Transposase polynucleotides and their use

Polynucleotides with hyperactive piggyBac transposase and modified UTRs enhance integration/excision activity and reduce immunogenicity, enabling efficient nucleic acid delivery and expression.

JP2026515655APending Publication Date: 2026-05-19POSEIDA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
POSEIDA THERAPEUTICS INC
Filing Date
2024-04-04
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing transposases lack enhanced incorporation/excision activity and exhibit significant in vivo immunogenicity, limiting their effectiveness in delivering nucleic acids into cells.

Method used

Polynucleotides comprising a piggyBac transposase with hyperactive mutations and modified 5' and 3' UTR sequences, including an HBB 5'-UTR, SV40 NLS, CYBA 3'-UTR elements, and miR-142-3p binding sites, are used to enhance expression and reduce immunogenicity, encapsulated in lipid nanoparticles for delivery.

Benefits of technology

The polynucleotides achieve enhanced integration/excision activity and reduced immunogenicity, facilitating efficient delivery and expression of exogenous nucleic acids in cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026515655000001_ABST
    Figure 2026515655000001_ABST
Patent Text Reader

Abstract

A polynucleotide for expressing a transposase, in particular a polynucleotide mRNA for expressing piggyBac transposase, is provided, comprising a piggyBac transposase coding sequence containing a hyperactive mutation and modified 5' and 3'-UTR sequences, in order to enhance the expression, integration / excision activity of piggyBac transposase and / or reduce the in vivo immunogenicity of the encoded transposase.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 494,303, filed on April 5, 2023, and U.S. Provisional Patent Application No. 63 / 610,715, filed on December 15, 2023, each of which is hereby incorporated by reference in its entirety.

[0002] Reference to Electronically Submitted Sequence Listing This application includes a sequence listing submitted in XML format via Patent Center, which is hereby incorporated by reference in its entirety. The XML copy created on April 1, 2024 is named "POTH - 082_001WO_SeqList" and is 94,499 bytes in size.

[0003] Field The present disclosure generally relates to polynucleotides for expressing transposases, particularly polynucleotide mRNAs for expressing piggyBac transposase, which contain an overactive mutant piggyBac transposase coding sequence and modified 5' and 3' - UTR sequences to enhance the expression, integration / excision activity of piggyBac transposase and / or reduce the in - vivo immunogenicity of the encoded transposase.

Background Art

[0004] Background Transposases can be used to introduce non-endogenous DNA sequences into genomic DNA and are advantageous in many ways over other gene editing methods. However, the need for transposases with enhanced incorporation / excision activity and reduced in vivo immunogenicity for in vivo delivery of nucleic acids remains unmet. Incorporation of human cytochrome b-245 alpha polypeptide (CYBA) UTRs into mRNA sequences has been previously reported to significantly increase protein levels of specific mRNAs without altering mRNA stability (see, e.g., Ferizi, M., Aneja, M., Balmayor, E. et al. Sci Rep 6, 39149 (2016)). Importantly, many miRNAs are expressed in hematopoietic lines and have been shown to act as central regulators of the transcriptional program for normal hematopoiesis, including HSC self-renewal, differentiation, and function (see, e.g., Lu et al. (2013) Cell Res 23, 1356-1368 (2013)). [Overview of the project]

[0005] overview In one embodiment, a polynucleotide is provided herein that comprises, in the 5' to 3' direction, (i) a hemoglobin beta (HBB) 5'-UTR, (ii) a sequence encoding a nuclear localization signal (NLS), (iii) a nucleic acid sequence encoding a piggyBac transposase, (iv) one or more nucleic acid sequences containing a human cytochrome b-245 alpha polypeptide (CYBA) 3'-UTR element and one or more miR-142-3p binding sites, and (v) a polyA tail. In some embodiments, the piggyBac transposase comprises five hyperactive mutants selected from I30V;G165S;M226F;M282V and N538K (i.e., the amino acid sequence shown in SEQ ID NO: 14). In some embodiments, the nucleic acid sequence encoding the piggyBac transposase comprises the nucleic acid sequence shown in SEQ ID NO: 2.

[0006] In some embodiments, the NLS is an SV40 NLS containing the amino acid sequence shown in SEQ ID NO: 8.

[0007] In some embodiments, one or more CYBA 3'-UTR elements each include the nucleic acid sequence shown in SEQ ID NO: 3. In some embodiments, the 3'-UTR includes at least two tandem nucleic acid sequences encoding the CYBA 3'-UTR elements separated by the linker sequence. In some embodiments, each tandem nucleic acid sequence encoding the CYBA 3'-UTR elements includes the nucleic acid sequence shown in SEQ ID NO: 4.

[0008] In some embodiments, each of the one or more miR-142-3p binding sites includes the nucleic acid sequence shown in SEQ ID NO: 5. In some embodiments, each of the one or more miR-142-3p binding sites includes the nucleic acid sequence ACACTAC. In some embodiments, the 3'-UTR includes four miR-142-3p binding sites. In some embodiments, the polynucleotide further includes a linker sequence located between each of the four miR-142-3p binding sites. In some embodiments, the linker sequence includes the nucleic acid sequence shown in SEQ ID NO: 6.

[0009] In some embodiments, the HBB 5'-UTR comprises the nucleic acid sequence shown in SEQ ID NO: 1.

[0010] In some embodiments, the poly-A tail is an 80X poly-A tail containing the nucleic acid sequence shown in SEQ ID NO: 7.

[0011] In some embodiments, the polynucleotide comprises the nucleic acid sequence shown in SEQ ID NO: 10.

[0012] In some embodiments, the polynucleotide is a DNA molecule. In some embodiments, the polynucleotide is an RNA molecule. In some embodiments, the RNA molecule is an mRNA molecule. In some embodiments, the mRNA includes a 5'-CAP. In some embodiments, the 5'-CAP is a 5'-CleanCap.

[0013] In another embodiment, lipid nanoparticle (LNP) compositions comprising polynucleotides as described herein are provided herein.

[0014] In another embodiment, a method for delivering an exogenous nucleic acid to a cell is provided herein, the method comprising introducing the mRNA into a cell, the mRNA comprising, in the 5'-3' direction, (i) a nucleic acid sequence encoding an HBB 5'-UTR, NLS, (ii) a nucleic acid sequence encoding a piggyBac transposase containing five hyperactive mutations, (iii) a 3'-UTR containing two or more tandem nucleic acid sequences containing a CYBA3'-UTR element and four miR-142-3p binding sites, and (iv) a polyA tail, wherein the piggyBac transposase is expressed in the cell and incorporates the exogenous nucleic acid-containing transposon into a TTAA integration site in the cellular genome, the expressed piggyBac transposase exhibiting enhanced integration and / or excision activity compared to a piggyBac transposase containing four or fewer hyperactive mutations.

[0015] In another embodiment, a method for in vivo delivery of an exogenous nucleic acid to cells in a subject is provided herein, comprising co-introducing a DNA transposon containing the exogenous nucleic acid and mRNA containing an HBB 5'-UTR, an NLS coding sequence, a piggyBac transposase coding sequence containing five hyperactive mutations, a 3'-UTR containing a tandem CYBA 3'-UTR element upstream of the sequence to four miR-142-3p binding sites, and a polyA tail into a control, wherein cells in the subject take up the transposon, express piggyBac transposase in the cells, incorporate the exogenous nucleic acid-containing transposon into the TTAA integration site in the cellular genome of the subject, and the expressed piggyBac transposase exhibits reduced immunogenicity in the subject compared to mRNA encoding piggyBac transposase lacking the sequence of four miR-142-3p binding sites. [Brief explanation of the drawing]

[0016] [Figure 1A] Figure 1A is a schematic diagram showing an exemplary polynucleotide for expressing piggyBac transposase, including the HBB 5'-UTR; the coding sequence for the nuclear localization sequence (NLS); the piggyBac transposase coding sequence encoding four hyperactive variants; the HBB 3'UTR; and the poly-A tail, in the 5' to 3' direction. [Figure 1B] Figure 1B is a schematic diagram showing the polynucleotides for expressing the piggyBac transposase, including the HBB 5'-UTR; the coding sequence for the nuclear localization sequence (NLS); the piggyBac transposase coding sequence encoding five hyperactive mutations; the 3'UTR containing the tandem CYBA 3'-UTR sequence and sequences for four miR-142-3p binding sites, as well as the polyA tail, in the 5' to 3' direction.

[0017] [Figure 2] Figure 2 shows an example of a GFP episome excision reporter construct.

[0018] [Figure 3A] Figure 3A shows a schematic diagram of polynucleotides including two transposase-expressing polynucleotides containing HBB 5'-UTR; NLS coding sequence; piggyBac transposase coding sequence encoding four hyperactive mutations; HBB 3'-UTR; and polyA tails, in the 5'-to-3' direction, as well as polynucleotides containing HBB 5'-UTR; nuclear localization sequence (NLS) coding sequence; piggyBac transposase coding sequence encoding four hyperactive mutations; and tandem CYBA 3'-UTR. SPBv3.1-HBB is the same as shown in Figure 1. SPB-HBB / 2xCYBA is an intermediate construct lacking a fifth overmutation (M226F) and the miR-142-3p binding site compared to the construct shown in Figure 1.

[0019] [Figure 3B] Figure 3B shows the results of an excision reporter assay illustrating the time course of GFP expression in HepG2 cells transposed using the transposase-expressing polynucleotide or catalytically inactive transposase ("CD-SPB") shown in Figure 3A as a negative control.

[0020] [Figure 4] Figure 4 shows a graph of serum factor VIII (hFVIII) levels (as normal level %) on day 6 of young BALB / c mice that were simultaneously administered either an LNP composition that encapsulates a DNA transposon containing an FVIII expression cassette, an LNP composition that encapsulates one of the mRNA transposase-expressing polynucleotides shown in Figure 3A, or a catalytically inactivated (CD) transposase as a negative control.

[0021] [Figure 5]Figure 5 shows a graph of serum factor VIII (hFVIII) levels (as normal level %) on day 6 of adult C57BL / 6 mice that were simultaneously administered an LNP composition that encapsulates a DNA transposon containing an FVIII expression cassette and an LNP composition that encapsulates one of the mRNA transposase-expressing polynucleotides shown in Figure 3A.

[0022] [Figure 6] Figure 6 shows the results of a resected reporter assay, which describes the 42-hour time course of GFP expression in HepG2 cells transposed using transposase-expressing polynucleotides lacking ("none") or containing ("+miR-142-3p BS") four miR-142-3p binding sites in the 3'-UTR, or catalytically inactive transposases ("CD-SPB"), as negative controls.

[0023] [Figure 7] Figure 7 shows the results of a GFP reporter expression assay, illustrating the 18-hour time course of GFP expression in K562 cells (hematopoietic cells) nucleofected with GFP-expressing polynucleotides lacking ("none") or containing ("+miR-142-3p BS") four miR-142-3p binding sites in the 3'-UTR.

[0024] [Figure 8] Figure 8 shows the results of an excision reporter assay, illustrating the 42-hour time course of GFP expression in K562 cells transposed with transposase-expressing polynucleotides lacking ("none") or containing ("+miR-142-3p BS") four miR-142-3p binding sites in the 3'-UTR.

[0025] [Figure 9]Figure 9 shows a graph of serum factor VIII (hFVIII) levels (as normal level %) at day 6 of young BALB / c mice that were simultaneously administered an LNP composition encapsulating a DNA transposon containing an FVIII expression cassette, an LNP composition encapsulating one of the mRNA transposase-expressing polynucleotides from Figure 3A, or one of the mRNA transposase-expressing polynucleotides from Figure 3A further containing sequences for four miR-142-3p binding sites in the 3'-UTR, or a catalytically inactive transposase as a negative control.

[0026] [Figure 10] Figure 10 shows the number of piggyBac transposase-responsive T cells (as number of IFNγ-positive cells / 10e6 splenocytes) at day 28 in young BALB / c mice that were co-administered with an LNP composition that encapsulates a DNA transposon containing an FVIII expression cassette, an LNP composition that encapsulates one of the mRNA transposase-expressing polynucleotides from Figure 3A, which further includes the sequence of four miR-142-3p binding sites in the 3'-UTR, or a catalytically inactive transposase as a negative control.

[0027] [Figure 11] Figure 11 shows the number of piggyBac transposase-responsive T cells (as number of IFNγ-positive cells / 10e6 splenocytes) at day 21 in adult C57BL / 6 mice co-administered either an LNP composition encapsulating a DNA transposon containing an FVIII expression cassette, an LNP composition encapsulating one of the mRNA transposase-expressing polynucleotides from Figure 3A, further containing the sequence of four miR-142-3p binding sites in the 3'-UTR, or a catalytically inactive transposase as a negative control. The "1 dose" group received the LNP composition on day 1 of the study; the "3 doses" group received the LNP composition repeatedly on days 1, 7, and 14 of the study.

[0028] [Figure 12] Figure 12 shows schematic diagrams of the dual reporter plasmid designs used to confirm the excision and integration rates using each mutant transposon. Using the H-2Kk GFP transposon reporter (Reporter 1), an increase in H-2Kk expression is observed when transposon excision increases. Using Reporter 2, an increase in GFP expression is observed when transposon integration increases. In an alternative design for Reporter 2, an increase in firefly luciferase expression is observed when transposon excision increases, and an increase in NanoLuc is observed when transposon integration increases.

[0029] [Figure 13] Figure 13 shows a schematic diagram of the H-2Kk GFP transposon reporter (Reporter 1). The structural features of the transposon are shown in both circular and linear maps. Increased transposon excision is associated with increased H-2Kk expression, and increased transposon incorporation is associated with increased GFP expression.

[0030] [Figure 14] Figure 14 is a schematic diagram of the firefly luciferase NanoLuc transposon reporter. The structural features of the transposon are shown in both circular and linear maps. Increased transposon excision is associated with increased firefly luciferase expression, and increased transposon incorporation is associated with increased NanoLuc expression.

[0031] [Figures 15A-15B]Figures 15A and 15B show the results of luciferase dual insertion / excision reporter assays in K562 and 293T cells, respectively, using DNA transposons containing luciferase dual insertion / excision reporter constructs including wild-type LE and RE ITR, or 35TCC LE and wild-type RE ITR, as well as DNA plasmids containing transposases expressing polynucleotides encoding piggyBac transposase with 4 ("SPB") or 5 ("Hyper") hyperactive mutations, or a DNA plasmid without transposase-expressing polynucleotides encoding piggyBac transposase (no SPB) as a negative control.

[0032] [Figure 16] Figure 16 shows the results of a luciferase dual integration / excision reporter assay in young BALB / c mice co-administered with an LNP composition that encapsulates DNA transposons containing a luciferase dual integration / excision reporter construct including wild-type LE and RE ITR or 35TCC LE and wild-type RE ITR, an LNP composition that encapsulates mRNA expressed from one of the mRNA transposase-expressing polynucleotides shown in Figure 1, or a catalytically inactive transposase as a negative control.

[0033] [Figures 17A-17E] Figures 17A–17E show a comparison of the activity of two versions of SPB as measured by transposition efficacy, B2M knockout, and T cell proliferation. [Modes for carrying out the invention]

[0034] Detailed explanation Polynucleotides for expressing a transposase, particularly polynucleotide mRNA for expressing piggyBac transposase, are provided herein, comprising a piggyBac transposase coding sequence containing a hyperactive mutation and modified 5' and 3'-UTR sequences, in order to enhance the expression of piggyBac transposase and reduce the in vivo immunogenicity of the encoded transposase.

[0035] PiggyBac transposase expressing polynucleotides In certain aspects of the present disclosure, the polynucleotide encoding the transposase coding sequence is a polynucleotide comprising, in the 5' to 3' direction, (i) an HBB 5'-UTR, (ii) a nucleic acid sequence encoding an SV40 NLS, (iii) a nucleic acid sequence encoding a piggyBac transposase containing five hyperactive mutations, (iv) a 3'-UTR containing a tandem CYBA3'-UTR element upstream of a nucleic acid sequence encoding four miR-142-3p binding sites, and (v) an 80X poly-A tail (Figure 1).

[0036] In certain embodiments, 5'-UTR is HBB 5'-UTR. In certain embodiments, the HBB 5'-UTR sequence is a nucleic acid sequence: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (Sequence ID 1) is included or essentially derived from it. In some embodiments, the HBB 5'UTR sequence includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in Sequence ID 1.

[0037] In a particular embodiment, the nucleic acid sequence codes for a piggyBac transposase containing the following five hyperactive variants: I30V;G165S;M226F, M282V, and N538K (e.g., a piggyBac transposase containing the sequence shown in SEQ ID NO: 45).

[0038] In some embodiments, the piggyBac transposase containing five hyperactive mutations I30V;G165S;M226F, M282V, and N538K includes the sequence of Sequence ID No. 45 (the underlined and bolded sequence is the nuclear localization sequence and may be omitted; the numbering of residues for mutation purposes begins at residue 12). TIFF2026515655000002.tif81170

[0039] In some embodiments, the piggyBac transposase contains an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 45.

[0040] In certain embodiments, the nucleic acid sequences encoding the piggyBac transposase containing mutations I30V;G165S;M226F, M282V, and N538K include or consist of the following sequences:

[0041]

[0042] In certain embodiments, the nucleic acid sequence encodes a piggyBac transposase containing the following four hyperactive variants: I30V, G165S, M282V, and N538K.

