and "transformed cells," which include primary transformed cells and their progeny, regardless of the number of passages. Progeny may not be identical to parental cells in their nucleic acid contents and may contain mutations. This article includes mutant progeny with the same function or biological activity as those screened or selected in the initially transformed cells.
[0165] The term "pharmaceutical composition" as used herein refers to a formulation which is present in a form that allows for the effective biological activity of the active ingredient contained therein, and which does not contain any additional ingredients that would have unacceptable toxicity to a subject administering the pharmaceutical composition.
[0166] As used herein, the terms “subject,” “object,” and “patient” refer to an organism that receives treatment for a specific disease or condition (such as cancer or an infectious disease) as described herein. Examples of objects and patients include mammals receiving treatment for diseases or conditions (such as proliferative conditions like cancer or infectious diseases), such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the Bovidae family (such as domestic cattle, bison, buffalo, elk, and yaks), sheep, and horses.
[0167] As used herein, the term "treatment" refers to surgical or therapeutic treatment aimed at preventing, slowing (reducing) undesirable physiological changes or lesions in the treated individual, such as the progression of proliferative disorders (e.g., cancer or infectious diseases). Beneficial or desired clinical outcomes include, but are not limited to, relief of symptoms, reduction of disease severity, stabilization of the disease state (i.e., no worsening), delay or slowing of disease progression, improvement or mitigation of the disease state, and remission (whether partial or complete), whether detectable or undetectable. Individuals requiring treatment include those already suffering from the condition or disease, those susceptible to the condition or disease, or those intending to prevent the condition or disease. When terms such as slowing, reducing, weakening, mitigating, or alleviating are used, they also include elimination, disappearance, and non-occurrence.
[0168] The term "effective dose" in this document refers to the amount of a therapeutic agent, when administered alone or in combination with another therapeutic agent to cells, tissues, or subjects, that is effective in preventing or alleviating symptoms of a disease or the progression of that disease. "Effective dose" also refers to the amount of a compound sufficient to relieve symptoms, such as treating, curing, preventing, or alleviating an associated medical condition, or increasing the rate at which such symptoms are treated, cured, prevented, or alleviated. When an active ingredient is administered to an individual alone, the therapeutically effective dose refers to that ingredient alone. When a combination is used, the therapeutically effective dose refers to the combined amount of active ingredients that produce a therapeutic effect, regardless of whether they are administered in combination, consecutively, or simultaneously.
[0169] The term "appropriate conditions" in this article refers to conditions suitable for culturing various host cells, including eukaryotic and prokaryotic cells.
[0170] The term "cancer" in this article refers to or describes a physiological condition in mammals characterized by unregulated cell growth. This definition includes both benign and malignant cancers.
[0171] The term "tumor" in this article refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues. The terms "cancer" and "tumor" are not mutually exclusive when used in this article.
[0172] The term "antitumor agent" in this article refers to antitumor drugs, which are a class of drugs used to treat tumor diseases, including chemotherapy drugs and biological agents.
[0173] The term "EC" in this article 50 "" refers to the half-maximum effective concentration, which includes the antibody concentration that induces a half-range response between baseline and maximum after a specified exposure time. 50Essentially representing 50% of the antibody concentration where its maximum effect is observed, it can be measured using methods known in the art. Attached Figure Description
[0174] Figure 1 The image shows the SDS-PAGE protein electrophoresis pattern of the scFv-Fc antibody after reduction (where M: Marker; 1-17: scFv1-scFv17).
[0175] Figure 2 The image shows the protein electrophoresis pattern of scFv-Fc antibody by non-reducing SDS-PAGE (where M: Marker; 1-17: scFv1-scFv17).
[0176] Figure 3 This is the concentration-absorbance curve of the binding of scFv-Fc antibody to human CLL-1 antigen.
[0177] Figure 4 The image shows the concentration-absorbance curve of the binding of scFv-Fc antibody to cynomolgus monkey CLL-1 antigen.
[0178] Figure 5 The value represents the concentration-average fluorescence intensity of the scFv-Fc antibody binding to hCLL1-293 cells.
[0179] Figure 6 The value represents the concentration-average fluorescence intensity of the scFv-Fc antibody binding to HEK 293 cells.
[0180] Figure 7 This is the concentration-mean fluorescence intensity curve of scFv-Fc antibody binding to U937 cells. Detailed Implementation
[0181] The present invention will now be described in detail with reference to embodiments and accompanying drawings. The accompanying drawings are provided to illustrate some preferred embodiments of the invention; however, it is to be understood that the invention is not limited to the specific embodiments disclosed or should not be considered a limitation on the scope of the invention. Unless otherwise specified, specific conditions in the embodiments are performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.
[0182] Example 1: Screening of mouse anti-human CLL-1 scFv antibodies
[0183] 1.1 Immunological and serum titer detection in mice
[0184] Six SPF-grade Balb / c mice (Vitollea) were selected and ear-tagged as H59#-H64#. They were immunized with the Human CLL-1Fc (ACRO, catalog number: CLA-H5266) antigen. 0.05 mg of antigen was mixed with complete Freund's adjuvant (Sigma, catalog number: F5881) and injected subcutaneously into the right axilla of each mouse. Subsequently, immunizations were performed every two weeks using incomplete Freund's adjuvant (Sigma, catalog number: F5506) in the same manner, for a total of three immunizations. One week after the third immunization, 100 μL of blood was collected from the orbital sinus, and the serum was separated by centrifugation for titer determination.
