ETX-dependent diagnosis and therapy of multiple sclerosis
By detecting ETX-carrying Clostridium perfringens strains in the gut microbiome or blood, the method addresses the need for MS treatment by providing diagnostic and preventative strategies.
Patent Information
- Application Number
- JP2025546590
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-22
- Filing Date
- 2024-02-16
- Publication Date
- 2026-03-04
AI Technical Summary
There is a long-felt need to identify environmental triggers and causes of multiple sclerosis (MS) to develop effective therapeutic and preventative treatments, as the biologically plausible factors involved in lesion induction remain elusive.
A method for detecting the relative abundance of epsilon toxin (ETX)-carrying Clostridium perfringens strains in the gut microbiome or epsilon toxin binding to lymphocytes in the blood using PCR and flow cytometry, respectively, to guide MS diagnosis, prognosis, treatment, and prevention.
Enables confirmatory diagnosis, prognosis, and targeted treatment of MS by identifying subjects at risk, reducing symptoms, and preventing disease progression through specific interventions.
Smart Images

Figure 2026507509000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This patent application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 522,610, filed June 22, 2023, 63 / 446,677, filed February 17, 2023, and 63 / 446,593, filed February 17, 2023, the contents of each of which are incorporated herein by reference in their entirety.
[0002] Government support This invention was made with United States government support under Grant No. R21 RNS106581A awarded by the National Institutes of Health. The government has certain rights in this invention.
[0003] The present invention is generally directed to compositions and methods for identifying patient populations for the prevention and treatment of multiple sclerosis by detecting the relative abundance of strains of C. peifringens carrying the epsilon toxin gene (ETX) in the gut microbiome or by detecting epsilon toxin binding to lymphocytes in the blood. [Background technology]
[0004] Multiple sclerosis (MS) is a complex disease of the CNS. MS lesions are centered in postcapillary venules, and defects in blood-brain barrier (BBB) function are considered the earliest event in lesion evolution, paving the way for the invasion of myelin-autoreactive lymphocytes. MS disease initiation, and therefore lesion formation, is thought to require an environmental trigger in genetically susceptible individuals, but biologically plausible environmental factors involved in lesion induction remain elusive.
[0005] There is a long-felt and unmet need to identify the environmental triggers and causes of MS in order to develop new therapeutic and preventative treatments for MS. Summary of the Invention
[0006] Aspects of the invention disclosed herein include a method for the confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, prevention of MS, and / or treatment of MS in a human subject at risk for or suffering from MS, comprising: (a) obtaining a fecal sample from the human subject; and (b) detecting, in the obtained fecal sample, by polymerase chain reaction (PCR), optionally real-time quantitative polymerase chain reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-carrying C. perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject, wherein ETX-carrying C. perfringens strains are detected. If the abundance of C. perfringens strains is above the median level for healthy subjects, (i) a standard of care MS evaluation of the human subject is performed, (ii) the human subject is administered a standard of care MS therapy, and / or (iii) the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains; and if the abundance of ETX-carrying C. perfringens strains is at or below the median level for healthy subjects, (i) a standard of care MS evaluation of the human subject is not performed, (ii) the subject is not administered an MS therapy, and / or (iii) the subject is not administered an ETX or a composition comprising an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains. In some of these embodiments, the present invention provides methods for the confirmatory diagnosis of MS. In some of these embodiments, the present invention provides methods for the prognosis of MS. In some of these embodiments, the present invention provides methods for monitoring the progression of MS. In some of these embodiments, the present invention provides methods for monitoring the responsiveness of MS to treatment. In some of these embodiments, the present invention provides methods for the prevention of MS. In some of these embodiments, the invention provides methods for the treatment of MS. In some of these embodiments, the invention further provides methods for reducing at least one symptom of MS. In some of these embodiments, the invention further provides methods for reducing the severity of MS.In some of these embodiments, the invention further provides methods for preventing the progression of MS.
[0007] In some embodiments, if the relative abundance of ETX-carrying C. perfringens strains is greater than 0.001% (or, e.g., greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%), then (i) a standard of care MS evaluation of the human subject is performed, (ii) the human subject is administered a standard of care MS therapy, and / or (iii) the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains. In some embodiments, if the relative abundance of ETX-carrying C. perfringens strains is greater than 0.001%, the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or antigen-binding fragment thereof). In other embodiments, a standard of care MS therapy is administered instead of or in addition to an ETX-specific therapy. In other embodiments, a standard of care MS evaluation of the human subject is performed instead of, or in addition to, one or more of the treatment methods.
[0008] In some aspects of the present invention, provided herein are methods for detecting the relative abundance of epsilon toxin (ETX) gene-carrying strains of C. perfringens in a subject's gut microbiome, comprising: (a) obtaining a fecal sample from a human subject; and (b) detecting the abundance of epsilon toxin gene (ETX)-carrying strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens in the obtained fecal sample by polymerase chain reaction (PCR), optionally real-time quantitative polymerase chain reaction (RT-qPCR), wherein the relative abundance of ETX-carrying strains of C. perfringens is detected when the percentage of ETX-carrying C. perfringens strains is greater than 0.001% (or, for example, greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%).
[0009] In some embodiments, the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and if the abundance of ETX-carrying strains of C. perfringens is detected (e.g., greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%), (i) a standard of care MS evaluation is performed on the subject, (ii) the subject is administered a standard of care MS therapy, and / or (iii) the subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains. In some embodiments, if the abundance of ETX-carrying strains of C. perfringens is detected, the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or antigen-binding fragment thereof). In other embodiments, standard of care MS therapy is administered instead of or in addition to ETX-specific therapy. In other embodiments, standard of care MS evaluation of the human subject is performed instead of or in addition to one or more of the treatment methods.
[0010] In some embodiments, the method further includes selecting a subject for treatment with standard of care MS therapy, wherein the subject is at risk for or has MS, and the subject is selected for treatment when the relative abundance of ETX-carrying strains of C. perfringens is detected if the percentage of ETX-carrying C. perfringens strains is greater than 0.001%.
[0011] In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 0.001%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 0.01%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 0.1%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 0.5%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 1%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 5%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 10%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 15%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 20%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 25%. In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens in a human subject is greater than 30%.
[0012] In some embodiments, the abundance of ETX-carrying strains of C. perfringens is measured by detecting an ETX gene, and the abundance of ETX-carrying and non-ETX strains of C. perfringens is measured by detecting a gene present in ETX-carrying and non-ETX strains of C. perfringens. The gene present in ETX and non-ETX-carrying strains of C. perfringens can be a CPA gene or a 16S rRNA gene (e.g., a C. perfringens-specific 16S rRNA gene). In some embodiments, the gene is a CPA gene. In some embodiments, the gene is a 16S rRNA gene (e.g., a C. perfringens-specific 16S rRNA gene).
[0013] In some embodiments, the fecal sample obtained contains ETX-bearing strains of C. perfringens (ETX + , and CPA + and / or C. perfringens 16S rRNA + ) and non-ETX strains of C. perfringens (ETX - , and CPA + and / or C. perfringens 16S rRNA + In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens (ETX) in the obtained fecal sample is measured. + and CPA + ) and non-ETX strains of C. perfringens (ETX - and CPA + In some embodiments, the relative abundance of ETX-carrying strains of C. perfringens (ETX) in the obtained fecal sample is measured. + and C. perfringens 16S rRNA + ) and non-ETX strains of C. perfringens (ETX - and C. perfringens 16S rRNA + ) relative abundance is measured.
[0014] In certain embodiments, 2 -ΔΔCt The analysis was performed to determine whether non-ETX strains (e.g., ETX) were detected in the obtained fecal samples. - , and CPA + and / or C. perfringens 16S rRNA + ) versus ETX holdings (e.g., ETX + , and CPA + and / or C. perfringens 16S rRNA + ) and optionally, a 2 abundance greater than 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9. -ΔΔCt The value indicates the abundance of ETX-carrying C. perfringens strains and can optionally be set to 2 -ΔΔCt is greater than 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, then (i) a standard of care MS evaluation is performed on the subject, (ii) the subject is administered a standard of care MS therapy, and / or (iii) the subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or an ETX-carrying C. perfringens strain. -ΔΔCt is greater than 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or antigen-binding fragment thereof). In other embodiments, a standard of care MS therapy is administered instead of, or in addition to, an ETX-specific therapy. In other embodiments, a standard of care MS evaluation of the human subject is performed instead of, or in addition to, one or more of the treatment methods. In some of these embodiments, two -ΔΔCt In some of these embodiments, 2 -ΔΔCt In some of these embodiments, 2 -ΔΔCt In some of these embodiments, 2 -ΔΔCt is greater than 0.75.
[0015] In some embodiments, more than 1 -ΔΔCt values below 1, indicating a predominance of ETX-carrying C. perfringens strains with increased ETX plasmid copy numbers. -ΔΔCt Values indicate a higher percentage of non-ETX C. perfringen strains, and optionally, 2 -ΔΔCt If 2 is greater than 1, then (i) a standard of care MS evaluation is performed on the subject, (ii) the subject is administered a standard of care MS therapy, and / or (iii) the subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or an ETX-carrying C. perfringens strain. -ΔΔCt is greater than 1, the human subject is administered a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or antigen-binding fragment thereof). In other embodiments, a standard of care MS therapy is administered instead of, or in addition to, an ETX-specific therapy. In other embodiments, a standard of care MS evaluation of the human subject is performed instead of, or in addition to, one or more of the treatment methods.
[0016] In some embodiments, after the fecal sample is obtained and before the detection step (such as between step (a) and step (b)), the bacteria are separated from the non-microbial fecal material of the obtained fecal sample. In some embodiments, the bacteria are separated from the non-microbial fecal material by density gradient centrifugation.
[0017] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains by PCR (e.g., RT-qPCR) involves the use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.
[0018] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains by PCR (e.g., RT-qPCR) involves the use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and / or 5'-ACTCATCTCCCATAACTGCACT-3'.
[0019] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains by PCR (e.g., RT-qPCR) involves the use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT.
[0020] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains comprises detecting the relative abundance of CPA-carrying C. perfringens strains by PCR (e.g., RT-qPCR) comprising the use of at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.
[0021] In some embodiments, detecting the relative abundance of CPA-carrying C. perfringens strains by PCR (e.g., RT-qPCR) involves the use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TTACTGCCGTTGATAGCGCAGGAC.
[0022] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains comprises detecting the relative abundance of C. perfringens-specific 16S rRNA by PCR (e.g., RT-qPCR) comprising the use of at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'-GCAAGGGATGTCAAGTGT-3'.
[0023] In some embodiments, detecting the relative abundance of C. perfringens-specific 16S rRNA by PCR (e.g., RT-qPCR) involves the use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGAGTGCAGGAGAGGAGAGTGGAA.
[0024] In some embodiments, detecting the abundance of ETX-carrying C. perfringens strains comprises detecting the abundance of ETX-carrying C. perfringens strains in a obtained fecal sample by sequencing 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or The sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and an ETX-targeting primer pair comprising, consisting essentially of, or consisting of 5'-ACTCATCTCCCATAACTGCACT-3'; and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT, and (i) Sequence 5'-GCATGAGTCATAGTTGGGATGA-3' and a CPA targeting primer pair comprising, consisting essentially of, or consisting of 5'-CTGATGGATCATTACCCTCTGATAC-3' and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TGGGACTATGCAGCAAAGGTAACTTTAGC; and / or (ii) the sequence 5'-GCGAGACTGCCGGTAATAAA-3', and a universal 16S rRNA primer comprising, consisting essentially of, or consisting of 5'-TCGTTGTACCAGCCATTGTAG-3'; and Optionally, non-ETX strains (ETX) can be identified by PCR (e.g., RT-qPCR) involving the use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence CCCTTATGACCTGGGCTACACACG. - , and CPA + and / or C. perfringens 16S rRNA + ) ETX holdings (ETX + , and CPA + and / or C. perfringens 16S rRNA + In some embodiments, the CPA gene is used for comparison in detecting the relative abundance of the ETX gene. In some embodiments, the 16S rRNA gene is used for comparison in detecting the relative abundance of the ETX gene.
[0025] In some embodiments of the present invention, the method based on fecal sample ETX detection comprises (c) obtaining a blood sample from a human subject, and (d) detecting the presence and / or abundance of epsilon toxin (ETX) bound to lymphocytes in the obtained blood sample by flow cytometry, wherein optionally the lymphocytes are CD4 +lymphocytes, optionally detected by flow cytometry, further comprising isolating lymphocytes, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the fluorescently labeled anti-ETX antibody bound to the lymphocytes, and optionally proceeding to the performing and / or administering step only if the presence and / or abundance of epsilon toxin (ETX) bound to the lymphocytes is detected in the human subject (optionally, if more than 0.1%, 0.2%, 0.5%, or 1% of the lymphocytes are positive for ETX). In some embodiments, the performing and / or administering step is performed if more than 0.2% of the lymphocytes are positive for ETX. In some embodiments, the performing and / or administering step is performed if more than 0.5% of the lymphocytes are positive for ETX.
[0026] Aspects of the invention provided herein include a method for the confirmatory diagnosis of multiple sclerosis (MS), the prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, preventing MS, and / or treating MS in a human subject at risk for or suffering from MS, comprising: (a) obtaining a blood sample from the human subject; (b) detecting the presence of epsilon toxin (ETX) bound to lymphocytes in the obtained blood sample by flow cytometry, wherein optionally the lymphocytes are CD4+ +lymphocytes, and optionally, wherein detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX, wherein if the presence of ETX bound to the lymphocytes is detected, and optionally greater than 0.1%, 0.2%, 0.5%, or 1% of the lymphocytes are positive for ETX, then (i) performing a standard of care MS evaluation of the human subject, and (ii) administering a standard of care MS therapy to the human subject. and / or (iii) administering to a human subject a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains, and if the presence of ETX bound to lymphocytes is undetectable or substantially undetectable, or less than 0.1% or 0.2% of the lymphocytes are positive for ETX, then (i) not performing a standard of care MS evaluation on the human subject, (ii) not administering an MS therapy to the subject, and / or (iii) not administering to the subject a composition comprising ETX or an agent that directly or indirectly interferes with ETX-carrying C. perfringens strains. In some of these embodiments, the invention provides methods for the confirmatory diagnosis of MS. In some of these embodiments, the invention provides methods for the prognosis of MS. In some of these embodiments, the invention provides methods for monitoring the progression of MS. In some of these embodiments, the invention provides methods for monitoring the responsiveness of MS to treatment. In some of these embodiments, the invention provides methods for the prevention of MS. In some of these embodiments, the invention provides methods for the treatment of MS. In some of these embodiments, the invention further provides methods for reducing at least one symptom of MS. In some of these embodiments, the invention further provides methods for reducing the severity of MS. In some of these embodiments, the invention further provides methods for preventing the progression of MS. In some embodiments, the performing and / or administering step is performed when more than 0.2% of lymphocytes are positive for ETX.In some embodiments, the performing and / or administering step is performed when greater than 0.5% of lymphocytes are positive for ETX.
[0027] In some aspects, provided herein is a method for the detection of epsilon toxin in the blood of a subject, comprising: (a) obtaining a blood sample from the subject; (b) detecting the presence of epsilon toxin (ETX) bound to lymphocytes in the obtained blood sample by flow cytometry, wherein optionally the lymphocytes are CD4 + A method is provided in which the lymphocytes are lymphocytes, and optionally the detecting comprises isolating lymphocytes from blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX.
[0028] In some embodiments, the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and ETX bound to lymphocytes is detected, and optionally, if more than 0.1%, 0.2%, 0.5%, or 1% of the lymphocytes are positive for ETX, then (i) a standard of care MS evaluation is performed on the subject, (ii) the subject is administered a standard of care MS therapy, and / or (iii) the subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or an ETX-carrying C. perfringens strain. In some embodiments, the performing and / or administering step is performed if more than 0.2% of the lymphocytes are positive for ETX. In some embodiments, the performing and / or administering step is performed if more than 0.5% of the lymphocytes are positive for ETX.
[0029] In some embodiments, the method further includes selecting a subject for treatment with standard of care MS therapy, wherein the subject is at risk for or has MS, and the subject is selected for treatment when the relative abundance of ETX-carrying strains of C. perfringens is detected if the percentage of ETX-carrying C. perfringens strains is greater than 0.001%.
[0030] In some embodiments, the method of blood sample ETX detection further includes (c) obtaining a fecal sample from the human subject, and (d) detecting in the obtained fecal sample by real-time quantitative polymerase chain reaction (RT-qPCR) the abundance of epsilon toxin (ETX) gene-carrying C. perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject, optionally proceeding to the performing and / or administering step only if the abundance of ETX-carrying C. perfringens strains in the human subject is above the median level for healthy subjects or the relative abundance of ETX-carrying strains of C. perfringens in the human subject is greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%.
[0031] In some embodiments, prior to obtaining the sample (e.g., prior to step (a)), the human subject is selected, and the human subject has MS or one or more symptoms of MS. In some embodiments, any of the methods provided herein are contemplated to be performed on a subject who has been diagnosed with MS. In some embodiments, any of the methods provided herein are contemplated to be performed on a subject who exhibits one, two, three, or more symptoms of MS. In some embodiments, any of the methods provided herein are contemplated to be performed on a subject who has relapsed MS or is at risk for relapse or progression of MS. In other embodiments, any of the methods provided herein are contemplated to be performed on a subject at risk for MS.
[0032] In some embodiments, if the abundance of ETX-carrying C. perfringens strains is above the median level for healthy subjects and / or if the presence of ETX bound to lymphocytes is detected, the subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or ETX-carrying C. perfringens strains, thereby treating MS in the human subject, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS.
[0033] In some aspects of the present invention, provided herein are methods for treating multiple sclerosis (MS), reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS in a human subject, comprising: (a) selecting a subject for treatment, wherein the subject is at risk for or has MS, and the subject is selected for treatment when the relative abundance of ETX-carrying strains of C. perfringens is detected when the percentage of ETX-carrying C. perfringens strains is greater than 0.001%; and (b) administering to the subject a standard of care MS therapy and / or a composition comprising an agent that directly or indirectly interferes with ETX or ETX-carrying C. perfringens strains, thereby treating MS in the human subject, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS. In some embodiments, the relative abundance of ETX-bearing strains of C. perfringens is detected by (a) obtaining a fecal sample from a human subject, and (b) detecting in the obtained fecal sample the abundance of epsilon toxin gene (ETX)-bearing strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens by polymerase chain reaction (PCR), optionally real-time quantitative polymerase chain reaction (RT-qPCR). In some embodiments, the relative abundance of ETX-bearing strains of C. perfringens is detected by (a) obtaining a blood sample from the subject, and (b) detecting in the obtained blood sample the presence of epsilon toxin (ETX) bound to lymphocytes by flow cytometry, wherein optionally the lymphocytes are CD4+ +lymphocytes, optionally detected by detecting comprising isolating lymphocytes from blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX. In some of these embodiments, the present invention provides methods for treating MS. In some of these embodiments, the present invention provides methods for reducing at least one symptom of MS. In some of these embodiments, the present invention provides methods for reducing the severity of MS. In some of these embodiments, the present invention provides methods for preventing MS. In some of these embodiments, the present invention provides methods for preventing the progression of MS.
[0034] In some embodiments, standard of care MS assessments include magnetic resonance imaging (MRI), evoked potential testing, cerebrospinal fluid analysis, motor skill assessment, and / or blood tests.
[0035] In some embodiments, administering standard of care MS therapy to the subject comprises administering any one or more of the following therapies: (i) an injectable medication that is interferon beta-1a, interferon beta-1b, glatiramer acetate, ofatumumab, or peginterferon beta-1a; (ii) an oral medication that is teriflunomide, monomethyl fumarate, dimethyl fumarate, fingolimod, cladribine, siponimod, ponesimod, fingolimod, diroximel fumarate, or ozanimod; (iii) an infusion medication that is ublituximab, alemtuzumab, mitoxantrone, ocrelizumab, natalizumab-sztn, or natalizumab; and (iv) rituximab or a glucocorticoid.
[0036] In some embodiments, administering to a subject a composition comprising an agent that directly or indirectly interferes with ETX or an ETX-carrying C. perfringens strain comprises administering to the subject a composition comprising an effective amount of an agent that directly or indirectly interferes with ETX.
[0037] In some embodiments, the agent that directly or indirectly interferes with ETX is an inhibitor of ETX. In some embodiments, the inhibitor is an antibody to ETX or an antigen-binding fragment thereof. In some embodiments, the antibody to ETX or an antigen-binding fragment thereof (a) prevents ETX pore formation, (b) prevents cytotoxicity, (c) removes ETX from the circulation, (d) targets ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP), (e) neutralizes ETX, inhibits ETX binding to an ETX-binding receptor, and / or (f) inhibits or prevents ETX oligomerization. In some embodiments, the antibody to ETX or an antigen-binding fragment thereof neutralizes ETX, inhibits ETX binding to an ETX-binding receptor, and / or inhibits or prevents ETX oligomerization. In some embodiments, the antibody or antigen-binding fragment thereof against ETX (a) prevents ETX pore formation, (b) prevents cytotoxicity, (c) clears ETX from the circulation, and / or (d) targets ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP). In some embodiments, the antibody or antigen-binding fragment thereof is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody, or an antigen-binding fragment thereof. In some embodiments, the antibody is a monoclonal antibody or an antigen-binding fragment thereof. In some embodiments, the antibody is a human or humanized antibody, or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a nanobody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a dAb fragment, a single-chain antibody, a single-domain antibody, a VHH, a maxibody, a minibody, an intrabody, a diabody, a triabody, a tetrabody, a v-NAR, or a bis-scFv. In some embodiments, the antigen-binding fragment is a nanobody. In some embodiments, the antigen-binding fragment is an scFv. In some embodiments, the antigen-binding fragment is a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, an adAb fragment, or a VHH.
[0038] In some embodiments, the agent that directly or indirectly interferes with ETX is an inhibitor or antagonist of an ETX-binding receptor. In some embodiments, the ETX-binding receptor is expressed on endothelial cells of the blood-brain barrier (BBB). In some embodiments, the ETX-binding receptor is a tetraspan integral membrane receptor, and the tetraspan integral membrane receptor is myelin and lymphocyte protein (MAL) or hepatitis A virus cellular receptor 1 (HAVcR1). In some embodiments, the agent is a soluble ETX-binding receptor protein, and the soluble ETX-binding receptor protein is soluble HAVcR1, soluble MAL, or a fragment thereof.
[0039] In some embodiments, the agent that directly or indirectly interferes with ETX is a phage lytic enzyme specific for Clostridium perfringens type B or type D bacterial strains. In some embodiments, the phage lytic enzyme is muramidase (PlyCM) from strain ATCC 13124. In some embodiments, the agent is a probiotic strain that expresses a phage lytic enzyme specific for Clostridium perfringens type B and / or type D bacterial strains.
[0040] In some embodiments, the agent that directly or indirectly interferes with ETX is a vaccine against Clostridium perfringens types B and / or D, or the ETX produced therefrom.
[0041] In some embodiments, the agent that directly or indirectly interferes with ETX is a probiotic supplement containing C. peifringens type A or other bacterial types that can effectively outcompete Clostridium perfringens types B and / or D.
[0042] In some embodiments, the agent that directly or indirectly interferes with ETX is an antibiotic sufficient to kill C. perfringens types B and / or D.
[0043] In certain aspects, provided herein are compositions for preventing or treating multiple sclerosis (MS) in a patient in need thereof, comprising a pharmaceutically acceptable excipient and an effective amount of an agent disclosed herein, optionally wherein the composition is for preventing or treating MS following detection as disclosed herein.
[0044] In some embodiments of any of the methods provided herein, the PCR used is quantitative PCR. In some embodiments of any of the methods provided herein, the subject is a human subject suffering from or diagnosed with MS. In some embodiments, the subject is a human subject with one, two, three, or more symptoms of MS. In some embodiments, the subject is suspected of having MS (e.g., based on a preliminary evaluation or the presence of one or more symptoms). In other embodiments, the subject is a human subject at risk for MS. In some embodiments, the subject is a human subject experiencing a relapse of MS or at risk of relapse or progression.
[0045] In another aspect of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of epsilon toxin (ETX) gene-carrying strains of C. perfringens or their abundance, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.
[0046] In another aspect of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of epsilon toxin (ETX) gene-carrying strains of C. perfringens or their abundance, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and / or 5'-ACTCATCTCCCATAACTGCACT-3'.
[0047] In some embodiments, the compositions or kits provided herein further comprise a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT.
[0048] In yet another aspect of the present invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of CPA-carrying C. perfringens strains or their abundance, comprising at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.
[0049] In some embodiments, the compositions or kits provided herein further comprise a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TTACTGCCGTTGATAGCGCAGGAC.
[0050] In a further aspect of the present invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of C. perfringens-specific 16S rRNA or its abundance, comprising at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'-GCAAGGGATGTCAAGTGT-3'.
[0051] In some embodiments, a composition or kit provided herein further comprises a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGAGTGCAGGAGAGGAGAGTGGAA.
[0052] In some aspects of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of the relative abundance of epsilon toxin (ETX) gene-carrying strains of C. perfringens, comprising the sequence 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or The sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and an ETX-targeting primer pair comprising, consisting essentially of, or consisting of 5'-ACTCATCTCCCATAACTGCACT-3'; and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT, (i) Sequence a CPA targeting primer pair comprising, consisting essentially of, or consisting of 5'-GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TGGGACTATGCAGCAAAGGTAACTTTAGC; and / or (ii) the sequence 5'-GCGAGACTGCCGGTAATAAA-3', and Compositions or kits are provided that include a universal 16S rRNA primer comprising, consisting essentially of, or consisting of 5'-TCGTTGTACCAGCCATTGTAG-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence CCCTTATGACCTGGGCTACACACG.
