Gene therapy for the anterior part of the eyeball

The administration of a circular DNA vector with a truncated ColE2-P9 replication origin, delivered with electrical energy, addresses the limitations of current treatments for Fuchs dystrophy by achieving persistent and less immunogenic expression of therapeutic factors, enhancing corneal endothelial cell survival and gene modification.

JP2026515779APending Publication Date: 2026-05-19ALDEVRON LLC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ALDEVRON LLC
Filing Date
2024-02-09
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current treatments for anterior ocular disorders such as Fuchs dystrophy, characterized by progressive vision loss due to corneal endothelial degeneration, are limited to tissue transplant-based therapies, which do not fully address the unmet medical need for effective treatment options.

Method used

A method involving the administration of a circular DNA vector deficient in plasmid backbone components, encoded with a transgene, and delivered via electrodes with electrical energy to express therapeutic factors or modify mutant genes in ophthalmic cells of the anterior segment, utilizing a truncated ColE2-P9 replication origin for enhanced persistence and reduced immunogenicity.

Benefits of technology

The method achieves persistent and less immunogenic expression of therapeutic factors, effectively promoting corneal endothelial cell survival and modifying genes associated with Fuchs dystrophy, providing a more effective treatment than existing transplant-based therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026515779000001_ABST
    Figure 2026515779000001_ABST
Patent Text Reader

Abstract

The present invention includes therapies for eye diseases or disorders in individuals. Methods for delivering nucleic acid vectors to ophthalmic cells in the anterior segment of the eyeball (e.g., corneal endothelium, trabecular meshwork, etc.), including methods for administering nucleic acid vectors to an individual and methods for electrically introducing nucleic acid vectors to express therapeutic transgenes, are provided herein. Nucleic acid vectors for eye diseases such as Fuchs dystrophy are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Generally, the present invention is characterized by a nucleic acid vector and a method for administering the nucleic acid vector to ophthalmic cells in the anterior part of the eyeball.

[0002] Cross-references to related applications This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 444,740, filed February 10, 2023, which is incorporated herein by reference in its entirety.

[0003] Description of the electronically submitted text file This application includes a sequence listing in XML format, which was submitted electronically with this specification via the Patent Center. The XML copy created on February 8, 2024, is filed "IGT-012PC_135234-5012.xml" and is 11,089 bytes in size. The sequence listing is incorporated herein by reference in its entirety. [Background technology]

[0004] Numerous eye disorders, including tissue dysfunction in the anterior part of the eye such as corneal dysfunction, present high levels of unmet medical needs. For example, Fuchs dystrophy is a corneal endothelial disorder characterized by progressive vision loss due to its progressive degeneration. Symptoms include a decrease in corneal endothelial cell count with polymegathism and pleomorphism, corneal guttata (droplet-like deposits), corneal edema, decreased visual acuity and contrast sensitivity, glare, diurnal variation in visual acuity, and pain. Onset can occur in youth or later in life; it is estimated that 4% of the US population over 40 years of age are affected. Fuchs dystrophy can be caused by autosomal dominant inheritance of a known mutation, which can cause symptoms through mechanisms such as oxidative stress, mitochondrial dysregulation, endoplasmic reticulum-related mechanisms including protein misfolding, apoptosis, epithelial-mesenchymal transition, RNA toxicity, and repeat-associated non-ATG translation (transition). Currently, the only available treatments are tissue transplant-based therapies such as full-thickness corneal transplants and Descemet's membrane detachment endothelial transplants / Descemet's membrane corneal endothelial transplants. There is a clear unmet medical need regarding treatment options for anterior ocular disorders. [Overview of the project]

[0005] The present invention provides a method for treating disorders of the anterior part of the eye (e.g., Fuchs dystrophy), a method for delivering nucleic acid vectors to tissues and cells in the anterior part of the eye, and a therapeutic composition (circular DNA vector) for treating Fuchs dystrophy.

[0006] One aspect of the present invention provides a method for expressing a transgene in ophthalmic cells of the anterior segment of an individual. In some embodiments, the method includes (a) administering a circular DNA vector into the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma), wherein the circular DNA vector is deficient in one or more components of a plasmid backbone and encodes a transgene; (b) placing one or more electrodes (e.g., one, two, three, four, or more electrodes) in and / or around the eyeball; and (c) transferring electrical energy through one or more electrodes under conditions suitable for electrotransfer of the circular DNA vector into ophthalmic cells of the anterior segment, thereby expressing the transgene in the ophthalmic cells of the anterior segment. In some embodiments, the circular DNA vector is expressed in ophthalmic cells of the anterior segment eight days after administration. In some embodiments, the transgene expressed by the circular DNA vector in ophthalmic cells of the anterior segment is more persistent than the transgene encoded by a plasmid DNA vector encoding the transgene. In some embodiments, circular DNA vectors in anterior segment ophthalmic cells are less immunogenic than plasmid DNA vectors encoding transgenes. In some embodiments, one or more components of the plasmid backbone that are missing in the circular DNA vector include drug resistance genes and / or origins of replication.

[0007] In some embodiments, the circular DNA vector is a nonviral circular DNA vector, e.g., a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector contains an origin of replication and / or lacks a selectable marker. In some embodiments, the 3' end of the transgene is ligated to the 5' end of the transgene promoter by a sequence containing a bacterial origin of replication, and the sequence containing the bacterial origin of replication is less than 50 bp long or less than 100 bp long. In embodiments, the sequence containing the bacterial origin of replication is less than 50 bp long, and the circular DNA vector lacks a selectable marker. In various embodiments, the vector further lacks a recombination site. In some embodiments, the vector contains a transposase scar. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof.

[0008] In this embodiment, the sequence containing the bacterial replication origin directly ligates the 3' end of the therapeutic sequence to the 5' end of the therapeutic sequence.

[0009] In the embodiment, the circular DNA vector has a bacterial-derived sequence of approximately 200 base pairs (bp) or less, or approximately 150 bp or less, or approximately 100 bp or less, or approximately 75 bp or less, or approximately 50 bp or less.

[0010] In the embodiments, the origin of replication is derived from a ColE2-associated plasmid and is optionally ColE2-P9. In such embodiments, the origin of replication is recognized by the ColE2-P9 replication protein. An exemplary ColE2-P9 replication protein contains the amino acid sequence of SEQ ID NO: 1.

[0011] In some embodiments, the origin of replication is 40 bp or less in length. In some embodiments, the origin of replication is 36 bp or less, or 34 bp or less, or 32 bp or less, or 30 bp or less, or 28 bp or less in length. For example, the origin of replication may have the nucleotide sequence of Sequence ID No. 2, or may be a functional variant or cleavage variant thereof.

[0012] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 5.

[0013] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 6.

[0014] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 7.

[0015] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 8.

[0016] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 9.

[0017] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 10.

[0018] In an embodiment, the replication origin is a truncated ColE2-P9 replication origin. At this time, one strand of the replication origin contains or consists of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0019] In some embodiments, the replication origin includes or consists of the nucleic acid sequence X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7 (SEQ ID NO: 11), where each X is selected from A, T, C, or G. In some embodiments, X1 is A, T, or C; X2 is A, T, or C; X3 is A, T, or G; X4 is A, T, or C; X5 is A, T, or G; X6 is C; and X7 is A.

[0020] In some embodiments, the Disclosure provides a genetically modified bacterial cell for replicating a circular DNA vector. The genetically modified bacterial cell comprises (a) the circular DNA vector of the Disclosure, and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial origin of replication of the circular DNA vector, the Rep gene replicating the circular DNA vector.

[0021] In some embodiments, the therapeutic sequence includes a transposase overhang sequence, which may be (but not limited to) a TTAA. In such embodiments, the bacterial cell includes a transposase protein, which hydrolyzes the DNA adjacent to the transposase overhang sequence. In some embodiments, the transposase protein may be encoded by a transposase gene expressed by the genetically modified bacterial cell and integrated into the bacterial genome. In some embodiments, the genetically modified bacterial cell further includes an insertion excision enhancer (IEE), which may be encoded by a gene integrated into the bacterial genome. In some embodiments, the genetically modified bacterial cell further includes a closed-ended linear DNA molecule containing a plasmid backbone. The plasmid backbone may contain selectable markers (which may be antibiotic resistance genes and / or counter-selection markers).

[0022] In various embodiments, the origin of replication is the sole bacterial sequence in the circular DNA vector. In some embodiments, genetically modified bacterial cells (e.g., in culture) contain, on average, at least 10 copies of the circular DNA vector. In various embodiments, the circular DNA vector is monomeric. In some embodiments, bacterial cells in culture contain, on average, at least 10, or at least 15, or at least 20 copies of the circular DNA vector per genetically modified bacterial cell.