[0185] The titer of anti-human CLL-1 antibody in mouse serum was detected by enzyme-linked immunosorbent assay (ELISA).
[0186] The Human CLL-1 antigen (Kaikai Biotechnology, catalog number: CLE-HM12A) was diluted to 0.5 μg / mL with PBS and added to each well of a 96-well ELISA plate (Thermo, catalog number: 468667), 100 μL per well. The plate was sealed with sealing film and incubated overnight at 4°C in the dark. The next day, the plate was washed three times with a plate washer, and PBS containing 5% skim milk powder was added to each well for blocking. The plate was then sealed with sealing film and incubated at 37°C in a shaker for 1 hour in the dark. First, dilute the serum 1:200 with PBS, then perform 5-fold serial dilutions, resulting in a total of 7 concentration gradients. Add 100 μL to each well of the sealed ELISA plate. Seal the ELISA plate with a sealing film and incubate it at 37°C in the dark for 1 hour. Discard the chimeric antibody from the ELISA plate and wash the plate 3 times with a plate washer. Dilute HRP Anti-Mouse IgG H&L (Thermo, catalog number: A16078) with PBS at a ratio of 1:10000 and add 100 μL to each well of the ELISA plate. Seal the ELISA plate with a sealing film and incubate it at 37°C in the dark for 1 hour. Discard the secondary antibody from the ELISA plate, wash the plate three times with a plate washer, and add 100 μL of TMB solution (Solepro, catalog number: PR1200) to each well. After 4 minutes of color development, add 100 μL of stop solution (1M H2SO4 solution) to each well, shake thoroughly to stop the color development reaction. Place the ELISA plate in a microplate reader and read the OD value. 450 value.
[0187] The results in Table 5 show that after the third immunization, the serum titer of mice was between 1:125000 and 1:25000, which is at a medium to high level and is suitable for phage library construction.
[0188] Table 5. Serum ELISA titer detection in mice after the third immunization
[0189]
[0190] 1.2 Construction of phage libraries
[0191] Spleens of mice after the third immunization were collected, ground into powder using liquid nitrogen, and total RNA was extracted using an RNA extraction kit (Tiangen, catalog number: DP451). The extracted RNA was then reverse transcribed into cDNA using a reverse transcription kit (Tiangen, catalog number: KR118-02).
[0192] The antibody heavy chain variable region (VH) and light chain variable region (VL) were amplified by PCR.
[0193] PCR primers for the heavy chain variable region (VH):
[0194] Upstream primer SEQ ID NO: 134: AGGTSMARCTGCAGSAGTCWGG
[0195] Downstream primer SEQ ID NO: 135: TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC
[0196] PCR primers for the light chain variable region (VL):
[0197] Upstream primer SEQ ID NO: 136: GACATTGAGCTCACCCAGTCTCCA
[0198] Downstream primer SEQ ID NO: 137: CCGTTTBAKYTCCARCTTKGTSCC
[0199] The light chain variable region (VL) was ligated to the linker ((GGGGS)3) using PCR.
[0200] PCR primers for the VL-Linker fragment:
[0201] Upstream primer SEQ ID NO: 138:
[0202] CCACGGTCACCGTCTCCTCAGGAGGAGGAGGCAGCGGAGGAGGAGGCAGCGGAGGAGGAGGCAGCGACATTGAGCTCACCCAGTCTCCA
[0203] Downstream primer SEQ ID NO: 137: CCGTTTBAKYTCCARCTTKGTSCC
[0204] The heavy chain variable region (VH) was ligated to VL-Liner using PCR.
[0205] PCR primers for the VL-Linker-VH(scFv) fragment:
[0206] Upstream primer SEQ ID NO: 139:
[0207] GTCCTCGCAACTGCGGCCCAGGCGGCCATGGCCCAGGTSMARCTGCAGSAGTCWGG
[0208] Downstream primer SEQ ID NO: 140:
[0209] GAGCATTCTGGCCGGCCTGGCCCCGTTTBAKYTCCARCTTKGTSCC
[0210] The target scFv antibody and pComb3XTT vector nucleic acid fragment were recovered and cloned into the phage display vector pComb3XTT (Fenghui Biotechnology, catalog number: QT078) using the restriction endonuclease SfiI (NEB, catalog number: R0123L). The constructed vector was electroporated into *E. coli* electroporation competent cells TG1 (Beyotime, catalog number: D0389) using a cell electroporator (Bio-Rad, model: 1652100) to construct a phage display library of scFv antibody against human CLL-1, and the library was validated. The library size was calculated to be 3 × 10⁻⁶ cells after serial dilution plating. 7 .
[0211] 1.3 Screening of phage scFv antibodies
[0212] Plates were coated with 10 μg / well of human CLL-1 Fc (human IgG1) antigen (ACRO, catalog number: CLA-H5266) and human IgG1 Fc antigen (ACRO, catalog number: FCC-H5214), respectively, and incubated overnight at 4°C. The next day, the phage display library was premixed with an equal volume of PBS containing 6% BSA (Solepro, catalog number: 128K058) (final content: 3% BSA), and blocked at room temperature for 2 h. The premix was first incubated with Fc-coated ELISA plates at 37°C for 1 h, and then with human CLL-1 Fc antigen-coated ELISA plates at 37°C for 1 h. The plates were then washed 6 times with PBST and 2 times with PBS to remove unbound phages. Finally, 100 μL of 0.1M Gly-HCl elution buffer was added to elute phages that specifically bind to human CLL-1, thus enriching positive clones.