[0043] In some embodiments, the piggyBac transposase containing four hyperactive mutants I30V, G165S, M282V, and N538K includes the sequence of Sequence ID No. 46 (the underlined bold sequence is the nuclear localization sequence and may be omitted; the numbering of residues for mutation purposes begins at residue 12). TIFF2026515655000003.tif81170

[0044] In some embodiments, the piggyBac transposase contains an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 46.

[0045] In certain embodiments, the NLS sequence includes or comprises a nucleic acid sequence encoding the amino acid sequence PKKKRKV (SEQ ID NO: 8). In certain embodiments, the nucleic acid encoding the NLS includes or comprises the nucleic acid sequence CCCAAGAAGAAGCGGAAAGTT (SEQ ID NO: 9).

[0046] In certain embodiments, the 80X poly-A tail is arranged as follows: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (sequence number 7) is included or derived from it.

[0047] In certain embodiments, the polynucleotide for expressing piggyBac transposase comprises the nucleic acid sequence shown in SEQ ID NO: 10. In some embodiments, the polynucleotide for expressing piggyBac transposase comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 10.

[0048] CYBA 3'-UTR element In certain embodiments, the transposase-expressed polynucleotide comprises one or more nucleic acid sequences encoding the CYBA 3'-UTR element.

[0049] In certain embodiments, the nucleic acid encoding the CYBA 3'-UTR element is a nucleic acid sequence: CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA (Sequence ID 3) is included in or consists of. In some embodiments, the nucleic acid sequence encoding the CYBA 3'-UTR element includes a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence shown in Sequence ID 3.

[0050] In certain embodiments, the polynucleotide comprises a tandem nucleic acid sequence, each encoding a CYBA 3'-UTR element. In some embodiments, the two tandem nucleic acid sequences encoding CYBA 3'-UTR elements are separated via a linker sequence. In certain embodiments, the tandem nucleic acid sequences encoding CYBA 3'-UTR elements separated together by the linker sequence are: CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGAGAATTCCCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA (Sequence No. 4) is included or consists of.

[0051] miR-142-3P binding site The polynucleotides encoding transposases described herein contain one or more miR-142-3p binding sites in the 3'-UTR of the encoded mRNA. MicroRNAs (miRNAs) are a group of non-coding RNAs (approximately 22 nt) that can silence gene expression by binding to the 3' untranslated region (UTR) or coding region of a target mRNA, thereby promoting mRNA destabilization or inhibiting protein translation. 。

[0052] In some embodiments, the miR-142-3p binding site includes the sequence ACACTAC. In certain embodiments, the miR-142-3p sequence includes or consists of the nucleic acid sequence:TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 5).

[0053] In certain embodiments, the 3'-UTR contains four miR-142-3p binding sites. In certain embodiments, the four miR-142-3p target sequences are separated via three linker sequences. In certain embodiments, the four miR-142-3p target sequences separated via three linker sequences are: TCCATAAAGTAGGAAACACTACACGATTCCATAAAGTAGGAAACACTACAACCGGTTCCATAAAGTAGGAAACACTACATCACTCCATAAAGTAGGAAACACTACA (Sequence ID 6) is included or consists of.

[0054] piggyBac ITR array PiggyBac transposase recognizes the transposon-specific reverse terminal repeat (ITR) at the end of a transposon and inserts its contents between the ITRs of either the chromosomal sequence 5'-TTAA-3' (TTAA target sequence) or the chromosomal sequence 5'-TTAT-3' (TTAT target sequence). The target sequences of PB or piggyBac-like (PBL) transposons are 5'-CTAA-3', 5'-TTAG-3', 5'-ATAA-3', 5'-TCAA-3', 5'AGTT-3', 5'-ATTA-3', 5'-GTTA-3', 5'-TTGA-3', 5'-TTTA-3', 5'-TTAC-3', 5'-ACTA-3', 5'-AGGG-3', 5'-CTAG-3', 5'-TGAA-3', 5'-AGGT-3', 5'-ATCA-3', 5'-CTCC-3', 5'-TAAA-3', 5'-TCTC-3', and 5'TGAA-3 This includes, or may consist of, 5'-AAAT-3', 5'-AATC-3', 5'-ACAA-3', 5'-ACAT-3', 5'-ACTC-3', 5'-AGTG-3', 5'-ATAG-3', 5'-CAAA-3', 5'-CACA-3', 5'-CATA-3', 5'-CCAG-3', 5'-CCCA-3', 5'-CGTA-3', 5'-GTCC-3', 5'-TAAG-3', 5'-TCTA-3', 5'-TGAG-3', 5'-TGTT-3', 5'-TTCA-3', 5'-TTCT-3', and 5'-TTTT-3'. The PB transposon system has no payload limit on the target gene that can be included between ITRs (i.e., not limited in terms of the size of the target gene).

[0055] In some embodiments, the DNA transposon contains a piggyBac ITR sequence. In some embodiments, the DNA transposon contains a first piggyBac ITR sequence, the first piggyBac sequence being the left-end (LE) ITR sequence of piggyBac. In some embodiments, the piggyBac LE ITR sequence is the minimal piggyBac LE ITR sequence. In some embodiments, the minimal piggyBac LE ITR is a 35 bp piggyBac LE ITR sequence containing sequence number 11.

[0056] In some embodiments, the minimal ITR is an LE minimal ITR containing the sequence CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG (sequence ID 14).

[0057] In some embodiments, the piggyBac LE ITR sequence is an ultra-minimal piggyBac LE ITR sequence. In some embodiments, the DNA transposon contains a second piggyBac ITR sequence, the second piggyBac sequence being the piggyBac right-end (RE) ITR sequence. In some embodiments, the piggyBac RE ITR sequence is a minimal piggyBac RE ITR sequence. In some embodiments, the minimal piggyBac RE ITR is a 63 bp piggyBac RE ITR sequence containing sequence number 12. In some embodiments, the minimal ITR is an RE minimal ITR containing the sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATG (sequence number 15). In some embodiments, the piggyBac LE ITR sequence is an ultra-minimal piggyBac LE ITR sequence containing the following sequence This is an ITR sequence: CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCA (Sequence ID 16); CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGAT (Sequence ID 17); CCCTAGAAAGATAATCATATTGTGACGTACGTTA (Sequence ID 18); CCCTAGAAAGATAATCATATTGTGACGTA (Sequence ID 19); CCCTAGAAAGATAATCATATTGTG (Sequence ID 20); CCCTAGAAAGATAATCATA (Sequence ID 21); CCCTAGAAAGATAATCA (Sequence ID 22); CCCTAGAAAGATAATC(Sequence ID 23);CCCTAGAAAGATAATCAT(Sequence ID 24);CCCTAGAAAGATAATCATAT(Sequence ID 25);CCCTAGAAAGATAATCATATT(Sequence ID 26);CCCTAGAAAGATAATCATATTG(Sequence ID 27);CCCTAGAAAGATAATCATATTGT(Sequence ID 28);CCCTAGAAAGATAATCATATTGTGA(Sequence ID 29);CCCTAGAAAGATAATCATATTGTGAC(Sequence ID 30);CCCTAGAAAGATAATCATATTGTGACG(Sequence ID 31);CCCTAGAAAGATAATCATATTGTGACGT(Sequence No. 32);CCCTAGAAAGATAATCATATTGTGACGTAC(Sequence No. 33);CCCTAGAAAGATAATCATATTGTGACGTACG(Sequence No. 34);CCCTAGAAAGATAATCATATTGTGACGTACGT(Sequence No. 35);CCCTAGAAAGATAATCATATTGTGACGTACGTT(Sequence No. 36);CCCTAGAAAGATAATCATATTGTGACGTACGTTAA(Sequence No. 37);CCCTAGAAAGATAATCATATTGTGACGTACGTTAAA(Sequence No. 38);CCCTA GAAAGATAATCATATTGTGACGTACGTTAAAG (Sequence No. 39); CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGA (Sequence No. 40); CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATA (Sequence No. 41); CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAA (Sequence No. 42); CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAAT (Sequence No. 43); or CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATC (Sequence No. 44).

[0058] In some embodiments, the DNA transposon comprises a second piggyBac ITR sequence, the second piggyBac sequence being a piggyBac left-end (LE) ITR sequence containing the 35TCC mutation. The piggyBac ITR sequence containing the 35TCC mutation is described in International PCT Application Publication No. 2023 / 060088, and the whole is incorporated herein by reference for an example of a piggyBac ITR sequence that may be used in the compositions and methods described herein. The 35TCC mutation comprises a G-to-T substitution at position 31 of the ITR and an A-to-C substitution at position 33 to produce a 35TCC ITR variant. In certain embodiments, the 35TCC ITR variant is a complete LE ITR sequence containing Sequence ID No. 13.

[0059] In some embodiments, the piggyBac ITR sequence may include any piggyBac ITR sequence known in the art. For example, the piggyBac ITR sequence, such as a first piggyBac ITR sequence and / or a second piggyBac ITR sequence in a transposon, may include, essentially consist of, or be composed of, the Sleeping Beauty transposon ITR, the Helraiser transposon ITR, the Tol2 transposon ITR, the TcBuster transposon ITR, or any combination thereof.

[0060] Lipid nanoparticles This disclosure provides transposase-expressing polynucleotides described herein, encapsulated in lipid nanoparticles (LNPs) for in vivo delivery of transposase-expressing polynucleotides. In some embodiments, the LNP composition comprises at least one cationic lipid and a polynucleotide molecule encoding at least one transposase. In some embodiments, the lipid nanoparticles may further comprise at least one structural lipid. In some embodiments, the lipid nanoparticles may further comprise at least one phospholipid. In some embodiments, the lipid nanoparticles may further comprise at least one PEGylated lipid.

[0061] Accordingly, the present disclosure provides an LNP composition comprising at least one lipid nanoparticle, wherein the at least one lipid nanoparticle comprises at least one cationic lipid, at least one nucleic acid molecule, at least one structural lipid, at least one phospholipid, and at least one PEGylated lipid.

[0062] Bioreducible ionizable cationic lipids In some embodiments, the cationic lipid may be a bioreducible ionizable cationic lipid. Accordingly, the present disclosure provides a composition comprising at least one lipid nanoparticle, wherein at least one lipid nanoparticle comprises at least one bioreducible ionizable cationic lipid.

[0063] In some embodiments of the compositions and methods of this disclosure, the bioreducible ionizable cationic lipid for use in the LNP composition may be C12-200(1,1'-[[2-[4-[2-[[2-[[bis(2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-1-piperazinyl]ethyl]imino]bis-2-dodecanol). In some embodiments, an exemplary LNP composition containing C12-200 for encapsulating DNA molecules is 35% C12-200; 41.84% DOPE; 20% CHOL; and 3.16% DM-PEG. In some embodiments, an exemplary LNP composition containing C12-200 for encapsulating RNA molecules is 33.5% C12-200; 33.5% DOPE; 32% CHOL; and 1% DM-PEG.

[0064] In some embodiments of the compositions and methods of this disclosure, the bioionizable cationic lipid is a terpene lipidoid having the following structure: TIFF2026515655000004.tif51170

[0065] Methods for preparing compound X and LNP compositions containing compound X are previously described in the jointly owned International PCT application no. PCT / US2023 / 61005. In some embodiments, exemplary LNP compositions containing compound X for encapsulating nucleic acid molecules are as follows: 41.84% compound X; 45.85% DOPE; 10% CHOL; and 2.7% DM-PEG or 33.5% compound X; 32% DOPE; 33.5% CHOL; and 1% DM-PEG.

[0066] In some aspects of the compositions and methods of this disclosure, the bioreducible ionizable cationic lipid for use in the LNP composition may be ssPalmO-Ph-P4C2. As will be understood by those skilled in the art, ssPalmO-Ph-P4C2 has the following structure: JPEG2026515655000005.jpg31170

[0067] As those skilled in the art will understand, ssPalmO-Ph-P4C2 may also be called Coatsome® SS-OP, ssPalmO-Phe-P4C2, ssPalmO-phenyl-P4C2, ssPalmO-Phe, and ssPalmO-Ph. Therefore, ssPalmO-Ph-P4C2, Coatsome® SS-OP, ssPalmO-Phe-P4C2, ssPalmO-phenyl-P4C2, ssPalmO-Phe, and ssPalmO-Ph are used interchangeably herein to refer to a bioreducible ionizable cationic lipid having the chemical structure shown in Formula I.

[0068] While not wishing to be constrained by theory, the three specific segments of ssPalmO-Ph-P4C2 facilitate its biodegradation. First, the tertiary amines of each piperidine ring are acidic pH-responsive cationic charged units. Upon endocytosis, the tertiary amine moieties become positively charged in response to the acidic intracellular endosomal compartment. These can now interact with the membrane, destabilizing it, which leads to endosomal escape. Once in the cytosol, the disulfide bonds are susceptible to reduction by glutathione, producing two free sulfhydryl groups. The resulting high concentration of free thiols leads to further nucleophilic reactions, causing the particle to undergo autodegradation / disintegration via thioesterification, releasing the payload into the cytosol. This is defined as HyPER (or hydrolysis), accelerated by the intraparticle concentration of reactants, and generally may eliminate the potentially toxic side effects of cationic lipids.

[0069] As used herein, the term “bioreducible ionizable cationic lipid” is used in its broadest sense and refers to a cationic lipid comprising at least one tertiary amine, at least one disulfide group, at least one group containing a bond readily cleaved by thioesterification, and further comprising at least two saturated or unsaturated hydrocarbon chains. Examples of bioreducible ionizable cationic lipids include, but are not limited to, those described in Akita et al., (2020) Biol. Phar. Bull. 43:1617-1625, the entirety of which is incorporated herein by reference.

[0070] In some embodiments, the bioreducible ionizable cationic lipid may contain at least two tertiary amines. In some embodiments, at least one tertiary amine may be a substituted piperidinyl group. In some embodiments, each tertiary amine may be a substituted piperidinyl group. In some embodiments, the bioreducible ionizable cationic lipid may contain at least one disulfide bond. In some embodiments, the sulfur atom of the disulfide bond is linked to the nitrogen of the piperidinyl ring via an alkylene group, thereby forming two tertiary amine groups adjacent to the disulfide bond. In some embodiments, at least one of the alkylene groups is an ethylene group. In some embodiments, each of the alkylene groups is an ethylene group.

[0071] In some embodiments, at least one group containing a bond susceptible to cleavage by thioesterification may be a phenyl ester group. In some embodiments, the bioreducible ionizable cationic lipid may contain at least two phenyl ester groups. In some embodiments, at least one of at least two saturated or unsaturated hydrocarbon chains is an unsaturated hydrocarbon chain. In some embodiments, each of at least two saturated or unsaturated hydrocarbon chains is an unsaturated hydrocarbon chain. In some embodiments, the unsaturated hydrocarbon chain may be octadecene. In some embodiments, octadecene may be (Z)-octadeca-9-ene. In some embodiments, the (Z)-octadeca-9-ene group may be linked to the phenyl ester group of the bioreducible ionizable cationic lipid.

[0072] Examples of bioreducible ionizable cationic lipids useful in the methods of the present invention and methods for preparing such lipids are disclosed in International Patent Application PCT / JP2016 / 052690, published as International Publication 2016 / 121942, the contents of which are incorporated herein by reference in their entirety with respect to examples of bioreducible ionizable cationic lipids that may be used in the compositions and methods described herein. Accordingly, this disclosure provides compositions comprising at least one lipid nanoparticle, the at least one lipid nanoparticle comprising any one of the bioreducible ionizable cationic lipids described in International Publication 2016 / 121942.

[0073] Accordingly, the present disclosure provides a composition comprising at least one lipid nanoparticle, wherein the at least one lipid nanoparticle comprises at least one bioreducible ionizable cationic lipid, at least one nucleic acid molecule, at least one structural lipid, at least one phospholipid, and at least one PEGylated lipid.

[0074] In some embodiments, the bioreducible ionizable cationic lipid may be ssPalmO-Ph-P4C2 having the structure described in Formula I (see Akita et al., (2020) Biol. Phar. Bull. 43:1617-1625 (its entire contents are incorporated by reference)).

[0075] As described herein, LNP compositions of this disclosure comprising at least one bioreducible ionizable cationic lipid advantageously exhibit significantly reduced toxicity in animals compared to LNP compositions comprising non-bioreducible ionizable cationic lipids. In particular, administration of the LNP compositions of this disclosure surprisingly does not result in any weight loss. In fact, the LNP compositions of this disclosure are so non-toxic that animals administered with the LNPs actually gain weight, even at doses of LNP exceeding the lethal dose of LNP compositions comprising non-bioreducible ionizable cationic lipids.

[0076] LNP component In some embodiments, the LNPs of the Disclosure may contain, on a molar basis, at least one bioreducible ionizable cationic lipid in amounts of about 2.5%, or about 5%, or about 7.5%, or about 10%, or about 12.5%, or about 15%, or about 17.5%, or about 20%, or about 22.5%, or about 25%, or about 27.5%, or about 30%, or about 32.5%, or about 35%, or about 37.5%, or about 40%, or about 42.5%, or about 45%, or about 47.5%, or about 50%, or about 52.5%, or about 55%, or about 57.5%, or about 60%, or about 62.5%, or about 65%, or about 67.5%, or about 70%.

[0077] In some embodiments, the LNPs of the Disclosure are at least about 2.5%, or at least about 5%, or at least about 7.5%, or at least about 10%, or at least about 12.5%, or at least about 15%, or at least about 17.5%, or at least about 20%, or at least about 22.5%, or at least about 25%, or at least about 27.5%, or at least about 30%, or at least about 32.5%, or at least about 35%, or at least about It may contain at least one bioreducible ionizable cationic lipid in proportion to 37.5%, or at least about 40%, or at least about 42.5%, or at least about 45%, or at least about 47.5%, or at least about 50%, or at least about 52.5%, or at least about 55%, or at least about 57.5%, or at least about 60%, or at least about 62.5%, or at least about 65%, or at least about 67.5%, or at least about 70%.

