Compositions and methods for treating CAG repeat disease

Abstract

This disclosure provides a double-stranded RNA (dsRNA) comprising a) a first strand that hybridizes with a target CAG repeat region of CAG repeat RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand comprises i) a first mismatch to the target CAG repeat region, and ii) at least a second mismatch to the target CAG repeat region. This disclosure provides recombinant nucleic acids comprising a) the dsRNA of this disclosure and b) a microRNA scaffold, and this disclosure also provides recombinant expression vectors comprising a nucleotide sequence encoding such recombinant nucleic acids. This disclosure provides viral and nonviral delivery media comprising the recombinant expression vector of this disclosure, and pharmaceutical compositions comprising such delivery media. This disclosure provides a method for selectively reducing the translation of disease-related CAG repeat-containing RNA. TIFF2026515707000003.tif130128

Description

[Technical Field]

[0001] cross reference This application claims the interests of U.S. Provisional Patent Application No. 63 / 457,297, filed on April 5, 2023, which is incorporated herein by reference in its entirety.

[0002] Referencing an XML array list The sequence list was created on April 1, 2024, and is provided herein as a sequence list XML file, "IRIS-002WO_SEQ_LIST.XML," with a size of 3,204,864 bytes. The entire contents of the sequence list XML are incorporated herein by reference. [Background technology]

[0003] Introduction Repeat elongation disorders are genetic disorders caused by the elongation of DNA repeats. DNA repeats can consist of a single nucleotide or more in dodecamers or more. The threshold at which repeat elongation becomes symptomatic varies depending on the specific disorder. There are more than 50 different disorders caused by repeat elongation. Repeat elongation can occur in the coding or non-coding regions of a gene. Repeat elongation can lead to defects in proteins encoded by the gene, alter the regulation of gene expression, generate toxic RNA, or destabilize chromosomes.

[0004] Inhibiting the expression of both mutant and wild-type genes containing repeats can lead to serious side effects. Therefore, suppression of mutant repeat elongation alleles is a desirable therapeutic strategy for repeat elongation disorders. Current strategies for mutant allele-specific inhibition include targeting disease-related single nucleotide polymorphisms (SNPs) or deletions with antisense oligonucleotides or RNA interferants. However, identifying SNPs associated with repeat elongation mutations requires detailed population-specific genetic studies in large clinical cohorts. Furthermore, depending on the frequency of the target SNP or its position on the mutant repeat elongation allele, specific affected individuals or populations may be excluded. [Overview of the project]

[0005] This disclosure provides a double-stranded RNA comprising a) a first strand that hybridizes with a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand comprises i) a first mismatch to the target CAG repeat region, and ii) at least a second mismatch to the target CAG repeat region. This disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, wherein the nucleotide sequence is operably ligated to a promoter that is functional in eukaryotic cells. This disclosure provides a recombinant nucleic acid comprising a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold. This disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such recombinant nucleic acid. This disclosure provides a DNA molecule having a nucleotide sequence encoding a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold. This disclosure also provides a recombinant expression vector comprising such a DNA molecule. This disclosure provides viral and nonviral delivery media comprising recombinant expression vectors of this disclosure, and pharmaceutical compositions comprising such delivery media. This disclosure provides a method for selectively reducing the translation of disease-related CAG repeat-containing RNA. [Brief explanation of the drawing]

[0006] [Figure 1] This shows the design of a miRNA miR33 scaffold for artificial miRNA expression. A shows the structure and sequence elements of the miR33 miRNA. B shows a generalized miR33 scaffold for miRNA cloning and expression. "N" indicates a nucleotide that needs to be substituted to target the mRNA of interest. "Z" indicates a nucleotide that needs to be substituted to maintain the double-stranded stem portion of the miRNA. The secondary structure of the stem region depends on nucleotide complementarity between the guide sequence and the 3' stem sequence. C shows the miR33 miRNA structure of a CAG-targeted sbRNA. "X" indicates nucleotides at positions 17-21 that may mismatch from the mRNA target sequence. [Figure 2] This shows the design of a miRNA miR451 scaffold for artificial miRNA expression. A shows the structure and sequence elements of the miR451 miRNA (SEQ ID NO: 65). B shows a generalized miR451 scaffold for miRNA cloning and expression (SEQ ID NO: 66). "N" indicates a nucleotide that needs to be substituted to target the target mRNA. "Z" indicates a nucleotide that needs to be substituted to maintain the double-stranded stem portion of the miRNA. The secondary structure of the stem region depends on nucleotide complementarity between the guide sequence and the 3' stem sequence. C shows the miR451 miRNA structure of a CAG-targeted sbRNA. "X" indicates nucleotides at positions 17-21 that may mismatch from the mRNA target sequence. [Figure 3] This shows the design of a small molecule binding RNA (sbRNA) guide sequence. Mismatch positions 8-11 and 17-21 within the guide sequence are indicated. [Figure 4] The mismatch positions 8-11 and 17-21 of the sbRNA guide sequence in different registers are shown. [Figure 5] This is a schematic diagram of a guide sequence screening system. [Figure 6-1] Table 1 is provided. Table 1 shows the mismatch (mm) locations, i.e., the locations of mismatches between the sbRNA and the target CAG repeat region. [Figure 6-2]Please refer to the explanation in Figure 6-1. [Figure 7] This provides an example of the nucleotide sequence of the first strand of a double-stranded RNA (dsRNA) having two mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 8A] This provides an example of the nucleotide sequence of the first strand of a dsRNA having three mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 8B] This provides an example of the nucleotide sequence of the first strand of a dsRNA having three mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 8C] This provides an example of the nucleotide sequence of the first strand of a dsRNA having three mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9A] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9B] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9C] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9D] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9E] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9F] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9G]This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9H] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9I] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9J] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9K] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 9L] This provides an example of the nucleotide sequence of the first strand of a dsRNA having four mismatches with respect to the target CAG repeat region of a CAG repeat-containing RNA. [Figure 10-01] Table 3 is provided. [Figure 10-02] Please refer to the explanation in Figure 10-01. [Figure 10-03] Please refer to the explanation in Figure 10-01. [Figure 10-04] Please refer to the explanation in Figure 10-01. [Figure 10-05] Please refer to the explanation in Figure 10-01. [Figure 10-06] Please refer to the explanation in Figure 10-01. [Figure 10-07] Please refer to the explanation in Figure 10-01. [Figure 10-08] Please refer to the explanation in Figure 10-01. [Figure 10-09] Please refer to the explanation in Figure 10-01. [Figure 10-10] Please refer to the explanation in Figure 10-01. [Figure 10-11] Please refer to the explanation in Figure 10-01. [Figure 10-12] Please refer to the explanation in Figure 10-01. [Figure 10-13] Please refer to the explanation in Figure 10-01. [Figure 10-14] Please refer to the explanation in Figure 10-01. [Figure 10-15] Please refer to the explanation in Figure 10-01. [Figure 10-16] Please refer to the explanation in Figure 10-01. [Figure 10-17] Please refer to the explanation in Figure 10-01. [Figure 11-01] Table 4 is provided. [Figure 11-02] Please refer to the explanation in Figure 11-01. [Figure 11-03] Please refer to the explanation in Figure 11-01. [Figure 11-04] Please refer to the explanation in Figure 11-01. [Figure 11-05] Please refer to the explanation in Figure 11-01. [Figure 11-06] Please refer to the explanation in Figure 11-01. [Figure 11-07] Please refer to the explanation in Figure 11-01. [Figure 11-08] Please refer to the explanation in Figure 11-01. [Figure 11-09] Please refer to the explanation in Figure 11-01. [Figure 11-10] Please refer to the explanation in Figure 11-01. [Figure 11-11] Please refer to the explanation in Figure 11-01. [Figure 11-12] Please refer to the explanation in Figure 11-01. [Figure 11-13] Please refer to the explanation in Figure 11-01. [Figure 11-14] Please refer to the explanation in Figure 11-01. [Figure 11-15] Please refer to the explanation in Figure 11-01. [Figure 11-16] Please refer to the explanation in Figure 11-01. [Figure 11-17] Please refer to the explanation in Figure 11-01. [Figure 11-18] Please refer to the explanation in Figure 11-01. [Figure 11-19] Please refer to the explanation in Figure 11-01. [Figure 11-20] Please refer to the explanation in Figure 11-01. [Figure 11-21] Please refer to the explanation in Figure 11-01. [Figure 11-22] Please refer to the explanation in Figure 11-01. [Figure 11-23] Please refer to the explanation in Figure 11-01. [Figure 12-01] Table 5 is provided. [Figure 12-02] Please refer to the explanation in Figure 12-01. [Figure 12-03] Please refer to the explanation in Figure 12-01. [Figure 12-04] Please refer to the explanation in Figure 12-01. [Figure 12-05] Please refer to the explanation in Figure 12-01. [Figure 12-06] Please refer to the explanation in Figure 12-01. [Figure 12-07] Please refer to the explanation in Figure 12-01. [Figure 12-08] Please refer to the explanation in Figure 12-01. [Figure 12-09] Please refer to the explanation in Figure 12-01. [Figure 12-10] Please refer to the explanation in Figure 12-01. [Figure 12-11] Please refer to the explanation in Figure 12-01. [Figure 12-12] Please refer to the explanation in Figure 12-01. [Figure 12-13] Please refer to the explanation in Figure 12-01. [Figure 12-14] Please refer to the explanation in Figure 12-01. [Figure 12-15] Please refer to the explanation in Figure 12-01. [Figure 12-16] Please refer to the explanation in Figure 12-01. [Figure 12-17] Please refer to the explanation in Figure 12-01. [Figure 12-18]Please refer to the explanation in Figure 12-01. [Figure 12-19] Please refer to the explanation in Figure 12-01. [Figure 12-20] Please refer to the explanation in Figure 12-01. [Figure 12-21] Please refer to the explanation in Figure 12-01. [Figure 12-22] Please refer to the explanation in Figure 12-01. [Figure 12-23] Please refer to the explanation in Figure 12-01. [Figure 12-24] Please refer to the explanation in Figure 12-01. [Figure 12-25] Please refer to the explanation in Figure 12-01. [Figure 12-26] Please refer to the explanation in Figure 12-01. [Figure 12-27] Please refer to the explanation in Figure 12-01. [Figure 13] It demonstrates guide sequence screening and allele selectivity. [Figure 14] The sbRNA sequences that exhibit the most significant mut HTT knockdown, mut HTT (CAG68) and wt HTT (CAG17), are shown to express these sequences.

[0007] definition As used herein, the terms “nucleic acid” or “polynucleotide” refer to any nucleic acid polymer composed of covalently linked nucleotide subunits, such as polydeoxyribonucleotides or polyribonucleotides. Examples of nucleic acids include RNA and DNA.

[0008] As used herein, the term “RNA” means a molecule comprising one or more ribonucleotides, including double-stranded RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, and modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. The nucleotides of an RNA molecule may include standard nucleotides or non-standard nucleotides (e.g., nucleotides that do not exist in nature or chemically synthesized nucleotides).

[0009] As used herein, “DNA” means a molecule comprising one or more deoxyribonucleotides, including double-stranded DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, and modified DNA that differs from naturally occurring DNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. The nucleotides of a DNA molecule may include standard nucleotides or non-standard nucleotides (e.g., nucleotides that do not exist in nature or chemically synthesized nucleotides).

[0010] As used herein, “nucleoside” means a compound comprising a nucleic acid base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (those found in DNA and RNA) and modified nucleosides. Nucleosides can be linked to a phosphate moiety.

[0011] As used herein, “nucleotide” means a nucleoside further comprising a phosphate linking group. As used herein, “linked nucleoside” may or may not be linked by phosphate bonds, and therefore includes, but is not limited to, “linked nucleotides.” As used herein, “linked nucleoside” is a nucleoside linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0012] As used herein, “nucleic acid base” or “base” means a group of atoms that can be linked with a sugar moiety to form a nucleoside that can be incorporated into an oligonucleotide, and whose atoms can bind to another oligonucleotide or a naturally occurring nucleic acid base that is complementary to the nucleic acid. Nucleic acid bases may be naturally occurring or may be modified.

[0013] As used herein, “oligonucleotide” means a compound comprising multiple linked nucleosides. In some cases, oligonucleotides may comprise one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0014] As used herein, “oligomer compound” means a polymer structure comprising two or more substructures. In certain embodiments, the oligomer compound comprises an oligonucleotide. In certain embodiments, the oligomer compound comprises one or more conjugated groups and / or terminal groups. In certain embodiments, the oligomer compound consists of an oligonucleotide. The oligomer compound also comprises naturally occurring nucleic acids.

[0015] As used herein, "single-chain" means an oligomeric compound that does not hybridize to its complement and lacks sufficient self-complementarity to form a stable self-double chain.

[0016] As used herein, “double-stranded” means an oligomeric compound that partially or completely hybridizes with its complement to form a stable double-stranded molecule. A double-stranded oligomeric compound may consist of two separate chains of complementary oligomeric compounds that hybridize with each other, or a single oligomeric compound that is sufficiently self-complementary to form a stable self-double-stranded compound. A stable self-double-stranded compound may include a stem-loop structure and / or a bulge.

[0017] "Isolated" refers to a substance isolated from its natural environment or artificially produced. As used herein with respect to cells, "isolated" refers to a cell isolated from its natural environment (e.g., from an object, organ, tissue, or body fluid). As used herein with respect to nucleic acids, "isolated" refers to a nucleic acid isolated from its natural environment, or purified (e.g., from a cell, organelle, or cytoplasm), recombinantly produced, amplified, or synthesized. In embodiments, isolated nucleic acids include nucleic acids contained within a vector.

[0018] As used herein, the terms “wild-type” or “non-mutant” gene form refer to nucleic acids encoding proteins that are associated with normal or non-pathogenic activity (e.g., proteins lacking mutations such as repeat region elongation that would result in a higher risk of developing, onset, or progression of neurodegenerative diseases).

[0019] As used herein, the term “mutation” refers to any change in the structure of a gene, such as in its sequence, resulting in an altered form of the gene that may or may not be inherited by subsequent generations (hereditary mutation). Gene mutations include substitutions, insertions, or deletions of single bases in DNA, or substitutions, insertions, deletions, or rearrangements of multiple bases or larger sections in a gene or chromosome, including repeat extensions.

[0020] As used herein, the term “inhibitory nucleic acid” refers to a nucleic acid comprising a guide strand sequence that hybridizes to at least a portion of a target nucleic acid, such as target RNA, mRNA, or pre-mRNA, and inhibits its expression or activity. Inhibitory nucleic acids may target protein-coding regions (e.g., exons) or non-coding regions (e.g., 5'UTR, 3'UTR, introns, etc.) of the target nucleic acid. In some cases, inhibitory nucleic acids are single-stranded or double-stranded molecules. Inhibitory nucleic acids may further include passenger strand sequences on separate strands (e.g., double-stranded) or within the same strand (e.g., single-stranded, self-annealing double-stranded structures). In some cases, inhibitory nucleic acids are RNA molecules such as siRNA, shRNA, pri-miRNA, pre-miRNA, or miRNA. In some cases, inhibitory nucleic acids are double-stranded RNAs (dsRNAs) such as pri-miRNA, pre-miRNA, miRNA, or shRNA.

[0021] As used herein, “microRNA” or “miRNA” refers to a small non-coding RNA molecule that can mediate the silencing of a target gene by cleaving, repressing, degrading, or a combination thereof of target mRNA. Typically, miRNAs are transcribed as a hairpin or stem-loop (e.g., having a self-complementary single-stranded skeleton) double structure called primary miRNA (pri-miRNA), which is enzymatically processed into pre-miRNA (e.g., by Drosha, DGCR8, Pasha, etc.). The pre-miRNA is transported to the cytoplasm, where it is enzymatically processed by Dicer to produce a miRNA double helix with a passenger strand, and then a single-stranded mature miRNA molecule, which is then loaded into the RNA-induced silencing complex (RISC). References to miRNA may include synthetic or artificial miRNAs.

[0022] As used herein, “synthetic miRNA,” “artificial miRNA,” “amiRNA,” or “small molecule binding RNA” (sbRNA) refers to endogenous, modified, or synthetic pri-miRNA or pre-miRNA (e.g., miRNA backbone or scaffold) in which the endogenous miRNA guide and passenger sequences within the stem sequence are replaced with heterologous guide and passenger sequences that direct highly efficient RNA silencing of the target gene (see, for example, Eamens et al. (2014), Methods Mol. Biol. 1062:211-224). In some cases, the complementary properties of the guide and passenger sequences (e.g., number of bases, mismatch locations, bulge type, etc.) may be similar to or different from the complementary properties of the guide and passenger sequences in the endogenous miRNA backbone on which the synthetic miRNA is constructed.

[0023] As used herein, the terms “microRNA backbone,” “miR backbone,” “microRNA scaffold,” or “miR scaffold” refer to a pri-miRNA or pre-miRNA scaffold in which the stem sequence is replaced with the heterologous RNA of interest, and which can produce a functional, mature miRNA that directs RNA silencing at the gene targeted by the miRNA of interest. In some cases, the miR backbone includes a 5' flanking region (also referred herein as a “5' flanking polynucleotide” or “5' leader”), a loop motif region (also referred herein as a “loop polynucleotide”), and a 3' flanking region (also referred herein as a “3' flanking polynucleotide” or “3' trailer”). In some cases, the miR backbone includes the 5' flanking region and the 3' flanking region (but not the loop motif region). The miR backbone may be entirely or partially derived from a wild-type miRNA scaffold, or it may be a completely artificial sequence.

[0024] As used herein, the term “short hairpin RNA” or “shRNA” includes conventional stem-loop shRNA that forms precursor miRNA (pre-miRNA). “shRNA” also includes microRNA-embedded shRNA (miRNA-based shRNA), in which the guide and passenger strands of a miRNA double helix are incorporated into an existing (or native) miRNA or a modified or synthetic (designed) miRNA. Upon transcription, conventional shRNA forms a structure very similar to primary miRNA (pri-miRNA) or native pri-miRNA. The pri-miRNA is then processed into pre-miRNA by Drosha and its cofactors. Thus, the term “shRNA” includes both pri-miRNA and pre-miRNA molecules.

[0025] A “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides known or predicted to form a double-stranded or self-double-stranded (stem portion) which is linked on one end primarily by a single-stranded nucleotide region (terminal loop portion). The terms “hairpin,” “self-double-stranded,” and “foldback” structure are also used herein to refer to stem-loop structures. Such structures are well known in the art, and the term is used in accordance with its well known meaning in the art. As is known in the art, the secondary structure does not require precise base pairing. Therefore, the stem may contain one or more base mismatches or bulges, or the base pairing may be precise, i.e., without any mismatches.

[0026] As used herein, the term “guide sequence” in the context of inhibitory nucleic acids refers to a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) to a region of approximately 10–50 nucleotides (e.g., approximately 15–30, 16–25, 18–23, or 19–22 nucleotides) of the mRNA or pre-mRNA targeted for silencing. The guide sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, for example, to induce disruption of the target mRNA by an RNAi apparatus or process, or to reduce the translation of the target mRNA. In some cases, the guide sequence refers to the mature guide sequence remaining after cleavage by Dicer.

[0027] As used herein, the term “passenger strand sequence” in the inhibitory nucleic acid refers to a sequence homologous to the target mRNA or pre-mRNA and partially or completely complementary to the guide strand sequence of the inhibitory nucleic acid. The guide strand sequence and passenger strand sequence of the inhibitory nucleic acid hybridize to form a double-stranded structure (e.g., the formation of a double-stranded or single-stranded self-annealing double-stranded structure). In some cases, the guide strand sequence and passenger strand sequence refer to the mature sequence remaining after cleavage by Dicer.

[0028] As used herein, the terms “5' arm” or “5' stem” refer to a portion of double-stranded RNA (e.g., shRNA, pre-miRNA, pri-mRNA) that includes a guide strand or passenger strand.

[0029] As used herein, the terms “3' arm” or “3' stem” refer to the passenger strand relative to the guide strand of the 5' stem, or the portion of double-stranded RNA that includes the guide strand relative to the passenger strand of the 5' stem.

[0030] As used herein, “double helix” refers, when used in relation to inhibitory nucleic acids, to two nucleic acid strands (e.g., a guide strand and a passenger strand) that hybridize with each other to form a double helix structure. A double helix may be formed by two separate nucleic acid strands or by a single nucleic acid strand having a self-complementary region (e.g., a hairpin or stem-loop).

[0031] As used herein, “target nucleic acid” means the nucleic acid molecule into which the antisense compound hybridizes. The target nucleic acid may be mRNA (target mRNA) or pre-mRNA (target pre-mRNA) encoded by the target gene.

[0032] As used herein, “targeted” or “targeted” means the association of an antisense compound with a specific target nucleic acid molecule or a specific region of a target nucleic acid molecule. A double-stranded RNA targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid and allows for hybridization under physiological conditions.

