Expression construct

By employing RNA polymerase I promoters to control lentiviral genome expression, the method improves yield and safety in lentiviral vector production, addressing toxicity and efficiency issues in current systems.

JP2026511127APending Publication Date: 2026-04-10LENTITEK LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-22
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current viral vector systems for gene and cell therapy, particularly those using lentiviral vectors, face challenges such as toxicity due to unintended protein expression and inefficient production methods, which can lead to off-target effects and reduced yield.

Method used

Utilizing RNA polymerase I (Pol I) promoters to drive the production of lentiviral genomes, avoiding poly(A) tail addition and inappropriate splicing, thereby increasing transcript availability for viral packaging and reducing toxicity.

Benefits of technology

Enhances the yield and efficiency of lentiviral vector production, minimizing unintended protein expression and off-target effects, making it safer and more effective for therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026511127000001_ABST
    Figure 2026511127000001_ABST
Patent Text Reader

Abstract

This disclosure relates to constructs, particularly lentiviral constructs, used in expression systems for cell therapy and / or gene therapy applications. The constructs include a viral genome whose expression is regulated by an RNA polymerase I promoter.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to constructs for use in expression systems for cell therapy and / or gene therapy applications.

Background Art

[0002] There are several viral vectors for gene therapy, and these have been successfully used to treat diseases in patients. These viral vectors are typically based on adenovirus, adeno-associated virus (AAV), or retrovirus [1]. The most commonly used retrovirus in gene therapy is lentivirus, because lentivirus can transduce both dividing and non-dividing cells. Vector platforms based on equine infectious anemia virus (EIAV) and human immunodeficiency virus (HIV) have been used, and HIV is currently the most common lentiviral system for clinical and commercial applications [2]. In fact, all chimeric antigen receptor T cell (CAR-T) therapies approved worldwide in 2022 use HIV-based lentiviral vectors to reprogram T cells in the manufacturing process.

[0003] Lentiviral vectors, like wild-type lentiviruses, are single-stranded positive-sense RNA viruses, and the virions have an envelope [2]. Lentiviruses can be transduction into both dividing and non-dividing cells, resulting in sustained gene expression in either cell type [1]. Although AAV can also infect non-dividing cells, it is a much smaller virus, resulting in a smaller size of transducible genetic material, making it difficult to use in many applications such as CAR-T [2]. Lentiviral production systems typically employ a triple transfection system. For safety reasons, plasmids containing packaging and envelope components are kept separate from the viral vector genome. Even though all the components for producing a lentivirus can be contained in three, and sometimes four, plasmids, specific elements are often included within the production cell line (called the packaging cell line) [2].

[0004] A common technique in the art for the production of retroviral vectors involves using a plasmid containing an RNA polymerase II promoter to drive the production of both viral protein components and the viral genome. The CMV promoter is commonly chosen because it has very high protein expression levels in mammalian cells [3]. However, the RNA polymerase II promoter typically terminates transcription by adding a poly(A) tail to the end of the transcript, which leads to the translation of the transcript into a protein [4]. In gene therapy applications, translation of the transcript into a protein in the production cell line may be undesirable because unintended expression of the protein may lead to moderate to severe toxicity [5] or other deviant expression effects [6]. For example, in the art, it has been previously shown that CD19 CARs were presented on the surface of lentiviral particles by transgene expression during the production process, causing off-target transduction of B cells and relapse of B-cell lymphoma [6].

[0005] Alternatively, or in addition, it is also possible to produce viral protein components and viral vector genomes using the RNA polymerase I promoter. For example, European Patent No. 1317559 discloses a DNA transfection system for generating infectious negative-strand RNA viruses for use in the development of recombinant influenza vaccines. The plasmid described therein comprises polymerase I promoters and polymerase II promoters, a polyadenylation signal, and viral cDNA transcribed from these two promoters, and is used to generate infectious negative-strand RNA viruses (e.g., influenza viruses). However, European Patent No. 1317559 and other viral vector systems disclosed in the art using the RNA polymerase I promoter typically produce infectious recombinant viruses with replication ability for use as vaccines. Therefore, there remains an unmet need for safe expression systems and efficient methods for producing vectors for use in such expression systems that are suitable for cell therapy and / or gene therapy applications. In particular, there is a need for novel systems for producing modified non-replicating retroviruses (e.g., lentiviruses) that are more efficient, have reduced toxicity or other unexpected effects, and / or are safer. [Overview of the project] [Problems that the invention aims to solve]

[0006] This disclosure is at least partly based on the finding that RNA polymerase I (Pol I) can be used to drive the efficient and improved production of retroviruses, particularly lentiviral genomes, within cells.

[0007] In one embodiment, a lentiviral genome construct is provided, comprising a lentiviral genome and an RNA polymerase I promoter, wherein the expression of the lentiviral genome is under the control of the RNA polymerase I promoter.

[0008] While we do not wish to be constrained by theory, transcripts produced using RNA polymerase I (Pol I) are not modified by the addition of a poly(A) tail, thus making the transcript available for its intended purpose (intracellularly) and preventing inappropriate directing to the cell's protein-producing mechanisms (e.g., the Golgi apparatus). Using Pol I to produce transcripts also reduces the possibility of unexpected expression of the transcript (or a portion thereof) and / or inappropriate RNA splicing within the cell (see, for example, Cooper et al., Nucleic Acids Research, Volume 43, Issue 1, 9 January 2015, Pages 682-690).

[0009] In one teaching, the various methods, applications, and systems described herein can be used for the production of viral vectors, particularly lentiviral vectors. In such applications, at least the viral genome can be placed under the control of Pol I, thereby ensuring the efficient generation of viral genome transcripts in the production cell line. Furthermore, by using Pol I to generate the viral (e.g., lentiviral) vector genome, it is ensured that the generated transcripts are available for packaging and are not inappropriately directed towards the cellular protein production mechanism. Taken together, these advantages improve and make more efficient the methods for producing viral vectors, such as lentiviral vectors.

[0010] Based on the above, in one embodiment, this disclosure provides an improved method for generating retroviral genomes, particularly lentiviral genome transcripts, within cells, and this method is (i) operably linking a retroviral genome sequence for transcription to the RNA polymerase I promoter (Pol I) within a cell; and / or (ii) To place the retroviral genome sequence for transcription under the control of the RNA polymerase I promoter (Pol I) within the cell. Includes.

[0011] The method of this disclosure has been improved for the following reasons: (a) The yield of the transcript is improved; (b) The amount of transcript available for the original purpose (packaging into a viral vector) increases; (c) The risk of unexpected occurrences may be reduced; and / or (d) If the transcript is required for the production of a viral (e.g., lentiviral) vector genome, the production can be carried out more efficiently, and the yield of the viral vector will increase.

[0012] As mentioned earlier, we do not wish to be bound by theory, but these improvements stem from the fact that transcripts generated using the Pol I promoter are not modified to include a polyA tail, thereby avoiding the transcript being improperly directed to the cellular protein production mechanism and / or improperly spliced. This increases the amount of transcript available for its intended purpose. When the transcript is a viral vector genome (e.g., a lentiviral vector genome), the purpose is to package and utilize the genomic transcript in a viral vector (along with glycoproteins and viral protein components).

[0013] In the context of this disclosure, the term “transcript” may encompass any RNA copy of a DNA fragment. The DNA may encode a protein, such as a therapeutic protein, or it may be non-coding, meaning it does not encode a protein or peptide.

[0014] In addition to directly improving viral yield, constructs for generating retroviruses that include a combination of an RNA polymerase I (Pol I) promoter and a long terminal repeat sequence may provide an improved system with increased efficiency and reduced other problems associated with host cytotoxicity or the unexpected expression of the payload or transgene. Importantly, the constructs of this disclosure are suitable for generating non-replicating recombinant retroviruses for use in cell therapy and / or gene therapy applications. This disclosure provides a lentiviral genome construct including an RNA polymerase I (Pol I) promoter.

[0015] The lentiviral genome construct of this disclosure may further include a Pol I termination signal.

[0016] The lentiviral genome constructs of this disclosure may further include a 5' long-terminal repeat sequence (5'LTR) and / or a 3' long-terminal repeat sequence (3'LTR). The 5'LTR may be located downstream of the RNA polymerase I (Pol I) promoter, and the 3'LTR may be located upstream of the Pol I termination signal.

[0017] The lentiviral genome construct may include, and may further include, inserts adjacent to the 5' long-chain terminal repeat sequence and the 3' long-chain terminal repeat sequence. The inserts may include transgenes.