[0213] Using the same method, the phages enriched with human CLL-1Fc antigen were further enriched with cynomolgus monkey CLL-1Fc (human IgG1) antigen (Yiqiao Shenzhou, catalog number: 90146-H01H) and human IgG1 Fc to obtain phage clones that could bind to both human and cynomolgus monkey CLL-1 antigens.
[0214] 1.4 Validation of phage-positive clones
[0215] After selection, the obtained phages that were positive for binding to human and cynomolgus monkey CLL-1 were used to infect blank *E. coli* and plated. Then, 384 single colonies were selected and amplified separately. ELISA detection plates (Corning, catalog number: 9018) were coated with human CLL1-His (Kaika Biotechnology, catalog number: CLE-HM12A) and cynomolgus monkey CLL1-His (Kaika Biotechnology, catalog number: CLE-CM12A) antigens and incubated overnight at 4°C. After blocking with 3% BSA at room temperature for 1 hour, phage-E. coli culture supernatant was added, and the plates were incubated at 37°C for 1 hour. The washing was repeated 3 times. A 1:10000 dilution of horseradish peroxidase-labeled M13 antibody anti-M13-HRP (Yiqiao Shenzhou, catalog number: 11973-MM05T-H) was added and incubated at room temperature for 1 hour. The washing was repeated 3 times. TMB chromogenic buffer was added for color development, and absorbance was measured at 450 nm using a microplate reader. Phage clones that were positive for binding to human and cynomolgus monkey CLL-1 were selected, and their supernatant was incubated with 293 cells overexpressing human CLL1 at 4°C for 1 hour. After washing three times, anti-M13 antibody labeled with PE (anti-M13-PE, catalog number: 11973-MM05T-P) was added, and after washing three times, the mean fluorescence intensity (MFI) of the PE channel of the sample was detected by flow cytometry.
[0216] Forty-five positive clones were selected for sequencing. The sequencing results were analyzed using MOE software. A phylogenetic tree was constructed based on the amino acid sequence of the scFv encoded protein. After removing sequences that were close to each other on the phylogenetic tree based on sequence similarity, 33 unique mouse scFv antibody sequences were obtained. The CDRs region sequences of these sequences were analyzed using KABAT, IMGT, and Chothia methods, as shown in Tables 6-9 below. Table 6 shows the amino acid sequences of 17 scFv antibodies, Table 7 shows the nucleotide sequences of 17 scFv antibodies, Table 8 shows the amino acid sequences of the light and heavy chain variable regions of the 17 scFv antibodies, and Table 9 shows the CDRs region sequences obtained by KABAT, IMGT, and Chothia methods.
[0217] Table 6. Amino acid sequence information of mouse scFv antibody
[0218]
[0219]
[0220] Table 7. Nucleotide sequence information of mouse scFv antibodies
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227] Table 8. Amino acid sequences of the variable regions of the light and heavy chains of mouse scFv antibodies
[0228]
[0229]
[0230]
[0231] Table 9. Amino acid sequence information of mouse scFv antibody CDRs
[0232]
[0233]
[0234]
[0235]
[0236] Example 2: Preparation and Quality Control of scFv-Fc Antibody
[0237] 2.1 Molecular construction of the scFv-Fc antibody expression vector
[0238] To obtain recombinant scFv-Fc antibodies for subsequent evaluation, the phage-displayed scFv sequence was amplified using a PCR kit (Novizan, catalog number: P510-01). The scFv sequence was then recombined into a pcDNA3.4 expression vector containing a signal peptide and human IgG1 Fc using a homologous recombination kit (Yisheng Bio, catalog number: 10923ES50). This vector was then transformed into DH5α competent cells (ApexBio, catalog number: BC2001) for amplification and culture. Gene sequencing was performed by Genewiz Biotechnology. After confirming the sequence was correct, the expression vector was prepared using an endotoxin-free plasmid mini-prep kit (Tiangen, catalog number: DP118-03) and filtered sterilized using a 0.22 μM filter membrane (NEST, catalog number: 331011). The 17 mouse scFv antibody expression vectors were numbered as shown in Table 10 below.
[0239] Table 10. Correspondence between Antibody Number and Antibody Name
[0240] Antibody number scFv-Fc antibody name Antibody number scFv-Fc antibody name Antibody number scFv-Fc antibody name scFv1 CSAB001 scFv7 CSAB007 scFv13 CSAB016 scFv2 CSAB002 scFv8 CSAB008 scFv14 CSAB018 scFv3 CSAB003 scFv9 CSAB009 scFv15 CSAB019 scFv4 CSAB004 scFv10 CSAB012 scFv16 CSAB020 scFv5 CSAB005 scFv11 CSAB013 scFv17 CSAB022 scFv6 CSAB006 scFv12 CSAB015
[0241] 2.2 Expression and purification of scFv-Fc antibody
[0242] Using Expi293 TM Expression Medium (Thermo, catalog number: A1435101) was used to passage cells to 1×10⁶ cells. 6 cells / mL, using ExpiFectamine TM The expression vector was transiently transfected into Expi-293F cells (Thermo, A29127) using the 293Transfection Kit (Themro, catalog number: A14524). The cells were cultured continuously for 5 days using a cell culture shaker (IKA, model: MS3digital) at 8% CO2, 37°C, 85% relative humidity, and 1000 rpm / min. Cell components were removed by centrifugation to obtain the culture supernatant containing scFv-Fc antibody.
