Bifidobacterium longum strains and uses thereof

Bifidobacterium longum strain CECT30763 addresses the limitations of current treatments for depression, anxiety, and cardiometabolic disorders by modulating gut microbiota and reducing inflammation, providing a promising therapeutic approach for mood, metabolic, and liver health improvements.

JP2026507673APending Publication Date: 2026-03-04AGENCIA ESTATAL CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS (CSIC)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-22
Publication Date
2026-03-04

AI Technical Summary

Technical Problem

Current treatments for psychiatric disorders such as depression and anxiety, as well as cardiometabolic disorders like cardiovascular disease and liver fibrosis, have limited effectiveness and are complicated by high comorbidity rates, with existing research lacking on the use and efficacy of bacterial strains for prevention and treatment.

Method used

The use of Bifidobacterium longum strain CECT30763 and its derivatives, which are isolated from healthy human feces, to modulate the gut microbiota and reduce inflammatory mediators, improve neuroendocrine responses, and exert beneficial effects on mood, cardiometabolic, and hepatic disorders through anti-inflammatory and regulatory T lymphocyte mechanisms.

Benefits of technology

B. longum strain CECT30763 effectively reduces depressive and anxiety-like behaviors, modulates stress-induced liver alterations, and improves cardiometabolic health by decreasing inflammatory markers and increasing regulatory T cells, offering a potential therapeutic target for these disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026507673000001
    Figure 2026507673000001
  • Figure 2026507673000002
    Figure 2026507673000002
  • Figure 2026507673000003
    Figure 2026507673000003
Patent Text Reader

Abstract

The present invention relates to B. longum strain CECT30763, its cellular components, metabolites, secreted molecules, and compositions comprising said products, and their use in the prevention or treatment of mood alterations, such as depression and anxiety disorders, cardiometabolic disorders, or liver disorders, either alone or in combination.
Need to check novelty before this filing date? Find Prior Art

Description

Detailed Description of the Invention

[0001] The present invention is in the field of therapeutic activity of pharmaceutical compositions or formulations, as well as in the field of food. In particular, the present invention relates to Bifidobacterium longum strain CECT30763 and its use in the prevention or treatment of mood disorders, such as depression and anxiety disorders, cardiometabolic disorders or liver disorders, either alone or in combination.

[0002] Latest Technology Psychiatric disorders such as depression and anxiety disorders, as well as cardiometabolic disorders such as cardiovascular disease, liver fibrosis, and type 2 diabetes, are among the leading causes of disability, morbidity, and mortality worldwide. These disorders have a high rate of comorbidity, i.e., they tend to occur simultaneously. Depression and anxiety occur simultaneously in approximately 50% of cases. These psychiatric disorders often occur together because they increase the risk of cardiometabolic disorders (e.g., metabolic syndrome, diabetes, and cardiovascular disease) and liver damage, and vice versa. The presence of comorbidities not only complicates diagnosis but also worsens disease prognosis and response to treatment.

[0003] Mood disorders, particularly depression and anxiety disorders, are highly prevalent and rank among the leading causes of disability worldwide. The total cost of mental illness is estimated at $798 billion, of which mood disorders account for approximately $118 billion in annual direct and indirect costs. Depression includes major or unipolar depression, typical or melancholic and atypical depression, perinatal and postpartum depression, bipolar disorder, psychotic depression, dysthymia, depressive personality disorder, seasonal affective disorder, and mood disorders due to substance abuse or drug use. Anxiety disorders include panic disorder, generalized anxiety disorder, social and specific phobias, agoraphobia, and anxiety due to general medical conditions. Current treatments for these disorders have very limited effectiveness. For example, antidepressant treatments are only fully effective in approximately 50% of cases, with many patients experiencing residual subclinical symptoms and frequent relapses, and some patients experiencing no improvement at all.

[0004] Depression has a high comorbidity rate with mental illness (e.g., anxiety disorder) and physical illness (e.g., cardiometabolic disorders such as metabolic syndrome, diabetes, and cardiovascular disease), which worsens the course of the disease, reduces treatment response, and increases the risk of progression.Anxiety disorder also has a high comorbidity rate with mental illness and cardiometabolic disorders such as hypertension and coronary artery disease.Anxiety disorder also increases the risk of developing serious cardiovascular diseases, such as myocardial infarction, left ventricular failure, coronary revascularization, and stroke, in patients with cardiovascular disease.

[0005] Stress is one of the major risk factors for the development of depression and anxiety. Similarly, stress is associated with the progression of cardiovascular disease, metabolic syndrome, type 2 diabetes, obesity, and liver damage (e.g., causing liver fibrosis). In the liver, stress reduces hepatic blood flow, causes tissue damage, elevates transaminase levels, and promotes the development of certain liver diseases and the progression of liver fibrosis associated with increased inflammation. Liver inflammation caused by the activation of pathogen-associated molecular pattern (PAMPS) or damage-associated molecular pattern (DAMPS) recognition receptors activates and transforms dormant hepatic stellate cells into fibroblasts, which have a high fibrogenic potential. Liver fibrosis, a disease characterized by the excessive accumulation of extracellular matrix proteins, primarily collagen, in the liver, disrupts normal liver function and promotes the progression of hepatocellular carcinoma (HCC).

[0006] The high comorbidity of psychiatric disorders and cardiometabolic disorders suggests that these diseases may be caused by the same risk factors and share pathophysiological mechanisms. This suggests that common solutions may exist for the prevention and treatment of these complications. Chronic inflammation and abnormal stress responses are part of the pathophysiological mechanisms linking depression and anxiety disorders with cardiometabolic disorders. Chronic inflammation and abnormal stress responses are triggered via the pituitary-hypothalamic-adrenal (HPA) axis and can result from abnormal communication between the gut and the brain (gut-brain axis). This axis is primarily regulated by the gut microbiota, and its modulation represents a preventive and therapeutic target. Indeed, animal models have shown that stress-induced increases in HPA axis responses lead to gut microbiota dysbiosis; conversely, microbiota dysbiosis contributes to behavioral and mood disorders. Animal studies have also shown that the specific composition of the gut microbiota influences stress responses, exacerbating or ameliorating its neurochemical and behavioral consequences through mechanisms that regulate the dialogue between the immune, endocrine, and nervous systems.

[0007] The use of gut bacteria in the treatment of diseases such as depression, anxiety, cardiometabolic disorders, or liver disorders is being investigated, considering these diseases as separate and independent disorders. Given the high prevalence and clinical importance of these diseases, recent research highlights the need for alternative bacterial strains for the prevention and / or treatment of these diseases, especially when these diseases manifest as complications, making their management (including prevention and treatment) even more complicated, due to the lack of research on the use and efficacy of bacterial strains.

[0008] Description of the Invention The present invention relates to Bifidobacterium longum (B. Longum) strains, particularly B. longum strain accession number CECT30763 and derivatives thereof, to cellular components, metabolites, and secreted molecules of the strain, to compositions containing the products, and to the use thereof for the prevention and / or treatment of mood disorders, such as depression and anxiety disorders; cardiometabolic disorders, such as obesity, metabolic syndrome, type 2 diabetes, and cardiovascular disease; or liver disorders, such as hepatic steatosis and liver fibrosis. Because many of these disorders have a high rate of comorbidity, the present invention also relates to the use of B. longum strain CECT30763 in the prevention and / or treatment of psychiatric, cardiometabolic, and / or hepatic complications.

[0009] The inventors identified and isolated this B. longum strain, CECT30763, from the feces of healthy volunteers and demonstrated that this strain has the ability to exert beneficial effects on depression- and anxiety-like behaviors, as well as cardiometabolic and hepatic disorders, in animals whose complications were induced by exposure to chronic social stress.

[0010] In particular, the present inventors have shown that oral administration of B. longum CECT30763 in an animal model of social stress reduces depressive and anxiety-induced behaviors, as shown by the results of the behavioral tests described in Example 2.

[0011] Furthermore, the strains of the present invention reduced plasma concentrations of chemokines and cytokines (specifically, CXCL9, CXCL10, CCL2, IL-6, and TNF-α), which are increased in association with depression and anxiety in the aforementioned stress model animals and humans, restoring them to levels comparable to those in control models (Example 5). Because these chemokines and cytokines are inflammatory mediators that are also increased in cardiometabolic pathologies, these results indicate that the strains of the present invention play a positive role in preventing such diseases. In this regard, the anti-inflammatory effect of B. longum strain CECT30763 may also be due to an increase in regulatory T lymphocytes (Tregs), which are associated with anti-inflammatory effects. The strain increased Tregs, whose levels were significantly reduced by chronic stress in both the spleen and intestine (Figures 6A and 6B). Furthermore, after the initial stress exposure (acute stress), the strains of the present invention caused a significant increase in Tregs, indicating that this anti-inflammatory and regulatory effect is expressed at an early stage and contributes to preventing the harmful effects of chronic stress (Figure 6C).

[0012] Other effects of B. longum strain CECT30763 include improved endocrine and dopaminergic responses by suppressing chronic stress-induced overproduction of corticosterone and increased dopamine levels (see Example 4). B. longum strain CECT30763 also exerts beneficial effects on the liver (see Example 5), modulating stress-induced alterations in the expression of fatty acid metabolism-related enzymes in the liver and inducing changes in the expression of pro-fibrotic molecules (Figures 9A, 9B, and 9C). B. longum strain CECT30763 also exerts beneficial effects on the heart by reducing oxidative stress (Example 6, Figure 11).

[0013] The strains of the present invention and their derivatives In one aspect, the present invention relates to a strain of Bifidobacterium longum having accession number CECT30763 (hereinafter referred to as "the strain of the present invention" or "B. longum CECT30763").

[0014] The B. longum strain CECT30763 (G121) was isolated from the feces of a healthy human and deposited with the Spanish Type Culture Collection as an international depository under the Budapest Treaty on December 13, 2022 (Edificio 3 CUE, Parc Cientific Universitat de Valencia, Catedratico Agustin Escardino, 9, 46980, Paterna (Valencia) SPAIN). The assigned accession number is CECT30763.

[0015] The scientific classification of the bacterial strain of the present invention is as follows: Domain: Bacterium; Phylum: Actinobacteria; Class: Actinobacteria; Order: Bifidobacteria; Family: Bifidobacteriaceae; Genus: Bifidobacterium; Species: B. longum.

[0016] Members of the genus Bifidobacterium are among the microorganisms that colonize the human gastrointestinal tract and are thought to confer health benefits to the host. Due to these health benefits and a general perception of safety, Bifidobacteria are commercially used as probiotic agents.

[0017] Bifidobacteria are Gram-positive, non-motile, and often branched anaerobic bacteria. They are one of the major bacterial genera that make up the mammalian intestinal microbiota and include over 30 different species. Among these bacteria, B. longum is a catalase-negative bacterium with a branched rod-shaped structure.

[0018] Another aspect of the present invention relates to strains derived from B. longum strain CECT30763, which maintain or improve upon the performance of the original strain as described throughout the present invention.