[0018] In one teaching, the lentiviral genome construct of this disclosure is: RNA polymerase I (Pol I) promoter and; Pol I termination signal and; 5' long-chain terminal repeat sequences (5'LTRs) and; 3'-long terminal repeat sequences (3'LTRs) and; Includes an insert positioned or placed between 5' and 3' long-chain terminal repeat sequences; The 5' LTR is positioned or disposed downstream of the RNA polymerase I (Pol I) promoter, and the 3' LTR is positioned or disposed upstream of the Pol I termination signal.

[0019] In one teaching, the present disclosure provides a construct for use in an expression system, the construct comprising: an insert adjacent to a 5' long terminal repeat (5' LTR) and a 3' long terminal repeat (3' LTR), the 5' LTR being downstream of the RNA polymerase I (Pol I) promoter and the 3' LTR being upstream of the Pol I termination signal, the insert comprising a transgene.

[0020] As used herein, the term "expression system" typically includes one or more constructs (e.g., one or more DNA constructs) that encode a protein, peptide or RNA when introduced into a cell. For example, an expression system may include a bacterial expression system, a yeast expression system or a mammalian expression system.

[0021] In one embodiment, a construct for generating a recombinant retrovirus is provided, the construct comprising an insert adjacent to a 5' long terminal repeat (5' LTR) and a 3' long terminal repeat (3' LTR), the 5' LTR being downstream of the RNA polymerase I (Pol I) promoter and the 3' LTR being upstream of the Pol I termination signal, the insert comprising a transgene, optionally, the construct further comprising a post-transcriptional response element downstream of the transgene and upstream of the Pol I termination signal, and further optionally, the construct comprising a retroviral packaging element and / or one or more nuclear export components upstream of the insert.

[0022] In one embodiment, a polyA signal is provided immediately after the transgene (typically 20 to 200 bp, such as 40 to 100 bp downstream from the end of the gene coding sequence). Although the introduction of a strong polyA signal is widely known to enhance gene expression, it is generally not included in current lentiviral designs because Pol II transcription is terminated before the 3'LTR.

[0023] As an extension of the above, transgene expression systems that express two or more transgenes typically currently separate each transgene using a cleavable peptide linker, but the overall transgene expression is under the control of a single promoter. However, in some cases, it may be desirable to place different transgenes under the control of different promoters. The present disclosure enables the expression of two or more complete transgene systems, and each transgene may be under the control of an individual promoter (e.g., promoter - transgene - polyA signal). The transgene or each transgene may be, for example, under the control of a Pol I or Pol II promoter.

[0024] Pol I transcripts are not usually processed by the same splicing mechanism as Pol II transcripts. However, introns can be useful and in some cases essential for the expression level of a particular transgene. Thus, in one embodiment, the transgene or each transgene may include one or more introns and transgene coding sequences or exon sequences.

[0025] Throughout this specification, the terms "comprising" and / or "including" indicate that the aspects and / or embodiments of the present disclosure "comprise" the features described, and may include other features. However, in the context of the present disclosure, the terms "comprising" and "including" also encompass embodiments that "essentially comprise" the relevant features or "only comprise" the relevant features.

[0026] In one application, the constructs of this disclosure are intended for use in the production of non-replicating recombinant retroviruses for cell therapy and / or gene therapy applications. The retrovirus production system typically includes a transfection system containing multiple vectors encoding different portions of the retrovirus particle. For safety reasons, the vectors, including packaging and envelope components, are usually introduced into host cells separately from the retrovirus vector genome. As used herein, the term “retrovirus vector genome” refers to genetic material transcribed from the constructs disclosed herein and intended to be delivered to target cells by retrovirus particles for cell therapy and / or gene therapy applications.

[0027] This disclosure may also encompass host cells in which various lentiviral components (or genetic elements encoding them) are stably integrated into the host cell genome. It should be noted that providing stable (lentiviral vector)-producing cell lines offers significant economic advantages, particularly because it avoids the need to produce large quantities of plasmids. The sites in which viral components are stably integrated into the cell genome can be important because they require high and balanced relative levels of expression. However, those skilled in the art will understand that the integration process is somewhat random and therefore the locations are not predetermined. Thus, the result of balanced high expression is determined to some extent when selecting a particular clone. For example, clones in which viral elements are integrated at unfavorable locations should be excluded by screening. In these embodiments, transcription of the lentiviral genome integrated into the cellular DNA (genome) can be driven using at least Pol I.

[0028] For the sake of clarity, the term “host cell” as used herein refers to a cell (typically in vitro) into which the construct of this disclosure has been introduced (e.g., by transfection) and is used for the production of non-replicating recombinant retroviruses. Since the host cell is a host cell that produces recombinant retroviruses for use in cell therapy and / or gene therapy applications, it may also be called a host-producing cell or producing cell. The term “target cell” refers to a cell into which the resulting recombinant retrovirus, including a transgene, has been introduced (e.g., by transduction) and is used for cell therapy and / or gene therapy applications. Typically, the recombinant retrovirus introduced into the target cells of this disclosure is a non-replicating recombinant retrovirus.

[0029] In one embodiment, the host cell is a mammalian cell. In a further embodiment, the mammalian cell can be selected from HEK 293 cells, HEK 6E cells, CHO cells, BHK21 cells, NSD20 cells, Sp2 / 0 cells, HT-1080 cells, PER.c6 cells, HKB-11 cells, CAP cells, HuH-7 cells, Jurkat cells, KS62 cells, PerC6 cells, HeLa cells, HOS cells, H9 cells or their derivatives or functional equivalents. In a further embodiment, the mammalian host cell is HEK 293 cells or derived from HEK 293 cells. These cells may be adherent cell lines (i.e., growing in a monolayer attached to a surface) or suspension-adapted / non-adherent cell lines (i.e., growing suspended in culture medium). In a further embodiment, the HEK 293 cell is HEK 293T cells or HEK 6E cells. The term "HEK 293 cells" refers to the human fetal kidney-derived 293 cell line commonly used in the biotechnology field. In particular, HEK 293T cells are widely used for the production of various retroviral vectors. Other suitable commercially available cell lines include the T REX® (Life Technologies) cell line. In alternative embodiments, insect cell lines (e.g., Sf9, Sf21, High Five) may be used as host cells.

[0030] The constructs of this disclosure provide inserts for producing (single-stranded positive sense RNA) transcripts that can be transcribed in a host cell and packaged into retroviral particles as a retroviral vector genome. Each single-stranded positive sense RNA transcript can form the “retroviral vector genome” of the resulting non-replicating recombinant retrovirus. Generally, the constructs of this disclosure are used in conjunction with other constructs that encode viral packaging and / or envelope components.

[0031] As used herein, the term “transgene” refers to a nucleic acid sequence artificially introduced into a construct of this disclosure. Preferably, a packaged retroviral genome contains a transgene. The transgene may be homologous, partially or completely heterogeneous, to an endogenous gene in the target animal or cell into which it is introduced, but is designed to modify the target cell genome or is inserted in such a manner. In some cases, the transgene may not be similar to the endogenous gene and may be introduced from another cell type or heterogene. For example, a bacterial protein may be delivered to a mammalian cell using a construct of this disclosure and used for gene editing of the target cell using a lentivirus as described herein. The transgenes of this disclosure may include sequences for the production of exogenous proteins in the target cell, or they may be non-coding in the sense that they do not encode a protein or peptide. In some embodiments, the construct of this disclosure may contain multiple transgenes. In some embodiments, the construct of the present disclosure comprises a transgene containing a nucleic acid sequence for the production of an exogenous protein, and optionally further comprises nucleic acid sequences encoding gRNA, miRNA, siRNA, shRNA and / or lncRNA.

[0032] In one embodiment, the transgene includes a target nucleic acid sequence, for example, a sequence encoding one or more target genes.

[0033] In one embodiment, the insert may optionally further include one or more promoters for the expression of a transgene.