[0243] Add an appropriate amount of Protein A purification magnetic beads (GenScript, catalog number: L00695) to the supernatant culture medium, incubate overnight at 4°C and 30 rpm / min, mix thoroughly, and remove the beads using a magnetic separator (GenScript, catalog number: L00722). Discard the supernatant, wash four times with an equal volume of PBST, and elute the antibody with 0.1M glycine-hydrochloric acid buffer (pH 3.0±0.1). Neutralize with 1 / 10 volume of 1M Tris-HCl (pH 8.5±0.1). Ultrafilter the antibody using a 3kDa ultrafiltration tube (Cobot, catalog number: ULRC0030150P) at 4°C, replacing the buffer with PBS. After sterile filtration through a 0.22μM filter membrane, aliquot and store at -80°C.
[0244] 2.3 Analysis of molecular weight and purity of scFv-Fc antibody
[0245] To evaluate the molecular weight and purity of the scFv-Fc antibody, the antibody was premixed with 5× reducing loading buffer (Beyotime, catalog number: P0286) and 5× non-reducing loading buffer (Sangon Biotech, catalog number: 1927DA0001), respectively. SDS-PAGE electrophoresis (120V, 45min) was performed using a high-resolution gradient gel (Yisheng Biotech, catalog number: P7311040). After the gel was stained with Coomassie Brilliant Blue R-250 and destaining, gel imaging was performed using a chemiluminescence imaging system (Shenhua, catalog number: SH-523).
[0246] The results showed that the molecular weights of the scFv-Fc antibodies, after reduction SDS-PAGE protein electrophoresis, were all in the range of 55kDa to 70kDa. Figure 1 The proteins were of theoretical molecular weight and exhibited high purity after non-reducing SDS-PAGE protein electrophoresis. Figure 2 ).
[0247] Example 3: Evaluation of the binding affinity of scFv-Fc antibody to human, cynomolgus monkey, and mouse CLL-1 antigens by enzyme-linked immunosorbent assay (ELISA).
[0248] 3.1 Binding affinity of scFv-Fc antibody to human CLL-1 antigen
[0249] To evaluate the binding affinity of scFv-Fc antibody to human CLL-1 antigen, the concentration of human CLL-1 (KaiKa Biotechnology, catalog number: CLE-HM12A) antigen was diluted to 0.5 μg / mL with PBS and added to 96-well microplates at a concentration of 100 μL per well. The microplates were sealed with sealing film and incubated overnight at 4°C in the dark. The next day, the microplates were washed three times with a plate washer, and blocking buffer (PBS containing 5% skim milk powder) was added to each well at a concentration of 200 μL. The microplates were then sealed with sealing film and incubated at 37°C in a shaker in the dark for 1 hour. First, dilute the scFv-Fc antibody to 50 nM with PBS, then perform a 4-fold serial dilution, resulting in 7 concentration gradients. Add 100 μL to each well of the sealed ELISA plate. Seal the ELISA plate with a sealing film and incubate it at 37°C in the dark for 1 hour. Discard the scFv-Fc antibody from the ELISA plate, wash the plate 3 times with a plate washer, and dilute goat anti-human IgG Fc-HRP (Thermo, 31413) with PBS at a ratio of 1:2000 and add 100 μL to each well of the ELISA plate. Seal the ELISA plate with a sealing film and incubate it at 37°C in the dark for 1 hour. Discard the secondary antibody from the ELISA plate, wash the plate three times with a plate washer, and add 100 μL of TMB solution to each well. After 4 minutes of color development, add 100 μL of stop solution (1 M H₂SO₄ solution) to each well, and shake thoroughly to terminate the color development reaction. Place the ELISA plate in a microplate reader and read the OD value. 450 value.
[0250] The results showed that all scFv-Fc antibodies could bind to human CLL-1 antigen, and the binding affinity was strong. 50 <10nM (Table 11, Figure 3 ).
[0251] Table 11. OD of scFv-Fc binding to human CLL-1 antigen 450 Absorbance and EC 50 value
[0252]
[0253] 3.2 Binding affinity of scFv-Fc antibody to cynomolgus monkey CLL-1 antigen
[0254] The binding affinity of the scFv-Fc antibody to the cynomolgus monkey CLL-1 (Kaikai Biotechnology, catalog number: CLE-CM12A) antigen was evaluated according to the method in Example 3.1.
[0255] The results showed that all scFv-Fc antibodies could bind to the cynomolgus monkey CLL-1 antigen. CSAB006, CSAB007, CSAB008, CSAB009, CSAB015, CSAB019, CSAB020, and CSAB022 showed stronger binding to the cynomolgus monkey CLL-1 antigen. 50 <10nM (Table 12, Figure 4 ); CSAB001, CSAB002, CSAB003, CSAB004, CSAB005, CSAB012, CSAB013, CSAB016, and CSAB18 bind slightly weakly to the cynomolgus monkey CLL-1 antigen, 10 nM < EC 50 <100nM (Table 12, Figure 4 ).