[0019] In preferred embodiments, alone or in combination with other preferred embodiments, strains derived from B. longum CECT30763 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the sequence of SEQ ID NO: 5. The sequence of SEQ ID NO: 5 corresponds to the 16S rRNA gene sequence of B. longum strain CECT30763.

[0020] In the present invention, "sequence identity" is understood as the degree of similarity between two nucleotide sequences obtained by aligning the two sequences. The degree of identity, expressed as a percentage, is obtained depending on the number of common residues between the aligned sequences. The degree of identity between two nucleotide sequences can be determined by conventional methods using standard sequence alignment algorithms well known to those skilled in the art, such as BLAST [Altschul SF et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215(3):403-10]. BLAST programs (e.g., BLASTN, BLASTX, TBLASTX, TBLASTN) are publicly available on the website of the National Center for Biotechnology Information (NCBI).

[0021] Derived microorganisms may be produced naturally (e.g., natural mutants) or may be intentionally produced by mutagenesis methods known in the art (e.g., but not limited to, culturing the original microorganism in the presence of mutagens or stress inducers) or by genetic engineering aimed at modifying specific genes. Thus, in a preferred embodiment, the strains of the present invention or strains derived from the B. longum species are genetically modified mutants or natural mutants. The terms "mutant strain" and "derived strain" can be used interchangeably.

[0022] B. longum strain CECT30763 or a mutant or derivative thereof can be used in any method that achieves the described effects, for example, in a preferred embodiment of the present invention, the B. longum strain is in the form of viable cells, either culturable or non-culturable, or in another preferred embodiment of the present invention, the B. longum strain CECT30763 is in the form of non-viable cells (cells that have been inactivated and "dead" by any technique known to those skilled in the art, such as heat, freezing, or UV irradiation). Thus, in a more preferred embodiment, the non-viable cells of B. longum strain CECT30763 are selected from the following list: heat-treated, frozen, lyophilized, or UV-irradiated cells.

[0023] As used herein, "nonviable" (or "abiotic," "inactive," or "inactivated," these terms are used interchangeably herein) refers to a metabolically or physiologically inactive microorganism, i.e., one that does not maintain metabolic and growth activity after administration of nutrients. Viability is independent of the ability of the microorganism to form colonies on solid media.

[0024] Another aspect of the present invention relates to cellular components, metabolites, secreted molecules, or any combination thereof, obtained from a strain of the present invention, a derivative thereof, or a combination of microorganisms comprising at least one strain of the present invention and / or a derivative thereof.

[0025] Bacterial cellular components include cell wall components (e.g., but not limited to, peptidoglycan), as well as nucleic acids, membrane components, or proteins, lipids, carbohydrates, and combinations thereof (e.g., lipoproteins, glycolipoproteins, or glycoproteins). Metabolites include any molecules produced or modified as a result of bacterial metabolic activity during growth, their use in technological processes (e.g., but not limited to, food or pharmaceutical manufacturing processes), product storage, or gastrointestinal transit. Examples of these metabolites include, but are not limited to, organic acids, inorganic acids, proteins, peptides, amino acids, enzymes, lipids, carbohydrates, lipoproteins, glycolipids, glycoproteins, vitamins, salts, metals, or nucleic acids. Secreted molecules include any molecules exported or released by bacteria during bacterial growth, including their use in technological processes (e.g., food or pharmaceutical manufacturing), product storage, or gastrointestinal transit. Examples of these molecules include, but are not limited to, organic and inorganic acids, proteins, peptides, amino acids, enzymes, lipids, carbohydrates, lipoproteins, glycolipids, glycoproteins, vitamins, salts, metals, or nucleic acids.

[0026] Compositions and uses of the present invention Another aspect of the present invention relates to compositions comprising the strains of the present invention, derivatives thereof and / or cellular components, metabolites, secreted molecules of the strains of the present invention or derivatives thereof, or any combination thereof (hereinafter referred to as "compositions of the present invention").

[0027] The composition generally comprises a collection of components comprising at least the strain of the present invention and / or a derivative thereof in any concentration; or a collection of components comprising at least cellular components, metabolites, secreted molecules, or any combination thereof, of the strain of the present invention or a derivative thereof; or a combination thereof.

[0028] In a preferred embodiment, the compositions of the invention contain a concentration of the strain of the invention and / or its derivatives of 10 per gram or milliliter of final composition. 4 ~10 14 Colony forming units (cfu).

[0029] In another preferred embodiment, the composition of the present invention may further comprise at least one additional microorganism other than the strain of the present invention or its derivative, and / or its cellular components, metabolites, or secreted molecules, or any combination thereof. For example, but not limited to, the additional microorganism that may be included as part of the composition may be selected from at least one of the following groups: - at least one species of Lactobacillus or Bifidobacterium from the intestine, food, or environment, wherein the Lactobacillus is selected from the list including, but not limited to, bacteria of the genera Bifidobacterium, Lactobacillus, Lactococcus, Enterococcus, Propionibacterium, Leuconostoco, Weissella, Pedicoccus, or Streptococcus; -At least one strain of prokaryotes of other phylogenetic groups, genus, or species from the intestine, food, or environment. For example, Archaea, Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, Verrucomicrobia, Fusobacteria, Methanobacteria, Spirochaetes, Fibrobact eres, Deferribacteres, Deinococcus, Thermus, Cyanobacteria, Methanobrevibacterium, Peptostreptococcus, Ruminococcus, Coprococcus, Subdolingranul um, Dorea, Bulleidia, Anaerofustis, Gemella, Roseburia, Catenibacterium, Dialister, Anaerotruncus, Staphylococcus, Micrococcus, Propionibacterium, Enterobacteriaceae, Faecalibacterium, Bacteroides, Parabacteroides, Prevotella, Eubacterium, Akkermansia, Bacillus, Butyrivibrio or Clostridium; - at least one fungal or yeast strain, including but not limited to strains belonging to the genera Saccharomyces, Candida, Pichia, Debaryomyces, Toruloposis, Aspergillus, Rhizopus, Mucor or Penicillium.

[0030] The additional microorganism may be a strain of the same species as the strain of the present invention, a strain of a different species from the strain of the present invention, or a strain of a microbial taxon belonging to the same taxon as the strain of the present invention. The cells comprising the composition may be non-viable or viable, and may be in any developmental or growth stage (latent, exponential, stationary, etc.), regardless of morphology. In a specific embodiment, the additional microorganism comprises at least one Enterobacteriaceae or one Lactobacillus.

[0031] Optionally, in another specific embodiment, the compositions of the present invention can further comprise at least one bioactive ingredient (active substance, effective ingredient, or therapeutic agent), such as a food ingredient, botanical product, and / or pharmaceutical. The term "bioactive ingredient" refers to a compound having biological activity that improves or complements the activity of B. longum strain CECT30763 within the scope of this patent, and includes food ingredients or ingredients (e.g., but not limited to, polyunsaturated fatty acids, conjugated linoleic acid, prebiotics, dietary fiber, guar gum, glucomannan, chitosan, copper picolinate, calcium, etc.), other probiotics, plants, plant extracts or ingredients, and pharmaceuticals.

[0032] Furthermore, the compositions of the present invention can be prepared for pharmaceutical administration, i.e., constitute part of a pharmaceutical product administered to a subject by any administration means. Thus, in certain embodiments, the compositions of the present invention are pharmaceutical compositions, hereinafter also referred to as "pharmaceutical compositions of the present invention." A pharmaceutical composition is a collection of components containing at least the strains of the present invention and / or their derivatives in any concentration, or at least cellular components, metabolites, secreted molecules of the strains of the present invention or their derivatives, or any combination thereof, and has at least one application in improving the physical, physiological, or psychological well-being of a subject, meaning an overall improvement in the subject's health or a reduction in the risk of disease. Such pharmaceutical compositions are medicinal products, hereinafter also referred to as medicinal products of the present invention.

[0033] Therefore, in another aspect, the present invention relates to the strain of the present invention, a derivative thereof, a cellular component, a metabolite, a secreted molecule, or any combination thereof, obtained from the strain of the present invention or a derivative thereof, or a composition of the present invention, for use as a medicament.

[0034] The term "pharmaceutical product" as defined herein has a more limited meaning than "pharmaceutical composition," because a pharmaceutical product necessarily implies a preventive or therapeutic effect. Pharmaceutical products related to the present invention may be for human or veterinary use. A "human pharmaceutical product" refers to a substance or combination thereof that has properties effective in treating or preventing a human disease, or a substance or combination thereof that is used or can be administered to a human for the purpose of restoring, correcting, or altering physiological function by exerting a pharmacological, immunological, or metabolic effect, or establishing a medical diagnosis. A "veterinary pharmaceutical product" refers to a substance or combination thereof that has a therapeutic or preventive effect against an animal disease, or a substance or combination thereof that can be administered to an animal for the purpose of restoring, correcting, or altering physiological function by exerting a pharmacological, immunological, or metabolic effect, or establishing a medical diagnosis. Veterinary pharmaceutical products also include "drug-containing feed premixes" prepared to be incorporated into animal feed.

[0035] In addition to the requirement of therapeutic effect, there may be a fundamental reason that requires or strongly recommends the use of a combination of the compound of the present invention and a biologically active ingredient when the pharmaceutical composition requires the use of other therapeutic agents, where the biologically active ingredient has an activity suitable for functioning as a pharmaceutical product. The compound of the present invention clearly refers to the strain of the present invention, or a derivative thereof, or a cellular component, metabolite, secreted molecule obtained from the strain or derivative thereof, or any combination thereof.

[0036] In certain embodiments, the pharmaceutical composition of the present invention further comprises at least one pharmaceutically acceptable vehicle and / or excipient.

[0037] "Carrier" is preferably an inert substance. The function of a carrier is to facilitate the blending of other compounds, improve dosage and administration method, or give uniformity and shape to the pharmaceutical composition. Therefore, a carrier is a substance used in pharmaceuticals to dilute any of the components of the pharmaceutical composition of the present invention to a certain volume or weight; or a substance that can enable better dosage and administration method without diluting the component, or give uniformity and shape to the pharmaceutical. When the presentation form is liquid, the pharmaceutically acceptable carrier is a diluent.

[0038] The term "excipient" refers to a substance that aids in the preparation of a pharmaceutical composition by aiding in the absorption of any component of the composition of the present invention, stabilizing the component, or providing uniformity or flavor to enhance palatability. Thus, excipients include those that function to bind components, such as starch, sugar, or cellulose; to provide sweetness; to provide color; to protect the pharmaceutical (e.g., by isolating it from air and / or moisture); to form tablets, capsules, or other presentation forms (e.g., calcium phosphate dihydrate); to promote dissolution of components and disintegrate them to aid in intestinal absorption; and other types of additives not listed here. Thus, the term "excipient" refers to a substance contained in a dosage form, added to an active ingredient or its formulation, that allows its preparation and stability, alters its organoleptic properties, or determines the physicochemical properties and bioavailability of the formulation. A "pharmaceutically acceptable" excipient must not interfere with the activity of the compound in the formulation; i.e., be compatible with the ingredient.