[0023] In another embodiment, the Disclosure provides a plasmid template comprising (a) a plasmid template comprising (i) a first segment comprising a sequence comprising a therapeutic sequence and a bacterial origin of replication, wherein two transposase overhang sequences are adjacent to the first segment; and (ii) a second segment comprising a plasmid backbone, wherein a left-end (LE) repeat and a right-end (RE) repeat are adjacent, and the LE and RE repeats can be bound by a transposase protein; and (b) a genetically engineered bacterial cell for generating a circular DNA vector comprising a Rep gene encoding a bacterial replication protein that binds to the bacterial origin of replication. In various embodiments, the bacterial cell further comprises a transposase protein, which hydrolyzes the DNA adjacent to the transposase overhang sequence. In some embodiments, the genetically modified bacterial cell further comprises (c) a circular DNA vector containing a bacterial replication origin and a therapeutic sequence containing one of two transposase overhang sequences; and / or (d) a linear closed-terminated DNA molecule containing a plasmid backbone flanked by LE repeats and RE repeats (e.g., to be generated).

[0024] In some embodiments, the transposase protein is encoded by a transposase gene that can be expressed by genetically modified bacterial cells and integrated into the bacterial genome. In some embodiments, the genetically modified bacterial cell further expresses IEE, which can be encoded by a gene that is integrated into the bacterial genome.

[0025] In any of the above embodiments for expressing a transgene in ophthalmic cells, step (a) may include administering a circular DNA vector intracamerally or into the corneal stroma. In some embodiments, step (b) includes placing one or more electrodes (e.g., one or more needle electrodes, e.g., unipolar needle electrodes) in the anterior chamber, and step (c) includes transferring electrical energy through the electrodes placed in the anterior chamber. In some embodiments, the anterior chamber location of the one or more electrodes is within 5 mm of the corneal endothelium.

[0026] In some of the embodiments described above, the anterior segment ophthalmos cells expressing the circular DNA vector are corneal cells, trabecular reticular cells, iris cells, lens cells, ciliary cells, and / or Schlemm's canal cells. In some embodiments, the anterior segment ophthalmos cells are corneal endothelial cells or corneal stromal cells.

[0027] In some embodiments, the transgene encodes a protective factor that promotes corneal endothelial cell survival. In some embodiments, the protective factor modulates the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway (e.g., Nrf2 agonists), the Rho kinase (ROCK) signaling pathway (e.g., ROCK inhibitors), the transforming growth factor β (TGF-B) signaling pathway (e.g., TGF-B inhibitors), or the fibroblast growth factor 1 (FGF-1) signaling pathway. In some embodiments, the circular DNA vector silences, modifies, or replaces mutant genes associated with Fuchs dystrophy, such as solute carrier family 4 member 11 (SLC4A11), TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0028] In another embodiment, the present invention provides a method for expressing a therapeutic protein in ophthalmic cells of the anterior segment of an individual. In some embodiments, the method includes (a) administering a nucleic acid vector into the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma), wherein the nucleic acid vector encodes a therapeutic protein; (b) placing one or more electrodes in and / or around the eyeball; and (c) transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of the nucleic acid vector into ophthalmic cells of the anterior segment, thereby expressing the therapeutic protein in the ophthalmic cells of the anterior segment.

[0029] In some embodiments, the therapeutic protein is a protective factor that promotes corneal endothelial cell survival. In some embodiments, the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. In some embodiments, the nucleic acid vector silences, modifies, or replaces mutant genes associated with Fuchs dystrophy, such as SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0030] In some embodiments, the individual has Fuchs dystrophy.

[0031] In another embodiment, a method is provided for treating Fuchs dystrophy in an individual in need, comprising the steps of: (a) administering a nucleic acid vector into the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma) in the individual, wherein the nucleic acid vector encodes a protective factor that promotes corneal endothelial cell survival; (b) placing one or more electrodes in and / or around the eyeball; and (c) transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of the nucleic acid vector into the ophthalmic cells of the anterior segment, thereby causing the protective factor to be expressed in the ophthalmic cells of the anterior segment in an amount sufficient to treat Fuchs dystrophy.

[0032] In another embodiment, a method is provided for treating Fuchs dystrophy in an individual in need, comprising the steps of: (a) administering a nucleic acid vector into the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma) in an individual, wherein the nucleic acid vector silences, modifies, or replaces a mutant gene associated with Fuchs dystrophy; (b) placing one or more electrodes in and / or around the eyeball; and (c) transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of the nucleic acid vector into ophthalmic cells of the anterior segment, thereby silencing, modifying, or replacing the mutant gene in an amount sufficient to treat Fuchs dystrophy.

[0033] In some embodiments, the nucleic acid vector lacks one or more components of the plasmid backbone. In some embodiments, the one or more components of the plasmid backbone that are missing in the circular DNA vector include drug resistance genes and / or origins of replication.

[0034] In some embodiments, the nucleic acid vector is a circular DNA vector, e.g., a nonviral circular DNA vector, e.g., a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector contains an origin of replication and / or lacks a selectable marker. In some embodiments, the 3' end of the transgene is ligated to the 5' end of the transgene promoter by a sequence containing a bacterial origin of replication, and the sequence containing the bacterial origin of replication is less than 100 bp long. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof.

[0035] In some embodiments, the individual is a mammal, such as a human.

[0036] In another embodiment, a circular DNA vector (e.g., isolated and / or genetically engineered circular DNA vector) is provided, comprising (a) a eukaryotic cell promoter; (b) a coding sequence that (i) encodes a protective factor that promotes corneal endothelial cell survival; or (ii) a coding sequence that silences, modifies, or replaces a mutant gene associated with Fuchs dystrophy; and (c) a bacterial origin of replication less than 50 bp in length, wherein the circular DNA vector lacks a selectable marker (e.g., a drug resistance gene). In some embodiments, the 3' end of the coding sequence is ligated to the 5' end of the promoter by a sequence containing the bacterial origin of replication, and the sequence containing the bacterial origin of replication is less than 100 bp in length. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof (e.g., a truncated ColE2-P9 origin as described). In some embodiments, the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. In some embodiments, the genes associated with Fuchs dystrophy are SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

[0037] In another aspect, the present invention provides a pharmaceutical composition comprising (a) a circular DNA vector from any of the above-described embodiments of any of the prior embodiments; and (b) a carrier suitable for use in the delivery of the pharmaceutical composition to an organism.

[0038] In another embodiment, a method is provided for delivering a circular DNA vector to anterior segment ophthalmos of an individual (e.g., corneal endothelial cells of an individual), comprising the steps of (a) administering the circular DNA vector into the anterior segment of the eyeball (e.g., by intrachorporeal injection or injection into the corneal stroma); (b) positioning one or more electrodes in and / or around the eyeball (e.g., one or more electrodes in the anterior chamber (e.g., needle electrodes)); and (c) delivering the circular DNA vector to anterior segment ophthalmos of an individual (e.g., corneal endothelial cells) by transmitting electrical energy (e.g., electrical pulses) through one or more electrodes under conditions suitable for the electrical introduction of the circular DNA vector into anterior segment ophthalmos, thereby delivering the circular DNA vector to anterior segment ophthalmos (e.g., corneal endothelial cells). In some embodiments, the circular DNA vector is expressed in anterior segment ophthalmos (e.g., corneal endothelial cells) 8 days after administration. In some embodiments, the transgene expressed by the circular DNA vector in anterior segment ophthalmos is more persistent than the transgene encoded by a plasmid DNA vector encoding the transgene. In some embodiments, the circular DNA vector in anterior segment ophthalmic cells is less immunogenic than the plasmid DNA vector encoding the transgene. In some embodiments, one or more components of the plasmid backbone that are missing in the circular DNA vector include a drug resistance gene and / or origin of replication. In some embodiments, the individual is a mammal, e.g., a human.

[0039] The application file shall include at least one drawing prepared in color. A copy of the patent or patent application, including the color drawing, will be provided by the Secretariat upon request and payment of the required fees. [Brief explanation of the drawing]

[0040] [Figure 1A] This is a schematic diagram showing the relative positions of the DNA injection needle and electrode needle within the anterior segment of the eyeball as positioned in Example 1. DNA was administered into the anterior chamber (into the anterior chamber), and a pulsed electric field was transmitted into the anterior chamber (into the anterior chamber) through a single unipolar electrode. [Figure 1B]This figure shows a fluorescence live image of GFP expression in rabbit eyes on postoperative day 7, obtained using a RetCam equipped with a gonioscope lens. [Figure 1C] This is a fluorescence image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red, and DAPI is blue. [Figure 2A] This is a schematic diagram showing the relative positions of the DNA injection needle and electrode needle within the anterior segment of the eyeball as positioned in Example 2. DNA was administered into the corneal stroma, and a pulsed electric field was transmitted into the anterior chamber (into the anterior chamber) through a single unipolar electrode. [Figure 2B] This figure shows a fluorescence live image of rabbit eyes showing widespread GFP expression on postoperative day 7, obtained using a RetCam equipped with a gonioscope lens. [Figure 2C] This is a fluorescence image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red, and DAPI is blue. [Modes for carrying out the invention]

[0041] I. Definition Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art in the field to which this invention pertains, and a general guide to many of the terms used herein is provided by reference to published texts. In the event of any conflict between the definitions given herein and those in the referenced publications, the definitions provided herein shall prevail.