[0078] In some embodiments, the LNPs of the Disclosure may contain, on a molar basis, at least one structural lipid in amounts of about 2.5%, or about 5%, or about 7.5%, or about 10%, or about 12.5%, or about 15%, or about 17.5%, or about 20%, or about 22.5%, or about 25%, or about 27.5%, or about 30%, or about 32.5%, or about 35%, or about 37.5%, or about 40%, or about 42.5%, or about 45%, or about 47.5%, or about 50%, or about 52.5%, or about 55%, or about 57.5%, or about 60%, or about 62.5%, or about 65%, or about 67.5%, or about 70%.

[0079] In some embodiments, the LNPs of the present disclosure may contain at least about 2.5%, or at least about 5%, or at least about 7.5%, or at least about 10%, or at least about 12.5%, or at least about 15%, or at least about 17.5%, or at least about 20%, or at least about 22.5%, or at least about 25%, or at least about 27.5%, or at least about 30%, or at least about 32.5%, or at least about 35%, or at least about 37.5%, or at least about 40%, or at least about 42.5%, or at least about 45%, or at least about 47.5%, or at least about 50%, or at least about 52.5%, or at least about 55%, or at least about 57.5%, or at least about 60%, or at least about 62.5%, or at least about 65%, or at least about 67.5%, or at least about 70% on a molar basis of at least one structural lipid.

[0080] In some embodiments, the LNPs of the Disclosure may contain at least one phospholipid in molar terms of about 2.5%, or about 5%, or about 7.5%, or about 10%, or about 12.5%, or about 15%, or about 17.5%, or about 20%, or about 22.5%, or about 25%, or about 27.5%, or about 30%, or about 32.5%, or about 35%, or about 37.5%, or about 40%, or about 42.5%, or about 45%, or about 47.5%, or about 50%, or about 52.5%, or about 55%, or about 57.5%, or about 60%, or about 62.5%, or about 65%, or about 67.5%, or about 70%.

[0081] In some embodiments, the LNPs of the present disclosure may contain at least about 2.5%, or at least about 5%, or at least about 7.5%, or at least about 10%, or at least about 12.5%, or at least about 15%, or at least about 17.5%, or at least about 20%, or at least about 22.5%, or at least about 25%, or at least about 27.5%, or at least about 30%, or at least about 32.5%, or at least about 35%, or at least about 37.5%, or at least about 40%, or at least about 42.5%, or at least about 45%, or at least about 47.5%, or at least about 50%, or at least about 52.5%, or at least about 55%, or at least about 57.5%, or at least about 60%, or at least about 62.5%, or at least about 65%, or at least about 67.5%, or at least about 70% on a molar basis of at least one phospholipid.

[0082] In some embodiments, the LNPs of the present disclosure may contain, on a molar basis, at least 0.25%, or about 0.5%, or about 0.75%, or about 1.0%, or about 1.25%, or about 1.5%, or about 1.75%, or about 2.0%, or at least about 2.5%, or about 2.5%, or about 5% of at least one PEGylated lipid.

[0083] In some embodiments, the LNPs of the present disclosure may contain at least about 0.25%, or at least about 0.5%, or at least about 0.75%, or at least about 1.0%, or at least about 1.25%, or at least about 1.5%, or at least about 1.75%, or at least about 2.0%, or at least about 2.5%, or at least about 5% of at least one PEGylated lipid on a molar basis.

[0084] structural lipids In some embodiments, the structural lipid may be a steroid. In some embodiments, the structural lipid may be a sterol. In some embodiments, the structural lipid may include cholesterol. In some embodiments, the structural lipid may include ergosterol. In some embodiments, the structural lipid may be a phytosterol.

[0085] Phospholipids As used herein, the term “phospholipid” is used in its broadest sense to refer to any amphiphilic molecule comprising a polar (hydrophilic) head group containing a phosphate and two hydrophobic fatty acid chains. In some embodiments, phospholipids may include dioleoylphosphatidylethanolamine (DOPE). In some embodiments, phospholipids may include DDPC (1,2-didecanoyl-sn-glycero-3-phosphocholine), DEPA-NA (1,2-diellcoyl-sn-glycero-3-phosphate (sodium salt)), DEPC (1,2-diellcoyl-sn-glycero-3-phosphocholine), DEPE (1,2-diellcoyl-sn-glycero-3-phosphoethanolamine), DEPG-NA (1,2-diellcoyl-sn-glycero-3-[phospho [1-Glycerol (sodium salt)]), DLOPC (1,2-Dilinoleyl-sn-Glycero-3-Phosphocholine), DLPA-NA (1,2-Dilauroyl-sn-Glycero-3-Phosphate (sodium salt)), DLPC (1,2-Dilauroyl-sn-Glycero-3-Phosphocholine), DLPE (1,2-Dilauroyl-sn-Glycero-3-Phosphoethanolamine), DLPG-NA (1,2-Dilauroyl-s n-Glycero-3-[phospho-rac-(1-glycerol)(sodium salt)]), DLPG-NH4(1,2-dilauroyl-sn-glycero-3-[phospho-rac-(1-glycerol)(ammonium salt)]), DLPS-NA(1,2-dilauroyl-sn-glycero-3-phosphoserine(sodium salt)), DMPA-NA(1,2-dimiristoyl-sn-glycero-3-phosphate(sodium salt)), DMPC(1,2-di Myristoyl-sn-glycero-3-phosphocholine), DMPE (1,2-dimiristoyl-sn-glycero-3-phosphoethanolamine), DMPG-NA (1,2-dimiristoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(sodium salt)]), DMPG-NH4 (1,2-dimiristoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(ammonium salt)]), DMPG-NH4 / NA (1,2-Dimyristoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(sodium / ammonium salt)]), DMPS-NA(1,2-Dimyristoyl-sn-glycero-3-phosphoserine(sodium salt)), DOPA-NA(1,2-Dioleoyl-sn-glycero-3-phosphate(sodium salt)), DOPC(1,2-Dioleoyl-sn-glycero-3-phosphocholine), DOPE(1,2-Dioleoyl-sn-glycero-3-phosphoethanol) DOPG-NA (1,2-dioleoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(sodium salt)]), DOPS-NA (1,2-dioleoyl-sn-glycero-3-phosphoserine(sodium salt)), DPPA-NA (1,2-dipalmitoyl-sn-glycero-3-phosphate(sodium salt)), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DPPE (1,2-dipalmitoyl-sn-glycero-3- Phosphoethanolamine), DPPG-NA (1,2-dipalmitoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(sodium salt)]), DPPG-NH4 (1,2-dipalmitoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(ammonium salt)]), DPPS-NA (1,2-dipalmitoyl-sn-glycero-3-phosphoserine(sodium salt)), DSPA-NA (1,2-distearoyl-sn-glycero-3-phosphate) (sodium salt), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine), DSPG-NA (1,2-distearoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(sodium salt)]), DSPG-NH4 (1,2-distearoyl-sn-glycero-3-[phospho-rac-(1-glycerol)(ammonium salt)]), DSPS-NA (1,2-Distearoyl-sn-glycero-3-phosphoserine (sodium salt), EPC (Egg-PC), HEPC (Hydrogenated Egg PC), HSPC (Hydrogenated Soy PC), LYSOPC MYRISTIC (1-Myristoyl-sn-glycero-3-phosphocholine), LYSOPC PALMITIC (1-Palmitoyl-sn-glycero-3-phosphocholine), LYSOPC STEARIC (1-stearoyl-sn-glycero-3-phosphocholine), milk sphingomyelin (MPPC; 1-myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine), MSPC (1-myristoyl-2-stearoyl-sn-glycero-3-phosphocholine), PMPC (1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine), POPC (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine), POPE (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanol It may contain MIN), POPG-NA(1-palmitoyl-2-oleoyl-sn-glycero-3[phospho-rac-(1-glycerol)](sodium salt)), PSPC(1-palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine), SMPC(1-stearoyl-2-myristoyl-sn-glycero-3-phosphocholine), SOPC(1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine), SPPC(1-stearoyl-2-palmitoyl-sn-glycero-3-phosphocholine), or any combination thereof.

[0086] PEGylated lipids As used herein, the term “PEGylated lipid” is used to refer to any lipid that has been modified (e.g., covalently linked) to at least one polyethylene glycol molecule. In some embodiments, the PEGylated lipid may include 1,2-dimiristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (hereinafter referred to as DMG-PEG2000).

[0087] nucleic acid In some embodiments, the lipid nanoparticles may contain at least one transposase-expressing polynucleotide molecule. In some embodiments, the lipid nanoparticles may contain multiple transposase-expressing polynucleotide molecules. In some embodiments, at least one or more transposase-expressing polynucleotide molecules can be formulated into lipid nanoparticles.

[0088] In some embodiments, the nucleic acid molecule may be a synthetic transposase-expressed polynucleotide molecule. In some embodiments, the transposase-expressed polynucleotide molecule may be a nucleic acid molecule that does not exist in nature. In some embodiments, the nucleic acid molecule may contain at least one non-naturally occurring nucleotide. The at least one non-naturally occurring nucleotide may be any non-naturally occurring nucleotide known in the art. In some embodiments, the nucleic acid molecule may be a modified transposase-expressed polynucleotide molecule. In some embodiments, the modified nucleic acid molecule may contain at least one modified nucleotide. The at least one modified nucleotide may be any modified nucleic acid known in the art.

[0089] In some embodiments, lipid nanoparticles may contain lipids and nucleic acids in a specific ratio (weight / weight).

[0090] In some embodiments, lipid nanoparticles containing at least one nucleic acid are in a ratio of approximately 5:1 to approximately 15:1, or approximately 10:1 to approximately 20:1, or approximately 15:1 to approximately 25:1, or approximately 20:1 to approximately 30:1, or approximately 25:1 to approximately 35:1, or approximately 30:1 to approximately 40:1, or approximately 35:1 to approximately 45:1, or approximately 40:1 to approximately 50:1, or approximately 45:1 to approximately 55:1, or approximately 50:1 to approximately 60:1, or approximately 55:1 to approximately 65:1, or approximately 60:1 to approximately 70:1, or approximately 65:1 to approximately 75:1, or approximately 70:1 to approximately 80:1, or approximately 75:1 to approximately It may contain lipids and nucleic acids in a ratio of 85:1, or approximately 80:1 to 90:1, or approximately 85:1 to 95:1, or approximately 90:1 to 100:1, or approximately 95:1 to 105:1, or approximately 100:1 to 110:1, or approximately 105:1 to 115:1, or approximately 110:1 to 120:1, or approximately 115:1 to 125:1, or approximately 120:1 to 130:1, or approximately 125:1 to 135:1, or approximately 130:1 to 140:1, or approximately 135:1 to 145:1, or approximately 140:1 to 150:1 (lipids:nucleic acids (weight / weight)).

[0091] In some embodiments, lipid nanoparticles are arranged in a ratio of approximately 5:1, or approximately 10:1, or approximately 15:1, or approximately 20:1, or approximately 25:1, or approximately 30:1, or approximately 35:1, or approximately 40:1, or approximately 45:1, or approximately 50:1, or approximately 55:1, or approximately 60:1, or approximately 65:1, or approximately 70:1, or approximately 75:1, or approximately 80:1, or approximately 85:1. Alternatively, lipids and nucleic acids can be included in lipid:nucleic acid (weight / weight) ratios of approximately 90:1, 95:1, 100:1, 105:1, 110:1, 115:1, 120:1, 125:1, 130:1, 135:1, 140:1, 145:1, 150:1, or 200:1.

[0092] In some embodiments, lipid nanoparticles may contain lipids and nucleic acids in a lipid:nucleic acid (weight / weight) ratio of about 10:1, or about 17.5:1, or about 25:1.

[0093] In some embodiments, the nucleic acid molecule may be an RNA molecule. Therefore, in some embodiments, the lipid nanoparticles may contain at least one transposase-expressed polynucleotide, and the polynucleotide molecule is an RNA molecule. In some embodiments, the RNA molecule may be an mRNA molecule. In some embodiments, the mRNA molecule may contain a 5'-CAP.

[0094] In some embodiments, mRNA molecules can be capped using any method and / or capping moiety known in the art. mRNA molecules can be capped with an m7G(5')ppp(5')G moiety, also referred to herein as "Cap0". mRNA molecules can be capped with a CleanCap® moiety, which may include an m7G(5')ppp(5')(2'OMeA)(CleanCap®AG) moiety. CleanCap® moieties may include an m7G(5')ppp(5')(2'OMeG)(CleanCap®GG) moiety. mRNA molecules can be capped with an anti-reverse cap analog (ARCA®) moiety, which may include an m7(3'-O-methyl)G(5')ppp(5')G moiety. mRNA molecules can be capped with the CleanCap® 3'OMe moiety (CleanCap® + ARCA®).

[0095] In some embodiments, the mRNA molecule containing the transposase-expressing polynucleotide described herein is prepared according to the method of Example 10.

[0096] In some embodiments, the mRNA molecule may contain at least one modified nucleic acid.

[0097] Modified nucleic acids include 5-methoxyuridine (5 moU) and N1-methylpsoiduridine (me 1Examples include, but are not limited to, Ψ), pseudouridine (Ψ), and 5-methylcytidine (5-MeC).

[0098] DNA editing composition This disclosure also provides gene-editing compositions and cells containing gene-editing compositions. The gene-editing compositions may include a nucleic acid sequence encoding a DNA-binding domain and a nucleic acid sequence encoding a nuclease protein or its nuclease domain. The sequence encoding the nuclease protein or its nuclease domain may include a DNA sequence, an RNA sequence, or a combination thereof. The nuclease or its nuclease domain may include one or more of the following: CRISPR / Cas proteins, transcriptional activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), and endonucleases.

[0099] The nuclease or its nuclease domain may include a nuclease-inactivated Cas(dCas) protein and an endonuclease. The endonuclease may include a Clo051 nuclease or its nuclease domain. The gene editing composition may include a fusion protein. In some embodiments, the fusion protein includes a nuclease-inactivated Cas9(dCas9) protein and a Clo051 nuclease or Clo051 nuclease domain. The gene editing composition may further include a guide sequence. The guide sequence includes an RNA sequence.

[0100] This disclosure provides compositions comprising Cas9 operably linked to an effector. This disclosure provides fusion proteins comprising, essentially consisting of, or consisting of a DNA localization component and an effector molecule, wherein the effector comprises Cas9. The Cas9 constructs of this disclosure may comprise an effector comprising an IIS-type endonuclease.

[0101] In some embodiments, the gene editing composition comprises an inactivated Cas9 (dSaCas9) operably linked to an effector. This disclosure provides a fusion protein comprising a DNA localization component and an effector molecule, wherein the effector comprises an inactivated Cas9 (dSaCas9). The inactivated Cas9 (dSaCas9) construct of this disclosure may comprise an effector comprising an IIS-type endonuclease. dSaCas9 comprises the amino acid sequence of SEQ ID NO: 48, which includes D10A and N580A mutations that inactivate the catalytic site.

[0102] This disclosure provides compositions comprising inactivated Cas9 (dCas9) operably linked to an effector. This disclosure further provides fusion proteins comprising a DNA localization component and an effector molecule, the effector comprising inactivated Cas9 (dCas9). The inactivated Cas9 (dCas9) constructs of this disclosure may comprise an effector comprising an IIS-type endonuclease.

[0103] dCas9 can be isolated or derived from Streptococcus pyogenes. dCas9 may include dCas9 having substitutions at amino acid positions 10 and 840 that inactivate the catalytic site. In some embodiments, these substitutions are D10A and H840A. dCas9 may contain the amino acid sequence of SEQ ID NO: 49 or SEQ ID NO: 50.

[0104] In some embodiments, the C-terminus of dCas9 or its inactivated nuclease domain is conjugated to the N-terminus of the Clo051 polypeptide or its nuclease domain via a peptide linker sequence selected from GGGGS (SEQ ID NO: 60).

[0105] In some embodiments, the Clo051 nuclease domain contains the amino acid sequence of SEQ ID NO: 51. In some embodiments, the Clo051 nuclease domain contains at least one amino acid substitution compared to SEQ ID NO: 51. In some embodiments, the amino acid substitution is located within the alpha-helix loop domain of the Clo051 nuclease. In some embodiments, the amino acid substitution is located at positions 35, 37, 60, 92, 98, 100, or 146 of SEQ ID NO: 51. In some embodiments, the amino acid substitution is located at position 37 of SEQ ID NO: 51. In some embodiments, the amino acid substitution is located at positions 37 and 92 of SEQ ID NO: 51.

[0106] An exemplary dCas9-Clo051 (Cas-CLOVER) fusion protein may contain the amino acid sequence of SEQ ID NO: 52. An exemplary dCas9-Clo051 fusion protein may be encoded by a polynucleotide containing the nucleic acid sequence of SEQ ID NO: 53. The nucleic acid encoding the dCas9-Clo051 fusion protein may be DNA or RNA.

[0107] An exemplary dCas9-Clo051 (Cas-CLOVER) fusion protein may contain the amino acid sequence of SEQ ID NO: 54. An exemplary dCas9-Clo051 fusion protein may be encoded by a polynucleotide containing the nucleic acid sequence of SEQ ID NO: 55. The nucleic acid encoding the dCas9-Clo051 fusion protein may be DNA or RNA.