[0039] Additionally, as one skilled in the art will appreciate, excipients and carriers must be pharmaceutically acceptable, i.e., approved and evaluated so as not to be harmful to the organism to which they are administered.

[0040] The pharmaceutical composition or medicament can be provided in a clinically acceptable administration route and in a therapeutically effective amount. For example, it can be provided in a form suitable for oral, sublingual, intranasal, intrathecal, intrabronchial, intralymphatic, rectal, transdermal, inhalation, or parenteral administration, preferably in a form suitable for oral administration. The pharmaceutical composition of the present invention can be prepared in a solid, semisolid, liquid, or gas form, such as a tablet, capsule, powder, granule, ointment, solution, suppository, injection, inhalant, gel, microsphere, or aerosol. In a preferred embodiment, the pharmaceutical composition or medicament of the present invention, alone or in combination with other preferred embodiments, is prepared in a liquid or solid form.

[0041] In a preferred embodiment, the composition of the present invention, preferably the pharmaceutical composition or medicament of the present invention, alone or in combination with other preferred embodiments, can be used in a form suitable for oral, sublingual, intranasal, intrathecal, intrabronchial, intralymphatic, intrarectal, transdermal, inhalation or parenteral administration. In a more preferred embodiment, the pharmaceutical composition of the present invention or the medicament of the present invention, alone or in combination with other preferred embodiments, is in a form suitable for oral administration.

[0042] The form suitable for oral administration refers to a physical state that allows oral administration. Examples of forms suitable for oral administration include, but are not limited to, drops, syrups, herbal teas, elixirs, suspensions, prepared suspensions, drinkable ampoules, tablets, capsules, granules, sachets, capsules, pellets, pills, lozenges, or freeze-dried forms.

[0043] In a further preferred embodiment, the pharmaceutical composition of the invention or the medicament of the invention is in a form suitable for oral administration selected from drops, syrup, herbal tea, elixir, suspension, preparative suspension, drinkable ampoules, tablets, capsules, granules, sachets, capsules, pellets, pills, lozenges and freeze-dried forms.

[0044] "Formulation" or "drug form" refers to the state in which an active ingredient and excipients are adapted to constitute a pharmaceutical product. This is defined by the combination of the form of the pharmaceutical composition proposed by the manufacturer and the form of administration.

[0045] In the present invention, the term "therapeutically effective amount" refers to the amount of a component of a pharmaceutical composition that, when administered to a mammal, preferably a human, is sufficient to prevent and / or treat a disease or condition of interest in the mammal, preferably a human, as defined below. The therapeutically effective amount varies depending on, for example, the activity of the strain of the present invention; any form of presentation of cellular components, metabolites, secreted molecules, or any combination thereof; the therapeutically effective amount also varies depending on the metabolic stability and duration of action of the compound; the patient's age, weight, and general health, sex, and diet; the method and timing of administration; excretion rate; the combination of pharmaceuticals; the severity of a specific disease or condition; and the patient to be treated, which can be determined by a person skilled in the art based on their own knowledge and the above explanation.

[0046] Instead of a pharmaceutical composition, the composition of the present invention may be a nutritional composition, also referred to herein as the "nutritional composition of the present invention." Thus, in another specific embodiment, the composition of the present invention is a nutritional composition.

[0047] The term "nutritional composition" as used herein refers to a food product that beneficially affects one or more bodily functions in a manner that improves the health and well-being of the subject consuming it, regardless of whether it provides nutrients to the subject. Thus, the nutritional composition may be intended for the prevention and / or treatment of a disease or a disease-causing factor. Therefore, the term "nutritional composition" as used herein may be used synonymously with functional food, specific nutritional food, or medicinal food.

[0048] In preferred embodiments, the nutritional composition is a food, supplement, nutraceutical, probiotic, synbiotic, postbiotic, parabiotic, or psychobiotic.

[0049] In a more preferred embodiment, the food product is selected from the list consisting of a dairy product, a plant product, a meat product, a snack, a chocolate, a beverage, or a baby food.

[0050] Examples of dairy products include, but are not limited to, products derived from fermented milk (such as, but not limited to, yogurt or cheese) or non-fermented milk (such as, but not limited to, ice cream, butter, margarine, whey). In a more preferred embodiment, the food product is a dairy product selected from the list consisting of yogurt, cheese, ice cream, butter, margarine, whey, and other products derived from fermented or non-fermented milk.

[0051] Examples of plant products include, but are not limited to, grains in any presentation, fermented or unfermented. In another more preferred embodiment, the food product is a plant product, and the plant product is a fermented or unfermented grain.

[0052] Examples of beverages include, but are not limited to, fruit or vegetable juices or non-fermented milk. In another more preferred embodiment, the food product is a beverage, and the beverage is a fruit or vegetable juice or non-fermented milk.

[0053] The term "supplement" is synonymous with any of the terms "dietary supplement," "nutraceutical," or "food supplement" and refers to a "food ingredient" used to supplement food. Some examples of supplements include, but are not limited to, vitamins, minerals, plant extracts, amino acids, and dietary ingredients such as enzymes and glandular extracts. They are presented as a dietary complement, rather than as a replacement for conventional foods or the sole component of a meal or diet. Furthermore, supplements are presented in single or multiple forms and are sold in capsules, capsule tablets, pellets, and other similar forms, powder sachets, liquid ampoules, and drop dispensers, as well as other similar forms of liquids and powders designed to be taken in a single dose.

[0054] In the present invention, the term "nutraceutical" refers to substances that have beneficial effects on health and are isolated from food and used in dosage forms.

[0055] In the present invention, the term "probiotics" refers to live microorganisms that, when administered in adequate amounts, have a beneficial effect on the health of the host organism.

[0056] In the present invention, the term "synbiotic" refers to a food product containing a mixture of prebiotics and probiotics. Typically, the prebiotic component promotes the growth and / or metabolic activity of the probiotic, ultimately enhancing the effect of the combined probiotics, a non-limiting example being a combination of fructooligosaccharides or galactooligosaccharides with Bifidobacterium.

[0057] In the present invention, the term "postbiotics" refers to foods or supplements that include substances or metabolites produced by probiotic microorganisms and have beneficial health effects at the nutritional, metabolic, and immune levels of the host, including, but not limited to, metabolic products such as vitamin K, short-chain fatty acids, or neurotransmitters such as GABA, serotonin, and acetylcholine.

[0058] As used herein, the term "parabiotics" refers to non-living substances of microbial origin that have been shown to have beneficial effects on human and / or animal health, including, by way of non-limiting example, cellular components such as teichoic acids, peptidoglycans, or surface proteins.

[0059] In the present invention, the term "psychobiotics" refers to probiotics, prebiotics, and other dietary strategies that influence the microbiota (e.g., some dietary fiber found in fruits and vegetables) and exert beneficial effects on mental health.

[0060] Another aspect of the invention relates to the use of the strain of the invention, a derivative thereof, or a component derived therefrom, or a composition of the invention, in the manufacture or production of a pharmaceutical, nutritional composition, or food product. The term "pharmaceutical" has been defined above and applies to this aspect of the invention.

[0061] [Use of the present invention] As mentioned above, the present inventors have demonstrated that B. longum strain CECT30763 has the ability to prevent and / or alleviate mood disorders, such as depressive or anxiety-provoking behavior. Accordingly, in another aspect, the present invention includes the use of the strains of the present invention, strains derived from the strains of the present invention, cellular components, metabolites, secreted molecules, or any combination thereof, obtained from the strains of the present invention, and compositions of the present invention (including pharmaceutical or nutritional compositions of the present invention) for the prevention and / or treatment of at least one mood disorder in a subject, as well as the use of these mood disorders when they co-exist as comorbidities.

[0062] In the present invention, the term "subject" refers to any animal, preferably a mammal, more preferably a primate, particularly a human, of any race, sex, or age. In a preferred embodiment, alone or in combination with other preferred embodiments, the subject is a human. In some embodiments, alone or in combination with other embodiments, the subject is a subject exhibiting stress.

[0063] In the present invention, the term "treatment" refers to combating the effects of a disease or condition of interest in a subject (preferably a mammal, more preferably a human) and includes: (i) inhibiting the disease or condition, i.e., halting its progression; (ii) alleviating the disease or condition, i.e., causing a reduction in the disease or condition or its symptoms; (iii) Stabilization of the disease or condition.

[0064] In the present invention, the term "prevention" refers to avoiding the onset of a disease, i.e., preventing the disease or condition from appearing in a subject (preferably a mammal, more preferably a human), particularly when the subject has a predisposition to the condition.

[0065] In the present invention, a mood disorder may be defined as a condition that affects the mental / emotional state of a subject and may affect their behavior, including, but not limited to, depression, anxiety disorder, major depression, atypical depression, typical or melancholic depression, psychotic depression, catatonic depression, perinatal and postpartum depression, bipolar disorder, seasonal affective disorder, dysthymia, depressive personality disorder, dual depression, unspecified depressive disorder, recurrent brief depressive disorder, mild depression, mood disorder due to substance abuse or drug use.

[0066] Another preferred embodiment relates to a bacterial strain of the invention, a bacterial strain derived from the bacterial strain of the invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the bacterial strain of the invention or a derived strain, a composition of the invention (including a pharmaceutical or nutritional composition of the invention) for use in the prevention and / or treatment of at least two, three, four, five, or more mood disorders in a subject. The mood disorders may occur simultaneously or sequentially.

[0067] In a more preferred embodiment, the mood disorder is selected from the list consisting of depression, anxiety or anxiety disorder, major depression, atypical depression, typical or melancholic depression, psychotic depression, catatonic depression, perinatal and postpartum depression, bipolar disorder, seasonal affective disorder, stress, dysthymia, depressive personality disorder, dual depression, unspecified depressive disorder, recurrent brief depressive disorder, mild depression, mood disorder due to substance abuse, mood disorder due to drug use, and any combination thereof. More preferably, the mood disorder is depression and / or anxiety. More preferably, when the mood disorder is stress, the stress is chronic stress, even more preferably chronic social stress or acute stress.

[0068] Anxiety is an emotion characterized by feelings of tension, anxious thoughts, and physical changes such as elevated blood pressure. Anxiety is experienced not only by humans but also by other animals, particularly other non-human mammals.

[0069] Anxiety disorders are the most common mental disorders in humans, affecting approximately 30% of adults at some point in their lifetime. Anxiety disorders include, but are not limited to, generalized anxiety disorder, panic disorder, specific phobia, agoraphobia, social anxiety disorder (formerly known as social phobia), noise avoidance disorder, or separation anxiety disorder.

[0070] In the present invention, the term "anxiety disorder" includes not only the anxiety disorders described above, but also related conditions, including but not limited to post-traumatic stress disorder (PTSD), acute stress disorder, obsessive-compulsive disorder, or adjustment disorder.