[0053] In some embodiments, the compositions and kits provided herein are compositions (not kits). In some embodiments, any of the compositions (for PCR detection) described herein may further include one or more components necessary to conduct a PCR (e.g., RT-qPCR) reaction. Such components can be any components known in the art for this purpose or described herein. In some embodiments, the compositions and kits provided herein are kits. In some embodiments, any of the kits (for PCR detection) described herein may include designated components (such as primers and probes) together (e.g., mixed together) or separately (contained in separate containers, e.g., each individual primer in a separate container and / or each probe in a separate container) in one or more containers, and may further include instructions for use. [Brief explanation of the drawings]
[0054] [Figure 1-1](A) Prevalence of etx in the gut microbiome of people with MS and healthy controls. Workflow of the experimental setup. Fecal bacteria were purified by density gradient centrifugation in Nycodenz solution. (B) Prevalence of etx in the gut microbiome of people with MS and healthy controls. Initial screening by PCR targeting the 3'-terminal sequence of etx (542 bp and 390 bp (not shown)) detected a more frequent presence of etx in people with MS compared to HC. [Figure 1-2] (C) The prevalence of etx in the gut microbiome of individuals with MS and healthy controls is shown. Subsequent PCR targeting the 5'-terminal sequence (679 bp) of etx confirmed the initial detection results. Detection of the C. perfringens-specific 16S rRNA and chromosomally located alpha-toxin (cpa / plc) genes present in all C. perfringens strains confirms the source of the etx gene. Red participant labels indicate negative results for etx from the initial screening (B), which served as negative controls in the confirmatory assay. Additional controls included reference strains including C. perfringens types B (ATCC3626), D (FD203), and F (ATCC12915). C. perfringens types B and D are etx-carrying strains, while type F is etx-negative. (D) The prevalence of etx in the gut microbiome of individuals with MS and healthy controls is shown. Statistical analysis of etx frequencies using Fisher's exact test. [Figure 2-1] (A) Representative amplification plot of etx abundance by TaqMan real-time PCR analysis showing the increase in etx abundance and etx-carrying strains in the fecal microbiota of MS. Notably, the system detected 15 etx-positive MS, fewer than those detected by standard PCR (19). [Figure 2-2](B) Etx abundance and an increase in etx-carrying strains in the fecal microbiota of MS. Statistical analysis of etx abundance by TaqMan real-time PCR analysis. Notably, the system detected 15 etx-positive MS, fewer than those detected by standard PCR (19). (C) Etx abundance and an increase in etx-carrying strains in the fecal microbiota of MS. Analysis of cpa abundance by TaqMan real-time PCR indicates an increase in the cpa gene in MS. (D) Etx abundance and an increase in etx-carrying strains in the fecal microbiota of MS. Analysis of cpa abundance by TaqMan real-time PCR indicates an increase in the cpa gene in MS. (E) Etx abundance and an increase in etx-carrying strains in the fecal microbiota of MS. Analysis of cpa abundance by TaqMan real-time PCR indicates an increase in the cpa gene in MS. [Figure 2-3](F) Increased etx abundance and etx-carrying strains in fecal microbiota of MS participants. Multiplex PCR reveals distinct strain compositions in fecal C. perfringens communities from etx-positive participants. Laboratory strains include etx-negative type A and three other strains shown in Figure 1. The orange asterisk indicates the presence of C. perfringens type E, defined by the presence of cpa and itx. The blue asterisk indicates cpb, which encodes beta-toxin, a virulence determinant for C. perfringens type C and is also carried by C. perfringens type B. (G) Analysis of the etx / cpa ratio by TaqMan real-time PCR using C. perfringens type B (ATCC3626) and type D (FD203) strains as calibrators for quantification of the etx-carrying / non-etx strain ratio in fecal microbiota from etx-positive participants. Quantification of etx / cpa ratios by 2-Act (g) and 2-ΔΔct (H) for type D cultures as calibrators. Estimation of the maximum percentage of etx-carrying / non-etx strains in etx+HC and MS (I). This estimation assumes that participants with 2-ΔΔct (type D) greater than 1 contain 100% etx-carrying strains. Mann-Whitney test (non-Gaussian distribution). The black lines in graphs B, C-E, and H indicate the median. [Figure 3-1](A) Characterization of the patient-derived strain SHDS0050 and its comparison to environmental and laboratory ETX-producing strains are shown. A circular map of the etx+ plasmid (pSHDS0050) from the MS patient-derived strain SHDS0050 is shown with a black backbone. Proteins of hypothetical and unknown function ORFs are black, those involved in conjugation are purple, toxin ORFs are red, DNA methylases are green, transposases and recombinases are gray, ribonucleases are pink, plasmid replication ORFs are blue, conserved etx plasmid ORFs are red, and ABC transporters are magenta (represented here in grayscale). The plasmid shows two transposases, Tn3 and IS1151 upstream of etx, followed by two IS256s, and a downstream mutagenic transposase. (B) Characterization of the patient-derived strain SHDS0050 and its comparison to environmental and laboratory ETX-producing strains are shown. GView BLAST Atlas map comparing the circular chromosome of pSHDS0050 as the reference genome to the D-type strains CN3842, FU17, and NCTC8346, and the B-type strains ATCC3626 and NCTC3110. The D-type chromosomes are shaded blue, while the B-type chromosomes are shaded red. The coloring of the regions for each genome indicates where there are BLAST hits in the reference genome. Empty slots in the query genome indicate where there are no matching BLAST hits in the reference genome, indicating unique regions in the reference genome. This indicates that the SHDS0050 genome has regions that are distinct from other etx-encoding strains. [Figure 3-2](C) Characterization of patient-derived strain SHDS0050 and its comparison to environmental and laboratory ETX-producing strains. Linearized plasmid map comparison of pSHDS0050 with the etx plasmids of two type D collection strains, pFU17etx and pNCTC8346etx, and two type B strains, pATCC3626etx and pNCTC3110etx. The linearized maps are color-coded in the same manner as in A, with different transposase ORFs having different pattern filling. The three type D strains share the same gene content, sharing many of the same genes as both type B strains; however, the type B strains are larger and have genes not present in their type D counterparts. [Figure 3-3] Characterization of the patient-derived strain SHDS0050 and its comparison to environmental and laboratory ETX-producing strains are shown. (D) Western blot analysis of pro-ETX (pETX) production from C. perfringens strains grown overnight in TGY broth. 10 ng of pETX spiked into PBS or broth was used as a positive control. Broth alone was used as a negative control. (E) Sensitivity of CHO cells expressing human MAL (hMAL-CHO) or a GFP control (GFP-CHO) to ETX produced by C. perfringens strains. To activate ETX, harvested broth was activated with trypsin. To determine whether cell death was ETX-mediated, activated broth was pretreated with a neutralizing anti-ETX antibody (.1004). Broth alone was used as a negative control. Cell death was determined by PI staining. n = 3. p < 0.0001 determined by two-way ANOVA with Sidak's multiple comparison test. [Figure 4-1] (A) Comparison of ETX-EAE and PTX-EAE in the spinal cord using a classical scoring scale. Time course of classical EAE scores in mice from the indicated experimental groups. Pertussis toxin (PTX, 5 μg / kg body weight), ETX at 50 ng / kg body weight (low, Lo), or 500 ng / kg body weight (high, Hi) were injected intraperitoneally on days 0 and 1 after CFA / M0G35_55 immunization. [Figure 4-2]Comparison of ETX-EAE and PTX-EAE in the spinal cord using a classical scoring scale is shown. (B) ETX-EAE mice exhibit demyelination in the spinal cord in a pattern similar to that of the PTX-EAE model. Mice immunized with CFA / PBS or CFA / M0G35_55 were followed by two injections of 5 μg / kg body weight PTX (top row) or 500 ng / kg body weight ETX (bottom row) on days 0 and 1 and then sacrificed on day 30. The left panel shows a representative slide from the lumbar spinal cord stained with Luxol Fast Blue (LFB) for visualization of myelin. Both PTX and ETX induce limited focal demyelination in the spinal column (red circle) and severe diffuse demyelination in the lateral and anterior funiculus (arrowhead). The dashed red line demarcates the lesion in the ventral white matter (WM) tract. Quantification of LFB intensity within the WM (center panel) reveals similar degrees of demyelination in both the ETX and PTX models. The right panel is a representative binary image generated by applying the same threshold across all treatment groups used for quantification. Myelin integrity is defined as a percentage by the ratio of LFB-stained area within the WM (pixels with thresholding) to the total area of the WM (pixels without thresholding). (C) Thin-section electron microscopy demonstrates demyelination and decompaction of the myelin sheath in ETX-EAE mice. Mice immunized with CFA / PBS or CFA / M0G35_55 were subsequently injected with ETX. Representative 75-nm-thick sections taken from the anterior funiculus of the lumbar spinal cord are shown. Red asterisks indicate demyelinated axons. The yellow rectangle illustrates ultrastructural changes in the myelin sheath at higher magnification. Cyan arrowheads point to myelin sheath segments in decompaction, yellow arrowheads point to torn myelin sheaths and debris, and red arrows point to enlarged spaces between axons (blue A) and myelin sheaths. Quantification of the number of unmyelinated axons per unit area (middle panel) and the percentage of unmyelinated axons in each field (right panel).Data in the left panel of A are means ± SEM; data in the right panel of A and B represent medians ± ranges; Kruskal-Wallis test (non-parametric); ns, not significant; n = 4 mice for control (PBS > PTX; PBS > ETX-Hi), n = 6 mice for MOG > EAE-Lo, and n = 8 mice for the groups containing MOG > PTX and MOG > ETX-Hi. Data in C represent means ± SD; unpaired t-test; ***p < 0.001; 24 fields from n = 2 mice. Scale bars, 1 mm in B, 500 nm (upper panel) and 200 nm (lower panel) in C. Similar results were achieved in two independently repeated experiments. [Figure 5] ETX-EAE is characterized by multifocal demyelination in the CNS. (A) ETX-EAE mice developed atypical EAE characterized by ataxia along with classic EAE symptoms defined by ascending paralysis. (B) ETX targets more widespread brain regions compared with PTX. ETX-EAE mice (left column) exhibit significantly more focal demyelinating lesions (arrowheads and red dashed circles) in the cerebellum (top row) and corpus callosum (cc, bottom row) within the WM tract when compared with PTX-EAE mice (right column). Asterisks indicate the cc. Black arrows indicate the border of the cc lesion, which is also enclosed by a red dashed rectangle. The corresponding locations in PTX-EAE mice (right column) are indicated by white arrows. (C) Quantification of lesions in the cerebellum and corpus collosum. Data in A are means ± SEM, and data in C represent medians ± range; Kruskal-Wallis test (non-parametric). n = 4 mice for control (PBS>PTX; PBS>ETX-Hi), n = 6 mice for MOG>ETX-Lo, and n = 8 mice for the groups containing MOG>PTX and MOG>ETX-Hi. ns, not significant. Scale bars, 1 mm in B and 100 p.m. in inserts. Similar results were achieved in two independently repeated experiments. [Figure 6-1]ETX-EAE mice show increased CD4+ lymphocyte infiltration in the cerebellum and thalamus compared with PTX-EAE. Sections from mice sacrificed 30 days after immunization with CFA / M0G35_55 followed by either ETX or PTX were immunostained with anti-CD4 antibodies. Representative photomicrographs of CD4 staining in the CNS are shown. The majority of CD4+ cells were found in the spinal cord (A), and to a much lesser extent in brain regions including the cerebellum (B) and thalamus (C). In the spinal cord (A), CD4+ cells are localized to the white matter (arrowheads). In the cerebellum (B) of ETX-EAE mice, heavily stained CD4+ cells are frequently found in the prominent perivascular cuff and surrounding parenchyma (area 1), indicating active infiltration. In contrast, CD4+ cells from the cerebellum of PTX-EAE mice are either localized in the perivascular space (region 1') or in a scattered manner (region 2'). High-magnification photomicrographs (1-s1) show the membrane localization of CD4 (brown staining, black arrows). CD4+ cells are also found in the white matter of the thalamus (C), including the optic tract (1, 1'), medial villus (2, 2'), and posterior commissure (3, 3') in ETX-EAE, but not in PTX-EAE mice (1'-3'), except for the optic tract. In each panel, the boxed area is shown at higher magnification below the corresponding image. Sections were counterstained with hematoxylin to reveal cell nuclei and overall morphology. ( [Figure 6-2]ETX-EAE mice show increased CD4+ lymphocyte infiltration in the cerebellum and thalamus compared with PTX-EAE. Sections from mice sacrificed 30 days after immunization with CFA / M0G35_55 followed by either ETX or PTX were immunostained with anti-CD4 antibodies. (D) Image J-generated binary plot of CD4+ distribution (black dots) in the white matter (WM) of the spinal cord (SC, orange arrows) and cerebellum (Ceb). The orange arrowhead in Ceb points to CD4+ cells that appear to be confined to a single layer in the meninges (region 1). Region 2 shows perivascular localization of CD4+ cells in Ceb. GM, gray matter. Scale bars: 1 mm (A and B, top row), 2 mm (C, top row), 200 p.m. (A and C, bottom row; B, middle row), 500 p.m. (D, left column), 100 p.m. (D, right column), 50 p.m. (B, lower left panel). (E) Statistical analysis of total CD4+ cell counts (E) and CD4+ perivascular cuff counts in three CNS regions. Data represent median ± range; Kruskal-Wallis test (non-parametric). ns, not significant. For control (control: CFA / PBS > PTX; ETX: CFA / PBS > ETX-Hi) and EAE groups (PTX-EAE: CFA / MOG > PTX; ETX-EAE: CFA / MOG / ETX-Hi), n = 4 and 8 mice, respectively. [Figure 6-3] ETX-EAE mice show increased CD4+ lymphocyte infiltration in the cerebellum and thalamus compared with PTX-EAE. Sections from mice sacrificed 30 days after immunization with CFA / MOG35_55 followed by either ETX or PTX were immunostained with anti-CD4 antibodies. Statistical analysis of total CD4+ cell counts (E) and CD4+ perivascular cuff counts in three CNS regions. Data represent median ± range; Kruskal-Wallis test (non-parametric). ns, not significant. n = 4 and 8 mice for control (control: CFA / PBS>PTX; ETX: CFA / PBS>ETX-Hi) and EAE groups (PTX-EAE: CFA / MOG>PTX; ETX-EAE: CFA / MOG / ETX-Hi), respectively. [Figure 7-1](A) Despite similar activation and comparable profiles of the transcription factor NJFKB p65 in the spinal cord in both models, ETX-EAE mice exhibit increased CD68+ microglia in the cerebellum compared with PTX-EAE mice. Representative sections from mice sacrificed 30 days after immunization with CFA / M0G35_55 followed by either ETX or PTX were immunostained with anti-CD68 antibody or anti-phosphorylated NFB p65 (Ser 276). The rectangular area for each condition in panel A is shown below the corresponding section at higher magnification. Ceb, cerebellum; SC, spinal cord. Scale bars represent 500 and 50 p.m. for the spinal cord and 1 mm and 20 p.m. for the cerebellum at low and high magnification, respectively. [Figure 7-2] Despite similar activation and comparable profiles of the transcription factor NJFKB p65 in the spinal cord in both models, ETX-EAE mice exhibit increased CD68+ microglia in the cerebellum compared to PTX-EAE mice. Statistical analysis of staining intensity for CD68 (A and B) and phosphorylated NFKB p65 (D and E) in the spinal cord (B and D) and cerebellum (C and E). Data represent median ± range; Kruskal-Wallis test (non-parametric). ns, not significant. n = 4 and 8 mice for control (control: CFA / PBS > PTX; ETX: CFA / PBS > ETX-Hi) and EAE groups (PTX-EAE: CFA / MOG > PTX; ETX-EAE: CFA / MOG / ETX-Hi), respectively. [Figure 8-1] Transcriptome analysis of ETX- and PTX-treated CNS endothelial cells from the spinal cord. (A) Principal component (PC) analysis of RNA-seq data based on the top 1000 most variable genes. Each symbol represents a biological replicate, and each component is indicated by the amount of variation it explains. (B) Venn diagram showing the degree of overlap between differentially expressed genes in ETX- or PTX-treated samples relative to the control (PBS). [Figure 8-2]Transcriptome analysis of ETX- and PTX-treated CNS endothelial cells from the spinal cord. (C) Correlation analysis of log2 fold changes between genes altered by both ETX and PTX displayed as a scatter plot, R2 = 0.96. (D) Heatmap of DEGs of interest associated with immune privilege (FDR < 0.10) in ETX or PTX. (E) Heatmap of DEGs induced by ETX and / or PTX reported by Munji (101) in the BBB dysfunction module. [Figure 8-3] Transcriptome analysis of ETX- and PTX-treated CNS endothelial cells from the spinal cord. (F) Heatmap of all DEGs by ETX and / or PTX relative to PBS control. (G) Selected pathways predicted to be activated in ETX-treated cells by Ingenuity Pathway Analysis (p<0.05 and z-score>=1) based on differentially expressed genes compared to PBS cells. [Figure 9] The geographic locations of participants in the HITMS are shown. Participants' geographic locations were mapped using the participant's home zip code at the time of fecal sample donation. Individual participants are shown in red for MS (A) and purple for HC (B). The majority of participants in both the MS and HC groups were from the New York metropolitan area. Each group had one participant from the Washington, DC metropolitan area. The MS group had one participant from Ithaca (not shown). The map was created using map lines. [Figure 10] The incidence of cpa is shown to be increased in MS. (A) PCR detection of cpa / plc (402 bp) from healthy controls (HC) and MS. (B) Distribution of HC and MS subjects by etx / cpa presence (+) and absence (-). Statistical analysis of the incidence of cpa in the overall HC and MS cohort (C) and etx+ / etx- subgroup (D). Fisher's exact test. [Figure 11]C. perfringens abundance is increased in MS. TaqMan real-time PCR analysis of C. perfringens abundance by simultaneously detecting C. perfringens-specific and universal 16s rRNA genes in healthy controls and MS (A). Quantification of the percentage of C. perfringens relative to total fecal bacteria from the overall cohort (B) or etx+ (C) and etx- (D) subgroups from HC and MS. The vertical lines in b depict the published range of C. perfringens percentage in the human fecal microbiota. Mann-Whitney test (non-Gaussian distribution). [Figure 12-1] (A) Analysis of etx abundance and etx-carrying strain composition across C. perfringens communities from etx+ healthy controls (HC) and MS participants. Representative amplification plots for simultaneous detection of etx and C. perfringens (CP)-specific 16S rRNA by TaqMan real-time PCR. Mann-Whitney test (non-Gaussian distribution). [Figure 12-2] (B) Analysis of etx abundance and etx-carrying strain composition across C. perfringens communities from etx+ healthy controls (HC) and MS participants. (C) Analysis of etx abundance and etx-carrying strain composition across C. perfringens communities from etx+ healthy controls (HC) and MS participants. Quantification of normalized etx abundance across type D strain cultures. (D) Analysis of etx abundance and etx-carrying strain composition across C. perfringens communities from etx+ healthy controls (HC) and MS participants. The black line in c indicates the median. [Figure 13-1]This figure shows that etx isolated from humans primarily harbors a small number of SNP variants within the receptor-binding domain, resulting in synonymous mutations. Reference sequences were from organisms isolated from ruminants, with one notable exception: a recently annotated sequence from whole-genome sequencing of a human fecal sample (Bethesda, MD: National Library of Medicine, US, National Center for Biotechnology Information;
[1988] . Accession number NZ CABPRN010000010.1). Analysis identified six SNP sites in the etx CDS. Of the six SNPs, four are located within the signal peptide, which is removed during export of the protoxin (proETX), and one is located at the C-terminus, which is removed upon activation via proteolytic cleavage. (A) Single-nucleotide variants (SNVs / SNPs) in the coding sequence (CDS) of the etx gene. The shaded line indicates the least conserved mutation among the six SNPs. (B) The scheme shows the location and key features of the mutations in ETX, with the upper numbers indicating the nucleotide position (see CDS) and the lower numbers indicating the amino acid residue. Notably, five SNPs, including four mutations in the signal peptide and one mutation in the C-terminus, are eliminated from the activated toxin (ETX). [Figure 13-2](C) etx isolated from humans primarily harbors a small number of SNP variants within the receptor-binding domain, resulting in synonymous mutations. The reference sequence was from an organism isolated from a ruminant, with one notable exception—a recently annotated sequence from whole-genome sequencing of a human fecal sample (Bethesda, MD: National Library of Medicine, US, National Center for Biotechnology Information;
[1988] . Accession number NZ CABPRN010000010.1). Analysis identified six SNP sites in the etx CDS. Of the six SNPs, four are located within the signal peptide, which is removed upon export of the protoxin (proETX), and one is located at the C-terminus, which is removed upon activation via proteolytic cleavage. Alignment of the etx reference sequence with the complete CDS reveals a region (nt 745–777) centered around site 762. Notably, the only etx sequence isolated from a human source (fecal sample) carries a minor variant at 762(G). The names of the reference sequences are organized as follows: gene name, GeneBank number / NCBI reference number, and the toxinotype of the C. perfringens form from which the etx was sequenced, followed by the animal from which the organism was isolated. [Figure 13-3](D) etx isolated from humans harbors a small number of SNP variants within the receptor-binding domain, primarily resulting in synonymous mutations. The reference sequence was from an organism isolated from a ruminant, with one notable exception—a recently annotated sequence from whole-genome sequencing of a human fecal sample (Bethesda, MD: National Library of Medicine, US, National Center for Biotechnology Information;
[1988] . Accession number NZ CABPRN010000010.1). Analysis identified six SNP sites in the etx CDS. Of the six SNPs, four are located within the signal peptide, which is removed during export of the protoxin (proETX), and one is located at the C-terminus, which is removed upon activation via proteolytic cleavage. Sequence alignment of PCR products from HITMS samples, centered around the nucleotide corresponding to 762. PCR products from two reference strains were also included in the sequencing and alignment analysis. Of note, two PCR products yielded short sequences that were sufficient to confirm etx homology but failed to cover site 762 and were excluded from the alignment analysis. HC, healthy control. [Figure 14-1]Figure 1 shows that ascending paralysis and ataxic behavior correlate better in ETX mice than in PTX mice. Clinical behaviors of classical (A and B) and atypical (C and D) EAE are shown. Time courses (A and C) and quantification of cumulative scores (B and D) are shown. Notably, atypical EAE (C and D) were not scored after day 21. As mice experienced ascending paralysis (A and B), assessing ataxia, a hallmark of atypical EAE, became increasingly imprecise and uncertain. Therefore, the endpoint for atypical EAE assessment in this experiment was set at day 21. The thick lines in the time course graphs (A and C) indicate the mean scores for all mice within the indicated group (PBS mean; PTX mean; ETX mean) at each daily observation time point. Thin lines delineate individual mice (PBS1-6; PTX1-12; ETX1-12). Note that one mouse from the control group, which received MOG35-55 in CFA but did not receive subsequent injections of either toxin, developed mild EAE. Data in B and D are median ± range; Kruskal-Wallis test (non-parametric). ns, not significant; ****p<0.0001. n = 6 and 12 mice for control (CFA / MOG>PBS) and experimental groups (CFA / MOG>PTX; CFA / MOG>ETX), respectively. [Figure 14-2]The correlation between ascending paralysis and ataxic behavior is better in ETX mice than in PTX mice. (E and F) Analysis of the correlation between classic and atypical EAE behavior in PTX-EAE mice (E, CFA / MOG>PTX) and ETX-EAE mice (F, CFA / MOG>ETX). Data included in E and F are from day 12 / 13, when at least one type of clinical phenotype (classical or / and atypical EAE) began, to day 21, when assessment of atypical EAE ended. Spearman correlation analysis: PTX-EAE, r(108) = 0.6463, p < 0.0001; ETX-EAE, r(120) = 0.7019, p < 0.0001. Orange lines indicate simple linear regression; PTX-EAE, R2 = 0.3147; ETX-EAE, R2 = 0.5352. Note that in E and F, many scores overlap, resulting in less data visualization indicated by the circles. (G) Representative photomicrographs of Luxol fast blue (LFB)-stained spinal cord (SC) and cerebellum (Ceb) from all three groups of mice. The orange line in the SC photomicrograph indicates the edge of the spinal cord and the border between the gray matter (GM) and white matter (WM). The arrow in the SC points to the demyelinated area in the anterior funiculus. The asterisk in the Ceb indicates demyelination in the white matter. Scale bar, 500 p.m. [Figure 15-1]We show that the ETX-EAE model is characterized by perivascular demyelination associated with lymphocytic infiltration. Representative sections from the spinal cord and cerebellum from MOG35_55-immunized mice following ETX injection were stained with Luxol fast blue (LFB), and consecutive slides were stained with hematoxylin and eosin (HE). Note that some of the same mice are also shown in Figures 4 and 5. In spinal cord photomicrographs, dashed pink lines in LFB-stained sections demarcate demyelinating lesions in the ventral WM, while dashed blue lines in HE-stained sections indicate areas of infiltrating inflammatory cells. Low-magnification photomicrographs with boxed high-magnification views show perivascular lesions (red asterisks) in the anterior funiculus (vf) and spinal column (dc). The arrowhead in vf points to the glia limitans or its basement membrane. The arrowhead points to the perivascular space. The cerebellum shows multiple perivascular demyelinating lesions (red asterisks). The boxed area showing the lesion is depicted below at higher magnification. The black line in le indicates the boundary between the granule cell layer (GL) and WM. [Figure 15-2] The ETX-EAE model is characterized by perivascular demyelination associated with lymphocytic infiltration. Quantification of LFB intensity and lymphocyte density from the same field of view within the WM region in the spinal cord (B) and cerebellum (C) shows that the two variables are negatively correlated by Pearson's correlation analysis. B, r(96) = -0.666, p < 0.0001; C, r(149) = -0.623, p < 0.0001. The best-fit curve (orange line) suggests that the LFB signal exponentially decays as lymphocyte density increases in the spinal WM (B), whereas the two variables are inversely proportional in the cerebellum (C). B, nonlinear regression based on a one-phase decay model, R2 = 0.463; C, simple linear regression, R2 = 0.389. Inserts in B and C are binary images generated by thresholding. Inserts: left panel, binary image from hematoxylin-stained section; right panel, binary image from LFB-stained section. [Figure 15-3]We demonstrate that the ETX-EAE model is characterized by perivascular demyelination associated with lymphocytic infiltration. Quantification of lymphocyte density (D) and LFB intensity (E) as a function of radial distance from the center of the perivascular lesion within the WM tract in the cerebellum confirms the inverse relationship between myelin content and the number of infiltrating lymphocytes. Arrows indicate the distance at which the perivascular cuff is located. The insert, showing a superimposed image of LFB and HE staining, illustrates the scheme for quantification. ML, molecular layer; GL, granular cell layer. Note that the ML and GL are excluded from the analysis. [Figure 16] Similar numbers of CD45-positive cells infiltrate lesions in the spinal cord and cerebellum from ETX-EAE and PTX-EAE mice. (A) Representative sections from mice sacrificed 30 days after immunization with CFA / M0G35_55 followed by either ETX or PTX were immunostained with an anti-CD45 antibody. Control mice were immunized with CFA / PBS followed by either ETX or PTX. The rectangular area for each condition in panel A is shown below the corresponding section at higher magnification. Ceb, cerebellum; SC, spinal cord. Scale bars represent 500 and 50 p.m. for the spinal cord and 1 and 20 p.m. for the cerebellum at low and high magnification, respectively. Statistical analysis of staining intensity for CD45 in the spinal cord (B) and cerebellum (C). Data represent median ± range; Kruskal-Wallis test (non-parametric). ns, not significant = 4 and 8 mice for the control (control: CFA / PBS > PTX; ETX: CFA / PBS > ETX-Hi) and EAE groups (PTX-EAE: CFA / MOG > PTX; ETX-EAE: CFA / MOG / ETX-Hi), respectively. [Figure 17-1]The ETX-EAE model shows a stronger correlation between demyelination and lymphocyte infiltration than the PTX-EAE model. Photomicrographs and binary images of the spinal cord (A) and cerebellum (B) from MOG35_55-immunized mice following PTX injection are shown. Note that the perivascular area in the cerebellum (enclosed by a rectangle) is shown at higher magnification to illustrate the morphology of the infiltrating cells. Binary images were generated by thresholding. Red, LFB staining; blue, hematoxylin staining. GL, granule cell layer; GM, gray matter; WM, white matter. Scale bars, 1 mm (A), 500 μm (B, lower magnification), 100 μm (B, higher magnification). [Figure 17-2] The ETX-EAE model shows a stronger correlation between demyelination and lymphocyte infiltration than the PTX-EAE model. Quantitative analysis of demyelination and lymphocyte infiltration in the spinal cord (C) and cerebellum (D). Pearson's correlation analysis reveals a negative correlation between demyelination and lymphocyte infiltration in both the spinal cord (A) and cerebellum (B). C, r(105) = -0.615, p < .0001; D, r(154) = -0.406, p < .0001. The best-fit curve (orange line) suggests that the correlation between the two variables is much weaker in the cerebellum (D) compared to the spinal cord (C). C, nonlinear regression based on a one-phase decay model, R2 = 0.395; D, simple linear regression, R2 = 0.165. (E) Slope analysis of myelin intensity versus infiltrating cell density in the spinal cord and cerebellum from ETX-EAE and PTX-EAE mice. [Figure 18-1]Figure 1 shows that ETX does not alter MOGp-specific CD4 T cell cytokine responses during active EAE immunization. (A) Schematic of the experiment and analysis of MOGp-specific T cell responses. Naive MOGp-specific CD4 T cells (2D2) were pre-transferred into recipient wild-type B6 mice. 24 hours later, active EAE was induced by subcutaneous immunization with complete Freund's adjuvant (CFA) and MOGp35-55, followed by intraperitoneal injections of PBS, 10 μg / kg pertussis toxin (PTX), or 500 μg / kg epsilon toxin (ETX) immediately after immunization and 48 hours later. Clinical scores were followed until the onset of clinical disease in PTX- and ETX-treated mice (B). On day 14 after immunization, single-cell suspensions were isolated from the indicated tissues and analyzed by flow cytometry for the frequency of cytokine-producing 2D2 T cells (Thy1.11 at dissection (C) or restimulated ex vivo with MOGp35_55 for 72 h separately to determine antigen-recall-induced cytokine production (D). Data in B–D are pooled from two independent experiments with similar results (n = 10 mice / group pooled from N = 2). Results are shown as mean ± SD. Statistics were calculated by two-way analysis of variance (ANOVA) with Sidak's multiple comparison test. The resulting P values were reported as ns (not significant), *p < 0.05, or **p < 0.01. [Figure 18-2]Figure 1 shows that ETX does not alter MOGp-specific CD4 T cell cytokine responses during active EAE immunization. (A) Schematic of the experiment and analysis of MOGp-specific T cell responses. Naive MOGp-specific CD4 T cells (2D2) were pre-transferred into recipient wild-type B6 mice. 24 hours later, active EAE was induced by subcutaneous immunization with complete Freund's adjuvant (CFA) and MOGp35-55, followed by intraperitoneal injections of PBS, 10 μg / kg pertussis toxin (PTX), or 500 μg / kg epsilon toxin (ETX) immediately after immunization and 48 hours later. Clinical scores were followed until the onset of clinical disease in PTX- and ETX-treated mice (B). On day 14 after immunization, single-cell suspensions were isolated from the indicated tissues and analyzed by flow cytometry for the frequency of cytokine-producing 2D2 T cells (Thy1.11 at dissection (C) or restimulated ex vivo with MOGp35_55 for 72 h separately to determine antigen-recall-induced cytokine production (D). Data in B–D are pooled from two independent experiments with similar results (n = 10 mice / group pooled from N = 2). Results are shown as mean ± SD. Statistics were calculated by two-way analysis of variance (ANOVA) with Sidak's multiple comparison test. The resulting P values were reported as ns (not significant), *p < 0.05, or **p < 0.01. [Figure 19] Figure 1 shows real-time quantitative PCR (RT-qPCR) analysis of MAL gene expression in primary human lymphocytes. MAL transcript levels were quantified in cDNA obtained from isolated populations of CD4+, CD8+, and B cells. Relative MAL expression in isolated CD4+, CD8+, and B cells. B-actin was used as the reference gene. **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. Results are expressed as the mean values from triplicates. [Figure 20-1]These results show that ETX binds to CD4+, CD8+, and CD19+ lymphocytes with a preference for CD4+ cells. PBMNCs were incubated with 0 nM or 50 nM pETX-647 for 2 hours, and binding to CD4+, CD8+, and CD19+ cells was examined by flow cytometry. An example of the gating strategy for examining CD4+, CD8+, and CD19+ lymphocytes is depicted in Supplementary Figure S2. Representative scatter plots (A) and histogram analysis (B) of pETX-647 fluorescence intensity from three separate donors performed in triplicate. [Figure 20-2]This figure shows that ETX binds to CD4+, CD8+, and CD19+ lymphocytes with a preference for CD4+ cells. PBMNCs were incubated with 0 nM or 50 nM pETX-647 for 2 hours, and binding to CD4+, CD8+, and CD19+ cells was examined by flow cytometry. An example of the gating strategy for examining CD4+, CD8+, and CD19+ lymphocytes is depicted in Supplementary Figure S2. Representative scatter plots (A) and histogram analysis (B) of pETX-647 fluorescence intensity from three separate donors performed in triplicate. (C) PBMNCs were incubated with 25 nM pETX-647 for the indicated time points, and binding was determined by flow cytometry. Results are expressed as the percentage of CD4+, CD8+, or CD19+ cells positive for pETX (pETX+%). Results are the average of three separate donors performed in triplicate. (D) PBMNCs were incubated with 0 nM or 1 nM pETX-647 for 2 hours. Results are expressed as the percentage of CD4+, CD8+, or CD19+ cells positive for pETX (pETX+%). Results are the average of triplicate data from two separate donors. (E) Anti-ETX antibodies inhibit binding to CD4+ cells. PBMNCs were pretreated with medium containing 50 nM pETX-647 for 30 minutes with or without an antibody known to block ETX binding, and then treated for 2 hours and assessed by flow cytometry. The percentage of pETX+ lymphocytes was assessed when cells were incubated without pETX-647 (CT), with pETX-647 (pETX), or with pETX-647 pretreated with anti-ETX antibody (pETX+anti-ETX). (F) PBMNCs were treated with 25 nM unlabeled pETX or ETX for 2 hours. Untreated cells were used as a control. pETX and ETX binding to lymphocytes was determined using affinity-purified anti-ETX polyclonal rabbit antibody and PE-conjugated anti-rabbit IgG. Results are expressed as the percent CD4+ lymphocytes positive for ETX or pETX (% positive). Data points are the mean values of triplicate runs.