[0108] The exemplary dCas9-Clo051 fusion (Cas-CLOVER) fusion proteins of this disclosure may further comprise at least one nuclear localization sequence (NLS). In some embodiments, the dCas9-Clo051 fusion proteins of this disclosure comprise two nuclear localization sequences. In some embodiments, the NLS is located at the N-terminus of the dCas9-Clo051 fusion protein (NLS-dCas9-Clo051). In some embodiments, the NLS is located at the C-terminus of the dCas9-Clo051 fusion protein (dCas9-Clo051-NLS). In some embodiments, the NLS is located at both the N-terminus and C-terminus of the dCas9-Clo051 fusion protein ("NLS-dCas9-Clo051-NLS", "wild-type Cas-CLOVER", or "dspCas9 Ca-CLOVER").

[0109] The NLS-dCas9-Clo051-NLS ("wild-type Cas-CLOVER", or "Cas-CLOVER v2", or "CCv2", or "dspCas9 Cas-CLOVER") fusion protein may contain the amino acid sequence of SEQ ID NO: 56, where the NLS amino acid sequence is bold and underlined, and the linker is bold and italicized): TIFF2026515655000006.tif209170

[0110] In some embodiments, the NLS-dCas9-Clo051-NLS ("wild-type Cas-CLOVER", or "Cas-CLOVER v2", or "CCv2", or "dspCas9 Cas-CLOVER") fusion protein contains an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 56. In some embodiments, the fusion protein contains an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 56.

[0111] In some embodiments, the NLS-dCas9-Clo051-NLS ("wild-type Cas-CLOVER", or "Cas-CLOVER v2", or "CCv2", or "dspCas9 Cas-CLOVER") fusion protein contains the amino acid sequence shown in SEQ ID NO: 56, which has 1, 2, 3, 4, or 5 conserved amino acid substitutions.

[0112] The nucleic acid encoding the NLS-dCas9-Clo051-NLS ("wild-type Cas-CLOVER", or "Cas-CLOVER v2", or "CCv2", or "dspCas9 Cas-CLOVER") fusion protein can be DNA or RNA. In some embodiments, the dCas9-Clo051 fusion protein, which contains two NLS regions, is encoded by an mRNA sequence containing the sequence shown in SEQ ID NO: 57 or a DNA sequence containing the sequence shown in SEQ ID NO: 61.

[0113] In some embodiments, NLS-dCas9-Clo051-NLS ("wild-type Cas-CLOVER") contains at least one amino acid substitution compared to SEQ ID NO: 56. In some embodiments, the amino acid substitution is located in the Clo051 domain of NLS-dCas9-Clo051-NLS.

[0114] In some embodiments, NLS-dCas9-Clo051-NLS of SEQ ID NO: 56 may contain at least one substitution in the amino acid at positions 42, 44, 67, 105, 107, or 153. In some embodiments, the amino acid substitution is F42E, F42D, S44E, S44P, R67E, I105Q, Q107A, Q107E, Q107H, Q107D, and / or K153D. In some embodiments, the amino acid substitution is S44P.

[0115] Exemplary S44P mutant NLS-dCas9-Clo051-NLS ("S44P Cas-CLOVER", "S44P CC", "S44P", "Cas-CLOVERv3", "CCv3") fusion proteins can contain the amino acid sequence of Sequence ID No. 58, where the NLS amino acid sequence is in bold and underlined, and the linker is in bold and italics. TIFF2026515655000007.tif209170

[0116] In some embodiments, the S44P mutant NLS-dCas9-Clo051-NLS ("S44P Cas-CLOVER", "S44P CC", "S44P", "Cas-CLOVERv3", "CCv3") fusion protein contains an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 56. In some embodiments, the fusion protein contains an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 58.

[0117] In some embodiments, the S44P mutant NLS-dCas9-Clo051-NLS ("S44P Cas-CLOVER", "S44P CC", "S44P", "Cas-CLOVERv3", "CCv3") fusion protein contains the amino acid sequence shown in SEQ ID NO: 58, which has 1, 2, 3, 4, or 5 conserved amino acid substitutions.

[0118] The Cas-CLOVER v3 fusion protein can be encoded by a polynucleotide containing the nucleic acid sequence of SEQ ID NO: 59. The nucleic acid encoding the dCas9-Clo051 fusion protein can be DNA or RNA. aaaA (Sequence ID 59)

[0119] SHRNA As used herein, the terms “guide sequence” or “spacer” in the context of the Cas-Clover system or CRISPR-Cas9 system include any polynucleotide molecule that hybridizes with the target nucleic acid sequence and has sufficient complementarity to the target nucleic acid sequence to direct the sequence-specific binding of the nucleic acid targeting complex to the target nucleic acid sequence. Guide sequences may include both RNA polynucleotides and DNA polynucleotides. Guide sequences may form a double helix with the target sequence. This double helix may be a DNA double helix, an RNA double helix, or an RNA / DNA double helix. The terms “guide molecule,” “guide RNA,” “gRNA,” “single guide RNA,” and “sgRNA” are used interchangeably herein to refer to RNA-based molecules that include a guide sequence that can form a complex with the Cas-Clover or CRISPR-Cas protein, hybridizes with the target nucleic acid sequence, and has sufficient complementarity to direct the sequence-specific binding of the complex to the target nucleic acid sequence. The guide molecule or guide RNA may include an RNA-based molecule having one or more chemical modifications (e.g., by chemically linking two ribonucleotides or by replacing one or more ribonucleotides with one or more deoxyribonucleotides) as described herein. The guide sequence may also partially include RNA and DNA-based nucleotides in which the molecule is a chimeric entity with respect to RNA and DNA nucleic acid bases (e.g., containing either ribose sugar or deoxyribose sugar).

[0120] Cas-Clover or CRISPR / Cas9-based systems may contain two or more gRNAs, where the gRNAs target different DNA sequences. The target DNA sequences may overlap. The target sequence or protospacer is followed by a PAM sequence at the 3' end of the protospacer. Different type II CRISPR systems have different PAM requirements. For example, the Streptococcus (S. pyogenes) type II system uses the "NGG" sequence, where "N" can be any nucleotide.

[0121] The guide RNA or guide RNA of the Cas-Clover protein or CRISPR-Cas protein may include a tracr-mate sequence (which in the context of the endogenous CRISPR system includes a “direct repeat”) and a guide sequence (also called a “spacer” in the context of the endogenous CRISPR system). In some embodiments, the Cas-Clover or CRISPR-Cas system or complex described herein does not include a tracr sequence and / or does not depend on the presence of a tracr sequence. In certain embodiments, the guide molecule may include, essentially consist of, or may consist of, a direct repeat sequence fused to or ligated to the guide sequence or spacer sequence.

[0122] In certain embodiments, the guide sequence or spacer length of the guide molecule is 15 to 50 nucleotides long. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides long. In certain embodiments, the spacer length is 15 to 17 nucleotides long, 17 to 20 nucleotides long, 20 to 24 nucleotides long, 23 to 25 nucleotides long, 24 to 27 nucleotides long, 27 to 30 nucleotides long, 30 to 35 nucleotides long, or greater than 35 nucleotides long.

[0123] In the step embodiment, the guide array is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 The lengths are 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150 nucleotides.

[0124] As described above, the Cas-Clover system and the CRISPR / Cas9 system utilize one or more targeting gRNAs that provide targeting for the Cas-Clover system and the CRISPR / Cas9-based system. The gRNA can be a fusion of two non-coding RNAs, namely crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by swapping the sequence encoding a 20 bp protospacer that confers targeting specificity through complementary base pairing with the desired DNA target. The gRNA mimics the naturally occurring crRNA:tracrRNA double helix involved in type II effector systems. This double helix may, for example, contain a 42-nucleotide crRNA and a 75-nucleotide tracrRNA, but acts as a guide for Cas9 to cleave the target nucleic acid.

[0125] Expression vectors and host cells This disclosure also relates to vectors containing the polynucleotides of this disclosure, host cells genetically engineered with recombinant vectors, and the production of at least one protein backbone by recombinant technology, as is well known in the art. See, for example, Sambrook, et al. and Ausubel, et al., respectively, which are fully incorporated herein by reference.

[0126] Polynucleotides can optionally be conjugated to vectors containing selectable markers for replication in a host. Generally, plasmid vectors are introduced in precipitates such as calcium phosphate precipitates or in complexes with charged lipids. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line and transduced into host cells.

[0127] The DNA insert must be operablely ligated to a suitable promoter. In some embodiments, the promoter is the EF-1α promoter. The expression construct further includes a transcription start site, a termination site, and a ribosome binding site for translation in the transcribed region. The coding portion of the mature transcript expressed by the construct preferably includes a transcription start codon at the start of the mRNA to be translated and a stop codon (e.g., UAA, UGA, or UAG) appropriately positioned at the end, with UAA and UAG preferred for expression in mammalian or eukaryotic cells.

[0128] The expression vector may contain at least one selectable marker. Such markers may include, but are not limited to, ampicillin, zeosin (Sh bla gene), puromycin (pac gene), hygromycin B (hygB gene), G418 / Geneticin (neo gene), DHFR (encoding Dihydrofolate Reductase and conferring resistance to Methotrexate), mycophenolic acid, or glutamine synthase (GS, U.S. Patent Nos. 5,122,464; 5,770,359; 5,827,739), blasticidine (bsd gene), resistance genes for eukaryotic cell culture, and ampicillin, zeosin (Sh Examples include the bla gene, puromycin (pac gene), hygromycin B (hygB gene), G418 / Geneticin (neo gene), kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, or tetracycline resistance genes (the above patents are fully incorporated herein by reference). Suitable culture media and conditions for the above host cells are known in the art. Suitable vectors will be readily apparent to those skilled in the art. Introduction of the vector construct into host cells can be carried out by calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other known methods. Such methods are described in the art, for example, in Sambrook, Chapters 1-4 and 16-18, and in Ausubel, Chapters 1, 9, 13, 15, and 16.

[0129] The expression vector may include at least one selectable cell surface marker for isolating cells modified by the compositions and methods of the present disclosure. The selectable cell surface markers of the present disclosure consist of surface proteins, glycoproteins, or groups of proteins that distinguish a cell or subset of cells from another defined subset of cells. Preferably, the selectable cell surface marker distinguishes cells modified by the compositions or methods of the present disclosure from cells that have not been modified by the compositions or methods of the present disclosure. Examples of such cell surface markers include, but are not limited to, “cluster designation” or “classification determinant” proteins (often abbreviated as “CD”) such as cleaved or full-length forms of CD19, CD271, CD34, CD22, CD20, CD33, CD52, or combinations thereof. An example of a cell surface marker is the suicide gene marker RQR8 (Philip B et al. Blood. 2014 Aug 21;124(8):1277-87).

[0130] The expression vector may include at least one selectable drug resistance marker for isolating cells modified by the compositions and methods of the present disclosure. The selectable drug resistance markers of the present disclosure may include wild-type or mutant Neo, DHFR, TYMS, FRANCF, RAD51C, GCS, MDR1, ALDH1, NKX2.2, or any combination thereof.

[0131] Those skilled in the art will be familiar with the numerous expression systems available for expressing the nucleic acids encoding the proteins of the Disclosure. Alternatively, the nucleic acids of the Disclosure can be expressed in host cells by being (operatedly) turned on in host cells containing endogenous DNA encoding the protein backbone of the Disclosure. Such methods are well known in the art, for example, as described in U.S. Patents No. 5,580,734, No. 5,641,670, No. 5,733,746 and No. 5,733,761, which are incorporated herein by reference in their entirety.

[0132] Examples of cell cultures useful for generating protein backbone, specific parts thereof, or variants are bacterial, yeast, and mammalian cells known in the art. Mammalian cell lines often exist in the form of a single layer of cells, but mammalian cell suspensions or bioreactors can also be used. Several suitable host cell lines capable of expressing intact glycosylated proteins have been developed in the art, including COS-1 (e.g., ATCC CRL 1650), COS-7 (e.g., ATCC CRL-1651), HEK293, BHK21 (e.g., ATCC CRL-10), CHO (e.g., ATCC CRL 1610), and BSC-1 (e.g., ATCC CRL-26) cell lines, Cos-7 cells, CHO cells, hep G2 cells, P3X63Ag8.653, SP2 / 0-Ag14, 293 cells, and HeLa cells, which are readily available, for example, from the American Type Culture Collection, Manassas, Va (www.atcc.org). Preferred host cells include lymphoid cells such as myeloma cells and lymphoma cells. Particularly preferred host cells are P3X63Ag8.653 cells (ATCC accession number CRL-1580) and SP2 / 0-Ag14 cells (ATCC accession number CRL-1851). In a preferred embodiment, the recombinant cells are P3X63Ab8.653 or SP2 / 0-Ag14 cells.

[0133] These cell expression vectors may contain one or more of the following expression regulatory sequences, for example, origins of replication, promoters (e.g., late or early SV40 promoter, CMV promoter (US Patent No. 5,168,062, 5,385,839), HSV tk promoter, pgk (phosphoglycerin kinase) promoter, EF-1 alpha promoter (US Patent No. 5,266,491), at least one human promoter, enhancers, and / or processing information sites, for example, ribosome binding sites, RNA splice sites, polyadenylation sites (e.g., SV40 large T Ag poly-A addition site), and transcription terminator sequences. See, for example, Ausubel et al. and Sambrook et al. Other cells useful for generating the nucleic acids or proteins of this disclosure are known and / or can be found, for example, in the American Type Culture Collection Catalogue of Cell Lines and It is available from Hybridoma (www.atcc.org) or other known or commercial sources.

[0134] When eukaryotic host cells are used, a polyadenylated sequence or transcriptional terminator sequence is typically incorporated into the vector. An example of a terminator sequence is a polyadenylated sequence derived from the bovine growth hormone gene. In some embodiments, the polyA sequence is the SV40 polyA sequence.

[0135] Sequences for precise splicing of the transcript can also be included. An example of a splicing sequence is the VP1 intron derived from SV40 (Sprague, et al., J. Virol. 45:773-781 (1983)). Furthermore, as is known in the art, gene sequences for controlling replication in host cells can be incorporated into the vector.

[0136] The plasmid constructs described herein may be used to deliver nucleic acids encoding transposase domains or fusion proteins described herein to cells.

[0137] The transposase domains and fusion proteins described herein may be delivered to cells using mRNA constructs. Accordingly, in one embodiment, mRNA sequences encoding the transposase domains or fusion proteins described herein are provided herein. Such mRNA sequences may be delivered to cells using nanoparticles, such as lipid nanoparticles. Examples of lipid nanoparticles are described, for example, in International Publications 2022 / 087148, 2022 / 182792, and 2023 / 141576 of the International Patent Application, each of which is incorporated herein by reference in whole, with respect to examples of lipid nanoparticles that may be used to deliver the fusion proteins or transposase domains encoding the mRNA constructs described herein.

[0138] Cells and modified cells The transposase-expressing polynucleotides described herein may be used in conjunction with transposons to modify cells. The transposon may be a piggyBac®(PB) transposon. In some embodiments where the transposon is a PB transposon, the transposase is a piggyBac®(PB) transposon, a piggyBac-like(PBL) transposon, or a Super piggyBac®(SPB) transposon. Non-limiting examples of PB transposons are described in detail in U.S. Patents 6,218,182; 6,962,810; 8,399,643 and PCT Publication No. International Publication No. 2010 / 099296, the contents of which are incorporated herein by reference in whole with respect to examples of transposases that may be delivered to cells using the polynucleotides described herein. The transposon may include nucleic acids encoding therapeutic proteins or therapeutic agents. Examples of therapeutic proteins are disclosed in PCT Publication Nos. 2019 / 173636 and 2020 / 051374, each of which is incorporated herein by reference in its entirety.

[0139] Accordingly, the Specified herein provides modified cells comprising one or more transposons and one or more transposases encoded by transposase-expressing polynucleotides or fusion proteins described herein. The cells and modified cells of this disclosure may be mammalian cells. Preferably, the cells and modified cells are human cells.

[0140] Cells modified using the transposase-expressing polynucleotides described herein may be germ cells or somatic cells. The cells and modified cells of this disclosure include immune cells, such as lymphoid progenitor cells, natural killer (NK) cells, T lymphocytes (T cells), and stem memory T cells (T SCM T cells), central memory T cells (T CMModified cells may be stem cells, stem cell-like T cells, B lymphocytes (B cells), antigen-presenting cells (APCs), cytokine-induced killer (CIK) cells, myeloid progenitor cells, neutrophils, basophils, eosinophils, monocytes, macrophages, platelets, erythrocytes, red blood cells (RBCs), megakaryocytes, or osteoclasts. Modified cells may be differentiated, undifferentiated, or immortalized. Modified undifferentiated cells may be stem cells. Modified undifferentiated cells may be induced pluripotent stem cells. Modified cells may be T cells, hematopoietic stem cells, natural killer cells, macrophages, dendritic cells, monocytes, megakaryocytes, or osteoclasts. Modified cells may be modified while quiescent, in an activated state, during quiescent, in intermediate phase, in prophase, in metaphase, in anaphase, or in telophase. Modified cells may be fresh cells, cryopreserved cells, bulk cells, cells classified into subpopulations, cells from whole blood, cells from leukocyte apheresis, or cells from immortalized cell lines. Detailed instructions for isolating cells from leukocyte apheresis products or blood are disclosed in PCT Publication No. International 2019 / 173636 and PCT / US2019 / 049816.