[0071] Furthermore, depression is a very common mental illness that the medical system must address. Like anxiety, depression can be experienced not only by humans but also by other animals, especially other non-human mammals.

[0072] In the present invention, the term "depression" refers to a clinical disorder characterized by a predominantly pessimistic or depressed mood, accompanied by other psychological and / or physical symptoms, which may be present at any time.

[0073] Depression and / or anxiety affect social functioning and productivity (including work performance), and depression- or anxiety-related disorders increase the risk of suicide and chronic diseases such as cardiovascular disease, stroke, diabetes, and obesity.

[0074] In particular, depression is thought to affect up to 60% of people with anxiety disorders, and depressive symptoms are associated with future impairments in mobility and function, as well as increased healthcare costs.

[0075] Furthermore, B. longum strain CECT30763 has the ability to improve neuroendocrine responses by reducing plasma corticosterone and dopamine levels in an animal model of stress-induced depression, as shown in Example 4. B. longum strain CECT30763 also reduces mediators of chronic stress-induced inflammation (CXCL9, CXCL10, CCL2, IL-6, and TNF-α) and increases the proportion of regulatory T cells in the intestine and spleen after acute and chronic stress (Example 5, Figures 6A, 6B, and 6C). Thus, in another aspect, the present invention relates to the strains of the present invention, their derivatives, cellular components, metabolites, secreted molecules, or any combination thereof obtained from the strains of the present invention or their derivatives, and compositions of the present invention (including pharmaceutical or nutritional compositions of the present invention) for use in improving neuroendocrine responses in a subject, preferably in improving neuroendocrine responses associated with at least one mood disorder. The examples used to define mood disorders have already been mentioned, and these and their preferred embodiments are also applicable to this aspect of the invention.

[0076] Furthermore, the strains of the present invention and products derived therefrom have application in the prevention and / or treatment of cardiometabolic disorders.

[0077] Thus, another aspect of the present invention relates to the strain of the present invention, a strain derived from the strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the strain of the present invention or a derived strain thereof, a composition of the present invention (including a pharmaceutical or nutritional composition of the present invention) for use in the prevention and / or treatment of at least one cardiometabolic disorder in a subject.

[0078] As with other previous aspects, some preferred embodiments provide for the prevention and / or treatment of at least two, three, four, five, or more cardiometabolic disorders in a subject, which disorders may occur simultaneously or sequentially.

[0079] Cardiometabolic disorders are disorders associated with multiple interrelated factors in the same subject, such as hypertension, inflammation, hyperglycemia, dyslipidemia, abdominal obesity, and hypertriglyceridemia, and these cardiometabolic disorders include cardiovascular or metabolic diseases or disorders.

[0080] Examples of cardiometabolic disorders include, but are not limited to, hyperlipidemia, hyperglycemia, metabolic syndrome, type 2 diabetes, obesity, arterial hypertension, coronary artery disease, or other cardiovascular diseases. In a more preferred embodiment, alone or in combination with other preferred embodiments, the cardiometabolic disorder is selected from the list consisting of cardiovascular disease, metabolic syndrome, type 2 diabetes, obesity, hyperlipidemia, hyperglycemia, and any combination thereof.

[0081] The strains of the present invention have been shown to exert protective effects on cardiometabolic health by reducing oxidative stress in the heart (Example 6, Figure 11). Furthermore, as previously described, the strains of the present invention have the ability to reduce levels of CXCL9, CXCL10, CCL2, IL-6, and TNF-α, inflammatory mediators that are also increased in cardiometabolic pathologies. Furthermore, B. longum strain CECT30763 increased Tregs in the spleen and intestine after acute and chronic stress, demonstrating anti-inflammatory effects (Example 5, Figures 6A, 6B, and 6C).

[0082] Therefore, in another more preferred embodiment, alone or in combination with other preferred embodiments, the cardiometabolic disorder comprises inflammation. More preferably, the inflammation is mediated by at least one cytokine selected from CXCL9, CXCL10, CCL2, IL-6, TNF-α, and any combination thereof, and / or the Treg level is reduced compared to a reference value. "Reference value" refers to the Treg level in healthy subjects.

[0083] The present invention can also be applied to the prevention and / or treatment of liver damage.Therefore, another aspect of the present invention relates to the strain of the present invention, a strain derived from the strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the strain of the present invention or a derived strain, or a composition of the present invention (including a pharmaceutical composition or nutritional composition of the present invention) for use in the prevention and / or treatment of at least one liver damage or condition in a subject.Similar to the previous aspect of the present invention, some preferred embodiments provide for the prevention and / or treatment of at least two, three, four, five or more liver damages in a subject.These diseases may occur simultaneously or sequentially.

[0084] In the present invention, liver damage refers to the disease or condition that impairs the normal function of the liver.Examples of liver damage include but are not limited to fatty liver or fatty degeneration, liver fibrosis, hepatocellular carcinoma, liver failure or hepatitis.

[0085] In another more preferred embodiment, alone or in combination with other preferred embodiments, the liver disorder is selected from the list consisting of hepatic steatosis, liver fibrosis, hepatitis, hepatocellular carcinoma, liver failure, or any combination thereof.

[0086] In another aspect, the present invention relates to a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof obtained from the bacterial strain of the present invention or a derived bacterial strain, or a composition of the present invention, for use in the prevention and / or treatment of mood disorders and / or cardiometabolic disorders and / or liver disorders, and / or in improving neuroendocrine responses in a subject.

[0087] Mood disorders such as depression and / or anxiety are associated with and often co-occur with other psychiatric and non-psychiatric disorders (e.g., cardiometabolic disorders such as cardiovascular disease, metabolic syndrome, and diabetes, and liver disorders such as hepatic steatosis and liver fibrosis).

[0088] In the present invention, the term "complication" refers to the presence of one or more diseases in addition to a primary disease or disorder in the same subject. These may occur simultaneously or sequentially. "Complication" also includes the possibility of interactions between diseases that may worsen the course of each disease or make treatment more difficult.

[0089] Thus, in another aspect, the present invention relates to a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof, obtainable from the bacterial strain of the present invention or a derived strain, a composition of the present invention (including a pharmaceutical or nutritional composition of the present invention) for use in the prevention and / or treatment of a co-morbid mood disorder in a subject.

[0090] The examples used to define mood disorders are set out above, and these and their preferred embodiments are also applicable to this aspect of the invention.

[0091] The mood disorders are preferably depression and anxiety disorders.

[0092] In another aspect, the present invention relates to the bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof obtained from the bacterial strain of the present invention or its derivative strain, or a composition of the present invention (including a pharmaceutical composition or nutritional composition of the present invention) for use in preventing and / or treating cardiometabolic complications in a subject. The term "cardiometabolic complications" refers to the presence of one or more cardiometabolic disorders in a subject in addition to a primary disease in the present invention, where the primary disease is at least one mood disorder. Therefore, this aspect relates to use in the prevention and / or treatment of one or more cardiometabolic disorders comorbid with at least one mood disorder in a subject.

[0093] Examples used to define cardiometabolic disorders have been described above, and these and their preferred embodiments are applicable to this aspect of the invention.

[0094] In another particular embodiment, the cardiometabolic disorder comprises inflammation.

[0095] In another aspect, the present invention relates to the strain of the present invention, the strain derived from the strain of the present invention, the cellular components, metabolites, secreted molecules, or any combination thereof obtained from the strain of the present invention or the derived strain, the composition of the present invention (including the pharmaceutical composition or nutritional composition of the present invention) for use in preventing and / or treating liver complications in a subject.The term "liver complications" refers to the presence of one or more liver diseases in a subject in addition to the main disease in the present invention, where the main disease is at least one mood disorder.Therefore, this aspect of the present invention relates to the use in preventing and / or treating one or more liver diseases in a subject that are complicated with at least one mood disorder.

[0096] The examples used to define liver damage have already been described, and these and their preferred embodiments are also applicable to this aspect of the invention.

[0097] In another aspect, the present invention relates to a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof obtained from the bacterial strain of the present invention, or a composition of the present invention (including a pharmaceutical or nutritional composition of the present invention) for use in the prevention and / or treatment of cardiometabolic and hepatic complications in a subject. As described above, "cardiometabolic complications" and "hepatic complications" refer to one or more cardiometabolic disorders and one or more liver disorders present in a subject in addition to a primary disease in the present invention. Here, the primary disease is at least one mood disorder. That is, this aspect of the present invention relates to use in the prevention and / or treatment of one or more liver disorders and one or more cardiometabolic disorders comorbid with at least one mood disorder present in a subject.

[0098] Furthermore, the strains of the present invention, strains derived therefrom, cellular components, metabolites, secreted molecules obtained from the strains of the present invention or derived strains, or any combination thereof, or compositions of the present invention can be used as adjuvants.

[0099] In the present invention, the term "adjuvant" refers to a compound that improves the therapeutic and / or prophylactic efficacy or efficiency of another pharmaceutical agent, and that can reduce the dosage and / or frequency of administration or improve the efficacy of a preparation of the bacterial strain of the present invention by administering it in a manner that has a complementary mechanism of action.

[0100] Thus, in another aspect, the present invention relates to a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof, obtained from the bacterial strain of the present invention or a derived strain, or a composition of the present invention, for use as an adjuvant for the treatment and / or prevention of mood disorders and / or cardiometabolic disorders and / or liver disorders and / or for improving neuroendocrine responses in a subject.

[0101] Examples used to define mood disorders, cardiometabolic disorders or liver disorders have already been described, and these and their preferred embodiments are also applicable to this aspect of the invention.

[0102] In another aspect, the present invention relates to the strain of the present invention, a strain derived from the strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the strain of the present invention or a derived strain thereof, or a composition of the present invention, for use as an adjuvant in the treatment and / or prevention of co-occurring mood disorders.

[0103] In another aspect, the present invention relates to the strain of the present invention, a strain derived from the strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the strain of the present invention or a derived strain, or a composition of the present invention, for use as an adjuvant for the treatment and / or prevention of cardiometabolic and / or hepatic complications and / or improvement of neuroendocrine responses as complications in a subject.

[0104] In another aspect, the present invention relates to a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, metabolite, secreted molecule, or any combination thereof obtained from the bacterial strain of the present invention or a derived strain, or a composition of the present invention, for use as an adjuvant in the treatment and / or prevention of one or more cardiometabolic disorders and one or more liver disorders associated with at least one mood disorder in a subject.

[0105] Methods of prevention and / or treatment In another aspect, the present invention relates to a method for the prevention and / or treatment of at least one mood disorder in a subject, comprising administering a strain of the present invention, a strain derived from a strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof, obtained from a strain of the present invention or a derived strain, or a composition of the present invention.

[0106] In another aspect, the present invention relates to a method for preventing and / or treating at least one cardiometabolic disorder in a subject, comprising administering a bacterial strain of the present invention, a bacterial strain derived from a bacterial strain of the present invention, a cellular component, metabolite, secreted molecule obtained from a bacterial strain of the present invention or a derived strain, or any combination thereof, or a composition of the present invention.