*p<0.05, **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. [Figure 21-1] Figure 1 shows that ETX binding to lymphocytes is time- and dose-dependent. To determine whether ETX binding is dose-dependent, PBMNCs were incubated with the indicated doses of pETX-647 for 15 minutes (A) and 120 minutes (B), and pETX-647 binding was determined by flow cytometry. Results are expressed as the percent pETX-positive (pETX+%) cells for CD4+, CD8+, and CD19+ cells. *p<0.05 and **p<0.001 compared to the untreated control (0 nM), as determined by one-way ANOVA with post-hoc Tukey HSD test. For a more detailed analysis of p values for all pETX doses, see Supplementary Table S1. To determine whether ETX binding is time-dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, or 50 nM pETX-647 for the indicated time points (C–E). The percentage of ETX-positive cells was determined by flow cytometry for CD4+ cells (C), CD8+ cells (D), and CD19+ cells (E). *p<0.01 and **p<0.001 were determined by one-way ANOVA with post-hoc Tukey HSD test. All results are the average of three donors performed in triplicate. [Figure 21-2]Figure 1 shows that ETX binding to lymphocytes is time- and dose-dependent. To determine whether ETX binding is dose-dependent, PBMNCs were incubated with the indicated doses of pETX-647 for 15 minutes (A) and 120 minutes (B), and pETX-647 binding was determined by flow cytometry. Results are expressed as the percent pETX-positive (pETX+%) cells for CD4+, CD8+, and CD19+ cells. *p<0.05 and **p<0.001 compared to the untreated control (0 nM), as determined by one-way ANOVA with post-hoc Tukey HSD test. For a more detailed analysis of p values for all pETX doses, see Supplementary Table S1. To determine whether ETX binding is time-dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, or 50 nM pETX-647 for the indicated time points (C–E). The percentage of ETX-positive cells was determined by flow cytometry for CD4+ cells (C), CD8+ cells (D), and CD19+ cells (E). *p<0.01 and **p<0.001 were determined by one-way ANOVA with post-hoc Tukey HSD test. All results are the average of three donors performed in triplicate. [Figure 22-1] Figure 1 shows that active ETX kills human CD4+ cells in a dose- and time-dependent manner. Cell viability was assessed via flow cytometry using PI inclusion. PI-positive cells are considered dead. Results are expressed as the number of PI-positive cells out of the total specific population and expressed as percent cell death (% cell death). Representative scatter plots of total lymphocytes stained with PI to assess cell death after 4 hours of treatment with 0 nM (A) or 50 nM (B) ETX. (C) Total lymphocyte cell death after 4 hours of incubation with the indicated ETX doses. [Figure 22-2]Figure 1 shows that active ETX kills human CD4+ cells in a dose- and time-dependent manner. Cell viability was assessed via flow cytometry using PI inclusion. PI-positive cells were considered dead. Results are expressed as the number of PI-positive cells among the total specific population and expressed as the percentage of cell death (% cell death). (D) Lymphocytes were pretreated with medium containing 50 nM ETX for 30 minutes with or without a neutralizing anti-ETX antibody, followed by treatment for 2 hours. Cell death was assessed by PI inclusion via flow cytometry. Percent cell death when lymphocytes were treated with medium alone (CT), medium containing 50 nM ETX (ETX), medium pretreated with anti-ETX antibody (CT + anti-ETX), and medium containing 50 nM ETX pretreated with anti-ETX antibody (ETX + anti-ETX). (E) Percent cell death of different lymphocyte subsets at the indicated ETX doses 4 hours after treatment. [Figure 22-3] Figure 4 shows that active ETX kills human CD4+ cells in a dose- and time-dependent manner. Cell viability was assessed via flow cytometry using PI inclusion. PI-positive cells were considered dead. Results are expressed as the number of PI-positive cells among the total specific population and expressed as percent cell death (% cytosis). (F) Cell death was assessed in CD4+ cells 4 hours after treatment with the indicated ETX doses. These data are the same as those depicted in Figure 4E, but with different statistical analyses. ETX-induced cell death of CD4+ cells is dose-dependent. (G) ETX-induced cytotoxicity in CD4+ cells over time at various time points. Data are the mean values from one donor in triplicate. Data are representative of multiple donors. *p<0.05, **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. [Figure 23]ETX cytotoxicity is mediated by pore formation in PBMNCs. (A) PBMNCs were treated with the indicated doses of ETX for 2 hours. Cells were washed extensively in PBS, and whole-cell lysates were examined via Western blot for detection of the 150 kDa oligomerized pore complex or the 27 kDa bound ETX monomer. Total, whole-cell lysates from rMAL-CHO cells treated with 1 ng of ETX and with or without 50 nM ETX were used as controls. (B) PBMNCs were treated with 50 nM ETX for the indicated time points and examined via Western blot for detection of the 150 kDa oligomerized pore complex or the 27 kDa bound monomer. [Figure 24-1]Depicts confirmation of MAL gene expression in primary human lymphocytes from publicly available datasets. (A) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via RNAseq analysis. Data were obtained from the Human Protein Atlas (available online) and exported to Microsoft Excel and Prism 7 software. Results are expressed as pTPM and are from six separate donors. Cells were isolated via FACS sorting. CD4 cells include naive CD4 cells (CD3+, CD4+CD45RA+), memory CD4 cells (CD3+, CD4+, CD45RA-), and Tregs (CD3+, CD4+, CD35+CD127low, CCR4+, CD25+). CD8 cells include naive CD8 cells (CD3+CD4-CD8a+CD45RA+) and memory CD8 cells (CD3+CD4-CD8a+CD45RA-). CD19 cells include naive B cells (CD3-CD19+CD27-) and memory B cells (CD3-CD19+CD27+). **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. (B) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via RNAseq analysis. Data were obtained from the online data portal "Haemosphere" and exported to Microsoft Excel and Prism 7 software. Results are expressed as Log2(tpm+1) and are from three to five donors. Cells were isolated via FACS sorting. CD4 cells are CD3+CD19-CD56-CD4+. CD8 cells are CD3+CD19-CD56-CD8+. CD19 cells include naive B cells (CD3-CD19+CD27-) and memory B cells (CD3-CD19+CD27+). **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. (C) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via microarray analysis.Data were obtained from Haemosphere and exported to Microsoft Excel and Prism 7 software. Results are expressed as log2 and are from seven separate donors. CD4+, CD8+, and CD19+ cells were isolated using an automated magnetic labeling protocol. **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. [Figure 24-2]This figure depicts confirmation of MAL gene expression in primary human lymphocytes from a publicly available dataset. MAL gene expression in CD4+, CD8+, and CD19+ cells was determined via scRNA-seq analysis. Five pooled healthy donor PBMNC output files in csv format were exported from a single-cell gene expression dataset from 10xgenomics (dataset: 6K_PBMC from healthy donors, Cell Ranger 1.1.0, single-cell immune profiling dataset by 10xgenomics). The files were imported into SeqGeq v1.6 software (BD Biosciences) for scRNA-Seq data analysis. Quality control was performed in parallel, first eliminating doublets, housekeeping genes, and low-variance gene parameters, followed by the Seurat v3 plugin, which eliminated genes with outlying expression levels for phenotypic use. To avoid subpopulations not relevant to this comparison, the data were log-normalized and adjusted to a clustering resolution of 0.3. Seurat returned eight clustered populations, which were characterized and plotted on a t-SNE graphic (D). The output characterized t-SNE clusters into PBMNC cell types based on previous prediction models. (E) Unsupervised phenotypic confirmation by established marker genes was visualized by a mode-normalized heatmap. In addition to canonical phenotypic markers, MAL expression was included. (C) Lymphocyte clusters (CD4+, CD8+, and B cells) were then examined for relative MAL expression using the Violinbox plugin available from TomKellyGenetics on GitHub. Results are presented on a Log2Expression scale, assessed by a Mann-Whitney pairwise U test. **p<0.01, **p<0.0001 determined by a Mann-Whitney pairwise U test. [Figure 24-3](F) Depicts confirmation of MAL gene expression in primary human lymphocytes from a publicly available dataset. MAL gene expression in CD4+, CD8+, and CD19+ cells was determined via scRNA-seq analysis. Five pooled healthy donor PBMNC output files in csv format were exported from a single-cell gene expression dataset from 10xgenomics (dataset: 6K_PBMC from healthy donors, Cell Ranger 1.1.0, single-cell immune profiling dataset by 10xgenomics). The files were imported into SeqGeq v1.6 software (BD Biosciences) for scRNA-Seq data analysis. Quality control was performed in parallel, first eliminating doublets, housekeeping genes, and low-variance gene parameters, followed by the Seurat v3 plugin, which eliminates genes that deviate from the desired expression range for phenotypic use. To avoid subpopulations not relevant to this comparison, the data were log-normalized and adjusted to a clustering resolution of 0.3. Seurat returned eight clustered populations, which were characterized and plotted on a t-SNE graphic (D). The output characterized t-SNE clusters into PBMNC cell types based on previous prediction models. (E) Unsupervised phenotypic confirmation by established marker genes was visualized by a mode-normalized heatmap. In addition to canonical phenotypic markers, MAL expression was included. (C) Lymphocyte clusters (CD4+, CD8+, and B cells) were then examined for relative MAL expression using the Violinbox plugin available from TomKellyGenetics on GitHub. Results are presented on a Log2Expression scale, assessed by a Mann-Whitney pairwise U test. **p<0.01, **p<0.0001 determined by a Mann-Whitney pairwise U test. [Figure 25-1]Gating strategy for lymphocyte populations is shown. PBMNCs were isolated from peripheral blood using density gradient separation. Lymphocyte and monocyte populations were identified using FSC and SSC profiles. Lymphocyte populations were further characterized using cell surface markers to identify CD4+ cells (B), CD8+ cells (C), and CD19+ cells (D). Red lines indicate further analysis of gated populations. [Figure 25-2] (E) Gating strategy for lymphocyte populations is shown. PBMNCs were isolated from peripheral blood using density gradient separation. Example scatter plot of PBMNCs incubated with 0 nM or 50 nM pETX-647 for 1 hour. The same data was used in Figure 20A. Results are representative from three separate donors performed in triplicate. [Figure 26] STX binding to CD4+, CD8+, and CD19+ cells is shown. To demonstrate that pETX-647 binding to human primary lymphocytes was specific and not the result of nonspecific binding due to fluorescent labeling, PBMNCs were incubated with 50 nM Alexa Fluor 647-labeled Shiga toxin (STX-647) for 2 hours at 37°C. STX was labeled with the Alexa Fluor 647 Protein Labeling Kit (Life Technologies) according to the manufacturer's instructions. The labeled toxin was stored in 50% glycerol stocks (10 μM) at -20°C until use. Binding was determined by flow cytometry. Results are expressed as the percentage of CD4+, CD8+, or CD19+ cells positive for STX-647 (STX+%). **p<0.01 determined by one-way ANOVA with post-hoc Tukey HSD test. Results are the mean of quadruplicates from one donor. [Figure 27]Additional time points for dose-response assessment in lymphocyte subsets are indicated. To determine whether ETX binding was dose-dependent, PBMNCs were incubated with the indicated doses of pETX-647 for 30 and 60 minutes. pETX-647 binding was assessed by flow cytometry as previously described. Results are expressed as percent ETX-positive cells for each lymphocyte population: CD4+, CD8+, and CD19+. *p<0.05 and **p<0.001 compared to the untreated control (0 nM), as determined by ANOVA. Results are the average of three donors performed in triplicate. [Figure 28-1] (A) ETX detection on CD4+ lymphocytes. Peripheral blood mononuclear cells were isolated from whole blood and analyzed for bound epsilon toxin (ETX) via flow cytometry. Gating strategy for identification of lymphocytes (top) and CD4+ cells via flow cytometry. [Figure 28-2] (B) ETX detection on CD4+ lymphocytes. Peripheral blood mononuclear cells were isolated from whole blood and analyzed for bound epsilon toxin (ETX) via flow cytometry. Detection of bound ETX on CD4+ cells when stained with anti-ETX monoclonal antibody (right) versus isotype control antibody (IgG CT, left). Representative dot blots from a healthy control (HC) and three separate MS donors (MS1, MS2, and MS3). ETX binding to CD4+ cells was examined in 15 HC donors and 40 MS donors. [Figure 28-3] (C) Percentage of CD4+ cells positive for ETX isolated from HC or MS donors. Results are displayed as boxplots, with each dot representing an individual donor. p-values are determined by unpaired t-test. (D) Percentage of HC or MS donors with ETX+ CD4+ cells, as determined by the gating strategy shown. p-values were determined by Fisher's exact test. [Figure 28-4]Figure 1 shows ETX detection on CD4+ lymphocytes. Peripheral blood mononuclear cells were isolated from whole blood and analyzed for bound epsilon toxin (ETX) via flow cytometry. (E) ETX median fluorescence intensity of CD4 cells. Results are displayed as box plots, with each dot representing an individual donor. (F) Percentage of HC or MS donors with ETX+ CD4 cells, as determined by ETX median fluorescence intensity. p-values were determined by Fisher's exact test.
[0055] Some of the data and discussion provided herein is also provided in a publication by the inventors of this disclosure, Ma et al., 2023, J. Clin. Invest. 133(9):e163239, https: / / doi.org / 10.1172 / JCI163239, which is incorporated herein by reference in its entirety, including any supplementary material.
[0056] Some of the data and explanations provided herein are also provided in a publication by the inventors of this disclosure, Shetty et al., 2023, Toxins 15, 423, https: / / doi.org / 10.3390 / toxins15070423, which is incorporated herein by reference in its entirety, including any supplementary material. DETAILED DESCRIPTION OF THE INVENTION
[0057] Provided herein are compositions and methods for monitoring and therapy of subjects (e.g., human subjects) at risk for, suffering from, or diagnosed with multiple sclerosis (MS) based on detecting the relative abundance of the epsilon toxin (ETX) gene or ETX gene-carrying strains of C. perfringens and / or detecting epsilon toxin bound to lymphocytes.
[0058] In some aspects, provided herein are compositions and methods for detecting the relative abundance of ETX genes or ETX gene-carrying strains of C. perfringens in a subject's fecal sample, e.g., for identifying, monitoring (e.g., monitoring disease progression or disease treatment), preventing, treating, or assessing responsiveness to treatment in a subject with MS. In some embodiments, after obtaining the fecal sample and prior to detection, bacteria are separated from non-microbial fecal material by any method known in the art or described herein. In some embodiments, bacteria are separated from non-microbial fecal material by density gradient centrifugation. In some embodiments, provided herein are specific primers and fluorogenic probes for use in such compositions and methods, such as specific primers for detecting ETX genes and one or more other non-ETX-carrying strain-specific C. perfringens genes for purposes of quantifying the relative abundance of ETX gene-carrying strains of C. perfringens. In some embodiments, provided herein are certain quantitative methods (particularly quantitative PCR-based methods) for determining the abundance of an ETX gene (and thus an ETX gene-carrying strain of C. perfringens) relative to the abundance of another gene or genes (e.g., 16S or CPA genes) found in and specific for ETX gene-carrying and non-ETX C. perfringens. In some embodiments, the abundance of the ETX gene is compared to the abundance of another gene (e.g., 16S or CPA genes) found in and specific for C. perfringens types A, B, and D. In some embodiments, the abundance of the ETX gene is compared to the abundance of another gene found in and specific for all seven toxinotypes of C. perfringens, C. perfringens A-G. In some embodiments, the abundance of the ETX gene is compared to the abundance of another gene found in and specific for C. perfringens types A, B, and D. + CPA + or ETX + 16S rRNA + The abundance of C. perfringens strains was -CPA + or ETX - 16S rRNA + The abundance of ETX gene-positive C. perfringens strains is compared to the abundance of C. perfringens strains. In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.001% are treated for MS as described herein (e.g., using standard of care MS therapies, and / or using therapies that target the ETX gene or protein, the interaction of ETX with its receptor (such as MAL), or using therapies that target C. perfringens type B and / or D strains). In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.01% are treated for MS as described herein. In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.1% are treated for MS as described herein. In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 1% are treated for MS as described herein. In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40% are treated for MS as described herein. In some embodiments, MS patients with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 2% are treated for MS as described herein. -ΔΔCt The analysis was performed using C. perfringens strains that do not carry ETX (e.g., ETX - , CPA + and / or ETX - , 16S + ) relative to the abundance of ETX gene-carrying C. perfringens strains (e.g., ETX + , CPA+ and / or ETX + , 16S + ) is used to quantify the abundance of. In some embodiments, 2 -ΔΔCt If the value is greater than 0.1 (indicating the presence of an ETX gene-carrying strain), the MS patient is treated for MS as described herein (e.g., using standard of care MS therapies, and / or using therapies that target the ETX gene or protein, the interaction of ETX with its receptor (such as MAL), or using therapies that target C. perfringens type B and / or type D strains). In some embodiments, 2 -ΔΔCt If the value is greater than 0.25 (indicating the presence of an ETX gene carrier), the MS patient is treated for MS as described herein. -ΔΔCt If the value is greater than 0.5%, indicating the presence of an ETX carrier, the MS patient is treated for MS as described herein. -ΔΔCt If the value is above 0.75%, which indicates the presence of an ETX carrier strain, the MS patient is treated for MS as described herein. -ΔΔCt If the value is greater than 1 (indicating a predominance of ETX-carrying strains), the MS patient undergoes an MS evaluation (e.g., a standard of care MS evaluation) and / or the MS patient is treated for MS as described herein (e.g., using a standard of care MS therapy, and / or using a therapy that targets the ETX gene or protein, the interaction of ETX with its receptor (such as MAL), or using a therapy that targets C. perfringens type B and / or type D strains).
[0059] In some aspects, provided herein are compositions and methods for detecting epsilon toxin protein bound to lymphocytes in a subject's blood sample, for example, to identify, monitor (e.g., monitor disease progression), prevent, treat, or evaluate response to treatment in a subject with MS. Any method for detecting proteins bound to cells known in the art can be used to detect epsilon toxin protein bound to lymphocytes. In some embodiments, provided herein are specific methods (particularly flow cytometry methods) for determining the presence and / or abundance of epsilon toxin bound to lymphocytes. In some embodiments, the lymphocytes are CD4+ lymphocytes. In some embodiments, determining the presence and / or abundance of epsilon toxin bound to lymphocytes comprises (i) isolating peripheral blood mononuclear cells from whole blood, and (ii) detecting bound ETX via flow cytometry. In some embodiments, detecting cell-bound ETX via flow cytometry involves incubating isolated cells with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence of CD4+ cells positive for ETX. Such a method can be used as an alternative method for detecting ETX or in conjunction with methods for identifying ETX genes or ETX gene carriers in fecal samples. Blood sample detection methods can be used to verify the relevance of ETX to MS, monitor lymphocyte-bound ETX, and / or monitor the effects of treatments designed to remove ETX from the blood (e.g., anti-ETX neutralizing antibodies, neutralizing nanobodies, or soluble neutralizing receptors) described herein. In some embodiments, if isolated lymphocytes (e.g., CD4+ lymphocytes) positive for ETX are detected, or if more than 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.75%, 1%, or 1.5% of the isolated lymphocytes are positive for ETX, the subject is treated for MS as described herein.In some embodiments, initial detection of an ETX gene carrier (e.g., in a subject suffering from MS) (e.g., using qPCR of a stool sample) is followed by administration of an ETX-specific treatment and further monitoring of treatment progress (e.g., by detection of lymphocyte-bound ETX in the blood).
[0060] In some aspects, provided herein is a specific therapy for use in MS patients after detecting either an elevated abundance of the ETX gene or an ETX gene-carrying C. perfirgens strain (e.g., in a fecal sample) or an elevated abundance of lymphocyte-bound epsilon toxin (e.g., in plasma serum). In some embodiments, the specific therapy is an agent that directly or indirectly interferes with ETX, such as an ETX inhibitor or antagonist. In some embodiments, the ETX inhibitor or antagonist is an antibody against ETX or an antigen-binding portion thereof (e.g., a neutralizing antibody (NAB), a neutralizing nanobody, an antibody that inhibits or prevents ETX oligomerization, or an antibody that inhibits or prevents ETX binding to an ETX-binding receptor on a cell). In some embodiments, the specific therapy is an agent that directly or indirectly interferes with the ETX-binding receptor, such as an inhibitor or antagonist of the ETX-binding receptor (MAL or HAVcR1). In some embodiments, the inhibitor or antagonist of the ETX-binding receptor is an antibody or antigen-binding portion thereof against the ETX-binding receptor (e.g., an antibody that inhibits or prevents ETX from binding to the ETX-binding receptor on a cell). In some embodiments, a soluble ETX-binding receptor protein, such as soluble HAVcR1, soluble MAL, or a fragment thereof, can also be used. In some embodiments, the specific therapy is an agent that directly or indirectly interferes with ETX gene-carrying C. perfringens strains. In some of these embodiments, the C. perfringens strain can be targeted or killed by an antimicrobial agent, such as an antibiotic. In some embodiments, antimicrobial treatment can be followed by fecal microbiome transfer using healthy donors with a defined gut microbiome classification. In some of these embodiments, C. perfringens strains can be selectively targeted or killed by a bacteriophage endolysin specific for C. perfringens type B or type D bacterial strains, alone or in conjunction with another therapy (e.g., an epsilon toxin-specific antibody or nanobody or soluble epsilon toxin receptor).Other ETX-specific therapies can also be used after the detection method described herein. Therapies can be selected based on whether ETX is detected in the subject's intestinal microbiome or blood, and therefore whether it is desirable to target ETX. For example, detection of ETX gene-carrying C. perfringens in a fecal sample can be followed by administering MS therapy targeting the intestinal microbiome (e.g., C. perfringens strains can be targeted or killed by antibiotics, followed by fecal microbiome transfer). Similarly, detection of ETX bound to lymphocytes in a blood sample can be followed by administering MS therapy to the systemic circulation (e.g., parenteral administration of anti-ETX neutralizing antibodies).
[0061] In some aspects, any ETX-specific therapy can be used in conjunction with any standard of care MS therapy (e.g., oral or injectable therapy) known in the art or described herein. In other embodiments, only ETX-specific therapy is administered to an MS patient after detecting either an elevated abundance of the ETX gene or an ETX gene-carrying C. perfirgens strain (e.g., in a fecal sample) or an elevated abundance of lymphocyte-bound epsilon toxin (e.g., in plasma serum).
[0062] term Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Further, unless otherwise required by context, singular terms shall include plural forms and plural terms shall include the singular form. In general, the nomenclature and techniques utilized in connection with chemistry, biochemistry, molecular biology, pharmacology, and toxicology are those well known and commonly used in the art.
[0063] All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing the devices, compositions, formulations, and methodologies that are described in the publications and that might be used in connection with the present disclosure.
[0064] When values are described as ranges, it is understood that such disclosure includes disclosure of all possible subranges within such ranges, as well as specific numerical values that fall within such ranges, whether or not a specific numerical value or specific subrange is explicitly recited.
[0065] As used herein, the term "about" refers to a range of + / - 10% of the stated value. In some embodiments, the range is + / - 5%, 3%, 2%, 1%, 0.5%, or 0.1% of the stated value.
[0066] "Patient," "subject," or "individual" are used interchangeably and refer to either a human or non-human animal. These terms include mammals such as humans, primates, livestock animals (including cows, pigs, etc.), companion animals (e.g., dogs, cats, etc.), and rodents (e.g., mice and rats).
[0067] "Administering" or "administration of" a substance, compound, or agent to a subject can be carried out using one of a variety of methods known to those of skill in the art. For example, a compound or agent can be administered intravenously, intraarterially, intradermally, intramuscularly, intraperitoneally, subcutaneously, intraocularly, sublingually, orally (by ingestion), intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g., through skin ducts). In some embodiments, administration is parenteral. In some embodiments, administration is enteral or oral. Administering can also be carried out, for example, once, multiple times, and / or over one or more extended periods of time. The appropriate method of administering a substance, compound, or agent to a subject will also depend, for example, on the age and / or physical condition of the subject, and the chemical and biological properties of the compound or agent (e.g., solubility, digestibility, bioavailability, stability, and toxicity).
[0068] The "effective amount" or "therapeutically effective amount" of a drug or agent is the amount of drug or agent that will have a therapeutic effect when administered to a subject. The complete therapeutic effect does not necessarily occur by administering one dose, but may occur only after administering a series of doses. Therefore, a therapeutically effective amount can be administered in one or more administrations. The exact effective amount required for a subject will depend, for example, on the subject's size, health and age, and the nature and severity of the condition being treated.
[0069] As used herein, the phrase "pharmaceutically acceptable carrier" refers to any pharmaceutically acceptable material, composition, or vehicle, such as a diluent, excipient, solvent, dispersion medium, coating, or encapsulating material useful in formulating a drug or agent for pharmaceutical or therapeutic use.
[0070] As used herein, the term "treating" a disease or condition in a subject refers to administering a pharmaceutical agent to a subject having or suspected of having a disease or condition (i.e., after onset of the disease or condition) to reduce at least one symptom of the disease or condition or prevent it from worsening. Desirable effects of treatment include reduced rate of progression, amelioration or alleviation of a pathological condition, and remission or improved prognosis of a particular disease, disorder, or condition. For example, an individual is successfully "treated" if one or more symptoms associated with a particular disease, disorder, or condition are reduced or eliminated.
[0071] As used herein, the term "preventing" a disease or condition in a subject refers to administering a pharmaceutical agent to a subject prior to the onset of a disease or condition, when administration of the pharmaceutical agent to a statistical sample prior to the onset of the disease or condition reduces the occurrence of the disease or condition in the treated sample relative to an untreated control sample, or delays the onset of, or reduces the occurrence or severity of, one or more symptoms of the disease or condition relative to an untreated control sample.
[0072] The terms "reduce," "reduced," "reduction," or "inhibit" are all used herein to mean a statistically significant amount of reduction. In some embodiments, "reduce," "reduction," or "reduce," or "inhibit" typically refers to a decrease of at least 10% compared to a reference level (e.g., the absence of a given ligand), and can include, for example, a decrease of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more.
[0073] Epsilon toxin and its detection in MS Intestinal dysbiosis is common in MS, but the specific species responsible are unknown. To address this knowledge gap, we used sensitive and quantitative PCR detection as described herein to surprisingly demonstrate for the first time that people with MS are more likely to harbor and exhibit a higher abundance of epsilon toxin (ETX)-producing strains of C. perfringens in their gut microbiome compared to healthy controls (HC).
[0074] C. perfringens ETX is a unique candidate environmental trigger for MS because this blood-borne neurotoxin specifically targets CNS endothelial cells, leading to disruption of BBB integrity. C. perfringens is a Gram-positive anaerobe classified into seven toxinotypes based on the production of one or more of six major toxins. Type B and D strains carry a plasmid-encoded ETX gene (etx). In the mammalian gastrointestinal tract, C. perfringens types B and D reside in the small intestine, where they spontaneously produce ETX during logarithmic-phase growth. Human exposure to C. perfringens strains is widespread because they are present in our food chain, pets, and are found in multiple ecological niches, including farm runoff, sewage, marine sediments, soil, and the gastrointestinal tracts of fish, birds, and mammals. As a spore-forming anaerobe, once C. perfringens enters the environment, it tends to persist due to the spores' resistance to heat, chemicals, radiation, and pressure. After environmental exposure and oral ingestion, colonization of the small intestine may depend on additional factors such as host genetics, microbiome composition, and prior antibiotic use.