[0042] As used herein, the terms “anterior segment” and “anterior part” of the eyeball are interchangeable to mean the region of the eyeball that includes the cornea, iris, ciliary body, and lens, as well as the anterior and posterior chambers filled with aqueous humor.

[0043] As used herein, “electrical introduction” means the movement of molecules (e.g., nucleic acids, e.g., naked nucleic acids) across the membrane of a target cell (e.g., from the outside to the inside of a target cell, e.g., a target cell, e.g., a corneal endothelial cell) induced by the transmission of an electric field (e.g., a pulsed electric field) into the microenvironment in which cells reside (e.g., the anterior segment of the eyeball). Electrical introduction can occur as a result of electrophoresis, i.e., the movement of molecules (e.g., nucleic acids, e.g., naked nucleic acids) along an electric field based on the charge of the molecule (e.g., in the direction of the electric current). Electrophoresis can induce electrical introduction, for example, by moving molecules (e.g., nucleic acids, e.g., naked nucleic acids) to the vicinity of the cell membrane, thereby enabling biological transport processes (e.g., endocytosis, including phagocytosis or phagocytosis) or passive transport (e.g., diffusion or lipid splitting) to transport molecules into the cell. Additionally, or alternatively, electrophoresis may occur as a result of electroporation, i.e., the creation of pores in target cells induced by the transfer of an electric field (e.g., a pulsed electric field), where the size, shape, and duration of the pores are suitable for accepting the movement of molecules (e.g., nucleic acids, e.g., naked nucleic acids) from the outside to the inside of the target cell. In other words, in some cases, electrophoresis occurs as a result of a combination of electrophoresis and electroporation.

[0044] The terms “expression level” or “expression level” are interchangeable and generally refer to the amount of polynucleotide or amino acid products or proteins in a biological sample (e.g., retina). “Expression” generally refers to the process by which the information encoded by a gene is translated into structures that exist and function within a cell. Therefore, according to this invention, “expression” of a gene may mean transcription into polynucleotides, translation into proteins, or post-translational modification of proteins. Transcribed polynucleotides, translated proteins, or post-translational modified protein fragments will also be considered expressed, whether they are transcripts produced by alternative splicing or degraded transcripts, or whether they originate from post-translational processing of proteins, such as by proteolysis. “Expressed genes” include genes that are transcribed into polynucleotides as mRNA and subsequently translated into proteins, as well as genes that are transcribed into RNA but not translated into proteins (e.g., transfer and ribosomal RNA).

[0045] As used herein, “delivery,” “to deliver,” and their grammatical variations mean causing a drug (e.g., a therapeutic agent) to access target cells. A drug can be delivered by administering the drug to an individual containing target cells (e.g., a systemic or local delivery step) so that the drug reaches the organ or tissue in which the target cells are located. Additionally, or alternatively, a drug can be delivered by adding a stimulus to the tissue or organ containing the drug, in which case the stimulus causes the drug to enter the target cells. In other words, in some cases, a drug is delivered to target cells by transmitting an electric field to the tissue containing the drug under conditions suitable for the electrical introduction of the drug into the target cells within the tissue.

[0046] As used herein, “administration” means a method of giving an individual a dose of the therapeutic agent of the present disclosure (e.g., a nucleic acid vector as described herein) or a composition thereof. Compositions used by the methods described herein may be administered intraocularly, for example, into the anterior chamber (i.e., into the aqueous humor), into the cornea (e.g., into the corneal stroma), into the vitreous humor, subretinal, or periocularly. Additionally, or alternatively, compositions may be delivered intravenously, subcutaneously, intradermally, percutaneously, intramuscularly, intraarterially, intraperitoneally, intrafocally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, intrarectally, topically, peritoneally, subconjunctivally, intracystically, mucosally, intrapericardially, intraumbilically, orally, topically, transdermally, conjunctivally, sub-Tenon's capsule, intraanterior chamber, subretinal, retrobulbar, intraoptic canal, by inhalation, by injection, by implantation, by drip infusion, by continuous drip infusion, by local perfusion directly into target cells, by catheter, by lavage, in a cream, or in a lipid composition. Compositions used in the methods described herein may be administered systemically. The method of administration may vary depending on various factors (e.g., the compound or composition to be administered, and the severity of the condition, disease, or disorder being treated).

[0047] As used herein, the terms “vector” and “nucleic acid vector” are interchangeable and refer to nucleic acid molecules capable of delivering a therapeutic sequence to which they are ligated, into target cells, in which the therapeutic sequence can subsequently be transcribed, replicated, processed, and / or expressed. Once the target cell or host cell has processed the therapeutic sequence in the vector, the therapeutic sequence is no longer considered a vector. One type of vector is a “plasmid,” which refers to a circular double-stranded DNA loop containing a bacterial skeleton into which additional DNA segments can be ligated. Another type of vector is a phage vector. Another type of vector is a viral vector (e.g., an adeno-associated virus (AAV) vector), in which the additional DNA segments can be ligated into the viral genome. Some vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors with bacterial origins of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the host cell's genome upon introduction into the host cell, thereby replicating together with the host genome. Furthermore, some vectors can be directed towards the expression of genes to which they are functionally linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply “recombinant vectors” or “expression vectors”). Any of the nucleic acid vectors described herein may be referred to as “isolated nucleic acid vectors.”

[0048] As used herein, the term “circular DNA vector” means a DNA vector in a circular form. Such a circular form can typically be amplified into concatemers by rolling circle amplification. Linear double-stranded nucleic acids having strands attached to their ends (e.g., by a covalently conjugated skeleton, e.g., a hairpin loop or other structure) are not considered circular vectors as used herein. The term “circular DNA vector” is used interchangeably with the term “covalently closed and circular DNA vector” and “C3 The terms "DNA" and "circular DNA" are used interchangeably herein. Those skilled in the art will understand that such circular vectors include vectors that are cohesive and closed with superhelical and complex DNA topology as described herein. In certain embodiments, the circular DNA vector is superhelical (e.g., monomeric superhelical). In other embodiments, the circular DNA vector is relaxed open circular (cohesive and closed without superhelical). In some cases, the circular DNA vector lacks a bacterial origin of replication. In some embodiments, the circular DNA vector contains a bacterial origin of replication. In other cases, the circular DNA vector may lack one or more components of the plasmid backbone (e.g., selectable markers) but may contain an origin of replication (e.g., ColE2-P9 origin of replication or a cleaved version thereof).

[0049] As used herein, the term “recombination site” means a nucleic acid sequence that is a product of site-directed recombination, comprising a first sequence corresponding to a portion of a first recombinase-binding site and a second sequence corresponding to a portion of a second recombinase-binding site. An example of a hybrid recombination site is attR, which is a product of site-directed recombination, comprising a first sequence corresponding to a portion of attP and a second sequence corresponding to a portion of attB. Alternatively, recombination sites can be generated from Cre / Lox recombination. That is, a vector generated from Cre / Lox recombination (e.g., a vector containing a LoxP site) contains a recombination site as used herein. Other site-directed recombination events that generate recombination sites include, for example, λ integrase, FLP recombinase, and Kw recombinase. Nucleic acid sequences resulting from non-site-directed recombination events (e.g., ITR-mediated intermolecular recombination) are not considered recombination sites as defined herein.

[0050] As used herein, the terms “individual” and “subject” are interchangeable and include, for example, any mammal that requires treatment or prevention by the therapeutic circular DNA vector or its pharmaceutical composition described herein. In some embodiments, the individual or subject is human. In other embodiments, the individual or subject is a non-human mammal (e.g., a non-human primate (e.g., a monkey), mouse, pig, rabbit, cat, or dog). The individual or subject may be male or female.