[0107] In another aspect, the present invention relates to a method for preventing and / or treating at least one liver disorder or condition in a subject, comprising administering a bacterial strain of the present invention, a bacterial strain derived from a bacterial strain of the present invention, a cellular component, metabolite, secreted molecule obtained from a bacterial strain of the present invention or a derived strain, or any combination thereof, or a composition of the present invention.

[0108] In another aspect, the present invention relates to a method for preventing and / or treating a co-occurring mood disorder in a subject, comprising administering a bacterial strain of the present invention, a strain derived from a bacterial strain of the present invention, a cellular component, metabolite, secreted molecule obtained from a bacterial strain of the present invention or a derived strain, or any combination thereof, or a composition of the present invention.

[0109] In another aspect, the present invention relates to a method for preventing and / or treating cardiometabolic complications in a subject, comprising administering a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, a metabolite, a secreted molecule, or any combination thereof, obtained from the bacterial strain of the present invention or a derived bacterial strain, or a composition of the present invention. The term "cardiometabolic complications" refers to one or more cardiometabolic disorders present in a subject in addition to a primary disease in the present invention, where the primary disease is at least one mood disorder. Thus, this aspect relates to a method for preventing and / or treating one or more cardiometabolic disorders accompanied by at least one mood disorder in a subject.

[0110] In another aspect, the present invention relates to a method for preventing and / or treating liver complications in a subject, comprising administering the strain of the present invention, the strain derived from the strain of the present invention, the cellular components, metabolites, secreted molecules, or any combination thereof obtained from the strain of the present invention or the derived strain, or the composition of the present invention.The term "liver complications" refers to one or more liver diseases that exist in a subject in addition to the main disease in the present invention, where the main disease is at least one mood disorder.Therefore, this aspect relates to a method for preventing and / or treating one or more liver diseases that are accompanied by at least one mood disorder in a subject.

[0111] In another aspect, the present invention relates to a method for preventing and / or treating cardiometabolic and hepatic complications in a subject, comprising administering a bacterial strain of the present invention, a bacterial strain derived from the bacterial strain of the present invention, a cellular component, metabolite, secreted molecule obtained from the bacterial strain of the present invention or a derived strain, or any combination thereof, or a composition of the present invention. This aspect relates to a method for preventing and / or treating one or more liver disorders and one or more cardiometabolic disorders associated with at least one mood disorder in a subject.

[0112] The terms defining the prophylactic and / or therapeutic methods of the present invention have been defined and explained in the previous aspects of the invention, and these and their preferred embodiments also apply thereto.

[0113] DESCRIPTION OF THE DRAWINGS Figure 1. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 13 (C), 13 (E), 14 (E+B)) exposed to chronic social stress in the sucrose preference test. 9 cfu / day). Data are presented as percentage of sucrose intake relative to total intake and standard error. Statistically significant differences were established by Kruskal-Wallis test followed by Dunn's multiple comparison test ( * =p<0.05, *** = p<0.001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: B. longum CECT30763-treated mice exposed to chronic stress.

[0114] Figure 2. B. longum strain CECT30763 (1 × 10 ) in C57BL / 6 mice (n = 13 (C), 13 (E), 11 (E+B)) exposed to chronic social stress in the tail suspension test. 9 cfu / day). Data are presented in seconds, with standard errors shown. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test ( * =p<0.05, ** =p<0.01, **** =p<0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0115] Figure 3. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 27 (C), 26 (E), 23 (E+B)) exposed to chronic social stress in the forced swim test. 9 cfu / day). Data are presented in seconds, with standard errors shown. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test ( * =p<0.05, ** =p<0.01, ****=p<0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0116] Figure 4. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 14 (C), 14 (E), 11 (E+B)) exposed to chronic social stress in the open field test. 9 cfu / day). Data are presented as the number of rearing or upright exploration movements and standard error. Statistically significant differences were established by Kruskal-Wallis test followed by Dunn's multiple comparison test ( ** =p<0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0117] Figure 5. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 8–9 / group) exposed to chronic social stress. 9 cfu / day) on the plasma immune system. Plasma chemokine and cytokine levels: CXCL9 (A), CXCL10 (B), CCL2 (C), IL-6 (D), and TNF-α (E). Data are presented in picograms (pg) per milliliter (ml) with standard errors indicated. Statistically significant differences were established by the Kruskal-Wallis test followed by Dunn's multiple comparison test ( * =p<0.05, *** =p<0.001, **** =p<0.0001). C: Control mice; E: Untreated mice subjected to chronic stress; E+B: Chronic stressed mice treated with B. longum CECT30763.

[0118] Figure 6. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 8–10 / group) exposed to acute and chronic social stress. 9cfu / day) on the immune system in the spleen and small intestine. Treg lymphocyte levels in the spleen (A) and small intestine (B) in mice exposed to chronic stress, and Treg lymphocyte levels in the spleen (C) in mice exposed to acute stress. Data are presented in picograms (pg) / milliliter (ml) with standard errors indicated. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test ( * =p<0.05, ** =p<0.01, **** =p<0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0119] Figure 7. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 12–16 / group) exposed to chronic social stress. 9 cfu / day). Plasma cortisone (A) and dopamine (B) concentrations. Data are presented as percentages (%) of the control group, with standard errors shown. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by post hoc Tukey's test ( ** =p<0.01, **** =p<0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0120] Figure 8. B. longum CECT30763 (1 × 10) suppressed the growth of C57BL / 6 mice (n = 7–9 / group) exposed to chronic social stress. 9cfu / day) on dopamine receptor expression in the prefrontal cortex of the brain. Relative mRNA expression of dopamine D2L (A) and D1R (B) receptors in the prefrontal cortex (PFCx). Data are shown for each individual, and each point and histogram represents the mean and standard error. Statistically significant differences were established by Kruskal-Wallis test followed by Dunn's multiple comparison test ( * =p<0.05). C, control mice; E, untreated mice exposed to chronic stress; E+B, mice exposed to chronic stress and treated with B. longum CECT30763.

[0121] Figure 9. B. longum CECT30763 (1 × 10) suppressed the growth of C57BL / 6 mice (n = 6–9 / group) exposed to chronic social stress. 9 cfu / day) on the expression of liver fibrosis-related genes. Relative mRNA expression levels of liver fibrosis-related genes TGFβ1 (A), Col1a1 (B), and Col3a1 (C). Data are shown for each individual, and each point and histogram represents the mean and standard error. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest ( * p<0.05; ** p>0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0122] Figure 10. B. longum CECT30763 (1 × 10) in C57BL / 6 mice (n = 8–9 / group) exposed to chronic social stress. 9cfu / day) on the expression of fatty acid metabolism-related genes in the liver. Relative mRNA expression levels of ACC1 (A), DGAT (B), and CPT1a (C) genes and the DGAT / CPT1 ratio (D). Data are shown for each individual, and each point and histogram represents the mean and standard error. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest or, where indicated, Student's t-test between two groups ( * p<0.05). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0123] Figure 11. B. longum CECT30763 (1 × 10 9 cfu / day) on oxidative stress damage. Percentage of 8-hydroxy-2'-deoxyguanosine (8-OHdG) antibody-positive tissue area to total tissue area. Data are shown for each individual, and each point and histogram represents the mean and standard error of the mean. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest ( * p<0.05; ** p<0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

[0124] [Example] Next, the present invention will be explained by means of tests carried out by the inventors to demonstrate the effectiveness of the present invention.

[0125] Example 1. Isolation and identification of B. longum strain CECT30763 B. longum strain CECT30763 was isolated and identified from feces of a healthy volunteer on MRS agar + 0.05% L-cysteine ​​(MRS-cis). Serial dilutions of the stool samples were prepared in PBS-1x + 0.05% L-cysteine ​​and cultured on MRS-cis plates under anaerobic conditions at 37°C for 48 hours. Isolated colonies were identified by Gram staining and subsequent colony PCR sequencing.

[0126] Two different genes were used to identify the species and different strains of B. longum. The 16S rRNA gene (1.5 kb) was amplified with primers 27F (SEQ ID NO: 1: 5'-AGAGAGTTTGATCCTGGCTCAG-3') and 1401R (SEQ ID NO: 2: 5'-CGGTGTGTACAAGACCC-3') to identify the genus and species. The threonine-tRNA ligase (ThrS) gene was amplified with primers BifiThrS-F (SEQ ID NO: 3: 5'-AAGGACGGCTTCTACTACTACGA-3') and BifiThrS-R (SEQ ID NO: 4: 5'-AAGATCAGGTTGTGCATCGG-3') and, when used in combination with the above, was useful for distinguishing strains. Both genes were sequenced using the Sanger technique with both forward and reverse primers on an Applied Biosystems ABI 3730XL sequencer. Two nucleotide sequences were obtained for each gene (16S rRNA and ThrS), one with a direct primer and one with a reverse primer. A single amplicon (SEQ ID NO: 5 and SEQ ID NO: 6, respectively) was generated for each gene using the PRABI-Doua web tool. The sequences obtained from the 16S rRNA were compared with the NCBI database and the BLASTn algorithm, resulting in species identification with 100% identity. Next, both genes were individually aligned using MAFFT software for subsequent concatenation, resulting in a single nucleotide sequence consisting of the 16S rRNA gene, 20 ambiguous nucleotides (N), and ThrS gene for each strain used in the analysis. Phylogenetic trees were generated using MEGAX software. After inputting the sequences into the program, alignments were performed using ClustalW+Muscle; a maximum likelihood statistical model was employed, and the T92 (Tamura-3-parameter) nucleotide substitution model was selected. Finally, 1,000 replicates were analyzed using the bootstrap method.By constructing a phylogenetic tree, it was confirmed that the subject strain of the patent (B. longum G121 or B. longum CECT30763) was distinct from other strains within the same species.