[0075] ETX is a member of the erolysin family of pore-forming toxins. It is synthesized as a 32.9 kDa inactive protoxin, which is secreted in the intestine and cleaved by host serine proteases and carboxypeptidases, or occasionally by bacterial lambda proteases, into a 27 kDa active toxin, resulting in a 1000-fold increase in ETX toxicity. ETX monomers pass through the small intestine without causing injury or intestinal inflammation. Myelin and lymphocyte protein (MAL) has been identified as the receptor for ETX, required for binding and all known biological activities. MAL is localized in lipid rafts, and ETX binding to MAL brings the monomer into close proximity, favoring self-assembly into a heptameric prepore complex, which then inserts into the plasma membrane of host cells. In vivo, ETX induces BBB permeability. In the bloodstream, ETX has access to all vascularized tissues, but its binding is restricted to CNS endothelial cells. This is because CNS endothelial cells are rich in expression of the ETX receptor, MAL. During both natural and experimental infection, ETX preferentially accumulates in the brain and kidneys of animals. In the brain, ETX selectively binds to brain endothelial cells, myelinated structures, and mature oligodendrocytes, the myelinating cells of the CNS. In the kidney, ETX preferentially binds to distal and collecting ducts. The preference of ETX for these specific cell types is most likely due to the expression of the ETX receptor, MAL.
[0076] Herein, we report that isolates from MS patients produced functional ETX and possessed a gene architecture typical of highly conjugative plasmids. Thus, an association between ETX-producing strains of C. perfringens in clinical samples and MS was identified. The data provided herein also demonstrate that individuals with MS have an increased abundance of ETX-producing strains of C. perfringens in their gut microbiome compared with healthy controls, and that ETX is a key component of the MOG. 35 ~ 55We disclose that in the context of active immunization with ETX, ETX is sufficient to induce multifocal inflammatory demyelination; in active EAE, ETX-induced inflammatory demyelination more closely resembles the lesion distribution observed in MS when compared to the traditional PTX model; and in CNS endothelial cells, ETX induces the expression of genes known to overcome CNS immune privilege.
[0077] In an active immunization model of experimental autoimmune encephalomyelitis (EAE), ETX can replace pertussis toxin (PTX) when PTX is used to overcome CNS immune privilege. In contrast to PTX-induced EAE, in which inflammatory demyelination is primarily restricted to the spinal cord, ETX-induced EAE caused demyelination in the corpus callosum, thalamus, cerebellum, brainstem, and spinal cord, more similar to the neuroanatomical lesion distribution in MS. Transcriptional profiling from CNS endothelial cells revealed ETX-induced genes known to play a role in overcoming CNS immune privilege. Together, the findings presented herein suggest that ETX-producing strains of C. perfringens are biologically plausible pathogens in MS, causing inflammatory demyelination in the context of circulating myelin autoreactive lymphocytes.
[0078] Also disclosed herein is the demonstration that ETX preferentially binds to human lymphocytes expressing increased levels of the myelin and lymphocyte protein MAL. Using flow cytometry, ETX binding was determined to be time- and dose-dependent, being highest for CD4+ cells, followed by CD8+ and then CD19+ cells. Similar results were observed with ETX-induced cytotoxicity. To determine whether ETX's preference for CD4+ cells is related to MAL expression, MAL gene expression was determined by RT-qPCR. CD4+ cells had the highest amount of Mal gene expression, followed by CD8+ and CD19+ cells. The data indicate that primary human cells are sensitive to ETX binding, supporting the hypothesis that MAL is the primary receptor for ETX. ETX binding to human lymphocytes suggests that ETX may influence the immune response in multiple sclerosis.
[0079] Herein, we describe ETX as a possible environmental cause of multiple sclerosis (MS) in humans and methods for its detection. Multiple sclerosis patients are more likely to be colonized by ETX-producing C. perfringens toxinotypes than healthy controls, and in colonized individuals, the relative abundance of ETX-producing strains is significantly higher in MS patients than in HCs. Histopathologically active MS lesions are characterized by overt blood-brain barrier permeability, demyelination, and robust CNS immune infiltration. Using both in vitro and in vivo models, we demonstrate herein that ETX specifically causes BBB permeability, demyelination, and loss of CNS immune privilege. This specificity is mediated by the selective expression of the ETX receptor, myelin, and lymphocyte protein MAL, on CNS endothelial cells, mature oligodendrocytes, and human lymphocytes. Pathogenic lymphocytes, including both T cells and B cells, play a critical role in MS pathogenesis. Data are provided herein showing the binding of ETX to primary human lymphocytes expressing MAL.
[0080] ETX detection method In certain aspects of the present invention, provided herein are methods for identifying a subset of subjects suffering from MS for epsilon toxin therapy. In some aspects, provided herein are methods for detecting and quantifying the epsilon toxin gene from a fecal sample. In some embodiments, the method comprises obtaining a fecal sample from the subject and detecting the relative abundance of epsilon toxin gene (ETX)-carrying C. peifringens in the fecal sample from the subject. Such detection methods are known in the art and include quantitative PCR techniques such as real-time quantitative polymerase chain reaction (RT-qPCR). In some embodiments, the abundance of the ETX gene is determined relative to a control gene, such as the cpa / plc gene common to all C. perfringens strains and / or a 16S ribosomal RNA gene specific to C. perfringens. A subject is identified as suitable for epsilon toxin therapy if the abundance of the ETX gene in the fecal sample exceeds a predetermined threshold derived from a fecal sample of a healthy control. For illustrative purposes, the percentage of ETX-carrying strains (relative abundance) based on quantification of etx and C. perfringens-specific 16S was determined in Table 1.
[0081] In some embodiments, the method can be used to identify patients who should be treated with an anti-epsilon toxin strategy. Notably, although detecting the epsilon toxin gene in healthy controls is rare, it is sometimes present. Thus, detection of the gene alone is not sufficient to support the pathophysiological role of this agent in MS, but it can be used to identify patients or subpopulations of patients suffering from MS who may benefit from epsilon toxin therapy. In some embodiments, patients subjected to the detection methods described herein have already been diagnosed with MS or are suspected of having MS. In some embodiments, patients subjected to the detection methods described herein have been diagnosed with MS (e.g., using standard of care MS evaluation methods such as those described herein). In some embodiments, patients subjected to the detection methods described herein are suspected of having MS (e.g., based on a preliminary evaluation or the presence of one or more symptoms). In some embodiments, patients subjected to the detection methods described herein exhibit one, two, three, or more symptoms of MS.
[0082] In some embodiments, detection of the ETX gene alone may support evaluation of such patients for MS (e.g., diagnostic evaluation for MS) in cases of unidentified or asymptomatic MS, or who are otherwise at risk for developing a form of MS, using criteria known in the art (e.g., the McDonald criteria) and methods known in the art (e.g., medical history, neurological examination, magnetic resonance imaging (MRI), cerebrospinal fluid analysis, motor skill assessment, and blood tests).
[0083] As disclosed herein, quantitative PCR was used to determine that the abundance of the epsilon toxin gene, and thus epsilon toxin-encoding strains of C. perfringens, was dramatically elevated in subjects with MS relative to healthy controls. In some embodiments, a threshold or "cutoff" value may be used to define patients recommended for epsilon toxin therapy. For illustrative purposes, the percentage (relative abundance) of etx-carrying strains based on quantification of etx and C. perfringens-specific 16S was determined as provided in Table 1. Table 1: Relative abundance of etx genes in healthy controls and MS patients (etx / 16s) [Table 1]
[0084] etx +The median percentage of healthy controls with β-glucanase (β-glucanase) has been determined by the inventors to be 0.001%, while the median value among multiple sclerosis patients has been determined by the inventors to be 42.5%. Thus, in some embodiments, the threshold for epsilon toxin treatment of a subject is based on a predetermined value derived from healthy controls. In some such embodiments, subjects tested as potential candidates for epsilon toxin treatment have, are suspected of having, or are at risk of having MS. In some such embodiments, the subject has a clinical diagnosis of MS. In some embodiments, the threshold for administering epsilon toxin treatment is greater than 0.001%. In some embodiments, the threshold for administering epsilon toxin treatment is at least 0.01% or greater than 0.01%. In some embodiments, the threshold for administering epsilon toxin treatment is at least 0.1% or greater than 0.1%. In some embodiments, the threshold for administering epsilon toxin treatment is at least 1% or greater than 1%. In some embodiments, the threshold for administering epsilon toxin therapy is at least or greater than 5%. In some embodiments, the threshold for administering epsilon toxin therapy is at least or greater than 10%.
[0085] In some aspects of the present invention, the presence of lymphocyte-bound epsilon toxin in a blood sample is determined. Lymphocyte-bound epsilon toxin can be detected using any method known in the art or described herein. In some embodiments, flow cytometry is used to detect lymphocyte-bound epsilon toxin, as described herein. Epsilon toxin is secreted by C. perfringens type B or D in the intestine as a 32.5 kDa protoxin, which is then cleaved by proteases in the intestine into an active toxin in the range of 27-29 kDa, which crosses the intestinal epithelium and enters the bloodstream. Once in the bloodstream, epsilon toxin can exist as a free toxin in the blood or can be bound to lymphocytes. In some embodiments, ETX primarily binds to CD4+ and / or CD8+ T cells. Free ETX is detected in the CNS microvasculature of the human brain, which is 15-25 meters deep. 2Because of its surface area of 1000 m, ETX is rapidly removed from the blood by specifically binding to CNS endothelial cells (e.g., luminal blood vessel walls), which represent a large sink for ETX binding. In addition, the kidneys also nonspecifically remove ETX from the blood via glomerular filtration, followed by uptake and degradation by proximal renal tubule cells. As a result of these two processes, the specific and nonspecific removal of ETX from the blood, detection of free ETX in plasma or serum is highly unlikely (unless sampling is performed nearly daily). However, the lifespan of lymphocytes in the blood is approximately 60 days. Therefore, as provided herein, ETX bound to lymphocytes is relatively long-lived in the blood compared to free ETX, and the use of flow cytometry to detect ETX bound to lymphocytes can be used to detect MS and monitor its treatment / progression. In some embodiments, such methods can be used to verify the relevance of ETX to MS or confirm an MS diagnosis. In certain embodiments, such methods may be used to monitor the progression of MS and / or the impact of treatments designed to remove epsilon toxin from the blood (e.g., neutralizing antibodies, neutralizing nanobodies, or soluble neutralizing receptors) by monitoring epsilon toxin bound to lymphocytes.
[0086] In some embodiments, a fecal sample ETX detection method and a blood sample ETX detection method are used together before a decision is made to proceed with an MS evaluation. In some embodiments, a fecal sample ETX detection method and a blood sample ETX detection method are used together before a decision is made to proceed with an MS treatment. In some embodiments, a fecal sample ETX detection method and a blood sample ETX detection method are used together before a decision is made to proceed with an ETX-targeted MS treatment. In some embodiments, a fecal sample ETX detection method and a blood sample ETX detection method are used together before a decision is made to proceed with a standard of care MS treatment.
[0087] In some embodiments, only a fecal sample ETX detection method or only a blood sample ETX detection method is used before a decision is made to proceed with an MS evaluation. In some embodiments, only a fecal sample ETX detection method or only a blood sample ETX detection method is used before a decision is made to proceed with an MS treatment. In some embodiments, only a fecal sample ETX detection method or only a blood sample ETX detection method is used before a decision is made to proceed with an ETX-targeted MS treatment. In some embodiments, only a fecal sample ETX detection method or only a blood sample ETX detection method is used before a decision is made to proceed with a standard of care MS treatment.
[0088] In some embodiments, the fecal sample ETX detection method and the blood sample ETX detection method can be used sequentially or at different stages of patient care or monitoring. For example, the fecal sample ETX detection method can be used in early diagnosis (such as a confirmatory diagnosis) or early cases where a treatment decision is made, followed by use of the blood sample ETX detection method to monitor the progression of MS and / or the impact of treatments designed to remove epsilon toxin from the blood.
[0089] Methods for preventing and treating MS when ETX is detected Any method known in the art for use in reducing or eliminating C. perfringens types B and / or D, or for use in inhibiting or antagonizing ETX or a receptor for ETX, can be used in the ETX-specific treatment methods provided herein.
[0090] In some embodiments, the present disclosure provides methods and techniques for modulating the gut microbiome to limit or eliminate C. perfringens, particularly toxinotypes B and D. C. perfringens has seven toxinotypes, namely, types A through G. Epsilon toxin-producing strains are type B and D strains. Type A strains, which are commensals in the human gut microbiome, encode cpa / plc, a hemolysin that functions to hydrolyze phosphatidylcholine and sphingomyelin. Type B and D strains encode and produce epsilon toxin. Type A strains are numerically dominant in the human gut microbiome, thereby limiting the ability of other toxinotypes, such as type B and D strains, to occupy this ecological niche. Aspects of the disclosed invention include methods for effectively eliminating or reducing the presence of C. perfringens type B and D strains. Without being bound by theory or methodology, such methods may include killing all C. perfringens strains with antibiotics. In some such embodiments, treatment is followed by fecal microbiome transfer from a healthy donor with a defined gut microbiome classification. In certain embodiments, C. perfringens is selectively killed by a bacteriophage endolysin specific for C. perfringens. Such endolysins are known in the art (e.g., Gervasi et al. Application of Lactobacillus johnsonii expressing phage endolysin for control of Clostridium perfringens. Lett Appl Microbiol. 2014 Oct;59(4):355-61; Ha et al. Clostridium perfringens Virulent Bacteriophage CPS2 and Its Thermostable Endolysin LysCPS2. Viruses 2018,10,251; Swift et al.A Thermophilic Phage Endolysin Fusion to a Clostridium perfringens-Specific Cell Wall Binding Domain Creates an Anti-Clostridium Antimicrobial with Improved Thermostability.Viruses 2015,7,3019-3034, Nariya et al.Identification and characterization of a putative endolysin encoded by episomal phage phiSM101 of Clostridium perfringens.Appl Microbiol Biotechnol 90,1973-1979(2011), Gervasi et al.Expression and delivery of an endolysin to combat Clostridium perfringens.Appl Microbiol Biotechnol 98,2495-2505(2014), and Shin et al.Characterization of thermostable bacteriophage CPD2 and its endolysin LysCPD2 as biocontrol agents against Clostridium perfringens. Food Sci Biotechnol 32, 2069-2077 (2023), each of which is incorporated herein by reference in its entirety. In some embodiments, treatment may be performed in conjunction with (before, simultaneously with, or after) administration of another epsilon toxin-specific therapy (e.g., an anti-ETX antibody or nanobody or soluble epsilon toxin receptor).
[0091] In other embodiments, the subject is treated with any MS therapy known in the art (e.g., standard treatment and off-label use of therapeutic agents).The subject can be treated with any MS therapy before, during, and after the detection methods described herein.In some embodiments, after detecting a clinically relevant level of relative abundance of ETX gene-carrying strains in the gut microbiome or the subject's fecal sample, or after detecting ETX bound to lymphocytes in the subject's blood sample, ETX-specific treatment is administered to the subject in combination with or simultaneously with standard treatment MS therapy.For example, but not limited to, such MS therapies include Avonex® (interferon beta-1a), Betaseron® (interferon beta-1b), Copaxone® (glatiramer acetate), Extavia® (interferon beta-1b), glatiramer acetate injection (generic equivalent of glatiramer acetate-Copaxone 20 mg and 40 mg doses), Glatopa® (glatiramer acetate-Copaxone Generic equivalents of 20 mg and 40 mg doses), Kesimpta® (ofatumumab), Plegridy® (peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio® (teriflunomide), Bafiertam™ (monomethyl fumarate), dimethyl fumarate (dimethyl fumarate - generic equivalent of Tecfidera), Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent® (siponimod), Ponvory™ (ponesimod), Tascenso May include ODT® (fingolimod), Tecfidera® (dimethyl fumarate), Vumerity® (diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab), Lemtrada® (alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko® (natalizumab-sztn), Tysabri® (natalizumab), rituximab, and / or glucocorticoids (oral or IV). In some embodiments of the invention, testing (e.g., qPCR of fecal samples), administering subsequent epsilon toxin treatment, and optionally monitoring treatment progress (e.g., detecting lymphocyte-bound toxin) (e.g., in subjects suffering from MS) is performed in conjunction with or simultaneously with any MS therapy known in the art (e.g., standard of care MS treatments and off-label use of therapeutic agents for MS).
[0092] Without being bound by any particular theory or methodology, a combination of therapies, for example, the therapies disclosed herein, can be administered to a subject who meets a predetermined threshold. Such a combination and administration of therapies can be, at least in part, informed by the methods disclosed herein. In some such embodiments, the combination (e.g., MS therapy and epsilon toxin treatment) can be administered simultaneously or sequentially in the same formulation or in separate formulations. Thus, subjects who receive such personalized treatment can benefit from the combined effect.
[0093] Additional disclosure of ETX-specific methods for preventing and treating MS In some embodiments, the present disclosure provides ETX-specific methods and agents for preventing or treating multiple sclerosis (MS) in a human subject in need thereof, following the step of detecting the relative abundance of ETX gene-carrying C. perfringens strains or detecting epsilon toxin bound to lymphocytes. In this regard, U.S. Patent No. 9,758,573 is specifically incorporated herein by reference in its entirety. All methods and agents for preventing or treating multiple sclerosis (MS), and in particular, all agents that directly or indirectly interfere with ETX or ETX-carrying C. perfringens strains disclosed in U.S. Patent No. 9,758,573, are specifically incorporated herein by reference in their entirety. In particular, U.S. Patent No. 9,758,573 is specifically incorporated herein by reference for its disclosure of various anti-ETX antibodies and antigen-binding fragments thereof.
[0094] Methods for treating a subject with MS with epsilon toxin therapy contemplated herein include a) directly or indirectly interfering with Clostridium perfringens type B or D epsilon toxin (ETX), b) directly or indirectly interfering with an ETX-interacting receptor such as MAL and / or viral cell receptor-1 (HAVcR-1), c) directly and / or indirectly interfering with the interaction of ETX with its linked receptor and downstream signaling activity, and / or d) directly or indirectly interfering with, inhibiting, or killing Clostridium perfringens.
[0095] In some embodiments, provided herein are methods for preventing or treating multiple sclerosis (MS) in a human subject in need thereof (e.g., a human subject with MS identified by the methods disclosed herein), comprising administering to the human subject an effective amount of a composition comprising epsilon toxin (ETX) produced by Clostridium perfringens type B or D bacterial strains, an ETX-binding receptor, or an agent that directly or indirectly interferes with the interaction of ETX with its binding receptor so as to inhibit or suppress the ETX-regulated receptor signaling pathway. In certain embodiments, the agent is an inhibitor of ETX or its binding receptor expressed on endothelial cells of the blood-brain barrier (BBB), blood-retinal barrier (BRB), oligodendrocytes, or myelin to which ETX is a ligand. In certain embodiments, the ETX-binding receptor is the tetraspan integral membrane receptor MAL expressed in myelin and by CNS endothelial cells, oligodendrocytes, and intestinal epithelial lymphocytes. In other embodiments, the ETX-binding receptor is the HAVcR-1 receptor.
[0096] In some embodiments, described herein are antibodies, or functional fragments thereof, e.g., antigen-binding fragments or portions thereof, against ETX or its binding receptors, e.g., MAL and / or HAVcR-1. Methods for generating antibodies against C. perfringens epsilon toxin (ETX) are well known in the art. Examples of antibodies and antibody responses to the epsilon toxin of C. perfringens are described, for example, in U.S. Pat. No. 9,758,573, Bentancor et al. (J Infect Dev Ctries 2009,3(8):624-627); Laine et al. (Veterinary Immunology and Immunopathology 125,2008,198-202); Uzal et al. (Veterinary Research Communications,23,1999,143-150); Percival et al. (Infection and Immunity,1990,2487-2492); Veschi et al. (Vet Immunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and Linden et al. Antibodies (2018 Dec;7(4):37), the entire contents of each of which are incorporated herein by reference.
[0097] Antigen-binding portions of anti-ETX antibodies are also provided herein. Examples of "antigen-binding portions" of antibodies include Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, dAb fragments (Ward et al., (1989) Nature 341:544-546), or single-chain antibodies. Antibody fragments also include single-domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs, and bis-scFvs (see, e.g., Hollinger and Hudson (2005) Nature Biotechnology 23:1126-1136). These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same manner as intact antibodies.
[0098] In some embodiments, the antibody is any known neutralizing antibody to an ETX protein. Examples of such ETX antibodies are described in U.S. Patent No. 9,758,573, Bentancor et al., Percival et al., Uzal et al., Veschi et al., and Linden et al. (2018), the entire contents of each of which are incorporated herein by reference. In certain embodiments, the neutralizing antibody to an ETX protein comprises an amino acid sequence that is at least about 71%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more identical to the polypeptide(s) of any known or later-developed ETX antibody.
[0099] In some embodiments, the ETX-specific therapeutic methods or steps described herein include those disclosed in U.S. Pat. No. 9,758,573, Bentancor et al. (J Infect Dev Ctries 2009,3(8):624-627); Laine et al. (Veterinary Immunology and Immunopathology 125,2008,198-202); Uzal et al. (Veterinary Research Communications,23,1999,143-150); Percival et al. (Infection and Immunity,1990,2487-2492); Veschi et al. (Vet Immunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and / or Linden et al. Antibodies (2018 No. 9,758,573 (2018 Dec;7(4):37) or any antibody or antigen-binding fragment thereof having a CDR, or a light chain variable domain or a heavy chain variable domain thereof. In some embodiments, provided herein is any one or more antibodies against ETX described in U.S. Pat. No. 9,758,573 or any antibody or antigen-binding fragment thereof having a CDR, or a light chain variable domain or a heavy chain variable domain thereof for use in any of ETX-specific treatment methods or steps. In some embodiments, provided herein is any one or more antibodies against ETX described in Linden et al. Antibodies (2018 Dec;7(4):37) or any antibody or antigen-binding fragment thereof having a CDR, or a light chain variable domain or a heavy chain variable domain thereof for use in any of ETX-specific treatment methods or steps.In some embodiments, provided herein are specific neutralizing antibodies against ETX, such as A5C12 described in Percival et al., 1990, mAb 4D7 and / or 5B7 described in McClain and Cover 2007, or any antibody or antigen-binding fragment having its CDRs, or light chain variable domain or heavy chain variable domain, for use in any of the ETX-specific treatment methods or steps.
[0100] The activity of an antibody in inhibiting the binding of ETX to its binding receptor can be determined by testing the antibody's ability to block the binding of ETX to its binding receptor. Without being bound by theory or methodology, a competitive ELISA assay in the presence of labeled ligand and / or antibody can be used.
[0101] In certain embodiments, the agents described herein include isolated polypeptides of ETX, its binding receptors MAL or HavR-1, and biologically active portions thereof. In some embodiments, the polypeptides of the present invention and biologically active portions thereof include soluble ETX-binding receptors, such as soluble MAL, which reduce the bioavailability of ETX and thus prevent ETX from binding to its cognate receptor in a subject.
[0102] In certain embodiments, the agents described herein are inhibitors of receptors to which epsilon toxin (ETX) binds, such as the MAL receptor. In certain embodiments, the agents described herein are inhibitors of receptors on the blood-brain barrier (BBB), such as HAVcR-1, which may also be therapeutic candidates for preventing and / or treating MS. Examples of such inhibitors are described in U.S. Patent No. 9,758,573 and Lewis et al. (Toxins 2010, 2, 1825-1847), the entire contents of which are incorporated herein by reference. Agents that have been found to potentially inhibit ETX binding to MAL or HAVcR-1 include, but are not limited to, mutant epsilon toxins (ETX-Y29E, ETX-Y30E, ETX-Y36E, and ETX-Y196E).
[0103] In certain embodiments, the agents described herein comprise a phage lytic enzyme specific for Clostridium perfringens bacterial strains type B or D. In some embodiments, such a phage lytic enzyme is muramidase PlyCM from strain ATCC 13124.
[0104] In certain embodiments, the agent is a probiotic supplement containing C. perfringens type A or other bacterial types that can effectively outgrow Clostridium perfringens types B or D without other C. perfringens toxinotypes. In certain embodiments, the probiotic supplement contains a C. perfringens type A bacterial strain because its toxinotype has been shown to outgrow C. perfringens type B. Typical bacterial strains included in probiotic supplement preparations include, but are not limited to, Lactobacillus acidophilus, L. bulgaricus, L. casei, L. fermentum, L. plantarum, Rhodoseudomonas palustris, Saccharomyces cerevisiae, and Steptococcus thermophiles.
[0105] In certain embodiments, the bacteriophage lytic enzymes described herein are for delivery in probiotic organisms by genetically engineering the organism to express enzymes that specifically lyse Clostridium perfringens.
[0106] In certain embodiments, the agent is a bacteriophage therapy. C. perfringens-specific bacteriophages eliminate C. perfringens in the host and have little or no effect on the healthy microbiota. C. perfringens-specific bacteriophages include, but are not limited to, members of the Siphoviridae and Podoviridae families with short, non-contractile tails.
[0107] In some such embodiments, the bacteriophage is bacteriophage ΦCPV1 and designated multivalent bacteriophage cocktails. In other embodiments, the bacteriophage comprises a phage lytic enzyme, e.g., a lysine, that is specific for C. perfringens types B and / or D. One such lysine, a muramidase from strain ATCC 13124 (designated PlyCM), has been identified. 32 Lysines specific to Clostridium perfringens can also be delivered to subjects through genetically engineered probiotics. Probiotic strains expressing lysine genes that specifically hydrolyze peptidoglycan or other components of the Clostridium perfringens cell wall can be used to kill Clostridium perfringens.
[0108] In certain embodiments, the agent is a vaccine against Clostridium perfringens type B or D bacterial strains, or the epsilon toxin (ETX) produced therefrom. Several anti-ETX vaccines have been developed and used to protect animals from Clostridium perfringens infection, and recombinant forms are in development. Vaccines against Clostridium perfringens bacterial strains and / or methods for producing same are well known in the art and / or are described, for example, in U.S. Patent No. 9,758,573 to Titball et al., U.S. Patent No. 6,403,094; Titball (Vaccine 27, 2009, D44-D47); and other publications, for example, Chandran et al. (Clinical and Vaccine Immunology, 2010, p. 1013-1016); and de la Rosa et al. (J ANIM Sci 1997, 75:2328-2334), the entire contents of each of which are incorporated by reference in their entirety.
[0109] In certain embodiments, the medicaments described herein include an antibiotic sufficient to kill C. perfringens bacterial strains type B or D. Antibiotics found to be effective against C. perfringens include, but are not limited to, penicillin, ampicillin, amoxicillin, metronidazole, erythromycin, and tylosin.
[0110] U.S. Patent No. 9,758,573 is also specifically incorporated herein by reference for its disclosure of methods of administering related therapeutic agents. U.S. Patent No. 9,758,573 is also specifically incorporated herein by reference for its disclosure of pharmaceutical compositions (including excipients).
[0111] Any of the agents described herein can be administered alone or in combination with any suitable second agent to enhance the effectiveness for the prevention and / or treatment of MS in humans and / or to reduce any symptoms associated with MS.
[0112] In some embodiments, administration of an epsilon toxin therapeutic agent is performed in combination (e.g., before, simultaneously with, or after) with any MS therapy known in the art (e.g., standard of care treatments and off-label use of therapeutic agents). For example, but not limited to, such MS therapies include Avonex® (interferon beta-1a), Betaseron® (interferon beta-1b), Copaxone® (glatiramer acetate), Extavia® (interferon beta-1b), glatiramer acetate injection (generic equivalent of glatiramer acetate-Copaxone 20 mg and 40 mg doses), Glatopa® (glatiramer acetate-Copaxone Generic equivalents of 20 mg and 40 mg doses), Kesimpta® (ofatumumab), Plegridy® (peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio® (teriflunomide), Bafiertam™ (monomethyl fumarate), dimethyl fumarate (dimethyl fumarate - generic equivalent of Tecfidera), Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent® (siponimod), Ponvory™ (ponesimod), Tascenso May include ODT® (fingolimod), Tecfidera® (dimethyl fumarate), Vumerity® (diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab), Lemtrada® (alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko® (natalizumab-sztn), Tysabri® (natalizumab), rituximab, and / or glucocorticoids (oral or IV).Purely for exemplary purposes, a subject suffering from or otherwise suspected of having MS may be identified as a candidate for epsilon toxin treatment by the methods disclosed herein (e.g., detection of the ETX gene in a fecal sample from the subject as described herein). Epsilon toxin treatment with the agent(s) and methods disclosed herein may be administered in conjunction with (e.g., before, simultaneously with, or after) any MS therapy known in the art (e.g., standard of care treatments for MS and off-label use of therapeutic agents). In some embodiments of the invention contemplated herein, treatment (e.g., epsilon toxin treatment and / or MS treatment) may be assessed or otherwise monitored by the methods disclosed herein (e.g., detection of lymphocyte-bound ETX in a blood sample from the subject as described herein).
[0113] Target / Patient Population and MS In some embodiments of any of the methods provided herein, the subject is a subject suffering from or diagnosed with MS. In some embodiments, the subject is a subject having one, two, three, four, five, or more symptoms of MS (e.g., any of the symptoms described herein). In some embodiments, the subject is suspected of having MS (e.g., based on a preliminary evaluation or the presence of one or more symptoms). In other embodiments, the subject is a subject at risk of MS. In some embodiments, the subject is a subject experiencing a relapse of MS. In some embodiments, the subject is a subject with MS at risk of relapse or progression. In particular, in some embodiments, the detection methods described herein are performed after the subject is selected based on one of the parameters mentioned above (such as a diagnosis of MS, suspicion of MS, or having one or more symptoms of MS). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. The subject's MS may be dramatic enough to physically injure the patient, or mild enough that the patient does not seek medical attention.