[0033] As used herein, the term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide subunits in antiparallel polynucleotide chains or single self-annealing polynucleotide chains. Complementary polynucleotide chains can form base pairs in a Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows for the formation of double helixes. In some cases, complementary nucleotides include G and U (fluctuating base pairs). As will be apparent to those skilled in the art, when using RNA as opposed to DNA, uracil rather than thymine is considered a base that is complementary to adenosine. Furthermore, where “U” is indicated in the context of this invention, its ability to substitute for “T” is understood unless otherwise stated. Complementarity also encompasses Watson-Crick base pairing between unmodified and modified nucleic acid bases (e.g., 5-methylcytosine instead of cytosine). Full complementarity, perfect complementarity, or 100% complementarity between two polynucleotide chains occurs when each nucleotide in one polynucleotide chain can form a hydrogen bond with a nucleotide unit in the second polynucleotide chain. Complementarity % refers to the number of nucleotides in a sequence of nucleotides complementary to an aligned reference sequence (e.g., target mRNA, passenger strand), divided by the total number of nucleotides and multiplied by 100. In such alignments, nucleic acid bases / nucleotides that do not form base pairs are called mismatches. Insertions and deletions are not considered when calculating the complementarity % of a sequence of nucleotides. It is understood by those skilled in the art that chemical modifications to nucleic acid bases are not considered in complementarity calculations, as long as the Watson-Crick base-pairing ability of the nucleic acid bases is preserved (for example, 5-methylcytosine is considered the same as cytosine for the purpose of calculating complementarity %).

[0034] As used herein, “non-complementary” with respect to nucleic acid bases means a pair of nucleic acid bases that do not form hydrogen bonds with each other.

[0035] As used herein, “mismatch” means a nucleic acid base of the first oligomer compound that cannot form a pair with the corresponding nucleic acid base of the second oligomer compound when the first and second oligomer compounds are aligned. Either or both of the first and second oligomer compounds may be oligonucleotides. Nucleotides that do not form base pairs include self-pairing nucleotides (AA, TT, UU, CC, and GG), A and C, C and U, C and T, and A and G. In some cases, mismatches do not include GU fluctuation base pairs.

[0036] The "identity percentage" between two or more nucleic acid sequences refers to the proportion of nucleotides in adjacent nucleotide sequences within a nucleic acid molecule that are shared by a reference sequence (i.e., identity % = number of identical nucleotides / total number of nucleotides in the aligned region (e.g., adjacent nucleotide sequence) × 100). Insertions and deletions are not permitted in the calculation of identity % between adjacent nucleotide sequences. It is understood by those skilled in the art that chemical modifications to nucleic acid bases are not considered in the identity calculation, as long as the Watson-Crick base-pairing ability of the nucleic acid bases is preserved (e.g., 5-methylcytosine is considered the same as cytosine for the purpose of calculating identity %).

[0037] As used herein, the term “hybridizing” or “hybridizing” refers to two nucleic acid strands that form a double helix by forming hydrogen bonds between base pairs on antiparallel strands. While not limited to a specific mechanism, the most common pair-forming mechanisms include hydrogen bonding, which may be Watson-Crick hydrogen bonds, Hougsteen hydrogen bonds, or inverse Hougsteen hydrogen bonds between complementary nucleic acid bases. The intensity of hybridization between two nucleic acid strands can be described by the melting temperature (Tm), defined as the temperature at which 50% of the target sequence hybridizes to a complementary polynucleotide at a given ionic strength and pH.

[0038] As used herein, “heterogeneous” refers to nucleic acids not found in natural (naturally occurring) nucleic acids. For example, with respect to components of microRNA (e.g., 5' flanking polynucleotides, loop polynucleotides, 3' flanking polynucleotides), heterogeneous guide sequences and heterogeneous passenger sequences include nucleotide sequences unrelated to natural microRNA. As used herein, a “guide sequence” is interchangeable with a “single strand” (or “targeting strand,” where the “targeting strand” hybridizes to the target RNA) of double-stranded RNA, regardless of orientation.

[0039] As used herein, “expression cassette” refers to any type of gene construct comprising nucleic acid (e.g., a transgene) in which part or all of the nucleic acid coding sequence can be transcribed. In some cases, expression involves, for example, the transcription of nucleic acid to produce a biologically active polypeptide product or inhibitory RNA (e.g., siRNA, shRNA, miRNA) from the transcribed gene. In some cases, the transgene is operably ligated to an expression regulatory sequence.

[0040] As used herein, the term “transgene” means an exogenous nucleic acid that is introduced into another cell, either naturally or by genetic engineering, and can be transcribed and optionally translated.

[0041] As used herein, the term “gene expression” refers to the process by which nucleic acids are transcribed from nucleic acid molecules and, in many cases, translated into peptides or proteins. The process may include transcription, post-transcriptional regulation, post-transcriptional modification, translation, post-translational regulation, post-translational modification, or any combination thereof. References to the measurement of “gene expression” may refer to the measurement of a transcript (e.g., RNA or mRNA) or a translation product (e.g., a peptide or protein).

[0042] As used herein, the term “inhibit gene expression” means to reduce, downregulate, repress, block, decrease, or stop gene expression. Gene expression products can be RNA molecules transcribed from a gene (e.g., mRNA) or polypeptides translated from mRNA transcribed from a gene. A decrease in mRNA levels results in a decrease in the levels of polypeptides translated therefrom. In some cases, inhibition of expression reduces the level of a polypeptide without substantially affecting the production of the mRNA encoding that polypeptide. Expression levels can be determined using standard techniques for measuring mRNA or protein.

[0043] As used herein, “vector” refers to a genetic construct (e.g., a transgene encoding an inhibitory nucleic acid) capable of transporting nucleic acid molecules between cells and, when operably ligated to a suitable regulatory sequence, capable of performing expression of the nucleic acid molecule. Regulatory sequences may include transcription start, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly-A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if necessary, sequences that promote the secretion of encoded products. Vectors may be plasmids, phage particles, transposons, cosmids, phagemids, chromosomes, artificial chromosomes, viruses, virions, lipid nanoparticles, etc. Once transformed into a suitable host cell, the vector may replicate and function independently of the host genome or, in some cases, be integrated into the genome itself.

[0044] As used herein, “host cell” refers to any cell containing, or potentially containing, the composition of interest, e.g., inhibitory nucleic acid. In some cases, the host cell is a mammalian cell, such as a rodent cell (e.g., mouse or rat) or a primate cell (e.g., monkey, chimpanzee, or human). In embodiments, the host cell may be in vitro or in vivo. In some cases, the host cell may be derived from an established cell line or primary cells. In some cases, the host cell may be obtained from a patient having, or suspected of having, a repeat elongation disease or disorder. In embodiments, the host cell is a non-CNS cell, such as a fibroblast. In some cases, the host cell is a CNS cell, such as a neuron, glial cell, astrocyte, or microglia.

[0045] As used herein, “elongation repeat-containing gene” or “elongation repeat-containing RNA” means a mutant gene or RNA molecule (e.g., pre-mRNA or mRNA) encoded by a mutant gene having a nucleotide sequence containing a repeat region (e.g., a CAG repeat), where the repeat region is elongated beyond a predetermined number or range of nucleotide repeats typically present in a “normal” elongation repeat-containing gene or RNA encoded by the gene. The presence or length of the repeat region may affect the normal processing, function, or activity of the RNA or encoded protein and may cause “repeat elongation” or “elongation repeat” disease or disorder. Elongation repeats can be unstable (dynamic) mutations whose size changes in successive generations. Elongation repeats may be dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, pentanucleotide repeats, hexanucleotide repeats, etc. In some cases, the repeat is a CAG repeat or a polyglutamine. Genes containing elongation repeats or RNA encoded by such genes are sometimes referred to as "pathological alleles" or "pathogenic alleles." In some cases, pathological or pathogenic alleles of CAG repeat-containing genes or RNA encoded by such genes have 30 or more consecutive CAG repeats.

[0046] "Repeat elongation disorder" or "elongation repeat disorder" refers to a disorder caused by the elongation of a base repeat sequence beyond a predetermined number or range of base repeats typically present in "normal" elongation repeat-containing genes or RNA encoded by a gene. Repeat elongation disorders can manifest as phenotypes that vary significantly depending on the size of the repeat elongation. Repeat elongation disorders are primarily neurodegenerative diseases. Some repeat elongation disorders are ophthalmic diseases. In some cases, repeat elongation disorders are polyglutamine disorders.

[0047] As used herein, “neurodegenerative disease” or “neurodegenerative disorder” refers to a disease or disorder that exhibits neuronal cell death as a pathological condition. Neurodegenerative diseases may exhibit chronic neurodegeneration, e.g., slow and progressive neuronal cell death over several years, or acute neurodegeneration, e.g., sudden onset or neuronal cell death. Examples of chronic neurodegenerative diseases include Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, spinocerebellar ataxia types 1-8 (SCA1-8), frontotemporal dementia (FTD), and amyotrophic lateral sclerosis (ALS). Neurodegenerative diseases may primarily involve the death of one or more types of neurons.

[0048] As used herein, “subject,” “patient,” and “individual” are interchangeable herein and refer to a living organism (e.g., a mammal) selected for treatment or therapy. Examples of subjects include humans and non-human mammals such as primates (monkeys, chimpanzees), cattle, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and their transgenic species.

[0049] Before further describing the present invention, it should be understood that the present invention is not limited to the specific embodiments described and, therefore, is subject to change. It should also be understood that the terminology used herein is merely for describing specific embodiments and is not intended to limit the scope of the present invention, as the scope is limited only by the appended claims.

[0050] Where a range of values ​​is provided, each value within that range is understood to be included in the scope of the invention, up to one-tenth of the lower limit unit, between the upper and lower limits of the stated range and any other stated or intermediate values, unless the context otherwise explicitly indicates otherwise. These upper and lower limits of smaller ranges may be independently included within the smaller range and are also included herein, subject to any specific exclusion limits within the stated range. Where a stated range includes one or both limits, ranges excluding either or both of those included limits are also included in the invention.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention belongs. Any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the present invention, but preferred methods and materials are described herein. All publications referenced herein are incorporated herein by reference to disclose and explain the methods and / or materials cited herein.

[0052] It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include multiple references unless otherwise explicitly indicated by the context. For example, a reference to “small molecule binding RNA (sbRNA)” includes multiple such sbRNAs, and a reference to “target nucleic acid” includes one or more target nucleic acids and their equivalents known to those skilled in the art. It should be further noted that claims may be constructed to exclude any element. Therefore, this statement is intended to act as a priori limitation for the use of exclusive terms such as “solely” or “only” in relation to the enumeration of elements of a claim or the use of “negative” limitations.

[0053] In the context describing this disclosure (in particular in the context of the following claims), the use of the terms “a,” “an,” and “the” and similar referents should be interpreted to encompass both singular and plural forms unless otherwise indicated herein or explicitly refuted by the context. The terms “comprising,” “having,” “including,” and “containing” should be interpreted as open terms (i.e., “including but not limited to”) unless otherwise indicated herein. The enumeration of ranges of values ​​herein is intended, unless otherwise indicated herein, simply as a shorthand method for referring individually to each distinct value that falls within the range, and each distinct value is incorporated herein as if it were individually enumerated herein. For example, if the range 10–15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein may be performed in any preferred order unless otherwise indicated herein or unless otherwise explicitly refuted by the context. Any and all examples or exemplary language provided herein (e.g., "etc.") are intended solely to better illustrate embodiments of the Disclosure and, unless otherwise requested, do not imply any limitation to the scope of the Disclosure.

[0054] Where used herein, the term “about” in relation to quantity indicates that the quantity may vary by up to 10% of the stated quantity. For example, “about 100” means the quantity between 90 and 110. When “about” is used in the context of a range, “about” used to refer to the lower quantity of a range means that the lower quantity includes an amount 10% lower than the lower quantity of the range, and “about” used to refer to the higher quantity of a range means that the higher quantity includes an amount 10% higher than the higher quantity of the range. For example, “about 100 to about 1000” means that the range extends from 90 to 1100.

[0055] As used herein, terms such as “and / or” and “A and / or B” are intended to include both A and B, A or B, A (alone), and B (alone). Similarly, as used herein, terms such as “and / or” and “A, B, and / or C” are intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0056] The aspects and embodiments of the disclosure described herein are understood to include the terms “including,” “consisting of,” and “essentially consisting of.”

[0057] For clarity, it is understood that certain features of the Invention described in the context of separate embodiments may be provided in combination in a single embodiment. Conversely, various features of the Invention described in the context of a single embodiment for the sake of brevity may be provided separately or in any preferred subcombinations. All combinations of embodiments relating to the Invention are specifically encompassed by the Invention and are disclosed herein as if every possible combination were individually and explicitly disclosed. In addition, all subcombinations of various embodiments and their elements are also specifically encompassed by the Invention and are disclosed herein as if every possible such subcombination were individually and explicitly disclosed herein.

[0058] The publications discussed herein are provided only for disclosures made prior to the filing date of this application. Nothing in this specification should be construed as acknowledging that the present invention is not entitled to precede such publications by prior art. Furthermore, the dates of the publications provided may differ from the actual publication dates and may need to be verified separately. [Modes for carrying out the invention]

[0059] Detailed explanation Repeat extension disorders are a major obstacle to selectively inhibiting disease alleles compared to normal alleles. This disclosure provides a double-stranded RNA that can achieve allele-selective inhibition of repeat-containing proteins by utilizing differences in repeat number. The double-stranded target RNA targets the repeat region of the repeat-containing target RNA (e.g., mRNA or pre-mRNA) and contains 2 to 5 mismatches (e.g., 2, 3, 4, or 5) relative to the repeat region in the target RNA. The mismatches enhance the double-stranded RNA's ability to selectively inhibit mutant protein expression compared to the wild type.

[0060] This disclosure provides a double-stranded RNA comprising a) a first strand that hybridizes with a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand comprises i) a first mismatch to the target CAG repeat region, and ii) at least a second mismatch to the target CAG repeat region. This disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, wherein the nucleotide sequence is operably ligated to a promoter that is functional in eukaryotic cells. This disclosure provides a recombinant nucleic acid comprising a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold. This disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such recombinant nucleic acid. This disclosure provides a DNA molecule having a nucleotide sequence encoding a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold. This disclosure also provides a recombinant expression vector comprising such a DNA molecule. This disclosure provides viral and nonviral delivery media comprising recombinant expression vectors of this disclosure, and pharmaceutical compositions comprising such delivery media. This disclosure provides a method for selectively reducing the translation of disease-related CAG repeat-containing RNA.

[0061] double stranded RNA This disclosure provides a double-stranded RNA (dsRNA) comprising a) a first strand that hybridizes with a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand comprises i) a first mismatch to the target CAG repeat region, and ii) at least a second mismatch to the target CAG repeat region. The dsRNA of this disclosure functions as an artificial microRNA for regulating the expression of a target RNA (e.g., mRNA or pre-mRNA) transcript. The double-stranded RNA comprises a precursor molecule that is processed in a cell before regulation. The double-stranded RNA may be encoded in a plasmid, vector, genome, or other nucleic acid expression vector for delivery to a cell.

[0062] In some cases, the dsRNA comprises, from 5' to 3', (a) a 5' leader sequence, (b) a 5' stem containing or substantially containing a passenger sequence or guide sequence, (c) a terminal loop, (d) a 3' stem containing or substantially containing a passenger sequence if (i) the 5' stem contains or substantially contains a passenger sequence, or (ii) a 3' stem containing or substantially containing a passenger sequence if the 5' stem contains or substantially contains a guide sequence, and (e) a 3' trailer sequence, wherein the guide sequence targets the CAG repeat region of CAG repeat-containing mRNA or pre-mRNA and contains 2-5 nucleotide mismatches to the CAG repeat region, with at least one of the 2-5 nucleotide mismatches being within nucleotides 8-11 of the guide sequence.

[0063] In some cases, the first strand of the dsRNA contains only two mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. In some cases, the first strand of the dsRNA contains only three mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. In some cases, the first strand of the dsRNA contains only four mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. In some cases, the second mismatch is located within nucleotides 17-21 of the guide sequence. In some cases, the second mismatch is located within nucleotides 9-16, and the third and fourth mismatches are located within nucleotides 17-21 of the guide sequence. In some cases, the second and third mismatches are located within nucleotides 9-16, and the fourth mismatch is located within nucleotides 17-21 of the guide sequence.

[0064] For numbering of mismatch locations, please refer to Figures 3 and 4, for example.

[0065] In some cases, double-stranded RNA refers to a single RNA oligonucleotide compound that has at least partial self-complementarity to form a stable self-double helix. Unless otherwise specified, nucleotide position numbering in double-stranded RNA is counted from 5' to 3' on single-stranded RNA. Similarly, unless otherwise specified, nucleotide sequences are read from 5' to 3' on single-stranded RNA.

[0066] The artificial double-stranded RNAs of this disclosure include a 5' leader, also called a 5' flanking sequence. The 5' leader sequence may be entirely or partially derived from or obtained from a wild-type microRNA sequence, or may be entirely or partially artificial. In some cases, the 5' leader sequence may be entirely or partially derived from or obtained from a flanking sequence of a wild-type pre-miRNA scaffold or pri-miRNA scaffold.

[0067] The 5' leader sequence contains a passenger sequence or a guide sequence, or is contiguously ligated to a 5' stem that substantially contains a passenger sequence or a guide sequence. The 5' leader sequence may be of any length. In some cases, the 5' leader sequence may be approximately 1 to 1,000 nucleotides, approximately 1 to 900 nucleotides, approximately 1 to 800 nucleotides, approximately 1 to 700 nucleotides, approximately 1 to 600 nucleotides, approximately 1 to 500 nucleotides, approximately 1 to 400 nucleotides, approximately 1 to 300 nucleotides, approximately 1 to 200 nucleotides, approximately 1 to 100 nucleotides, approximately 1 to 75 nucleotides, approximately 1 to 50 nucleotides, approximately 1 to 25 nucleotides, approximately 1 to 20 nucleotides, approximately 1 to 15 nucleotides, or approximately 1 to 10 nucleotides in length.

[0068] In some cases, the 5' leader contains a 5' bulge sequence. As used herein, the term “bulge sequence” refers to a region of nucleic acid that is non-complementary to the opposing nucleic acid in a double helix. For example, a double helix may contain a region of complementary nucleic acid, followed by a region of non-complementary nucleic acid, followed by a second region of complementary nucleic acid. The regions of complementary nucleic acid bind to each other, but the central non-complementary region does not, thereby forming a “bulge.” In some cases, the two strands of nucleic acid positioned between the two complementary regions may be of different lengths, thereby forming a “bulge.”

[0069] The artificial dsRNAs of this disclosure include a 3' trailer, also referred to as a 3' flanking sequence. The 3' trailer sequence may be entirely or partially derived from or obtained from a wild-type microRNA sequence, or may be entirely or partially artificial. In some cases, the 3' trailer sequence may be entirely or partially derived from or obtained from a flanking sequence of a wild-type pre-miRNA scaffold or pri-miRNA scaffold.

[0070] The 3' trailer sequence is adjoining and ligated to a 3' stem that contains or substantially contains a guide sequence or passenger sequence. The 3' trailer sequence may be of any length. In some cases, the 3' trailer sequence may be approximately 1 to 1,000 nucleotides, approximately 1 to 900 nucleotides, approximately 1 to 800 nucleotides, approximately 1 to 700 nucleotides, approximately 1 to 600 nucleotides, approximately 1 to 500 nucleotides, approximately 1 to 400 nucleotides, approximately 1 to 300 nucleotides, approximately 1 to 200 nucleotides, approximately 1 to 100 nucleotides, approximately 1 to 75 nucleotides, approximately 1 to 50 nucleotides, approximately 1 to 25 nucleotides, approximately 1 to 20 nucleotides, approximately 1 to 15 nucleotides, or approximately 1 to 10 nucleotides in length. In some cases, the 3' trailer contains a 3' bulge sequence.

[0071] In some cases, the 3' trailer contains a poly-U (polyuridine) tail. In some cases, the 3' trailer contains 3 to 6 uridines, e.g., 3 uridines, 4 uridines, 5 uridines, or 6 uridines. In some cases, the poly-U tail is immediately adjacent to the guide or passenger sequence in the 3' stem. In some cases, artificial double-stranded RNA having a 3' trailer containing a poly-U tail is expressed using a Pol III promoter.

[0072] In some cases, the 3' trailer contains a polyadenylation (pA) signaling sequence. Suitable polyadenylation signals include, but are not limited to, the SV40 late pA signal and the BGH pA signal. In some cases, artificial double-stranded RNA having a 3' trailer containing a pA signaling sequence is expressed using a Pol II promoter.

[0073] In some cases, the 5' leader sequence and the 3' trailer sequence have the same number of nucleotides. In other cases, the 5' leader sequence and the 3' trailer sequence have different lengths.

[0074] In some cases, the 5' leader sequence and 3' trailer sequence are obtained, or derived, entirely or partially, from the same miRNA scaffold, e.g., the same wild-type pre-miRNA scaffold or the same pri-miRNA scaffold. In some cases, both the 5' leader sequence and 3' trailer sequence are obtained, or derived, entirely or partially, from the miR-33 scaffold. In some cases, both the 5' leader sequence and 3' trailer sequence are obtained, or derived, entirely or partially, from the pri-miR-33 scaffold. In some cases, both the 5' leader sequence and 3' trailer sequence are obtained, or derived, entirely or partially, from the pre-miR-33 scaffold. In some cases, the 5' leader sequence and 3' trailer sequence are selected from those shown in Table 2.

[0075] In some cases, the 5' leader sequence is not complementary to the 3' trailer sequence. In some cases, the 5' leader sequence is partially complementary to the 3' trailer sequence. In some cases, the 5' leader sequence contains one, two, or more C mismatches (or CT mismatches for the DNA sequence encoding double-stranded RNA) for the uridine(s) in the poly-U tail of the 3' trailer sequence.