[0127] >B. longum_G121_16S-rRNA (SEQ ID NO: 5): >B.longum_G121_ThrS (SEQ ID NO: 6): CATCGGGCAGTTCATCGGCTTGAGGTAGTAGTCGGCGCCCGGCTTGGTGATGTTGCCGTCCGCGTCCTTCTCCTCGTCGAGGTGCATGGGCGGGTACATGCCGTCCTTGTACCAGTGCAGGTGGCCGGAGGTCTCGTACAGGCCGCCCTTGGTGATGTGCGGGGTCTGCACGAAGCTGTAATGGTGCTTGCGGTGCATCTCACGGGAGTAGATCCTCCATAGCGTTGATCACGGCGGCACCCTTCGGGTGGAACACGGCCAGGCCGGGGCCAATTTCATCCGGGAAGGAGAACAGGTCCATCTCGGCGCCGAGCTTGCGGTGATCGCGCTTGGCGGCTTCTTCCAGGCGGGTCTGGTAGGCCTTGAGGTCTTCCTTGGTGGCCCATGCGGTGCCGTAGACGCGCTGCATGGTCGGGTTCTTCTCGGAACCACGCCAGTAGGCGGCGGCGGAACGCTCGATTTTGAAGGCCTTGATGTAGCGGGTGTTCGGCAGGTGCGGGCCGCGGCACAGGTCCTTCCAAACCACATTGCCATCACGGT CTACGTTGTCGTAGAAGCTGAGCTCCTTTTCGGAGATCTCGGTGGCGGCGGCCGGGTCGAGGTGTGCTTCCTTGTCTTCGATCAGTTCGATCTTAAAGGGCTGGTCGGCCTCTTCCTTCAGAGCCTCTTCCTCGGTCACGGAACGGCGGCGGAAGGACTGGGAGGACTTGATGATGCGCTGCATGCGCTTCTCGATGTCCTTGAGGTCGTTCGGGGTGAAGGGCTGGTCGACCTGTAAAGTCGTAGTA

[0128] Example 2. Influence of B. longum strain CECT30763 on behavior in a socially stressful-induced depression model Production of B. longum strain CECT30763 B. longum strain CECT30763 was cultured under anaerobic conditions in MRS liquid medium at 37°C in an anoxic chamber (Bactron 300-2, Shellab, Cornelius, OR, USA) containing a gas mixture of 10% CO2, 10% H2, and 80% N2. Cells were harvested by centrifugation (12,000 x g for 10 min at 4°C) and washed with phosphate-buffered saline (PBS, 130 mM sodium chloride, 10 mM sodium phosphate, pH 7.4) supplemented with 0.05% L-cysteine. Bacteria were resuspended in PBS + 0.05% L-cysteine ​​+ 10% glycerol, and these suspensions were immediately frozen in liquid nitrogen and stored at -80°C until use. Cell viability of the cultures was measured on MRS agar plates; viability of the cultures after storage at -80°C ranged from 98% to 99% per ml of culture. To prevent fluctuations in viability of the cultures during the study, frozen cultures were thawed daily for administration.

[0129] Development of animal models of acute and chronic social stress and sample collection Pubertal male C57BL / 6 mice (32 days old, Charles River, Les Oncins, France) were used. Mice were housed under conditions of temperature (23°C), relative humidity (40%-50%), and a 12-hour light-dark cycle. They were fed a standard diet (D12450K, Research diet, Brogaarden, Denmark) for 7 weeks (the first week was kept in an isolation room to prevent zoonotic diseases). Mice were randomly divided into three experimental groups (n = 10): control (C), stress group (E), and B. longum CECT30763-treated group (E+B). Mice in the B. longum group received 1 × 10 bacteria suspended in PBS + 0.05% L-cysteine ​​+ 10% glycerol once daily. 9The control and stress groups received the same amount of carrier or placebo (PBS + 0.05% L-cysteine ​​+ 10% glycerol). Treatment or placebo was administered for 6 weeks. After 6 weeks, some groups were used for behavioral testing, and another subgroup was euthanized by cervical dislocation to obtain samples including blood, intestines, brain, fecal contents, and feces. The other experimental group was euthanized after the initial exposure to acute stress to analyze the effects of the traumatic situation at an early stage.

[0130] Acute and chronic social stress models To induce chronic social stress, we used an animal model of social defeat based on the resident-intruder paradigm. In this model, one of two animals (the resident) was allowed to establish a territory in its own cage. Then, a male C57BL / 6 mouse (the intruder) was introduced into the resident's cage in a one-to-one relationship. For this purpose, we used adult male mice (CD-1 strain) that were older (5 weeks older) and more aggressive than the target mice. These mice were isolated and trained to be more aggressive. For the chronic stress model, a 10-day contending encounter (introducing a naive mouse into the resident's cage for 5 minutes) was conducted. For the acute stress model, physical contact between the two animals was allowed, and the intruder mouse experienced high stress (reflected by high levels of corticosterone secretion). The contending encounters were conducted in a neutral room, not in the conventional animal facility. After receiving a threat / attack from an opponent, experimental mice (intruders) displayed avoidance or flight behaviors, as well as defensive / submissive behaviors. Defeat was defined as the adoption of a specific posture indicative of defeat. This posture is characterized by an upright, submissive posture with relaxed forelimbs, an upright head tilt, and tucked ears [Can, A., et al., The tail suspension test. J Vis Exp, 2012(59): p. e3769.]

[0131] The control group was not exposed to social defeat; all mice in this group were placed in a cage identical to the one used to observe fighting behavior for 5 minutes and allowed to explore the cage without any contact with the other mice.

[0132] 3% sucrose preference test (SPT) The 3% sucrose choice test was conducted to assess hedonic / anhedonic behaviors associated with depressive behavior. Anhedonic behavior (the inability to experience pleasure) is considered one of the most distinct symptoms of depression. Various animal studies have shown that depressed animals consume less water containing 3% sucrose, which is considered anhedonic behavior.

[0133] The test involves depriving animals of water for 12 hours and then presenting them with a choice between water or water containing 3% sucrose.

[0134] During the 2-hour test period, the sucrose bottle was swapped with the water bottle to eliminate the effects of place preference. The amount of 3% sucrose consumed during this 2-hour period indicated hedonic / anhedonic behavior. Lower sucrose intake indicated anhedonic behavior. Sucrose preference was calculated as the ratio of sucrose intake to the total amount of fluid ingested, corrected for body weight.

[0135] The results (Figure 1) show that stressed animals consumed significantly less 3% sucrose than control mice (p<0.05), indicating anhedonia and therefore depressive behavior. Administration of B. longum CECT30763 significantly reduced anhedonia (p<0.001), demonstrating its ability to alleviate depressive behavior in this study.

[0136] Tail suspension test Mice were suspended from the edge of a table with adhesive tape approximately 1 cm from the tip of their tail, preventing escape or clinging to nearby surfaces. Escape attempts and 5-minute immobility were quantified. Activity and immobility times were recorded for the duration of the 5-minute test. This test has been widely used to assess depressive behavior in mice [Can, A., et al., The tail suspension test. J Vis Exp, 2012(59): p. e3769].

[0137] The results (Figure 2) show that stressed animals showed a significant increase in overall activity compared to controls (p<0.01). Administration of B. longum CECT30763 (E+B) significantly normalized this abnormal behavior in the stressed or E groups (p<0.001), demonstrating its effectiveness in reversing depressive behavior.

[0138] Forced swim test To perform this test (Figure 3), a mouse was placed in a water-filled beaker for 5 minutes, and its behavior was recorded using software (Smart2.0, Panlab). The time spent moving or immobile by the mouse was analyzed.

[0139] The results showed that stressed mice moved significantly more than control mice (p<0.05), and administration of B. longum CECT30763 normalized this behavior (p<0.0001), suggesting its effectiveness in ameliorating depressive behavioral disorders.

[0140] Open Field This test measures activity and anxiety in an open field. In this test, animals are placed in an open box for 10 minutes. The less activity in the center of the open field, the more anxious the animal is considered to be.

[0141] The results of this study (Figure 4) show that stressed animals performed fewer central rears (rodent rearing on their hind legs) than control mice (p<0.01). Treatment with B. longum CECT30763 normalized this value, tending to eliminate the significant difference.

[0142] Overall, the results of these behavioral studies indicate that treatment with B. longum CECT30763 reverses depressive and anxious behaviors in mice exposed to chronic social stress, a model of these conditions.

[0143] Example 3. Effect of B. longum strain CECT30763 on immune responses in an animal model of social stress-induced depression In animal models of acute and chronic social stress-induced depression, immune system responses were analyzed in plasma, spleen, and small intestine by flow cytometry. Flow cytometry is an analytical technique that allows rapid measurement of certain physical and chemical properties of cells or particles suspended in a fluid, which individually emit signals when interacted with a light source.

[0144] To measure cytokines and chemokines in plasma, blood was collected by EDTA and centrifuged at 3500 rpm for 10 minutes at 4°C. A multiplex kit (LEGENDplex) specialized for fluorescent labeling of cytokines and chemokines was used. TM The labeled samples were simultaneously quantified by flow cytometry using a FORTESA kit (BD LSR-FORTESSA SORP, Becton Dickinson) and a Mouse Inflammation Panel (BD LSR-FORTESSA SORP) according to the manufacturer's instructions.

[0145] Small intestinal cells were isolated according to our previously reported procedure (Lopez-Almela et al., Bacteroides uniformis combined with fiber amplifies metabolic and immune benefits in obese mice. Gut Microbes. 2021, 13(1):p. 1). Isolated cells suspended in FACS buffer (PBS supplemented with 0.5% BSA) were incubated with different immune markers at 4°C in the dark for 30 minutes to measure lymphocyte subpopulations (particularly regulatory T lymphocytes, also known as Tregs).

[0146] For spleens, single cell suspensions were prepared by passing the tissue through a 100 μm cell strainer (Sarstedt, inserted into a 50 ml tube using the plunger of a 1 ml syringe and washing the strainer with sterile 1X PBS supplemented with 5% FBS (FACS 5%)). Samples were centrifuged at 300 g for 5 minutes. Red blood cells were lysed by incubation with 5 ml of 1X RBC hemolysis buffer (eBioscience) at 37°C for 10 minutes. Immune cells were washed with 5% FBS (FACS 5%).

[0147] Spleen and intestinal samples were stained with a CD16 / CD32 anti-mouse antibody (clone 2.4 G2, Bioscience) prior to incubation with FACS 5%. Treg cells were identified using CD45 AF700, CD19 PE-Cy7, CD4 PE, CD3 PerCp Cy5.5, CD8 FITC, CD25 APC, and Foxp3 BV421 (BD). For intracellular labeling, a mouse Foxp3 buffer set kit (BD) was used. Samples were purchased from BD LSR-FORTESSA SORP (Becton Dickinson) and analyzed using FCS express flow cytometry software version 5.

[0148] The plasma-derived chemokines CXCL9 (Figure 5A), which promotes leukocyte differentiation and proliferation, and CXCL10 (Figure 5B), which measures immune responses through leukocyte activation and recruitment, were significantly increased in stressed mice compared to controls (p<0.01). Administration of B. longum CECT30763 significantly reduced these changes in both cases (p<0.05). Because these chemokines are elevated in patients with elevated anxiety and depression, administration of B. longum CECT30763 may improve immune markers associated with depression and anxiety.

[0149] CCL2, a chemokine involved in the recruitment of monocytes, memory T cells, and dendritic cells to inflammatory sites (Figure 5C), was significantly increased in stressed mice (p<0.001), and administration of B. longum CECT30763 restored this abnormality (p<0.001). Because this chemokine is increased in patients with major depressive disorder, these results suggest that B. longum CECT30763 has the ability to reduce this inflammatory marker of depression in plasma.