[0141] The method of the present disclosure can modify and / or produce a population of modified T cells in which at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% or any percentage between thereof of the multiple modified T cells in the population are stem memory T cells (T SCM ) or T SCMThe cells express one or more cell surface markers, and one or more of these cell surface markers include CD45RA and CD62L. The cell surface markers may include one or more of CD62L, CD45RA, CD28, CCR7, CD127, CD45RO, CD95, CD95, and IL-2Rβ. The cell surface markers may include one or more of CD45RA, CD95, IL-2Rβ, CCR7, and CD62L.

[0142] This disclosure provides a method for expressing a CAR on the surface of a cell. The method comprises (a) obtaining a cell population, (b) contacting the cell population with a composition containing a CAR or a sequence encoding a CAR under conditions sufficient to transfer the CAR across the cell membrane of at least one cell in the cell population, thereby generating a modified cell population, (c) culturing the modified cell population under conditions suitable for incorporating the sequence encoding a CAR, and (d) growing and / or selecting at least one cell from the modified cell population that expresses a CAR on its cell surface. A more detailed description of the method for expressing a CAR on the surface of a cell is disclosed in PCT Publication Nos. 2019 / 049816 and 2020 / 051374, each of which is incorporated herein by reference in whole.

[0143] This disclosure provides cells or a population of cells comprising a composition comprising (a) an inducible transgene construct comprising a sequence encoding an inducible promoter and a sequence encoding a transgene, and (b) a receptor construct comprising a sequence encoding a constitutive promoter and a sequence encoding an exogenous receptor such as a CAR, wherein when constructs (a) and (b) are incorporated into the genomic sequence of cells, the exogenous receptor is expressed, and when the exogenous receptor binds to a ligand or antigen, it transmits an intracellular signal that directly or indirectly targets an inducible promoter that modifies the expression of the inducible transgene (a), thereby modifying gene expression. In some embodiments, the CAR targets MUC1C.

[0144] This disclosure further provides compositions comprising modified, amplified, and selected cell populations of the methods described herein.

[0145] The modified cells of this disclosure (e.g., CAR T cells) may be further modified to enhance their therapeutic potential. Alternatively, or in addition to this, the modified cells may be further modified to reduce their sensitivity to immunological and / or metabolic checkpoints, for example, by blocking and / or diluting specific checkpoint signals that are naturally delivered to the cell within the tumor immunosuppressive microenvironment (e.g., checkpoint inhibition).

[0146] The modified cells of this disclosure (e.g., CAR T cells) may be further modified to silence or reduce the expression of (i) one or more genes encoding inhibitory checkpoint signaling receptors; (ii) one or more genes encoding intracellular proteins involved in checkpoint signaling; (iii) one or more genes encoding transcription factors that interfere with therapeutic efficacy; (iv) one or more genes encoding cell death or apoptosis receptors; (v) one or more genes encoding metabolic sensing proteins; (vi) one or more genes encoding proteins that confer sensitivity to cancer treatment, including monoclonal antibodies; and / or (vii) one or more genes encoding growth advantage factors. Non-exclusive examples of genes that can be modified to silence or reduce their expression or to suppress their function include, but are not limited to, exemplary inhibitory checkpoint signals, intracellular proteins, transcription factors, cell death or apoptosis receptors, metabolism-sensing proteins, proteins that confer sensitivity to cancer treatment, and growth advantage factors, which are disclosed in their entirety in PCT Publication No. 2019 / 173636, which is incorporated herein by reference.

[0147] The modified cells of this disclosure (e.g., CAR T cells) can be further modified to express modified / chimeric checkpoint receptors. Modified / chimeric checkpoint receptors may include null receptors, decoy receptors, or dominant-negative receptors. Exemplary null, decoy, or dominant-negative intracellular receptors / proteins include, but are not limited to, downstream signaling components of inhibitory checkpoint signals, transcription factors, cytokines or cytokine receptors, chemokines or chemokine receptors, cell death or apoptosis receptors / ligands, metabolic sensing molecules, proteins conferring sensitivity to cancer treatment, and oncogenes or tumor suppressor genes. Non-exclusive examples of cytokines, cytokine receptors, chemokines, and chemokine receptors are disclosed in PCT Publication No. 2019 / 173636, which is incorporated herein by reference in its entirety with respect to examples of receptors and proteins that may be expressed in the cells disclosed herein.

[0148] In some aspects of this disclosure, cells of this disclosure may be modified to reduce the expression of B2M. In some aspects of this disclosure, cells of this disclosure may be modified to reduce the expression of CD3. The expression of B2M and / or CD3 may be reduced by targeting these genes using gene editing compositions disclosed herein. For example, cells may be modified using one of the Cas-Clover enzymes disclosed herein together with gRNAs that target B2M and / or CD3.

[0149] Genome modification involves introducing nucleic acid sequences, transgenes, and / or genome editing constructs into cells ex vivo, in vivo, in vitro, or in situ to stably incorporate nucleic acid sequences, transiently incorporate nucleic acid sequences, produce site-directed integration of nucleic acid sequences, or produce biased integration of nucleic acid sequences. A nucleic acid sequence can be a transgene.

[0150] Stable chromosome integration can be random, site-specific, or biased.

[0151] Formulation, dosage, and method of administration This disclosure provides formulations, dosages, and methods of administration of compositions and cells described herein. In one embodiment, a pharmaceutical composition comprising a polynucleotide for expressing a transposase described herein and a pharmaceutically acceptable carrier is provided herein. In another embodiment, a pharmaceutical composition comprising a modified cell described herein and a pharmaceutically acceptable carrier is provided herein.

[0152] The disclosed compositions and pharmaceutical compositions may, but are not limited to, contain at least one of any suitable adjuvants, such as diluents, binders, stabilizers, buffers, salts, lipophilic solvents, preservatives, and adjuvants. Pharmaceutically acceptable adjuvants are preferred. Non-limited examples of such sterile solutions and methods for their preparation are well known in the art, for example, but are not limited to Gennaro, Ed., Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co. (Easton, Pa.) 1990 and “Physician's Desk Reference”, 52nd ed., Medical Economics (Montvale, NJ) 1998. Pharmaceutically acceptable carriers suitable for the administration method, solubility, and / or stability of protein backbone, fragment, or variant compositions can be typically selected, as are well known in the art or as described herein.

[0153] Non-limiting examples of pharmaceutical excipients and additives suitable for use include proteins, peptides, amino acids, lipids, and carbohydrates (e.g., monosaccharides, sugars including di-, tri-, tetra-, and oligosaccharides, derivatized sugars such as alditol, aldonic acid, and esterified sugars, and polysaccharides or sugar polymers), which can exist alone or in combination, and which together occupy 1 to 99.99% by weight or volume. Non-limiting examples of protein excipients include serum albumins such as human serum albumin (HSA) and recombinant human albumin (rHA), gelatin, and casein. Representative amino acid / protein components that can also function as buffers include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, and aspartame. One preferred amino acid is glycine.

[0154] Non-limiting examples of suitable carbohydrate excipients include monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, and sorbose; disaccharides such as lactose, sucrose, trehalose, and cellobiose; polysaccharides such as raffinose, meletitose, maltodextrin, dextran, and starch; and algitols such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), and myo-inositol. Preferably, the carbohydrate excipient is mannitol, trehalose, and / or raffinose.

[0155] This composition may also contain a buffer or pH adjuster, typically a buffer being a salt prepared from an organic acid or base. Typical buffers include organic acid salts such as citric acid, ascorbic acid, gluconic acid, carbonate, tartaric acid, succinic acid, acetic acid, and phthalic acid salts, as well as Tris, tromethamine hydrochloride, and phosphate buffer. Preferred buffers are organic acid salts such as citrate.

[0156] Furthermore, the disclosed compositions may include polymer excipients / additives, such as polyvinylpyrrolidone, Ficol (polymer sugar), dextrose (e.g., cyclodextrin, e.g., 2-hydroxypropyl-β-cyclodextrin), polyethylene glycol, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g., polysorbates, e.g., "TWEEN 20" and "TWEEN 80"), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol), and chelating agents (e.g., EDTA).

[0157] Many known and developed methods can be used to administer a therapeutically effective amount of the composition or pharmaceutical composition disclosed herein. Non-limiting examples of administration methods include bolus, buccal, injection, intra-articular, intra-bronchial, intraperitoneal, intrasacral, intracartilaginous, intracavitary, intracervical, intracervical, intracervical, intragastric, intrahepatic, intrafocal, intramuscular, intramyocardial, transnasal, intraocular, intraosseous, intrapelvic, intrapericardial, intraperitoneal, intrapleural, intrabladder, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal cord, synovial, intrathoracic, intrauterine, intratumoral, intravenous, intrabladder, oral, parenteral, rectal, sublingual, subcutaneous, percutaneous, or vaginal means. In preferred embodiments, the composition comprising the modified cells described herein is administered intravenously, for example, by intravenous infusion.

[0158] The compositions disclosed herein can be prepared for parenteral (subcutaneous, intramuscular, or intravenous) or any other administration, particularly in the form of liquid solutions or suspensions. For parenteral administration, the compositions disclosed herein may be formulated together with a pharmaceutically acceptable parenteral vehicle as a solution, suspension, emulsion, particles, powder, or lyophilized powder, or may be provided separately from the parenteral vehicle. Formulations for parenteral administration may contain, as common excipients, sterile water or saline, polyalkylene glycols such as polyethylene glycol, plant-derived oils, hydrogenated naphthalene, etc. Aqueous or oily suspensions for injection can be prepared according to known methods using appropriate emulsifiers or wetting agents and suspending agents. Drugs for injection or infusion may be non-toxic, orally unadministerable diluents such as aqueous solutions, sterile injection solutions, or suspensions in solvents. Usable vehicles or solvents include water, Ringer's solution, isotonic saline, etc., and sterile non-volatile oils can be used as common solvents or suspension solvents. For these purposes, any type of non-volatile oil and fatty acid may be used, including natural, synthetic, or semi-synthetic fatty oils or fatty acids; natural, synthetic, or semi-synthetic mono-, di-, or tri-glycerides. Parenteral administration is known in the art and is not limited to conventional injection methods, including gas-pressurized needle-free injection devices such as those described in U.S. Patent No. 5,851,198, and laser puncture devices such as those described in U.S. Patent No. 5,839,446.

[0159] It may be desirable to deliver the disclosed polynucleotide to the subject in a single dose over a long period, for example, from one week to one year. Various sustained-release, depot, and implant formulations can be used. For example, the dosage form may include pharmaceutically acceptable non-toxic salts of compounds with low solubility in body fluids, e.g., (a) acid addition salts with polybasic acids, e.g., phosphoric acid, sulfuric acid, citrate, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono or disulfonic acid, polygalacturonic acid, etc., (b) salts with polyvalent metal cations, e.g., zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc., or salts with organic cations formed from, for example, N,N'-dibenzyl ethylenediamine or ethylenediamine, or (c) a combination of (a) and (b), e.g., zinc tannate salt. Furthermore, the disclosed compounds or preferably relatively insoluble salts, such as those described above, can be formulated into gels suitable for injection, such as aluminum monostearate gel containing sesame oil. Particularly preferred salts include zinc salts, zinc tannate salts, pamoate salts, etc. Another type of sustained-release depot formulation for injection contains the compound or salt dispersed for encapsulation in a rapidly degrading, non-toxic, non-antigenic polymer, such as polylactic acid / polyglycolic acid polymer, as described, for example, in U.S. Patent No. 3,773,919. The compounds or preferably relatively insoluble salts, such as those described above, can also be formulated into cholesterol matrix silastic pellets, particularly for use in animals. Further sustained-release formulations, depot formulations, or implant formulations, such as gaseous or liquid liposomes, are known in the literature (U.S. Patent No. 5,770,222 and “Sustained and Controlled Release Drug Delivery Systems”, JR Robinson ed. Marcel Dekker, Inc., NY, 1978).

[0160] This disclosure provides the use of the disclosed compositions and pharmaceutical compositions for the treatment of diseases or disorders in cells, tissues, organs, animals, or subjects, as known in the Art or as described herein, for example, by administering or contacting cells, tissues, organs, animals, or subjects with a therapeutically effective amount of the composition or pharmaceutical composition. In positional embodiments, the subject is a mammal. Preferably, the subject is a human. The terms “subject” and “patient” are used interchangeably herein.

[0161] In some embodiments, treatment of a disease or disorder includes adoptive cell therapy. For example, in one embodiment, the disclosure provides modified cells expressing a chimeric antigen receptor (CAR). The modified cells may be allogeneic or autologous to the patient. In some preferred embodiments, the modified cells are allogeneic cells. In some embodiments, the modified cells are autologous T cells or modified autologous CAR T cells. In some preferred embodiments, the modified cells are allogeneic T cells or modified allogeneic CAR T cells.

[0162] In some embodiments, the disease or disorder treated according to the methods described herein is cancer. Non-limiting examples of cancer include leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphoblastic leukemia, B cell, T cell, or FAB Examples include ALL, acute myeloid leukemia (AML), acute myeloid leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, nasopharyngeal cancer, malignant histiocytosis, paraneoplastic syndromes / hypercalcemia of malignant tumors, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, cervical cancer, hereditary nonpolyposis cancer, Hodgkin lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, etc.

[0163] In another non-limiting example, the present disclosure provides a method for treating a metabolic hepatic disorder in a subject, comprising administering to the subject: a) at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide, and b) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some embodiments, the metabolic hepatic disorder may be ornithine transcarbamylase (OTC) deficiency, and the at least one therapeutic protein may comprise an ornithine transcarbamylase (OTC) polypeptide. In some embodiments, the metabolic hepatic disorder may be methylmalonic acidemia (MMA), and the at least one therapeutic protein may comprise a methylmalonyl-CoA mutase (MUT1) polypeptide.

[0164] In a non-limiting example, the present disclosure provides a method for treating a hemophilia in a subject, comprising administering to the subject at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide, and b) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some embodiments, the hemophilia may be hemophilia A, and the at least one therapeutic protein may comprise factor VIII. In some embodiments, the hemophilia may be hemophilia B, and the at least one therapeutic protein may comprise factor IX.

[0165] In a non-limiting example, the present disclosure provides a method for treating phenylketonuria (PKU) in a subject, comprising administering to the subject at least one therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a phenylalanine hydroxylase gene, and a) at least one therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase.

[0166] In non-limiting examples, the present disclosure provides a method for treating a disease or disorder in a subject by administering a therapeutically effective amount of an LNP composition to a subject in need of it, comprising a polynucleotide mRNA expressing a DNA transposon encoding a therapeutic protein and a transposase encoding the piggyBac transposase described herein. In some embodiments, the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder, or hemophilia.

[0167] In non-limiting examples, the present disclosure provides a method for treating a disease or disorder in a subject by administering a therapeutically effective amount of a first LNP composition comprising a DNA transposon encoding a therapeutic protein and a second LNP composition comprising polynucleotide mRNA expressing a transposase encoding piggyBac transposase to a subject in need thereof. In some embodiments, the disease or disorder is cancer, liver disease or disorder, urea cycle disorder, metabolic liver disorder, or hemophilia.

[0168] In a non-limiting example, the present disclosure provides a method of treating a disease or disorder in a subject by administering a therapeutically effective amount of a first LNP composition comprising a hyper-miniaturized ITR and a DNA transposon encoding a therapeutic protein, and a second LNP composition comprising an mRNA encoding a piggyBac transposase, to the subject that needs it. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder, or hemophilia. In some embodiments, the disease or disorder is an autoimmune disease. In one embodiment, the autoimmune disease is autoimmune neutropenia, Guillain–Barré syndrome, epilepsy, autoimmune encephalitis, Isaac's syndrome, phakomatosis pigmentovascularis, pemphigus vulgaris, pemphigus foliaceus, bullous pemphigoid, epidermolysis bullosa acquisita, pemphigoid gestationis, mucous membrane pemphigoid, antiphospholipid antibody syndrome, autoimmune anemia, myasthenia gravis, autoimmune Graves' disease, thyroid eye disease (TED), Goodpasture's syndrome, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, idiopathic thrombocytopenic purpura (ITP), warm autoimmune hemolytic anemia (WAIHA), chronic inflammatory demyelinating polyneuropathy (CIDP), lupus nephritis, or membranous nephropathy.

[0169] The dosage of the pharmaceutical composition administered to the subject can be varied according to known factors such as the pharmacodynamic properties of the particular agent, and its mode and route of administration, the age, health status, and weight of the recipient, the nature and extent of the symptoms, the type of concurrent treatment, the frequency of treatment, and the desired effect.

[0170] In an aspect where the composition administered to the subject that needs it is the modified cell disclosed herein, about 1×10 3 ~ about 1×10 4 cells, about 1×10 4 ~ about 1×10 5 cells, about 1×10 5 ~ about 1×10 6 cells, about 1×10 6 ~ about 1×10 7 cells, about 1×10 7 ~ about 1×10 8 cells, about 1×10 8~Approx. 1×10 9 A single cell, approximately 1 x 10⁻⁶ 9 ~Approx. 1×10 10 A single cell, approximately 1 x 10⁻⁶ 10 ~Approx. 1×10 11 A single cell, approximately 1 x 10⁻⁶ 11 ~Approx. 1×10 12 A single cell, approximately 1 x 10⁻⁶ 12 ~Approx. 1×10 13 A single cell, approximately 1 x 10⁻⁶ 13 ~Approx. 1×10 14 A single cell, approximately 1 x 10⁻⁶ 14 ~Approx. 1×10 15 A single cell, approximately 1 x 10⁻⁶ 15 ~Approx. 1×10 16 A single cell, approximately 1 x 10⁻⁶ 16 ~Approx. 1×10 17 A single cell, approximately 1 x 10⁻⁶ 17 ~Approx. 1×10 18 A single cell, approximately 1 x 10⁻⁶ 18 ~Approx. 1×10 19 A single cell, or approximately 1 × 10⁶ 19 ~Approx. 1×10 20 A number of cells may be administered. In some embodiments, the cells are approximately 5 × 10 6 ~Approx. 25×10 6 It is administered in cellular doses.