[0076] In some cases, the 5' leader and 3' trailer sequences contain sequences that enable recognition and cleavage by Drosha. The standard pathway of miRNA biosynthesis in mammals is initiated by the Drosha-DGCR8 (DiGeorge syndrome critical region gene 8) complex (microprocessor), which processes a long primary miRNA (pri-miRNA) into approximately 60 nt pre-miRNA, which is further processed by Dicer into a double helix approximately 22 nt long. In some cases, the primary miRNA sequence used as or as part of the 5' leader and / or 3' trailer sequence may direct Drosha cleavage of the double-stranded RNA. Guide: Methods for using precursor miRNA as a scaffold for the selective expression of passenger double helix are provided in U.S. Patent Publication 2008 / 0226553 and Liu et al. (2008) Nucleic Acids Res. 36:2811~24, each of which is incorporated in whole by reference.

[0077] In some cases, artificial double-stranded RNA is processed via a Drosha-independent / Dicer-dependent pathway. In some cases, splicing, 3'-5' exoribonuclease, or pol III termination may replace Drosha cleavage.

[0078] In some cases, artificial double-stranded RNA is processed via a Drosha-dependent / Dicer-independent pathway. An example of Drosha-dependent / Dicer-independent pathway processing is provided by pri-miR-451, which is processed by Drosha to produce pre-miR-451, then cleaved by Ago2 (Argonaut 2), ac-pre-mir-451, which is further excised by an unknown mechanism to produce mature miR-451. In some cases, the first 5' nucleotide in the guide sequence is replaced with U or A to facilitate binding by Argonaut.

[0079] In some cases, the 5' leader sequence and / or 3' trailer sequence contain or consist of the nucleotide sequences listed in Table 2. In some cases, the artificial double-stranded RNA contains a 5' leader sequence containing or consisting of CCGG, and a 3' trailer sequence containing or consisting of UUUUUG. In some cases, the artificial double-stranded RNA contains a 5' leader sequence containing or consisting of CC, and a 3' trailer sequence containing or consisting of UUUUUG. In some cases, the artificial double-stranded RNA contains a 5' leader sequence containing or consisting of GCUG, and a 3' trailer sequence containing or consisting of gauuuuug. In some cases, the artificial double-stranded RNA contains a 5' leader sequence containing or consisting of ugcacacaccuccuggcgggcagcucug (SEQ ID NO: 15), and a 3' trailer sequence containing or consisting of ggaggccugcccugacugcccacuuuuug (SEQ ID NO: 17). [Table 2]

[0080] In some cases, the 5' stem (or 5' arm) of the double-stranded RNA contains a passenger sequence, also called the sense sequence. The passenger sequence can be substantially identical to the target mRNA transcript. The passenger sequence may have 1, 2, 3, 4, or 5 mismatches with the target mRNA transcript. The passenger sequence may be approximately 15–30 nucleotides long, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some cases, the passenger sequence may be approximately 19–24 nucleotides long.

[0081] In some cases, the 3' stem (or 3' arm) of a double-stranded RNA contains a guide sequence, also known as the antisense sequence. The guide sequence is complementary to the target mRNA transcript. The guide strand can be approximately 15–30 nucleotides long, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some cases, the guide sequence can be approximately 19–24 nucleotides long.

[0082] In some cases, the 5' stem contains the guide sequence, while the 3' stem contains the passenger sequence of the double-stranded RNA.

[0083] The guide and passenger sequences are sufficiently complementary to form a double-stranded siRNA molecule during processing in the host cell, acting as a suitable substrate for the RNA interference apparatus, such that the guide sequence derived from the 3' stem (or 5' stem) is recognized by the RISC complex and targets its specific mRNA transcript. In some cases, the guide and passenger sequences have 100% complementarity. In other cases, the guide and passenger sequences are substantially complementary to each other, for example, about 70%, 75%, 80%, 85%, 90%, 95%, or 99% complementarity. In some cases, the passenger sequence may contain 1 to 10 or 1 to 5 base mismatches or bulges.

[0084] The guide sequence has complete or near-complete Watson-Crick complementarity with the target mRNA sequence and may include a seed sequence located at positions 1–7, 2–7, 1–8, or 2–8 relative to the first 5' nucleotide of the guide strand. The seed region is important for efficient gene silencing by double-stranded RNA.

[0085] The guide sequence targets the CAG repeat region of the CAG repeat-containing mRNA and contains 2 to 5 mismatches relative to the CAG repeat region, with the first base mismatch located within positions 8 to 11 of the guide sequence. Mismatches include self-pairing nucleotides (AA, UU, TT, CC, and GG), A and C pairing, C and U pairing, C and T pairing, T and G pairing, T and C pairing, and A and G pairing. In some cases, mismatches include purine mismatches, such as the introduction of an adenosine base into the guide strand.

[0086] In some cases, the first strand of the dsRNA contains only two mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. An example of the locations of the first and second mismatches, in which the first strand of the dsRNA contains only two mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA, is shown in Figure 6.

[0087] In some cases, the first strand of the dsRNA contains only three mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. Examples of the locations of the first, second, and third mismatches, in which the first strand of the dsRNA contains only three mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA, are shown in Figure 6.

[0088] In some cases, the first strand of the dsRNA contains only four mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA. Examples of the locations of the first, second, third, and fourth mismatches, in which the first strand of the dsRNA contains only four mismatches with respect to the target CAG repeat region of the CAG repeat-containing target RNA, are shown in Figure 6.

[0089] For numbering of mismatch locations, please refer to Figures 3 and 4, for example.

[0090] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand comprises i) a first mismatch to the target CAG repeat region, and ii) at least a second mismatch to the target CAG repeat region, and 1) the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG) If the second mismatch is at position 8 based on the numbering of (SEQ ID NO: 4), SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 5)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), then the second mismatch is 3' 9-13 bases to the first mismatch, and 2) the first mismatch is SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 4 (GC If the second mismatch is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUG (sequence number 4) or sequence number 5 (UGCUGCUGCUGCUGCUGCUGCUG (sequence number 5)), then the second mismatch is 8-12 bases 3' to the first mismatch, and 3) the first mismatch is at position 9 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG (sequence number 4)), or (UGCUGCUGCUGCUGCUGCUGCUG ( If the first mismatch is at position 10 based on the numbering of SEQ ID NO: 5), the second mismatch is 7–11 bases 3' to the first mismatch, and if the first mismatch is at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), the second mismatch is 6–10 bases 3' to the first mismatch. In some cases, the first strand contains no more than two mismatches with the target CAG repeat region.In some cases, the first chain contains no more than three mismatches with the target CAG repeat region. In some cases, the first chain contains no more than four mismatches with the target CAG repeat region. In some cases, the second chain is 100% complementary to the first chain. In some cases, the second chain contains 1 to 10 mismatches with respect to the first chain (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second chain contains 1 to 4 mismatches with respect to the first chain. In some cases, the second chain contains 1, 2, 3, or 4 or fewer mismatches with respect to the first chain. In some cases, the second chain contains 1 or fewer mismatches with respect to the first chain. In some cases, the second chain contains 2 or fewer mismatches with respect to the first chain. In some cases, the second chain contains 3 or fewer mismatches with respect to the first chain. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first strand of double-stranded RNA has a length of 18 to 25 nucleotides. In some cases, the second strand of double-stranded RNA has a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, double-stranded RNA can be 36 to 80 nucleotides long (for example, 36 to 40 nucleotides, 40 to 50 nucleotides, 50 to 60 nucleotides, 60 to 70 nucleotides, or 70 to 80 nucleotides).In some cases, the first strand of dsRNA contains one of the nucleotide sequences shown in Figures 7, 8A-8C, and 9A-9L (for example, each "T" may be replaced with a "U") and has a length of 21 nucleotides. In some cases, the first strand of dsRNA contains one of the nucleotide sequences of the "RNA guide strand sequences" shown in Figure 10 (Table 3). In some cases, the first strand of dsRNA contains one of the nucleotide sequences of the "miRNA guide" shown in Figure 12 (Table 5). In some cases, each mismatch is generated by substituting a nucleotide (for example, the nucleotide present in CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1), the nucleotide present in GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2), or the nucleotide present in UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)) with a different nucleotide. In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0091] As shown in Figures 3 and 4, and as described in Figure 6 (Table 1), the first mismatch is at position 8 and the second mismatch is within positions 17–21, with the second mismatch located 9–13 bases 3' to the first mismatch. If the first strand of dsRNA contains two, three, or four mismatches, the first mismatch is the furthest 5' mismatch.

[0092] First mismatch at position 8, two mismatches As shown in Figure 6 (Table 1), the dsRNA of this disclosure may, in some cases, include a first strand having two or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 8 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 17–21 (as shown in Figures 3 and 4).

[0093] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second mismatch to the target CAG repeat region, the second mismatch being 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generates a second mismatch and is located 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generates a second mismatch and is located 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), and the second substitution generates a second mismatch and is located 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches).In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0094] First mismatch at position 8, three mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having three or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 8 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 17–21, and the third mismatch is located within positions 17–21 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 9–16, and the third mismatch is located within positions 17–21.

[0095] In some cases, the double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and b) a second strand that hybridizes with the first strand, wherein the first strand includes a second and a third mismatch to the target CAG repeat region, the second and third mismatches being 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the second and third substitutions are located 9-13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence GCUGUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the second and third substitutions are located 9-13 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the second and third substitutions are 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0096] In some cases, the double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and b) a second strand that hybridizes with the first strand, wherein the first strand includes a second and a third mismatch to the target CAG repeat region, the second mismatch being 1 to 8 bases 3' to the first mismatch, and the third mismatch being 9 to 13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch, the third substitution generates a third mismatch, the second substitution is located 1–8 bases 3' to the first mismatch, and the third substitution is located 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence GCUGUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch, the third substitution generates a third mismatch, the second substitution is located 1–8 bases 3' to the first mismatch, and the third substitution is located 9–13 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch, the third substitution generates a third mismatch, the second substitution is 1–8 bases 3' to the first mismatch, and the third substitution is 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0097] First mismatch at position 8, four mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having four or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 8 (as shown in Figures 3 and 4). In some cases the second, third, and fourth mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second mismatch is located within positions 9–16 and the third and fourth mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 9–16 and the fourth mismatch is located within positions 17–21.

[0098] In some cases, the double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and b) a second strand that hybridizes with the first strand, wherein the first strand includes a second, third, and fourth mismatch to the target CAG repeat region, the second, third, and fourth mismatches being 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, with the second, third, and fourth substitutions located 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, with the second, third, and fourth substitutions located 9–13 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, with the second, third, and fourth substitutions located 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0099] In some cases, the double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and b) a second strand that hybridizes with the first strand, wherein the first strand includes a second, third, and fourth mismatch to the target CAG repeat region, the second and third mismatches being 1 to 8 bases 3' to the first mismatch, and the fourth mismatch being 9 to 13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, where the second and third substitutions are 1 to 8 bases 3' to the first mismatch, and the fourth substitution is 9 to 13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, where the second and third substitutions are 1 to 8 bases 3' to the first mismatch, and the fourth substitution is 9 to 13 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, where the second and third substitutions are 1–8 bases 3' to the first mismatch, and the fourth substitution is 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0100] In some cases, the double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and b) a second strand that hybridizes with the first strand, wherein the first strand includes a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1 to 8 bases 3' to the first mismatch, and the third and fourth mismatches being 9 to 13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch, the third substitution generates a third mismatch, the fourth substitution generates a fourth mismatch, the second substitution is 1–8 bases 3' to the first mismatch, and the third and fourth substitutions are 9–13 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch, the third substitution generates a third mismatch, the fourth substitution generates a fourth mismatch, the second substitution is 1–8 bases 3' to the first mismatch, and the third and fourth substitutions are 9–13 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch, the third substitution generates a third mismatch, and the fourth substitution generates a fourth mismatch, where the second substitution is 1–8 bases 3' to the first mismatch, and the third and fourth substitutions are 9–13 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0101] First mismatch at position 9, two mismatches As shown in Figure 6 (Table 1), the dsRNA of this disclosure may, in some cases, include a first strand having two or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 9 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 17–21 (as shown in Figures 3 and 4).

[0102] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second mismatch to the target CAG repeat region, the second mismatch being 8-12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), and the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches).In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0103] First mismatch at position 9, three mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having three or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 9 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second mismatch is located within positions 10–16 and the third mismatch is located within positions 17–21.

[0104] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second mismatch and a third mismatch to the target CAG repeat region, the second mismatch being 8–12 bases 3' to the first mismatch, and the third mismatch being 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is 8–12 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0105] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being located at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second and a third mismatch to the target CAG repeat region, the second mismatch being 1 to 7 bases 3' to the first mismatch, and the third mismatch being 8 to 12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is 1–7 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0106] First mismatch at position 9, four mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having four or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 9 (as shown in Figures 3 and 4). In some cases the second, third, and fourth mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 10–16, and the fourth mismatch is located within positions 17–21. In some cases the second mismatch is located within positions 10–16, and the third and fourth mismatches are located within positions 17–21.

[0107] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) a first mismatch to a target CAG repeat region, and the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or sequence number 4. ii) including a first mismatch located at position 9 based on the numbering of number 5 (UGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 8–12 bases 3' to the first mismatch, the third mismatch being 8–12 bases 3' to the first mismatch, and the fourth mismatch being 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3); the second substitution generates a second mismatch and is located 8–12 bases 3' to the first mismatch; the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch; and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0108] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, i) a first mismatch to a target CAG repeat region, wherein the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or ii) including a first mismatch located at position 9 based on the numbering of sequence number 5 (UGCUGCUGCUGCUGCUGCUGCUG (sequence number 5), and ii) a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–7 bases 3' to the first mismatch, the third mismatch being 1–7 bases 3' to the first mismatch, and the fourth mismatch being 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–7 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–7 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–7 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches with respect to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0109] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, i) a first mismatch to a target CAG repeat region, wherein the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or ii) including a first mismatch located at position 9 based on the numbering of sequence number 5 (UGCUGCUGCUGCUGCUGCUGCUG (sequence number 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–7 bases 3' to the first mismatch, the third mismatch being 8–12 bases 3' to the first mismatch, and the fourth mismatch being 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 1–7 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 8–12 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0110] First mismatch at position 10, two mismatches As shown in Figure 6 (Table 1), the dsRNA of this disclosure may, in some cases, include a first strand having two or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 10 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 17–21 (as shown in Figures 3 and 4).

[0111] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second mismatch to the target CAG repeat region, the second mismatch being 7-11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), and the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches).In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0112] First mismatch at position 10, three mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having three or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 10 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second mismatch is located within positions 11–16 and the third mismatch is located within positions 17–21.

[0113] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second and a third mismatch to the target CAG repeat region, the second mismatch being 7–11 nucleotides 3' to the first mismatch, and the third mismatch being 7–11 nucleotides 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA are each 24 nucleotides long. In some cases, the first and second strands of the double-stranded RNA are each 25 nucleotides long. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0114] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being located at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second and a third mismatch to the target CAG repeat region, the second mismatch being 1 to 6 bases 3' to the first mismatch, and the third mismatch being 7 to 11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is 1–6 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA are each 24 nucleotides long. In some cases, the first and second strands of the double-stranded RNA are each 25 nucleotides long. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0115] First mismatch at position 10, four mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having four or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 10 (as shown in Figures 3 and 4). In some cases the second, third, and fourth mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 11–16, and the fourth mismatch is located within positions 17–21. In some cases the second mismatch is located within positions 11–16, and the third and fourth mismatches are located within positions 17–21.

[0116] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) a first mismatch to a target CAG repeat region, and the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or sequence number 4. ii) including a first mismatch located at position 10 based on the numbering of number 5 (UGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 7–11 bases 3' to the first mismatch, the third mismatch being 7–11 bases 3' to the first mismatch, and the fourth mismatch being 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3); the second substitution generates a second mismatch and is located 7–11 bases 3' to the first mismatch; the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch; and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0117] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, i) a first mismatch to a target CAG repeat region, wherein the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or ii) including a first mismatch located at position 10 based on the numbering of sequence number 5 (UGCUGCUGCUGCUGCUGCUGCUG (sequence number 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–6 bases 3' to the first mismatch, the third mismatch being 1–6 bases 3' to the first mismatch, and the fourth mismatch being 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–6 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–6 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–6 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0118] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) a first mismatch to a target CAG repeat region, and the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or sequence number 4. ii) including a first mismatch located at position 10 based on the numbering of number 5 (UGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–6 bases 3' to the first mismatch, the third mismatch being 7–11 bases 3' to the first mismatch, and the fourth mismatch being 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), where the first substitution generates a first mismatch and is located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3); the second substitution generates a second mismatch and is located 1–6 bases 3' to the first mismatch; the third substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch; and the fourth substitution generates a third mismatch and is located 7–11 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0119] First mismatch at position 11, two mismatches As shown in Figure 6 (Table 1), the dsRNA of this disclosure may, in some cases, include a first strand having two or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 11 (as shown in Figures 3 and 4). In some cases, the second mismatch is located within positions 17–21 (as shown in Figures 3 and 4).

[0120] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second mismatch to the target CAG repeat region, the second mismatch being 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generates a second mismatch and is located 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generates a second mismatch and is located 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first and second substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), and the second substitution generates a second mismatch and is located 6-10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1-10 mismatches relative to the first strand (e.g., 1-4, 3-5, 5-7, or 5-10 mismatches).In some cases, the second strand contains 1 to 4 mismatches with respect to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 1 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 2 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 3 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 4 or fewer mismatches with respect to the first strand. In some cases, the second strand contains 5 or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0121] First mismatch at position 11, three mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having three or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 11 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second mismatch is located within positions 12–16 and the third mismatch is located within positions 17–21.

[0122] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being located at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second and a third mismatch to the target CAG repeat region, the second mismatch being 6 to 10 bases 3' to the first mismatch, and the third mismatch being 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 6–10 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 6 to 10 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is 6-10 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is 6-10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1-10 mismatches relative to the first strand (e.g., 1-4, 3-5, 5-7, or 5-10 mismatches). In some cases, the second strand contains 1-4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0123] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes to the first strand, the first strand comprising i) a first mismatch to the target CAG repeat region, the first mismatch being located at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 4 (GCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 4)), or SEQ ID NO: 5 (UGCUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 5)), and ii) a second and a third mismatch to the target CAG repeat region, the second mismatch being 1 to 5 bases 3' to the first mismatch, and the third mismatch being 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGUCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, and third substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is 1–5 bases 3' to the first mismatch, and the third substitution generates a third mismatch and is 6–10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1–10 mismatches relative to the first strand (e.g., 1–4, 3–5, 5–7, or 5–10 mismatches). In some cases, the second strand contains 1–4 mismatches relative to the first strand. In some cases, the second strand contains one, two, three, or four or fewer mismatches with respect to the first strand. In some cases, the second strand contains one or fewer mismatches with respect to the first strand. In some cases, the second strand contains two or fewer mismatches with respect to the first strand. In some cases, the second strand contains three or fewer mismatches with respect to the first strand. In some cases, the second strand contains four or fewer mismatches with respect to the first strand. In some cases, the second strand contains five or fewer mismatches with respect to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is produced by a substitution independently selected from a) substitution of G to A, U, or C, b) substitution of U to A, G, or C, and c) substitution of C to A, U, or G.

[0124] First mismatch at position 11, four mismatches As shown in Figure 6 (Table 1), in some cases the dsRNA of this disclosure comprises a first strand having four or fewer mismatches with respect to the target CAG repeat region of the CAG repeat-containing RNA, the first mismatch being at position 11 (as shown in Figures 3 and 4). In some cases the second, third, and fourth mismatches are located within positions 17–21 (as shown in Figures 3 and 4). In some cases the second and third mismatches are located within positions 12–16, and the fourth mismatch is located within positions 17–21. In some cases the second mismatch is located within positions 12–16, and the third and fourth mismatches are located within positions 17–21.

[0125] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) a first mismatch to a target CAG repeat region, and the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or sequence number 4. ii) including a first mismatch located at position 11 based on the numbering of number 5 (UGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 6 to 10 bases 3' to the first mismatch, the third mismatch being 6 to 10 bases 3' to the first mismatch, and the fourth mismatch being 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 6-10 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6-10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6-10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 6-10 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6-10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6-10 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 6–10 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0126] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, i) a first mismatch to a target CAG repeat region, wherein the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or ii) including a first mismatch located at position 11 based on the numbering of sequence number 5 (UGCUGCUGCUGCUGCUGCUGCUG (sequence number 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–5 bases 3' to the first mismatch, the third mismatch being 1–5 bases 3' to the first mismatch, and the fourth mismatch being 6–10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1 to 5 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1 to 5 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 1–5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 1–5 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0127] In some cases, the double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) a first mismatch to a target CAG repeat region, and the first mismatch is sequence number 1 (CUGCUGCUGCUGCUGCUGCUG(Sequence Number 1)), sequence number 4 (GCUGCUGCUGCUGCUGCUGCUG(Sequence Number 4)), or sequence number 4. ii) including a first mismatch located at position 11 based on the numbering of number 5 (UGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 5), and a second, third, and fourth mismatch to the target CAG repeat region, the second mismatch being 1–5 bases 3' to the first mismatch, the third mismatch being 6–10 bases 3' to the first mismatch, and the fourth mismatch being 6–10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch. In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCU (Sequence ID 2), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generates a second mismatch and is located 1 to 5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6 to 10 bases 3' to the first mismatch.In some cases, the first strand is a variant containing the first, second, third, and fourth substitutions of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), where the first substitution generates a first mismatch and is located at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generates a second mismatch and is located 1–5 bases 3' to the first mismatch, the third substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch, and the fourth substitution generates a third mismatch and is located 6–10 bases 3' to the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand contains 1 to 10 mismatches relative to the first strand (e.g., 1 to 4, 3 to 5, 5 to 7, or 5 to 10 mismatches). In some cases, the second strand contains 1 to 4 mismatches relative to the first strand. In some cases, the second strand contains 1, 2, 3, or 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 1 or fewer mismatches relative to the first strand. In some cases, the second strand contains 2 or fewer mismatches relative to the first strand. In some cases, the second strand contains 3 or fewer mismatches relative to the first strand. In some cases, the second strand contains 4 or fewer mismatches relative to the first strand. In some cases, the second strand contains 5 or fewer mismatches relative to the first strand. In some cases, the first and second strands of double-stranded RNA each have a length of 18 to 25 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of double-stranded RNA each have a length of 25 nucleotides.In some cases, each mismatch is generated by a substitution independently selected from a) G to A, U, or C, b) U to A, G, or C, and c) C to A, U, or G.