[0150] The results for IL-6 (Figure 5D) and TNF-α (Figure 5E) were significantly increased in the stress group (p<0.0001 and p<0.001, respectively). Treatment attenuated these changes in both cases, but the results were not significant at p<0.05. IL-6 plays an important role in the pathogenesis of depression and is one of the cytokines most significantly increased in the serum of depressed patients in both clinical and preclinical studies. Meanwhile, a correlation has been found between serum TNF-α levels and subjects with anxiety disorders. Therefore, it can be confirmed that B. longum CECT30763 plays a positive role in immune responses related to depression and anxiety.

[0151] Overall, the results indicate that B. longum CECT30763 plays a positive role by restoring five abnormal plasma chemokines and cytokines in patients with depression and / or anxiety. Some of these inflammatory mediators are also involved in the progression of cardiovascular pathology. In particular, CCL2 plays a key role in the early progression of this type of disease, promoting the infiltration of macrophages and other immune system cells into cardiac tissue and activating the cascade of proinflammatory cytokines, including IL-6 and TNF-α. In this case, reduction of these chemokines is associated with reduced interstitial fibrosis and reduced cardiovascular disease, suggesting that B. longum CECT30763 may play an important role in cardiovascular health.

[0152] The results of cell counting of splenocytes and small intestinal cells (Figures 6A and 6B, respectively) showed that chronic stress significantly reduced regulatory T cells (Tregs), and that B. longum CECT30763 exerted anti-inflammatory effects and increased Tregs after repeated exposure to stress. Furthermore, in an acute social stress model (5 minutes of stress per day), bacterial administration significantly increased Treg lymphocytes (p<0.001) (Figure 6C), independent of the effects of stress. This latter result suggests that B. longum CECT30763 itself may have anti-inflammatory effects that are expressed early in stress exposure and may mitigate the harmful effects of continued exposure.

[0153] Example 4. Effects of B. longum strain CECT30763 on neuroendocrine responses in an animal model of chronic social stress-induced depression The effect of B. longum CECT30763 administration on endocrine responses was measured by analyzing plasma levels of corticosterone, the primary hormone released into the blood in response to stress-induced HPA axis activation. Samples were prepared by adding cold methanol to plasma in a 1:3 ratio and centrifuging at 13,000 rpm for 10 minutes at 4°C to remove proteins. The supernatant was injected into a mass spectrometer.

[0154] The results (Figure 7A) showed that 10 days of continuous stress significantly increased plasma corticosterone levels (p<0.0001). Administration of B. longum CECT30763 slightly decreased corticosterone levels, but this decrease was not significant.

[0155] Because dopamine plays an important role in stress-induced depression, dopamine responses were assessed. Specifically, plasma dopamine (DA) was measured. The same method used to measure corticosterone was used to measure dopamine.

[0156] The results (Fig. 7B) showed a clear but not statistically significant increase in plasma DA concentration in the stressed mice, and a statistically significant normalization was observed after administration of B. longum CECT30763 (p<0.01, Fig. 7B).

[0157] We analyzed the expression of two major DA receptors in the prefrontal cortex of affected brains in both animal models and patients with depression by qPCR, using Trizol RNA extraction, reverse transcription to obtain cDNA, and gene-specific primers for qPCR.

[0158] The primers for identifying the receptor were as follows: D2L: 5'-3'F-GGAGTTTCCCAGTGAACAGGCGG (SEQ ID NO: 7) and 5'-3'R-TTGCTATGTAGACCGTGGTGGGATG (SEQ ID NO: 8). D1: 5'-3'F-CAGGTAAACCAGATTACAGTCCTTG (SEQ ID NO: 9) and 5'-3'R-TTAGGATGCTATAGACTCTGCCCTA (SEQ ID NO: 10).

[0159] The reference or "housekeeping" gene for comparing and quantifying gene expression of both receptors was RPL19, and the primers used were as follows: 5'-3'F-CCTTGTCTGCCTTCAGCTTGT (SEQ ID NO: 11) and 5'-3'R-GAAGGTCAAAGGGAATGTGTTCA (SEQ ID NO: 12).

[0160] The results showed that D2L receptors (Figure 8A) were significantly decreased in stressed mice (p<0.05). Bacterial administration reversed this change (p<0.05). For D1R receptors (Figure 8B), a non-significant decrease in receptor expression was observed, and treatment tended to reverse this minor change (Figure 8B).

[0161] Overall, these results indicate that B. longum CECT30763 has the ability to improve endocrine as well as dopamine responses in an animal model of chronic social stress-induced depression.

[0162] Example 5. Effect of B. longum strains on hepatic responses in an animal model of chronic social stress-induced depression In the livers of mice in the social stress model, the expression of genes encoding transforming growth factor β1 (TGFβ1), type 1 collagen alpha 1 chain (Col1a1), and type 3 collagen alpha 1 chain (Col3a1) ( Figures 9A, B, and C, respectively) was analyzed by RT-qPCR.

[0163] Data analysis revealed that type I collagen was significantly increased in the chronic stress group, and probiotic administration had the ability to prevent this effect. Type III collagen expression showed a similar trend, but no statistically significant differences were observed between groups.

[0164] However, although an increase in TGFβ1 expression was expected because it is a pro-fibrotic molecule expressed by fibroblasts and promotes collagen production, no change was observed. This is likely because, since this molecule is the first part of the fibrotic pathway, its expression no longer increases after 10 days of stress exposure, and instead the expression of proteins or their target genes (e.g., collagen) increases.

[0165] The following primers were used: TGFβ1: 5′-3′F-ACCATGCCAACTTCTGTCTG (SEQ ID NO: 13) and 5′-3′R-CGGGTTGTGTTGGTTGTAGA (SEQ ID NO: 14). Col1a1: 5'-3'F-AATGGCACGGCTGTCTGCGA (SEQ ID NO: 15) and 5'-3'R-AGCACTCGCCCTCCCGTCTT (SEQ ID NO: 16) Col3a1: 5'-3'F-CTGTAACATGGAAACTGGGGAAA (SEQ ID NO: 17) and 5'-3'R-CCATAGCTGAACTGAAAACCACC (SEQ ID NO: 18)

[0166] Regarding metabolic health, B. longum CECT30763 has been observed to have a protective effect against some of the chronic stress-induced changes in the expression of fatty acid metabolism-related enzymes in the liver (the main organ for fatty acid metabolism). Specifically, stress reduces the expression of the ACC1 (acetyl-CoA carboxylase 1) enzyme (Figure 10A). This enzyme is involved in the de novo synthesis of fatty acids, and its reduced activity has been shown to cause increased accumulation of fat and triglycerides in the blood [Chow, JD, et al., Genetic inhibition of hepatic acetyl-CoA carboxylase activity increases liver fat and alters global protein acetylation. Mol Metab, 2014. 3(4): pp. 419-31.]. Administration of B. longum CECT30763 statistically significantly increases its expression in the liver of mice under chronic stress. The following primers were used: ACC1: 5'-3'F-TAATGGGCTGCTTCTGTGACTC (SEQ ID NO: 19) and 5'-3'R-CTCAATATCGCCATCAGTCTTG (SEQ ID NO: 20).

[0167] Furthermore, stress increases the expression of the DGAT (diacylglycerol O-acyltransferase 1) enzyme, which is involved in the synthesis of triglycerides in the liver from dietary fatty acids (Figure 10B), and decreases the expression of the CPT1a (carnitine palmitoyltransferase 1A) enzyme gene, which is involved in the oxidation of fatty acids and their utilization as an energy source (Figure 10C). All of this leads to increased lipid accumulation in the liver and promotes hepatic steatosis. This DGAT / CPT1a imbalance (Figure 10D) is reversed by B. longum CECT30763, improving metabolism and reducing the risk of progression of associated disorders. The following primers were used: DGAT: 5'-3'F-TCCGTCCAGGGTGGTAGTG (SEQ ID NO: 21) and 5'-3'R-TGAACAAAGAATCTTGCAGACGA (SEQ ID NO: 22). CPT1a: 5'-3'F-TTTGAATCGGCTCCTAATGG (SEQ ID NO: 23) and 5'-3'R-CCCAAGTATCCACAGGGTCA (SEQ ID NO: 24).

[0168] RPL19 was used as a reference gene, the primers for which were previously identified in Example 4.

[0169] Example 6. Effect of B. longum strain CECT30763 on oxidative stress in an animal model of chronic social stress-induced depression Cardiac tissue was analyzed for the presence of 8-hydroxy-2'-deoxyguanosine (8-OHdG) (Figure 11), a biomarker of DNA damage due to oxidative stress. This biomarker is known to be associated with cardiac disease, particularly in hypertensive pathologies. To examine the presence of DNA damage due to oxidative stress, 10-μm-thick cross sections were taken from the hearts of mice in different experimental groups and subjected to immunofluorescence analysis. These sections were first incubated with a monoclonal mouse primary antibody against 8-OHdG, followed by a secondary antibody against a fluorescent mouse primary antibody (Alexa Fluor® 488). Phalloidin, a probe conjugated with a red fluorescent dye (Alexa Fluor® 546) that specifically labels F-actin filaments, and DAPI, a fluorescent marker that specifically labels cell nuclei, were also used. To quantify this oxidative damage, images taken with a 16x microscope equipped with a fluorescent lamp were analyzed, and the percentage of the area labeled with the 8-OHdG antibody was calculated from the total tissue area.

[0170] Data analysis showed that chronic stress in mice disrupts the antioxidant balance in cardiomyocytes (heart muscle cells) through neuroendocrine stimulation or excessive inflammation, increasing the production of reactive oxygen species (ROS), causing DNA damage and its expression, resulting in detrimental effects on cellular function. This is reflected by a significant increase (p<0.05) in 8-hydroxy-2'-deoxyguanosine (8-OHdG) levels in the heart. Administration of B. longum CECT30763 statistically significantly reduced oxidative stress-induced DNA damage in myocardial tissue in the chronic stress model (p<0.01) (Figure 11), thereby avoiding adverse effects such as cell apoptosis, fibrosis, or increased risk of arrhythmia. Therefore, it was confirmed that B. longum CECT30763 has a positive effect on cardiac function and may prevent or delay the development of future cardiovascular disease associated with this animal model of chronic stress-induced depression. [Brief explanation of the drawings]