[0171] In other embodiments, the cell dosage may depend on the human body weight, for example, about 1 × 10⁻⁶ per kg of the subject's body weight. 3 ~Approx. 1×10 4 A single cell, approximately 1 x 10⁻⁶ 4 ~Approx. 1×10 5 A single cell, approximately 1 x 10⁻⁶ 5 ~Approx. 1×10 6 A single cell, approximately 1 x 10⁻⁶ 6 ~Approx. 1×10 7 A single cell, approximately 1 x 10⁻⁶ 7 ~Approx. 1×10 8 A single cell, approximately 1 x 10⁻⁶ 8 ~Approx. 1×10 9 A single cell, approximately 1 x 10⁻⁶ 9 ~Approx. 1×10 10 A single cell, approximately 1 x 10⁻⁶ 10 ~Approx. 1×10 11 A single cell, approximately 1 x 10⁻⁶ 11~Approx. 1×10 12 A single cell, approximately 1 x 10⁻⁶ 12 ~Approx. 1×10 13 A single cell, approximately 1 x 10⁻⁶ 13 ~Approx. 1×10 14 A single cell, approximately 1 x 10⁻⁶ 14 ~Approx. 1×10 15 A single cell, approximately 1 x 10⁻⁶ 15 ~Approx. 1×10 16 A single cell, approximately 1 x 10⁻⁶ 16 ~Approx. 1×10 17 A single cell, approximately 1 x 10⁻⁶ 17 ~Approx. 1×10 18 A single cell, approximately 1 x 10⁻⁶ 18 ~Approx. 1×10 19 A single cell, or approximately 1 × 10⁶ 19 ~Approx. 1×10 20 Individual cells may be administered.

[0172] A more detailed description of the disclosed compositions and pharmaceutically acceptable excipients, formulations, dosages, and methods of administration of the pharmaceutical compositions is disclosed in International Publication No. 2019 / 049816.

[0173] kit In another embodiment, a kit is provided herein comprising one or more compositions comprising a transposase-expressing polynucleotide and a DNA transposon described herein. In some embodiments, the one or more compositions comprising the transposase-expressing polynucleotide mRNA and the DNA transposon described herein are LNP compositions. In some embodiments, the one or more compositions comprise a first LNP composition comprising the transposase-expressing polynucleotide mRNA described herein and a second LNP composition comprising a DNA transposon.

[0174] definition As used throughout this disclosure, the singular forms "a," "an," and "the" include multiple references unless the context otherwise explicitly indicates otherwise. Thus, for example, a reference to "a method" includes multiple such methods, and a reference to "a dose" includes one or more doses and equivalents known to those skilled in the art.

[0175] The terms “about” or “approximately” mean that a particular value is within an acceptable margin of error, as determined by those skilled in the art, and this depends to some extent on the method by which the value is measured or determined, e.g., on the limitations of the measurement system. For example, “about” means within one or more standard deviations. Alternatively, “about” could mean a range of up to 20%, or up to 10%, or up to 5%, or up to 1% of a given value. Or, particularly with respect to biological systems or processes, the term could mean within one order of magnitude of the value, preferably up to five times, and more preferably up to two times. Where a particular value is described in this application and claims, unless otherwise specified, the term “about” should be assumed to mean within an acceptable margin of error of that particular value.

[0176] This disclosure provides isolated or substantially purified polynucleotide or protein compositions. “Isolated” or “purified” polynucleotides or proteins, or their biologically active portions, are substantially or essentially free from components that are typically associated with or interact with polynucleotides or proteins found in their naturally occurring environments. Therefore, isolated or purified polynucleotides or proteins, if produced by recombinant technology, are substantially free from other cell material or culture medium, and if chemically synthesized, are substantially free from chemical precursors or other chemicals. Optimally, “isolated” polynucleotides do not contain the sequences that naturally flank the polynucleotide in the genomic DNA of the organism from which they originate (i.e., sequences located at the 5' and 3' ends of the polynucleotide) (optimally, the protein-coding sequences). For example, in various embodiments, isolated polynucleotides may contain approximately 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb, or less than 0.1kb of the nucleotide sequences that naturally flank the polynucleotide in the genomic DNA of the cell from which they originate. Substantially cellular protein-free proteins include protein preparations having approximately 30%, 20%, 10%, 5%, or less than 1% (dry weight) of contaminating protein. When the proteins of this disclosure or their biologically active portions are recombinantly produced, the culture medium optimally contains approximately 30%, 20%, 10%, 5%, or less than 1% (dry weight) of chemical precursors or non-protein-of-interest chemicals.

[0177] This disclosure provides disclosed DNA sequence fragments and variants, as well as proteins encoded by these DNA sequences. Where used throughout this disclosure, the term “fragment” refers to a portion of a DNA sequence or a portion of an amino acid sequence, and therefore to the protein encoded thereby. A DNA sequence fragment consisting of a coding sequence may encode a protein fragment that retains the biological activity of the native protein and thus retains DNA recognition or binding activity to a target DNA sequence, as described herein. Alternatively, a DNA sequence fragment useful as a hybridization probe generally does not encode a protein that retains biological activity or promoter activity. Therefore, DNA sequence fragments may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length polynucleotides of this disclosure.

[0178] The nucleic acids or proteins of this disclosure may be constructed by a modular approach, which involves pre-assembling monomer units and / or repeating units in a target vector and then assembling them into a final target vector. The polypeptides of this disclosure may be constructed by a modular approach, which involves pre-assembling repeating units in a target vector that can be composed of repeating monomers of this disclosure and then assembled into a final target vector. This disclosure also provides polypeptides produced by this method, and nucleic acid sequences encoding these polypeptides. This disclosure provides host organisms and cells containing nucleic acid sequences encoding polypeptides produced by this modular approach.

[0179] The term “comprising” is intended to mean that a composition and method includes the elements described but does not exclude others. “Consisting essentially of,” when used to define a composition and method, means excluding other elements that are essentially important to the combination for the purposes described. Thus, a composition essentially consisting of the elements defined herein does not exclude trace amounts of contaminants or inert carriers. “Consisting of” means excluding other components and elements in amounts greater than trace amounts of substantial method steps. The embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0180] As used herein, “expression” refers to the process by which a polynucleotide is transcribed into mRNA, and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide is derived from genomic DNA, expression includes the splicing of mRNA in eukaryotic cells.

[0181] "Gene expression" is the process of converting the information contained in a gene into a gene product. A gene product can be a direct transcript of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, microRNA, structural RNA, or other types of RNA) or a protein produced by the translation of mRNA. Examples of gene products include RNA modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified by processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0182] The "regulation" or "control" of gene expression refers to a change in gene activity. Regulation of expression may include, but is not limited to, gene activation and gene repression.

[0183] The term "operatively linked" or its synonyms (e.g., "linked operatively") means that two or more molecules are positioned relative to each other so that they can interact in a way that influences the function of one or both of the molecules or a combination thereof. In relation to nucleic acids, a promoter may be operatively linked to a nucleotide sequence encoding a transposition domain or fusion protein as described herein, resulting in the expression of the nucleotide sequence under the control of the promoter.

[0184] Components linked by non-covalent bonds, and methods for producing and using non-covalently linked components are disclosed. Various components can take on a variety of different forms, as described herein. For example, non-covalently linked (i.e., operably linked) proteins can be used to enable transient interactions that circumvent one or more problems in the art. The ability of non-covalently linked components, such as proteins, to associate and dissociate allows for functional associations only under circumstances where such association is required for the desired activity, or primarily functional associations. The linkage only needs to last long enough to achieve the desired effect.

[0185] A method for inducing a protein to a specific gene locus in the genome of an organism is disclosed. This method may include a step of providing a DNA localization component and a step of providing an effector molecule, the DNA localization component and the effector molecule being operablely linked via non-covalent linkage.

[0186] A "target site" or "target sequence" is a nucleic acid sequence that defines the portion of the nucleic acid to which a binding molecule will bind, provided that sufficient conditions for binding are present.

[0187] The terms “nucleic acid,” “oligonucleotide,” or “polynucleotide” refer to at least two nucleotides linked by a covalent bond. A single-stranded description also defines the sequence of the complementary strand. Thus, a nucleic acid may encompass the complementary strand of a described single-stranded strand. The nucleic acids of this disclosure also encompass substantially identical nucleic acids and their complements that retain the same structure or encode the same protein.

[0188] The nucleic acids of this disclosure may be single-stranded or double-stranded. The nucleic acids of this disclosure may contain double-stranded sequences even if the majority of the molecule is single-stranded. The nucleic acids of this disclosure may contain single-stranded sequences even if the majority of the molecule is double-stranded. The nucleic acids of this disclosure may include genomic DNA, cDNA, RNA, or hybrids thereof. The nucleic acids of this disclosure may include combinations of deoxyribonucleotides and ribonucleotides. The nucleic acids of this disclosure may include combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. The nucleic acids of this disclosure may be synthesized to include non-natural amino acid modifications. The nucleic acids of this disclosure may be obtained by chemical synthesis or recombinant methods.

[0189] The nucleic acids disclosed may have their entire base sequence or any part thereof that does not exist in nature. The nucleic acids disclosed may contain one or more mutations, substitutions, deletions, or insertions that do not exist in nature, and the entire nucleic acid sequence may not exist in nature. The nucleic acids disclosed may contain one or more duplicate, reverse, or repeat sequences that do not exist in nature, and the entire nucleic acid sequence may not exist in nature. The nucleic acids disclosed may contain modified nucleotides, artificial nucleotides, or synthetic nucleotides that do not exist in nature, and the entire nucleic acid sequence may not exist in nature.

[0190] When the genetic code contains redundancy, multiple nucleotide sequences may encode a particular protein. All such nucleotide sequences are assumed herein.

[0191] As used throughout this disclosure, the term “promoter” refers to a synthetic or naturally occurring molecule that can confer, activate, or enhance the expression of nucleic acids within a cell. Promoters may include one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial and / or temporal expression. Promoters may also include distal enhancer or repressor elements located thousands of base pairs away from the transcription start site. Promoters may originate from viruses, bacteria, fungi, plants, insects, animals, etc. Promoters can constitutively or differentially regulate the expression of gene components with respect to cells, tissues or organs where expression occurs, or developmental stages where expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, EF-1 alpha promoter, CAG promoter, SV40 early promoter or SV40 late promoter, and CMV IE promoter.

[0192] As used throughout this disclosure, the term “vector” refers to a nucleic acid sequence containing an origin of replication. A vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. A vector may be either a DNA vector or an RNA vector. A vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid. A vector may consist of amino acids and a DNA sequence, an RNA sequence, or a combination of both DNA and RNA sequences.

[0193] Conservative substitutions of amino acids, i.e., substitution of an amino acid with a different amino acid having similar properties (e.g., hydrophilicity, degree and distribution of charged regions), are typically recognized in the art as involving only minor changes. These small changes can be partially identified by considering the hydrophobicity index of amino acids, as understood in the art. Kyte et al., J.Mol.Biol.157:105-132 (1982). The hydrophobicity index of an amino acid takes into account its hydrophobicity and charge. Substitution with amino acids having similar hydrophobicity indices can maintain the function of the protein. In some embodiments, amino acids with a hydrophobicity index of ±2 are substituted. The hydrophilicity of amino acids can also be used to identify substitutions that maintain the biological function of the protein. By considering the hydrophilicity of amino acids in the context of peptides, it is possible to calculate the maximum local mean hydrophilicity of the peptide, which is a useful indicator that has been reported to correlate well with antigenicity and immunogenicity. U.S. Patent No. 4,554,101 is fully incorporated herein by reference.

[0194] By substituting amino acids with similar hydrophilicity values, peptides with preserved biological activity, such as immunogenicity, can be obtained. Substitutions can be performed with amino acids whose hydrophilicity values ​​are within ±2 of each other. Both the hydrophobicity index and hydrophilicity value of an amino acid are influenced by its specific side chain. Consistent with this observation, it is understood that amino acid substitutions suitable for biological function depend on the relative similarity of the amino acids, particularly their side chains, as revealed by their hydrophobicity, hydrophilicity, charge, size, and other properties.

[0195] As used herein, “conservative” amino acid substitutions may be defined as shown in Tables 1, 2, and 3 below. In some embodiments, fusion polypeptides and / or nucleic acids encoding such fusion polypeptides include conservative substitutions introduced by modifying the polynucleotides encoding the polypeptides of this disclosure. Amino acids can be classified by their physical properties and their contribution to the secondary and tertiary structures of proteins. A conservative substitution is the replacement of one amino acid with another amino acid having similar properties. Exemplary conservative substitutions are shown in Table 1. [Table 1]

[0196] Alternatively, conserved amino acids can be classified as shown in Table 2, as described by Lehninger (Biochemistry, Second Edition; Worth Publishers, Inc. NY, NY (1975), pp. 71-77). [Table 2]

[0197] Alternatively, exemplary conservative substitutions are shown in Table 3. [Table 3]

[0198] The polypeptides and proteins of this disclosure may have sequences, or parts thereof, that do not exist in nature. The polypeptides and proteins of this disclosure may contain one or more mutations, substitutions, deletions, or insertions that do not exist in nature, and the entire amino acid sequence may not exist in nature. The polypeptides and proteins of this disclosure may contain one or more duplicate, reverse, or repeat sequences, and as a result, the sequence may not exist in nature, and the entire amino acid sequence may not exist in nature. The polypeptides and proteins of this disclosure may contain modified amino acids, artificial amino acids, or synthetic amino acids that do not exist in nature, and the entire amino acid sequence may not exist in nature.

[0199] As used throughout this disclosure, the identity between two sequences may be determined using a standalone executable BLAST engine program (bl2seq) for blasting two sequences, which can be obtained from the National Center for Biotechnology Information (NCBI) ftp site using default parameters (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250, which is incorporated herein by reference in its entirety). When used in the context of two or more nucleic acid or polypeptide sequences, the terms “identical” or “identity” refer to a specific percentage of the same residues across each particular region of the sequences. In some embodiments, sequence identity is determined across the entire length of the sequences. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over a given region, determining the number of positions where identical residues appear in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the given region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences have different lengths, or if alignment generates sequences with one or more ends shifted, and the specified comparison region contains only a single sequence, the residues of the single sequence are included in the denominator but not in the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or using computer sequencing algorithms such as BLAST or BLAST 2.0.

[0200] In certain embodiments, if a sequence has a specific sequence identity with a specific sequence number (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%), the sequence and the sequence number have the same length. In certain embodiments, if a sequence has a specific sequence identity with a specific sequence number (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%), the sequence and the sequence number differ only for the sake of conserved amino acid substitutions.

[0201] As used throughout this disclosure, the term “endogenous” refers to a nucleic acid or protein sequence that is naturally associated with the target gene or the host cell into which it is introduced.

[0202] As used throughout this disclosure, the term “exogenous” means a nucleic acid or protein sequence that is not naturally associated with the target gene or the host cell into which it is introduced, and includes unnatural multiple copies of naturally occurring nucleic acids, such as DNA sequences, or naturally occurring nucleic acid sequences at unnatural genomic locations.

[0203] This disclosure provides a method for introducing a polynucleotide construct containing a DNA sequence into a host cell. “Introducing” means presenting the polynucleotide construct to the cell in a manner that allows the polynucleotide construct to access the interior of the host cell. The method of this disclosure does not depend on a specific method for introducing the polynucleotide construct into a host cell, but only on the polynucleotide construct accessing the interior of a single host cell. Methods for introducing polynucleotide constructs into bacteria, plants, fungi, and animals are known in the art, but are not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0204] All documents cited herein, including cross-references or related patents or applications, are incorporated herein by reference in their entirety for all purposes unless expressly excluded or otherwise limited. The citation of any document does not constitute prior art relating to any invention disclosed or claimed herein, nor does it imply, suggest, or disclose any such invention, either alone or in combination with any other reference. Furthermore, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in any document incorporated by reference, the meaning or definition assigned to that term in this document shall prevail. [Examples]

[0205] The examples in this section are provided for illustrative purposes only and are not intended to limit the invention.

[0206] Example 1: Effect of a 3'UTR composition on in vitro expression and resective activity of PiggyBac transposase in hepatocytes The effect of 3'-UTR compositions on piggyBac transposase expression and excision activity was investigated by constructing and comparing polynucleotides encoding two piggyBac transposases containing different 3'-UTR sequences. The polynucleotide encoding the first piggyBac transposase contained the following in the 5'-to-3' direction: HBB 5'-UTR, NLS coding sequence; piggyBac transposase coding sequence containing four hyperactive mutations at amino acid I30V; G165S; M282V and N538K; HBB 3'-UTR and poly-A tail. A polynucleotide encoding a second piggyBac transposase, comprising the following in the 5'-3' direction: HBB 5'-UTR, NLS coding sequence, piggyBac transposase coding sequence with four hyperactive mutations at amino acid I30V; G165S; M282V and N538K, 3'-UTR containing a tandem CYBA 3'-UTR element joined by a linker sequence, and a poly A tail (Figure 3A).