[0051] As used herein, “effective amount” or “effective dose” of a nucleic acid vector or its pharmaceutical composition means an amount sufficient to achieve the desired biological, pharmacological, or therapeutic effect when administered to an individual, for example, according to a selected dosage form, route, and / or schedule. As will be understood by those skilled in the art, the absolute amount of a particular composition that is effective may vary depending on factors such as the desired biological or pharmacological endpoint, the drug to be delivered, the target tissue, etc. Those skilled in the art will further understand that the “effective amount” may be brought into contact with cells or administered to a subject, either in a single dose or through the use of multiple doses. An effective amount of a composition for treating a disease may slow or halt disease progression or increase partial or complete response compared to a reference population, for example, an untreated or placebo population, or a population receiving standard treatment.

[0052] As used herein, “treatment” (and its grammatical variations such as “to treat” or “to treat”) means a clinical intervention that seeks to alter the natural course of the individual being treated, which may be performed either for preventive purposes or during the course of a clinicopathological condition. Desired effects of treatment include, but are not limited to, prevention of disease onset or recurrence, reduction of symptoms, elimination of any direct or indirect pathological consequences of the disease, reduction of the rate of disease progression, improvement or mitigation of the disease state, and improved prognosis. In some embodiments, the therapeutic circular DNA vectors of the present invention are used to delay the onset of disease or to slow the progression of disease (e.g., reduction of corneal thickness or visual acuity).

[0053] As used herein, “target cell” means a cell that expresses a therapeutic protein encoded by a therapeutic gene.

[0054] The terms “expression level” or “expression level” are interchangeable and generally refer to the amount of polynucleotide or amino acid products or proteins in a biological sample (e.g., corneal endothelium). “Expression” generally refers to the process by which information encoded by a gene is translated into structures that exist and function within a cell. Therefore, according to this invention, “expression” may mean transcription to polynucleotides, translation to proteins, or post-translational modification of proteins. Transcribed polynucleotides, translated proteins, or post-translational modified protein fragments will also be considered expressed, whether they are transcripts produced by alternative splicing or degraded transcripts, or whether they originate from post-translational processing of proteins, such as by proteolysis. “Expressed gene” includes genes that are transcribed as mRNA into polynucleotides and subsequently translated into proteins, as well as genes that are transcribed into RNA but not translated into proteins (e.g., transfer and ribosomal RNA). The terms “a” and “an” mean “one or more of the following.” For example, "a cell" is understood to mean one or more cells. Therefore, the terms "a" and "an," "one or more of a (or an)," and "at least one of a (or an)" are used interchangeably in this specification.

[0055] As used herein, the term "approximately" means a value within a range of ±10% variation from the reference value, unless otherwise specified.

[0056] II. Method A method is provided for administering nucleic acid vectors anterior to the eyeball using electrical transport. Such methods include methods for expressing transgenes encoded by nucleic acid vectors and methods for treating diseases (e.g., Fuchs dystrophy) by administering nucleic acid vectors encoding protective factors that promote corneal endothelial cell survival, or by administering nucleic acid vectors that silence, modify, or replace mutant genes associated with Fuchs dystrophy.

[0057] Fuchs dystrophy The methods provided herein are useful for treating diseases of the anterior segment of the eye, such as Fuchs dystrophy, characterized by progressive vision loss due to progressive degeneration of the corneal endothelium. The methods of the present invention provide a treatment for Fuchs dystrophy comprising the steps of (a) administering a nucleic acid vector that encodes a protective factor that promotes corneal endothelial cell survival, or (b) silencing, modifying, or substituting a mutant gene associated with Fuchs dystrophy, and transfecting corneal endothelial cells with these vectors by electrotransduction.

[0058] In some embodiments, a method for treating Fuchs dystrophy includes the step of administering a nucleic acid vector expressing a protective factor known to promote corneal endothelial cell survival. Exemplary protective factors include modulators of Nrf2, ROCK, TGF-B, and FGF-1. In some embodiments, the protective factor modulates the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway (e.g., Nrf2 agonists), the Rho kinase (ROCK) signaling pathway (e.g., ROCK inhibitors), the transforming growth factor β (TGF-B) signaling pathway (e.g., TGF-B inhibitors), or the fibroblast growth factor 1 (FGF-1) signaling pathway. Thus, such protective factors can be cell-bound (e.g., intracellular or membrane-bound in transfected cells) or secreted into the extracellular space (e.g., accessible to one or more additional cell types or extracellular components of the anterior segment of the eyeball).

[0059] In other embodiments, a method for treating Fuchs dystrophy includes the step of administering a nucleic acid vector that silences (e.g., through an inhibitory nucleic acid (e.g., shRNA)), modifies (e.g., through gene editing, e.g., CRISPR) or replaces (e.g., by replacement with a functional version of the same or functionally similar or equivalent gene) a mutant gene associated with Fuchs dystrophy (i.e., known to cause or contribute to Fuchs dystrophy). Genes associated with Fuchs dystrophy are known in the art and include, for example, SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. Specific information regarding these mutations (e.g., nucleotide and amino acid changes) is identified and discussed in Liu et al., Eye Vis. 2021:8(1):24, which is incorporated herein by reference in its entirety.

[0060] In some embodiments, the mutation in the gene is an autosomal dominant mutation.

[0061] Administration of therapeutic drugs Provided herein are methods for administering a nucleic acid vector (e.g., one of the nucleic acid vectors described herein) or a pharmaceutical composition thereof to the anterior part of the eyeball as a means of delivering a therapeutic agent to target cells in the anterior part of the eyeball of an individual (e.g., a human patient). In some cases, the nucleic acid vector is administered into the eyeball such that the nucleic acid vector enters the extracellular space of the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma). If the nucleic acid vector is in the anterior extracellular space at the time of administration, it can subsequently be electrically introduced into target retinal cells upon transmission of electrical energy that reaches the anterior part of the eyeball, for example, through the transmission of electrical energy from electrodes placed in, on, or near the eyeball (e.g., in the anterior chamber).

[0062] In some embodiments, the nucleic acid vector is administered prior to the transmission of the electric field. For example, the nucleic acid vector can be administered within 24 hours before the transmission of the electric field (e.g., within 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 90 minutes, 60 minutes, 45 minutes, 30 minutes, 20 minutes, 15 minutes, 10 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, 1 minute, 45 seconds, 30 seconds, 20 seconds, 15 seconds, 10 seconds, or 5 seconds). In some embodiments, the nucleic acid vector is administered as part of a method described herein.

[0063] Any preferred means of anterior segment administration known in the art or described herein may be used as part of the method provided herein. A method for delivering a nucleic acid vector to target retinal cells includes the step of administering the nucleic acid vector into the eyeball by intraocular injection (e.g., anterior chamber injection) or an intraocular implant. In some embodiments of any of the methods described herein, the administration of the nucleic acid vector is via an intraocular implant (e.g., a controlled-release or depot implant). In other embodiments, the administration of the nucleic acid vector is not via an intraocular implant.

[0064] In some cases, the administration of nucleic acid vectors is not surgical. For example, in some embodiments, the administration of nucleic acid vectors does not utilize general anesthesia and / or does not involve retrobulbar anesthesia (i.e., retrobulbar block). Additionally, or alternatively, the administration of nucleic acid vectors does not involve injection using a needle larger than 28 gauge.

[0065] Additionally, or alternatively, nucleic acid vector administration does not involve the use of guidance mechanisms typically required for intraocular drug delivery via shunts or cannulas.

[0066] In some cases, nucleic acid vectors are administered by injection into the outer tissues of the eyeball, such as the sclera, cornea, corneal stroma, conjunctiva, subconjunctival space, or subretinal space (e.g., microneedle injection). Alternatively, nucleic acid vectors are administered by injection into sites adjacent to the outer tissues, such as the trabecular network, ciliary body, or aqueous humor (e.g., microneedle injection).

[0067] In some cases, nucleic acid vectors are administered topically or as eye drops.

[0068] Any of the nucleic acid vectors or their pharmaceutical compositions described herein contain 1 μg to 10 mg of DNA (e.g., 5 μg to 5.0 mg, 10 μg to 2.0 mg, or 100 μg to 1.0 mg of DNA, e.g., 10 μg to 20 μg, 20 μg to 30 μg, 30 μg to 40 μg, 40 μg to 50 μg, 50 μg to 75 μg, 75 μg to 100 μg, 100 μg to 200 μg, 200 μg to 300 μg, 300 μg to 400 μg, 400 μg to 500 μg, 500 μg to 1.0 mg, 1.0 mg to 5.0 mg) The DNA can be administered to the subject in doses of 5.0 mg to 10 mg, for example, approximately 10 μg, 20 μg, 30 μg, 40 μg, 50 μg, 60 μg, 70 μg, 80 μg, 90 μg, 100 μg, 150 μg, 200 μg, 250 μg, 300 μg, 350 μg, 400 μg, 450 μg, 500 μg, 600 μg, 700 μg, 750 μg, 1.0 mg, 2.0 mg, 2.5 mg, 5.0 mg, 7.5 mg, or 10 mg of DNA.