[0128] target nucleic acid The double-stranded RNA of this disclosure may be targeted to any gene or nucleic acid construct containing a targeted repeat region. In some cases, a gene (DNA or mRNA) encoding a human or primate protein may be targeted. In some cases, a non-coding gene may be targeted. In some cases, the coding region of a gene may be targeted. In some cases, the non-coding region of a gene may be targeted. In some cases, the targeted CAG repeat region is present in the targeted CAG repeat-containing RNA. In some cases, the targeted CAG repeat region is present in the targeted CAG repeat-containing mRNA. In some cases, the targeted CAG repeat region is present in the targeted CAG repeat-containing pre-mRNA.

[0129] In some cases, the double-stranded RNAs of this disclosure target CAG repeat-containing (polyglutamine) genes. In some cases, CAG repeat-containing genes are transcribed from one of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1. CAG repeat elongation is associated with many dominant genetic disorders known as polyglutamine (PolyQ) disorders. While CAG repeat-containing proteins are widely expressed throughout the body, the pathology of polyglutamine diseases primarily manifests in neuronal tissue, though not limited to neuronal tissue. Therefore, as used herein, the term polyglutamine disease refers to any disease or disorder associated with CAG repeat elongation, including but not limited to neurodegenerative diseases.

[0130] Huntington's disease (HTT), also known as interesting transcript 15 (IT15), is a gene that codes for the huntingtin protein. The exact function of huntingtin is unknown, but it is involved in axonal transport. An example of the sequence of the huntingtin transcript is provided by the NCBI reference sequence NM_002111.8 (SEQ ID NO: 24). Typically, the polyglutamine region (tract) of huntingtin has 10–35 CAG repeats. When the number of CAG repeats in the polyglutamine region elongates to 36–120 or more, Huntington's disease occurs. Early signs and symptoms may include irritability, depression, small involuntary movements, coordination difficulties, and difficulties in learning new information or making decisions. Many patients with Huntington's disease experience involuntary twitching or spasms known as chorea. These movements become more pronounced as the disease progresses. Affected individuals may have problems with walking, speaking, and swallowing. Patients with Huntington's disease also experience personality changes and a decline in thinking and reasoning abilities.

[0131] Ataxin-1 (ATXN1), associated with spinocerebellar ataxia type 1 (SCA1), refers to a gene encoding a polyglutamine-containing protein that is primarily expressed in the nucleus, binds to chromatin, and functions as a transcriptional repressor. An example of the ATXN1 transcript sequence is provided by the NCBI reference sequence NM_001128164.2 (SEQ ID NO: 25). Mutations of ataxin-1, which typically involve elongation of the polyglutamine region to approximately 40–83 repeats, cause motor impairment in spinocerebellar ataxia type 1 (SCA1) via a toxic gain-of-function mechanism in the cerebellum. Cerebellar dysfunction is progressive and permanent. Individuals with this condition initially experience problems with coordination and balance (ataxia). Other signs and symptoms of SCA1 include difficulty speaking and swallowing, muscle rigidity (spasticity), and weakness of the muscles controlling eye movements (oculopalsy). Weakness of the extraocular muscles causes rapid, involuntary eye movements (nystagmus). Individuals with SCA1 may have difficulty processing information, learning, and remembering (cognitive impairment). Over time, individuals with SCA1 may develop numbness, tingling, or pain in the arms and legs (sensory neuropathy); uncontrolled muscle tension (dystonia); muscle wasting (atrophy); and muscle spasms (fasciculations). Rarely, in individuals who have been affected for many years, rigidity, tremors, and involuntary twitching movements (chorea) have been reported.

[0132] Ataxin 2 (ATXN2), associated with spinocerebellar ataxia type 2 (SCA2), refers to a gene encoding a polyglutamine-containing RNA-binding protein that targets a cis-regulatory element of the 3'UTR to stabilize a subset of mRNA and increase protein expression. An example sequence of the ATXN2 transcript is provided by NCBI reference sequence: NM_001372574.1 (SEQ ID NO: 26). Polyglutamine repeat elongation in ATXN2 (e.g., typically around 33 or more repeats) can cause signs and symptoms of spinocerebellar ataxia type 2 (SCA2). People with SCA2 initially experience problems with coordination and balance (ataxia). Other early signs and symptoms of SCA2 include further motor impairments, speech and swallowing difficulties, and weakness of the muscles that control eye movements (oculopalasis). Weakness of the extraocular muscles causes involuntary forward and backward eye movements (nystagmus) and a reduced ability to perform rapid eye movements (saccadic hypomotility). Individuals with SCA2 may develop, over time, loss of sensation and weakness in the limbs (peripheral neuropathy), muscle wasting (atrophy), uncontrolled muscle tension (dystonia), and involuntary twitching movements (chorea). Some people with SCA2 develop a range of movement abnormalities known as parkinsonism. These include abnormally slow movements (bradykinesia), involuntary tremors (tremor), and muscle rigidity (rigidity). Individuals with SCA2 may have problems with short-term memory, planning, and problem-solving, or experience a general decline in intellectual function (dementia). Intermediate polyglutamine elongation of ATXN2 (27-33 CAG repeat) also increases the risk of amyotrophic lateral sclerosis (ALS). ALS is a neurodegenerative neuromuscular disease in which motor neurons that control voluntary muscles are gradually lost. Early symptoms of ALS include muscle rigidity, muscle spasms, and gradually progressing muscle weakness and wasting. Limb-onset ALS begins with weakness in the arms and legs, while bulbar-onset ALS begins with difficulty speaking and swallowing. Half of ALS patients experience at least mild impairment in thinking and behavior, and about 15% develop frontotemporal dementia. Most people experience pain.The loss of motor neurons continues until the ability to eat, talk, and move is lost, and ultimately the ability to breathe is lost. ALS ultimately causes paralysis and usually leads to early death due to respiratory failure.

[0133] Ataxin 3 (ATXN3), which is associated with spinocerebellar ataxia type 3 (SCA3), refers to a gene encoding a polyglutamine-containing deubiquitinating enzyme. An example of the sequence of the ATXN3 transcript is provided by NCBI reference sequence NM_004993.6 (SEQ ID NO: 27). An elongation of the polyglutamine repeat from a normal 13 - 36 CAG repeats to 50 or more CAG repeats causes Machado-Joseph disease (MJD), also known as Machado-Joseph Azorean disease, Machado disease, Joseph disease, or spinocerebellar ataxia type 3 (SCA3). People with this condition first experience problems with coordinated movement and balance (ataxia). Other early signs and symptoms of SCA3 include speech disorders, uncontrollable muscle tension (dystonia), muscle stiffness (spasticity), rigidity, tremors, bulging eyes, double vision, etc. People with this condition may experience sleep disorders such as restless legs syndrome or REM sleep behavior disorder. Individuals with SCA3 may develop numbness and weakness in the hands and feet (peripheral neuropathy), muscle cramps, muscle contractions (fasciculations), as well as swallowing difficulties over time. Individuals with SCA3 may have problems with memory, planning, and problem-solving.

[0134] Calcium voltage-gated channel subunit alpha1A (CACNA1A) associated with spinocerebellar ataxia type 6 (SCA6) encodes the α1A pore-forming subunit of neuronal calcium channel P / Q. An example of the sequence of the CACNA1A transcript is provided by NCBI reference sequence NM_000068.4 (SEQ ID NO: 28). An extension to a typical 19 - 33 repeats in the polyglutamine region of the CACNA1A gene causes spinocerebellar ataxia type 6 (SCA6). People with this condition first experience problems with coordinated movement and balance (ataxia). Other early signs and symptoms of SCA6 include dysarthria, involuntary eye movements (nystagmus), and double vision. Individuals with SCA6 may develop limb ataxia, tremors, and uncontrollable muscle tension (dystonia) over time.

[0135] Ataxin 7 (ATXN7) associated with spinocerebellar ataxia type 7 (SCA7) encodes a polyglutamine-containing protein that is an essential subunit of the GCN5 (general control of amino acid synthesis-5, KAT2A)-containing SAGA family of histone acetyltransferase (HAT) complexes. An example of the sequence of the ATXN7 transcript is provided by NCBI reference sequence NM_001377405.1 (SEQ ID NO: 29). The polyglutamine extension of ATXN7 causes spinocerebellar ataxia type 7 (SCA7) characterized by progressive cerebellar ataxia, retinal degeneration or blindness due to cone-rod dystrophy, and mild changes in sensation or reflexes. Subsequent symptoms include loss of motor control, slurred speech (dysarthria), and difficulty swallowing (dysphagia).

[0136] The protein phosphatase 2 regulatory subunit B-beta (PPP2R2B), associated with spinocerebellar ataxia type 12 (SCA12), encodes the B regulatory subunit of protein phosphatase 2, a serine / threonine phosphatase. An example sequence of the PPP2R2B transcript is provided by the NCBI reference sequence NM_181674.3 (SEQ ID NO: 30). An elongation of polyglutamine repeats from the typical normal range of approximately 7–28 to approximately 55–78 causes spinocerebellar ataxia type 12 (SCA12). The age of onset of symptoms in SCA12 ranges from 8 to 55 years, but is most commonly in the 40s. Symptoms typically begin with tremor and progress to cerebellar ataxia. Signs of dementia have also been reported in association with SCA12.

[0137] TATA-box binding protein (TBP), associated with spinocerebellar ataxia type 17 (SCA17), encodes a TATA-binding protein that is a component of transcription factor IID (TFIID). An example of the sequence of the TBP transcript is provided by the NCBI reference sequence NM_003194.5 (SEQ ID NO: 31). TBP typically has 25–42 polyglutamine repeats, and extension to 45–66 repeats is associated with spinocerebellar ataxia type 17 (SCA17). Individuals with this condition typically experience symptoms such as involuntary movements including ataxia, dementia, chorea and dystonia, rigidity, and pyramidal tract signs such as spasticity, weakness, blunting of rapid alternating movements, and hyperreflexia.

[0138] The androgen receptor (AR) encodes a steroid hormone-activating transcription factor. An example of an AR transcript sequence is provided by the NCBI reference sequence NM_000044.6 (SEQ ID NO: 32). The elongation of polyglutamine repeats from a typical 9-34 repeat to 38-62 repeats causes spinal and bulbar muscular atrophy (SBMA), also known as Kennedy disease. SBMA is characterized by progressively worsening muscle weakness and atrophy, causing seizures and difficulty walking, swallowing, and speaking. SBMA can also cause gynecomastia and infertility.

[0139] Atrophin 1 (ATN1) encodes a protein hypothesized to be a transcriptional corepressor that represses transcription by recruiting nuclear receptor subfamily 2 group E member 1 (NR2E1). An example sequence of the ATN1 transcript is provided by the NCBI reference sequence NM_001007026.2 (SEQ ID NO: 33). Dentatorubral-pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder associated with the elongation of the polyglutamine repeat of ATN1 from the typical 7–35 copies to 49–93 copies. When DRPLA develops before approximately 20 years of age, it is typically accompanied by myoclonus, ataxia, seizures, behavioral changes, and intellectual disability. When it develops after approximately 20 years of age, it is accompanied by ataxia, chorea athetosis, delusions, and dementia.

[0140] Myeloid / Lymphoid Or Mixed-Lineage Leukemia Translocated To Chromosome 3 (MLLT3), also known as AF-9, encodes a component of the superelongation complex (SEC), which is necessary for increasing the catalytic rate of RNA polymerase II transcription. An example sequence of the MLLT3 transcript is provided by the NCBI reference sequence NM_004529.4 (SEQ ID NO: 34). MLLT3 contains an unstable polyglutamine repeat, and genetic abnormalities involving MLLT3 are associated with leukemia, as well as neuromotor developmental delay, cerebellar ataxia, and epilepsy.

[0141] Bone Morphogenic Protein 2 Inducible Kinase (BMP2K) encodes a protein involved in skeletal development and pattern formation. An example of a BMP2K transcript sequence is provided by the NCBI reference sequence NM_198892.2 (SEQ ID NO: 35). BMP2K contains polyglutamine repeats and is associated with myopia and cancer, particularly cancer-related genetic dysregulations.

[0142] THAP domain-containing 11 (THAP11) encodes a transcriptional repressor associated with embryonic development. An example sequence of the THAP11 transcript is provided by the NCBI reference sequence NM_020457.3 (SEQ ID NO: 36). THAP11 typically contains approximately 29 copies of polyglutamine repeats, but ranges from 20 to over 40 copies. For example, an increase in the number of polyglutamine repeats to 38 copies is associated with neurodegenerative diseases. Polyglutamine elongation in THAP11 is also associated with intracellular aggregation, cytotoxicity, growth inhibition, G0 / G1 arrest, and inhibition of transcriptional activity of THAP11.

[0143] Zinc Finger Homeobox 3 (ZFHX3) encodes a transcription factor that regulates myogenesis and neuronal differentiation. It also functions as a tumor suppressor in some cancers and is associated with atrial fibrillation. An example of the sequence of the ZFHX3 transcript is provided by the NCBI reference sequence NM_006885.4 (SEQ ID NO: 37). ZFHX3 contains polyglutamine repeats. Individuals with extended polyglutamine repeats, e.g., 19 copies, are associated with coronary heart disease, hypertension, diabetes, or dyslipidemia compared to individuals with fewer repeats, e.g., 17 copies.

[0144] POU class 3 homeobox 2 (POU3F2) encodes a transcription factor associated with neuronal differentiation. An example sequence of the POU3F2 transcript is provided by the NCBI reference sequence NM_005604.4 (SEQ ID NO: 38). POU3F2 contains a polyglutamine region and is associated with bipolar disorder, obesity, developmental delay, and intellectual disability.

[0145] Mastermind-like transcriptional coactivator 2 (MAML2) encodes a transcriptional coactivator of the NOTCH protein and promotes β-catenin turnover. An example sequence of the MAML2 transcript is provided by the NCBI reference sequence NM_032427.4 (SEQ ID NO: 39). MAML2 contains a polyglutamine region with observed variability and is associated with cancers such as mucoepidermoid carcinoma, hidradenoma, B-cell derived lymphoma, and chronic lymphocytic leukemia.

[0146] Mastermind-like transcriptional coactivator 3 (MAML3) encodes a transcriptional coactivator of the NOTCH protein. An example sequence of the MAML3 transcript is provided by the NCBI reference sequence NM_018717.5 (SEQ ID NO: 40). MAML3 contains a polyglutamine region and is associated with cancers such as Schneiderian carcinoma and ossifying fibromyxoid neoplasm.

[0147] SWI / SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily A, Member 2 (SMARCA2) encodes a component of the SWI / SNF complex involved in transcriptional regulation through chromatin remodeling. SMARCA2 is also involved in neurogenesis. An example of the SMARCA2 transcript sequence is provided by the NCBI reference sequence NM_003070.5 (SEQ ID NO: 41). SMARCA2 contains a polymorphic polyglutamine region and is associated with conditions such as Nicolaides-Baraitser syndrome and blepharophimosis-impaired intellectual development syndrome. The SMARCA2 gene is also located in a chromosomal region associated with schizophrenia and bipolar disorder.

[0148] Subunit 4 of the Origin of Replication (ORC) complex (ORC4) encodes one of the six subunit components of the ORC complex necessary for the initiation of DNA replication. An example sequence of the ORC4 transcript is provided by the NCBI reference sequence NM_001190879.3 (SEQ ID NO: 42). ORC4 contains a region of polymorphic trinucleotide CAG repeats located upstream of the coding sequence and is associated with Meier-Gorlin syndrome 1 and Meier-Gorlin syndrome 2.

[0149] RUNX family transcription factor 2 (RUNX2) encodes a nuclear protein involved in osteoblast differentiation and skeletal morphogenesis. An example of the RUNX2 transcript sequence is provided by the NCBI reference sequence NM_001024630.4 (SEQ ID NO: 43). RUNX2 contains polyglutamine and polyalanine regions. For example, elongation of the polyglutamine region from a typical 23 residues to, for example, 27-30 residues leads to cleidocranial dysplasia, decreased bone density, and reduced RUNX2 transactivation ability. Ccleidocranial dysplasia (CCD) is a disease affecting the skull, bones, and teeth. Signs and symptoms include absence or underdevelopment of the clavicle, delayed closure of the cranial fontanelle, dental abnormalities, short stature, decreased bone density, hearing loss, and other bone abnormalities.

[0150] Transcription factor 4 (TCF4) encodes a protein that binds to the E-box to initiate transcription and promotes neuronal differentiation. TCF4 contains a CTG repeat sequence, typically consisting of about 20 repeats in healthy individuals. Extension of the CTG repeat sequence beyond approximately 100 units is associated with Fuchs' corneal endothelial dystrophy (FECD), an eye disease characterized by degeneration of corneal endothelial cells and progressive vision loss. The TCF4 gene can be transcribed either in the sense direction to produce a CUG elongation transcript or in the antisense direction to produce a CAG elongation transcript.

[0151] DM1 protein kinase (DMPK) is a serine / threonine kinase essential for maintaining proper skeletal muscle function. Healthy individuals have 5 to 38 CTG units in the 3' untranslated region (UTR) of the DMPK gene, while individuals with myotonic dystrophy 1 (DM1) have 50 or more CTG units. DM1 is a multisystem disorder affecting tissues such as skeletal muscle, smooth muscle, heart, and central nervous system. In DM1 patients, the DMPK gene may be transcribed either in the sense direction to produce an elongated CTG transcript or in the antisense direction to produce an elongated CAG transcript.

[0152] Mediator complex subunit 12 (MED12) encodes a component of the preinitiation complex that is involved in the control of transcription initiation. An example of the sequence of the MED12 transcript is provided by NCBI Reference Sequence NM_005120.3 (Accession number 44). MED12 has a polyglutamine region and is associated with Opitz-Kaveggia syndrome, Lujan-Fryns syndrome, Ohdo syndrome, X-linked, and tumor formation such as uterine leiomyoma.

[0153] E1A-binding protein P400 (EP400) encodes a component of the NuA4 histone acetyltransferase complex that is involved in transcriptional activation. An example of the sequence of the EP400 transcript is provided by NCBI Reference Sequence NM_015409.5 (Accession number 45). EP400 usually contains approximately 32 CAG repeats. EP400 is involved in ossifying fibromyxoid tumor and epilepsy, familial temporal lobe 1.

[0154] Membrane-associated guanylate kinase, WW and PDZ domain-containing 1 (MAGI1) encodes a protein that is involved in the assembly of multiple protein complexes in the intercellular contact region. An example of the sequence of the MAGI1 transcript is provided by NCBI Reference Sequence NM_015520.2 (Accession number 46). MAGI1 contains a polymorphic polyglutamine region and is associated with conditions such as cervical large cell neuroendocrine carcinoma and microscopic colitis.

[0155] UBAP1-MVB12-associated (UMA) domain-containing 1 (UMAD1) is a gene that encodes a protein. An example of the sequence of the UMAD1 transcript is provided by NCBI Reference Sequence NM_001302348.2 (Accession number 47). UMAD1 contains a polymorphic trinucleotide CAG repeat region upstream of the start codon and is associated with retinitis pigmentosa.

[0156] DM1 Locus Antisense RNA (DM1-AS) is an RNA gene. An example of the RNA sequence of DM1-AS is provided by the NCBI reference sequence NR_147193.1 (SEQ ID NO: 48). DM1-AS contains a polymorphic trinucleotide CAG repeat region within its introns and is associated with myotonic dystrophy 1 and branchio-otorenal syndrome 2.

[0157] AC007161.3, also known as ENSG 00000283549, is an RNA gene containing a CAG repeat.

[0158] Interferon regulator 2-binding protein-like (IRF2BPL) encodes a transcription factor involved in central nervous system development, neuronal maintenance, and the regulation of female reproductive function. An example of the sequence of the IRF2BPL transcript is provided by the NCBI reference sequence NM_024496.4 (SEQ ID NO: 49). IRF2BPL contains a polyglutamine region and is associated with neurodevelopmental disorders involving regression, abnormal motor skills, loss of language, and seizures, as well as neurological problems such as IRF2BPL-associated degenerative neurodevelopmental disorder-dystonia-seizure syndrome.