[0114] MS can be stratified into several common disease courses: (1) relapsing / remitting MS (RRMS), characterized by self-limiting attacks of neurological dysfunction that manifest acutely over the course of days to weeks, followed by periods of sometimes incomplete recovery over several months; (2) secondary progressive MS (SPMS), which evolves from RRMS but changes its clinical course to be characterized by a steady deterioration of function unrelated to acute attacks; (3) primary progressive MS (PPMS), characterized by a steady decline in function from onset without acute attacks; and (4) progressive / relapsing MS (PRMS), which also begins with a progressive course and involves occasional attacks superimposed on the progressive decline of function. Clinically isolated syndrome (CIS) is a further term describing the initial clinical onset of latent multiple sclerosis (MS), typically applied to young adults with episodes of acute or subacute onset, peaking very rapidly within 2–3 weeks. Recovery from attacks generally occurs within weeks to months of the peak of symptoms, although in rare cases some recovery can last for more than two years. MS can also be described as inactive MS, characterized by a fixed neurological deficit of variable magnitude.
[0115] Common symptoms of MS include, but are not limited to, sensory disturbances (e.g., in the limbs), abnormal sensations of pain motor dysfunction (such as gait or gait dysfunction), muscle weakness in one or more limbs, cramps, fatigue, optic nerve dysfunction (e.g., blurred vision due to optic neuritis), diplopia, pyramidal tract dysfunction, bladder dysfunction, bowel dysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxia. In some embodiments, the detection methods described herein are performed on MS patients with one or more of any of the symptoms known in the art or described herein or known in the art. In some embodiments, the detection methods described herein are performed on MS patients who have one or more of the following: sensory impairment (e.g., in the limbs), motor dysfunction (such as gait or gait dysfunction), muscle weakness in one or more limbs, spasms, fatigue, optic nerve dysfunction (e.g., blurred vision due to optic neuritis), diplopia, pyramidal dysfunction, bladder dysfunction, bowel dysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxia.
[0116] Patients with MS are typically evaluated using motor skill assessments known in the art and with MRI.Motor skill assessments include Expanded Disability Status Scale (EDSS), Scripps Neurological Rating Scale (SNRS), gait index, and Multiple Sclerosis Functional Composite Score (MSFC).The progression of MS can also be assessed by determining the attack rate and by magnetic resonance imaging (MRI), which can detect neurological lesions associated with MS (for example, new lesions, enhanced lesions, or combined specific active lesions).
[0117] In some embodiments, provided herein are methods for treating patients with MS, for example, individuals who have been diagnosed with MS and identified as suitable recipients of epsilon toxin therapy by the methods disclosed herein, comprising administering to the individual an agent disclosed herein. In some such embodiments, administering epsilon toxin therapy detectably improves or stabilizes one or more symptoms of MS in the patient. For example, but not limited to, epsilon toxin therapy may improve or stabilize MRI motor skill assessment scores and / or lesion assessments.
[0118] Specific Numbered Embodiments Particular embodiments of the present disclosure are described in the following numbered paragraphs. 1. A method for the diagnosis or prognosis of a human subject at risk for multiple sclerosis (MS), comprising: a) obtaining a fecal sample from the human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-carrying and alpha toxin gene (CPA)-carrying strains of C. perfringens in a fecal sample from the human subject by real-time quantitative polymerase chain reaction (RT-qPCR) to determine cycle thresholds for the ETX and CPA genes; -ΔΔCt The analysis showed that the samples contained non-ETX strains (CPA + , ETX - ) ETX holdings (CPA + , ETX + ), used to quantify the relative abundance of, and c) diagnosing a subject at risk for multiple sclerosis, comprising more than one of the following: -ΔΔCt values less than 1, indicating a predominance of ETX-encoding strains with increased ETX plasmid copy numbers. -ΔΔCt wherein the value indicates a higher percentage of non-ETX strains of C. perfringens. 2. A method for assessing a subject's risk of developing MS, comprising: a) obtaining a fecal sample from the human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-carrying and alpha toxin gene (CPA)-carrying strains of C. perfringens in a fecal sample from the human subject by real-time quantitative polymerase chain reaction (RT-qPCR) to determine cycle thresholds for the ETX and CPA genes; -ΔΔCt The analysis showed that the samples contained non-ETX strains (CPA + , ETX - ) ETX holdings (CPA + , ETX + ) was used to quantify the relative abundance of 2 -ΔΔCt values less than 1, indicating a predominance of ETX-encoding strains with increased ETX plasmid copy numbers. -ΔΔCt determining which values indicate a higher percentage of non-ETX strains of C. perfringens; and c)2 -ΔΔCt is greater than 1, performing a standard of care MS evaluation on the human subject. 3. A method for assessing the risk of exacerbation, relapse, or progression in a subject developing MS, comprising: a) obtaining a fecal sample from the human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-carrying and alpha toxin gene (CPA)-carrying strains of C. perfringens in a fecal sample from the human subject by real-time quantitative polymerase chain reaction (RT-qPCR) to determine cycle thresholds for the ETX and CPA genes; -ΔΔCt The analysis showed that the samples contained non-ETX strains (CPA + , ETX - ) ETX holdings (CPA + , ETX + ) was used to quantify the relative abundance of 2 -ΔΔCt values less than 1, indicating a predominance of ETX-encoding strains with increased ETX plasmid copy numbers. -ΔΔCtdetermining which values indicate a higher percentage of non-ETX strains of C. perfringens; and c)2 -ΔΔCt is greater than 1, performing a standard of care MS evaluation on the human subject. 4. The method of paragraph 2 or 3, wherein the standard of care MS assessment includes magnetic resonance imaging (MRI), evoked potential testing, cerebrospinal fluid analysis, and / or blood tests. 5. Standard of care MS assessment is 2 -ΔΔCt 4. The method of paragraph 2 or 3, wherein the method is not performed if 6. A method for preventing or treating multiple sclerosis (MS) in a human subject in need thereof, comprising the method of any one of paragraphs 1-3, comprising administering to the subject: -ΔΔCt is greater than 1, the method comprising administering a composition comprising an effective amount of an agent that directly or indirectly interferes with epsilon toxin (ETX) produced by an ETX strain of C. perfringens. 7. The method of paragraph 6, wherein the agent is an inhibitor of ETX. 8. The method of paragraph 7, wherein the inhibitor is an antibody against ETX or a functional component thereof. 9. The method of paragraph 8, wherein the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody. 10. The method of paragraph 8 or 9, wherein the antibody is a human or humanized antibody. 11. The method of any one of paragraphs 8 to 10, wherein the antibody is a neutralizing antibody against ETX or a functional component thereof. 12. The method of paragraph 6, wherein the agent is an inhibitor or antagonist of an ETX binding receptor. 13. The method of paragraph 12, wherein the ETX-binding receptor is expressed on endothelial cells of the blood-brain barrier (BBB) for which ETX is a ligand. 14. The method of paragraph 12, wherein the ETX-binding receptor is a tetraspan integral membrane receptor. 15. The method of paragraph 14, wherein the tetraspan integral membrane receptor is myelin and lymphocyte protein (MAL) or hepatitis A virus cellular receptor I (HAVCRI). 16. The method of paragraph 6, wherein the agent is a soluble ETX-binding receptor protein. 17. The method of paragraph 16, wherein the soluble ETX-binding receptor protein is soluble HAVCRI or a fragment thereof. 18. The method of paragraph 16, wherein the soluble ETX-binding receptor protein is soluble MAL or a fragment thereof. 19. The method of paragraph 6, wherein the agent is a phage lytic enzyme specific for Clostridium perfringens type B or type D bacterial strains. 20. The method of paragraph 19, wherein the phage lytic enzyme is muramidase from strain ATCC 13124, such as PlyCM. 21. The method of paragraph 6, wherein the agent is a vaccine against Clostridium perfringens type B or D, or an ETX produced therefrom. 22. The method of paragraph 6, wherein the agent is a probiotic supplement containing C. perfringens type A or other bacterial type that can effectively outcompete Clostridium perfringens type B or D without other C. perfringens toxinotypes. 23. The method of paragraph 6, wherein the agent is an antibiotic sufficient to kill C. perfringens type B and / or type D. 24. Drugs, 2 -ΔΔCt 7. The method of paragraph 6, wherein the subject is not administered if 25. A method for determining the relative abundance of epsilon toxin (ETX)-producing strains of C. perfringens within the gut microbiome of a subject, comprising: a) obtaining a fecal sample from the human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-carrying and alpha toxin gene (CPA)-carrying strains of C. perfringens in a fecal sample from the human subject by real-time quantitative polymerase chain reaction (RT-qPCR) to determine cycle thresholds for the ETX and CPA genes; -ΔΔCt The analysis showed that the samples contained non-ETX strains (CPA + , ETX - ) ETX holdings (CPA + , ETX + ) is used to quantify the relative abundance of 2 over 1 -ΔΔCt values less than 1, indicating a predominance of ETX-encoding strains with increased ETX plasmid copy numbers. -ΔΔCt determining a value indicative of a higher percentage of non-ETX strains of C. perfringens. 26. The method of any one of paragraphs 1 to 25, wherein detecting the relative abundance of ETX-carrying strains of C. perfringens comprises RT-qPCR using at least one ETX-targeting primer selected from 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3'. 27. The method of paragraph 26, wherein detecting the relative abundance of ETX-carrying strains of C. perfringens comprises RT-qPCR using each of the ETX-targeting primers 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3'. 28. The method of paragraph 26 or 27, wherein detecting the relative abundance of ETX-carrying strains of C. perfringens comprises RT-qPCR using a fluorogenic probe comprising the sequence AGCAACTGCTAAGTTTACTGTTCCT. 29. The method of any one of paragraphs 1 to 28, wherein detecting the relative abundance of CPA-carrying strains of C. perfringens comprises RT-qPCR using at least one CPA-targeting primer selected from 5'-CTTGGAGAGGCTATGCACTATTT-3' and 5'-TTGCAACCTGCTGTGTTTATTT-3'. 30. The method of any one of paragraphs 1 to 29, wherein detecting the relative abundance of CPA-carrying strains of C. perfringens comprises RT-qPCR using each of the CPA-targeting primers 5'-CTTGGAGAGGCTATGCACTATTT-3' and 5'-TTGCAACCTGCTGTGTTTATTT-3'. 31. The method of paragraph 29 or 30, wherein detecting the relative abundance of CPA-carrying strains of C. perfringens comprises RT-qPCR using a fluorogenic probe comprising the sequence TTACTGCCGTTGATAGCGCAGGAC. 32. The method of any one of paragraphs 1 to 31, wherein detecting the relative abundance of ETX-carrying and CPA-carrying strains of C. perfringens comprises RT-qPCR for C. perfringens abundance using at least one C. perfringens-specific 16S rRNA primer selected from 5'-AGATGGCATCATCATTCAAC-3' and 5'-GCAAGGGATGTCAAGTGT-3'. 33. The method of any one of paragraphs 1 to 32, wherein detecting the relative abundance of ETX-carrying and CPA-carrying strains of C. perfringens comprises RT-qPCR for C. perfringens abundance using each of the C. perfringens-specific 16S rRNA primers 5'-AGATGGCATCATCATTCAAC-3' and 5'-GCAAGGGATGTCAAGTGT-3'. 34. The method of paragraph 32 or 33, wherein detecting the relative abundance of ETX-carrying and CPA-carrying strains of C. perfringens comprises RT-qPCR for C. perfringens abundance using a fluorogenic probe comprising the sequence AGAGTGCAGGAGAGGAGAGTGGAA. 35. Quantifying the relative abundance of ETX-carrying (CPA+, ETX+) versus non-ETX strains (CPA+, ETX-) in a sample. 35. The method of any one of paragraphs 1 to 34, comprising RT-qPCR using an ETX-targeting primer pair: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', and a fluorogenic probe comprising the sequence: AGCAACTGCTAAGTTTACTGTTCCT, and a CPA-targeting primer pair: 5'-GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC-3', and a fluorogenic probe comprising the sequence TGGGACTATGCAGCAAAGGTAACTTTAGC. 36. The method of any one of paragraphs 1 to 35, wherein the RT-qPCR comprises using universal 16S rRNA primers 5'-GCGAGACTGCCGGTAATAAA-3' and 5'-TCGTTGTACCAGCCATTGTAG-3', and a fluorogenic probe comprising the sequence CCCTTATGACCTGGGCTACACACG. 37. A composition for preventing or treating multiple sclerosis (MS) in a patient in need thereof, comprising a pharmaceutically acceptable excipient and an effective amount of an agent according to any one of paragraphs 6 to 24. [Example]
[0119] Example 1: The MS gut microbiome harbors ETX-producing C. perfringens strains. Based on statistical power calculations (Methods), 62 participants were recruited under the IRB protocol: those with an early trigger for multiple sclerosis (HITMS), consented, and received instructions regarding self-collection of fecal samples. Healthy controls (HC) and MS participants were matched for age, sex, body mass index, place of residence at the time of fecal sample donation, and ancestry / ethnicity (Figure 9). Inclusion in the MS arm required a confirmed diagnosis of MS based on the 2010 revised McDonald criteria (65). Participants with a first- or second-degree relative with a diagnosis of MS or a clinically isolated syndrome were excluded from the HC arm. Complete inclusion and exclusion criteria are detailed herein.
[0120] Based on the results of previous studies, it was recognized that ETX-producing strains of C. perfringens were likely to be relatively low in abundance in human fecal samples because the ecological niche of these mucoadhesive bacteria is in the small intestine, a site known to be significantly underrepresented in fecal samples. Low abundance in fecal samples likely renders C. perfringens types B or D undetectable by metagenomic sequencing, a technique commonly utilized in MS microbiome studies. Therefore, to examine whether etx genes are present in the human gut microbiota, we utilized PCR, a more sensitive approach than shotgun metagenomics for gene detection. Density gradient centrifugation, Nycodenz, was used because separation of bacteria from non-microbiome fecal material removes PCR inhibitors, provides a more accurate representation of bacterial composition, and enhances recovery of the phylum Bacillote (Firmicutes), and particularly the class Clostridia (Figure 1A). Initial screening detected the occurrence of etx in 61% of MS patients and 13% of controls (Figure 1B). To confirm etx-positive study participants, we performed independent PCRs targeting different regions of the etx gene (Figure 1C). The identity of all PCR products was verified by Sanger sequencing. The cpa / plc gene, common to all C. perfringens strains, and the 16S ribosomal RNA gene specific to C. perfringens were also detected in these etx-positive participants, as expected, since only C. perfringens is known to naturally encode etx genes (Figure 1C). Fisher's exact test of independence showed that etx was significantly associated with disease status (MS vs. HC) at p = 0.0002 (Figure 1D). The odds ratio for etx positivity, MS vs. HC, was 10.7, 95% CI: 2.9871–38.2381, p = 0.0003. Multivariate logistic regression with etx- or etx+ status as a binary outcome was further performed to determine whether disease status (MS vs. HC) overall or stratified by disease-modifying treatment was associated with etx status, independent of sex.Disease status was found to be independently associated with etx status, even when controlling for sex. In addition, disease status (MS vs. HC) was independently associated with etx status, regardless of treatment, controlling for sex.
[0121] The prevalence of fecal etx positivity in our analysis is consistent with previously reported frequencies of ETX immunoreactivity in serum from individuals with clinically definite MS (43%) and age-matched controls (16%). This suggests a high translation rate of the C. perfringens type B / D virulence factor, etx, and suggests that the human gastrointestinal tract is a favorable environment for C. perfringens type B / D growth.
[0122] Next, we assessed the relative abundance of etx in fecal microbiota collected from individuals with MS and HC. Quantitative analysis of etx abundance relative to universal 16S by TaqMan real-time PCR was performed using modified 2 -ΔCt Method 2 was used. -ΔCt The method allows for normalization of real-time quantitative PCR data to an internal reference. We assessed etx abundance relative to the universal 16S in MS and HC, and found that etx abundance was significantly increased in fecal microbiota collected from individuals with MS compared to HC (Figure 2, A and B).
[0123] C. perfringens type A strains, defined by the presence of the chromosomally encoded alpha-toxin gene, cpa, but not the other major toxin genes, are human intestinal commensals. C. perfringens type B strains carry the cpa, cpb, and etx toxin genes, whereas C. perfringens type D strains carry the cpa and etx genes. PCR analysis identified cpa in 74% of MS patients compared with 45% of controls (Figure 10, A-C). When analyzing cpa prevalence in subgroups of participants, depending on the presence or absence of etx, cpa coexists with etx genes in etx+ participants (Figure 10D). Notably, cpa prevalence among etx-negative participants is essentially indistinguishable between those with MS and those with HC (Figure 10D). These results suggest that non-etx strains (cpa+, etx-) are unlikely to be involved in MS. TaqMan real-time PCR showed a significant increase in cpa abundance in MS compared with controls (Figure 2C). No statistical differences in cpa abundance were found between subgroups with or without etx (Figure 2, D and E). Neither the prevalence nor abundance of cpa from etx-negative participants differed between MS and HC, ruling out the role of non-etx strains in MS pathogenesis. However, the increased cpa prevalence in the MS group (etx- and etx+ combined) compared with HC suggests that people with MS may have a more favorable gastrointestinal environment for the survival and growth of C. perfringens.
[0124] Quantification by TaqMan real-time PCR simultaneously targeting the genes encoding C. perfringens-specific 16S rRNA and universal 16S rRNA confirmed the increased abundance of C. perfringens in MS compared to controls (Figure 11A). Using a pure reference strain as a calibrator, -ΔΔCtUsing the method, MS participants tended to have a higher percentage of C. perfringens in their fecal microbiota when compared to controls, although this did not achieve statistical significance (Figure 11, B-D). Notably, the estimate is consistent with the previously reported range of C. perfringens abundance in fecal microbiota from healthy humans (0.000001-0.01%), confirming the low abundance of this organism.
[0125] The 2018 revised classification scheme for C. perfringens defines seven distinct toxinotypes based on the presence of one or more of six major toxin genes (plc / cpa, cpb, etx, lap and lab, cpe, and netB). Multiplex PCR was performed for the major toxins used to characterize C. perfringens toxinotypes. The majority of etx+ MS participants carried C. perfringens type D strains (etx+, cpa+), while type B (etx+, cpa+, cpb+) strains were rarely detected (Figure 2F). C. perfringens enterotoxin (cpe), the primary agent of C. perfringens-mediated human food poisoning, was not detected. Notably, unlike the more sensitive singleplex PCR (Figure 1C), etx and cpa appear to be absent in some participants by multiplex PCR, likely due to annealing temperature compatibility issues between individual primer pairs in the multiplex PCR system. The apparent variation in etx / cpa band intensity ratios among participants that differed from those of the reference strains suggests that some participants likely harbored a community of combined type A strains (cpa+) and type B / D strains (cpa+, cpb+, etx+, or cpa+, etx+).
[0126] Next, we examined the significance of etx positivity in healthy controls. Multiplex PCR results suggest that, although etx was clearly detected in singleplex PCR (Figure 1, B and C), the etx band was clearly absent or weakened in the group of four etx-positive HC participants (Figure 2F). To understand this phenomenon, we developed a highly sensitive TaqMan real-time PCR to simultaneously target the etx and cpa genes and detect 2 -ΔΔCt Analysis was used to quantify the relative abundance of etx-producing (cpa+, etx+) versus non-etx strains (cpa+, etx-) from etx+-positive MS and HC groups (Figure 2G). -ΔCt Values were calculated to quantify the fold change in etx / cpa ratio when pure type D (cpa+, etx+) cultures were used as calibrators. For type D calibrators, a value of 1 was calculated as 2. -ΔΔCt We set it as 1. -ΔΔCt However, the predominance of etx-encoding strains with increased etx plasmid copy numbers was less than 1.2 -ΔΔCt We reasoned that this indicates a higher percentage of C. perfringens type A (cpa+) in the bacterial community. The results showed a 2.0% increase in the etx / cpa ratio in people with MS compared to controls. -ΔΔCt The values were significantly increased (Fig. 2H).
[0127] Next, 2 -ΔΔCtA value of 1 suggests that 100% of participants' C. perfringens strains are etx-carrying (i.e., type B and / or D), providing the greatest estimate of the average percentage of etx-carrying strains in the C. perfringens community for MS or HC. Analysis shows that etx+ MS participants contain 32% etx-carrying strains and 68% non-etx C. perfringens strains (Figure 21). In contrast, etx+ healthy controls contain 0.002% etx-carrying strains and nearly 100% non-etx C. perfringens strains. Analysis from a different perspective by quantifying etx abundance relative to C. perfringens-specific 16S rRNA resulted in a higher estimate of the percentage of etx-carrying strains: 43% in MS and a lower percentage of 0.001% in controls (Figure 12).
[0128] Collectively, these data consistently demonstrate that individuals with MS are more likely to have their gut microbiomes colonized by etx+ strains of C. perfringens than age- and sex-matched HCs. The data suggest that there may be an as-yet-undefined threshold of relative abundance of ETX-producing strains, and that relative abundance above this threshold contributes to MS. The complex dynamics between C. perfringens type A strains and etx-encoding strains are likely important because type A strains compete with other C. perfringens strains for resources, and because conjugative transfer between etx-plasmid-carrying type D and etx-negative type A has previously been demonstrated in vitro.
[0129] Example 2: Comparison of patient-derived, laboratory, and environmental isolates To determine whether isolates from MS patients shared characteristics with known environmental isolates and whether they produced a functional ETX, we performed whole-genome sequencing of an MS patient isolate (SHDS0050), several environmental isolates, including a type D strain isolated from a ruminant, and a laboratory type B strain. We successfully sequenced a closed 54.5 kb MS patient-derived plasmid, pSHDS0050 (Figure 3A). This plasmid contained 63 ORFs and an etx locus flanked by mobile gene elements. Like other etx plasmids, pSHDS0050 contained a Tn3 (in opposite orientation) and IS1151 transposase upstream of etx, but immediately followed by two IS256 and mutator transposases (Figure 3C). The plasmid resembled other highly conjugative plasmids of the pCW3 family found in C. perfringens strains because it contained the tcp locus and other genes related to conjugation, as well as a central control region containing the parMRC partitioning system. The plasmid lacked other toxin genes, such as cpe or cpb. When comparing the D-type plasmid from an MS patient to the other etx-containing B- and D-type plasmids sequenced herein, pSHDS0050 maintained the same conserved genes, such as regB, pe, amide ligase, permease, RICIN domain-containing genes, and radical SAM genes (Figure 3C). Interestingly, pSHDS0050 had an identical plasmid architecture to the sheep isolate NCTC8346 and the goat isolate FU17 (Figure 3C), suggesting that it may be a potential vector for ruminant infection in humans, as originally hypothesized. Although sharing much of the same genomic content, these D-type plasmids were not as large as the 64.7 kb etx plasmid sequenced herein from B-type strains ATCC3626 and NCTC3110, or the published B-type strain NCTC8533 (Figure 3C). pSHDS0050 lacked genes such as cpb2, thiF, and pri present in those plasmids.
[0130] The circularized chromosomes of type D strains CN3842, NCTC8346, and FU17, and type B strains ATCC3626 and NCTC3110 were then compared to ensure that the patient strain, SHDS0050, was not a contaminating collection strain. A GView BLAST atlas plot reveals that the patient-derived strain possesses multiple unique regions within its chromosome, distinguishing it from other isolates (Figure 3B).
[0131] To assess pro-ETX production and virulence, SHDS0050, ATCC type B strain, and ATCC type F strain were cultured in TGY broth under anaerobic conditions, and the supernatants were then evaluated for pro-ETX by Western blot. The MS patient-derived strains showed similar mobility to the ATCC type B strain. - The ATCC type F strain produced a 32.9 kDa pro-ETX protein (Figure 3D). As expected, the ATCC type F strain was negative for ETX production. To assess cytotoxicity, harvested supernatants were treated with trypsin to activate ETX. Next, CHO cells expressing the human ETX receptor MAL (hMAL-CHO) or control CHO cells expressing GFP (GFP-CHO) were treated with the trypsin-activated supernatant. Cell death was determined by a propidium iodide (PI) exclusion assay. To confirm that the cytotoxic effect was ETX-mediated, trypsin-activated supernatants were also treated with a neutralizing anti-ETX antibody before treatment with hMAL-CHO cells. Only trypsin-activated supernatants from the laboratory type B and MS patient-derived type D strain SHDS0050 induced hMAL-CHO cell death (Figure 3E). Cell death was not observed in hMAL-CHO cells treated with broth alone, and GFP-CHO cells were insensitive to all treatment conditions (Figure 3E). Anti-ETX antibody treatment inhibited hMAL-CHO cell death, indicating that supernatant cytotoxicity was ETX-mediated. Collectively, these data indicate that patient-derived C. perfringens type D strains possess a typical type D plasmid architecture, are capable of producing functional ETX, and likely originated from a ruminant source.
[0132] Single nucleotide polymorphisms (SNPs) in bacterial genes are associated with microbial fitness and the pathogen's ability to cause disease. Large-scale genomic analyses have identified abundant SNPs in the C. perfringens genome. To characterize these variants, we performed comparative alignment analysis of 17 etx genes against coding DNA sequences (CDS) available through the National Center for Biotechnology Information (NCBI) database. The SNP at site 762 harbors the fewest conserved SNPs among the six we identified and is the only SNP present in the coding sequence of the activated ETX. At site 762, G substitutes for A as the minor allele, regardless of C. perfringens toxinotype (Figure 13C).
[0133] etx genes isolated from human fecal samples as described herein predominantly carry a minor allele at site 762 (95%, 20 / 21), 762G (Figure 13D). This variant results in a synonymous mutation at residue 254 (Ser, corresponding to residue 222 in activated ETX) within the receptor-binding domain. Emerging evidence indicates that synonymous mutations, previously assumed to be phenotypically neutral, contribute to microbial fitness. Furthermore, synonymous mutations may affect mRNA secondary structure, protein translation, and protein folding.
[0134] Example 3: ETX overcomes CNS immune privilege Circulating myelin autoreactive lymphocytes are common in the general population. Despite the prevalence of myelin autoreactive lymphocytes among humans, widespread autoimmunity is minimized by peripheral tolerance and CNS barrier mechanisms that preserve immune privilege. The importance of the CNS barrier in maintaining immune privilege has been well demonstrated in active immunization models of EAE. In this model system, animals are immunized with myelin antigens, typically myelin-specific proteins or peptides, in complete Freund's adjuvant (CFA). In most paradigms, immunized animals do not develop clinical or histological CNS disease unless they also receive PTX, which targets CNS endothelial cells at the BBB. Similarly, in many myelin peptide-specific T cell receptor (TCR) transgenic models, EAE rarely occurs unless the animals receive PTX, despite the TCR repertoire being skewed toward an abnormally high frequency of autoreactive clones. PTX is widely used in EAE to overcome immune privilege, which is clinically unrelated to MS.
[0135] Knowing that blood-borne ETX specifically targets CNS endothelial cells, we tested whether ETX is sufficient to break CNS immune privilege in the presence of circulating myelin autoreactive lymphocytes and adapted a widely used immunization model of EAE that uses an immunodominant peptide in myelin oligodendrocyte glycoprotein (MOG). On day 0, female C57BL / 6 mice were immunized with 200 μg of synthetic murine MOG emulsified in 50 μl of CFA. 35 ~ 55 On days 0 and 2, mice received either PTX at 5 μg / kg body weight (approximately 100 ng per mouse), ETX at 50 ng / kg body weight (approximately 1 ng per mouse), or ETX at 500 ng / kg body weight (approximately 10 ng per mouse), all delivered intraperitoneally (IP). ETX, like PTX, inhibits MOG 35 ~ 55In the absence of either toxin, MOG was sufficient to induce clinical disease in mice immunized with MOG (Figure 4A). 35 ~ 55 Immunized animals remained healthy without any observable phenotype. Disease activity induced by ETX occurred at significantly lower doses than that of PTX (5 ng / kg or 50 ng / kg for ETX and 5 μg / kg for PTX). Using the classical EAE scoring scale, the onset, time course, and peak clinical deficits were similar for ETX- and PTX-induced EAE (Figure 4A). The magnitude of demyelination and the ultrastructural characteristics of demyelination in the spinal cord were similar when comparing ETX-induced EAE to PTX-induced EAE (Figure 4B and C). These results suggest that ETX significantly inhibits MOG 35 ~ 55 We show that IFN-γ is a potent inducer of EAE in the context of the / CFA immunization paradigm.
[0136] Example 4: ETX-EAE induces multifocal demyelination The ETX-EAE group exhibited more diverse behavioral deficits compared with PTX-EAE, including ataxia, head tilt, imbalance, axial rotation, and side-to-side leaning, as captured by the atypical EAE scoring scale (Figures 5A and 14). Demyelination in PTX-EAE mice was primarily restricted to the spinal cord (Figures 4 and 5). In contrast, ETX-EAE mice developed more typical MS multifocal demyelination (Figure 5B). Compared with PTX-EAE, ETX-EAE mice had nearly twice as many lesions in the cerebellum, and lesions in the corpus callosum were only observed in the ETX-EAE group (Figure 5C). ETX-induced EAE exhibited perivenous cuffs and mononuclear infiltrates of mononuclear cells, correlating with demyelination (Figure 15).