[0034] As used herein, “gene” may mean a nucleic acid sequence encoding functional RNA, and possibly an amino acid sequence (e.g., protein or peptide). In some embodiments, a gene may or may not contain introns. Therefore, it should be understood that the term “gene” encompasses open reading frames (ORFs). The term ORF refers to a nucleic acid sequence (or polynucleotide sequence) that encodes RNA and / or an amino acid sequence and lacks introns. Therefore, the entire sequence of an ORF encodes RNA and / or an amino acid sequence, excluding the final stop codon. Accordingly, “one or more target genes” in this disclosure may include genes encoding RNA, miRNA, protein or peptide for therapeutic purposes, and such RNA, miRNA, protein or peptide may be an exogenous protein / peptide or a mammalian protein / peptide. “One or more target genes” may be useful, for example, to repair or remove a defective gene or transcript in a target animal or cell. “One or more target genes” may be useful in expressing and presenting a receptor or chimeric receptor on the surface of a cell (e.g., a T cell) to produce a therapeutic effect by altering the immune response in a target animal or cell.

[0035] To promote the transcription of the construct in host cells, the construct of this disclosure includes an RNA polymerase I promoter, which is located upstream of the 5' LTR. The RNA polymerase I promoter is a strongly and constitutively active promoter. The promoters recognized by RNA polymerase I are not highly sequence-conserved across species. However, the general structure of the promoters is similar, consisting of a core element surrounding the transcription start site and an upstream promoter element located approximately 100 bp further upstream. RNA polymerase I transcribes the rRNA gene and binds to the promoter, which includes the core promoter element and the upstream regulatory element (UCE).

[0036] In eukaryotic cellular function, RNA polymerase I is responsible for the transcription of ribosomal RNA (rRNA), an essential component of protein synthesis. The coding sequence of rRNA is located in multiple repeat regions on the genome, and the human genome contains approximately 400 ribosomal DNA repeat sequences (Srivastava, AK, & Schlessinger, D. (1991). Structure and organization of ribosomal DNA. Biochimie, 73(6), 631-638). The RNA Pol I promoter drives the transcription of rRNA subunits 18S, 5.8S, and 28S as a single transcript, which is then processed into individual subunits. The eukaryotic RNA polymerase I promoter contains a core RNA Pol I promoter immediately upstream of the transcription start site. Upstream of the core promoter is the RNA Pol I termination sequence, and further upstream, up to approximately 1800 bp upstream from the transcription start site, are multiple repeat sequences that have been shown to enhance RNA Pol I transcription in cell-based assays (Figure 12).

[0037] Therefore, for production within human cell lines (e.g., HEK293), it is preferable to use a human RNA Pol I promoter sequence. In one embodiment, the RNA polymerase I promoter is derived from the same or related species as the host cell of interest. In one embodiment, the RNA polymerase I (Pol I) promoter is a mammalian Pol I promoter. In a preferred embodiment, the RNA polymerase I (Pol I) promoter is a human Pol I promoter. In one embodiment, the RNA polymerase I promoter may include the sequence TTTCGCTCCGAGTCGGCATTTTGGGCCGCCGGGTTATT (SEQ ID NO: 1). In some embodiments, the RNA polymerase I promoter may include the sequence GGCCGGCCCCCTGCGTGTGGCACGGGCGGCCGGGAGGGCGTCCCCGGCCCGGCGCTGCTCCCGCGTGTGTCCTGGGGTTGACCAGAGGGCCCCGGGCGCTCCGTGTGTGTGGCTGCGATGGTGGCGTTTTTGGGGACAGGTGTCCGTGTCGCGCGTCGCCTGGGCCGGCGGCGTGGTCGGTGACGCGACCTCCCGGCCCCGGGGGAGGTATATCTTTCGCTCCGAGTCGGCATTTTGGGCCGCCGGGTTATT (SEQ ID NO: 2), or a fragment thereof. The fragment may include a portion of the reference sequence, for example, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% of the sequence provided herein in length. Optionally, or in addition, the RNA polymerase I (Pol I) promoter may further include one or more Pol I enhancer elements.For example, the Pol I enhancer element may consist of multiple 140 bp repeat elements located upstream, as described by Pikaard et al. (1990) [Pikaard, CS, Pape, LK, Henderson, SL, Ryan, K., Paalman, MH, Lopata, MA, ... & Sollner-Webb, B. (1990), Enhancers for RNA polymerase I in mouse ribosomal DNA, Molecular and Cellular Biology, 10(9), 4816-4825, 1990], or it may include a proximal downstream regulatory element, as described by Haltiner et al. (1986) [Haltiner, MM, Smale, ST, & Tjian, R. (1986). Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis. Molecular and Cellular Biology, 6(1), 227-235.]. Furthermore, as described by Lorch et al. (1990), it is also possible to use eukaryotic RNA polymerase II (RNA Pol II) enhancer elements [Lorch, Y., Lue, NF, & Kornberg, RD, Interchangeable RNA polymerase I and II enhancers, Proceedings of the National Academy of Sciences, 87(21), 820-8206, 1990]. In addition, or alternatively, the RNA polymerase I promoter may include downstream sequences that promote or increase transcription.

[0038] In mice, the termination of RNA polymerase I transcription is mediated by a series of repeating elements of 10–18 nucleotides (a sequence called the Sal box, AGGTCGACCAGTACTCCG). A pyrimidine-rich tract (T or C) of at least 10 nucleotides is present near the Sal box. In cells, the initial Sal box has been shown to be sufficient for the termination of RNA Pol I transcription (Grummt, I., Maier, U., Ohrlein, A., Hassouna, N., & Bachellerie, JP (1985). Transcription of mouse rDNA terminates downstream of the 3′ end of 28S RNA and involves interaction of factors with repeated sequences in the 3′ spacer. Cell, 43(3), 801–810). A mouse termination sequence containing a Sal box and its upstream and downstream pyrimidine-rich tracts has been shown to be sufficient for terminating RNA Pol I transcription in minigene experiments in both mouse and human cells (Hadjiolova, KV, Normann, A., Cavaille, J., Soupene, E., Mazan, S., Hadjiolov, AA, & Bachellerie, JP (1994). Processing of truncated mouse or human rRNA transcribed from ribosomal minigenes transfected into mouse cells. Molecular and Cellular Biology, 14(6), 4044-4056).

[0039] Therefore, this RNA Pol I termination signal is generally required downstream of the 3'LTR. This termination signal has low species specificity, and therefore termination signals from various mammals may be used. In one embodiment, a mouse termination signal or a human termination signal may be used (Nemeth et al. (2013), Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms, 1829(3-4), 306-317; Normann et al. (1994), Molecular and Cellular Biology, 14(6), 4044-4056). In some embodiments, termination signals derived from mouse termination signals and / or human termination signals may be used. In one embodiment, the RNA polymerase I termination signal is the following sequence (SEQ ID NO: 3): It may also include JPEG2026511127000002.jpg18161.

[0040] In the above sequence (SEQ ID NO: 3), the mouse RNA Pol I termination sequence containing a sal box is underlined, and the pyrimidine-rich tract is shown in bold.

[0041] In some embodiments, the terminal sequence of the RNA polymerase I promoter may include the sequence TTATT, TTATAT, or a derivative thereof. The terminal sequence of the RNA polymerase I promoter containing TTATT, TTATAT, or a derivative thereof may further include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 additional nucleotides at the 5' or 3' end of the terminal sequence.

[0042] In some embodiments, in addition to the terminal sequences TTATT, TTATAT or derivatives thereof of the RNA polymerase I promoter, the construct of the present disclosure may optionally include the sequence GCTGACAACGCTGTCCTCT (SEQ ID NO: 4) downstream of the terminal sequence of the RNA polymerase I promoter.