[0159] Mab-21Like 1 (MAB21L1) encodes a protein associated with ocular and cerebellar development. An example sequence of the MAB21L1 transcript is provided by the NCBI reference sequence NM_005584.5 (SEQ ID NO: 50). MAB21L1 is associated with cerebellar syndromes, ocular syndromes, craniofacial syndromes, and genital syndromes and hydroophthalmos. MAB21L1 contains a polymorphic trinucleotide CAG repeat in the 5' untranslated portion of a gene associated with mental conditions such as bipolar disorder.

[0160] In some cases, the pathogenic or pathological allele of a CAG repeat-containing gene or RNA encoded by a CAG repeat-containing gene contains at least about 30 consecutive CAG repeats.

[0161] DNA molecules and recombinant expression vectors This disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the dsRNA of this disclosure, the nucleotide sequence being operably ligated to a promoter that is functional in eukaryotic cells. This disclosure provides recombinant nucleic acids comprising a) the dsRNA of this disclosure, and b) microRNA scaffolds comprising 5' flanking polynucleotides, loop polynucleotides, and 3' flanking polynucleotides. This disclosure includes a DNA molecule encoding such recombinant nucleic acids. This disclosure includes a recombinant expression vector comprising a DNA molecule.

[0162] In some cases, the dsRNAs of this disclosure are encoded by nucleic acid molecules, such as DNA molecules. The double-stranded RNA sequences provided herein can be converted to DNA form by replacing each uracil base "U" with a thymine "T" base.

[0163] In some cases, nucleic acid molecules encoding double-stranded RNA (e.g., DNA) are contained within an expression cassette or recombinant expression vector.

[0164] In some cases, the expression cassette further includes one or more regulatory sequences (operatably linked sequences) to the transgene. “Operatatably linked” sequences include regulatory sequences that act adjacent to the transgene, or trans or distant from it, to regulate its expression. Examples of regulatory sequences include transcription start sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly-A) signal sequences, or any combination thereof.

[0165] In some cases, promoters may be endogenous promoters, synthetic promoters, hybrid promoters, constitutive promoters, inducible promoters, tissue-specific promoters (e.g., central nervous system (CNS) specific), or cell-specific promoters (neurons, glial cells, astrocytes). Examples of constitutive promoters include the Rous sarcoma virus (RSV) long-terminal repeat (LTR) promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer), the SV40 promoter, and the dihydrofolate reductase promoter. Examples of inducible promoters include the zinc-inducible sheep metallotionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary cancer virus (MMTV) promoter, the T7 polymerase promoter system, the ecdysone insect promoter, the tetracycline-inhibiting system, the tetracycline-inducible system, the RU486-inducible system, and the rapamycin-inducible system. Further examples of promoters that can be used include, for example, the chicken beta-actin promoter (CBA promoter), CAG promoter, H1 promoter, CD68 promoter, JeT promoter, synapsin promoter, RNA polymerase II promoter, or RNA polymerase III promoter (e.g., U6, H1, etc.).

[0166] In some cases, the promoter is an RNA pol II promoter. Examples of pol II promoters include PGK, CBA, U1, CMV, EIF1α, EF1α, CAG, or synaptophysin promoters. In some cases, the promoter is a tissue-specific RNA pol II promoter. In some cases, the tissue-specific RNA pol II promoter is derived from a gene that exhibits neuron-specific expression. In some cases, the expression cassette contains a pol II promoter and a poly(A) tail and has a DNA sequence encoding a double-stranded RNA, for example, in which the pol II promoter flanks at the 5' end and the poly(A) tail flanks at the 3' end.

[0167] In some cases, the promoter is a neuron-specific promoter. Examples of neuron-specific promoters include those derived from neuron-specific enolase (NSE), human synapsin 1, human synapsin 2, caMK kinase, and tubulin.

[0168] In some cases, the promoter is an RNA pol III promoter. Examples of pol III promoters include U6, H1, 7SK, Y, RPR, MRP, and selenocysteine ​​tRNA. In some cases, the expression cassette contains a pol III promoter and a poly(T) tail, and has a DNA sequence encoding a double-stranded RNA, for example, with a pol III promoter flanking at the 5' end and a poly(T) tail flanking at the 3' end.

[0169] In some cases, the promoter is an RNA pol I promoter. In some cases, the expression cassette contains a pol I promoter and a 3' box, and has a DNA sequence encoding a double-stranded RNA, for example, with a pol I promoter flanking at the 5' end and a 3' box flanking at the 3' end.

[0170] Double-stranded RNA expression cassettes are known in the art; see, for example, ter Brake et al. Mol.Ther. (2008) 16:557, Maczuga et al., BMC Biotechnol. (2012) 12:42, and Bofill-De Ros and Gu (2016) 103:157.

[0171] In some cases, the DNA sequence encoding the double-stranded RNA of this disclosure is located in the untranslated region of the expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of this disclosure is located in an intron, the 5' untranslated region (5'UTR), or the 3' untranslated region (3'UTR) of the expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of this disclosure is located in an intron downstream of the promoter and upstream of the expressed gene.

[0172] In some cases, the DNA nucleotide sequence encoding the dsRNA of this disclosure is flanked by two AAV inverted terminal repeats (ITRs) (e.g., a 5'ITR and a 3'ITR) in an expression cassette. In some cases, each AAV ITR is a full-length ITR (e.g., approximately 145 bp in length, containing a functional rep-binding site (RBS) and terminal degradation sites (trs). In some cases, one of the ITRs is cleaved (e.g., shortened or not full-length). In some cases, the cleaved ITR lacks a functional terminal degradation site (trs) and is used to produce a self-complementary AAV vector (scAAV vector).

[0173] In some cases, the expression cassette contains a nucleotide sequence selected from the nucleotide sequences shown in Figure 11 (Table 4). In some cases, the cassette does not contain the 3'TTTTTG sequence.

[0174] In some cases, dsRNA can be encoded by a vector, such as a plasmid, a non-viral vector, or a viral vector. The use of vectors for expressing double-stranded RNA according to this disclosure may enable continuous or controlled expression of double-stranded RNA in a subject rather than administering the double-stranded RNA to the subject multiple times. This disclosure provides a vector comprising an isolated nucleic acid containing an expression cassette encoding the double-stranded RNA described herein.

[0175] Examples of viral vectors include, but are not limited to, herpesvirus (HSV) vectors, retrovirus vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, lentivirus vectors, and baculovirus vectors.

[0176] In some cases, the vectors encoding dsRNA in this disclosure are retroviral vectors. In some cases, retroviral vectors are mouse stem cell viruses, mouse leukemia viruses (e.g., Moloney's mouse leukemia virus vectors), feline leukemia viruses, feline sarcoma viruses, or avian reticuloendotheliopathy virus vectors. In some cases, the vectors encoding double-stranded RNA in this disclosure are lentiviruses or lentivirus-based vectors. In some cases, lentiviral vectors are HIV (human immunodeficiency viruses including HIV-1 and HIV-2), equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-visna virus vectors. Methods for expressing shRNA using lentiviral-manipulated cells are known in the art, e.g., Stegmeier et al. Proc.Natl.Acad.Sci.USA(2005)102:13212-13217, Klinghoffer et al. RNA(2010)16:879-884. Production of non-replicating recombinant lentiviruses can be achieved by co-transfection of an expression vector and a packaging plasmid using commercially available packaging cell lines and packaging plasmids, e.g., TLA-HEK293TM (Thermo Scientific / Open Biosystems(Huntsville,AL)).

[0177] In some cases, the vector encoding the dsRNA of this disclosure is an adeno-associated virus (AAV) vector, such as a recombinant rAAV vector produced by a recombinant method. AAV is a single-stranded, non-enveloped DNA virus having a genome encoding a protein for replication (rep) and a capsid (Cap), flanked by two ITRs that function as origins for replication of the viral genome. AAV also includes a packaging sequence that enables the packaging of the viral genome into the AAV capsid. In some cases, the AAV vector includes an expression cassette encoding the double-stranded RNA of this disclosure, flanked by two cis-active AAV ITRs (5'ITR and 3'ITR). The functional ITR sequences are used for the rescue, replication, and packaging of AAV viral particles. Accordingly, an AAV vector is defined herein to include at least sequences required in cis for viral replication and packaging (e.g., one or two functional ITRs and a packaging sequence). In some cases, each AAV ITR is a full-length ITR (e.g., approximately 145 bp in length, containing a functional rep-binding site (RBS) and terminal degradation sites (trs)). In some cases, one or both of the ITRs are modified, for example, by insertion, deletion, or substitution, provided that the ITR provides functional rescue, replication, and packaging. In some cases, the modified ITR lacks a functional terminal degradation site (trs) and is used for the production of self-complementary AAV vectors (scAAV vectors). In some cases, the ITR is selected from any one of the serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and their variants. In some cases, the ITR is derived from AAV2.

[0178] Other expression regulatory sequences may be present in an rAAV vector operably ligated to a DNA sequence encoding double-stranded RNA, including one or more transcription start sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (polyA) signal sequences, or any combination thereof.

[0179] rAAV vectors may have one or more AAV wild-type genes that are deleted entirely or partially. In some embodiments, rAAV vectors are replication defects. In some cases, rAAV vectors lack functional Rep proteins and / or capsid proteins.

[0180] Methods for packaging recombinant AAV vectors into AAV capsids using host cell cultures are known in the art. In some cases, one or more of the components necessary for packaging an rAAV vector (e.g., the Rep sequence, the cap sequence, and / or accessory function) may be provided by a stable host cell engineered to contain one or more of the required components (e.g., by the vector). The expression of components necessary for AAV packaging may be under the control of an inductive or constitutive promoter in the host packaging cell. AAV helper vectors are commonly used to provide transient expression of trans-functioning AAV rep and / or cap genes to compensate for the lack of AAV function necessary for AAV replication. In some cases, AAV helper vectors lack the AAV ITR and are unable to replicate or package themselves. AAV helper vectors may be in the form of plasmids, phages, transposons, cosmids, viruses, or virions.

[0181] The recombinant AAV vectors of this disclosure may be encapsulated by an AAV capsid to form rAAV particles. “rAAV particle” or “rAAV virion” refers to an infectious replication-deficient virus comprising an AAV protein shell and encapsulating a target transgene flanked on both sides by an AAV ITR. The rAAV particles are produced in a suitable host cell into which a sequence identifying the rAAV vector, AAV helper function, and accessory function have been introduced, enabling the host cell to encode the AAV polypeptide necessary to package the rAAV vector (containing the target transgene sequence) into the infectious rAAV particle for subsequent gene delivery to target cells.

[0182] In some cases, rAAV particles may be produced using a triple transfection method (see, for example, U.S. Patent No. 6,001,650, which is incorporated herein by reference in its entirety). In this approach, rAAV particles are produced by transfecting host cells with an rAAV vector (containing the transgene), an AAV helper vector, and an accessory function vector, which are packaged into the rAAV particles. In some cases, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The accessory function vector encodes a nucleotide sequence of a non-AAV-derived viral and / or cellular function on which AAV depends for replication (e.g., "accessory function"). The accessory function includes, but is not limited to, parts involved in the activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly, all functions necessary for AAV replication. The virus-based accessory function may originate from any known helper virus, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), or vaccinia virus. In some cases, rAAV particles are generated using a double transfection method in which both the AAV helper function and the accessory function are cloned onto a single vector.

[0183] The AAV capsid is a crucial factor in determining the tissue specificity of rAAV particles. Therefore, rAAV particles with specific capsid tissue specificity can be selected. In some cases, rAAV particles include capsids selected from AAV serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and their variants. In some cases, the AAV capsid is selected from serotypes capable of crossing the blood-brain barrier, such as AAV9, AAVrh.10, or their variants. In some cases, the AAV capsid is a chimeric AAV capsid.

[0184] In some cases, an rAAV vector is a mammalian serotype AAV vector (e.g., an AAV genome and an ITR derived from a mammalian serotype AAV) that includes a primate serotype AAV vector or a human serotype AAV vector. In some cases, an AAV vector is derived from any one of the serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and their variants. In some cases, an AAV vector is a chimeric AAV vector. In some cases, an rAAV vector may be a vector containing an AAV genome and an AAV capsid derived from the same AAV serotype. In some cases, an rAAV vector is a pseudotype, meaning that the rAAV vector contains an AAV genome derived from one AAV serotype and an AAV capsid derived from at least partially different AAV serotypes.

[0185] In some cases, the rAAV vector is an AAV9 serotype. In some cases, the rAAV contains the AAV9 capsid protein (e.g., SEQ ID NO: 2 in U.S. Patent No. 7,198,951), the AAV9 rep protein (e.g., SEQ ID NO: 3 in U.S. Patent No. 7,198,951), or both. In some cases, the rAAV contains (i) the AAV9 capsid protein (e.g., SEQ ID NO: 2 in U.S. Patent No. 7,198,951), and (ii) the AAV2 ITR.

[0186] In some cases, rAAV particles can transduce cells of the central nervous system (CNS). In some cases, rAAV particles can transduce non-neuronal or neuronal cells of the CNS. In some cases, the CNS cells may be neurons, glial cells, astrocytes, or microglia.

[0187] In some cases, rAAV vectors are self-complementary AAV (scAAV) vectors. scAAV vectors contain two complementary DNA strands in the form of a dimeric reverse repeat genome. The two complementary strands within the dimeric reverse repeat genome anneal together to form a single double-stranded DNA ready for immediate replication and transcription, thus bypassing the need for host cell DNA synthesis. Self-complementary AAV vectors are described in U.S. Patents 7,465,583, 7,790,154, 8,361,457, and 8,784,799.

[0188] This disclosure also provides host cells transfected with rAAV containing DNA sequences encoding double-stranded RNA as described herein. In some cases, the host cells are prokaryotic or eukaryotic cells. In some cases, the host cells are mammalian cells (e.g., HEK293T, COS cells, HeLa cells, KB cells), bacterial cells (E. coli), yeast cells, insect cells (Sf9, Sf21, Drosophila, mosquito), etc. In some cases, the host cells are obtained from or derived from human subjects. In some cases, the host cells are fibroblasts.

[0189] DNA molecules that encode one or both strands of double-stranded RNA This disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA of this disclosure. In some cases, the nucleotide sequence encoding the first strand is operably ligated to a promoter. In some cases, the nucleotide sequence encoding the first strand is operably ligated to a promoter that is functional in eukaryotic cells. This disclosure provides a DNA molecule comprising a nucleotide sequence encoding: i) the first strand of the double-stranded RNA of this disclosure, and ii) the second strand of the double-stranded RNA of this disclosure. In some cases, the nucleotide sequences encoding the first and second strands are operably ligated to a promoter. In some cases, the promoter is a Pol II promoter. In some cases, the promoter is a U6 promoter. In some cases, the promoter is a CAG promoter. In some cases, the promoter is a CBA promoter. In some cases, the promoter is a CMV promoter. In some cases, the promoter is an EF1α promoter. In some cases, the promoter is an H1 promoter. In some cases, the DNA molecule of this disclosure comprises a nucleotide sequence encoding one of sequence numbers 744-1603.

[0190] Recombinant RNA molecules This disclosure provides recombinant nucleic acids (which may be referred to as "artificial microRNA" or "small molecule binding RNA" (sbRNA)) comprising a) the dsRNA of this disclosure and b) a microRNA scaffold comprising a 5' flanking polynucleotide (hereinafter also referred to herein as the "5' leader"), a loop polynucleotide, and a 3' flanking polynucleotide (hereinafter also referred to herein as the "3' trailer"), wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) a first strand of double-stranded RNA, iii) a loop polynucleotide, (iv) a second strand of double-stranded RNA, and iii) a 3' trailer polynucleotide, wherein at least one of the 5' flanking polynucleotide, loop polynucleotide, and 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of double-stranded RNA. This disclosure provides a) a double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide, a loop polynucleotide, and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) a second strand of the double-stranded RNA, iii) a loop polynucleotide, (iv) a first strand of the double-stranded RNA, and iii) a 3' flanking polynucleotide, wherein at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of the double-stranded RNA. In some cases, the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide are derived from miR33.

[0191] This disclosure provides recombinant nucleic acids (which may be referred to as "artificial microRNA" or "small molecule binding RNA" (sbRNA)) comprising a) double-stranded RNA of the Disclosure and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred to herein as the "5' leader") and a 3' flanking polynucleotide (also referred herein as the "3' trailer"), wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) a first strand of double-stranded RNA, iii) a second strand of double-stranded RNA, and iv) a 3' trailer polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of double-stranded RNA. This disclosure provides recombinant nucleic acids (e.g., recombinant RNA) comprising a) double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) a second strand of double-stranded RNA, iii) a first strand of double-stranded RNA, and iv) a 3' flanking polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of double-stranded RNA. In some cases, the 5' flanking polynucleotide and the 3' flanking polynucleotide are derived from miR451.

[0192] Cassettes encoding recombinant RNA molecules This disclosure provides a DNA molecule (e.g., a “cassette” that can be inserted into an expression vector to produce a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the Disclosure (wherein the recombinant RNA molecule may be referred to as “artificial microRNA” or “sbRNA”), wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide (hereinafter also referred to herein as the “5' leader”), a loop polynucleotide, and a 3' flanking polynucleotide (hereinafter also referred to herein as the “3' trailer”), wherein the recombinant nucleic acid comprises i) the 5' flanking polynucleotide, ii) the first strand of the double-stranded RNA, iii) the loop polynucleotide, (iv) the second strand of the double-stranded RNA, and iii) the 3' trailer polynucleotide, wherein at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strand of the double-stranded RNA. This disclosure provides a DNA molecule (e.g., a "cassette" which can be inserted into an expression vector to produce a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of this disclosure (wherein the recombinant RNA molecule may be referred to as "artificial microRNA" or "sbRNA"), wherein the recombinant RNA molecule comprises a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide, a loop polynucleotide, and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the second strand of the double-stranded RNA, iii) a loop polynucleotide, iv) the first strand of the double-stranded RNA, and iii) a 3' flanking polynucleotide, wherein at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of the double-stranded RNA. In some cases, the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide are derived from miR33. In some cases, the cassette comprises a Pol3 transcription sequence.For example, in some cases, the cassette contains the nucleotide sequence TTTTTG at the 3' of the nucleotide sequence encoding the 3' trailer polynucleotide. In some cases, the cassette contains the nucleotide sequence T at the 3' of the nucleotide sequence encoding the 3' trailer polynucleotide. n It includes a sequence where n is an integer between 5 and 10 (for example, n is 5, 6, 7, 8, 9, or 10). In some cases, the cassette has a length of approximately 110 to 150 nucleotides. In some cases, the cassette contains a Pol II transcription sequence. For example, in some cases, the cassette contains a polyadenylated sequence at 3' of a nucleotide sequence encoding a 3' flanking polynucleotide.

[0193] This disclosure provides a DNA molecule (e.g., a “cassette” that can be inserted into an expression vector to produce a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the Disclosure (wherein the recombinant RNA molecule may be referred to as “artificial microRNA” or “sbRNA”), wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide (hereinafter also referred to herein as a “5' leader”) and a 3' flanking polynucleotide (hereinafter also referred to herein as a “3' trailer”), wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) a first strand of the double-stranded RNA, iii) a second strand of the double-stranded RNA, and iv) a 3' trailer polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA. This disclosure provides a DNA molecule (e.g., a "cassette" which can be inserted into an expression vector to produce a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of this disclosure (wherein the recombinant RNA molecule may be referred to as "artificial microRNA" or "sbRNA"), wherein the recombinant RNA molecule comprises a) the double-stranded RNA of this disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the second strand of the double-stranded RNA, iii) the first strand of the double-stranded RNA, and iv) a 3' flanking polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA. In some cases, the 5' flanking polynucleotide and the 3' flanking polynucleotide are derived from miR451. In some cases, the cassette comprises a Pol3 transcription sequence. For example, in some cases, the cassette contains the nucleotide sequence TTTTTG at the 3' position of the nucleotide sequence encoding the 3' trailer polynucleotide.In some cases, the cassette contains a nucleotide sequence T at 3' of the nucleotide sequence encoding the 3' trailer polynucleotide. n It includes n, where n is an integer between 5 and 10 (for example, n is 5, 6, 7, 8, 9, or 10). In some cases, the cassette has a length of approximately 110 nucleotides to approximately 650 nucleotides (for example, 110 nucleotides (nt) to 115 nt, 115 nt to 120 nt, 500 nt to 600 nt, or 600 nt to 610 nt). In some cases, the cassette contains a Pol II transcription sequence. For example, in some cases, the cassette contains a polyadenylated sequence at 3' of a nucleotide sequence encoding a 3' flanking polynucleotide.

[0194] In some cases, the portion of the cassette encoding the 5' flanking polynucleotide contains the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO: 6). In some cases, the portion of the cassette encoding the loop polynucleotide contains the nucleotide sequence tgttctggcaatacctg (SEQ ID NO: 7). In some cases, the portion of the cassette encoding the 3' flanking polynucleotide contains the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO: 8). In some cases, the cassette contains a Pol3 transcription sequence. For example, in some cases, the cassette contains the nucleotide sequence TTTTTG at 3' of the nucleotide sequence encoding the 3' trailer polynucleotide. In some cases, the cassette has a length of approximately 110 to 150 nucleotides. In some cases, the cassette contains a Pol II transcription sequence. For example, in some cases, the cassette contains a polyadenylation sequence at 3' of the nucleotide sequence encoding the 3' flanking polynucleotide.