[0137] We compared immune infiltration in the brain and spinal cord between the ETX-EAE and PTX-EAE models. Histological sections from ETX-EAE, PTX-EAE, and control animals were examined for infiltrating CD4+ lymphocytes. While both models induce similar demyelination in the spinal cord, PTX-EAE showed significantly more infiltrating CD4+ T cells in the spinal cord compared with ETX (Figure 6, A and E). In the cerebellum, there were significantly more infiltrating CD4+ lymphocytes and more CD4+ lymphocytes in the perivascular cuffs in the ETX-EAE model compared with PTX-EAE (Figure 6, B–F). In the thalamus, there was a similar trend toward more perivenous CD4+ T cell infiltration in ETX-EAE compared with PTX-EAE (Figure 6, C–F). In the spinal cord, based on immunohistochemical analysis of phospo-NFKB p65, CD68, and CD45, similar activation of inflammatory processes was observed in both models at peak disease (Figures 7 and 16). However, in the cerebellum, CD68 was significantly increased in ETX-EAE but not PTX-EAE mice (Figure 7, A-C). A similar trend for phospo-NFKB p65 and CD45 was observed in the cerebellum, but this did not achieve statistical significance (Figures 7 and 16). Collectively, these results, using data from Figures 4 and 5, indicate that ETX induces multifocal inflammatory demyelination in a neuroanatomical distribution more consistent with MS, with a stronger correlation between immune infiltration and demyelination in the ETX-EAE model compared to PTX-EAE (Figure 17).
[0138] Human lymphocytes, but not mouse lymphocytes, express the ETX receptor MAL. Although it seemed unlikely that ETX functions to induce active EAE by affecting peripheral immunity, this possibility was nevertheless tested by tracking MOGp-specific T cell cytokine responses via antigen recall experiments. To track the fate of MOGp-specific T cell responses in vivo, naive, purified MOGp 35 _ 55 Specific CD4+ T cells were cultured in CFA. 35 ~55 2D2 transgenic mice were transferred to recipient wild-type B6 mice 24 hours prior to induction of active EAE by subcutaneous immunization with MOGp. Immunized mice then received either PBS, 10 μg / kg PTX, or 500 ng / kg ETX immediately and 48 hours after immunization (Figure 18A). Mice were monitored for the onset of clinical disease (Figure 18B). 14 days after immunization, single-cell suspensions were generated from inguinal and cervical lymph nodes and from the CNS (brain and spinal cord) for either 1) direct analysis of basal cytokine production by flow cytometry (Figure 18C), or 2) 72-hour MOGp immunization to determine cytokine production after antigen recall. 35 ~ 55 For both sets of experiments, intracellular cytokine production was assessed by flow cytometry. MOGp-specific 2D2 cells were defined as positively CD45+, CD3 / 5+, CD4+, and Thy1.1+. The frequency of TNFα, IFNγ, or GM-CSF-positive CD4+ T cells was significantly higher in the MOGp-specific 2D2 cells than in the control group. 35 ~ 55 After 72 hours of restimulation with PTX, there were no significant differences between the PBS control and ETX-treated groups in the cervical or inguinal lymph nodes, except for a slight difference in the frequency of TNFα-positive T cells from the inguinal lymph nodes (Figure 18D). In CNS tissues, there were no notable differences in the frequency of TNFα-, IFNγ-, or GM-CSF-positive CD4+ T cells between the ETX- and PTX-treated groups. These results support the conclusion that ETX does not function through significant effects on peripheral immunity and does not affect MOGp-specific T cell responses during the induction of active EAE.
[0139] Example 5: ETX and PTX alter the CNS endothelial cell transcriptome and induce genes involved in BBB dysfunction. To gain mechanistic insight into how ETX and PTX may function in overcoming immune privilege at the CNS endothelial barrier, bulk RNA-seq was performed on CNS endothelial cells isolated from animals treated with ETX, PTX, or PBS, and transcriptional profiles were compared.
[0140] Mice were treated with PBS, ETX (0.5 μg / kg body weight), or PTX (5 μg / kg body weight) for two consecutive days, followed by isolation of CNS endothelial cells from the spinal cord for bulk RNA-seq. Sixteen hours after the second toxin dose, CNS endothelial cells were isolated from the spinal cord as previously described. Bulk RNA-seq was performed and analyzed using the limma-voom workflow. Principal component analysis (Figure 8A) revealed separation by treatment. PC1 distinguished the control from both ETX and PTX, while PC2 distinguished ETX from PTX, indicating that the ETX and PTX transcriptomes were more similar to each other than to the PBS control. We identified 798 differentially expressed genes (DEGs) between ETX- and PBS-treated samples and 905 DEGs between PTX- and PBS-treated samples (FDR q-value <0.10). Of these DEGs, 595 were altered in response to both ETX and PTX treatment (Figure 8B). Comparison of the fold changes (FC) of overlapping genes revealed remarkable consistency in the direction and magnitude of differential expression between ETX and PTX treatment (Figure 8C). Considering that PTX is an A-B toxin that functions through ADP-ribosylation of G proteins, and ETX is a pore-forming toxin of the aerolysin family, the consistency in induced and repressed genes was both intriguing and unexpected. A heatmap depicting genes of interest revealed induction of protease, signaling, cytokine, and transcription factor genes potentially relevant to overcoming CNS immune privilege (Figure 8D). In Figure 8E, a heatmap of differentially expressed genes by ETX and PTX, also identified by Munji et al. as components of a core set of genes involved in BBB dysfunction, is shown. Overall gene induction in endothelial cells isolated from PTX- or ETX-treated mice shares a large degree of overlap (Figure 8F). Further analysis with RNA-seq data identified signaling pathways preferentially activated by ETX ( Figure 8G ).
[0141] Example 6: Consideration of Examples 1 to 5 It has been hypothesized that factors involved in the formation of initial lesions in MS are the same factors involved in the formation of new lesions throughout the disease course. In other words, the environmental trigger for MS likely does not occur once at disease onset, but rather repeatedly throughout the disease course. The episodic nature of MS disease activity is well consistent with the ETX hypothesis. ETX production occurs when C. perfringens types B or D enter logarithmic phase growth and is therefore linked to the increased abundance of these strains in the gut microbiome. A short cycle of logarithmic growth, followed by a long period of quiescence, explains episodic ETX production. MS disease activity is associated with an increased relative abundance of Bacillus (Firmicutes), including the genus Clostridium, suggesting that the MS gut microbiome episodically favors the growth of this phylum. In addition to our findings, it is noteworthy that C. perfringens is the bacterium most commonly associated with neuromyelitis optica, an immune-mediated demyelinating disorder affecting the spinal cord and optic nerve.
[0142] C. perfringens type D is responsible for enterotoxemia in sheep, goats, and, less commonly, cattle. The disease is distributed worldwide and can be acute, subacute, chronic, or fatal. Enterotoxemia type D is an infectious disease that can occur in small outbreaks via the oral-fecal route, but it is not typically an epidemic. A variable number of ruminants harbor C. perfringens type D in their small intestine, but the number of organisms is generally low, and clinical disease does not occur unless the gut microbial balance is disrupted. When these animals are fed large amounts of readily fermentable carbohydrates, undigested starch enters the small intestine and provides a substrate for the rapid growth of C. perfringens. This subsequently produces large amounts of ETX, which is then absorbed into the systemic circulation. The bacteria are released into the environment via feces and can survive in soil for several months. Neonatal and elderly animals are infected via the fecal-oral route.
[0143] Epstein-Barr virus (EBV) has been proposed as an environmental trigger for MS, potentially acting through molecular mimicry. In humans, EBV is significantly associated with MS, but seroconversion itself is not sufficient to induce MS, as approximately 94% of the general population seroconverts by age 24, yet MS risk remains relatively low. This suggests that while EBV may play a role in MS pathogenesis, an additional, but less widely distributed, causative factor may be required, which we propose to be C. perfringens type B or D. Attorney Docket No. CUW-02661
[0144] In summary, a strong clinical association was found between specific bacteria, their toxins, and the diagnosis of MS. Additionally, the abundance of ETX-producing strains of C. perfringens was found to be significantly elevated in the MS gut microbiome. Herein, a biologically plausible mechanism by which ETX functions in the multistep process of CNS autoimmunity is provided.
[0145] Example 7: Materials and Methods for Examples 1-5 statistical analysis Statistical analysis was performed using GraphPad Prism (v.9; GraphPad) and Microsoft Excel (2016; Microsoft). Gaussian-distributed data are expressed as mean ± SEM (standard error of the mean) or SD (standard deviation), as appropriate. Non-Gaussian-distributed data are expressed as median ± range. Two datasets were compared for statistical significance using an unpaired two-tailed t-test (for Gaussian distributions) or a Mann-Whitney test (for non-Gaussian distributions). For multiple datasets, one-way ANOVA followed by a post hoc Tukey's multiple comparison test (for Gaussian distributions) or a Kruskal-Wallis test followed by a post hoc Dunn's multiple comparison test (for non-Gaussian distributions) was performed to determine statistical significance. For EAE time course analysis, a nonparametric Friedman test followed by a post hoc Dunn's test was performed. Pearson's correlation analysis was performed to examine whether the density of CNS-infiltrating lymphocytes correlated with the degree of demyelination. A one-phase decay model was used for curve fitting. Multivariate logistic regression was used to test for differences while adjusting for covariates. Statistical significance of all analyses is noted in the figures or legends.
[0146] Availability of data and materials C. perfringens chromosome and plasmid sequences were deposited in GenBank under the following accession numbers (chromosome, plasmid for each strain): C. perfringens type D CN3842 (CP116428, CP116429), C. perfringens type D NCTC8346 (CP116430, CP116431), C. perfringens type D FU17 (CP116432, CP116433), C. perfringens type D SHDS0050 (CP116434, CP116435), C. perfringens type B NCTC3110 (CP116436, CP116437), and C. perfringens type B ATCC3626 (CP116438, CP116439).
[0147] RNA-seq data have been deposited in NCBI's Gene Expression Omnibus ( Edgar et al., 2002 ) and are accessible through GEO series accession number GSE223137. Reagents and Resources [Table 2]
[0148] Research participant recruitment and IRB Possessing Early Triggers of Multiple Sclerosis (HITMS) IRB#1003010940: Patients were prospectively screened for eligibility for the HITMS study by the Weill Cornell MS Center research coordinator, and eligible participants were provided with a study overview and an informed consent form for review. HCs were recruited through advertising via flyers, website announcements, and by recruiting friends (genetically unrelated) of patients. Participants willing to participate in the study completed and signed an informed consent form in the presence of IRB-approved personnel at the MS Center. Enrolled participants were assigned a study number and provided with a stool collection kit consisting of two biohazard bags, six 50 ml sterile conical polypropylene tubes, one freezer box, blue pads, a stool collection toilet hat, a sterile tongue depressor, and instructions for self-collection of stool samples.
[0149] Inclusion / exclusion criteria for study participants and sample size Possessing Early Triggers of Multiple Sclerosis (HITMS) IRB#1003010940: Patients were prospectively screened for eligibility for the HITMS study by the Weill Cornell MS Center research coordinator, and eligible participants were provided with a study overview and an informed consent form for review. HCs were recruited through advertising via flyers, website announcements, and by recruiting friends (genetically unrelated) of patients. Participants willing to participate in the study completed and signed an informed consent form in the presence of IRB-approved staff at the MS Center. Enrolled participants were assigned a study number and provided with a stool collection kit consisting of two biohazard bags, six 50 ml sterile conical polypropylene tubes, one freezer box, blue pads, a stool collection toilet hat, a sterile tongue depressor, and instructions for self-collection of stool samples.
[0150] Inclusion criteria: 1. Participants with clinically definite multiple sclerosis (MS) (1) - Male and female participants aged 18 years or older who have been accurately diagnosed with MS based on the revised McDonald criteria (1). These subjects must be able to provide consent and willing to participate in the study. 2. Healthy controls were enrolled for comparison.
[0151] Exclusion Criteria: Any participant who met the following criteria was excluded from participation in this study: 1. Inability to provide informed consent (2). 2. Any form of dementia or cognitive impairment (2). 3. Current or chronic use of anticoagulants. 4. Pregnancy. Body mass index greater than 3.39 or less than 17.5. 5. Use of the following medications within the past 6 months: a) systemic antibiotics (intravenous, intramuscular, or oral) for more than 3 days, b) amylase inhibitors, c) ≥ 10 mg / day of steroids. 8(Commercially available probiotics consumed at greater than 1000 cfu of organisms). 6. Chronic immune deficiency, renal, metabolic, pancreatic, hepatic, gastrointestinal (Crohn's disease, ulcerative colitis), pulmonary, or cardiovascular disease requiring ongoing treatment. 7. Hematologic, psychiatric, or hematopoietic dysfunction unrelated to standard-of-care MS treatment. 8. Major dietary change (e.g., from omnivorous to vegan, or from vegan to omnivorous) in the 3 months prior to fecal sample collection. 7. Chronic alcohol consumption, defined as >5 oz (or 5 drinks) per day or ethanol. 8. Any history of fecal microbiota transfer. Many of the above criteria were based on the NIH Human Microbiome Project Core Microbiome Sampling Protocol A. Sample size: Power calculations were based on a dichotomous result of etx-positive or -negative. The estimated incidence of etx-positive was 10% in the HC group and 40% in the MS group. Alpha was set at 0.05, beta at 0.2, and power at 0.8. This resulted in a calculated sample size of 62 participants, with 31 HC and 31 MS participants enrolled in a 1:1 ratio.
[0152] Fecal microbiota isolation and DNA extraction Stool samples were collected from 31 MS patients and 31 healthy donors and stored in a locked freezer at 80°C. The frozen samples were thawed for 1 hour in a Whitley A35 HEPA workstation set at 37°C with 40% humidity. A portion of each stool sample was subjected to a Nycodenz density gradient to separate the microbiota from other fecal material. Each stool sample was sampled a minimum of three times. Two grams of feces were aseptically transferred using a sterile tongue depressor into 18 mL of 0.9% NaCl prepared in ultrapure water containing 16.2 mm sterile metal beads and homogenized by vortexing for 2 minutes. 10.5 mL of homogenized feces was added on top of 3.5 mL of 80% (w / v) Nycodenz in ultrapure water and centrifuged at 10,000 g for 1 hour at 4°C. The layer corresponding to the microbiota was collected, washed twice with 1 mL of PBS, and resuspended in 1 mL of PBS. Bacteria were digested with lysozyme, RNase A, and proteinase K and lysed with sodium sarkosyl. DNA from the lysates was extracted with phenol, precipitated with 100% ethanol, and finally resuspended in sterile ultrapure water for subsequent standard PCR and quantitative PCR analysis. C. perfringens reference strains, including ATCC 3626, ATCC 13124, ATCC 12915, and FD203, were grown overnight on rapid Perfringens medium (RPM). Bacteria were harvested by centrifugation at 4000 rpm for 10 minutes at 4°C, followed by total DNA extraction as described above. DNA from the reference strains was included as a control or calibrator in both standard PCR and quantitative PCR analyses.
[0153] Detection of etx genes and toxinotyping of C. perfringens populations For the detection of etx and other genes shown in this study, simplex and multiplex PCR was performed with DNA extracted from fecal microbiota using the Platinum II Hot Start OCR Master Mix kit (Thermo Fisher #14000014) according to the manufacturer's instructions and with the following PCR primers and parameters:
[0154] Primers and parameters for PCR analysis For detection of etx and other genes shown in this study, simplex PCR included the following primers: etx (3' end; 542bp), forward: 5'-ACTGCAACTACTACTCATACTGTG-3', reverse: 5'-CTGGTGCCTTAATAGAAAGACTCC-3'; etx (3' end; 390bp), order: 5'-ACTGCAACTACTACTCATACTGTG-3', Reverse: 5'-CTGGTGCCTTAATAGAAAGACTCC-3'; etx (5' end; 679bp), forward: 5'-GCATCAGCGGTGATATCCATC-3', reverse: 5'-TCTCTCCCCATTCACTTCCAC-3'; cpa / plc, forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'-CATGTAGTCATCTGTTCCAGCATC-3'; universal 16S rRNA, forward (8F): 5'-AGAGTTTGATCCTGGCTCAG-3', reverse (1492R): 5'-GGTTACCTTGTTACGACTT-3'; C. perfringens -specific 16S rRNA, forward: 5′-AGATGGCATCATCATTCAAC-3′, reverse: 5′-GCAAGGGATGTCAAGTGT-3′.
[0155] Toxinotyping of C. perfringens in fecal microbiota was performed using a multiplex protocol modified based on a recent report. Primers included in the multiplex PCR included: etx (5' end): etx (5' end, 697 bp), forward: 5'-GCATCAGCGGTGATATCCATC-3', reverse: 5'-TCTCTCCCCATTCACTTCCAC-3'; cpa / plc(402bp), forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'-CATGTAGTCATCTGTTCCAGCATC-3'; cpb(236bp), forward: 5'-ACTATACAGACAGATCATTCAACC-3', reverse: 5'-TTAGGAGCAGTTAGAACTACAGAC-3'; itx(317bp): forward, 5'-GCGATGAAAAGCCTACACCACTAC-3', reverse, 5'-GGTATATCCTCCACGCATATAGTC-3'; cpe (506 bp), forward: 5'-GGGGAACCCTCAGTAGTTTCA-3', reverse: 5'-ACCAGCTGGATTTGAGTTTAATG-3'.
[0156] For both simplex and multiplex PCR, C. perfringens reference strains including ATCC 3626 for type B and FD203 for type D were used as positive controls for etx, while reference strains including ATCC 13124 for type A and ATCC 12915 for type F served as negative controls for etx.
[0157] The amplification program used for all assays consisted of an initial step of 94 °C for 5 min, followed by 35 cycles of 45 s at 94 °C, 1 min at 50–58 °C (for simplex PCR: 57 °C for 5'etx, 53 °C for 3'etx, 58 °C for cpa, 50 °C for universal 16S rRNA, and 55 °C for C. perfringens-specific 16S rRNA; for multiplex PCR: 55 °C), 1 min at 68 °C, and a final extension step of 10 min at 68 °C. PCR products were electrophoresed on a 1.2% agarose gel and visualized by an Azure c200 gel imaging system.
[0158] Quantitative analysis of etx gene abundance and the proportion of etx-carrying C. perfringens in fecal microbiota Quantitative PCR (qPCR) was performed on an Applied Biosystems QuantStudio 6 Flex real-time PCR system (Thermo Fisher Scientific) using the PerfecTa Multiplex qPCR SuperMix kit (Quanta Bio #95108-200) according to the manufacturer's instructions. Custom-designed target-specific TaqMan probes labeled with FAM / VIC and quenched with TAMRA / MGBNFG were utilized. For each qPCR system, amplicons were designed to be similar in size, and primers for target sequences with similar melting temperatures were selected to achieve comparable amplification efficiency. Universal 16S rRNA served as the reference gene in most cases. All measurements were performed in triplicate. The specificity of each qPCR system was tested and validated using etx-bearing or non-etx C. perfringens reference strains as positive and negative controls. The relative abundances of etx, cpa, and C. perfringens-specific 16S rRNA genes were determined using the threshold cycle (Ct) and 2' algorithm, with universal 16S rRNA as the reference gene (3). Furthermore, the percentage of C. perfringens in the fecal microbiota was calculated using a laboratory reference strain culture (100%) as a calibrator based on the 2' algorithm (3). Similarly, the ratio of etx-carrying strains to non-etx strains was assessed using etx / cpa from the reference etx-carrying strain (type D). The PCR primers and parameters for qPCR analysis were as follows:
[0159] Primers and parameters for qPCR analysis qPCR for ebc abundance includes the following primers and fluorogenic probe: ebc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM-AGCAACTGCTAAGTTTACTGTTCCT-TAMRA; Universal 16S rRNA, forward, 5'-GCGAGACTGCCGGTAATAAA-3', reverse, 5'-TCGTTGTACCAGCCATTGTAG-3', probe: VIC-CCCTTATGACCTGGGCTACACACG-MGBNFQ.
[0160] The PCR cycling protocol consisted of 45 seconds at 94°C, 1 minute at 62°C, and 30 seconds at 68°C for 40 cycles.
[0161] qPCR for cpa abundance includes the following primers and fluorogenic probe: cpa, forward: 5'-CTTGGAGAGGCTATGCACTATTT-3', reverse: 5'-TTGCAACCTGCTGTGTTTATTT3', probe: 6-FAM-TTACTGCCGTTGATAGCGCAGGAC-TAMRA; Universal 16S rRNA, forward, 5'-GCGAGACTGCCGGTAATAAA-3', reverse, 5'-TCGTTGTACCAGCCATTGTAG-3', probe: VIC-CCCTTATGACCTGGGCTACACACG-MGBNFQ.
[0162] The PCR cycling protocol consisted of 45 seconds at 94°C, 1 minute at 62°C, and 30 seconds at 68°C for 40 cycles.
[0163] qPCR for C. perfringens abundance includes the following primers and fluorogenic probe: C. perfringens -specific 16S rRNA, forward: 5′-AGATGGCATCATCATTCAAC-3′, reverse: 5′-GCAAGGGATGTCAAGTGT-3′, probe: 6-FAM-AGAGTGCAGGAGAGGAGAGTGGAA-TAMRA; Universal 16S rRNA, forward, 5'-GCGAGACTGCCGGTAATAAA-3', reverse, 5'-TCGTTGTACCAGCCATTGTAG-3', probe: VIC-CCCTTATGACCTGGGCTACACACG-MGBNFQ.
[0164] The PCR cycling protocol consisted of 45 seconds at 94°C, 1 minute at 58°C, and 1 minute 15 seconds at 68°C for 40 cycles.
[0165] qPCR for etx / cpa ratio includes the following primers and fluorogenic probe: ebc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM-AGCAACTGCTAAGTTTACTGTTCCT-TAMRA; cpa, forward: 5′-GCATGAGTCATAGTTGGGATGA-3′, reverse: 5′-CTGATGGATCATTACCCTCTGATAC-3′, probe: VIC-TGGGACTATGCAGCAAAGGTAACTTTAGC-MGBNFQ.
[0166] The PCR cycling protocol consisted of 45 seconds at 94°C, 1 minute at 62°C, and 30 seconds at 68°C for 40 cycles.
[0167] Bacterial strains and cultures This study utilized multiple C. perfringens strains. Type B strain ATCC3626 was purchased from ATCC. Four other collected strains were provided by Francisco Uzal: three type D strains CN3842, NCTC8346, and FU17, and one type B strain NCTC3110. Type D strain FU17 was isolated from the intestine of a goat with clinical endotoxemia, including cerebral perivascular edema (4). All strains isolated in this study, including the type D strain SHDS0050, were grown and maintained at 37°C with 40% humidity in a Whitley A35 HEPA anaerobic workstation in rapid perfringens medium (RPM) (3% fluid thioglycollate medium, 6% gelatin, 0.5% peptone, 0.5% dextrose, 0.5% dibasic potassium phosphate, 0.3% yeast extract, 0.15% sodium chloride, 0.05% ferrous sulfate, and 440 mg / mL D-cycloserine) ( 5 ).
[0168] Genome sequencing preparation and analysis To understand the etx plasmid architecture of strain SHDS0050 and compare it to other etx-producing strains, pure cultures of C. perfringens strains ATCC 3626, CN 3842, FU17, NCTC 3310, NCTC 8346, and SHDS0050 were grown overnight in RPM, and total genomic DNA was isolated from each strain. DNA library preparations were performed for both Illumina (short reads) and Oxford Nanopore sequencing (long reads) with 50x coverage for each. Illumina libraries were generated using the Nextera Flex Protocol (now renamed Illumina DNA Prep).
[0169] 250ng of genomic DNA for each sample was diluted to 10µl and loaded into library prep. The DNA was fragmented, cleaned, and amplified using IDT indexing for multiplexing. Samples were run on a NovaSeq S4 Flow Cell at PE150, and reads were demultiplexed using Illumina BaseSpace software. Nanopore libraries were generated using the LSK-109 ligation sequencing kit from Oxford Nanopore and run on a PromethlON sequencing device. Briefly, 1µg of DNA was diluted to 48µl and loaded into library prep using the LSK-109 kit from Oxford Nanopore. Adapters were ligated to the DNA, followed by motor protein ligation. The library was loaded into a PromethlON Flow Cell PRO-002 and run for 64 hours. Reads were demultiplexed using Guppy software from Oxford Nanopore integrated into the PromethlON device. Nanopore reads were assembled using the Flye 2.8 assembler in 10 iterations. Flye assemblies with Nanopore reads were refined using Medaka 1.0.3 (Oxford Nanopore Technologies Ltd.). To further clean the assembly, Illumina reads were trimmed, quality controlled via Fastp 0.20.0, and mapped to the Medaka-refined genome using Burrows-Wheeler Aligner (BWA) 0.7.17. These alignments were used to further refine the genome with Pilon 1.23. Both Illumina and Nanopore reads were then assembled into a hybrid assembly using SPAdes 3.13. Chromosomes were circularized using Circlator 3.0 or by aligning the SPAdes assembly to a more contiguous Flye assembly.To ensure that the plasmids were circular, the plasmid sequences from the refined Flye assembly were aligned to the SPAdes assembly using Mauve, and the SPAdes assembly was used to fill gaps and circularize the plasmids. Chromosome assemblies were compared using the BLAST Atlas function in GView.
[0170] Bacterial culture conditions for pETX production Frozen cultures stored at -80°C in 50% RPM / 50% glycerol stocks were streaked onto BBL™ Schaedler Agar (BD) with vitamin K1 and 5% sheep blood and placed in a BD GasPak EZ anaerobic pouch system, where they were grown at 37°C for at least 48 hours. A large inoculum was used to start a 13 mL RPM culture, which was incubated at 37°C for 6 hours under anaerobic conditions. 3 mL of the 6-hour RPM culture was used to inoculate 10 mL of TGY broth (3% tryptic soy broth, 1% yeast extract, 0.1% sodium thioglycolate). The TGY culture was incubated overnight at 37°C. To harvest the conditioned medium, the overnight TGY culture was centrifuged at 12,000 rcf for 10 minutes, and the supernatant was carefully collected without disturbing the bacterial pellet. The harvested medium was stored at -20°C until use. Sterile broth was used as a negative control. Note that direct inoculation into TGY broth did not result in growth when this protocol was used.
[0171] Western blot analysis of pro-ETX production A total of 10 μl of conditioned TGY broth was loaded onto the gel. 10 μl of sterile TGY broth was used as a negative control. 10 ng of pETX in 110 μl of PBS or TGY broth was used as a positive control. All samples were prepared in 2x Laemmli sample buffer (Bio-Rad) containing 5% 2-mercaptoethanol (Bio-Rad) and heated at 95°C for 5 minutes before loading onto a 4-20% Mini-PROTEAN TGX Stain-Free Gel (Bio-Rad). 5 μl per lane of WesternSure Pre-stained Chemiluminescent Protein Ladder (Licor) was used as a molecular weight standard. The gel was run at 200 V for 30 minutes in Tris / glycine SDS buffer (Bio-Rad). Semi-dry transfer was performed in transfer Tris / glycine buffer (Bio-Rad) using a Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell system (Bio-Rad) at 15 V for 15 min. Blots were blocked in 5% Blotting-Grade Blocker nonfat milk (Bio-Rad) in Tris-buffered saline with Tween 20 (TBS-T, Cell Signaling Technology) for 30 min at room temperature. Blots were then incubated overnight at 4°C with anti-ETX antibody JL008 (16) at 0.211 μg / mL in blocking solution. Blots were washed at room temperature with TBS-T and incubated for 1 h at room temperature with secondary antibody peroxidase-conjugated Affinipure goat anti-rabbit IgG H+L (Jackson ImmunoResearch) at 0.0241 μg / mL in blocking solution. Blots were washed again in TBS-T and developed in SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific) for 5 minutes at room temperature. Developed blots were visualized on 5x7 CL-XPosure Films (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX-101A film processor.
[0172] ETX activation Culture supernatant or epsilon pro-toxin purified from culture supernatant of C. perfringens strain 34 (type B) was activated with immobilized TPCK trypsin according to the manufacturer's protocol. Each batch of activated ETX was normalized for activity by assessment of cytotoxicity using a CHO cell line expressing rMAL. Epsilon pro-toxin from C. perfringens, strain 34 (type B), NR-856, was obtained through BEI Resources, NIAID, NIH.
[0173] hMAL-CHO cell sensitivity assay The collected TGY broth was incubated with an equal volume of 0.25% trypsin-EDTA solution (Gibco) at 37°C for 2 hours. Sterile TGY broth was used as a control. Trypsin activity was stopped by adding FBS to a total FBS percentage of 25% (i.e., 25 μL of FBS was added to 100 μL of TGY / trypsin solution). 50 μL of trypsinized TGY broth was used to treat confluent hMAL-CHO cells seeded in 200 μL of CHO cell culture medium (Dulbecco's Modified Eagle's Medium / Ham's F12 medium (Life Technologies) with 10% heat-inactivated fetal bovine serum, Glutamax, and 50 units / ml penicillin and 50 μg / ml streptomycin) in a 96-well plate. A portion of the trypsinized TGY broth was treated with 50 μg / mL of the neutralizing anti-ETX antibody JL004 for 20 minutes before treatment with CHO cells. CHO cells were treated overnight at 37°C. To assess cell death, cells were treated with 50 μg / mL of propidium iodide (PI, Sigma). Live images of randomly selected fields within each well were acquired under an inverted fluorescence microscope (Nikon, Minato, Tokyo, Japan) equipped with a Charged Coupled Device (CCD) camera (Carl Zeiss, Oberkochen, Germany) imaged with Spot software and then imported into ImageJ64 in 8-bit gray format. For quantification of PI-positive cells, images were converted to binary images by applying the same threshold to all images collected from the same experiment. The particle analysis function was selected to automatically count the number of particles. Data were exported and analyzed in Excel (Microsoft) and Prism version 9.0.2 (Graphpad).