[0069] electric field transmission A method for delivering a nucleic acid vector (e.g., a circular DNA vector) to the anterior part of the eyeball includes the step of transferring electrical energy into the tissue in which target eye cells reside. Such a method includes the electrical introduction of a therapeutic agent from the extracellular space in the anterior segment of the eyeball (e.g., the anterior chamber or corneal stroma) into target eye cells (e.g., corneal endothelium). For example, if an individual is being treated for a disease of the anterior segment of the eyeball (e.g., Fuchs dystrophy), the method includes the step of transferring electrical energy into the retina to induce the electrical introduction of the nucleic acid vector from the extracellular space in or near the cornea into corneal endothelial cells.

[0070] In some aspects of the present invention, the electrodes are positioned inside the eyeball of an individual (e.g., within the anterior segment, e.g., the anterior chamber or corneal stroma), and an electric field is transmitted through the electrodes into the target eye tissue under conditions suitable for the electrical introduction of a nucleic acid vector into target cells (e.g., corneal endothelium). The electric field transmitted into the target eye tissue can facilitate the movement of a nucleic acid vector (e.g., a circular DNA vector) into the target eye cells. Such electrical introduction can occur through any one of several mechanisms (and combinations thereof), including electrophoresis, electrokinetically driven drug uptake, and / or electroporation. The transmission of the electric field includes conditions suitable for such mechanisms. Suitable means for generating an electric field for the electrical introduction of nucleic acids in mammalian tissues are known in the art, and any suitable means known in the art or described herein can be adapted for use as part of the present invention.

[0071] Various means for generating and transmitting electric fields into tissues are considered herein as part of the methods of the present invention. Devices and systems having electrodes suitable for transmitting electric fields into mammalian tissues are commercially available and may be useful in the methods disclosed herein. In some cases, the electric field is transmitted through electrodes including needles (e.g., needles placed in the aqueous humor or subretinal space). Suitable needle electrodes include CLINIPORATOR® electrodes sold by IGEA® and needle electrodes sold by AMBU®. Other electrodes that can be adapted for use in the anterior part of the eye are described in International Publication 2022 / 198138, which is incorporated herein by reference in its entirety.

[0072] Electrodes for use in the methods of the present invention (e.g., needle electrodes) may be unipolar. In some embodiments involving electrical introduction using unipolar electrodes, the ground electrode is attached to the individual at a point other than the eyeball (e.g., attached to the individual's skin). In some embodiments, the ground electrode is a pad that contacts the skin of the individual's buttocks, legs, torso, neck (e.g., the back of the neck), or head (e.g., the back of the head or temples). In some embodiments, the unipolar electrode transmits electrical energy when positively charged. In some embodiments, the unipolar electrode transmits electrical energy when negatively charged.

[0073] Alternatively, the electrodes may be bipolar. In bipolar embodiments, an auxiliary electrode may be electrically connected to the main electrode. The auxiliary electrode may be in close proximity to the main electrode (i.e., closer to the operator) and may, for example, be part of a sheath surrounding the main wire electrode or be connected to it. In some embodiments involving electrical introduction using bipolar electrodes, electrical energy (e.g., current) is transmitted when a positive voltage is applied to the main electrode and a negative voltage to the auxiliary electrode.

[0074] It will be understood that various suitable electrical parameters and algorithms can be used. The voltage source is, for example, in target cells (e.g., corneal endothelial cells), approximately 10 V / cm to approximately 1,500 V / cm (e.g., approximately 10 V / cm to approximately 100 V / cm, e.g., approximately 10 V / cm, 20 V / cm, 30 V / cm, 40 V / cm, 50 V / cm, 60 V / cm, 70 V / cm, 80 V / cm, 90 V / cm, or 100 V / cm, e.g., approximately 100 V / cm to approximately 1,000 V / cm, e.g., approximately 200 V / cm). The voltage source can be configured to generate an electric field strength of approximately 10V / cm to 1,000V / cm (e.g., approximately 10V / cm to 500V / cm or approximately 500V / cm to 1,000V / cm). In some embodiments, the voltage source is configured to generate an electric field strength of approximately 10V / cm to 1,000V / cm (e.g., approximately 10V / cm to 500V / cm or approximately 500V / cm to 1,000V / cm) in, for example, a target cell. In some embodiments, the electric field strength is 50V / cm to 300V / cm. In some embodiments, the electric field strength is approximately 100 V / cm in the target cell (e.g., target retinal cell).

[0075] In some embodiments, the total number of electrical energy pulses is delivered within 1 to 60 seconds (e.g., 1 to 5 seconds, 5 to 10 seconds, 10 to 15 seconds, 15 to 20 seconds, 20 to 30 seconds, 30 to 40 seconds, 40 to 50 seconds, or 50 to 60 seconds). In some embodiments, the total number of electrical energy pulses is delivered within 1 to 20 seconds. For example, the total number of electrical energy pulses can be delivered within 1 to 5 seconds, 5 to 10 seconds, 10 to 15 seconds, or 15 to 20 seconds, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 seconds. The electrical energy pulses may be, for example, rectangular waveforms. The electrical energy pulses may have an amplitude of 5V to 500V. For example, a pulse of electrical energy may have an amplitude of approximately 5V, 10V, 15V, 20V, 25V, 30V, 35V, 40V, 45V, 50V, 60V, 70V, 80V, 90V, 100V, 125V, 150V, 175V, 200V, 225V, 250V, 275V, 300V, 325V, 350V, 375V, 400V, 425V, 450V, 475V, or 500V. In some embodiments, a pulse of electrical energy may have an amplitude of approximately 5 to 250V (e.g., approximately 20V). Any of the above voltages may be the top of a rectangular waveform, a peak in a sinusoidal waveform, a peak in a sawtooth waveform, the root-mean-square (RMS) voltage of a sinusoidal waveform, or the RMS voltage of a sawtooth waveform.

[0076] In some embodiments, approximately 1 to 12 pulses of electrical energy (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 pulses) are transmitted during use. In some embodiments, approximately 4 to 12 pulses of electrical energy are transmitted during use.

[0077] In some embodiments, each of the electrical energy pulses is approximately 10 ms to approximately 200 ms. For example, each of the electrical energy pulses may be approximately 10 ms, 20 ms, 30 ms, 40 ms, 50 ms, 60 ms, 70 ms, 80 ms, 90 ms, 100 ms, 110 ms, 120 ms, 130 ms, 140 ms, 150 ms, 160 ms, 170 ms, 180 ms, 190 ms, or 200 ms. In some embodiments, each of the electrical energy pulses is approximately 50 ms or shorter. In some embodiments, each of the electrical energy pulses is less than 10 ms. For example, each of the electrical energy pulses could be approximately 10 μs to 10 ms, for example, approximately 10 μs to 100 μs, for example, approximately 20 μs, 30 μs, 40 μs, 50 μs, 60 μs, 70 μs, 80 μs, 90 μs, or 100 μs, for example, approximately 100 μs to 1 ms, for example, approximately 200 μs, 300 μs, 400 μs, 500 μs, 600 μs, 700 μs, 800 μs, 900 μs, or 1 ms, for example, approximately 1 ms to 10 ms, for example, approximately 2 ms, 3 ms, 4 ms, 5 ms, 6 ms, 7 ms, 8 ms, 9 ms, or 10 ms.

[0078] As demonstrated in Examples 1 and 2, the relative placement of electrodes and injections can determine the areas of transfection and transgene expression, for example, by corneal endothelial cells.

[0079] In one example of the present invention, any of the nucleic acid vectors described herein can be injected into the corneal stroma, and an electrode placed in the anterior chamber can transfer energy into the aqueous humor. This configuration can result in broad-ranging (for example, and specific to) expression within the corneal endothelium.

[0080] Alternatively, one of the nucleic acid vectors described herein can be injected into the anterior chamber, and an electrode placed in the anterior chamber can transfer energy into the aqueous humor. This configuration may result in localized expression (e.g., specific to and for that region) within the corneal endothelium in a region near the electrode. In some cases, the method includes the steps of repositioning the electrode one or more times and repeating energy transfer to transfect two or more regions of the corneal endothelium.

[0081] III. Composition The present invention provides therapeutic compositions (e.g., nucleic acid vectors and their pharmaceutical compositions) useful for the treatment of Fuchs dystrophy. In some cases, the present invention provides a shared closed circular DNA (C) useful for the treatment of Fuchs dystrophy. 3 DNA vector (for example, C) lacking one or more components of the plasmid backbone 3 We provide DNA vectors.