[0043] In some embodiments, the RNA polymerase I promoter of the construct of this disclosure may include the following sequence: GAGGGGCTGCGTTTTCGGCCTCGGGAAGAGCTTCTCGACTCACGGTTTCGCTTTCGCGGTCC ACGGGCCGCCCTGCCAGCCGGATCTGTCTCGCTGACGTCCGCGGCGGTTGTCGGGCTCCATC TGGCGGCCGCTTTGAGATCGTGCTCTCGGCTTCCGGAGCTGCGGTGGCAGCTGCCGAGGGAG GGGACCGTCCCCGCTGTGAGCTAGGCAGAGCTCCGGAAAGCCCGCGGTCGTCAGCCCGGCTG GCCCGGTGGCGCCAGAGCTGTGGCGCGTCGCTTGTGAGTCACAGCTCTGGCGTGCAGGTTTTA TGTGGGGGAGAGGCTGTCGCTGCGCTTCTGGGCCCGCGGCGGGCGTGGGGCTGCCCGGGCCG GTCGACCAGCGCGCCGTAGCTCCCGAGGCCCGAGCCGCGACCCGCGGGACCCGCCGCGCGT GGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCATCCTGGCCGT CTGAGGCGGCGGCCGAATTCGTTTCCGAGTCCCCGTGGGGAGCCGGGGACCGTCCCGCCCCC GTCCCCCGGGTGCCGGGGAGCGGTCCCTCTGCCGCGATCCTTTCTGGCGAGTCCCCGTGCGG AGTCGGAGAGCGCTCCCTGAGCGCGCGTGCGGCCCGAGAGGTCGCGCCTGGCCGGCCTTCGG TCCCTCGTGTGTCCCGGTCGTAGGAGGGGCCGGCCGAAAATGCTTCCGGCTCCCGCTCTGGA GACACGGGCCGGCCCCCTGCGTGTGGCACGGGCGGCCGGGAGGGCGTCCCCGGCCCGGCGCT GCTCCCGCGTGTGTCCTGGGGTTGACCAGAGGGCCCCGGGCGCTCCGTGTGTGGCTGCGATG GTGGCGTTTTTGGGGACAGGTGTCCGTGTCGCGCGTCGCCTGGGCCGGCGGCGTGGTCGGTG ACGCGACCTCCCGGCCCCGGGGGAGGTATATCTTTCGCTCCGAGTCGGCATTTTGGGCCGCC GGGTTATT (SEQ ID NO: 5)

[0044] Conventional methods in the art for the production of recombinant viruses rely on RNA polymerase II promoters for recombinant virus synthesis. These transcripts are produced with a poly-A tail, which leads to RNA splicing and direction to protein production mechanisms within host cells, reducing the amount available for viral packaging. The constructs of this disclosure have the advantage of bypassing the processing step before packaging into viral particles by using an RNA polymerase I termination signal instead of a polyadenylation signal. In one embodiment, the constructs of this disclosure do not include a polyadenylation signal.

[0045] To induce the integration of transgenes into the target animal or cell genome, long-terminal repeat (LTR) regions are typically required for integration into the target genome. LTRs: The basic structure of a retroviral genome includes a 5'LTR and a 3'LTR, with genes necessary for retroviral production located between or within them. LTRs are necessary for retroviral integration and transcription. They also function as promoter sequences, regulating the expression of retroviral genes (i.e., they are cis-acting sequences). In some cases, the constructs of this disclosure may not include cis-acting polyadenylation sequences within the 5'LTR region. The LTR consists of three sub-regions: U3, R, and U5: U3 is derived from a sequence specific to the 3' end of RNA; R is derived from a sequence that is repeatedly present at both ends of RNA; and U5 is derived from a sequence specific to the 5' end of RNA. Therefore, according to this disclosure, the construct includes 5' and 3'LTRs. Furthermore, in one embodiment, the U5 region of the 3'LTR may be deleted and replaced with a non-HIV-1 poly(A) tail (see Hanawa et al. (2002) Mol. Ther. 5(3): 242-51).

[0046] In one embodiment of the present disclosure, the LTR present in the nucleic acid vector of the present disclosure may be a self-inactivating LTR (referred to as a SIN LTR). To address safety concerns regarding the generation of a replicable virus, self-inactivating (SIN) vectors have been developed by deleting a portion of the U3 region of the 3LTR (including the TATA box and the binding sites for transcription factors Spl and NF-KB) (see Miyoshi et al. (1998) J. Virol. 72(10):8150-7). This deletion is transferred to the 5'LTR after reverse transcription and incorporation into infected cells, resulting in transcriptional inactivation of the LTR. This is known as a self-inactivating lentivirus-based vector system and may be incorporated into the present disclosure.

[0047] The 5' and 3'LTRs of the constructs of this disclosure sandwich a transgene (also referred to as the “payload”). The 5' and 3'LTRs of the constructs of this disclosure may be derived from a viral genome. In one embodiment, the 5'LTR and / or 3'LTR sequences are derived from a retroviral genome, such as the sequences disclosed in Bulcha et al (2021)[1]. In a preferred embodiment, the 5'LTR and / or 3'LTR sequences are derived from a lentiviral genome. Alternatively, the 5'LTR and / or 3'LTR sequences may be derived from mammalian sequences, such as human 5'LTR and / or 3'LTR sequences.

[0048] In one embodiment, the 5'LTR nucleic acid sequence of the construct of the present disclosure may include the following sequence (SEQ ID NO: 6): GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA

[0049] In one embodiment, the 3'LTR nucleic acid sequence of the construct of the present disclosure may include the following sequence (SEQ ID NO: 7): TGGAAGGGCTAGCTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA

[0050] In addition to transgenes, inserts of the constructs disclosed herein may optionally include one or more viral components necessary for the assembly of functional or infectious viral particles. For example, the construct may include sequences that facilitate the packaging of the retroviral vector genome into viral particles after transfection into a host cell.

[0051] Therefore, in further embodiments, one or more elements of the insert may optionally include one or more viral packaging components and / or one or more nuclear export components (Milone and O'Doherty (2018), Leukemia, 32(7):1529-1541; Dull T et. al. (1998), J. Virol. 72(11):8463-8471. A Third Generation Lentivirus Vector with a Conditional Packaging System.). In preferred embodiments, the viral packaging components and / or nuclear export components of the insert are located downstream of the 5'LTR and upstream of the transgene. Ψ: Encapsidation of retroviral RNA is caused by the Ψ (psi) sequence located at the 5' end of the retroviral genome. Furthermore, it is well known in the art that sequences extending downstream of the psi sequence to the gag coding region are involved in efficient retroviral vector production (see Cui et al. (1999) J. Virol. 73(7): 6171-6176). In one embodiment, the nucleic acid vector may further include a Ψ (psi) sequence. In some embodiments, one or more viral packaging components may include a retroviral packaging element, such as HIV-1 Ψ, and one or more nuclear export components may include a Rev response element (RRE).In one embodiment, RRE may include the following sequence (SEQ ID NO: 8): ATGGCAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAAGGCAGTCAGACTCATCAAGTTTCTCTATCAAAGCAACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAATATTGGAGTCAGGAGCTAAAGAATAG.

[0052] Optionally, the constructs of this disclosure may further include one or more transport and / or stabilizing motifs that promote the stability and / or export of the transcript.

[0053] Those skilled in the art will recognize that for the expression of a transgene in target cells, the transgene is likely to require a promoter to which it is operatively or functionally linked to the target gene.

[0054] As used herein, the term “functionally linked” means that two or more nucleic acid sequences or subsequences are located in positions that allow them to functionally interact in order to perform an intended function. For example, a promoter is functionally linked to a nucleic acid sequence if, typically in a cis configuration, it can control or regulate the transcription of the linked nucleic acid sequence. Generally, functionally linked nucleic acid sequences are in close proximity to each other, but this is not always necessary. Functionally linked promoters are typically located upstream of a coding sequence, but this is not always necessary.

[0055] In one embodiment, one or more promoters for transgene expression may include Pol I or Pol II promoters. For example, promoters used for transgene expression are described in Milone, MC, & O'Doherty, U. (2018), Clinical use of lentiviral vectors. Leukemia, 32(7), 1529-1541. In some embodiments, endogenous promoters may be used to target expression in a specific tissue type, such as the liver. In some examples, tissue-specific Pol II promoters may be used to target the expression of one or more genes to a preferred cell type (see Frecha, C., Szecsi, J., Cosset, FL, & Verhoeyen, E. (2008). Strategies for targeting lentiviral vectors. Current gene therapy, 8(6), 449-460).

[0056] In one embodiment, one or more promoters for transgene expression may be Pol II promoters, such as CMV, RSV, SV40, EFS (EF1a short), Ubc promoter, or SFFV promoter.

[0057] In addition, or alternatively, in some embodiments, if the transgene of the construct contains a sequence encoding a native or synthetic non-coding RNA such as a gRNA, the construct may contain a Pol I promoter for the expression of the non-coding RNA. In some embodiments, the transgene of the construct may contain a Pol II promoter for the expression of the Cas protein and a Pol I promoter for the expression of the gRNA.