[0174] EAE induction and clinical scoring Eight- to ten-week-old female C57BL / 6 mice received subcutaneous (sc) injections of 200 µg of synthetic mouse / rat MOG35-55 (MEVGWYRSPFSRVVHLYRNGK) emulsified in 5011.1 ml of complete Freund's adjuvant and supplemented with 200 µg of heat-inactivated M. tuberculosis H37Ra (TB). On days 0 and 2, 150 ng of pertussis toxin or ETX at 50 or 500 ng / kg body weight were administered via intraperitoneal injection. Animals were weighed and scored daily. The classical EAE assessment was based on a previously published scale and was as follows: 0 indicates no physical signs of disability, 0.5 indicates loss of tail tone or distal tail limpness, 1 indicates complete tail droop, 2 indicates both tail droop and hindlimb weakness / limpness, 3 indicates hindlimb paralysis, 4 indicates complete hindlimb paralysis and partial forelimb paralysis, and 5 indicates moribundity or death. Peak, mean, and cumulative scores were calculated to assess the severity of EAE.
[0175] Atypical EAE was assessed separately from the classic EAE symptoms described above and based on a previously published scale with modifications, specifically: 0, no disease; 1, hunched appearance, stiff tail, slight head tilt; 2, stumbling gait, scruffy coat; 3, obvious balance / locomotor impairment with irregular stumbling and side-to-side wobbling, slight axial rotation; 4, severe axial rotation, spinning, severe body leaning, falling; and 5, moribund. As diseased mice experienced ascending paralysis, assessing ataxia, a hallmark of atypical EAE, became increasingly impossible and unreliable. Therefore, the endpoint for atypical EAE assessment was set at the peak of classic EAE, which ranged from 17 to 21 days.
[0176] Histological analysis Mice were anesthetized with a ketamine / xylene cocktail, followed by transcardial perfusion with PBS and 4% PFA. The brains and spinal cords were removed, processed for paraffin embedding, and sectioned at 5 μm thickness. Sections were stained with hematoxylin and eosin to assess overall morphology and lymphocytic infiltration. Inflammatory parameters were evaluated on the following scale: 0, no signs of inflammation; 1, scattered inflammatory cells; 2, some inflammatory cells and nuclear clumps; 3, perivascular inflammatory cell infiltration; and 4, significant inflammatory cell infiltration into the parenchyma. Consecutive sections were stained with Luxol Fast Blue (LFB) for myelin. The size of the demyelinated area and the number of infiltrating inflammatory cells were measured using ImageJ software (National Institutes of Health, USA). A universal threshold was applied to images across all sections in all conditions. The area of LFB staining intensity was threshold-limited, while the total area of white matter was measured without thresholding. Myelin integrity was defined by the ratio of the LFB stained area within the WM (pixels with thresholding) to the total area of the WM (pixels without thresholding) and is expressed as a percentage.
[0177] Immunohistochemical analysis Paraffin-embedded sections from EAE and control mice were submitted to Histowiz (New York, NY) for immunohistochemical staining for CD4, CD45, CD68, and hosho-NFKB expression. Quantification of staining signals was performed using Image J software (National Institutes of Health, USA), and integrated intensities were used for statistical analysis using Prism 9.
[0178] electron microscope Mice were anesthetized with a ketamine / xylene cocktail and transcardially perfused with EM fixative 4% PFA, 2.5% glutaraldehyde, and 0.1 M sucrose in 0.1 M PB and 0.1 M MP. Immediately after perfusion, the brain and lumbar spinal cord were removed and cut into 2 mm-thick brain slices and spinal cord segments. The trimmed tissue was immersed in the above fixative for 2 days before tissue processing at the Electron Microscopy Core at New York University. Semithin sections were cut at 1 μm thickness and stained with turidine to identify target regions using light microscopy. The target regions were then trimmed, reoriented, and embedded in epoxy resin. Ultrathin (70 nm) transverse sections were cut, stained with uranyl acetate and lead citrate, and imaged under a transmission electron microscope (JEOL, MA).
[0179] Structural analysis of myelin Electron microscopic analysis was performed to determine changes in the myelin sheath in EAE and control mice according to standard protocols. Tissue processing, preparation of semithin and ultrathin sections, and imaging were performed at the Electron Microscopy Core at New York University. For quantification, 30–40 electron micrographs from 12 randomly selected fields from each mouse were imaged at both low (4,000x) and high (40,000x) magnification, and 12 of these micrographs of adequate quality were used for analysis using Image J. Parameters used to assess demyelination included counting unmyelinated / demyelinated axons and morphological abnormalities of the myelin sheath and axons. Unmyelinated / demyelinated axons were defined as axons of appropriate diameter without complete coverage of at least one oligodendrocyte process. Demyelination was measured per field and in area units (mm) using Image J. 2The results were expressed as the average number of unmyelinated axons per 1000 cells / mole. Axon degeneration was assessed based on a previously published classification scheme (21). According to this scheme, degenerated axons were identified as: a) myelin profiles lacking axons (axonolysis due to either vacuolation or condensation); b) swollen axons lacking organelles and neurofilaments; c) axons containing swollen mitochondria or mitochondria with disrupted cristae; and d) axonal profiles with electron-dense cytoplasm, likely due to increased cytoskeleton or neurofilament density. Quantification of the staining signal was performed using Image J software (National Institutes of Health, USA), and integrated intensities were used for statistical analysis using Prism 9.
[0180] Isolation of cells from mouse lymph nodes and CNS, and antigen recall assay Mice were euthanized, and lymph nodes (cervical and inguinal) and central nervous systems (CNS, brain, and spinal cord) were immediately collected by dissection and maintained on complete RPMI medium containing 10% FBS, penicillin-streptomycin, L-glucan, HEPES, and p-mercaptoethanol. Lymph nodes were dissociated using a syringe plunger and passed through a cell strainer (70 p.m.). CNS tissue was finely pulverized with a razor blade and digested in HBSS (Sigma Aldrich) with collagenase D (2 mg / ml; Roche Diagnostics) and DNase 1 (0.1 mg / ml; Sigma) in an incubator shaker for 20 minutes at 37°C. Mononuclear cells were further purified by passing through a cell strainer (70 p.m.) and concentrated by 30% / 70% Percoll gradient centrifugation (GE Healthcare). Where indicated, to determine antigen recall responses, bulk cell suspensions were cultured with exogenous MOGp35-55 (50 μg / mL) at 37 °C for 72 h before analysis of cytokine production by flow cytometry.
[0181] CNS endothelium isolation, RNA extraction, sequencing, and RNA sequencing analysis Mice were treated with PBS, ETX (0.51 μg / kg body weight), or PTX (51 μg / kg body weight) for two consecutive days. Sixteen hours after the second dose, CNS endothelial cells were isolated from the spinal cord or brain with the cerebellum removed as previously described. Briefly, CNS tissue was enzymatically dissociated with papain solution, followed by vigorous trituration and a second dissociation with collagenase and dispase solution. Myelin was removed using Miltenyi Biotec Myelin Removal Beads II according to the manufacturer's instructions. Isolated cells were stained with anti-CD31 clone 390, anti-CD45 clone 30-F11 (and CD1 lb clone M1 / 70), anti-CD13 clone R3-242, anti-PDGF beta clone APB%, and DAPI. Viable endothelial cells positive for CD31 only (DAPI-) (CD31+, CD45-, CD1 lb-, CD13-, and PDGF beta-) were sorted via FACS using a BD Biosciences FACSAria II Cell Sorter. RNA was extracted from sorted endothelial cells using Qiagen's RNeasy Plus Micro Kit according to the manufacturer's instructions. Total RNA integrity was checked using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). cDNA synthesis and amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA, Mountain View, CA). The PCR was performed using a PCR-based PCR kit (Illumina, San Diego, CA, USA) starting with less than 1 ng of total RNA from each sample. 150 pg of qualified full-length double-stranded cDNA was used and processed for Illumina library construction using the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA). Normalized cDNA libraries were then pooled and sequenced on an Illumina NovaSeq6000 sequencer using 100 paired-end cycles. Raw sequencing reads in BCL format were processed through bcl2fastq 2.19 (Illumina) for FASTQ conversion and demultiplexing.
[0182] Raw reads were quality checked with FastQC v0.11.7. Reads were aligned to the mouse reference genome (GRCm38.p6) using STAR v2.7.6a with default parameters. Gene abundance was calculated with featureCounts v2.0.1 using a composite gene model from Gencode release vM25. Differential expression analysis was performed in R using limma (v3.50.3) after removing low-expressing genes with the filterByExpr function from edgeR (v3.36.0). Briefly, a linear model was fitted to the treatment information to create a design matrix, followed by empirical Bayes adjustment of the t-statistic. Raw P values were adjusted for multiple testing using the Benjamini & Hochberg method, and only genes with an adjusted p<0.10 were considered differentially expressed. Differentially expressed genes for the ETX vs. PBS contrast were analyzed using Ingenuity Pathway Analysis (IPA, QIAGEN Inc., Pathway Analysis, version 0121-03). The core analysis settings included all available data sources from human, mouse, or rat species. Expression heatmaps were generated using pheatmap (R package version 1.0.12.0) using log2 counts per million (CPM), with values centered and scaled row-wise. All scripts and code used to generate bulk RNA-seq-based figures can be found online at github (abcwcm / Vartanian2023).
[0183] Example 8: Primary human lymphocytes express Mal To confirm Mal gene expression in T cell lineages, real-time quantitative PCR (RT-qPCR) for human Mal was performed on isolated CD4+, CD8+, and B cells (Figure 19A). Mal gene expression was normalized to CD4+ cells. RT-qPCR analysis confirmed that CD4+ cells had the highest amount of Mal gene expression compared to isolated CD8+ and B cells (Figure 19A). In addition, CD8+ cells showed a tendency to express significantly more Mal than B cells.
[0184] To determine whether the low Mal expression observed in our isolated B cell populations was the result of T cell contamination, we compared Mal expression results with those of other publicly available datasets using various cell isolation and gene expression techniques (Supplementary Figure S1). Isolation methods included FACS sorting (Figure 24A, B), positive magnetic selection (Figure 24C), and single-cell RNA-seq analysis (Figure 24D-F), while Mal expression was assessed using RNA-seq (Figure 24A, B, D) and microarray (Figure 24C). Examination of these four independent datasets confirmed significantly higher Mal gene expression in CD4+ cells, followed by CD8+ cells, and finally CD19+ / B cells. These results also showed low, but still detectable, levels of Mal transcripts in CD19 / / B cells, consistent with the RT-qPCR results disclosed herein. Based on these findings, the RT-qPCR results were considered accurate.
[0185] Example 9: ETX binds to human lymphocytes with a preference for CD4+ cells To determine whether ETX bound to human lymphocytes expresses MAL, PBMNCs were probed with 50 nM Alexa Fluor 647 pETX (pETX-647) for 2 h, and binding to CD4+, CD8+, and CD19+ cells was assessed by multicolor flow cytometry (Figure 20A-C). pETX was used to study ETX binding because it bound with similar affinity to active ETX but did not oligomerize to form pores, preventing endosomal recycling and potential cell surface relocation of MAL. Untreated cells (0 nM) were used as a negative control. Scatter plots (Figure 20A) and histogram analysis of pETX-647 fluorescence intensity (Figure 20B) revealed that CD4+ cells bound more toxin than CD8+ and CD19+ cells. In addition, CD8+ cells bound more toxin than CD19+ cells.
[0186] To quantify ETX binding to target cells, pETX-647 binding was quantified via flow cytometry 2 hours after incubation with 25 nM pETX-647. Significantly more CD4+ cells were positive for pETX-647 compared with CD8+ and CD19+ cells; 82.3%, 60.3%, and 24.7%, respectively (Figure 20C). Even when cells were incubated with 25 nM pETX-647 for 15 minutes, 50.1%, 30.0%, and 18.2% of CD4+, CD8+, and CD19+ cells, respectively, were positive for pETX-647. This trend was observed for all time points examined.
[0187] The prototoxin ETX-647 was observed to bind to CD4+ cells at concentrations as low as 1 nM (Figure 20D). PBMNCs were incubated with 1 nM pETX-647 for 2 hours, and the percentage of positive cells was assessed by flow cytometry. Untreated cells (0 nM) were used as a negative control. No significant differences in CD8+ or CD19+ were observed when cells were treated with or without 1 nM pETX-647. In contrast, significantly more CD4+ cells were positive for pETX-647 when treated with 1 nM pETX-647 than when not treated, 0.34% vs. 0.07%, respectively.
[0188] To confirm that pETX binding to lymphocytes was pETX-specific, pETX-647 was pretreated with an anti-ETX antibody, which has been shown to block ETX binding. Binding to all lymphocytes was inhibited when culture medium containing pETX-647 was pretreated with the anti-ETX antibody (Figure 19E). To ensure that the fluorescent signal observed in lymphocytes was not due to excess fluorophore from the pETX-647 labeling process, PBMNCs were treated with Shiga toxin (STX) fluorescently conjugated with Alexa Fluor 647 (STX-647) using the exact same labeling process (Figure 26). When PBMNCs were incubated with 50 nM STX-647 for 2 hours, only a small percentage of lymphocytes bound STX-647, less than 2%. Importantly, the percentage of CD19+ cells positive for STX-647 was significantly higher than that of CD4+ or CD8+ cells, 1.64%, 0.19%, and 0.01%, respectively, confirming previous results that B cells have increased affinity for STX. The low percentage of STX-647-positive cells indicated minimal contamination of lymphocytes with excess dye upon treatment with Alexa Fluor-conjugated 647 toxin.
[0189] Finally, we sought to confirm that probing cells with pETX is a reliable marker for ETX binding. PBMNCs were probed with 25 nM ETX or pETX for 2 h, and binding was determined using affinity-purified anti-ETX polyclonal rabbit antibody and PE-conjugated anti-rabbit IgG and examined by flow cytometry (Figure 20F). Cells treated without ETX were used as a control. No significant differences in ETX and pETX binding were observed. Similar results were obtained when cells were probed with 5 nM, 10 nM, and 50 nM ETX or pETX (data not shown). This confirmed previously published results that pETX and ETX bind similarly to target cells.
[0190] Taken together, this data demonstrates that ETX specifically binds to human primary lymphocytes with a preference for CD4+, followed by CD8+, and then CD19+ cells. Importantly, ETX binding positively correlates with Mal gene expression.
[0191] Example 10: ETX binding to human lymphocytes is dose- and time-dependent To determine whether ETX binding to lymphocyte subsets was dose- and time-dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM pETX-647 for 15, 30, 60, and 120 min. After 15 min of incubation, pETX was observed to bind to CD4+, CD8+, and CD19+ cells in a dose-dependent manner (Figure 21A). For a complete breakdown of p values between different doses, see Supplementary Table S1. After 15 min, significantly more CD4+ cells were positive for ETX when treated with 10 nM (11%), 25 nM (50%), and 50 nM (75%) compared with the untreated control (0%) (Figure 21A). In contrast, a significant increase in ETX-positive CD8+ and CD19+ cells was not observed until treatment with 25 nM pETX-647. When PBMNCs were incubated with pETX-647 for 120 min, significantly more CD4+ cells were positive for ETX at 5 nM (41%), 10 nM (62%), 25 nM (83%), and 50 nM (90%) compared with untreated controls (0%) (Figure 21B). In contrast, a significant increase in pETX-647-positive CD8+ and CD19+ cells was not observed until cells were treated with 10 nM pETX-647. A similar trend was observed when cells were incubated with pETX-647 for 30 and 60 min (Supplementary Figures 27A and 27B, respectively). These data indicated that ETX binding to all lymphocyte subsets was dose-dependent and reaffirmed that ETX preferentially binds to CD4+ cells compared with CD8+ and CD19+ cells.
[0192] For CD4+ cells, significant differences in ETX binding at different time points were observed when cells were treated with 1 nM, 5 nM, 10 nM, or 25 nM pETX-647 (Figure 21C). Notably, after 15 min of 1 nM treatment, 0.021% of CD4+ cells were positive for ETX. After 60 and 120 min, significantly more CD4+ cells were positive for pETX: 0.060% and 0.067%, respectively. In contrast, with 5 nM treatment, 3.2%, 8.1%, 23.8%, and 40.9% of CD4+ cells were positive for pETX after 15, 30, 60, and 120 min of incubation, respectively. Similar trends were observed for the 10 nM and 25 nM doses. With 50 nM pETX-647 treatment, pETX binding to CD4+ cells appeared to be saturable, as there was no significant difference between any of the time points. Similar results were observed with CD8+ cells (Figure 21D), with the clearest time-dependent binding occurring with 10 nM pETX-647 treatment. In total, 4.4%, 17.2%, 21.6%, and 34.2% of CD8+ cells were positive for pETX after 15, 30, 60, and 120 minutes of incubation, respectively. Again, pETX binding appeared to be saturable for all time points with 50 nM treatment for CD8+ cells. ETX binding was observed on CD19+ cells, but binding did not appear to be time-dependent under these conditions (Figure 21E). These data showed that ETX binding to CD4+ and CD8+ cells was time-dependent and again confirmed that ETX binds preferentially to CD4+ cells compared with CD8+ and CD19+ cells.
[0193] Example 11: ETX induces cytotoxicity in human lymphocytes, especially CD4+ cells To determine whether ETX binding to human lymphocytes confers cytotoxicity, total lymphocytes were assessed for cell death by propidium iodide (PI) inclusion via flow cytometry (Figures 22A and B). Cells positive for (PI+) were considered dead. Four hours after active ETX treatment, only a small percentage of cell death was observed: 1.4% (Figure 22C). A significant increase in total lymphocyte cell death was observed at ETX doses of 25 nM and 50 nM: 11.5% and 17.8%, respectively. Importantly, pretreatment of ETX with a neutralizing antibody that blocks ETX cytotoxicity inhibited ETX-induced cell death (Figure 22D).
[0194] To determine whether lymphocyte populations expressing higher levels of MAL are more susceptible to ETX-induced cytotoxicity, cell death was assessed in CD4+, CD8+, and CD19+ cells by flow cytometry (Figure 22E). When treated with 25 nM ETX for 4 h, cell death was significantly higher in CD4+ cells compared with CD8+ and CD19+ cells using PBMNCs: 19.6%, 6.5%, and 3.0%, respectively. Similar results were observed when cells were treated with 50 nM ETX using CD4+, CD8+, and CD19+ cells, which showed cell death of 35.1%, 13.9%, and 1.9%, respectively. In addition, CD8+ cell death was significantly higher than CD19+ cell death. Taken together, these data demonstrated that active ETX induces cell death in CD4+ and CD8+ cells and is positively associated with Mal gene expression.
[0195] Example 12: ETX-induced cytotoxicity in human CD4+ cells is time- and dose-dependent To determine whether ETX-induced cytotoxicity in CD4+ cells is dose-dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM of active ETX for 4 hours (Figure 22F). A significant increase in the percentage of cell death was observed at doses of 25 nM (19.6%) and 50 nM (35.1%) compared to the untreated control (0.82%). Cell death at 50 nM was significantly higher than that at 25 nM. This indicated that ETX-induced cell death of CD4+ cells is dose-dependent.
[0196] To determine whether ETX-induced cell death of CD4+ cells was time-dependent, PBMNCs were incubated with the indicated doses of ETX for 30, 60, 120, and 240 min (Figure 22G). At doses as low as 1 nM, a significant increase in CD4+ cell death was observed from 30 min to 4 h: 0.55% and 1%, respectively. At a dose of 5 nM, a significant increase in CD4+ cell death was observed from 30 min to 4 h: 0.47% and 1.21%, respectively. Cell death was significantly higher at larger ETX doses. With 50 nM ETX treatment, cell death was 0.84%, 2.06%, 18.06%, and 35.07% after 30 min, 60 min, 2 h, and 4 h of treatment, respectively. This data indicated that ETX induces CD4+ cell death in a time-dependent manner.
[0197] Example 13: ETX-induced cytotoxicity in human lymphocytes is mediated by pore formation It has been proposed that ETX-induced cell death is mediated by pore formation in sensitive cell lines. To determine whether ETX pore formation occurs in primary human lymphocytes, whole-cell lysates from PBMNCs treated with 0, 10, 25, or 50 nM ETX for 2 hours were evaluated by Western blot (Figure 23A). Control and lysates from ETX-treated rMAL-CHO cells, which are known to form a 150 kDA ETX pore complex, were used as positive controls. The 150 kDA pore complex was only observed when PBMNCs were treated with 50 nM ETX (Figure 23A). In addition, a 27 kDA band could be observed in all cell lysates treated with 50 and 25 nM ETX, indicating bound ETX monomer, since all cells were thoroughly washed in PBS before lysis. Pore formation appeared to be time-dependent when cells were treated with 50 nM ETX for 30, 60, and 120 min (Figure 23B), indicating that ETX-mediated cytotoxicity of PBMNCs was mediated by pore formation.
[0198] Example 14: Consideration of Examples 8 to 13 ETX binding and cytotoxicity are positively associated with Mal expression in human lymphocytes Disclosed herein is the demonstration that ETX binding and cytotoxicity to primary human lymphocyte populations are positively correlated with Mal gene expression. Specifically, CD4+ cells have the highest amount of MAL gene expression, followed by CD8+ and then B cells. Thus, ETX preferentially binds to and kills CD4+ cells, followed by CD8+ and then CD19+ cells.
[0199] Mal expression in CD4+, CD8+, and B cells was first confirmed using RT-qPCR. Results demonstrated that CD4+ cells had the highest amount of Mal gene expression, followed by CD8+ cells and then CD19+ cells. Increased Mal gene expression in CD4+ cells was also confirmed using publicly available datasets. Second, we demonstrated that ETX binds to human lymphocytes with a preference positively associated with Mal expression. When lymphocytes were incubated with 25 nM pETX-647 for 2 hours, 82.8% of CD4+, 60.3% of CD8+, and 24.7% of CD19+ cells bound pETX. In addition, pETX binding occurred in a dose- and time-dependent manner. Finally, we demonstrated that ETX induces lymphocyte cell death. When lymphocytes were incubated with 50 nM active ETX for 4 hours, 35.1% of CD4+ and 13.9% of CD8+ cells exhibited cell death; no significant cell death was observed in CD19+ cells. ETX-induced cell death of CD4+ cells was also dose- and time-dependent. Taken together, this data indicated that ETX binding and cytotoxicity to human lymphocytes were positively correlated with Mal expression. Alternatively, the increased binding and activity of ETX to CD4+ cells may also be the result of CD4 expression itself. In a single experiment, ETX was observed to bind to recombinant human CD4 immobilized on Dynabeads, raising the possibility that CD4+ affinity and sensitivity to ETX may be a combination of both CD4 and MAL expression. Importantly, other ETX-sensitive cell lines, including MDCK and ACHN cells, also express MAL. Taken together, these observations supported the theory that MAL is the primary receptor for ETX.
[0200] MAL expression in human lymphocytes MAL expression in CD4+ and CD8+ cells was consistent with previously published results, looking at both peripheral blood lymphocytes and various cell lines of T and B cell lineages. Using a privately generated anti-MAL antibody, Copie-Bergman et al. demonstrated that 65–90% of CD4+ and 22–39% of CD8+ cells were positive for MAL via flow cytometry. In contrast, the authors did not detect significant amounts of MAL expression on B cells from peripheral blood, tonsils, or spleen: 0–0.6%, 1.5–2%, and 0.6–0.7%, respectively. However, they did observe occasional MAL-positive plasma cells via immunohistochemistry in tonsils or reactive lymph nodes. In addition, other groups have observed MAL expression in various T cell lines but not B cell lineages. The conflicting results for MAL detection in B cells may be the result of technical differences in experimental approach and sensitivity (e.g., protein expression vs. gene expression). However, the results consistently showed that B cells expressed significantly less or no MAL compared to T cells.
[0201] Function of MAL in different lymphocyte populations The reason for the differential expression of MAL in specific lymphocyte populations is unclear. The function of MAL in lymphocytes has been extensively studied only in the T cell lineage. In general, MAL appears to play an important role in the formation and stabilization of lipid rafts and protein trafficking to the apical plasma membrane in polarized cells. In human T cells, MAL is selectively present in glycolipid-enriched membrane microdomains (also known as detergent-resistant membranes) and appears to play an important role in T cell activation, primarily through its interaction with the src-like kinase Lck.
[0202] Src-like kinases, particularly Lck, play essential roles in T cell activation and maturation. Previous studies have shown that MAL and Lck co-immunoprecipitate with each other in lipid-dependent interactions in T cells. Loss of MAL expression results in impaired plasma membrane targeting of Lck. As such, loss of MAL results in defective T cell receptor (TCR) polarization and immunological synapse (IS) organization. MAL targets Lck to the plasma membrane via vesicular trafficking along microtubule tracks, requiring the involvement of inverted Formin2 (INF2), Cdc42, and Rac1. MAL has also been shown to be required for proper receptor and signaling protein assembly at the IS within the supramolecular activation cluster (SMAC). Incorrect localization of MAL results in Lck being transported to the wrong part of the SMAC. Additionally, more recent publications have demonstrated that MAL plays an important role in endosomal trafficking and exosome secretion from T cells.
[0203] Although the function of MAL in B cells is unknown, it is possible that MAL may play a similar role in lipid raft protein organization and signaling in B cells. Lipid rafts play a role in B cell activation and can act as a platform for B cell receptor (BCR) signaling and possibly antigen transport. MAL may play a similar role in Lck or other Src-like kinase transport in B cells. Interestingly, MAL is highly expressed in mediastinal large B-cell lymphoma and a subset of Hodgkin's lymphoma, which has a poor prognosis.
[0204] ETX-induced cell death pathway It is generally accepted that ETX causes cell death through the formation / oligomerization of heptameric pores. ETX pore formation occurs in three sequential steps: (1) binding of ETX to its receptor, (2) oligomerization of the pre-pore complex on the cell surface, and (3) pore insertion into the cell membrane. Pore formation is accompanied by a rapid decrease in transmembrane resistance and the release of intracellular K+ and Cl - This leads to a rapid depletion of Na + and Ca 2+ This is followed by a slower intracellular increase in ETX. ETX also causes a rapid depletion of ATP, leading to permeabilization of the mitochondrial membrane and translocation of apoptosis-inducing factors to the nucleus.
[0205] ETX treatment of PBMNCs as disclosed herein resulted in ETX oligomerization / pore formation, as detected by Western blot. However, the majority of ETX detected in PBMNC lysates was observed as bound monomers, not in pore complexes. It is interesting to note that when PBMNCs were probed with 50 nM pETX-647 for 2 h, 90% of CD4+ cells were positive. However, when cells were treated with 50 nM active ETX for 4 h, only 35% of CD4+ cells died, indicating a significant difference in ETX binding to cell death in CD4+ cells at this dose and time point. Alternatively, in rMAL-CHO cells, a highly ETX-sensitive cell line, we found a closer correlation between ETX binding and ETX cytotoxicity. When rMAL-CHO cells were treated with ETX, the majority of cells bound ETX and also died. For example, cell viability decreased to nearly 0% when treated with 50 nM ETX. In addition, pore formation occurred rapidly (within 5 min when cells were treated with 50 nM ETX) and at very low doses (within 30 min after cells were treated with 1 nM ETX), and the majority of ETX was detected in the scarce complex rather than as a bound monomer, indicating that the low amount of cell death observed in CD4+ cells, despite the high binding percentage, may be due to the low amount of ETX oligomerization / pore formation observed in these cells.
[0206] Possible role of ETX-lymphocyte interactions in MS pathogenesis Based on the limited amount of ETX-induced cell death observed in human lymphocytes, and without being bound by theory or methodology, despite the significantly higher degree of ETX binding, ETX binding to lymphocytes may affect other cellular behaviors in addition to cell death, including various immune functions. Sublethal doses of ETX binding to MAL on human lymphocytes may alter immune function and, in some cases, affect lymphocyte activity in immune-mediated diseases such as MS. CD4+, CD8+, and B cells are all involved in MS pathogenesis, but the precise mechanisms by which they influence MS pathogenesis remain unclear. Pathogenic lymphocytes, including autoreactive and proinflammatory lymphocytes, are thought to be stimulated in the periphery before these cells infiltrate the CNS. Histopathological examination of active MS lesions reveals dense lymphocytic infiltrates in the CNS perivascular space, with more limited extravasation into the CNS parenchyma. These infiltrates are largely dominated by the presence of CD4+ and CD8+ cells, with much lower B cell presence. Based on these observations, MS pathology has historically been considered T cell-driven; however, the widespread success of B cell-depleting therapies in treating MS also highlights the importance of B cells in MS pathogenesis. Due to the role of MAL in T cell activation and the critical role it plays in the immune synapse, it seems possible that ETX binding to MAL could initiate diverse signaling cascades. Indeed, other pore-forming toxins have been shown to induce numerous cell signaling cascades unrelated to membrane permeabilization. However, the effects of ETX on lymphocyte function require further examination and are an area of ongoing research. ETX binding and cytotoxicity to human lymphocytes are positively correlated with MAL gene expression, further confirming that MAL is the primary receptor for ETX.