[0082] nucleic acid vectors Nucleic acid vectors comprising any of the transgenes or coding sequences described herein are provided herein. Nucleic acid vectors include plasmid DNA vectors, nanoplasmid vectors (e.g., as described in International Publication Nos. 2008 / 153733 and 2014 / 035457), minicircle DNA vectors (e.g., as described in U.S. Patent Nos. 8,828,726 and 9,233,174), miniintronic plasmids (e.g., as described in Lu et al., Mol. Ther. 2013, 21:954 and U.S. Patent No. 9,347,073), synthetic circular DNA vectors as described herein and in International Publication No. 2019 / 178500, closed-end DNA vectors (e.g., as described in U.S. Patent Application Publication Nos. 2020 / 0283794 and 2021 / 0071197), and doggybone. DNA vectors (e.g., as described in U.S. Patent Publication No. 2015 / 0329902 and U.S. Patent No. 9,499,847) or ministring DNA vectors (e.g., as described in U.S. Patent No. 9,290,778 and U.S. Reissue Patent No. 48908E1) can be prepared according to methods for preparing them. In certain embodiments, any of the nucleic acid vectors described herein include a therapeutic sequence.

[0083] In some cases, nucleic acid vectors persist within cells (e.g., in dividing cells or quiescent cells such as postmitted cells) as episomes, similar to AAV vectors. 3 This is a DNA vector. In any of the embodiments described herein, a circular DNA vector may be a non-integrating vector. 3DNA vectors can be naked DNA vectors lacking substantial components of bacterial plasmid DNA, such as viral vector-specific components (e.g., viral proteins) and immunogenic components (e.g., immunogenic bacterial traces (CpG islands or CpG motifs)) or components associated with persistence, either additionally or otherwise reduced (e.g., CpG islands or CpG motifs). Circular DNA vectors may feature one or more therapeutic sequences and may lack plasmid backbone elements such as (i) bacterial replication origins and / or (ii) drug resistance genes and / or (iii) recombination sites. Synthetic circular DNA vectors lacking replication origins can be synthesized by various means known in the art and described herein. Synthesis methods may include, for example, the use of phage polymerases such as Phi29 polymerase as replication tools using rolling circle amplification. Specific methods for cell-free synthesis of synthetic circular DNA vectors are further described, for example, in International Publication No. 2019 / 178500, which is incorporated herein by reference.

[0084] In other embodiments, the therapeutic circular DNA vectors described herein may be non-synthetic vectors (e.g., including bacterial skeletal sequences such as origins of replication and / or recombination sites).

[0085] Such nucleic acid vectors described herein (e.g., circular DNA vectors lacking plasmid backbone elements) can be produced in vivo (e.g., by bacteria), and, for example, by using genetically engineered bacterial cells to produce circular DNA vectors from parent plasmids, selectable markers (e.g., drug resistance genes) and optionally recombinant sites or transposase scars can be deleted. Circular DNA produced by such bacteria lacking selectable markers (e.g., C 3A DNA vector may include any of the features described in International Patent Application PCT / US2022 / 082078, which is incorporated herein by reference in its entirety. Bacterial cells (e.g., Escherichia coli) can be genetically engineered to include a Rep gene encoding a bacterial replication protein, which is optionally integrated into the bacterial genome. The genetically engineered cells can be transfected using a parent plasmid having a vector sequence and a backbone sequence. The vector sequence includes an ori sequence corresponding to the Rep gene (e.g., ColE2-P9 origin of replication) and does not include a selectable marker. The backbone sequence includes a selectable marker and does not include an ori sequence contained in the vector sequence. The parent plasmid may also have restriction enzyme recognition sequences, or site-directed recombination, or transposase recognition sequences adjacent to the aligned vector sequence, thereby allowing the plasmid backbone sequence to be separated from the vector sequence within the cell by restriction digestion, site-directed recombination, or transposase action. In the case of restriction digestion, the circular DNA vector is formed by the autoligation of the vector sequence. In the case of site-directed recombination or transposase activity, a circular DNA vector is formed upon completion of recombination or transposase activity. Isolation of the vector sequence and expression of the rep protein after circular DNA vector formation can maintain the circular DNA vector at high copy numbers, despite the circular DNA vector lacking selectable markers. In contrast, maintenance of the plasmid backbone sequence in genetically modified bacterial cells after isolation can be avoided by modifying culture conditions to remove selective pressure on selectable markers. Culturing a population of bacterial cells containing high-copy-number circular DNA vectors under conditions where the parent plasmid is not maintained results in highly pure C₂ with a high yield of less than 100 bp backbone (and less than 50 bp origin). 3 DNA vectors can be efficiently generated. Such methods are described in International Publication No. 2023 / 122625 and U.S. Patent Application No. 63 / 509,458 (filed June 21, 2023), which are incorporated herein by reference in their entirety.

[0086] One advantage of using a transposase-based system is the ability to further reduce the backbone size within a C 3 DNA DNA vector. For example, the use of a site-specific recombinase creates recombination sites (e.g., binding sites) within the vector near or adjacent to the origin of replication. In contrast, the use of a transposase allows the origin of replication to directly link the 5' end of a therapeutic sequence to the 3' end of the therapeutic sequence without intervening sequences. In some cases, the use of a transposase allows for a "scarless" backbone by placing the sequences of the transfer (transposase overhang) obtained within the therapeutic sequence without changing the function of the therapeutic sequence. As an example, the piggybac transposase generates a 4bp transposase overhang of TTAA. By placing the plasmid backbone within the target sequence at the TTAA site, the system can be designed such that upon transposase-mediated excision of the plasmid backbone from the target sequence, the original target sequence is restored and only the original TTAA sequence remains as the transposase scar. This leaves a backbone within the C 3 DNA DNA vector that does not contain a transposase scar. Thus, the plasmid backbone sequence in the vector can consist entirely of the origin of replication.

[0087] Additionally, or alternatively, the transposase scar can be placed within the vector backbone (e.g., within a sequence containing the origin of replication). For example, if the parental plasmid contains inverted repeats (left end) and (right end) adjacent to the backbone, and / or transposase overhang sequences adjacent to the therapeutic sequence, the transposase scar will be placed between the 3' end and the 5' end of the target sequence (e.g., next to the origin of replication).

[0088] In some embodiments, the C of the present disclosure 3Genetically modified bacterial cells for generating DNA vectors contain a Rep gene that encodes a bacterial replication protein directed towards replication from the ColE2-P9 origin, which can be integrated into the bacterial genome. Alternatively, the Rep gene may be contained on an extrachromosomal DNA molecule, such as a plasmid or bacterial artificial chromosome ("BAC"). The genetically modified bacterial cell further contains a parent plasmid containing the vector sequence and a backbone sequence. The vector sequence contains the origin of replication (ori) sequence corresponding to the Rep gene and does not contain a selectable marker. The backbone sequence contains the gene encoding the selectable marker and does not contain the ori sequence contained in the vector sequence. The parent plasmid also has enzyme recognition sequences (e.g., restriction enzyme recognition sequences, site-directed recombination sequences, or transposase recognition sequences) adjacent to the aligned vector sequence, thereby allowing the plasmid backbone sequence to be separated from the vector sequence within the cell by restriction digestion, transposition, or site-directed recombination.

[0089] In some embodiments, to minimize the bacterial sequence, a short origin of replication, such as the ColE2-P9 origin or a functional variant thereof, is used. 3 It is used in a DNA vector. In such embodiments, the Rep gene encodes a ColE2-P9 replication protein. In some exemplary embodiments, the Rep gene encodes a ColE2-P9 replication protein having the amino acid sequence shown in SEQ ID NO: 1 (or, for example, a functional variant thereof having at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity thereto). Other suitable replication proteins include those encoded by naturally occurring plasmids, such as ColE3-CA38, which are associated with ColE2-P9.

[0090] In some exemplary embodiments, the ori (e.g., one strand) contains or consists of the nucleotide sequence shown in SEQ ID NO: 2. In some embodiments, the ori sequence is a functional fragment of a ColE2-P9 ori sequence having the DNA sequence shown in SEQ ID NO: 2 (on one strand). The 40-base pair functional fragment shown in SEQ ID NO: 2 is capable of supporting vector replication in cells expressing the ColE2-P9 replication protein. In some embodiments, the ori is a ColE2-P9 origin and is approximately 40 nucleotides or less in length, or 38 nucleotides or less, 37 nucleotides or less, 36 nucleotides or less, 34 nucleotides or less, or 30 nucleotides or less. In various embodiments, the ColE2-P9 origin is 20-40 nucleotides in length, or 30-40 nucleotides or 34-40 nucleotides in length, thereby C 3 Minimize bacterial sequences in the DNA vector. In some embodiments, the ori sequence is a naturally occurring ori sequence.