[0058] The synthesis of recombinant viruses typically involves introducing a vector encoding viral components into a host cell. Therefore, in preferred embodiments, the constructs of this disclosure are typically provided as vectors. Any suitable vector known in the art may be used in recombinant virus production, such as artificial chromosomes (e.g., bacteria or yeast), plasmids, cosmids, or phagemids. Those skilled in the art are familiar with the various vectors that can be used to transfect host cells for viral genome replication and viral protein synthesis. In one embodiment, the vector may be a plasmid vector. For example, the constructs of this disclosure may be inserted into a pEX-K168 vector. In other examples, the construct may be inserted into vectors such as pMX, pMA, pMK, pcDNA 3.1(+), pcDNA3.3-TOPO, pcDNA3.4-TOPO, pDONR221, pET100 / D-TOPO, pET151 / D-TOPO, pFastBac I, pRSET_A, pYes2.1V5-His TOPO, pBAD_His_B, pBAD_His_C, pBADHis_A, pcDNA3.1_Zeo, pcDNA3.1+ Hygro, pcDNA5_FRT, pDONR_zeo, pFastBacHTA, pFastBacHTb, pFastBacHTC, pPICZalphaA, pPICZalphaB, pPICZalphaC, pRSET_B, pRSET_C, or pYES2. Suitable vectors used for recombinant virus production in this disclosure are typically capable of accommodating inserts of up to 1 kbp, 2 kbp, 3 kbp, 4 kbp, 5 kbp, 6 kbp, 7 kbp, 8 kbp, 9 kbp, 10 kbp, 15 kbp, 20 kbp, or 25 kbp in size.

[0059] In this disclosure, the constructs or vectors of this disclosure may contain some retroviral sequences present in a wild-type retroviral genome. In a preferred embodiment, an insert containing the transgene of this disclosure can replace a large portion of the viral sequence to form a retroviral vector genome, insofar as the transcript obtained from the construct can be packaged into a retroviral particle.

[0060] In one embodiment, the construct of this disclosure may be used to produce a recombinant lentivirus. Lentiviruses (a subtype of retrovirus) have the advantage of being able to transduce both dividing and non-dividing cells and resulting in sustained gene expression. Suitable lentiviruses from which a portion of the retroviral vector genome may be derived include, but are not limited to, human immunodeficiency virus (HIV-1), HIV-2, EIAV, feline immunodeficiency virus (FIV), simian immunodeficiency virus (SIV), and Meidi / Visna virus. As used herein, “portion” means at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the total length of the sequence of interest. In one embodiment, the construct is for lentivirus production.

[0061] Various methods for producing recombinant retroviruses are known to those skilled in the art, such as the widely adopted transfection method. In current manufacturing practices, well-characterized human embryonic kidney cells (HEK293, HEK293T) are commonly used for lentivirus production. Other cell lines that can be used for lentivirus production include CHO cells, BHK21 cells, mouse myeloma cells (NS0 and / or Sp2 / 0), HT-1080 cells, PER.C6 cells, HKB-11 cells, CAP cells, HuH-7 cells, Jurkat human cell lines, Sf9 cells, Sf21, and High Five cells. To produce lentiviruses, a triple (sometimes quadruple) transfection method is used in the production cells, involving packaging, envelope, and viral genome plasmid (see Figure 1). The envelope protein, VSV-G, can be substituted with other proteins depending on the application, enabling targeted infection of other cell types. For example, the envelope protein may be selected from mouse leukemia virus (MULV), Gibbon's ape leukemia virus (GALV), feline endogenous RD114 retrovirus, Moloney MULV 4070A, Moloney MULV strain 10A1, rabies virus glycoprotein, and / or measles virus hemagglutinin and fusion glycoprotein. However, without VSV-G or other similar envelope proteins, the virus cannot infect target cells. The packaging components Gag, Pol, and Rev are also essential structural and functional viral components. All of these elements are typically produced as protein components within the host cell line used for production.

[0062] Accordingly, in a further embodiment, the Disclosure provides a system for producing recombinant lentiviruses, the system comprising the construct of the Disclosure or a vector comprising the construct, optionally, One or more viral genome packaging components; and / or A vector containing one or more viral envelope proteins, Includes.

[0063] In one embodiment, one or more viral genome packaging components may include Gag, Pol, and / or Rev. In one embodiment, one or more viral envelope proteins may include Env, for example, VSV-G.

[0064] Gag / pol: The expression of the gag and pol genes depends on the translational frameshift between gag and pol. Both are polyproteins that are cleaved during maturation. The major structural matrix of retroviral vectors, the capsid and nucleocapsid proteins, are encoded by gag. The pol gene encodes retroviral enzymes: (i) a reverse transcriptase essential for reverse transcription of the retroviral RNA genome into double-stranded DNA, (ii) an integrase that integrates the retroviral DNA genome into the host cell chromosome, and (iii) a protease that cleaves the synthesized polyprotein to produce mature, functional retroviral proteins. In one embodiment, the retroviral nucleic acid sequence encoding the gag and pol proteins is derived, for example, from the HIV-1 HXB2 sequence (base pairs 790-5105) with genome accession number K03455.

[0065] Rev: The accessory gene rev ("virion regulator") encodes an accessory protein that binds to the Rev response element (RRE) and facilitates the nuclear export of retroviral transcripts. The protein product of this gene enables the transport of retroviral mRNA fragments containing the Rev response element (RRE) from the nucleus to the cytoplasm. The RRE sequence is expected to form a complexly folded structure. This unique role of rev reflects the close coordination of splicing and nuclear export steps. In one embodiment, the nucleic acid vector contains the RRE sequence. In a further embodiment, the RRE sequence is derived, for example, from the HIV-1 HXB2 sequence (base pairs 7622-8479, or 7769-8146, particularly 7622-8479) of genome accession number K03455.

[0066] Rev binds to RRE and facilitates the transport of single-spliced ​​(env, vif, vpr, and vpu) or unspliced ​​(gag, pol, and genomic RNA) viral transcripts, thereby leading to downstream events such as gene translation and packaging (see Suhasini and Reddy (2009) Curr. HIV Res. 7(1): 91-100). In one embodiment, the nucleic acid vector further includes the accessory gene rev or a similar gene (i.e., derived from another retrovirus or a functionally similar system). The inclusion of the rev gene ensures efficient transport of the RNA transcript of the retroviral vector genome from the nucleus to the cytoplasm, especially if the RRE element is also included in the transported transcript. In a further embodiment, the rev gene has at least 60%, for example, at least 70%, sequence identity to base pairs 970-1320 of, for example, genomic accession number Ml1840 (i.e., HIV-1 clone 12 cDNA, HIVPCV12 locus). In an alternative embodiment, the rev gene has at least 60%, for example, at least 70%, 80%, 90%, or 100% sequence identity with respect to base pairs 5970-6040 and 8379-8653 of, for example, genome accession number K03455.1 (i.e., human immunodeficiency virus type 1, HXB2).

[0067] Env: The env ("envelope") gene encodes surface and transmembrane components of the retroviral envelope (e.g., the HIV-1 glycoproteins gpl20 and gp41) and is involved in retroviral-cell membrane fusion. To extend the tissue targeting of retroviral vectors, the retroviral vectors described herein may be pseudotyped with envelope proteins derived from another virus. Pseudotyped means that the host cell range of a retroviral vector (including lentiviral vectors) can be extended or altered by altering the glycoprotein (GP) on the retroviral vector particle (e.g., using GP obtained from or derived from another enveloped virus, or using synthetic / artificial GP). The most commonly used glycoprotein for pseudotyped retroviral vectors is bullous stomatitis GP (VSVg), which has broad targeting and high vector particle stability. However, it will be understood by those skilled in the art that other glycoproteins can also be used for pseudotyping (Cronin et al. (2005) Curr. Gene Ther. 5(4):387-398, the full text is incorporated herein by reference). The selection of viruses used for pseudotyping may also depend on the type of cell and / or organ being targeted, because some pseudotypes are known to exhibit tissue-specificity.

[0068] In one embodiment, the env protein or its functional substitute is used for vesicle viruses (e.g., vesicle stomatitis virus), lyssaviruses (e.g., rabies virus, mocola virus), arenaviruses (e.g., lymphocytic choriomeningitis virus (LCMV)), alphaviruses (e.g., Ross River virus (RRV), Sindbis virus, Semryki forest virus (SFV), Venezuelan encephalitis virus), filoviruses (e.g., Ebola virus Reston, Ebola virus Zaire, Lassa virus), alpha-retroviruses (e.g., avian leukemia virus (ALV)), beta-retroviruses (e.g., Jagziegte sheep retrovirus (JSRV)), cancer The env protein is obtained from or derived from viruses selected from maletroviruses (e.g., Moloney's mouse leukemia virus (MLV), Gibbon's ape leukemia virus (GALV), feline endogenous retrovirus (RD114)), deltaretroviruses (e.g., human T lymphotropic virus type 1 (HTLV-1)), spumaviruses (e.g., human formyvirus), lentiviruses (e.g., Maedivisna virus (MVV)), coronaviruses (e.g., SARS-CoV), respiroloviruses (e.g., Sendai virus, respiratory syncytial virus (RSV)), hepaciviruses (e.g., hepatitis C virus (HCV)), influenza viruses (e.g., influenza virus type A), and nuclear polyhedronitis viruses (e.g., Autographa californica multiple nucleopolyhedrovirus (AcMNPV)). In further embodiments, the env protein or its functional substitute is obtained from or derived from vesicular stomatitis virus. In this embodiment, the glycoprotein (VSVg) protein of vesicular stomatitis virus may be used, which allows the retroviral particle to infect a wider range of host cells and eliminates the possibility of recombination to produce the wild-type envelope protein. In a further embodiment, the nucleic acid sequence of the retrovirus encoding the env protein or a functional substitute thereof is derived, for example, from the sequence with genome accession number J02428.1 (base pairs 3071-4720).