[0195] In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 9). In some cases, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO: 10). In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 9). Also, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO: 10).

[0196] In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggcgctatgcttcctgtgcccccagtggggccctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 11). In some cases, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtgggggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccgcccg (SEQ ID NO: 12).In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggcgctatgcttcctgtgcccccagtggggccctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 11). Furthermore, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtgggggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccgcccg (SEQ ID NO: 12).

[0197] In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggcgctatgcttcctgtgcccccagtggggccctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 13). In some cases, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtgggggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccgccc (SEQ ID NO: 14).In some cases, the cassette portion encoding the 5' flanking polynucleotide contains the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggcgctatgcttcctgtgcccccagtggggccctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 13). Furthermore, the cassette portion encoding the 3' flanking polynucleotide contains the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtgggggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccgccc (SEQ ID NO: 14).

[0198] The following is a non-restrictive example of a cassette. In the following cassette: (i) tgcacacctcctggcgggcagctctg (SEQ ID NO: 6) encodes a 5' leader polynucleotide; (ii) the first capital letter sequence encodes the first strand of the double-stranded RNA; (iii) tgttctggcaatacctg (SEQ ID NO: 7) encodes a loop polynucleotide; (iv) the second capital letter sequence encodes the second strand of the double-stranded RNA; (v) gggaggcctgccctgactgcccac (SEQ ID NO: 8) encodes a 3' trailer polynucleotide; and (vi) TTTTTG is the Pol3 transcription termination sequence. In some cases, the cassette does not contain the 3'TTTTTG sequence. In some cases, the cassette contains the nucleotide sequence T instead of the 3'TTTTTG sequence. n It includes n, where n is an integer between 5 and 10 (for example, n is 5, 6, 7, 8, 9, or 10). In some cases, the cassette contains the nucleotide sequence TTTTT instead of the 3'TTTTTG sequence.

[0199] Recombinant expression vector encoding sbRNA This disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule (wherein the recombinant RNA molecule may be referred to as “artificial microRNA” or “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a promoter that functions in eukaryotic cells. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a CAG promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a CBA promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an EF1α promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an H1 promoter. In some cases, recombinant expression vectors contain 5' adeno-associated virus (AAV) inverted terminal repeat (ITR) sequences and 3' AAV ITR sequences.

[0200] This disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant RNA molecule of the Disclosure, wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide (hereinafter also referred to herein as the “5' leader”), a loop polynucleotide, and a 3' flanking polynucleotide (hereinafter also referred to herein as the “3' trailer”), wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the first strand of the double-stranded RNA, iii) the loop polynucleotide, (iv) the second strand of the double-stranded RNA, and iii) the 3' trailer polynucleotide, wherein at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of the double-stranded RNA. This disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant RNA molecule of the Disclosure, wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide, a loop polynucleotide, and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the second strand of the double-stranded RNA, iii) a loop polynucleotide, iv) the first strand of the double-stranded RNA, and iii) a 3' flanking polynucleotide, wherein at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strand of the double-stranded RNA. In some cases, the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide are derived from miR33.

[0201] This disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant RNA molecule of the Disclosure, wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred herein as the “5' leader”) and a 3' flanking polynucleotide (also referred herein as the “3' trailer”), wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the first strand of the double-stranded RNA, iii) the second strand of the double-stranded RNA, and iv) the 3' trailer polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA. This disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant RNA molecule of the Disclosure, wherein the recombinant RNA molecule comprises a) the double-stranded RNA of the Disclosure, and b) a microRNA scaffold comprising a 5' flanking polynucleotide and a 3' flanking polynucleotide, wherein the recombinant nucleic acid comprises i) a 5' flanking polynucleotide, ii) the second strand of the double-stranded RNA, iii) the first strand of the double-stranded RNA, and iv) a 3' flanking polynucleotide, wherein one or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA. In some cases, the 5' flanking polynucleotide and the 3' flanking polynucleotide are derived from miR451.

[0202] Recombinant expression vectors including cassettes This disclosure provides a recombinant expression vector comprising a cassette of this disclosure ("DNA molecule"), wherein the cassette comprises a nucleotide sequence encoding a recombinant RNA molecule of this disclosure (wherein the recombinant RNA molecule may be referred to as "artificial microRNA" or "sbRNA"). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a promoter that functions in eukaryotic cells. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an EF1α promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably ligated to an H1 promoter. In some cases, recombinant expression vectors contain 5' adeno-associated virus (AAV) inverted terminal repeat (ITR) sequences and 3' AAV ITR sequences.

[0203] Composition, delivery medium, and virus particles This disclosure provides a delivery medium containing the recombinant expression vector of this disclosure. This disclosure provides viral particles containing the recombinant expression vector of this disclosure. This disclosure provides compositions containing the recombinant expression vector of this disclosure.

[0204] delivery vehicle The recombinant expression vectors of this disclosure may be present in the delivery medium. Accordingly, this disclosure provides a delivery medium containing the recombinant expression vectors of this disclosure. In some cases, the delivery medium is a nonviral delivery medium. In some cases, the delivery medium is lipid nanoparticles. In some cases, the delivery medium is a viral delivery medium. In some cases, the viral delivery medium is a recombinant AAV virion. Suitable AAV virions include those having an AAV2 capsid, an AAV9 capsid, and the like.

[0205] Suitable lipid nanoparticles may include, for example, one or more cationic lipids, poly(ethylene glycol)-modified lipids ("PEGylated lipids"). Suitable cationic lipids include XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((92,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine), NC98-5 (4,7,13-tris(3-oxo-3-(u This includes, but is not limited to, ddecylaminopropyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003, ICE, HGT5000, cis or trans HGT5001, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, and C12-200. Other suitable lipids that can be included in lipid nanoparticles include, but are not limited to, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho(1'-rac-glycerol)), and cholesterol.Suitable PEGylated lipids include, for example, PEG-DSG (1,2-distearoyl-rac-glycero-3-methoxypolyethylene glycol conjugated with, for example, PEG-1000, PEG-2000, PEG-5000, etc.), PEG-DMG (1,2-dimiristoyl-rac-glycerol conjugated with PEG), and PEG-ceramide.

[0206] Pharmaceutical composition This disclosure provides pharmaceutical compositions comprising a nucleic acid (e.g., DNA) encoding double-stranded RNA as described herein, an expression cassette, or a vector, and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” means a compound, material, composition, and / or dosage form suitable for use in contact with cells and / or tissues, within reasonable medical judgment, without excessive toxicity, irritation, allergic reactions, or other problems or complications, and with a reasonable benefit / risk ratio.

[0207] As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition, or carrier, such as a liquid or solid filler, stabilizer, dispersant, suspending agent, diluent, excipient, thickener, solvent, or encapsulating material, that is involved in transporting or delivering a compound useful in the present invention to or within a patient in order to perform its intended function. Each carrier must be “acceptable” in the sense that it is compatible with the other components of the formulation and is not harmful to the cells or tissues it comes into contact with. Further components that may be included in the pharmaceutical compositions used in the implementation of the present invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0208] As is well known in the medical field, the dosage for any one patient depends on many factors including the patient's size, weight, body surface area, age, level of inhibitory RNA expression required to achieve a therapeutic effect, stability of the inhibitory nucleic acid, specific disease being treated, stage of the disease, gender, time and route of administration, general health status, and other drugs being administered simultaneously.

[0209] In some cases, the rAAV described herein may be administered to a subject at about 1×10 6 VG (viral genome) to about 1×10 16 VG, or about 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 , 7×10 6 , 8×10 6 , 9×10 6 , 1×10 7 , 2×10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6×10 7 , 7×10 7 , 8×10 7 , 9×10 7 , 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , 1×10 9 , 2×10 <00000​​​​​​​​​​​​​​​​​​​​​、5×10 10 、6×10 10 、7×10 10 、8×10 10 、9×10 10 、1×10 11 、2×10 11 、2.1×10 11 、2.2×10 11 、2.3×10 11 、2.4×10 11 、2.5×10 11 、2.6×10 11 、2.7×10 11 、2.8×10 11 、2.9×10 11 、3×10 11 、4×10 11 、5×10 11 、6×10 11 、7×10 11 、7.1×10 11 、7.2×10 11 、7.3×10 11 、7.4×10 11 、7.5×10 11 、7.6×10 11 、7.7×10 11 、7.8×10 11 、7.9×10 11 、8×10 11 、9×10 11 、1×10 12 、1.1×10 12 、1.2×10 12 、1.3×10 12 、1.4×10 12 、1.5×10 12 、1.6×10 12 、1.7×10 12 、1.8×10 12 、1.9×10 12 、2×10 12 、3×10 12 、4×10 12 、4.1×10 12 、4.2×10 12 、4.3×10 12 、4.4×10 12 、4.5×10 12 、4.6×10 12 、4.7×1012 , 4.8×10 12 , 4.9×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , 8.1×10 12 , 8.2×10 12 , 8.3×10 12 , 8.4×10 12 , 8.5×10 12 , 8.6×10 12 , 8.7×10 12 , 8.8×10 12 , 8.9×10 12 , 9×10 12 , 1×10 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 6.7×10 13 , 7×10 13 , 8×10 13 , 9×10 13 , 1×10 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , 9×10 14 , 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , 9×10 15 , or 1×10 16 is administered in VG / amount of the subject.

[0210] In some cases, the rAAV particles described herein are administered to the subject at about 1×10 6 VG / kg to about 1×10 16 VG / kg, or about 1×10 6、2×10 6 、3×10 6 、4×10 6 、5×10 6 、6×10 6 、7×10 6 、8×10 6 、9×10 6 、1×10 7 、2×10 7 、3×10 7 、4×10 7 、5×10 7 、6×10 7 、7×10 7 、8×10 7 、9×10 7 、1×10 8 、2×10 8 、3×10 8 、4×10 8 、5×10 8 、6×10 8 、7×10 8 、8×10 8 、9×10 8 、1×10 9 、2×10 9 、3×10 9 、4×10 9 、5×10 9 、6×10 9 、7×10 9 、8×10 9 、9×10 9 、1×10 10 、2×10 10 、3×10 10 、4×10 10 、5×10 10 、6×10 10 、7×10 10 、8×10 10 、9×10 10 、1×10 11 、2×10 11 、2.1×10 11 、2.2×10 11 、2.3×10 11 、2.4×10 11 、2.5×10 11 、2.6×10 11 、2.7×10 11 、2.8×10 11 、2.9×1011 、3×10 11 、4×10 11 、5×10 11 、6×10 11 、7×10 11 、7.1×10 11 、7.2×10 11 、7.3×10 11 、7.4×10 11 、7.5×10 11 、7.6×10 11 、7.7×10 11 、7.8×10 11 、7.9×10 11 、8×10 11 、9×10 11 、1×10 12 、1.1×10 12 、1.2×10 12 、1.3×10 12 、1.4×10 12 、1.5×10 12 、1.6×10 12 、1.7×10 12 、1.8×10 12 、1.9×10 12 、2×10 12 、3×10 12 、4×10 12 、4.1×10 12 、4.2×10 12 、4.3×10 12 、4.4×10 12 、4.5×10 12 、4.6×10 12 、4.7×10 12 、4.8×10 12 、4.9×10 12 、5×10 12 、6×10 12 、7×10 12 、8×10 12 、8.1×10 12 、8.2×10 12 、8.3×10 12 、8.4×10 12 、8.5×10 12 、8.6×10 12 、8.7×10 12 、8.8×10 12 、8.9×10 12, 9×10 12 , 1 x 10 13 , 2×10 13 , 3 x 10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 6.7×10 13 , 7×10 13 , 8×10 13 , 9×10 13 , 1 x 10 14 , 2×10 14 , 3 x 10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , 9×10 14 , 1 x 10 15 , 2×10 15 , 3 x 10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , 9×10 15 , or 1 x 10 16 It is administered in VG / kg amounts.

[0211] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition being treated (or prevented), as determined by those skilled in the medical field. Appropriate doses of the composition, as well as preferred duration and frequency of administration, are determined by factors such as the patient's health status, patient size (i.e., weight, volume, or body area), the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. Generally, appropriate doses and treatment regimens provide the composition in an amount sufficient to provide therapeutic and / or preventive benefits (including, as described herein, improved clinical outcomes, e.g., more frequent complete or partial remission, longer disease-free survival and / or overall survival, or reduced severity of symptoms). For preventive use, the dose should be sufficient to prevent the disease, delay the onset of the disease, or reduce the severity of the disease in relation to the disease or disorder. The prophylactic benefits of compositions administered according to the methods described herein can be determined by conducting preclinical studies (including in vitro and in vivo animal studies) and clinical studies and by analyzing data obtained by appropriate statistical, biological, and clinical methods and techniques, all of which can be readily carried out by those skilled in the art.

[0212] Compositions (e.g., pharmaceutical compositions) may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subpia, parenchymal, striatal, intrathalamic, intracerebellar, intracranial, intracisional, intracerebral, intraventricular, intraocular, intraventricular, intralumbar, subcutaneous, percutaneous, intradermal, rectal, vaginal, intraperitoneal, topical (as powder, ointment, cream, and / or drops), mucous membrane, nose, cheek, and sublingual; by intratracheal infusion, bronchial infusion, and / or inhalation; and / or as oral spray, nasal spray, and / or aerosol. Generally, the most appropriate route of administration depends on various factors, including the properties of the active ingredient (e.g., stability in the gastrointestinal environment) and / or the condition of the subject. In some cases, the composition may be injected directly into the CNS of the subject. In some cases, direct injection into the CNS may be intracerebral injection, intraventricular injection, intraparenchymal injection, intrathecal injection, striatal injection, intrathalamic injection, subpiatric injection, or any combination thereof. In some cases, direct injection into the CNS may be direct injection into the cerebrospinal fluid (CSF) of the subject, and optionally, direct injection may be intracisional injection, intraventricular injection, and / or intralumbar injection. In some cases, the composition may be administered by a combination of direct injection into the CNS and by a route that does not involve direct injection into the CNS (e.g., intravenous injection).

[0213] In some cases, pharmaceutical compositions containing rAAV particles may be particularly problematic when high concentrations of rAAV particles are present (for example, 約 10 13 The formulation is designed to reduce the aggregation of rAAV particles (VG / ml or higher). Methods for reducing the aggregation of rAAV particles are well known in the art and include, for example, the addition of surfactants, pH adjustment, and salt concentration adjustment (see, for example, Wright FR, et al., Molecular Therapy (2005) 12:171-178, which is incorporated herein by reference in its entirety).

[0214] kit In some cases, the compositions provided herein may be assembled into pharmaceutical or research kits to facilitate their use in therapeutic or research applications. A kit may include one or more containers containing: (a) an expression cassette or vector encoding the double-stranded RNA described herein, (b) instructions for use, and optionally (c) a reagent for transducing kit component (a) into host cells. In some cases, kit component (a) may be a pharmaceutical formulation and dosage suitable for a particular mode of use and administration. For example, kit component (a) may be provided in unit-dose or multi-dose containers, such as sealed ampoules or vials. Kit components may require mixing of one or more components before use, or may be prepared in a pre-mixed state. Kit components may be in liquid or solid form and may require the addition of a solvent or further dilution. Kit components may be sterile. Instructions may be in written or electronic form and may accompany the kit (e.g., accompanying documentation, CD, DVD) or be provided via the internet or web-based communication. The kit may be shipped and stored at refrigerated or frozen temperatures.

[0215] Treatment method This disclosure provides nucleic acids (e.g., DNA), expression cassettes, recombinant expression vectors comprising cassettes, recombinant expression vectors encoding dsRNA, or pharmaceutical compositions for use in therapeutic methods.

[0216] This disclosure provides a method for selectively reducing the translation of disease-related CAG repeat-containing RNA in an individual having a CAG repeat extension disorder, the method comprising administering an effective amount of the recombinant expression vector of this disclosure, the delivery medium of this disclosure, the viral particles of this disclosure, or the pharmaceutical composition of this disclosure to the individual. In some cases, the repeat extension disorder is Huntington's disease, ataxia 1, ataxia 2, ataxia 3, ataxia 6, ataxia 7, ataxia 12, ataxia 17, spinal and bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, myotonic dystrophy type 1, Fuchs' corneal endothelial dystrophy, or cleidocranial dysplasia. In some cases, such administration involves direct injection into the central nervous system of the individual. In some cases, direct injection may be intracerebral injection, intraventricular injection, intraparenchymal injection, intrathecal injection, striatal injection, intrathalamic injection, intracisional injection, subpiatric injection, or any combination thereof. In some cases, the administration may provide a ratio of non-disease-related CAG repeat-encoded polypeptides to disease-related CAG repeat-encoded polypeptides greater than 1.0. In some cases, the administration may provide a ratio of non-disease-related CAG repeat-encoded polypeptides to disease-related CAG repeat-encoded polypeptides to disease-related CAG repeat-encoded polypeptides of 1.1 to 1.8 (e.g., 1.1 to 1.4, 1.4 to 1.6, or 1.6 to 1.8). In some cases, the administration provides a ratio of polypeptides encoded by non-disease-related CAG repeat-containing RNA to polypeptides encoded by disease-related CAG repeat-containing RNA that is greater than 1.8 (e.g., 2.0, 2.0-2.2, 2.2-2.4, 2.4-2.6, 2.6-2.8, 2.8-3.0). In some cases, the administration provides a ratio of polypeptides encoded by non-disease-related CAG repeat-containing RNA to polypeptides encoded by disease-related CAG repeat-containing RNA that is greater than 5.0 (e.g., 3.1-3.3, 3.3-3.5, 3.5-3.7, 3.9-4.1, 4.1-4.3, 4.3-4.5, 4.5-4.7, 4.7-5.0).

[0217] This disclosure provides a method for reducing or inhibiting the expression of CAG repeat-containing RNA (e.g., mRNA or pre-mRNA) in mammalian cells, comprising introducing the dsRNA or recombinant expression vector of the present invention into mammalian cells.

[0218] In some cases, inhibiting the expression of CAG repeat-containing mRNA may include, for example, inhibiting the expression of polyglutamine-containing proteins encoded by CAG repeat-containing mRNA by binding to the CAG repeat region of the CAG repeat-containing mRNA and blocking the translation of the CAG repeat-containing protein rather than by degradation of the CAG repeat-containing mRNA.

[0219] In some cases, this method reduces or inhibits the expression of pathological or pathogenic alleles of CAG repeat-containing RNA. In some cases, this method selectively reduces or inhibits the expression of pathological or pathogenic alleles of CAG repeat-containing RNA compared to the expression of normal alleles of CAG repeat-containing RNA.

[0220] In some cases, double-stranded RNA is contained within pre-miRNA scaffolds, pri-miRNA scaffolds, or shRNA. In some cases, double-stranded RNA is cleaved by DROSHA and / or DICER in mammalian cells to produce siRNA.

[0221] In some cases, the amount of siRNA produced from dsRNA in mammalian cells is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the amount of siRNA produced from double-stranded RNA by mammalian cells. The percentage of accurately processed siRNA from double-stranded RNA can be measured by obtaining the number of RNA sequence reads that have an accurately processed 5' end and align to a reference transcript containing a reference CAG repeat region, and dividing this by the total number of RNA sequence reads of siRNA that align to the reference transcript containing a reference CAG repeat region.

[0222] In some cases, CAG repeat-containing mRNA or pre-mRNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, Ataxin 7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1. In some cases, CAG repeat-containing mRNA contains an expanded number of repeats.

[0223] In some cases, the mammalian cells are CNS cells. In some cases, the mammalian cells are non-neuronal or neuronal cells of the CNS. In some cases, non-neuronal cells of the CNS are glial cells, astrocytes, or microglia. In some cases, the mammalian cells are in vitro. In some cases, the mammalian cells are non-CNS cells. In some cases, the mammalian cells are fibroblasts. In some cases, the mammalian cells originate from subjects who have one or more symptoms of polyglutamine disease, are suspected of having polyglutamine disease, or are predisposed to polyglutamine disease.

[0224] This disclosure provides a method for reducing or inhibiting the expression of CAG repeat-containing mRNA in a subject requiring such reduction, the method comprising administering to a subject a nucleic acid molecule encoding the double-stranded RNA of this disclosure (e.g., DNA), an expression cassette containing the double-stranded RNA encoding

[0225] In some cases, inhibiting the expression of CAG repeat-containing mRNA includes, for example, inhibiting the expression of polyglutamine-containing proteins encoded by said CAG repeat-containing mRNA by binding to the CAG repeat region of the CAG repeat-containing mRNA and blocking or repressing the translation of the CAG repeat-containing protein rather than by degradation of the CAG repeat-containing mRNA.

[0226] In some cases, CAG repeat-containing mRNA or pre-mRNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1.

[0227] In some cases, CAG repeat-containing mRNA or pre-mRNA contains an expanded number of repeats. In some cases, subjects have polyglutamine disease, meaning they exhibit symptoms of polyglutamine disease. In some cases, subjects are at risk of developing polyglutamine disease but have not yet shown signs of it. In some cases, polyglutamine disease is associated with HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1. In some cases, polyglutamine disorders are neurodegenerative diseases. In some cases, the subjects may have Huntington's disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, amyotrophic lateral sclerosis, spinal and bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, cleidocranial dysplasia, retinitis pigmentosa, myotonic dystrophy type 1, Fuchs corneal endothelial dystrophy, or branchio-otorenal syndrome type 2, or Huntington's disease. He is at risk of developing Chinton's disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, amyotrophic lateral sclerosis, spinal and bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, cleidocranial dysplasia, retinitis pigmentosa, myotonic dystrophy type 1, Fuchs corneal endothelial dystrophy, or branchio-otorenal syndrome type 2, and has not yet shown signs of the disease.