[0256] Table 12. OD of scFv-Fc binding to cynomolgus monkey CLL-1 antigen 450 Absorbance and EC 50 value
[0257]
[0258]
[0259] 3.3 Binding affinity of scFv-Fc antibody to mouse CLL-1 antigen
[0260] The binding affinity of the scFv-Fc antibody to the mouse CLL-1 (Kaikai Biotechnology, catalog number: CLE-MM12A) antigen was evaluated according to the method in Example 3.1.
[0261] The results in Table 13 show that none of the scFv-Fc antibodies bound to the mouse CLL-1 antigen, EC 50 Unable to calculate.
[0262] Table 13. OD of scFv-Fc binding to mouse CLL-1 antigen 450 Absorbance and EC 50 value
[0263]
[0264] N / A: No value available.
[0265] Example 4: Evaluation of the binding affinity of scFv-Fc antibody to human, cynomolgus monkey, and mouse CLL-1 antigens using biomembrane interference (BLI) method.
[0266] 4.1 Binding affinity of scFv-Fc antibody to human CLL-1 antigen
[0267] The binding affinity of scFv-Fc antibody to human CLL-1 antigen was detected and analyzed using a GatorBio (Gator Prime) molecular interaction analyzer. The detection buffer was a PBS (10 mM P H7.4) solution containing 0.02% Tween (Solepro, catalog number: T8220) and 0.2% BSA IgG Free (Jackson ImmunoResearch, catalog number: 001-000-061). The scFv-Fc antibody was diluted to 5 μg / mL with the detection buffer, and the human CLL-1 (Kaikai Biotechnology, catalog number: CLE-HM12A) antigen was diluted to 200 nM, 50 nM, 12.5 nM, and 0 nM. The antibody dilution, antigen dilution, and detection buffer were added to the corresponding wells of the detection plate. The detection plate temperature was set to 30℃, the light acquisition rate to 5.0 Hz, and the probe rotation speed to 1000 rpm / min. In each detection cycle, Protein A probe (GatorBio, catalog number: 160001) was equilibrated in detection buffer for 1 min, loaded with scFv-Fc antibody solution for 2 min, equilibrated in detection buffer for 1 min, bound to different concentrations of human CLL-1 antigen for 5 min, and then dissociated in detection buffer for 5 min. The 0 nM well light signal value was used as a blank reference; light signal values at other concentrations were subtracted from the reference value. The binding-dissociation kinetic curve was fitted using Global mode (combining detection values from different concentrations), and the dissociation rate constant K was calculated. off Binding rate constant K on Binding affinity K D .
[0268] The results in Table 14 show that the scFv-Fc antibody has a strong affinity for both human CLL-1 antigen and K. D 10 -12 ~10 -9 Level (1pM~1nM), Fitted Curve Full R 2 All are greater than 0.95.
[0269] Table 14. Binding affinity (K) of scFv-Fc to human CLL-1 antigen D )
[0270] Antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> <![CDATA[Full R 2 ]]> CSAB001 2.69E-04 8.33E+04 3.23E-09 0.995 CSAB002 4.15E-04 9.93E+04 4.18E-09 0.992 CSAB003 5.56E-05 9.85E+04 5.65E-10 0.992 CSAB004 4.30E-04 1.07E+05 4.02E-09 0.991 CSAB005 4.80E-04 8.24E+04 5.83E-09 0.995 CSAB006 2.67E-04 9.31E+04 2.87E-09 0.994 CSAB007 2.72E-04 1.64E+05 1.66E-09 0.99 CSAB008 3.55E-04 8.37E+04 4.24E-09 0.996 CSAB009 4.97E-05 1.16E+05 4.30E-10 0.994 CSAB012 1.95E-04 9.36E+04 2.08E-09 0.994 CSAB013 8.67E-05 2.46E+05 3.53E-10 0.996 CSAB015 3.31E-06 9.36E+04 3.53E-11 0.997 CSAB016 4.13E-04 9.46E+04 4.36E-09 0.993 CSAB018 4.13E-04 9.09E+04 4.54E-09 0.993 CSAB019 6.64E-05 8.07E+04 8.23E-10 0.997 CSAB020 2.61E-05 1.07E+05 2.45E-10 0.997 CSAB022 1.00E-06 1.13E+05 1.00E-12 0.997
[0271] 4.2 Binding affinity of scFv-Fc antibody to cynomolgus monkey CLL-1 antigen
[0272] The binding affinity of the scFv-Fc antibody to the cynomolgus monkey CLL-1 (Kaikai Biotechnology, catalog number: CLE-CM12A) antigen was detected and analyzed according to the method in Example 4.1.
[0273] The results in Table 15 show that the scFv-Fc antibodies CSAB007, CSAB009, CSAB013, CSAB015, CSAB019, CSAB020, and CSAB022 have strong affinity for the cynomolgus monkey CLL-1 antigen. D 10 -9 Grade (1nM), the remaining scFv-Fc antibodies showed slightly weaker affinity for the cynomolgus monkey CLL-1 antigen, K D 10 -8 Level (10 nM), Fitted Curve Full R 2 All are greater than 0.95.
[0274] Table 15. Binding affinity (K) of scFv-Fc to cynomolgus monkey CLL-1 antigen D )
[0275]
[0276]
[0277] 4.3 Evaluation of the binding affinity between scFv-Fc antibody and mouse CLL-1 antigen using biomembrane interference (BLI) method
[0278] The binding affinity of the scFv-Fc antibody to the mouse CLL-1 (Kaikai Biotechnology, catalog number: CLE-MM12A) antigen was detected and analyzed according to the method in Example 4.1.