[0069] The structural genes described herein are common to all retroviruses. Furthermore, accessory genes may differ depending on the type of retrovirus. For example, lentiviruses such as HIV-1 contain six additional accessory genes known as rev, vif, vpu, vpr, nef, and tat. Other retroviruses may have accessory genes similar to those described herein, but they are not always given the same names in the literature. Various retroviral accessory genes are described in literature such as Tomonaga and Mikami (1996) J. Gen. Virol. 77(Pt 8): 1611-1621.

[0070] Because accessory genes are thought to be involved in retroviral replication and pathogenicity, many current viral vector production systems do not include some of these genes. The exception is rev, which is usually present, or a system similar to the rev / RRE system may be used. Therefore, in one embodiment, the nucleic acid sequences encoding one or more accessory genes of vpr, vif, vpu, tat, and ne, or similar accessory genes, are removed from the RNA genome of the retroviral vector particle or disrupted so that they cannot encode functional accessory proteins. In a further embodiment, at least two, three, four, or all of vpr, vif, vpu, tat, and nef, or similar accessory genes, are removed from the RNA genome of the retroviral vector particle or disrupted so that they cannot encode functional accessory proteins. Removal of functional accessory genes does not require removal of the entire gene; removal of a portion of the gene or disruption of the gene is sufficient. The nucleic acid sequence encoding a non-replicable retroviral vector particle may be identical to or derived from the gene of the wild-type retroviral virus from which the retroviral particle is based; that is, the sequence may be a genetically or otherwise modified version of the sequence contained in the wild-type virus. Therefore, the retroviral gene incorporated into the nucleic acid vector or host cell genome may refer to a codon-optimized version of the wild-type gene.

[0071] In further embodiments, one or more vectors may further include one or more nuclear export elements and / or one or more stabilizing motifs. In one embodiment, one or more nuclear export elements may include Rev response elements (RREs).

[0072] To enhance the safety of recombinant retrovirus production systems, constructs containing the viral vector genome may be introduced into host cells in a separate construct or vector from the packaging and envelope components. In preferred embodiments, one or more optional vectors containing one or more viral genome packaging components and / or one or more viral envelope proteins are introduced into host cells in one or more vectors separate from the viral vector genome.

[0073] In a further embodiment, a method for producing a recombinant lentivirus is provided, the method being: a) Transfecting a host cell by contacting it with one or more vectors encoding the constructs and one or more additional viral components disclosed herein; b) Culturing the host cells under conditions that produce non-replicating retroviral vector particles; c) Isolating the non-replicating retroviral vector particles, This includes.

[0074] In one embodiment, one or more additional viral components are: (i) one or more packaging components; and / or (ii) One or more envelope proteins Selected from.

[0075] In one embodiment, one or more packaging components include Gag, Pol, and / or Rev, and the envelope protein includes VSV-G.

[0076] In one embodiment, the method of the present disclosure may further include contacting the obtained recombinant lentivirus with target cells in vitro, in vivo, or ex vivo to introduce at least a portion of the construct of the present disclosure into the genome of the target cells. In some embodiments in which the method includes contacting the obtained recombinant lentivirus with target cells in vitro or ex vivo, the method may further optionally include providing the target cells to a subject.

[0077] Recombinant lentiviruses obtained by any of the methods disclosed herein may be used as pharmaceuticals or for therapeutic purposes. In alternative embodiments, the obtained recombinant lentiviruses may be used for gene therapy.

[0078] A method for producing recombinant lentiviruses may include providing cells (or cell lines) in which various lentiviral components (including gag / pol, VSV-G, and genomic components) are stably incorporated into the cell genome for expression, and in such cells, at least the genomic components (of the lentivirus) may contain an RNA polymerase I (Pol I) promoter.

[0079] The constructs of this disclosure or vectors comprising such constructs may be used as pharmaceuticals or in therapeutic applications, such as gene therapy. For example, gene therapy may involve replacing a deficient gene in a target cell with a transgene to restore the expression level of the target protein. As another example, the recombinant retroviruses obtained as disclosed herein may be used in cancer treatment, and the recombinant retroviruses may be used to induce the expression of chimeric antigen receptors in the patient's T cells.

[0080] In further teaching, the Disclosure also relates to compositions comprising the construct or vector described herein together with at least one acceptable excipient. Compositions comprising the construct or vector of the Disclosure may be used together with other plasmids (e.g., plasmids encoding viral packaging). In one embodiment, acceptable excipients may include water, saline (e.g., phosphate-buffered saline), calcium phosphate, diethylaminoethyl (DEAE) dextran, cationic lipids, human serum albumin, dextrose, trehalose, sucrose, mannitol, sorbitol, polysorbate 20, polysorbate 80, glycerol, ethanol, or polyethylene glycol, and combinations thereof. In some embodiments, the composition may include one or more excipients that facilitate intracellular uptake of the construct or vector. Alternatively, any suitable transfection buffer known in the Art may be used in the preparation of the composition.

[0081] This disclosure will be explained with reference to the following figures. These figures are as follows: [Brief explanation of the drawing]

[0082] [Figure 1] This is a schematic diagram of a triple transfection system, in which a packaging plasmid (typically encoding Gag / Pol) and an envelope plasmid (typically encoding VSV-G, but may also contain alternative envelope components) are cotransfected into a production cell line along with a viral genome or transfer plasmid encoding the desired insert. In this system, all viral elements are driven by an RNA Pol II promoter such as CMV. [Figure 2]This diagram shows a typical viral genome plasmid with the plasmid backbone elements removed. It includes the Pol II promoter (gray), 5' and 3' LTRs (stripes), the HIV-1 Ψ and RRE viral packaging and nuclear export elements (white and hatched, respectively), the internal target gene (GOI) Pol II promoter (gray), the target gene (dot), and the terminal poly(A) signal (gray). [Figure 3] This is a proposed diagram of a viral genome plasmid structure using RNA Pol I. The elements between the 5'LTR and 3'LTR (stripes) remain unchanged, as in Figure 2. The promoter upstream of the 5'LTR is replaced with a species-specific RNA Pol I promoter sequence (gray), depending on the cell line used for production. For mammalian production, a mouse Pol I termination signal (gray) is required to terminate transcription. [Figure 4] This is a schematic diagram of a triple transfection system in which the RNA Pol I promoter drives viral genome production. The packaging plasmid (encoding Gag / Pol) and envelope plasmid (encoding envelope proteins such as VSV-G) remain unchanged. [Figure 5] This is a diagram of the Pol I test genome plasmid (named pEX-K168_LTek_CMV-GFP_Puro_v2). The RSV promoter is replaced with a 249 bp human RNA Pol I promoter sequence, and the SV40 poly(A) signal is replaced with a mouse RNA polymerase I termination sequence. The termination sequence is directly ligated to the 3' LTR without a spacer sequence. [Figure 6] This is a diagram of the transfer plasmid map. The standard plasmid is based on the widely used pCCL system and contains a luciferase / GFP fusion reporter transgene. As mentioned above, the Lentitek plasmid has a Pol I promoter (LTEK) and a Pol I termination sequence (Term) inserted. The promoter that drives the luciferase / GFP transgene is the endogenous liver promoter. [Figure 7] This figure shows the results of the p24 ELISA. It shows the quantification of lentiviral titers by p24. Pol I (Lentitek batch 1 or 2) is lower than, but similar in size to, the Pol II control plasmid. [Figure 8] This figure shows the titers for FACS and qPCR. The left panel shows qPCR for Psi of the lentiviral genome. The right panel shows FACS data for GFP expression in transformed cells. In both cases, the Pol I-driven titers (Lentitek 1 and 2) are approximately two orders of magnitude lower. [Figure 9] This figure shows a comparison of vector titers obtained by PCR. The left panel shows the qPCR-produced virus (RNA titer) and the infection titer (DNA titer) of transformed cells. The right panel shows the DNA provirus synthesis rate in transformed cells as a ratio to the RNA genome supply. [Figure 10] This figure shows a comparison of expression levels by flow cytometry. The left panel shows the total fluorescence of transformed HEK293 cells transformed with normalized Lentitek or standard lentivirus. The right panel shows the relative fluorescence of cells transformed with either vector. [Figure 11] This figure shows a comparison of GFP expression in production cells by flow cytometry. The left panel shows the cell levels expressing detectable levels of GFP. The right panel shows the GFP levels within the cells expressing GFP. [Figure 12] This is a schematic layout of the eukaryotic RNA Pol I promoter (created based on Pikaard, CS, Pape, LK, Henderson, SL, Ryan, K., Paalman, MH, Lopata, MA, ... & Sollner-Webb, B. (1990). Enhancers for RNA polymerase I in mouse ribosomal DNA. Molecular and cellular biology, 10(9), 4816-4825.).