[0228] The Disclosure also provides a method for treating subjects who have or are at risk of developing a polyglutamine disease, the method comprising administering to a subject a nucleic acid molecule encoding the double-stranded RNA of the Disclosure (e.g., DNA), an expression cassette containing the double-stranded RNA encoding

[0229] As used herein, the term “treat” means to prevent or delay the onset of a polyglutamine disorder, reduce the severity of a polyglutamine disorder, reduce or prevent the occurrence of symptoms characteristic of a polyglutamine disorder, prevent the exacerbation of symptoms characteristic of a polyglutamine disorder, or any combination thereof. In some cases, the treatment of a subject involves a subject who has a polyglutamine disorder or is at risk of developing a polyglutamine disorder but has not yet shown signs of one.

[0230] In some cases, the therapeutic methods of the Disclosure include administration as monotherapy for the treatment of polyglutamine diseases, or in combination with one or more additional therapies. Combination therapy may mean administering the compositions of the Disclosure (e.g., a nucleic acid molecule encoding double-stranded RNA of the Disclosure (e.g., DNA), an expression cassette containing a nucleic acid molecule encoding double-stranded RNA of the Disclosure, a vector containing a nucleic acid molecule encoding double-stranded RNA of the Disclosure, or the pharmaceutical composition thereof) concurrently with, before, or after one or more additional therapies. Concurrent administration of combination therapy may mean that the compositions of the Disclosure (e.g., a nucleic acid molecule encoding double-stranded RNA of the Disclosure (e.g., DNA), an expression cassette containing a nucleic acid molecule encoding double-stranded RNA of the Disclosure, a vector containing a nucleic acid molecule encoding double-stranded RNA of the Disclosure, or the pharmaceutical composition thereof) and the additional therapy are formulated for administration in the same dosage form or are administered in separate dosage forms.

[0231] In some cases, CAG repeat-containing RNA is mRNA or pre-mRNA transcript. In some cases, CAG repeat-containing RNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPL, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1.

[0232] In some cases, processed artificial miRNAs target pathogenic or pathological alleles of CAG repeat-containing RNA. In some cases, processed artificial miRNAs selectively target pathogenic or pathological alleles of CAG repeat-containing RNA compared to normal alleles of CAG repeat-containing RNA. In some cases, pathogenic or pathological alleles of CAG repeat-containing RNA contain at least 30 consecutive CAG repeats.

[0233] In some cases, the cells are within the subject. In some cases, the subject is human. In some cases, the subject has or is suspected of having CAG repeat extension disorder.

[0234] This disclosure also provides a method for inhibiting the expression of CAG repeat-containing RNA in cells, comprising administering to cells (a) a viral vector encoding double-stranded RNA according to any of the embodiments described herein, or (b) a viral vector encoding artificial miRNA.

[0235] In some cases, CAG repeat-containing RNA is mRNA or pre-mRNA transcript. In some cases, CAG repeat-containing RNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1.

[0236] In some cases, the guide sequence of the artificial miRNA has zero predicted perfectly matching off-target transcripts. In some cases, the guide sequence of the artificial miRNA has 0 to 1 predicted off-target transcript with a perfect 17-mer match within guide sequence positions 1 to 21. In some cases, the guide sequence of the artificial miRNA has zero predicted perfectly matching off-target transcripts. In some cases, the guide sequence of the artificial miRNA has 0 to 4 predicted off-target transcripts with a perfect 17-mer match within guide sequence positions 1 to 21. In some cases, the guide sequence of the artificial miRNA with one substitution has 0 to 2 predicted off-target transcripts.

[0237] In some cases, the cells are within the subject. In some cases, the subject is human. In some cases, the subject has or is suspected of having CAG repeat extension disorder.

[0238] In some cases, the subject treated by any of the methods described herein may be a mammal (e.g., mouse, rat), preferably a primate (e.g., monkey, chimpanzee), or a human.

[0239] In any of the therapeutic methods described herein, the compositions of the Disclosure (e.g., nucleic acids or expression cassettes, vectors, or pharmaceutical compositions encoding double-stranded RNA according to the Disclosure) may be administered to a subject by intrathecal, subpia, parenchymal, striatal, intracranial, intrathalamic, intracerebellar(?), intracisional, intracerebral, intraventricular, intraocular, intraventricular, intraventricular, intralumbar, intraocular, parenteral, intravenous, intramuscular, intraarterial, subcutaneous, transdermal, intercutaneous, rectal, vaginal, intraperitoneal, mucosal administration, or any combination thereof.

[0240] In some cases, the compositions of this disclosure (e.g., inhibitory nucleic acids, isolated nucleic acids containing expression cassettes encoding inhibitory nucleic acids, vectors, rAAV particles, pharmaceutical compositions) are injected directly into the CNS of the subject. In some cases, direct injection into the CNS is intracerebral injection, intraparenchymal injection, intrathecal injection, intrathalamic injection, subpiatric injection, or any combination thereof. In some cases, direct injection into the CNS is intraventricular injection. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, and optionally, direct injection is intracisional injection, intraventricular injection, intralumbar injection, or any combination thereof. In some cases, administration to the subject is achieved by a combination of direct injection into the CNS and a route that is not directly injected into the CNS (e.g., intravenous).

[0241] In some cases, the methods of the present disclosure reduce the level of glutamine (Gln) repeat-containing protein in cells by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more compared to the level of Gln repeat-containing protein in cells that have not been in contact with double-stranded RNA. In some cases, the method of this disclosure can be used to compare the level of Gln repeat-containing protein in cells with the level of Gln repeat-containing protein in cells not in contact with double-stranded RNA, resulting in levels of 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, and 3 Reduce by 0-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%. In some cases, the method of this disclosure reduces the level of pathogenicity or pathological morphology of a Gln repeat-containing protein. In some cases, the pathogenicity or pathological morphology of a Gln repeat-containing protein includes at least 30 consecutive Gln repeats.

[0242] In some cases, the method of the present disclosure reduces the level of Gln repeat-containing protein in the target CNS by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to the level of Gln repeat-containing protein in the untreated target CNS. In some cases, the method of this disclosure compares the level of Gln repeat-containing protein in the target CNS with the level of Gln repeat-containing protein in the untreated target CNS to 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30 Reduce by ~70%, 30~80%, 30~90%, 30~95%, 30~100%, 40~50%, 40~60%, 40~70%, 40~80%, 40~90%, 40~95%, 40~100%, 50~60%, 50~70%, 50~80%, 50~90%, 50~95%, 50~100%, 60~70%, 60~80%, 60~90%, 60~95%, 60~100%, 70~80%, 70~90%, 70~95%, 70~100%, 80~90%, 80~95%, 80~100%, 90~95%, 90~100%. In some cases, the method of this disclosure reduces the level of pathogenicity or pathological morphology of a Gln repeat-containing protein in the CNS of interest. In some cases, the pathogenicity or pathological morphology of a Gln repeat-containing protein includes at least 30 consecutive Gln repeats.

[0243] In some cases, the methods of the present disclosure provide a selective reduction in the level of pathogenicity or pathological morphology of a Gln repeat-containing protein (having elongated Gln repeats in cells). In some cases, the pathogenicity or pathological morphology of the Gln repeat-containing protein contains at least 30 consecutive Gln repeats. In some cases, the selective reduction in the pathogenicity or pathological morphology of the Gln repeat-containing protein is at least 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, or more compared to the reduction in the level of the normal (wild-type) morphology of the Gln repeat-containing protein. In some cases, Gln repeat-containing proteins are transcribed from one or more of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.

[0244] In some cases, the methods of the present disclosure are used for the selective reduction of the expression or activity of a pathogenic or pathological allele of CAG repeat-containing RNA (having elongated CAG repeats in cells). In some cases, the pathogenic or pathological allele of CAG repeat-containing RNA contains at least 30 consecutive CAG repeats. In some cases, the selective reduction of the pathogenic or pathological allele of CAG repeat-containing RNA is at least 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, or more compared to the reduction in the expression of a normal (wild-type) allele of CAG repeat-containing RNA. In some cases, CAG repeat-containing RNA is transcribed from one or more of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.

[0245] In some cases, the methods of this disclosure are used for the selective reduction of the expression or activity of pathogenic or pathological alleles of CAG repeat-containing RNA in the CNS of a subject. In some cases, pathogenic or pathological alleles of CAG repeat-containing RNA contain at least 30 consecutive CAG repeats. In some cases, the selective reduction of CAG repeat-containing RNA having elongated CAG repeats is at least 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, or more compared to the normal (wild-type) allele for CAG repeat-containing RNA. In some cases, the subject has or is suspected of having a CAG repeat elongation disorder or impairment. In some cases, CAG repeat-containing RNA is transcribed from one or more of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.

[0246] Examples of non-limiting aspects of this disclosure Embodiments of the subject matter described above, including those described above, may be useful on their own or in combination with one or more other embodiments or forms. Without limiting the foregoing description, certain non-limiting embodiments of the disclosure are provided below. As will be apparent to those skilled in the art upon reading the disclosure, each of the individually numbered embodiments may be used with or combined with any of the preceding or succeeding individually numbered embodiments. This is intended to provide support for all combinations of such embodiments, and is not limited to the combinations of embodiments expressly provided below.

[0247] Embodiment 1. A double-stranded RNA comprising a) a first strand that hybridizes with a target CAG repeat region of a CAG repeat-containing RNA, and b) a second strand that hybridizes with the first strand, wherein the first strand is i) A first mismatch with respect to the target CAG repeat region, and ii) At least a second mismatch with respect to the target CAG repeat region Includes, i) If the first mismatch is at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), then the second mismatch is located 9-13 bases 3' to the first mismatch, ii) If the first mismatch is at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), then the second mismatch is located 8 to 12 bases 3' to the first mismatch, iii) If the first mismatch is at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), then the second mismatch is 7 to 11 bases 3' to the first mismatch, and iv) If the first mismatch is at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), the double-stranded RNA wherein the second mismatch is located 6 to 10 bases 3' to the first mismatch. Embodiment 2. The double-stranded RNA according to Embodiment 1, wherein each mismatch is generated by a substitution independently selected from a) a substitution of G to A, U, or C, b) a substitution of U to A, G, or C, and c) a substitution of C to A, U, or G. Embodiment 3. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes: i) a first mismatch to the target CAG repeat region, the first mismatch located at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG(SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU(SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3)); and ii) a second mismatch to the target CAG repeat region, the second mismatch located 9 to 13 bases 3' to the first mismatch. Embodiment 4. The double-stranded RNA according to any one of Embodiments 1 to 3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence:CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch. Embodiment 5. The double-stranded RNA according to any one of Embodiments 1 to 3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch. Embodiment 6. A double-stranded RNA according to any one of Embodiments 1 to 3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence:UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch. Embodiment 7. The double-stranded RNA according to any one of Embodiments 3 to 6, wherein the first strand contains no more than two mismatches with the target CAG repeat region. Embodiment 8. The double-stranded RNA according to any one of Embodiments 3 to 6, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 9. The double-stranded RNA according to any one of Embodiments 3 to 6, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 10. The double-stranded RNA according to Embodiment 3 or Embodiment 4, wherein the first strand comprises a nucleotide sequence selected from the group consisting of CUGCUGCAGCUGCUGCAGCUG (SEQ ID NO: 51), CUGCUGCAGCUGCUGCUACUG (SEQ ID NO: 52), CUGCUGCAGCUGCUGCUGAUG (SEQ ID NO: 53), CUGCUGCAGCUGCUGCUGCAG (SEQ ID NO: 54), and CUGCUGCCAGCUGCUGCUGCUA (SEQ ID NO: 55). Embodiment 11. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch to the target CAG repeat region, the second mismatch and the third mismatch being 9 to 13 bases 3' to the first mismatch. Embodiment 12. A double-stranded RNA according to any one of Embodiments 1, 2, and 11, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch. Embodiment 13. A double-stranded RNA according to any one of Embodiments 1, 2, and 11, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence GCUGUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch. Embodiment 14. A double-stranded RNA according to any one of Embodiments 1, 2, and 11, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch. Embodiment 15. The double-stranded RNA according to any one of Embodiments 11 to 14, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 16. The double-stranded RNA according to any one of Embodiments 11 to 14, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 17. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being located at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region. Embodiment 18. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 9 to 13 bases 3' to the first mismatch. Embodiment 19. A double-stranded RNA according to any one of Embodiments 1, 2, and 18, wherein the first strand is a variant comprising at least a first, second, third, and fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 9 to 13 bases 3' to the first mismatch. Embodiment 20. A double-stranded RNA according to any one of Embodiments 1, 2, and 18, wherein the first strand is a variant comprising at least a first, second, third, and fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 9 to 13 bases 3' to the first mismatch. Embodiment 21. A double-stranded RNA according to any one of Embodiments 1, 2, and 18, wherein the first strand is a variant comprising at least a first, second, third, and fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 9 to 13 bases 3' to the first mismatch. Embodiment 22. The double-stranded RNA according to any one of Embodiments 18 to 21, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 23. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes: i) a first mismatch to the target CAG repeat region, the first mismatch located at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUG (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)); and ii) a second mismatch to the target CAG repeat region, the second mismatch located 8 to 12 bases 3' to the first mismatch. Embodiment 24. The double-stranded RNA according to any one of Embodiments 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch. Embodiment 25. The double-stranded RNA according to any one of Embodiments 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 9 based on the numbering of GCUGUCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch. Embodiment 26. The double-stranded RNA according to any one of Embodiments 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch. Embodiment 27. The double-stranded RNA according to any one of Embodiments 23 to 26, wherein the first strand contains no more than two mismatches with the target CAG repeat region. Embodiment 28. The double-stranded RNA according to any one of Embodiments 23 to 26, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 29. The double-stranded RNA according to any one of Embodiments 23 to 26, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 30. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first mismatch is located at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch with respect to the target CAG repeat region, wherein the second and third mismatches are located 8 to 12 bases 3' to the first mismatch. Embodiment 31. A double-stranded RNA according to any one of Embodiments 1, 2, and 30, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 8 to 12 bases 3' to the first mismatch. Embodiment 32. A double-stranded RNA according to any one of Embodiments 1, 2, and 30, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence GCUGUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 9 based on the numbering of GCUGUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 8 to 12 bases 3' to the first mismatch. Embodiment 33. A double-stranded RNA according to any one of Embodiments 1, 2, and 30, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 8 to 12 bases 3' to the first mismatch. Embodiment 34. The double-stranded RNA according to any one of Embodiments 30 to 33, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 35. The double-stranded RNA according to any one of Embodiments 30 to 33, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 36. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 8 to 12 bases 3' to the first mismatch. Embodiment 37. A double-stranded RNA according to any one of Embodiments 1, 2, and 36, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 743), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 8 to 12 bases 3' to the first mismatch. Embodiment 38. A double-stranded RNA according to any one of Embodiments 1, 2, and 36, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 8 to 12 bases 3' to the first mismatch. Embodiment 39. A double-stranded RNA according to any one of Embodiments 1, 2, and 36, wherein the first strand is a variant comprising at least a first, second, third, and fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCGCUGC (Sequence ID 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 8 to 12 bases 3' to the first mismatch. Embodiment 40. The double-stranded RNA according to any one of Embodiments 36 to 39, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 41. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes: i) a first mismatch to the target CAG repeat region, which is located at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)); and ii) a second mismatch to the target CAG repeat region, which is located 7 to 11 bases 3' to the first mismatch. Embodiment 42. The double-stranded RNA according to any one of Embodiments 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 7 to 11 bases 3' to the first mismatch. Embodiment 43. The double-stranded RNA according to any one of Embodiments 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), wherein the first substitution generates the first mismatch and is located at position 10 based on the numbering of GCUGUCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generates the second mismatch and is located 7 to 11 bases 3' to the first mismatch. Embodiment 44. The double-stranded RNA according to any one of Embodiments 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGC(SEQ ID NO: 3), and the second substitution generating the second mismatch and located 7 to 11 bases 3' to the first mismatch. Embodiment 45. The double-stranded RNA according to any one of Embodiments 41 to 44, wherein the first strand contains no more than two mismatches with the target CAG repeat region. Embodiment 46. The double-stranded RNA according to any one of Embodiments 41 to 44, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 47. The double-stranded RNA according to any one of Embodiments 41 to 44, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 48. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first mismatch is located at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch with respect to the target CAG repeat region, wherein the second and third mismatches are located 7 to 11 bases 3' to the first mismatch. Embodiment 49. A double-stranded RNA according to any one of Embodiments 1, 2, or 48, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch. Embodiment 50. A double-stranded RNA according to any one of Embodiments 1, 2, or 48, wherein the first strand is a variant comprising at least a first, second, and third substitution of the nucleotide sequence GCUGUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 10 based on the numbering of GCUGUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch. Embodiment 51. A double-stranded RNA according to any one of Embodiments 1, 2, or 48, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch. Embodiment 52. The double-stranded RNA according to any one of Embodiments 48 to 51, wherein the first strand contains no more than three mismatches with the target CAG repeat region. Embodiment 53. The double-stranded RNA according to any one of Embodiments 48 to 51, wherein the first strand contains no more than four mismatches with the target CAG repeat region. Embodiment 54. The double-stranded RNA according to Embodiment 1 or Embodiment 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 1 to 6 bases 3' to the first mismatch. Embodiment 55. The double-stranded RNA according to Embodiment 1, 2, or 54, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions located 7 to 11 bases 3' to the first mismatch. Embodiment 56. The double-stranded RNA according to Embodiment 1, 2, or 54, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions located 7 to 11 bases 3' to the first mismatch. Embodiment 57. The double-stranded RNA according to Embodiment 1, 2, or 54, wherein the first strand is a variant comprising at least a first, second, third, and fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (Sequence ID 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 7 to 11 bases 3' to the first mismatch. Embodiment 58. The double-stranded RNA according to any one of Embodiments 54 to 57, wherein the first strand contains no more ...

Claims

1. It is double-stranded RNA, a) A first strand that hybridizes with the target CAG repeat region of the CAG repeat-containing RNA, and b) A second chain that hybridizes with the first chain. Includes, The first chain, i) A first mismatch with respect to the target CAG repeat region, and ii) At least a second mismatch with respect to the target CAG repeat region Includes, i) If the first mismatch is at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), then the second mismatch is located 9 to 13 bases 3' to the first mismatch, ii) If the first mismatch is at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 3)), then the second mismatch is 8 to 12 bases 3' to the first mismatch, iii) If the first mismatch is at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), then the second mismatch is 7 to 11 bases 3' to the first mismatch, and iv) If the first mismatch is at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), then the second mismatch is located 6 to 10 bases 3' to the first mismatch, The aforementioned double-stranded RNA.

2. Each mismatch, a) Substitution of G with A, U, or C, b) Substitution of U with A, G, or C, c) Substitution of C with A, U, or G The double-stranded RNA according to claim 1, generated by substitutions independently selected from.

3. The first chain, i) A first mismatch with respect to the target CAG repeat region, the first mismatch located at position 8 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCUGCUGCUGCUGCUGCUGC (sequence number 3)), and ii) A second mismatch with respect to the target CAG repeat region, the second mismatch being located 9 to 13 bases 3' on the side of the first mismatch. The double-stranded RNA according to claim 1 or claim 2, comprising:

4. The double-stranded RNA according to any one of claims 1 to 3, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch.

5. The double-stranded RNA according to any one of claims 1 to 3, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch.

6. The double-stranded RNA according to any one of claims 1 to 3, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence: UGCUGCUCUGCUGCUCUGCUGCUC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUCUGCUGCUCUCUCUCUC (SEQ ID NO: 3), and the second substitution generating the second mismatch and located 9 to 13 bases 3' to the first mismatch.

7. The double-stranded RNA according to any one of claims 3 to 6, wherein the first strand includes no more than two mismatches with the target CAG repeat region.

8. The double-stranded RNA according to any one of claims 3 to 6, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

9. The double-stranded RNA according to any one of claims 3 to 6, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

10. The first chain, CUGCUGCAGCUCUGCUGCAGCUG (Sequence No. 51), CUGCUGCAGCUGCUGCUACUG (Sequence ID 52), CUGCUGCAGCUCUGCUGCUGAUGAUG (Sequence ID 53), CUGCUGCAGCUGCUGCUGCAGAG (SEQ ID NO: 54), and CUGCUGCAGCUCUGCUGCUGCUA (Sequence No. 55) The double-stranded RNA according to claim 3 or claim 4, comprising a nucleotide sequence selected from the group consisting of the following.

11. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch to the target CAG repeat region, the second mismatch and the third mismatch being 9 to 13 bases 3' to the first mismatch.

12. The double-stranded RNA according to any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch.

13. The double-stranded RNA according to any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch.

14. The double-stranded RNA according to any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGCUC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUCUGCUGCUCUCUCUCUC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 9 to 13 bases 3' to the first mismatch.

15. The double-stranded RNA according to any one of claims 11 to 14, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

16. The double-stranded RNA according to any one of claims 11 to 14, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

17. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region.

18. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch with respect to the target CAG repeat region, the first mismatch being at position 8 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch with respect to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 9 to 13 bases 3' of the first mismatch.