[0279] The results in Table 16 show that none of the scFv-Fc antibodies bound to the mouse CLL-1 antigen, and the dissociation rate constant K could not be detected. off Value and binding rate constant K on Value, unable to calculate binding affinity K D .
[0280] Table 16. Binding affinity (K) of scFv-Fc to mouse CLL-1 antigen D )
[0281] Antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> <![CDATA[Full R 2 ]]> CSAB001 N / A N / A N / A N / A CSAB002 N / A N / A N / A N / A CSAB003 N / A N / A N / A N / A CSAB004 N / A N / A N / A N / A CSAB005 N / A N / A N / A N / A CSAB006 N / A N / A N / A N / A CSAB007 N / A N / A N / A N / A CSAB008 N / A N / A N / A N / A CSAB009 N / A N / A N / A N / A CSAB012 N / A N / A N / A N / A CSAB013 N / A N / A N / A N / A CSAB015 N / A N / A N / A N / A CSAB016 N / A N / A N / A N / A CSAB018 N / A N / A N / A N / A CSAB019 N / A N / A N / A N / A CSAB020 N / A N / A N / A N / A CSAB022 N / A N / A N / A N / A
[0282] N / A: No value available.
[0283] Example 5: Evaluation of the binding ability of scFv-Fc antibody to human CLL-1 positive cells by flow cytometry (FACS)
[0284] To evaluate the binding ability of scFv-Fc antibody to human CLL-1 positive cells, hCLL1-293 and HEK293 cells were cultured in T75 culture flasks to the logarithmic growth phase. The supernatant was discarded, and the cells were washed with sterile ice-cold PBS. 1 mL of 0.25% trypsin containing EDTA was added, and the cells were digested at room temperature. After the cells detached from the bottom of the culture dish, 5 mL of complete culture medium was added, and the cells were thoroughly mixed by pipetting with a sterile pipette and transferred to a 50 mL sterile centrifuge tube. U937 cells (Beina Biotechnology, 211228) were cultured in T75 culture flasks to the logarithmic growth phase and then transferred to a 50 mL sterile centrifuge tube. The cells were centrifuged at 300g for 4 min at 4°C, and the supernatant was discarded. 25 mL of FACS Buffer (PBS containing 0.2% BSA) was added to the centrifuge tube using a sterile pipette, and the cells were gently resuspended by pipetting. The cells were centrifuged at 300g for 4 min at 4°C, and the supernatant was discarded. This washing process was repeated twice. Resuspend cells in FACS Buffer, count cells, and adjust cell concentration to 2.5 × 10⁻⁶. 6 / mL, add 80μL of cell suspension to each well of a U-bottom 96-well plate. Dilute scFv-Fc antibody to working concentration with FACS Buffer (PBS solution containing 0.2% BSA) and add to each well of the U-bottom 96-well plate (hCLL1-293 and HEK293 cells: final concentration 100nM and 20nM respectively; U937 cells: final concentration 100nM, 4-fold dilution, 8 concentration gradients), mix well, and incubate at 4°C in the dark for 1 hour. Centrifuge at 300g for 4 min at 4°C and discard the supernatant. Repeat washing 3 times. Add Goat anti-Human IgG Fc, Alexa Fluor to FACS Buffer. TM 647 (Thermo, A55749) was diluted 1:1000 to the working concentration and added to 100 μL per well of a U-bottom 96-well plate. The plates were incubated at 4°C in the dark for 1 hour. The plates were then centrifuged at 300g for 4 min at 4°C, and the supernatant was discarded. The washing process was repeated three times. Using a multichannel pipette, 200 μL of FACS Buffer was added to each well of the U-bottom 96-well plate, and the cells were resuspended by pipetting. The mean fluorescence intensity (MFI) of the 647 (APC) channels was measured using flow cytometry.
[0285] The results showed that, compared with the blank control, the scFv-Fc antibody had a stronger binding ability to hCLL1-293 cells (Table 17). Figure 5 Furthermore, at the same antibody concentration, the average fluorescence intensity of scFv-Fc antibody binding to hCLL1-293 cells was significantly higher than that binding to HEK293 cells (Table 17). Figure 6 ).
[0286] Compared with the blank control, scFv-Fc antibody showed strong binding ability to U937 cells, except for CSAB022 antibody (EC). 50 Apart from 1.6 nM, the remaining antibody EC 50 All are less than 1 nM (Table 18, Figure 7 ).
[0287] Table 17. Concentrations of scFv-Fc binding to hCLL1-293 and HEK293 cells - mean fluorescence intensity
[0288]
[0289] Table 18. Concentrations of scFv-Fc binding to U937 cells - mean fluorescence intensity and EC50 50 value
[0290]
[0291]
[0292] N / A: No value available.