[0083] material and method Cloning and Molecular Biology Standard cloning and molecular biological techniques were used to generate plasmid variants. These included PCR amplification from human DNA templates, site-directed mutagenesis, restriction enzyme digestion, and topoisomerase-assisted cloning. Plasmids were amplified using a standard miniprep protocol. Nucleic acid sequences were also synthesized using GeneArt (ThermoFisher).

[0084] Lentivirus production and titration The VSV-G pseudotyped lentiviral vector contains 2 pmol of transgene plasmid and 0.5-1 pmol of packaging and envelope plasmid in 6 × 10⁶ units. 6 The plasmids were prepared by co-transfecting HEK 293T cells. Plasmids were introduced into the cells using an appropriate transfection agent. In this example, FuGENE® 6 (Promega) was used as the transfection reagent at a ratio of 3 μl per 1 μg of DNA.

[0085] HEK293T cells were cultured in Opti-MEM® medium (ThermoFisher) under standard conditions (37°C, 5% CO2, humidified atmosphere).

[0086] Virus-containing media were collected at 48 and 72 hours after transfection. After each collection, the supernatant was filtered through a cellulose acetate membrane (0.45 μm pore size). Lentivirus harvests were combined as needed, stored at 4°C, and then ultracentrifuged at 90,000 × g at 4°C for 2 hours. The virus pellets were resuspended in 200 μl of Opti-MEM®.

[0087] Due to virus titration, 1 x 10 5HEK293T cells were seeded in each well of a 6-well plate and transductioned with various volumes of enriched lentivirus. 72 hours after transduction, genomic DNA was extracted from the HEK293T cells, and proviral titers were calculated by qPCR.

[0088] cell line transduction HEK293T cells were placed in 3 × 10⁶ of flat-bottom 96-well plates. 4 Cells were seeded at a cell / well density. After 24 hours, lentiviruses were introduced in a total volume of 100 μl at an appropriate MOI. For dose-response analysis of NIGWs, neomycin (Geneticin® (Life Technologies)) was added to the culture medium at a working concentration of 0.4 mg / ml.

[0089] Detection of transgene expression by flow cytometry Cells were trypsin-treated, and 200 μl of suspension was added to a round-bottom 96-well plate for analysis using a BD FACSArray™ instrument. GFP fluorescence was excited with a 488 nm argon laser. During cytometry plot analysis, forward and side scattering light were plotted to gate the viable cell population, which was then visualized and isolated. GFP-positive cells were identified by plotting the emission from the green channel (detected with a 530 / 30 nm bandpass filter) against the emission from the yellow channel (detected with a 575 / 26 nm bandpass filter), and correcting for autofluorescence events. Unless otherwise specified, the non-transduction population was used to establish the baseline for GFP expression.

[0090] All FACS data was analyzed using FlowJo software version 9.3.1 (Tree Star, Inc).

[0091] result Pol I test plasmid Initial test experiments used the previously reported genome / payload plasmid pLenti CMV GFP Puro (https: / / www.addgene.org / 17448 / ), which uses a GFP reporter as its payload. In this plasmid, the RSV is the Pol II promoter, driving genomic transcription. In short, by substituting the Pol II promoter upstream of the 5'LTR and cloning the mouse Pol I termination sequence immediately after the 3'LTR sequence, a comparison between Pol II and Pol I becomes possible. The packaging plasmid was supplied as a working system.

[0092] As mentioned above, the Pol I promoter has been used in the past to produce RNA transcripts for various purposes. However, there is evidence that this promoter sequence is species-specific. Therefore, to produce Pol I-driven transcripts in human cells, the human Pol I promoter sequence should be used. There are various studies on how to clone the Pol I promoter and produce transcripts, but the exact details of the promoter sequence are rarely described in the papers or supplementary information. For example, Neumann et al. produced influenza transcripts using human Pol I, but did not describe the exact sequence used [7].

[0093] A search of human Pol I promoter sequences obtained from databases confirmed that the correct terminal sequence is TTATT, as described by Neumann[7]. Since TTATT was also confirmed in the Genebank sequence, this sequence was selected.

[0094] Another challenge in promoter selection is the length of the sequence to include. The 1kb upstream of the TTATT motif on Genebank accession KY962518.1 was used as the reference sequence for the RNA Pol I promoter. Since the Sos_ZsG_pol I-mg plasmid uses a 183-nucleotide fragment, a shorter sequence is likely sufficient. Therefore, the 249-nucleotide fragment upstream of the TTATT motif, which includes the TTATT motif, was used as the Pol I promoter.

[0095] Unlike promoter sequences, RNA Pol I termination sequences appear to have low species specificity. Unlike promoter sequences, this 78nt sequence is readily available in the literature and consistent. The SV40 poly(A) signal sequence is located slightly downstream from the 3'LTR and separated by a 71-base pair that appears to be the cloning vector backbone. The Pol I termination sequence should be placed immediately after the intended transcript (see Figure 3).

[0096] Considering these design elements, the pEX-K168_Lenti_CMV-GFP_Puro sequence was edited as appropriate (see Figure 5).

[0097] In addition to the comparative work using GFP described above, the Pol I design was also incorporated into other luciferase / EGFP systems (see Figure 6).

[0098] Validation of Pol I plasmid A small-scale comparison was performed using adherent HEK293T cells in a T75 flask. Pol I and Pol II-driven GFP payload plasmids were compared to known control GFP payloads derived from ViroCell. Productivity was evaluated by qPCR, p24 ELISA, and FACS analysis.

[0099] The ELISA results in Figure 7 show that the virus is produced at a similar level to the control. It is widely known that p24 ELISA can overestimate plasmid titer. This is because some quantitative kits have difficulty distinguishing between p24 constituting the viral particle and free p24. Therefore, while this result is promising, infectivity data from PCR and FACS are preferable.

[0100] Perhaps the most important indicator of manufacturing efficiency is the infection titer. Figure 8 shows that the Pol I promoter can produce infectious virus and transform cells to express GFP.

[0101] In parallel experiments, the Pol I promoter and termination sequences used above were cloned into a lab-specific GFP reporter system (see Figure 6). Figure 9 shows the PCR titers for viral RNA and post-transformed cell DNA.

[0102] The data in Figure 9 shows that although the Pol I method produces a small amount of lentiviral, the produced virus can be integrated into target host DNA in a dose-response manner similar to RNA polymerase II-producing lentivirals. In fact, although a slight difference in DNA integration rates is observed in Figure 9, this difference is not seen in flow cytometry analysis (Figure 10) when the virus concentration is adjusted.

[0103] Therefore, the ability of individual viruses to integrate into target cells and subsequently express the target gene (GFP) cannot be distinguished between Pol II-producing lentiviruses and Pol I-producing lentiviruses.

[0104] GFP production levels in the manufacturing cells were also analyzed in parallel. Manufacturing cell lines were evaluated for GFP production before infectious virus production (see Figure 11). Since the transgene promoter is a liver promoter, significant expression should not occur in the HEK293 kidney cell line unless there is a breakthrough by the upstream promoter or an RNA splicing event. As expected, a breakthrough was observed in the CMV-driven plasmid system, with up to 80% of cells expressing relatively high levels of GFP. In contrast, the number of cells detected in the Pol I Lentitek system was drastically reduced to 20%, and even these cells had GFP levels of about one-sixth. In fact, fluorescence under Pol I conditions was only detectable by high-sensitivity flow cytometry. Such low levels of GFP expression in the Pol I system could not be detected by fluorescence microscopy.