[0171] [Figure 1] Evaluation of the effect of B. longum CECT30763 (1 x 109 cfu / day) administration in C57BL / 6 mice exposed to chronic social stress (n = 13 (C), 13 (E), 14 (E+B)) in the sucrose preference test. Data are shown as the percentage of sucrose intake relative to total intake and standard error. Statistically significant differences were established using the Kruskal-Wallis test followed by Dunn's multiple comparison test (* = p < 0.05, *** = p < 0.001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: B. longum CECT30763-treated mice exposed to chronic stress. [Figure 2]Evaluation of the effect of B. longum strain CECT30763 (1 x 109 cfu / day) administration in C57BL / 6 mice exposed to chronic social stress (n = 13 (C), 13 (E), 11 (E+B)) in the tail suspension test. Data are presented in seconds, with standard errors shown. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test (* = p < 0.05, ** = p < 0.01, **** = p < 0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 3] Evaluation of the effects of B. longum CECT30763 (1 x 109 cfu / day) administration in C57BL / 6 mice exposed to chronic social stress (n = 27 (C), 26 (E), 23 (E+B)) in the forced swim test. Data are presented in seconds, with standard errors shown. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test (* = p < 0.05, ** = p < 0.01, **** = p < 0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 4] Evaluation of the effects of B. longum CECT30763 (1 x 109 cfu / day) administration in C57BL / 6 mice exposed to chronic social stress (n = 14 (C), 14 (E), 11 (E+B)) in the open field test. Data are shown as the number of rearing or upright exploration movements and standard error. Statistically significant differences were established by Kruskal-Wallis test followed by Dunn's multiple comparison test (** = p < 0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 5]Evaluation of the effects of administration of B. longum CECT30763 (1 x 109 cfu / day) on the plasma immune system in C57BL / 6 mice (n = 8-9 / group) exposed to chronic social stress. Plasma chemokine and cytokine levels: CXCL9 (A), CXCL10 (B), CCL2 (C), IL-6 (D), and TNF-α (E). Data are presented in picograms (pg) per milliliter (ml) with standard errors indicated. Statistically significant differences were established by Kruskal-Wallis test followed by Dunn's multiple comparison test (* = p < 0.05, *** = p < 0.001, **** = p < 0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 6] Evaluation of the effects of B. longum CECT30763 (1 x 10 cfu / day) administration on the spleen and small intestine immune system in C57BL / 6 mice (n = 8-10 / group) exposed to acute and chronic social stress. Treg lymphocyte levels in the spleen (A) and small intestine (B) of mice exposed to chronic stress and in the spleen (C) of mice exposed to acute stress. Data are presented in picograms (pg) / milliliter (ml) with standard errors indicated. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test (* = p < 0.05, ** = p < 0.01, **** = p < 0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 7]Evaluation of the effects of B. longum CECT30763 (1 x 109 cfu / day) administration in C57BL / 6 mice (n = 12-16 / group) exposed to chronic social stress. Plasma cortisone (A) and dopamine (B) concentrations. Data are shown as percentages of the control group, with standard errors indicated. Statistically significant differences were established by one-way analysis of variance (ANOVA) followed by a post hoc Tukey's test (** = p < 0.01, **** = p < 0.0001). C: Control mice; E: Untreated mice exposed to chronic stress; E + B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 8] Evaluation of the effect of B. longum CECT30763 (1 × 109 cfu / day) administration on dopamine receptor expression in the prefrontal cortex of the brain in C57BL / 6 mice (n = 7-9 / group) exposed to chronic social stress. Relative mRNA expression of dopamine D2L (A) and D1R (B) receptors in the prefrontal cortex (PFCx). Data are shown for each individual, and each point and histogram represents the mean and standard error. Statistically significant differences were established using the Kruskal-Wallis test followed by Dunn's multiple comparison test (* = p < 0.05). C, control mice; E, untreated mice exposed to chronic stress; E + B, mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 9] Evaluation of the effect of B. longum CECT30763 (1 x 109 cfu / day) administration on liver fibrosis-related gene expression in C57BL / 6 mice (n = 6-9 / group) exposed to chronic social stress. Relative mRNA expression levels of the liver fibrosis-related genes TGFβ1 (A), Col1a1 (B), and Col3a1 (C). Data are shown for each individual, and each point and histogram represent the mean and standard error. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest (*p<0.05; **p>0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 10] The effects of B. longum CECT30763 administration (1 × 109 cfu / day) on the expression of fatty acid metabolism-related genes in the liver of C57BL / 6 mice (n = 8-9 / group) exposed to chronic social stress were evaluated. The relative mRNA expression levels of ACC1 (A), DGAT (B), and CPT1a (C) genes and the DGAT / CPT1 ratio (D) are shown. Data are shown for each individual, and each point and histogram represents the mean and standard error. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest or, where indicated, Student's t-test between two groups (*p < 0.05). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763. [Figure 11] Evaluation of the effect of B. longum CECT30763 (1 x 109 cfu / day) administration on oxidative stress damage in C57BL / 6 mice exposed to chronic social stress (n = 9 (C), 9 (E), 7 (E+B)). 8-hydroxy-2'-deoxyguanosine (8-OHdG) antibody-positive tissue area as a percentage of total tissue area. Data are shown for each individual, and each point and histogram represent the mean and standard error of the mean. Statistically significant differences were established by one-way analysis of variance (ANOVA) with Bonferroni pretest (*p<0.05; **p<0.01). C: Control mice; E: Untreated mice exposed to chronic stress; E+B: Mice exposed to chronic stress and treated with B. longum CECT30763.

Claims

1. A strain of Bifidobacterium longum with accession number CECT30763.

2. A strain derived from the strain of claim 1.

3. The strain according to claim 1 or 2, which is a genetically engineered mutant strain or a naturally occurring mutant strain.

4. The strain according to any one of claims 1 to 3, in the form of viable or non-viable cells.

5. A cellular component, metabolite, secreted molecule or any combination thereof obtained from the strain of any one of claims 1 to 4.

6. A composition comprising the strain according to any one of claims 1 to 4, or the cellular components, metabolites, secreted molecules or any combination thereof according to claim 5.

7. The composition of claim 6 further comprising at least one bioactive ingredient.

8. The composition according to claim 6 or 7, further comprising at least one microorganism other than the strain according to any one of claims 1 to 4.

9. The composition of claim 8 , wherein the microorganism is an enterobacterium or a lactic acid bacterium.

10. The composition according to any one of claims 6 to 9, which is a pharmaceutical composition.

11. The composition of claim 10, further comprising at least one pharmaceutically acceptable carrier and / or excipient.

12. 12. The composition of claim 10 or 11, provided in a form suitable for oral, sublingual, nasal, bronchial, intrathecal, lymphatic, rectal, transdermal, inhalation or intravenous administration.

13. The composition according to any one of claims 6 to 9, which is a nutritional composition.

14. 14. The composition of claim 13, wherein the nutritional composition is a food, a supplement, a nutraceutical, a probiotic, or a synbiotic.

15. 15. The composition of claim 14, wherein the food product is selected from the list consisting of a dairy product, a plant product, a meat product, a snack, a chocolate, a beverage, or a baby food.

16. 10 per gram or milliliter of final composition 4 ~10 14 16. The composition according to any one of claims 6 to 15, having a strain concentration of colony forming units (cfu).

17. A bacterial strain according to any one of claims 1 to 4, a cellular component, a metabolite, a secreted molecule or any combination thereof according to claim 5, or a composition according to any one of claims 6 to 16, for use as a pharmaceutical.

18. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use in the prevention and / or treatment of at least one mood disorder in a subject.

19. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use as an adjuvant in the treatment of at least one mood disorder in a subject.

20. 20. The bacterial strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 18 or 19, wherein the mood disorder is selected from the list consisting of depression, anxiety, major depression, atypical depression, typical or melancholic depression, psychotic depression, catatonic depression, perinatal depression, postpartum depression, bipolar disorder, seasonal affective disorder, stress, dysthymia, depressive personality disorder, dual depression, depressive disorder not otherwise specified, recurrent brief depression, minor depression, mood disorder due to substance abuse, mood disorder due to medication use, and any combination thereof.

21. 21. The strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 20, wherein the mood disorder is depression and / or anxiety.

22. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use in the prevention and / or treatment of at least one cardiometabolic disorder in a subject.

23. 17. The bacterial strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use as an adjuvant in the treatment of at least one cardiometabolic disorder in a subject.

24. 24. The bacterial strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 22 or 23, wherein the cardiometabolic disorder is selected from the list consisting of cardiovascular disease, metabolic syndrome, type 2 diabetes, obesity, hyperlipidemia, hyperglycemia, and any combination thereof.

25. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use in the prevention and / or treatment of at least one liver disorder in a subject.

26. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use as an adjuvant in the treatment of at least one liver disorder in a subject.

27. 27. The strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 25 or 26, wherein the liver damage is selected from the list consisting of hepatic steatosis, liver fibrosis, hepatitis, hepatocellular carcinoma, liver failure and any combination thereof.

28. 17. The strain according to any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof according to claim 5, or the composition according to any one of claims 6 to 16, for use in the prevention and / or treatment of a comorbid mood disorder in a subject.

29. 17. The strain according to any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof according to claim 5, or the composition according to any one of claims 6 to 16, for use as an adjuvant in the prevention and / or treatment of a comorbid mood disorder in a subject.

30. 30. The bacterial strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 28 or 29, wherein the mood disorder is selected from the list consisting of depression, anxiety, major depression, atypical depression, typical or melancholic depression, psychotic depression, catatonic depression, perinatal depression, postpartum depression, bipolar disorder, seasonal affective disorder, stress, dysthymia, depressive personality disorder, dual depression, depressive disorder not otherwise specified, recurrent brief depression, minor depression, mood disorder due to substance abuse, mood disorder due to medication use, and any combination thereof.

31. A bacterial strain according to any one of claims 1 to 4, a cellular component, a metabolite, a secreted molecule or any combination thereof according to claim 5, or a composition according to any one of claims 6 to 16 for use in the prevention and / or treatment of cardiometabolic complications in a subject.

32. 17. The bacterial strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use as an adjuvant in the prevention and / or treatment of cardiometabolic complications in a subject.

33. 33. The bacterial strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 31 or 32, wherein the cardiometabolic complications comprise one or more cardiometabolic disorders selected from the list consisting of cardiovascular disease, metabolic syndrome, type 2 diabetes, obesity, hyperlipidemia, hyperglycemia, and any combination thereof.

34. A bacterial strain according to any one of claims 1 to 4, a cellular component, a metabolite, a secreted molecule or any combination thereof according to claim 5, or a composition according to any one of claims 6 to 16, for use in the prevention and / or treatment of liver complications in a subject.

35. A bacterial strain according to any one of claims 1 to 4, a cellular component, a metabolite, a secreted molecule or any combination thereof according to claim 5, or a composition according to any one of claims 6 to 16, for use as an adjuvant in the prevention and / or treatment of liver complications in a subject.

36. 36. The strain, cellular component, metabolite, secreted molecule or any combination thereof, or composition for use according to claim 34 or 35, wherein the liver complications comprise one or more liver disorders selected from the list consisting of hepatic steatosis, liver fibrosis, hepatitis, hepatocellular carcinoma, liver failure, or any combination thereof.

37. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use in the prevention and / or treatment of one or more cardiometabolic disorders and one or more liver disorders (combined with at least one mood disorder) in a subject.

38. 17. The strain of any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof of claim 5, or the composition of any one of claims 6 to 16, for use as an adjuvant in the prevention and / or treatment of cardiometabolic and liver disorders complicated by at least one mood disorder in a subject.

39. 17. Use of the strain according to any one of claims 1 to 4, the cellular component, metabolite, secreted molecule or any combination thereof according to claim 5, or the composition according to any one of claims 6 to 16 in the manufacture of a food product.