[0207] Example 15: Materials and Methods for Examples 8-13 Peripheral blood isolation from healthy controls Peripheral blood samples were collected from healthy controls via the antecubital vein using BD Vacutainer K2 EDTA 7.2 mg blood collection tubes in accordance with Institutional Review Board protocol number 1003010940. At the time of donation, healthy controls were free of any chronic or acute illness, were both male and female, ranged in age from 18 to 59 years, and resided in the New York City metropolitan area.
[0208] Isolation of CD4+, CD8+, and B cells from human peripheral blood for RT-qPCR analysis Peripheral blood samples were collected from healthy controls via the cubital vein using BD Vacutainer K2 EDTA 7.2 mg blood collection tubes. Subsets were isolated using the RossetteSep immunodensity negative selection cocktail (Stem Cell Technologies). CD4+, CD8+, and B cells were isolated using the RosetteSep™ Human CD4+ T Cell Enrichment Cocktail, RosetteSep™ Human CD8+ T Cell Enrichment Cocktail, and RosetteSep™ Human B Cell Enrichment Cocktail, respectively, according to the manufacturer's instructions.
[0209] Real-time quantitative PCR (RT-qPCR) analysis Comparative RT-qPCR was performed in an ABI Taqman 7900HT Fast Real-Time PCR machine (Applied Biosystems, CA) using PowerUp SYBRO Green Master Mix (Applied Biosystems, CA, #A25742). Briefly, PCR was performed in a volume of 10 μL at a final concentration of 1× SYBRO Green Master Mix containing 300 nM of forward and reverse primers and 10 ng of cDNA. The primer sequences were as follows: human MAL, F 5′-GGGTGATGTTCGTGTCTGTG-3′, R 5′-ACTGAGGCGCTGAGGTAAAA-3′; human b-actin, F 5′-CACCAACTGGGACGACAT-3′, R 5′-ACAGCCTGGATAGCAACG-3′. The PCR reaction steps were as follows: 50°C for 2 minutes, 95°C for 2 minutes, and 40 cycles of 95°C for 15 seconds, followed by 60°C for 1 minute. Subsequent dissociation curve measurements were performed at 60°C to 95°C. All samples were run in triplicate. PCR data were analyzed using 7900 SDS v2.4.1 software (Applied Biosystems, CA). Relative gene expression was analyzed using double delta Ct analysis (2 -ΔΔCt ) was performed. B-actin Ct values were used as an internal control, and gene of interest (GOI) expression was normalized to CD4+ cell expression.
[0210] Preparation of fluorescently labeled pETX pETX was provided by BEI (epsilon protoxin from Clostridium perfringens, strain type 34B, NR-856) at 0.5 mg / mL with a minimum purity of >95%. pETX was labeled with the Alexa Fluor 647 Protein Labeling Kit (Life Technologies) according to the manufacturer's instructions. The labeled toxin was stored in 50% glycerol stocks (10 μM) at -20°C until use.
[0211] ETX activation pETX, provided by BEI, was activated in-house using immobilized trypsin, TPCK treatment, and agarose resin (Thermo Fischer Scientific). Briefly, 125 μL of resin was washed three times in sodium phosphate buffer (pH 7.98). The resin was suspended in 200 μL of sodium phosphate buffer and combined with 500 μL of BEI pETX (0.5 mg / mL) at 37°C for 2 hours with gentle agitation. The solution was centrifuged at 18,000 rcf for 10 minutes, and the supernatant containing activated ETX was collected. ETX activation was confirmed by treatment of rMAL-CHO cells against an in-house control. The activated toxin (approximately 11 μM) was aliquoted and stored at -80°C until use.
[0212] PBMNC isolation from human peripheral blood for ETX binding and cytotoxicity studies Blood samples were collected from healthy controls via the cubital vein using BD Vacutainer K2 EDTA 7.2 mg blood collection tubes. The samples were allowed to reach room temperature and then diluted with an equal volume of phosphate-buffered saline (PBS) + 2% fetal bovine serum (FBS). The diluted blood was layered on top of Ficoll-Paque PLUS (GE Healthcare Bio-Sciences, Uppsala, Sweden). The tubes were centrifuged at 1200 rcf for 20 minutes at room temperature (no brake). The buffy coat containing peripheral blood mononuclear cells (PBMNCs) was collected using a sterile transfer pipette. The buffy coat was washed with 20 mL of PBS + 2% FBS and centrifuged at 250 rcf for 10 minutes at 4°C. The platelet-containing supernatant was removed by aspiration. The cell pellet was washed with 20 mL of PBS + 2% FBS and centrifuged at 500 rcf for 10 minutes at 4°C. The supernatant was aspirated and the cells were resuspended in CTS™ OpTmizer™ T Cell Expansion Medium (A1048501) supplemented with Glutamax and 5% FBS. Cells were enumerated using a hemocytometer and counted at 1.5 x 10 6 The solution was adjusted to 100 cells / mL. The cells were kept on ice until use.
[0213] Assessment of pETX-647 binding to lymphocyte subsets To determine ETX binding, PBMNCs (1.5 × 10 6 Cells (100 μL / mL) were incubated with pETX-647 at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 15, 30, 60, and 120 minutes at 37°C. In selected experiments, media containing 50 nM pETX-647 was pretreated with or without anti-ETX antibody (JL004) for 30 minutes before cells were treated for 2 hours. At selected time points, 100 μL of cells were transferred to a round-bottom plate containing PBS + 2% FBS and immediately washed with PBS to remove unbound pETX-647. Cells were centrifuged at 500 rcf for 5 minutes. Cells were resuspended in cell staining buffer (Biolegend) containing 5% human TruStain FcX™ Fc receptor blocking solution (BD Bioscience) for 10 minutes. The cells were then probed with FITC-conjugated anti-CD4 multiclones SK3 and SK4 (Biolegend), PE-conjugated anti-CD8β clone 2ST8.5H7 (BD Bioscience), and V450-conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for 20 minutes at room temperature. The cells were washed, resuspended in PBS, and analyzed using a BD FACSVerse flow cytometer. Between pETX-647 treatment and analysis via flow cytometry, the cells were washed a total of three times. Data were collected using FACSuite™ software and analyzed using FlowJo software.
[0214] Evaluation of ETX-induced cytotoxicity in lymphocyte subsets To determine ETX-induced cytotoxicity, PBMNCs (1.5 × 10 6Cells (100 μL / mL) were treated with activated ETX at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 30, 60, 120, and 240 minutes at 37°C. In selected experiments, cells were pretreated with medium containing 50 nM ETX for 30 minutes with or without anti-ETX antibody (JL008) before treatment for 2 hours. At selected time points, 100 μL of cells were transferred to a round-bottom plate containing ice-cold PBS + 2% FBS to stop ETX activity. Cells were immediately washed to remove unbound ETX and centrifuged at 500 rcf for 5 minutes at 4°C. Cells were resuspended in cell staining buffer (Biolegend) containing 5% human TruStain FcX™ Fc receptor blocking solution (BD Bioscience) for 10 minutes. Cells were then probed with FITC-conjugated anti-CD4 multiclones SK3 and SK4 (Biolegend), APC anti-CD8 clone SKI (Biolegend), and V450-conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for 20 minutes at room temperature. Cells were washed, resuspended in PBS containing 2 μg / mL PI, and analyzed using a BD FACSVerse flow cytometer. Data were collected using FACSuite™ software and analyzed using FlowJo software.
[0215] Assessment of pore formation by Western blot analysis PBMNCs (1.5 × 10 6Cells (1000 cells / mL) were incubated with activated ETX at 0, 10, 25, and 50 nM for 120 minutes at 37°C. Alternatively, cells were treated with 50 nM ETX for 30, 60, or 120 minutes. As a positive control for pore formation, rMAL-CHO cells treated with or without 50 nM activated ETX for 30 minutes were used as controls. After treatment, cells were immediately transferred to ice and then washed three times with ice-cold PBS. Cells were lysed for 10 minutes in ice-cold RIPA buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate) using proteinase and phosphatase inhibitors (Cell Signaling Technologies). Samples were centrifuged at 5000 rcf for 5 minutes to pellet nuclei and DNA. The supernatant was collected and used for Western blot analysis. All samples were prepared in 2x Laemmli sample buffer (Bio-Rad) containing 5% 2-mercaptoethanol (Bio-Rad) and heated at 95°C for 5 minutes before loading onto a 4-20% Mini-PROTEAN TGX Stain-Free Gel (Bio-Rad). The gel was run in Tris / glycine SDS buffer (Bio-Rad) at 200V for 35 minutes. Semi-dry transfer was performed in transfer Tris / glycine buffer (Bio-Rad) at 15V for 15 minutes using a Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell System (Bio-Rad). The blot was blocked in 5% Blotting-Grade Blocker nonfat milk (Bio-Rad) in Tris-buffered saline with Tween 20 (TBS-T, Cell Signaling Technology) for 1 hour at room temperature. The blots were then incubated overnight at 4°C with the primary antibody anti-ETX antibody JL004 at 0.34 μg / mL in blocking solution.Blots were washed three times for 5 minutes in TBS-T at room temperature and incubated with the secondary antibody peroxidase-conjugated Affinipure goat anti-rabbit IgG H+L (Jackson ImmunoResearch) at 0.024 μg / mL in blocking solution for 2 hours at room temperature. Blots were washed three times for 5 minutes in TBS-T and developed in SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific) for 5 minutes at room temperature. Developed blots were visualized on 5x7 CL-XPosure Films (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX-101A film processor.
[0216] statistics One-way ANOVA with post-hoc Tukey HSD test was used to determine significance when comparing three or more data points. Unpaired Student's t-test was used to determine significance when comparing only two data points. These cases are indicated in the figure legends.
[0217] The present disclosure is not limited to the exemplary embodiments and applications presented herein or the manner in which the exemplary embodiments and applications operate or are described herein.
[0218] It should be understood that any use of subheadings herein is for organizational purposes and should not be read to limit the application of those subheaded features to various embodiments herein. Each and every feature described herein is applicable and usable in all of the various embodiments discussed herein, regardless of the specific example embodiment described herein, and all features described herein can be used in any contemplated combination. Furthermore, it should be noted that exemplary descriptions of specific features are used primarily for informational purposes and are not intended to limit in any way the design, sub-features, and functionality of the specifically described features.
[0219] Incorporation by Reference The disclosures of each of the references cited herein, including patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.
[0220] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following claims.
Claims
1. 1. A method for the confirmatory diagnosis of multiple sclerosis (MS), the prognosis of MS, the monitoring of MS progression, the monitoring of MS responsiveness to treatment, the prevention of MS, and / or the treatment of MS in a human subject at risk for or suffering from MS, comprising: a) obtaining a fecal sample from said human subject; b) In the obtained fecal samples, the abundance of the epsilon toxin (ETX) gene relative to the abundance of non-ETX strains of C. perfringens in the human subject was determined by real-time quantitative polymerase chain reaction (RT-qPCR). detecting the abundance of the harboring C. perfringens strain; If the abundance of ETX-carrying C. perfringens strains is above the median level for healthy subjects, (i) perform a standard of care MS evaluation on the human subject, (ii) administer a standard of care MS therapy to the human subject, and / or (iii) administer ETX or ETX-1 to the human subject. administering a composition comprising an agent that directly or indirectly disrupts the carriage of C. perfringens strains; If the abundance of the ETX-carrying C. perfringens strain is at or below the median level for healthy subjects, then (i) do not perform a standard of care MS evaluation on the human subject, (ii) do not administer an MS therapy to the subject, and / or (iii) administer ETX or ETX-containing C. perfringens strain to the subject. The method does not involve administering a composition containing an agent that directly or indirectly interferes with the carriage of C. perfringens strains.
2. If the relative abundance of ETX-carrying C. perfringens strains is greater than 0.001%, (i) perform a standard of care MS evaluation on the human subject, (ii) administer standard of care MS therapy to the human subject, and / or (iii) administer ETX or ETX- 10. The method of claim 1, wherein a composition comprising an agent that directly or indirectly disrupts carriage of C. perfringens strains is administered.
3. 1. A method for detecting the relative abundance of epsilon toxin (ETX) gene-carrying strains of C. perfringens in the gut microbiome of a subject, comprising: a) obtaining a fecal sample from a human subject; b) detecting the abundance of epsilon toxin gene (ETX)-bearing strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens in the obtained fecal sample by real-time quantitative polymerase chain reaction (RT-qPCR); The method, wherein the relative abundance of ETX-bearing strains of C. perfringens is detected when the percentage of ETX-bearing C. perfringens strains is greater than 0.001%.
4. If the subject is a human subject at risk for or suffering from multiple sclerosis (MS) and the abundance of an ETX-carrying strain of C. perfringens is detected, (i) perform a standard of care MS evaluation on the subject, (ii) administer a standard of care MS therapy to the subject, and / or (iii) administer ETX or ETX-carrying strain to the subject.
4. The method of claim 3, wherein a composition comprising an agent that directly or indirectly disrupts carriage of C. perfringens strains is administered.
5. 5. The method of claim 3 or 4, further comprising selecting the subject for treatment with a standard of care MS therapy, wherein the subject is at risk for or has MS, and the subject is selected for treatment as detected when the relative abundance of ETX-carrying strains of C. perfringens is greater than 0.001%.
6. 6. The method of any one of claims 2-5, wherein the relative abundance of ETX-bearing strains of C. perfringens in the human subject is greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%.
7. 7. The method of any one of claims 1-6, wherein the abundance of ETX-carrying strains of C. perfringens is determined by detection of the ETX gene, and the abundance of ETX-carrying and non-ETX strains of C. perfringens is determined by detection of genes present in ETX-carrying and non-ETX strains of C. perfringens.
8. 8. The method of claim 7, wherein the gene present in ETX and non-ETX-carrying strains of C. perfringens is a CPA gene or a C. perfringens-specific 16S rRNA gene.
9. In the obtained fecal samples, ETX-carrying strains of C. perfringens (ETX + , and CPA + and / or C. perfringens 16S rRNA + ) and a non-ETX strain of C. perfringens (ETX - , and CPA + and / or C. perfringens 16S rRNA + 9. The method of claim 1, wherein the relative abundance of a protein is measured.
10. 2 -ΔΔCt Analysis shows that non-ETX strains (ETX - , and CPA + and / or C. perfringens 16S rRNA + ) ETX holdings (ETX + , and CPA + and / or C. perfringens 16S rRNA + ) is used to quantify the relative abundance of Optionally, a ratio of 2 to 1 greater than 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9 -ΔΔCt The value indicates the abundance of ETX-bearing C. perfringens strains, and optionally, -ΔΔCt is greater than 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, (i) perform a standard of care MS evaluation on said subject, (ii) administer a standard of care MS therapy to said subject, and / or (iii) administer ETX or ETX- 10. The method of any one of claims 1 to 9, wherein a composition comprising an agent that directly or indirectly disrupts carriage of C. perfringens strains is administered.
11. 2 over 1 -ΔΔCt values indicate ETX with increased ETX plasmid copy number The predominance of the C. perfringens strain was less than 1. -ΔΔCt values indicate a higher percentage of non-ETX C. perfringen strains, and optionally, -ΔΔCt is greater than 1, then (i) perform a standard of care MS evaluation on the subject, (ii) administer standard of care MS therapy to the subject, and / or (iii) administer ETX or ETX- 11. The method of claim 10, wherein a composition comprising an agent that directly or indirectly disrupts carriage of C. perfringens strains is administered.
12. 12. The method according to any one of claims 1 to 11, wherein between steps (a) and (b), bacteria are separated from non-microbial fecal material of the obtained fecal sample.
13. 13. The method of claim 12, wherein the bacteria are separated from the non-microbial fecal material by density gradient centrifugation.
14. 14. The method of any one of claims 1-13, wherein detecting the abundance of the ETX-carrying C. perfringens strain by RT-qPCR comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.
15. 15. The method of any one of claims 1-14, wherein detecting the abundance of the ETX-carrying C. perfringens strain by RT-qPCR comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and / or 5'-ACTCATCTCCCATAACTGCACT-3'.
16. 16. The method of any one of claims 1-15, wherein detecting the abundance of the ETX-carrying C. perfringens strain by RT-qPCR comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT.
17. 17. The method of any one of claims 1-16, wherein detecting the abundance of ETX-carrying C. perfringens strains comprises detecting the relative abundance of CPA-carrying C. perfringens strains by RT-qPCR comprising use of at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.
18. 18. The method of claim 17, wherein detecting the relative abundance of the CPA-carrying C. perfringens strains by RT-qPCR comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TTACTGCCGTTGATAGCGCAGGAC.
19. 19. The method of any one of claims 1-18, wherein detecting the abundance of the ETX-carrying C. perfringens strain comprises detecting the relative abundance of C. perfringens-specific 16S rRNA by RT-qPCR comprising use of at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'-GCAAGGGATGTCAAGTGT-3'.
20. 20. The method of claim 19, wherein detecting the relative abundance of the C. perfringens-specific 16S rRNA by RT-qPCR comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGAGTGCAGGAGAGGAGAGTGGAA.
21. Detecting the abundance of the ETX-carrying C. perfringens strain in the obtained fecal sample includes: an ETX-targeting primer pair comprising, consisting essentially of, or consisting of the sequences 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or the sequences 5'-ACTCATACTGTGGGAACTTCGA-3' and 5'-ACTCATCTCCCATAACTGCACT-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT; and (i) a CPA targeting primer pair comprising, consisting essentially of, or consisting of the sequences 5'-GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TGGGACTATGCAGCAAAGGTAACTTTAGC; and / or (ii) Identifying non-ETX strains (ETX) by RT-qPCR comprising the use of universal 16S rRNA primers comprising, consisting essentially of, or consisting of the sequences 5'-GCGAGACTGCCGGTAATAAA-3' and 5'-TCGTTGTACCAGCCATTGTAG-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence CCCTTATGACCTGGGCTACACACCG. - , and CPA + and / or C. perfringens 16S rRNA + ) ETX holdings (ETX + , and CPA + and / or C. perfringens 16S rRNA + 21. The method of claim 1, comprising quantifying the relative abundance of:
22. The method comprises: (c) obtaining a blood sample from the human subject; and (d) detecting the presence and / or abundance of epsilon toxin (ETX) bound to lymphocytes in said obtained blood sample by flow cytometry, wherein optionally said lymphocytes are CD4 + lymphocytes, and optionally, said detecting by flow cytometry further comprises isolating lymphocytes, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the fluorescently labeled anti-ETX antibody bound to the lymphocytes; 22. The method of any one of claims 1 to 21, optionally wherein the presence and / or abundance of epsilon toxin (ETX) bound to said lymphocytes is detected in said human subject, and optionally proceeding to the performing and / or administering step only if more than 0.2%, 0.5%, or 1% of said lymphocytes are positive for ETX.
23. 1. A method for the confirmatory diagnosis of multiple sclerosis (MS), the prognosis of MS, the monitoring of MS progression, the monitoring of MS responsiveness to treatment, the prevention of MS, and / or the treatment of MS in a human subject at risk for or suffering from MS, comprising: (a) obtaining a blood sample from said human subject; (b) detecting in said obtained blood sample the presence of epsilon toxin (ETX) bound to lymphocytes by flow cytometry, wherein optionally said lymphocytes are CD4 + lymphocytes, optionally wherein said detecting comprises isolating lymphocytes from blood, incubating said isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX; If the presence of ETX bound to the lymphocytes is detected, and optionally, if more than 0.2%, 0.5%, or 1% of the lymphocytes are positive for ETX, then (i) a standard of care MS evaluation is performed on the human subject, (ii) a standard of care MS therapy is administered to the human subject, and / or (iii) a standard of care MS treatment is administered to the human subject. administering a composition comprising an agent that directly or indirectly disrupts the carriage of C. perfringens strains; If there is no or substantially no detectable presence of ETX bound to the lymphocytes, or less than 0.1% or 0.2% of the lymphocytes are positive for ETX, then (i) do not perform a standard of care MS evaluation on the human subject, (ii) do not administer an MS therapy to the subject, and / or (iii) administer ETX or ETX-binding markers to the subject. The method does not involve administering a composition containing an agent that directly or indirectly interferes with the carriage of C. perfringens strains.
24. 1. A method for the detection of epsilon toxin in the blood of a subject, comprising: (a) obtaining a blood sample from said subject; (b) detecting in said obtained blood sample the presence of epsilon toxin (ETX) bound to lymphocytes by flow cytometry, wherein optionally said lymphocytes are CD4 + a lymphocyte, and optionally said detecting comprises isolating lymphocytes from blood, incubating said isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX.
25. If the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and ETX bound to the lymphocytes is detected, and optionally, more than 0.2%, 0.5%, or 1% of the lymphocytes are positive for ETX, then (i) a standard of care MS evaluation is performed on the subject, (ii) the subject is administered a standard of care MS therapy, and / or (iii) the subject is administered ETX or ETX-binding markers.
25. The method of claim 24, wherein a composition comprising an agent that directly or indirectly disrupts carriage of C. perfringens strains is administered.
26. 26. The method of claim 24 or 25, further comprising selecting the subject for treatment with a standard of care MS therapy, wherein the subject is at risk for or has MS, and the subject is selected for treatment as detected when the relative abundance of ETX-carrying strains of C. perfringens is greater than 0.001%.
27. The method comprises: (c) obtaining a fecal sample from the human subject; and (d) in the obtained fecal samples, the abundance of the epsilon toxin (ETX) gene relative to the abundance of non-ETX strains of C. perfringens in the human subject by real-time quantitative polymerase chain reaction (RT-qPCR). further comprising detecting the abundance of the retained C. perfringens strain; 27. The method of any one of claims 23-26, optionally proceeding to a performing and / or administering step only if the abundance of ETX-carrying C. perfringens strains in the human subject is above the median level for healthy subjects or if the relative abundance of ETX-carrying strains of C. perfringens in the human subject is greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%.
28. 28. The method of any one of claims 1 to 27, wherein prior to step (a), the human subject is selected, and the human subject has MS or one or more symptoms of MS.
29. If the abundance of the ETX-carrying C. perfringens strain is above the median level for healthy subjects and / or if the presence of ETX bound to the lymphocytes is detected, the subject is administered ETX or ETX- administering a composition comprising an agent that directly or indirectly disrupts the carriage of C. perfringens strains; 29. The method of any one of claims 1 to 28, thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS in the human subject.
30. 1. A method for treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS in a human subject, comprising: a. selecting a subject for treatment, wherein the subject is at risk for or has MS, and the subject is selected for treatment when the relative abundance of ETX-carrying strains of C. perfringens is detected when the percentage of ETX-carrying C. perfringens strains is greater than 0.001%; b. administering to said subject a standard of care MS therapy and / or administering to said subject ETX or administering a composition comprising an agent that directly or indirectly disrupts the carriage of C. perfringens strains; thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and / or preventing the progression of MS in said human subject.
31. The relative abundance of the ETX-bearing strain of C. perfringens is a. obtaining a fecal sample from the human subject; b) The method of claim 30, wherein the abundance of epsilon toxin gene (ETX)-carrying strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens is detected in the obtained fecal sample by real-time quantitative polymerase chain reaction (RT-qPCR).
32. The relative abundance of the ETX-bearing strain of C. perfringers is a. obtaining a blood sample from said subject; b. detecting the presence of epsilon toxin (ETX) bound to lymphocytes in said obtained blood sample by flow cytometry, wherein optionally said lymphocytes are CD4 + 32. The method of claim 30 or 31, wherein the lymphocytes are lymphocytes, and optionally the detecting comprises isolating lymphocytes from blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing away unbound anti-ETX antibody, and detecting the presence, and optionally the percentage, of lymphocytes positive for ETX.
33. 10. The method of any one of the preceding claims, wherein the standard of care MS assessment comprises magnetic resonance imaging (MRI), evoked potential testing, cerebrospinal fluid analysis, and / or blood tests.
34. said administering to said subject a standard of care MS therapy includes one of the following therapies: (i) an injectable medication that is interferon beta-1a, interferon beta-1b, glatiramer acetate, ofatumumab, or peginterferon beta-1a; (ii) an oral medication that is teriflunomide, monomethyl fumarate, dimethyl fumarate, fingolimod, cladribine, siponimod, ponesimod, fingolimod, diroximel fumarate, or ozanimod; (iii) an infusion medication that is ublituximab, alemtuzumab, mitoxantrone, ocrelizumab, natalizumab-sztn, or natalizumab; and (iv) the method of any one of the preceding claims, comprising administering any one or more of rituximab or glucocorticoids.
35. The subject is administered ETX or 10. The method of any one of the preceding claims, wherein said administering a composition comprising an agent that directly or indirectly interferes with carriage of C. perfringens strains comprises administering to the subject a composition comprising an effective amount of an agent that directly or indirectly interferes with ETX.
36. 36. The method of claim 35, wherein the agent is an inhibitor of ETX.
37. 37. The method of claim 36, wherein the inhibitor is an antibody against ETX or an antigen-binding fragment thereof.
38. The antibody or antigen-binding fragment thereof against ETX is a. Prevents pore formation in ETX; b. Prevents cytotoxicity; c. Removes ETX from circulation; d. Targeting ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP); e. Neutralize ETX, inhibit ETX binding to ETX-binding receptors, and / or f) The method of claim 37, wherein the oligomerization of ETX is inhibited or prevented.
39. 39. The method of claim 37 or 38, wherein the antibody or antigen-binding fragment thereof is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody, or an antigen-binding fragment thereof.
40. The method of any one of claims 37 to 39, wherein the antibody or antigen-binding fragment thereof is a human or humanized antibody, or antigen-binding fragment thereof.
41. 41. The method of any one of claims 37 to 40, wherein the antigen-binding fragment thereof is a nanobody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a dAb fragment, a single-chain antibody, a single-domain antibody, a VHH, a maxibody, a minibody, an intrabody, a diabody, a triabody, a tetrabody, a v-NAR, or a bis-scFv.
42. 36. The method of claim 35, wherein the agent is an inhibitor or antagonist of an ETX binding receptor.
43. 43. The method of claim 42, wherein the ETX binding receptor is expressed on endothelial cells of the blood-brain barrier (BBB).
44. 44. The method of claim 42 or 43, wherein the ETX binding receptor is a tetraspan integral membrane receptor, and the tetraspan integral membrane receptor is myelin and lymphocyte protein (MAL) or hepatitis A virus cellular receptor 1 (HAVcR1).
45. 36. The method of claim 35, wherein the agent is a soluble ETX binding receptor protein, and the soluble ETX binding receptor protein is soluble HAVcR1, soluble MAL, or a fragment thereof.
46. 36. The method of claim 35, wherein the agent is a phage lytic enzyme specific for Clostridium perfringens type B or type D bacterial strains.
47. 47. The method of claim 46, wherein the phage lytic enzyme is muramidase (PlyCM) from strain ATCC 13124.
48. 36. The method of claim 35, wherein the agent is a probiotic strain expressing a phage lytic enzyme specific for Clostridium perfringens type B or type D bacterial strains.
49. 36. The method of claim 35, wherein the agent is a vaccine against Clostridium perfringens type B or D, or ETX produced therefrom.
50. 36. The method of claim 35, wherein the agent is a probiotic supplement comprising C. peifringens type A or other bacterial types that can effectively outcompete Clostridium perfringens types B or D.
51. 36. The method of claim 35, wherein the agent is an antibiotic sufficient to kill C. perfringens types B and / or D.
52. 52. A composition for preventing or treating multiple sclerosis (MS) in a patient in need thereof, comprising a pharmaceutically acceptable excipient and an effective amount of an agent according to any one of claims 35 to 51, optionally wherein the composition is for preventing or treating MS after the detection according to any one of claims 1 to 32.
53. 1. A composition for PCR detection of epsilon toxin (ETX) gene-carrying strains or abundance thereof of C. perfringens, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.
54. 1. A composition for PCR detection of epsilon toxin (ETX) gene-carrying strains or abundance thereof of C. perfringens, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-ACTCATACTGTGGGAACTTCGA-3' and / or 5'-ACTCATCTCCCATAACTGCACT-3'.
55. 55. The composition of claim 53 or 54, further comprising a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT.
56. 1. A composition for PCR detection of CPA-bearing C. perfringens strains or their abundance, comprising at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5′-CTTGGAGAGGCTATGCACTATTT-3′ and / or 5′-TTGCAACCTGCTGTGTTTATTT-3′.
57. 57. The composition of claim 56, further comprising a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TTACTGCCGTTGATAGCGCAGGAC.
58. 1. A composition for PCR detection of C. perfringens-specific 16S rRNA or its abundance, comprising at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of the sequence 5'-AGATGGCATCATCATCATTCAAC-3' and / or 5'-GCAAGGGATGTCAAGTGT-3'.
59. 59. The composition of claim 58, further comprising a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGAGTGCAGGAGAGGAGAGTGGAA.
60. 1. A composition for PCR detection of the relative abundance of epsilon toxin (ETX) gene-carrying strains of C. perfringens, comprising: an ETX-targeting primer pair comprising, consisting essentially of, or consisting of the sequences 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or 5'-ACTCATACTGTGGGAACTTCGA-3' and 5'-ACTCATCTCCCATAACTGCACT-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence AGCAACTGCTAAGTTTACTGTTCCT; (i) a CPA targeting primer pair comprising, consisting essentially of, or consisting of the sequences 5'-GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence TGGGACTATGCAGCAAAGGTAACTTTAGC; and / or (ii) a universal 16S rRNA primer comprising, consisting essentially of, or consisting of the sequences 5'-GCGAGACTGCCGGTAATAAA-3' and 5'-TCGTTGTACCAGCCATTGTAG-3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of the sequence CCCTTATGACCTGGGCTACACACCG.