[0207] The excision activity of polynucleotides encoding two transposases containing either HBB 3'-UTR or tandem CYBA element 3'-UTR was determined using an episomal excision reporter plasmid (Figure 2). Briefly, the episomal excision reporter plasmid contains an EF-1a promoter that controls GFP gene expression, followed by a polyA sequence. The GFP coding sequence is fragmented by the insertion of a minitransposon that interferes with the expression of functional GFP. If the transposase has excision activity, excision of the inserted minitransposon by the transposase restores the full-length GFP coding sequence, resulting in intracellular expression of GFP. A catalytically inactive piggyBac transposase lacking substantial transposase excision activity was used as a negative control. On day 0, 75,000 HepG2 cells were seeded in a 48-well plate. On day 1, 125 ng of mRNA encoding a transposase (e.g., HBB 3'-UTR or 2X-CYBA 3'-UTR) and 375 ng of transposon-interrupted GFP donor plasmid were delivered to each well of the 48-well plate, and the cells were co-transfected using Lipofectamine 3000 (Thermo Fisher) according to the manufacturer's instructions. GFP expression was monitored for 48 hours using Incucyte. The results are shown in Figure 3B.

[0208] As shown in Figure 3B, polynucleotides encoding piggyBac transposases, either HBB 3'-UTR or 2X CYBA3'-UTR, were able to express the encoded piggyBac transposase mRNA in cells and excavate the reporter minitransposon that caused the disruption. Excision of the minitransposon restored the full-length GFP gene, resulting in intracellular GFP expression. Polynucleotides encoding the transposase containing 2X CYBA3'-UTR showed approximately a twofold enhancement of GFP expression in the HepG2 hepatocyte cell line compared to polynucleotides encoding the transposase containing HBB 3'-UTR. Cells transfected with polynucleotides encoding a catalytically inactive piggyBac transposase-negative control showed little to no GFP expression.

[0209] Example 2: Effect of 3'UTR composition on PiggyBac transposase in vivo expression and resective activity in young mice In the second experiment, polynucleotides encoding transposases containing 2X CYBA3'-UTR resulted in elevated serum factor VIII (FVIII) levels in young mice compared to polynucleotides encoding transposases containing HBB 3'-UTR.

[0210] On day 1, young wild-type BALBc mice (N=4 / group) were administered a single 0.25 mg / kg dose by intravenous injection of an LNP composition (C12-D8-35% C12-200; 41.84% DOPE; 20% CHOL; and 3.16% DM-PEG) that encapsulates a DNA transposon containing nucleic acid encoding a modified factor VIII gene under the control of a liver-specific promoter, or a single 0.25 mg / kg dose of the factor VIII LNP composition and a 0.35 mg / kg dose of an LNP composition (C12-D15) that encapsulates an mRNA transposase encoding a polynucleotide containing HBB 3'-UTR or 2X CYBA 3'-UTR (or, as a negative control, an mRNA transposase encoding a polynucleotide containing nucleic acid encoding a catalytically inactive transposase). The animals were simultaneously administered 33.5% C12-200; 33.5% DOPE; 32% CHOL; and 1% DM-PEG. On day 6, serum factor VIII levels were determined from blood samples of treated and control animals using factor VIII ELISA. The results are shown in Figure 4.

[0211] As shown in Figure 4, polynucleotides encoding a transposase containing 2X CYBA3'-UTR resulted in a 42% increase in serum factor VIII levels in young mice compared to polynucleotides encoding a transposase containing HBB 3'-UTR.

[0212] Example 3: Effect of 3'-UTR composition on in vivo expression and resective activity of PiggyBac transposase in adult mice In related experiments, polynucleotides encoding transposases containing 2X CYBA3'-UTR resulted in elevated serum factor VIII (FVIII) levels in adult mice compared to polynucleotides encoding transposases containing HBB 3'-UTR.

[0213] On day 1, adult wild-type C57BL / 6 mice (N=4 / group) were administered either by intravenous injection of a single 0.25 mg / kg dose of an LNP composition (C12-D8-35%C12-200;41.84%DOPE;20%CHOL; and 3.16%DM-PEG) encapsulating a DNA transposon containing nucleic acid encoding a modified factor VIII gene under the control of a liver-specific promoter, or by co-administration of a single 0.25 mg / kg dose of a factor VIII LNP composition and a 0.5 mg / kg dose of an LNP composition (C12-D15-33.5%C12-200;33.5%DOPE;32%CHOL; and 1%DM-PEG) encapsulating a polynucleotide encoding an mRNA transposase containing HBB 3'-UTR or 2X CYBA3'-UTR. On day 6, serum factor VIII levels were determined using factor VIII ELISA on blood samples collected from treated and control animals. The results are shown in Figure 5.

[0214] As shown in Figure 5, the polynucleotide encoding the transposase containing 2X CYBA3'-UTR resulted in a 38% increase in serum factor VIII levels in adult mice compared to the polynucleotide encoding the transposase containing HBB3'-UTR.

[0215] Example 4: Effects of adding the miR-142-3p binding site to the 3'-UTR of PiggyBac transposase polynucleotide on in vitro expression and resection activity in hepatocytes The effects of adding the miR-142-3p binding site to the 3'-UTR on the in vitro expression of piggyBac transposase mRNA and its resective activity in hepatocytes were investigated using HepG2 cells.

[0216] In short, on day 0, 75,000 HepG2 cells were seeded in a 48-well plate. On day 1, 125 ng of mRNA encoding a transposase containing or lacking four miR-142-3p binding sites in the 3'-UTR, and 375 ng of the transposon-disrupted GFP donor plasmid described in Example 1 were delivered to each well of the 48-well plate, and the cells were co-transfected using Lipofectamine 3000 reagent (Thermo Fisher) according to the manufacturer's instructions. GFP expression was monitored for 40 hours using Incucyte. The results are shown in Figure 6.

[0217] As shown in Figure 6, the addition of four miR-142-3p binding sites separated by the linker sequence to the 3'-UTR on piggyBac transposase did not have an observable effect on the encoded transposase cleavage activity over 40 hours compared to the 3'-UTR lacking the four miR-142-3p binding sites.

[0218] Example 5: Addition of the miR-142-3p binding site to the 3'-UTR of GFP-encoding mRNA reduces GFP expression in hematopoietic cells. The effect of adding miR-142-3p binding sites to the 3'-UTR of GFP-encoding mRNA was investigated by constructing and comparing two DNA plasmids containing GFP-encoding mRNA genes, one containing four miR-142-3p binding sites within the 3'-UTR and the other lacking four. The first GFP-encoding mRNA contained miR-142-3p binding sites, while the second GFP-encoding mRNA lacked them.

[0219] On day 0, approximately 250,000 K562 cells were nucleofected using 20 μl of SF buffer and programmed FF-120. Each reaction contained 830 ng of GFP-encoding mRNA, either containing or lacking four miR-142-3p binding sites within the 3'-UTR. GFP expression from K562 cells transfected with each mRNA was monitored for 18 hours using Incucyte. The results are shown in Figure 7.

[0220] As shown in Figure 7, GFP expression in K562 cells transfected with GFP-encoding mRNA lacking four miR-142-3p binding sites was detectable approximately 4 hours post-nucleofection and increased to maximum expression levels approximately 16 hours post-transfection. In contrast, GFP expression in K562 cells transfected with GFP-encoding mRNA containing four miR-142-3p binding sites remained essentially undetectable throughout the 18-hour post-nucleofection monitoring period, resulting in 99% inhibition of GFP expression in hematopoietic cells.

[0221] Example 6: Addition of the miR-142-3p binding site to the 3'-UTR on the PiggyBac transposase polynucleotide reduces PiggyBac transposase expression and cleavage activity in hematopoietic cells. We analyzed the effects of adding the miR-142-3p binding site to the 3'-UTR of piggyBac transposase mRNA on in vitro expression and resectable activity in hematopoietic cells.

[0222] Two mRNAs encoding piggyBac transposases containing or lacking four miR-142-3p binding sites with 3-'UTRs were constructed, and the transposon excision activity of the encoded transposases was determined in K562 hematopoietic cells using the episome excision reporter plasmid system described in Figure 2.

[0223] On day 0, approximately 250,000 K562 cells were nucleofected using 20 μl of SF buffer and programmed FF-120. Each reactant contained 208 ng of piggyBac transposase encoding mRNA containing or lacking four miR-142-3p binding sites within the 3'-UTR, and 400 ng of transposon-disrupted GFP donor plasmid as described in Example 1. GFP expression from nucleofected K562 cells was monitored for 42 hours using Incucyte. The results are shown in Figure 8.

[0224] As shown in Figure 8, transposase-mediated GFP reporter expression in K562 cells transfected with mRNA encoding piggyBac transposase lacking four miR-142-3p binding sites was detectable approximately 12 hours post-transfection and increased linearly to a maximum expression level at the end of the 42-hour post-transfection period. In contrast, transposase-mediated GFP reporter expression in K562 cells nucleofected with mRNA encoding piggyBac transposase containing four miR-142-3p binding sites remained essentially undetectable until approximately 18 hours post-transfection monitoring and showed 79% inhibition of piggyBac transposase resective activity in hematopoietic cells at the end of the 42-hour monitoring period.

[0225] Example 7: Effects of a 3'-UTR composition on PiggyBac transposase in in vivo expression, excision activity, and T cell responsiveness in young mice The effect of adding a miR-142-3p binding site to the 3'-UTR of the piggyBac transposase-encoding mRNA was investigated in vivo by constructing two piggyBac transposase-encoding mRNAs and comparing them to HBB 3'-UTR or 2X CYBA 3'-UTR (shown in Figure 3A) that either contained or lacked four miR-142-3p binding sites in the 3'-UTR.

[0226] On day 1, young wild-type BALBc mice (N=4 / group) were administered a single 0.25 mg / kg dose by intravenous injection of an LNP composition (C12-D8-35%C12-200; 41.84%DOPE; 20%CHOL; and 3.16%DM-PEG) that encapsulates a DNA transposon containing nucleic acid encoding a modified factor VIII gene under the control of a liver-specific promoter, or a single 0.25 mg / kg dose of the factor VIII LNP composition and mRNA piggyBac transposase encoding a polynucleotide containing an HBB 3'-UTR with or without four miR-142-3p binding sites, or mRNA encoding a polynucleotide containing a 2X CYBA 3'-UTR with or without four miR-142-3p binding sites. A 0.35 mg / kg dose of an LNP composition (C12-D15-33.5%C12-200;33.5%DOPE;32%CHOL;and 1%DM-PEG) encapsulating piggyBac transposase (or a polynucleotide-encoding mRNA transposase containing a nucleic acid encoding a catalytically inactive transposase as a negative control) was administered concurrently. On day 6, serum factor VIII levels were determined from blood samples of untreated, treated, and control animals using factor VIII ELISA. The results are shown in Figure 9. As shown in Figure 9, the addition of four miR-142-3p binding sites to mRNA transposases encoding polynucleotides containing HBB 3-'UTR or 2X CYBA 3'-UTR did not affect serum factor VIII levels in young mice compared to mRNA transposases encoding polynucleotides lacking the four miR-142-3p binding sites.

[0227] In the second experiment, the effect of adding a miR-142-3p binding site to the 3'-UTR of the piggyBac transposase-encoding mRNA on the number of piggyBac transposase-responsive T cells was investigated in vivo by constructing the piggyBac transposase-encoding mRNA and comparing it with HBB 3'-UTR or 2X CYBA 3'-UTR (shown in Figure 3A) that contained or lacked four miR-142-3p binding sites in the 3'-UTR.

[0228] On day 1, young wild-type BALBc mice (N=4 / group) were administered a single 0.25 mg / kg dose by intravenous injection of an LNP composition (C12-D8-35%C12-200; 41.84%DOPE; 20%CHOL; and 3.16%DM-PEG) that encapsulates a DNA transposon containing nucleic acid encoding a modified factor VIII gene under the control of a liver-specific promoter, or a single 0.25 mg / kg dose of the factor VIII LNP composition and mRNA piggyBac transposase encoding a polynucleotide containing an HBB 3'-UTR with or without four miR-142-3p binding sites, or mRNA encoding a polynucleotide containing a 2X CYBA 3'-UTR with or without four miR-142-3p binding sites. A 0.35 mg / kg dose of an LNP composition (C12-D15-33.5%C12-200;33.5%DOPE;32%CHOL;and 1%DM-PEG) encapsulating piggyBac transposase (or a polynucleotide-encoding mRNA transposase containing a nucleic acid encoding a catalytically inactive transposase as a negative control) was administered concurrently.

[0229] On day 28, the treated and control mice were euthanized, their spleens were removed, and splenocytes were isolated. The number of piggyBac transposase-responsive T cells (IFNγ-positive T cells / 10e6 splenocytes) was counted from the treated and control animals using the ELISpot assay. The results are shown in Figure 10.

[0230] As shown in Figure 10, the addition of four miR-142-3p binding sites to mRNA transposases encoding polynucleotides containing HBB 3-'UTR or 2X CYBA 3'-UTR resulted in a reduction in the number of IFNγ-positive T cells in young mice compared to the corresponding mRNA transposases encoding polynucleotides lacking the four miR-142-3p binding sites.

[0231] Example 8: Effect of a 3'UTR composition on T cell reactivity after repeated administration of PiggyBac transposase polynucleotide in adult mice. The effect of adding a miR-142-3p binding site to the 3'-UTR of piggyBac transposase-encoding mRNA on the number of piggyBac transposase-responsive T cells after single or repeated doses was investigated in vivo by comparing the piggyBac transposase-encoding mRNA with 2X CYBA 3'-UTR (shown in Figure 3A) containing or lacking four miR-142-3p binding sites in its 3'-UTR.

[0232] On day 1, adult wild-type C57BL / 6 mice (N=5 / group) were given a single dose of 0.25 mg / kg of an LNP composition (C12-D8-35% C12-200; 41.84% DOPE; 20% CHOL; and 3.16% DM-PEG) encapsulating a DNA transposon containing nucleic acids encoding a modified factor VIII gene under the control of a liver-specific promoter, and a 0.5 mg / kg dose of an LNP composition (C12-D15-33.5%) encapsulating an mRNA piggyBac transposase encoding a polynucleotide containing HBB 3'-UTR; an mRNA piggyBac transposase encoding a polynucleotide containing tandem 2X CYBA 3'-UTR; or an mRNA piggyBac transposase encoding a polynucleotide containing 2X CYBA 3'-UTR and four miR-142-3p binding sites. C12-200 (33.5% DOPE; 32% CHOL; and 1% DM-PEG) were administered simultaneously by intravenous injection.

[0233] Furthermore, on day 1, a group of mice were simultaneously administered either a 0.25 mg / kg dose LNP composition encapsulating a DNA transposon containing nucleic acid encoding a modified factor VIII gene under the control of a liver-specific promoter, a 0.5 mg / kg dose LNP composition encapsulating an mRNA piggyBac transposase encoding a polynucleotide containing HBB 3'-UTR, or an mRNA piggyBac transposase encoding a polynucleotide containing tandem 2X CYBA 3'-UTR, or an mRNA piggyBac transposase encoding a polynucleotide containing 2X CYBA 3'-UTR and four miR-142-3p binding sites. On day 7, treated mice were again administered by simultaneously administering a 0.15 mg / kg dose of an LNP composition containing a DNA transposon and a 0.5 mg / kg dose of an LNP composition encapsulating a polynucleotide encoding the same mRNA piggyBac transposase. On day 14, treated mice were administered a third dose of the 0.5 mg / kg LNP composition encapsulating the same polynucleotide encoding the mRNA piggyBac transposase.

[0234] On day 21, the treated and control mice were euthanized, their spleens were removed, and splenocytes were isolated. The number of piggyBac transposase-responsive T cells (IFNγ-positive T cells / 10e6 splenocytes) was counted from the treated and control animals using the ELISpot assay. The results are shown in Figure 11.

[0235] As shown in Figure 11, by adding four miR-142-3p binding sites to a polynucleotide-encoding mRNA transposase, the number of IFNγ-positive T cells after repeated administration in adult mice was substantially reduced compared to repeated administration of a polynucleotide-encoding mRNA transposase lacking the four miR-142-3p binding sites.

[0236] Example 9: Effects of the number of hyperactive mutations and ITR composition on the integration and excision activities of the transposon of the PiggyBac transposase polynucleotide The integration and excision activities of the PiggyBac transposase encoded by a polynucleotide encoding the PiggyBac transposase containing four hyperactive mutations (I30V; G165S; M282V and N538K) or five hyperactive mutations (I30V; G165S; M226F, M282V and N538K) were determined using a transposon containing either wild-type left end (LE) and right end (RE) PiggyBac ITRs, or an LE PiggyBac ITR containing a wild-type RE PiggyBac ITR and a 35TCC mutation. The reporter systems used to test for integration or excision are shown in Figures 12 - 14. Figure 12 shows a schematic of the assay, and Figures 13 and 14 show the vector maps of the plasmids used.