[0091] In some cases, the ori sequence is a functional variant of a naturally occurring ori, such as an ori sequence modified to be shorter than the corresponding naturally occurring ori sequence while still retaining the ability to support replication initiation. Examples of such functional variants of the ColE2-P9 replication origin include SEQ ID NOs: 3–11. Although such sequences are shown herein as single-stranded for convenience, it is recognized that the origin will exist in the vector as double-stranded DNA. In some embodiments, the functional variant has 1, 2, 3, 4, or 5 nucleotide substitutions compared to the origin sequences of SEQ ID NOs: 3–11.

[0092] In some cases, C as specified herein 3The DNA vector is a naked DNA vector and lacks substantial components of bacterial plasmid DNA, such as components specific to viral vectors (e.g., viral proteins) and immunogenic components (e.g., immunogenic bacterial traces (e.g., CpG motifs)) or components associated with persistence, either additionally or otherwise reduced (e.g., CpG islands). For example, in some embodiments, C 3 The DNA vector contains DNA in which at least 50% of the DNA (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) lacks one or more elements of bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial traces (e.g., CpG motifs)) or components associated with additionally or otherwise reduced persistence (e.g., CpG islands). In some embodiments, at least 50% of the DNA (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) lacks CpG methylation. In some embodiments, C 3 The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) of the DNA lacks bacterial methylation traces such as Dam methylation and Dcm methylation. For example, in some embodiments, C 3 The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) of the GATC sequence is unmethylated (e.g., by Dam methylase). In addition or alternatively, C 3The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or essentially all) of the CCAGG sequence and / or CCTGG sequence is unmethylated (e.g., by Dcm methylase).

[0093] In some embodiments, one or more components of the plasmid backbone are missing. 3 DNA vectors are persistent in vivo (for example, C2 is a DNA vector that lacks one or more components of the plasmid backbone). 3 DNA vectors exhibit improved expression persistence (e.g., intracellular persistence and / or persistence across generations) and / or therapeutic persistence compared to reference vectors, such as circular DNA vectors with a plasmid backbone.

[0094] In some embodiments, one or more components of the plasmid backbone are missing. 3 DNA vector expression persists for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year, or longer after administration.

[0095] In some embodiments, one or more components of the plasmid backbone are missing. 3 The DNA vector survives in targeted eye cells for at least approximately 6 months, or at least 1 year, or at least 18 months, or several years. In some embodiments, one or more components of the plasmid backbone are missing. 3The expression level of the DNA vector does not decrease by more than 90%, more than 50%, more than 25%, or more than 10% within one week or more after transfection, e.g., two weeks, three weeks, five weeks, seven weeks, nine weeks or more, thirteen weeks or more, or eighteen weeks or more, from the level observed within the first one, two, or three days. In some embodiments, administration of the nucleic acid vector of this disclosure (e.g., to retinal cells) is four times or less per year, or two times or less per year, or one time or less per year, or less frequently (e.g., once every two years).

[0096] In the embodiment, C 3 DNA vectors are monomeric. In some embodiments, C 3 The DNA vector is superhelical after treatment with, for example, a topoisomerase (e.g., gyrase). In some embodiments, C 3 The DNA vector is a monomeric superhelical circular DNA molecule. In some embodiments, C 3 DNA vectors have nicks. In some embodiments, C 3 The DNA vector is open circular (relaxed open circular). In some embodiments, C 3 DNA vectors are double-stranded circular in shape.

[0097] Therapeutic C described herein 3 The DNA vector comprises a therapeutic sequence that may include one or more protein-coding domains and / or one or more non-protein-coding domains. The therapeutic sequence may include any of the expression constructs disclosed herein.

[0098] C containing non-protein-coding therapeutic sequences 3 In embodiments of DNA vectors, the therapeutic sequence lacks a protein-coding domain (e.g., a therapeutic protein-coding domain). For example, in some embodiments, the therapeutic sequence includes a short hairpin RNA (shRNA) coding sequence or a non-protein-coding therapeutic nucleic acid such as an immunoactivating therapeutic nucleic acid (e.g., a TLR agonist).

[0099] C 3In some embodiments of DNA vectors, the therapeutic sequence is 0.1Kb to 100Kb in length (for example, therapeutic gene sequences are 0.2Kb to 90Kb, 0.5Kb to 80Kb, 1.0Kb to 70Kb, 1.5Kb to 60Kb, 2.0Kb to 50Kb, 2.5Kb to 45Kb, 3.0Kb to 40Kb, 3.5Kb to 35Kb, 4.0Kb to 30Kb, 4.5Kb to 25Kb, 4.6Kb to 24Kb, 4.7Kb to 23Kb, 4.8Kb to 22Kb, 4.9Kb to 21Kb, 5.0Kb to 20Kb, 5.5Kb to 18Kb, 6 Lengths of 0.0Kb~17Kb, 6.5Kb~16Kb, 7.0Kb~15Kb, 7.5Kb~14Kb, 8.0Kb~13Kb, 8.5Kb~12.5Kb, 9.0Kb~12.0Kb, 9.5Kb~11.5Kb, or 10.0Kb~11.0Kb, for example, 0.1Kb~0.5Kb, 0.5Kb~1.0Kb, 1.0Kb~2.5Kb, 2.5Kb~4.5Kb, 4.5Kb~8Kb, 8Kb~10Kb, 10Kb~15Kb, 15Kb~20Kb, or longer, for example, 0.1Kb~0.25Kb, 0.25Kb. b~0.5Kb, 0.5Kb~1.0Kb, 1.0Kb~1.5Kb, 1.5Kb~2.0Kb, 2.0Kb~2.5Kb, 2.5Kb~3.0Kb, 3.0Kb~3.5Kb, 3.5Kb~4.0Kb, 4.0Kb~4.5Kb, 4.5Kb~5.0Kb, 5.0Kb~5.5Kb, 5.5Kb~6.0Kb, 6.0Kb~6.5Kb, 6.5Kb~7.0Kb, 7.0Kb~7.5K b, 7.5Kb~8.0Kb, 8.0Kb~8.5Kb, 8.5Kb~9.0Kb, 9.0Kb~9.5Kb, 9.5Kb~10K b, 10Kb~10.5Kb, 10.5Kb~11Kb, 11Kb~11.5Kb, 11.5Kb~12Kb, 12Kb~12.5Kb, 12.5Kb~13Kb, 13Kb~13.5Kb, 13.5Kb~14Kb, 14Kb~14.5Kb, 14.5Kb ~15Kb, 15Kb~15.5Kb, 15.5Kb~16Kb, 16Kb~16.5Kb, 16.5Kb~17Kb, 17Kb ~17.5Kb, 17.5Kb~18Kb, 18Kb~18.5Kb, 18.5Kb~19Kb, 19Kb~19.5Kb, 19.Lengths of 5Kb-20Kb, 20Kb-21Kb, 21Kb-22Kb, 22Kb-23Kb, 23Kb-24Kb, 24Kb-25Kb, or longer (for example, approximately 4.5Kb, 5.0Kb, 5.5Kb, 6.0Kb, 6.5Kb, 7.0Kb, 7.5Kb, 8.0Kb, 8.5Kb, 9.0Kb, 9.5Kb, 10Kb, 11Kb, 12Kb, 13Kb, 14Kb, 15Kb, 16Kb, 17Kb, 18Kb, 19Kb, 20Kb, or longer). In some embodiments, the therapeutic sequence is at least 10Kb (e.g., 10Kb-15Kb, 15Kb-20Kb, or 20Kb-30Kb; e.g., 10Kb-13Kb, 10Kb-12Kb, or 10Kb-11Kb; e.g., 10-11Kb, 11-12Kb, 12-13Kb, 13-14Kb, or 14-15Kb). In some embodiments, the therapeutic sequence is at least 1,100bp long (e.g., 1,100bp-10,000bp, 1,100bp-8,000bp, or 1,100bp-5,000bp long). In some embodiments, the therapeutic sequence is at least 2,500 bp long (e.g., 2,500 bp to 15,000 bp, 2,500 bp to 10,000 bp, or 2,500 bp to 5,000 bp long; e.g., 2,500 bp to 5,000 bp, 5,000 bp to 7,500 bp, 7,500 bp to 10,000 bp, 10,000 bp to 12,500 bp, or 12,500 bp to 15,000 bp). In some embodiments, the therapeutic sequence is at least 8,000 bp, at least 9,000 bp, at least 10,000 bp, at least 11,000 bp, at least 12,000 bp, at least 13,000 bp, at least 14,000 bp, at least 15,000 bp, or at least 16,000 bp (e.g., 11,000 bp–16,000 bp, 12,000 bp–16,000 bp, 13,000 bp–16,000 bp, 14,000 bp–16,000 bp, or 15,000 bp–16,000 bp). In certain embodiments, the therapeutic sequence is large enough to encode a protein and is not oligonucleotide therapy (e.g., not antisense, siRNA, shRNA therapy, etc.).