[0293] Example 6: Biomembrane Interference (BLI) Method for Analyzing the Binding Epitopes of scFv-Fc Antibody and Human CLL-1 Antigen
[0294] The binding epitopes of different scFv-Fc antibodies to human CLL-1 antigen were grouped using a GatorBio (Gator Prime) molecular interaction analyzer. The detection buffer was a PBS (10 mM MPa H7.4) solution containing 0.02% Tween (Solepro, catalog number: T8220) and 0.2% BSAIgG Free (Jackson ImmunoResearch, catalog number: 001-000-061). The scFv-Fc antibody was diluted to 5 μg / mL with the detection buffer, the human CLL-1 (Kaikai Biotechnology, catalog number: CLE-HM12A) antigen was diluted to 200 nM, and the human IgG1 Fc was diluted to 50 μg / mL as blocking buffer. The antibody dilution, antigen dilution, blocking buffer, and detection buffer were added to the corresponding wells of the detection plate. The detection plate temperature was set to 30℃, the light signal acquisition rate to 5.0 Hz, and the probe rotation speed to 1000 rpm / min. In each detection cycle, the HFC probe (GatorBio, catalog number: 160003) was equilibrated in the detection buffer for 1 min, the first scFv-Fc antibody solution was loaded for 2 min, equilibrated in the detection buffer for 1 min, human CLL-1 antigen binding was performed for 5 min, blocking buffer was applied for 5 min, and the second scFv-Fc antibody solution was applied for 5 min. The presence or absence of a binding signal from the second scFv-Fc antibody was used to determine whether the binding epitopes of the first and second scFv-Fc antibodies against the human CLL-1 antigen were the same.
[0295] The results in Table 19 show that all seven scFv-Fc antibodies and the human CLL-1 antigen share the same binding epitope.
[0296] Table 19. Grouping of epitopes binding to human CLL-1 antigen by scFv-Fc antibody
[0297]
Claims
1. An antibody or antigen-binding fragment thereof that specifically binds to human CLL-1, characterized in that, The antibody or its antigen-binding fragment comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein: 1) The heavy chain variable region (VH) comprises HCDR1, HCDR2, and HCDR3; HCDR1 comprises any sequence of SEQ ID NO.1–4, SEQ ID NO.44–47, or SEQ ID NO.70–73, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; HCDR2 comprises any sequence of SEQ ID NO.5–8, SEQ ID NO.48–51, or SEQ ID NO.74–77, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; and HCDR3 comprises any sequence of SEQ ID NO.9–12, or SEQ ID NO.52–55, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequence; and 2) The light chain variable region (VL) comprises LCDR1, LCDR2, and LCDR3; LCDR1 comprises any sequence of SEQ ID NO.13-23, SEQ ID NO.56-64, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; LCDR2 comprises any sequence of SEQ ID NO.24-31, SEQ ID NO.65-69, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; and LCDR3 comprises any sequence of SEQ ID NO.32-43, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequence; each of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 is encoded according to the common analytical methods of KABAT, Chothia, or IMGT.
2. The antibody or antigen-binding fragment thereof that specifically binds to human CLL-1 as described in claim 1, characterized in that, The antibody or its antigen-binding fragment comprises a heavy chain variable region (VL) and a light chain variable region (VH), wherein: (1) The heavy chain variable region comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 has any of the HCDR1 sequences shown in Table 1 below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; HCDR2 has any of the HCDR2 sequences shown below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; and HCDR3 has any of the HCDR3 sequences shown below or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below: Table 1. and, (2) The light chain variable region comprises LCDR1, LCDR2, and LCDR3, wherein LCDR1 has any of the LCDR1 sequences shown in Table 2 below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; LCDR2 has any of the LCDR2 sequences shown below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below; and LCDR3 has any of the LCDR3 sequences shown below, or a sequence having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the sequences shown below: Table 2 3. An antibody or antigen-binding fragment thereof that specifically binds to human CLL-1 as described in claim 1 or 2, characterized in that, The antibody or its antigen-binding fragment comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein, according to the analytical method of IMGT, The heavy chain variable region (VH) contains HCDR1, HCDR2, and HCDR3 selected from any of the following sequences (18)-(21) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences: (18) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.44, 48 and 52; (19) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences of SEQ ID NO.45, 49 and 53; (20) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.46, 50 and 54; (21) The HCDR1, HCDR2 and HCDR3 are respectively shown as sequences in SEQ ID NO.47, 51 and 55; Furthermore, according to the IMGT analysis method, the LCDR1, LCDR2, and LCDR3 contained in the light chain variable region (VL) are selected from any of the following sequences (22)-(33) or sequences having 1, 2, 3, or more amino acid insertions, deletions, and / or substitutions compared to the aforementioned sequences: (22) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.56, 65 and 32; (23) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.57, 65 and 33; (24) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.58, 66 and 34; (25) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.59, 66 and 35; (26) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.56, 67 and 36; (27) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.58, 66 and 37; (28) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.60, 65 and 38; (29) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.58, 66 and 39; (30) The LCDR1, LCDR2 and LCDR3 are respectively shown in the sequences of SEQ ID NO.61, 65 and 40; (31) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences of SEQ ID NO.62, 68 and 41; (32) The LCDR1, LCDR2, and LCDR3 are respectively in the sequences shown in SEQ ID NO. 63, 65, and 42; or (33) The LCDR1, LCDR2 and LCDR3 are respectively as shown in the sequences SEQ ID NO.64, 69 and 43.
4. An antibody or antigen-binding fragment thereof that specifically binds to human CLL-1 as described in any one of claims 1-3, wherein, The antibody or its antigen-binding fragment comprises a heavy chain variable region (VH) and a light chain variable region (VL), characterized in that, 1) The heavy chain variable region (VH) is selected from any of the sequences in SEQ ID NO.78 to SEQ ID NO.84 or the heavy chain variable region having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with the amino acid sequence thereon; 2) The light chain variable region (VL) is selected from any of the sequences in SEQ ID NO.85 to SEQ ID NO.97 or the light chain variable region having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with the amino acid sequence.