[0105] conclusion RNA polymerase I (Pol I) can drive the expression of payload plasmids and produce infectious lentiviral particles. Lentiviral particles produced by the Pol I method behave similarly to those produced by the standard method, considering the viral titer, and can transform cells to a similar degree. Importantly, when using the Pol I system, the unexpected expression of the payload in the production cells, namely GFP in this example, is significantly reduced.

[0106] References 1. Bulcha, JT, Wang, Y., Ma, H., Tai, PW, & Gao, G. (2021). Viral vector platforms within the gene therapy landscape. Signal transduction and targeted therapy, 6(1), 1-24. 2.Perry, C., & Rayat, AC (2021). Lentiviral vector bioprocessing. Viruses, 13(2), 268. 3. Johari, YB, Scarrott, JM, Pohle, TH, Liu, P., Mayer, A., Brown, AJ, & James, DC (2022). Engineering of the CMV promoter for controlled expression of recombinant genes in HEK293 cells. Biotechnology Journal, 2200062. 4. Osman, S., & Cramer, P. (2020). Structural biology of RNA polymerase II transcription: 20 years on. Annual Review of Cell and Developmental Biology, 36, 1-34. 5. Lizee, G., Aerts, J. L., Gonzales, M. I., Chinnasamy, N., Morgan, R. A., & Topalian, S. L. (2003). Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Human gene therapy, 14(6), 497-507. 6. Cordes, N., Kolbe, C., Lock, D., Holzer, T., Althoff, D., Schafer, D., ... & Kaiser, A. D. (2021). Anti-CD19 CARs displayed at the surface of lentiviral vector particles promote transduction of target-expressing cells. Molecular Therapy-Methods & Clinical Development, 21, 42-53.. 7. Neumann, G., Zobel, A., & Hobom, G. (1994). RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology, 202(1), 477-479

Claims

1. A lentiviral genome construct comprising a lentiviral genome and an RNA polymerase I promoter, wherein the expression of the lentiviral genome is under the control of the RNA polymerase I promoter.

2. The lentiviral genome construct according to claim 1, further comprising a Pol I termination signal.

3. Furthermore, the lentiviral genome construct according to claim 1 or 2 comprises a 5' long-terminal repeat sequence (5'LTR) and / or a 3' long-terminal repeat sequence (3'LTR).

4. The lentiviral genome construct according to claims 1 to 3, wherein the 5'LTR is located or positioned downstream of the RNA polymerase I (Pol I) promoter, and the 3'LTR is located or positioned upstream of the Pol I termination signal.

5. The lentiviral genome construct according to any one of claims 1 to 4, further comprising an insert adjacent to the 5' long-chain terminal repeat sequence and the 3' long-chain terminal repeat sequence.

6. A lentiviral genome construct according to any one of claims 1 to 4, comprising a transgene.

7. (i) RNA polymerase I (Pol I) promoter and; (ii) Pol I termination signal; (iii) 5' long terminal repeat sequence (5'LTR) and; (iv) 3'-long terminal repeat sequences (3'LTRs) and; (v) an insert, optionally containing a transgene, positioned or disposed between the 5' long-chain terminal repeat sequence and the 3' long-chain terminal repeat sequence; Includes, The lentiviral genome construct of the present disclosure, wherein the 5'LTR is located or positioned downstream of the RNA polymerase I (Pol I) promoter, and the 3'LTR is located or positioned upstream of the Pol I termination signal.

8. A construct for use in an expression system, A construct comprising an insert adjacent to a 5' long-terminal repeat sequence (5'LTR) and a 3' long-terminal repeat sequence (3'LTR), wherein the 5'LTR is downstream of the RNA polymerase I (Pol I) promoter, the 3'LTR is upstream of the Pol I termination signal, and the insert contains a transgene.

9. The aforementioned expression system is used to produce recombinant retroviruses. The insert optionally further includes a post-transfer response element downstream of the transgene. The construct for use according to claim 8, further optionally comprising a retroviral packaging element and / or one or more nuclear export components upstream of the transgene.

10. The construct for use according to claim 8 or 9, wherein the transgene of the insert comprises a nucleic acid sequence encoding one or more target genes.

11. The construct for use according to any one of claims 8 to 10, wherein the insert further comprises one or more additional promoters for the expression of the one or more target genes.

12. A construct for use according to any one of claims 8 to 11, which is inserted into a vector.

13. The construct for use according to claim 12, wherein the vector is a plasmid.

14. The construct for use according to any one of claims 8 to 13, wherein the Pol I promoter is derived from a mammalian Pol I promoter sequence.

15. The construct for use according to any one of claims 8 to 14, wherein one or more additional promoters for the expression of one or more target genes comprises an RNA polymerase II promoter.

16. The construct for use according to claim 15, wherein the RNA polymerase II promoter is a CMV promoter.

17. The construct for use according to any one of claims 8 to 16, wherein the expression system is used to produce recombinant lentiviruses.

18. The construct for use according to claim 117, wherein the recombinant retrovirus is a non-replicating recombinant retrovirus, or the recombinant lentivirus is a non-replicating recombinant lentivirus.

19. A system for producing recombinant retroviruses comprising a construct according to any one of claims 1 to 18, further optionally comprising: One or more viral genome packaging components; One or more viral envelope proteins; One or more nuclear extratransport elements; and / or One or more stabilizing motifs A system comprising one or more vectors including the following.

20. The system according to claim 19, wherein the one or more viral genome packaging components include Gag, Pol, and / or Rev.

21. The system according to claim 19, wherein the one or more viral envelope proteins include VSV-G.

22. The system according to claim 19, wherein the one or more nuclear export elements include a Rev response element (RRE).

23. The system according to any one of claims 19 to 22, wherein the recombinant retrovirus is a recombinant lentivirus.

24. The system according to any one of claims 19 to 23, wherein the recombinant retrovirus is a recombinant retrovirus that cannot replicate, or the recombinant lentivirus is a recombinant lentivirus that cannot replicate.

25. A host cell transfected with the construct according to any one of claims 1 to 18.

26. A host cell transfected with a vector comprising the construct according to any one of claims 1 to 18.

27. The host cell according to claim 25 or 26, wherein the Pol I promoter of the construct is species-specific for the host cell.

28. A host cell according to any one of claims 25 to 28, further transfected with one or more vectors encoding one or more viral genome packaging components and / or one or more envelope proteins.

29. The host cell according to claim 28, wherein the one or more viral genome packaging components include Gag, Pol, and / or Rev.

30. The host cell according to claim 28, wherein the one or more envelope proteins comprise VSV-G.

31. Target cells transductioned with a recombinant retrovirus comprising the construct according to any one of claims 1 to 18.

32. Target cells transfected with a vector comprising the construct according to any one of claims 1 to 18.

33. A method for producing a recombinant retrovirus, comprising: transfecting a host cell by contacting it with a construct according to any one of claims 1 to 18 and one or more vectors encoding one or more additional viral components; culturing the host cell under conditions that produce recombinant retroviral vector particles; and isolating the recombinant retroviral vector particles.

34. The method according to claim 33, wherein the recombinant retrovirus is a recombinant lentivirus.

35. The method according to claim 33 or 34, wherein the recombinant retrovirus is a recombinant retrovirus that cannot replicate, or the recombinant lentivirus is a recombinant lentivirus that cannot replicate.

36. The method according to any one of claims 33 to 35, wherein the one or more additional viral components are selected from (i) one or more packaging components; and / or (ii) one or more envelope proteins.

37. The method according to any one of claims 33 to 36, wherein the one or more packaging components include Gag, Pol and / or Rev, and the envelope protein includes VSV-G.

38. A method for producing a recombinant lentivirus, comprising stably incorporating the lentivirus gag / pol, VSV-G, and genomic genetic components into the genome of a cell, wherein the expression of at least the genomic genetic components (of the lentivirus) is controlled by an RNA polymerase I (Pol I) promoter.

39. The method according to claim 38, further comprising selecting a cell clone in which various lentivirus genetic elements are stably incorporated into the cell's genome.

40. A cell having a genome in which the lentiviral gag / pol, VSV-G, and genomic elements are stably incorporated, and in which the expression of the lentiviral genomic components is regulated by the RNA polymerase I (Pol I) promoter.