19. The double-stranded RNA according to any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 9 to 13 bases 3' of the first mismatch.

20. The double-stranded RNA according to any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 9 to 13 bases 3' of the first mismatch.

21. The double-stranded RNA according to any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence UGCUGCUCUGCUUGCUUGCUUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 8 based on the numbering of UGCUGCUCUGCUUGCUUGCUGC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 9 to 13 bases 3' to the first mismatch.

22. The double-stranded RNA according to any one of claims 18 to 21, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

23. The first chain, i) A first mismatch with respect to the target CAG repeat region, the first mismatch located at position 9 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCUGCUGCUGCUGCUGCUGC (sequence number 3)), and ii) A second mismatch with respect to the target CAG repeat region, the second mismatch being located 8 to 12 bases 3' on the side of the first mismatch. The double-stranded RNA according to claim 1 or claim 2, comprising:

24. The double-stranded RNA according to any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch.

25. The double-stranded RNA according to any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch.

26. The double-stranded RNA according to any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), and the second substitution generating the second mismatch and located 8 to 12 bases 3' to the first mismatch.

27. The double-stranded RNA according to any one of claims 23 to 26, wherein the first strand includes no more than two mismatches with the target CAG repeat region.

28. The double-stranded RNA according to any one of claims 23 to 26, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

29. The double-stranded RNA according to any one of claims 23 to 26, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

30. The double-stranded RNA according to claim 1 or 2, wherein the first mismatch is located at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch with respect to the target CAG repeat region, wherein the second mismatch and the third mismatch are located 8 to 12 bases 3' to the first mismatch.

31. The double-stranded RNA according to any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 8 to 12 bases 3' to the first mismatch.

32. The double-stranded RNA according to any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and being at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions being 8 to 12 bases 3' to the first mismatch.

33. The double-stranded RNA according to any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUUGCUUGCUUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUGCUUGCUUGCUGCUGCUGC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 8 to 12 bases 3' to the first mismatch.

34. The double-stranded RNA according to any one of claims 30 to 33, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

35. The double-stranded RNA according to any one of claims 30 to 33, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

36. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch with respect to the target CAG repeat region, the first mismatch being at position 9 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or SEQ ID NO: 3 (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch with respect to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 8 to 12 bases 3' of the first mismatch.

37. The double-stranded RNA according to any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and being at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 743), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 8 to 12 bases 3' of the first mismatch.

38. The double-stranded RNA according to any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and being at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 8 to 12 bases 3' of the first mismatch.

39. The double-stranded RNA according to any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGCUC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 9 based on the numbering of UGCUGCUCUGCUGCUCUCUCUC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being located 8 to 12 bases 3' to the first mismatch.

40. The double-stranded RNA according to any one of claims 36 to 39, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

41. The first chain, i) A first mismatch with respect to the target CAG repeat region, the first mismatch located at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and ii) A second mismatch with respect to the target CAG repeat region, the second mismatch being located 7 to 11 bases 3' on the side of the first mismatch. The double-stranded RNA according to claim 1 or claim 2, comprising:

42. The double-stranded RNA according to any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 7 to 11 bases 3' to the first mismatch.

43. The double-stranded RNA according to any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 7 to 11 bases 3' to the first mismatch.

44. The double-stranded RNA according to any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), and the second substitution generating the second mismatch and located 7 to 11 bases 3' to the first mismatch.

45. The double-stranded RNA according to any one of claims 41 to 44, wherein the first strand includes no more than two mismatches with the target CAG repeat region.

46. The double-stranded RNA according to any one of claims 41 to 44, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

47. The double-stranded RNA according to any one of claims 41 to 44, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

48. The double-stranded RNA according to claim 1 or 2, wherein the first mismatch is located at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch with respect to the target CAG repeat region, wherein the second mismatch and the third mismatch are located 7 to 11 bases 3' to the first mismatch.

49. The double-stranded RNA according to any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch.

50. The double-stranded RNA according to any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch.

51. The double-stranded RNA according to any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGCUC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUCUGCUGCUCUCUCUC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 7 to 11 bases 3' to the first mismatch.

52. The double-stranded RNA according to any one of claims 48 to 51, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

53. The double-stranded RNA according to any one of claims 48 to 51, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

54. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being at position 10 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 1 to 6 bases 3' to the first mismatch.

55. The double-stranded RNA according to claim 1, 2, or 54, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 7 to 11 bases 3' of the first mismatch.

56. The double-stranded RNA according to claim 1, 2, or 54, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and being at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 7 to 11 bases 3' of the first mismatch.

57. The double-stranded RNA according to claim 1, 2, or 54, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence UGCUGCUCUGCUUGCUUGCUUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 10 based on the numbering of UGCUGCUCUGCUUGCUUGCUGC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 7 to 11 bases 3' of the first mismatch.

58. The double-stranded RNA according to any one of claims 54 to 57, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

59. The first chain, i) A first mismatch with respect to the target CAG repeat region, the first mismatch located at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and ii) A second mismatch with respect to the target CAG repeat region, the second mismatch being located 6 to 10 bases 3' on the side of the first mismatch. The double-stranded RNA according to claim 1 or claim 2, comprising:

60. The double-stranded RNA according to any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), and the second substitution generating the second mismatch and located 6 to 10 bases 3' to the first mismatch.

61. The double-stranded RNA according to any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), and the second substitution generating the second mismatch and located 6 to 10 bases 3' to the first mismatch.

62. The double-stranded RNA according to any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least first and second substitutions of the nucleotide sequence UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 11 based on the numbering of UGCUGCUCUGCUGCUCUGCUGC (SEQ ID NO: 3), and the second substitution generating the second mismatch and located 6 to 10 bases 3' to the first mismatch.

63. The double-stranded RNA according to any one of claims 59 to 62, wherein the first strand includes no more than two mismatches with the target CAG repeat region.

64. The double-stranded RNA according to any one of claims 59 to 62, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

65. The double-stranded RNA according to any one of claims 59 to 62, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

66. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch to the target CAG repeat region, the first mismatch being located at position 11 based on the numbering of SEQ ID NO: 1 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch and a third mismatch to the target CAG repeat region, the second mismatch and the third mismatch being 6 to 10 bases 3' to the first mismatch.

67. The double-stranded RNA according to any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 6 to 10 bases 3' to the first mismatch.

68. The double-stranded RNA according to any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 6 to 10 bases 3' to the first mismatch.

69. The double-stranded RNA according to any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least first, second, and third substitutions of the nucleotide sequence UGCUGCUGCUUGCUUGCUUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 11 based on the numbering of UGCUGCUGCUUGCUUGCUGCUC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, and the second and third substitutions located 6 to 10 bases 3' to the first mismatch.

70. The double-stranded RNA according to any one of claims 66 to 69, wherein the first strand includes no more than three mismatches with the target CAG repeat region.

71. The double-stranded RNA according to any one of claims 66 to 69, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

72. The double-stranded RNA according to claim 1 or 2, wherein the first strand includes a first mismatch with respect to the target CAG repeat region, the first mismatch being at position 11 (CUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 1)), SEQ ID NO: 2 (GCUGCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 2)), or (UGCUGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 3)), and the first strand includes a second mismatch, a third mismatch, and a fourth mismatch with respect to the target CAG repeat region, the second mismatch, the third mismatch, and the fourth mismatch being 6 to 10 bases 3' of the first mismatch.

73. The double-stranded RNA according to any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the first substitution generating the first mismatch and located at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUGCUG (Sequence ID 1), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 6 to 10 bases 3' of the first mismatch.

74. The double-stranded RNA according to any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the first substitution generating the first mismatch and being located at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCUGCU (Sequence ID 2), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 6 to 10 bases 3' to the first mismatch.

75. The double-stranded RNA according to any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least first, second, third, and fourth substitutions of the nucleotide sequence UGCUGCUCUGCUUGCUUGCUUGCUGC (SEQ ID NO: 3), the first substitution generating the first mismatch and located at position 11 based on the numbering of UGCUGCUCUGCUUGCUUGCUGC (SEQ ID NO: 3), the second substitution generating the second mismatch, the third substitution generating the third mismatch, the fourth substitution generating the fourth mismatch, and the second, third, and fourth substitutions being 6 to 10 bases 3' to the first mismatch.

76. The double-stranded RNA according to any one of claims 72 to 75, wherein the first strand includes no more than four mismatches with the target CAG repeat region.

77. It is double-stranded RNA, A) A first strand that hybridizes with the target CAG repeat region of the CAG repeat-containing RNA, and B) A second strand that hybridizes with the first strand. Includes, a) The first chain includes a first mismatch, a second mismatch, and a third mismatch, i) The first mismatch is located at position 8 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 8 bases 3' on the side of the first mismatch, iii) The third mismatch is located 9 to 13 bases 3' of the first mismatch; b) The first chain includes a first mismatch, a second mismatch, and a third mismatch, i) The first mismatch is located at position 9 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 7 bases 3' on the side of the first mismatch, iii) The third mismatch is located 8 to 12 bases 3' on the first mismatch; c) The first chain includes a first mismatch, a second mismatch, and a third mismatch, i) The first mismatch is located at position 10 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 6 bases 3' on the first mismatch, iii) The third mismatch is located 7 to 11 bases 3' on the first mismatch; d) The first chain includes a first mismatch, a second mismatch, and a third mismatch, i) The first mismatch is located at position 11 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 5 bases 3' on the first mismatch, iii) The third mismatch is located 6 to 10 bases 3' on the first mismatch; e) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 8 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 8 bases 3' on the side of the first mismatch, iii) The third mismatch is located 1 to 8 bases 3' on the first mismatch, iv) The fourth mismatch is located 9 to 13 bases 3' of the first mismatch; f) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 8 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 8 bases 3' on the side of the first mismatch, iii) The third mismatch is located 9 to 13 bases 3' on the first mismatch, iv) The fourth mismatch is located 9 to 13 bases 3' of the first mismatch; g) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 9 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 7 bases 3' on the side of the first mismatch, iii) The third mismatch is located 1 to 7 bases 3' on the first mismatch, iv) The fourth mismatch is located 8 to 12 bases 3' on the first mismatch; h) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 9 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or sequence number 3 (UGCUGCCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 7 bases 3' on the side of the first mismatch, iii) The third mismatch is located 8 to 12 bases 3' on the first mismatch, iv) The fourth mismatch is located 8 to 12 bases 3' on the first mismatch; i) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 10 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 6 bases 3' on the first mismatch, iii) The third mismatch is located 1 to 6 bases 3' on the first mismatch, iv) The fourth mismatch is located 7 to 11 bases 3' of the first mismatch; j) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, i) The first mismatch is located at position 10 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 6 bases 3' on the first mismatch, iii) The third mismatch is located 7 to 11 bases 3' on the first mismatch, iv) The fourth mismatch is located 7 to 11 bases 3' of the first mismatch; k) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a third mismatch, i) The first mismatch is located at position 11 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 5 bases 3' on the first mismatch, iii) The third mismatch is located 1 to 5 bases 3' on the first mismatch, iv) A fourth mismatch is located 6 to 10 bases 3' of the first mismatch; or l) The first chain includes a first mismatch, a second mismatch, a third mismatch, and a third mismatch, i) The first mismatch is located at position 11 based on the numbering of sequence number 1 (CUGCUGCUGCUGCUGCUGCUGCUG (sequence number 1)), sequence number 2 (GCUGCUGCUGCUGCUGCUGCUGCU (sequence number 2)), or (UGGCUGCUGCUGCUGCUGCUGC (sequence number 3)), ii) The second mismatch is located 1 to 5 bases 3' on the first mismatch, iii) The third mismatch is located 6 to 10 bases 3' on the first mismatch, iv) The fourth mismatch is located 6 to 10 bases 3' of the first mismatch, Each mismatch, a) Substitution of G with A, U, or C, b) Substitution of U with A, G, or C, c) Substitution of C with A, U, or G Generated by substitutions selected independently of The aforementioned double-stranded RNA.

78. A double-stranded RNA comprising a first strand and a second strand, wherein the first strand comprises a nucleotide sequence selected from any one of the nucleotide sequences shown in Figure 7, Figures 8A-8C, Figures 9A-9L, Figure 10 (Table 3), and Figure 12 (Table 5).

79. The double-stranded RNA according to any one of claims 1 to 78, wherein the second strand is 100% complementary to the first strand.

80. The double-stranded RNA according to any one of claims 1 to 78, wherein the second strand contains 1 to 10 mismatches, 3 to 5 mismatches, 4 to 7 mismatches, or 5 to 10 mismatches with respect to the first strand.

81. a) The first and second strands of the double-stranded RNA each have a length of 18 to 25 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, or 19 to 21 nucleotides, and / or b) The double-stranded RNA has a total length of 36 to 40 nucleotides, 40 to 45 nucleotides, 45 to 50 nucleotides, 50 to 60 nucleotides, or 60 to 75 nucleotides, according to any one of claims 1 to 80.

82. The double-stranded RNA according to any one of claims 1 to 80, wherein the first strand and the second strand of the double-stranded RNA each have a length of 21 to 25 nucleotides.

83. The double-stranded RNA according to any one of claims 1 to 82, wherein the nucleotide at position 1 of the dsRNA is A or U.

84. A DNA molecule comprising a nucleotide sequence encoding a first strand according to any one of claims 1 to 83, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

85. Recombinant nucleic acids, a1) Double-stranded RNA according to any one of claims 1 to 83, and b1) MicroRNA scaffold containing 5' flanking polynucleotides, loop polynucleotides, and 3' flanking polynucleotides Includes, The recombinant nucleic acid, i) The 5' flanking polynucleotide, ii) The first strand of the double-stranded RNA, iii) The loop polynucleotide, iv) The second strand of the double-stranded RNA, and iv) The 3' flanking polynucleotide Includes, At least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of the double-stranded RNA; or a2) Double-stranded RNA according to any one of claims 1 to 83, and b2) MicroRNA scaffold containing 5' flanking polynucleotides, loop polynucleotides, and 3' flanking polynucleotides Includes, The recombinant nucleic acid, i) The 5' flanking polynucleotide, ii) The second strand of the double-stranded RNA, iii) The loop polynucleotide, iv) The first strand of the double-stranded RNA, and v) The 3' flanking polynucleotide Includes, At least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterogeneous with respect to the first and / or second strands of the double-stranded RNA; or a3) Double-stranded RNA according to any one of claims 1 to 83, and b3) MicroRNA scaffold containing 5' flanking polynucleotides and 3' flanking polynucleotides Includes, The recombinant nucleic acid, i) The 5' flanking polynucleotide, ii) The first strand of the double-stranded RNA, iii) The second strand of the double-stranded RNA, and iv) The 3' flanking polynucleotide Includes, One or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA; or a4) Double-stranded RNA according to any one of claims 1 to 83, and b4) MicroRNA scaffold containing 5'-flanking polynucleotides and 3'-flanking polynucleotides Includes, The recombinant nucleic acid, i) The 5' flanking polynucleotide, ii) The second strand of the double-stranded RNA, iii) The first strand of the double-stranded RNA, and iv) The 3' flanking polynucleotide Includes, One or both of the 5' flanking polynucleotide and the 3' flanking polynucleotide are heterogeneous with respect to the first and / or second strands of the double-stranded RNA. The aforementioned recombinant nucleic acid.

86. The recombinant nucleic acid, a) The 5' flanking polynucleotide, b) The first strand of the double-stranded RNA, c) The loop polynucleotide, d) The second strand of the double-stranded RNA, and e) The 3' flanking polynucleotide Recombinant nucleic acid according to claim 85, comprising:

87. The recombinant nucleic acid according to claim 85 or claim 86, wherein the 5'-flanking polynucleotide, the loop polynucleotide, and the 3'-flanking polynucleotide are derived from miR33.

88. The recombinant nucleic acid, a) The 5' flanking polynucleotide, b) The first strand of the double-stranded RNA, c) The second strand of the double-stranded RNA, and d) The 3' flanking polynucleotide Recombinant nucleic acid according to claim 85, comprising:

89. The recombinant nucleic acid according to claim 85 or claim 86, wherein the 5'-flanking polynucleotide and the 3'-flanking polynucleotide are derived from miR451.

90. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to any one of claims 85 to 89.

91. The DNA molecule according to claim 90, wherein the 5' flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctgggcgggcagctctg (SEQ ID NO: 6).

92. The DNA molecule according to claim 90 or claim 91, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgtctggcaatacctg (SEQ ID NO: 7).

93. The DNA molecule according to any one of claims 90 to 92, wherein the 3' flanking polynucleotide is encoded by the nucleotide sequence: gggagccctgccctgactgccccac (SEQ ID NO: 8).

94. The DNA molecule according to claim 90, wherein the 5' flanking polynucleotide is encoded by the nucleotide sequence acctactgactgccagggcacctttggggaatggcaagg (SEQ ID NO: 9).

95. The DNA molecule according to claim 90 or claim 94, wherein the 3' flanking polynucleotide is encoded by the nucleotide sequence tcttgctataccccagaaaacgtgccaggaagaac (SEQ ID NO: 10).

96. i) The 5' flanking polynucleotide is encoded by the nucleotide sequence acctactgactgccagggcacctttggggaatggcaagg (SEQ ID NO: 9), ii) The 3' flanking polynucleotide is encoded by the nucleotide sequence tcttgctatacccagaaaacgtgccaggagaac (SEQ ID NO: 10), The DNA molecule according to claim 90.

97. A recombinant expression vector comprising the DNA molecule described in any one of claims 90 to 96.

98. The recombinant expression vector according to claim 97, wherein the nucleotide sequence is operably linked to a promoter that is functional in eukaryotic cells.

99. The recombinant expression vector according to claim 98, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

100. The recombinant expression vector according to claim 98 or claim 99, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EF1α promoter, or an H1 promoter.

101. A recombinant expression vector according to any one of claims 97 to 101, comprising a 5' adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3' AAV ITR sequence.

102. A recombinant expression vector comprising a nucleotide sequence encoding a recombinant nucleic acid according to any one of claims 85 to 89.

103. The recombinant expression vector according to claim 102, wherein the nucleotide sequence is operably linked to a promoter that is functional in eukaryotic cells.

104. The recombinant expression vector according to claim 103, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

105. The recombinant expression vector according to claim 103 or claim 104, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EF1α promoter, or an H1 promoter.

106. A recombinant expression vector according to any one of claims 97 to 105, comprising a 5' adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3' AAV ITR sequence.

107. A delivery medium comprising a recombinant expression vector according to any one of claims 97 to 106.

108. The delivery medium is a non-virus delivery medium, or the delivery medium according to claim 107.

109. The delivery medium according to claim 108, wherein the delivery medium is lipid nanoparticles.

110. The delivery medium according to claim 107, wherein the delivery medium is a virus particle.

111. A viral particle comprising a recombinant expression vector according to any one of claims 97 to 106.

112. The virus particle according to claim 111, wherein the virus particle is an adeno-associated virus (AAV) particle.

113. The virus particle according to claim 112, wherein the AAV particle comprises an AAV9 capsid.

114. The virus particle according to claim 112, wherein the AAV particle comprises an AAV2 capsid.

115. A composition, a) A recombinant expression vector according to any one of claims 97 to 106, b) Pharmaceutically acceptable excipients and The composition comprising the above.

116. A composition, a) A delivery medium according to any one of claims 107 to 110, b) Pharmaceutically acceptable excipients and The composition comprising the above.

117. A composition, a) A viral particle comprising a recombinant expression vector according to any one of claims 97 to 106, b) Pharmaceutically acceptable excipients and The composition comprising the above.

118. A method for selectively reducing the translation of disease-related CAG repeat-containing RNA in an individual having CAG repeat extension disorder, comprising administering to the individual an effective amount of an expression vector according to any one of claims 97 to 106, a delivery medium according to any one of claims 107 to 110, a viral particle according to any one of claims 111 to 114, or a pharmaceutical composition according to any one of claims 115 to 117.

119. The method according to claim 118, wherein the repeat elongation disorder is Huntington's disease, ataxia 1, ataxia 2, ataxia 3, ataxia 6, ataxia 7, ataxia 12, ataxia 17, spinal and bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, amyotrophic lateral sclerosis, myotonic dystrophy type 1, Fuchs corneal endothelial dystrophy, branchio-otorenal syndrome 2, or cleidocranial dysplasia.

120. The method according to claim 118 or claim 119, wherein the administration includes direct injection into the central nervous system of the individual.

121. The method according to claim 120, wherein the direct injection is an intraventricular injection, an intraparenchymal injection, an intrathecal injection, an intrastriatal injection, an intrathalamic injection, an intracisional injection, a subpia injection, or any combination thereof.

122. The method according to any one of claims 118 to 121, wherein the administration provides a ratio of a polypeptide encoded by a non-disease-related CAG repeat-containing RNA to a polypeptide encoded by a disease-related CAG repeat-containing RNA, which is greater than 1.

0.

123. The method according to any one of claims 118 to 122, wherein the administration provides a ratio of 1.1 to 1.8 of polypeptides encoded by non-disease-related CAG repeat-containing RNA to polypeptides encoded by disease-related CAG repeat-containing RNA.

124. The method according to any one of claims 118 to 122, wherein the administration provides a ratio of a polypeptide encoded by a non-disease-related CAG repeat-containing RNA to a polypeptide encoded by a disease-related CAG repeat-containing RNA, which is greater than 1.8.

Images