5. An antibody or antigen-binding fragment thereof that specifically binds to human CLL-1 as described in any one of claims 1-4, characterized in that, The antibody that specifically binds to human CLL-1 or its antigen-binding fragment is an scFv single-chain antibody, the scFv single-chain antibody comprising: a heavy chain variable region containing any amino acid sequence of SEQ ID NO: 78-84 or an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with it; a light chain variable region containing any amino acid sequence of SEQ ID NO: 85-97 or a light chain variable region having at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with it; and optionally a linker between the heavy chain variable region and the light chain variable region, the linker preferably being a linker peptide, the linker peptide preferably containing the amino acid sequence of SEQ ID NO:
132.
6. The specific human CLL-1 binding antibody or its antigen-binding fragment as described in claim 5, characterized in that, The scFv antibody comprises an antigen-binding region of any of the amino acid sequences SEQ ID NO: 98-114 or a variant thereof, or has at least 90%, 92%, 95%, 97%, 98%, 99% or higher identity with any of the sequences SEQ ID NO: 98-114.
7. The specific human CLL-1 binding antibody or antigen-binding fragment according to any one of claims 1-6, characterized in that, The antibody or antigen-binding fragment comprises a sequence containing a constant region of any one of antibodies IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, or IgD; preferably, it comprises a sequence containing a constant region of antibody IgG1, IgG2, IgG3, or IgG4.
8. The CLL-1 antibody or antigen-binding fragment according to any one of claims 1-7, characterized in that, The antibody or antigen-binding fragment further includes an antibody constant region sequence that does not contain the CH1 fragment.
9. The specific human CLL-1 binding antibody or antigen-binding fragment according to any one of claims 1-8, characterized in that, The antibody or antigen-binding fragment further comprises an antibody constant region sequence having CH2 and CH3 fragments, or the antibody or antigen-binding fragment further comprises an antibody Fc region; the antibody constant region or antibody Fc region is linked to the antibody or antigen-binding fragment by or without a linker peptide; Optionally, the antibody constant region or antibody Fc region is derived from camels, mice, rats, rabbits, sheep, or humans; Optionally, the antibody constant region or antibody Fc region is derived from IgG, IgA, IgM, IgD, or IgE.
10. The specific human CLL-1 binding antibody or antigen-binding fragment according to any one of claims 1-9, characterized in that, The antibody or antigen-binding fragment is: (1) Chimeric antibody or fragment thereof; (2) Humanized antibodies or fragments thereof; or, (3) Fully human antibodies or fragments thereof; Preferably, the antibody or antigen-binding fragment is selected from monoclonal antibodies, polyclonal antibodies, natural antibodies, engineered antibodies, monospecific antibodies, multispecific antibodies (e.g., bispecific antibodies), monovalent antibodies, multivalent antibodies, full-length antibodies, antibody fragments, naked antibodies, conjugated antibodies, humanized antibodies, fully human antibodies, Fab, Fab', F(ab')2, Fd, Fv, scFv, diabody, or single-domain antibodies.
11. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes an antibody or antigen-binding fragment of CLL-1 as described in any one of claims 1-10, or any combination thereof.
12. An expression vector comprising the isolated nucleic acid molecule of claim 11.
13. A host cell comprising the isolated nucleic acid molecule of claim 11 or the expression vector of claim 12; preferably, the host cell is a eukaryotic cell or a prokaryotic cell; more preferably, the host cell is derived from mammalian cells, yeast cells, insect cells, Escherichia coli and / or Bacillus subtilis; even more preferably, the host cell is selected from HEK293E or CHO cells.
14. A method for preparing the antibody or antigen-binding fragment according to any one of claims 1 to 10, characterized in that, The host cells of claim 13 are cultured under appropriate conditions, and antibodies or antigen-binding fragments or multispecific antigen-binding molecules are isolated.
15. A pharmaceutical composition, characterized in that, The composition comprises an antibody or antigen-binding fragment according to any one of claims 1-10, an isolated nucleic acid molecule according to claim 11, an expression vector according to claim 12, a host cell according to claim 13, or a product prepared by the method according to claim 14; preferably, the composition further comprises a pharmaceutically acceptable carrier, diluent, or adjuvant. Preferably, the pharmaceutical composition further comprises an additional antitumor agent.
16. Use of the antibody or antigen-binding fragment of any one of claims 1-10, the isolated nucleic acid molecule of claim 11, the expression vector of claim 12, the host cell of claim 13, or the product prepared by the method of claim 14, or the pharmaceutical composition of claim 15 in the preparation of a medicament for the prevention and / or treatment of CLL-1 mediated diseases; preferably, the CLL-1 mediated disease is myeloid leukemia, acute myeloid monocytic leukemia, acute monocytic leukemia, acute primary myeloid leukemia, chronic myeloid leukemia (CML), or myelodysplastic syndrome (MDS) related diseases.
Citation Information
Patent Citations
RNA-coded antibody
EP2101823B1
Novel nucleic acids and polypeptides
US20050196754A1
Constant speed holding device
US4956778A
Biosynthetic antibody binding sites
US5091513A
Biosynthetic antibody binding sites
US5132405A