[0237] In one example, K562 cells were nucleofected with a polynucleotide encoding a piggyBac transposase encoding four or five hyperactive mutations, and the cells were co-transfected with a dual excision / insertion luciferase reporter vector (Figure 14) containing wild-type piggyBac LE and RE ITRs or a LE piggyBac ITR containing wild-type RE piggyBac ITR and a 35TCC mutation. The vector was designed such that the open reading frame of the firefly luciferase was disrupted by the SPB transposon. Initially, the firefly luciferase is not expressed, but expression occurs by SPB-mediated excision and seamless repair of the transposon. The transposon itself expresses destabilized NanoLuc luciferase mRNA. Since the mRNA lacks a polyA tail and contains a 3’ destabilizing element, NanoLuc expression from the episomal vector is unstable. Integration of the transposon into genomic DNA causes the mRNA to acquire a polyA sequence and utilize a splice donor sequence on the transposon to splice out the destabilizing element, resulting in luciferase expression.

[0238] K562 cells were nucleofected using 20 μl of SF buffer and program FF-120. Each reaction contained 50 ng of the dual luciferase reporter and 500 ng of the transposase expression plasmid. One day after transfection, the luciferase signal was measured using Promega's dual luciferase reagent and a plate reader. The results are shown in Figure 15A.

[0239] As shown in Figure 15A, the addition of the fifth hyperactive M226F mutation to the piggyBac transposase sequence resulted in an approximately 50% enhancement of the integration activity of transposons containing wild-type ITRs, while both hyperactive mutant piggyBac transposases showed enhanced integration activity of transposons containing 35TCC LE ITRs. The addition of both the fifth hyperactive M226F mutation and 35TCC LE ITR resulted in a twofold enhancement of integration activity. The addition of the fifth hyperactive mutation to the piggyBac transposase sequence enhanced the cleavage activity of transposons containing either wild-type ITRs or 35TCC LE ITRs compared to only four hyperactive mutations, and both hyperactive transposases showed enhanced cleavage activity of transposons containing 35TCC LE ITRs, but no further enhancement of cleavage activity was observed in the transposase containing the M226F mutation.

[0240] In another example, 293T cells were transfected with a piggyBac transposase encoding a polynucleotide containing four or five hyperactive mutations, and the cells were co-transfected with a double excision / integrated H2Kk / GFP reporter vector (Figure 13) containing wild-type piggyBac LE and RE ITR or wild-type RE piggyBac ITR and LE piggyBac ITR containing the 35TCC mutation. The vector was designed so that the H2Kk open reading frame is interrupted by the SPB transposon. Initially, H2Kk is not expressed, but expression occurs by SPB-mediated excision and seamless repair of the transposon. H2Kk is a cell surface protein, and its expression can be detected on the cell surface using a fluorescent anti-H2Kk antibody. The transposon itself expresses destabilized GFP mRNA. GFP expression from the episomal vector is unstable because the mRNA lacks a poly-A tail and contains a 3' destabilizing element. The integration of transposons into genomic DNA allows mRNA to pick up poly(A) and splice the destabilizing element using a splice donor sequence on the transposon, resulting in GFP expression.

[0241] On day 0, 120,000 HEK293T cells were seeded in 24-well plates. On day 1, 10 ng of plasmid encoding a transposase (e.g., piggyBac transposase containing four or five hyperactive mutants) and 490 ng of a dual H2Kk / GFP reporter plasmid were delivered to specific wells of the 24-well plates, and the cells were transfected using JetPrime reagent (Polyplus) according to the manufacturer's instructions. On day 2, the transfected cells were passaged, the remaining cells were stained for H2Kk expression, and analyzed by flow cytometry to determine the percentage of H2Kk-positive cells. The cells were passaged again on day 5. On day 8, the cells were analyzed by flow cytometry to determine the percentage of GFP-positive cells. The results are shown in Figure 15B.

[0242] As shown in Figure 15B, the addition of the fifth hyperactive M226F mutation provided little to no benefit to embedded activity compared to the hyperactive transposase containing only four hyperactive mutations. However, the addition of the fifth hyperactive M226F mutation to the piggyBac transposase sequence resulted in an approximately 50% enhancement of cleavage activity against transposons containing wild-type ITRs, while both hyperactive mutant piggyBac transposases showed enhanced cleavage activity against transposons containing 35TCC LE ITRs. The addition of the fifth hyperactive M226F mutation and 35TCC LE ITR resulted in a 2.5-fold enhancement of cleavage activity.

[0243] Example 10: Improved PiggyBac transposase polynucleotide and 35TCC LE ITR-enhanced transposase integration and cleavage activity in young mice Using a double excision / integration luciferase reporter system, we tested the effects of wild-type ITRs and 35TCC LE ITRs on the transposase activity of piggyBac transposase, including five hyperactive mutations and a 3'-UTR containing either a tandem 2X CYBA 3'-UTR sequence and four miR-142-3p binding sites or four hyperactive mutations, as well as an HBB 3'-UTR from in vivo engineered transposon integration or excision. The reporter system contains an open reading frame of firefly luciferase fragmented by the piggyBac transposon. Initially, firefly luciferase is not expressed, but expression occurs upon transposase-mediated excision and seamless repair of the transposon. The transposon itself expresses destabilized NanoLuc luciferase mRNA. NanoLuc expression from the episomal vector is unstable because the mRNA lacks a polyA tail and contains a 3' destabilization element. The integration of transposons into genomic DNA allows mRNA to utilize the genomic polyA sequence and splice destabilizing elements using splice donor sequences on the transposon, resulting in luciferase expression.

[0244] On day 1, a single 0.25 mg / kg dose of an LNP composition (C12-D8-35%C12-200; 41.84%DOPE; 20%CHOL; and 3.16%DM-PEG) encapsulates a DNA double integration / excision reporter containing a transposon with wild-type LE ITR and RE ITR or a transposon with 35TCC LE ITR and wild-type RE ITR, along with a polynucleotide containing four hyperactive mutations and mRNA encoding HBB 3'-UTR, or a polynucleotide containing five hyperactive mutations and mRNA encoding tandem 2X CYBA 3'-UTR and 3'-UTR containing four miR-142-3p binding sites. A 0.5 mg / kg dose LNP composition (C12-D15-33.5%C12-200;33.5%DOPE;32%CHOL;and 1%DM-PEG) encapsulating piggyBac transposase was co-administered intravenously to juvenile wild-type BALBc mice (N=3 / group). As a negative control, an LNP composition containing mRNA encoding a catalytically inactive version of piggyBac transposase was administered as described above.

[0245] Luciferase activity was measured on days 1, 2, 3, 7, 14, and 21 in treated and control animals, and the total flux observed for each day and construct was measured, as shown in Figure 16. As shown in Figure 16, each piggyBac transposase polynucleotide was able to express the transposase and was able to incorporate and excise transposons containing wild-type ITRs or 35TCC LE ITRs in vivo in juvenile mice. However, a slight enhancement of in vivo incorporation activity was observed for five hyperactive mutants and for piggyBac transposases containing a tandem 2X CYBA 3'-UTR element and a 3'-UTR containing four miR-142-3p binding sites.

[0246] Example 11: Exemplary method for preparing 5'CleanCap PiggyBac transposase mRNA for use in LNP compositions This example provides an exemplary method for preparing 5'CleanCap mRNA encoding an SPB transposase containing a 5' hemagglutinin tag. This method may be used to prepare 5'CleanCap mRNA encoding an additional piggyBac transposase.

[0247] The DNA plasmid pRT-HA-SPB-CC-AG encodes a Super piggyBac transposase containing a 5'-hemagglutinin tag corresponding to amino acids 98-106 ("HA-SPB"). This plasmid was used as a template for an in vitro transcription reaction to produce mRNA encoding HA-SPB and further containing 5'-CAP.

[0248] In short, approximately 10 ug of supercoiled pRT-HA-SPB-CC-AG was added to a 1.5 ml Eppendorf tube containing 1X CutSmartBuffer and 200 units of restriction enzyme SpeI (New England Biolabs, catalog no. R3133l) in a total volume of 100 μl. To ensure complete digestion of the plasmid DNA, 37 o It became linear after incubation in C overnight.

[0249] Linear plasmids were purified by eluting the purified DNA with 40 μl of nuclease-free water using the DNA QIAquick PCR Purification Kit (Qiagen, catalog number 28104) according to the manufacturer's instructions. The DNA concentration of the eluate was determined using a NanoDrop micro-spectrophotometer (ThermoFisher) according to the manufacturer's instructions.

[0250] Using purified plasmids as DNA templates, mRNA was produced using the in vitro transcription mMESSAGE mMACHINE T7 Transcription Kit (ThermoFisher, catalog number AM1344) according to the manufacturer's instructions. Briefly, 100 mM stocks of nucleotides GTP, ATP, CTP, and UTP were prepared, and 15 μl (final 2x) of each stock was transferred to Eppendorf tubes containing 12 μl (2x) of CleanCap® Reagent AG ((m7G(5')ppp(5')(2'OMeA)pG, TriLink, catalog number N-7113) in a total volume of 100 μl.

[0251] Add approximately 1.67 μg of linear pRT-HA-SPB-CC-AG DNA, 20 μl of 10X T7 transcription buffer, and 20 μl of T7 RNA polymerase mix to a 1.5 ml Eppendorf tube (final volume 200 μl), and then fill the tube to 37 o The tubes were incubated in 1C for 3 hours. A 10 μl aliquot of TURBO DNase enzyme (ThermoFisher) was added, and the tubes were further incubated at 37°C for 15 minutes to degrade the DNA template.

[0252] Poly(A) tails were added to the 3' end of 5'-CleanCap®-HA-SPB mRNA using the Poly(A) Tailing Kit (ThermoFisher, catalog number 1350M). Briefly, digested DNA, mRNA solution (210 μl), 100 μl 25 mM ATP, 200 μl 5X-E-PAP buffer, 100 μl 25 mM MnCl2, 40 μl E. coli poly(A) polymerase ("E-PAP"), and 350 μl nuclease-free water (total volume 1 ml) were combined and the reaction was carried out for 37 minutes. o I ran the program for 1 hour using C.

[0253] 5'-CleanCap®-HA-SPB-poly(A)mRNA was purified using the RNeasy Midi Purification Kit (Qiagen, catalog number 75144) according to the manufacturer's instructions. Briefly, a fresh 3.5 ml solution of buffer RLT was prepared using 35 μl of 2-mercaptoethanol, combined with 2.5 ml of 100% ethanol, and the final mRNA product was eluted from the column using 300 μl of nuclease-free water. The average mRNA yield from this process was approximately 600–800 μg.

[0254] Example 12: Enhanced PiggyBac transposase polynucleotide and 35TCC RE ITR for increased transposition efficiency of gene-edited cells during CAR-T cell production. The effects of mRNA encoding four hyperactive forms of piggyBac transposase on in vitro production of CAR-T cells were tested. The results demonstrated a doubling of CAR-T cell production and improved yield of percent gene-edited T cells in the CAR-T population.

[0255] In short, pan T cells isolated from four separate donors were nucleofected with mRNA encoding SPBv3.0 or SPBv4.0. The T cells were co-nucleofected with a) sequences encoding genes for selectable markers of dihydrofolate reductase, including the wild-type LE piggyBac ITR and the RE piggyBac ITR containing the 35TCC mutation; anti-MUC1C CAR, the iCAS9 safety switch (which is further described in its entirety in International Patent Application Publication No. 2018 / 068022, incorporated herein); b) mRNA encoding Cas-CLOVER v3.0 (SEQ ID NO: 46); c) a pair of gRNAs targeting beta-2-microglobulin (B2M) and CD3, respectively, which knock out B2M and CD3; and d) mRNAs encoding booster molecules for proliferation of the transfected T cells. (Further details are provided in International Patent Application Publication No. 2020 / 051374, which is incorporated herein by reference in its entirety.)

[0256] Transfected T cells from four donors were grown using ImmunoCult CD3 / CD28 / CD2 T Cell Activator, selected for methotrexate resistance, and the yield and proliferation rate of activated T cells from each of the four donors were determined. CD3+ transfected CAR-T cells were removed by column chromatography using anti-CD3 beads, and the T cells were subjected to flow cytometry on days 5 and 14 to identify the T cell population: mean CAR fluorescence intensity (MFI; transposition efficiency [TPE]), B2M knockout percentage; CD3 knockout percentage and total yield of CD3-T cells after depletion. The results are shown in Figures 17A–17E.

[0257] As shown in Figures 17A–17E, mRNA encoding SPBv4.0 resulted in increased T cell proliferation, i.e., a 10-fold increase, in 3 out of 4 donors compared to SPBv3.0 (Figure 17A). While SPBv4.0 did not result in an improvement in overall transposition efficiency on day 5 compared to SPBv3.0 (Figure 17B), SPB4.0 resulted in a greater increase in the percentage of B2M knockout cells (Figure 17C) and CD3- knockout cells (Figure 17D), and increased the total number of CD3-CAR-T cells by approximately 3–4 times in 3 out of 4 donors (Figure 17E). This resulted in an increased yield of desired CAR-T cells with B2M and CD3 expression knocked out in final CAR-T isolation.

Claims

1. A polynucleotide comprising, in the 5' to 3' direction, (i) a hemoglobin beta (HBB) 5'-UTR, (ii) a sequence encoding a nuclear localization signal (NLS), (iii) a nucleic acid sequence encoding piggyBac transposase, (iv) one or more nucleic acid sequences containing a human cytochrome b-245 alpha polypeptide (CYBA) 3'-UTR element and one or more 3'-UTRs containing a miR-142-3p binding site, and (v) a poly A tail.

2. The polynucleotide according to claim 1, wherein the piggyBac transposase comprises the amino acid sequence shown in SEQ ID NO:

14.

3. The polynucleotide according to claim 1 or 2, wherein the nucleic acid sequence encoding the piggyBac transposase includes the nucleic acid sequence shown in Sequence ID No.

2.

4. The polynucleotide according to claim 1, wherein the NLS is an SV40 NLS containing the amino acid sequence shown in SEQ ID NO:

8.

5. The polynucleotide according to claim 1, wherein each of the one or more CYBA 3'-UTR elements comprises the nucleic acid sequence shown in Sequence ID No.

3.

6. The polynucleotide according to claim 5, wherein the 3'-UTR comprises at least two tandem nucleic acid sequences encoding CYBA 3'-UTR elements separated by a linker sequence.

7. The polynucleotide according to claim 6, wherein each of the tandem nucleic acid sequences encoding the CYBA 3'-UTR element includes the nucleic acid sequence shown in Sequence ID No.

4.

8. The polynucleotide according to claim 1, wherein each of the one or more miR-142-3p binding sites comprises the nucleic acid sequence shown in Sequence ID No.

5.

9. The polynucleotide according to claim 1, wherein each of the one or more miR-142-3p binding sites comprises the nucleic acid sequence ACACTAC.

10. The polynucleotide according to claim 9, wherein the 3'-UTR comprises four miR-142-3p binding sites.

11. The polynucleotide according to claim 10, further comprising a linker sequence located between each of the four miR-142-3p binding sites.

12. The polynucleotide according to claim 11, wherein the linker sequence includes the nucleic acid sequence shown in Sequence ID No.

6.

13. The polynucleotide according to claim 1, wherein the HBB 5'-UTR comprises the nucleic acid sequence shown in Sequence ID No.

1.

14. The polynucleotide according to claim 1, wherein the poly-A tail is an 80X poly-A tail containing the nucleic acid sequence shown in Sequence ID No.

7.

15. The polynucleotide according to claim 1, wherein the polynucleotide comprises the nucleic acid sequence shown in Sequence ID No.

10.

16. The polynucleotide according to any one of claims 1 to 15, wherein the polynucleotide is a DNA molecule.

17. The polynucleotide according to any one of claims 1 to 15, wherein the polynucleotide is an RNA molecule.

18. The polynucleotide according to claim 17, wherein the RNA molecule is an mRNA molecule.

19. The polynucleotide according to claim 18, wherein the mRNA comprises 5'-CAP.

20. The polynucleotide according to claim 19, wherein the 5'CAP is a 5'CleanCap.

21. A lipid nanoparticle (LNP) composition comprising the polynucleotide described in claim 16.

22. A lipid nanoparticle (LNP) composition comprising the polynucleotide described in claim 17.

23. A method for delivering exogenous nucleic acids to cells, The method involves introducing an exogenous nucleic acid-containing DNA transposon and mRNA into the cells, wherein the mRNA comprises, in the 5' to 3' direction, (i) an HBB 5'-UTR which is a nucleic acid sequence encoding NLS, (ii) a nucleic acid sequence encoding piggyBac transposase containing five hyperactive mutations, (iii) a 3'-UTR containing two or more tandem nucleic acid sequences including a CYBA 3'-UTR element and four miR-142-3p binding sites, and (iv) a poly A tail. A method comprising expressing the piggyBac transposase within the cell, incorporating the transposon containing the exogenous nucleic acid into the TTAA integration site in the cell genome, wherein the expressed piggyBac transposase exhibits enhanced integration and / or excision activity compared to piggyBac transposase containing four or fewer hyperactive mutations.

24. A method for in vivo delivery of exogenous nucleic acids to cells in a target, comprising simultaneously introducing into the target a DNA transposon containing exogenous nucleic acids and mRNA, the mRNA comprising, in the 5' to 3' direction, an HBB 5'-UTR, an NLS coding sequence, a piggyBac transposase coding sequence containing five hyperactive mutations, a 3'-UTR containing tandem CYBA 3'-UTR elements upstream of the sequence to four miR-142-3p binding sites, and a poly A tail. A method comprising the following steps: the cells in the subject take up the transposon, express the piggyBac transposase in the cells, incorporate the transposon containing the exogenous nucleic acid into the TTAA integration site in the cell genome of the subject, and the expressed piggyBac transposase exhibits reduced immunogenicity in the subject compared to mRNA encoding piggyBac transposase lacking sequences for four miR-142-3p binding sites.