[0100] In some embodiments, the nucleic acid vector includes a reporter sequence in addition to a therapeutic protein-coding domain or a therapeutic non-protein-coding domain. Such reporter genes may be useful, for example, for verifying the expression of therapeutic gene sequences in specific cells and tissues. Reporter sequences that can be provided in a transgene include, but are not limited to, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art. When accompanied by regulatory elements that drive their expression, the reporter sequence provides a signal detectable by conventional means, including enzymatic, radioactive, colorimetric, fluorescence or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of the signal-carrying vector can be detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the signal-carrying vector can be visually measured by the generation of color or light in a light meter. In some embodiments, the therapeutic sequence is deficient in the reporter sequence.

[0101] In some cases, the nucleic acid vector is a non-viral DNA vector (e.g., the DNA vector is not encapsulated within a viral capsid). Additionally or alternatively, in some embodiments, the nucleic acid vector is not encapsulated within an envelope (e.g., a lipid envelope) or matrix (e.g., a polymer matrix) and does not physically bind (e.g., covalently or non-covalently) to a solid structure (e.g., a particulate structure) before or during administration to an organism. In some embodiments, the nucleic acid vector is not connected to any adjacent nucleic acid vectors, thereby allowing each nucleic acid vector to diffuse freely in a solution of nucleic acid vectors independently of adjacent ones. In some embodiments, the nucleic acid vector is accompanied by another agent in solution, such as a charge-changing molecule or a stabilizing molecule.

[0102] Nucleic acid vectors can be naked DNA vectors, meaning they are not complexed with another drug (e.g., encapsulated within another drug, conjugated to it, or non-covalently bound to it). Naked DNA vectors can be co-formulated (e.g., in solution) with drugs that are not complexed with the naked DNA vector, such as buffers and / or drugs generally recognized as safe (GRAS) by the U.S. Food and Drug Administration.

[0103] Pharmaceutical composition The present invention also provides a method comprising administering a pharmaceutical composition having a therapeutic agent (e.g., any of the nucleic acid vectors described herein (e.g., circular DNA vectors)) in a pharmaceutically acceptable carrier. In some cases, the pharmaceutical composition contains a non-viral nucleic acid vector (e.g., the pharmaceutical composition substantially lacks a viral capsid). Additionally or alternatively, the pharmaceutical composition may contain a nucleic acid vector that is not encapsulated in an envelope (e.g., a lipid envelope) or matrix (e.g., a polymer matrix) and does not physically bind (e.g., covalently or non-covalently) to a solid structure (e.g., a particulate structure) before and during administration to an individual. In some embodiments of the pharmaceutical composition, the nucleic acid vectors are not linked to any adjacent nucleic acid vectors, thereby allowing each nucleic acid vector to diffuse freely in a solution of nucleic acid vectors independently of adjacent nucleic acid vectors. In some embodiments of the pharmaceutical composition, the nucleic acid vectors are accompanied by another agent in solution, such as a charge-changing molecule or a stabilizing molecule.

[0104] A pharmaceutical composition may contain a nucleic acid vector in a naked form, i.e., the nucleic acid vector is not complexed with another drug (e.g., encapsulated within another drug, conjugated to it, or non-covalently bound to it). In such a pharmaceutical composition, the naked nucleic acid molecule may be co-formulated (e.g., in solution) with a buffer and / or a drug that is not complexed with the naked nucleic acid molecule, such as a drug generally recognized as safe (GRAS) by the U.S. Food and Drug Administration.

[0105] In some cases of the present invention, the pharmaceutical composition comprises a naked circular DNA vector.

[0106] Pharmaceutically acceptable carriers include excipients and / or stabilizers that are nontoxic to the organism at the dose and concentration used. In some embodiments, the pharmaceutically acceptable carrier is a pH-buffered aqueous solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphates, citrates, and other organic acids; antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, e.g., serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, e.g., glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, e.g., glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols, e.g., mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as tween, polyethylene glycol (PEG), and Pluronic.

[0107] A pharmaceutical composition having the therapeutic agent of the present invention (e.g., a nucleic acid vector such as a circular DNA vector) may contain a pharmaceutically acceptable carrier. When the composition is provided in liquid dosage form, the carrier may be water (e.g., pyrogen-free water), isotonic saline, or a buffered aqueous solution, such as a phosphate buffer or a citrate buffer. The pharmaceutical composition may be injected in water or a buffer, such as an aqueous buffer containing a sodium salt (e.g., at least 50 mM sodium salt), a calcium salt (e.g., at least 0.01 mM calcium salt), or a potassium salt (e.g., at least 3 mM potassium salt). According to a particular embodiment, sodium, calcium, or potassium salts may exist in the form of their halides, such as chlorides, iodides, or bromides, or in the form of their hydroxides, carbonates, bicarbonates, or sulfates. Examples of sodium salts, but not limited to, include NaCl, NaI, NaBr, Na2CO2, NaHCO2, and Na2SO4. Examples of potassium salts include, for example, KCl, KI, KBr, K2CO2, KHCO2, and K2SO4. Examples of calcium salts include, for example, CaCl2, CaI2, CaBr2, CaCO2, CaSO4, and Ca(OH)2. In addition, the organic anions of the cations mentioned above may be included in the buffer. According to a particular embodiment, a buffer suitable for the injection purpose as defined above may contain a salt selected from sodium chloride (NaCl), calcium chloride (CaCl2), or potassium chloride (KCl), in which case further anions may be present. CaCl2 may also be replaced with another salt such as KCl. In some embodiments, the salts in the injection buffer are present at concentrations of at least 50 mM sodium chloride (NaCl), at least 3 mM potassium chloride (KCl), and at least 0.01 mM calcium chloride (CaCl2).The injection buffer may be hypertonic, isotonic, or hypotonic with respect to a specific reference medium; that is, the buffer may have a higher, identical, or lower salt content with respect to a specific reference medium, preferably of the aforementioned salts at such concentrations that do not cause cell damage due to osmotic action or other concentration effects. The reference medium may be a liquid such as blood, lymph, cytoplasm, other body fluids, or a general buffer. Such general buffers or liquids are known to those skilled in the art. Ringer's lactate solution is particularly preferred as the liquid base.

[0108] One or more compatible solid or liquid fillers, diluents, or encapsulating compounds may be suitable for administration to humans. The components of the pharmaceutical compositions according to the present invention can be mixed with nucleic acid vectors according to the present invention as defined herein in such a manner that no interactions occur that would substantially reduce the pharmaceutically effectiveness of the (pharmaceutical) compositions according to the present invention under typical use conditions. Pharmaceutically acceptable carriers, fillers, and diluents can have sufficiently high purity and sufficiently low toxicity to be suitable for administration to an individual under treatment. Some examples of compounds that can be used as pharmaceutically acceptable carriers, fillers, or components thereof include sugars, e.g., lactose, glucose, trehalose, and sucrose; starches, e.g., corn starch or potato starch; dextrose; cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; powdered tragacanth; malt; gelatin; animal fat; solid flow promoters, e.g., stearic acid, magnesium stearate; calcium sulfate; vegetable oils, e.g., peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa oil; polyols, e.g., polypropylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; or alginic acid.

[0109] The selection of a pharmaceutically acceptable carrier can be determined according to the manner in which the pharmaceutical composition is administered.

[0110] Suitable unit doses for injection include sterile solutions of water, physiological saline, and mixtures thereof. The pH of such solutions can be adjusted to approximately 7.4. Suitable carriers for injection include hydrogels, devices for controlled or delayed release, polylactic acid, and collagen matrices.

[0111] Pharmaceutical compositions according to the present invention can be provided in liquid or dry (e.g., lyophilized) form. In certain embodiments, the nucleic acid vector of the pharmaceutical composition is provided in lyophilized form. Prior to administration, the lyophilized composition containing the nucleic acid vector of the present invention can be advantageously reconstituted in a suitable buffer based on an aqueous carrier, such as Ringer's lactate solution, Ringer's solution, or phosphate buffer solution.

[0112] In certain embodiments of the present invention, any of the nucleic acid vectors of the present invention can be complexed with one or more cationic or polycationic compounds, such as cationic or polycationic polymers, cationic or polycationic peptides or proteins, such as protamines, cationic or polycationic polysaccharides, and / or cationic or polycationic lipids.

[0113] According to certain embodiments, the nucleic acid vectors of the present invention can be complexed with lipids to form one or more liposomes, lipoplexes, or lipid nanoparticles. Thus, in one embodiment, the composition of the present invention comprises liposomes, lipoplexes, and / or lipid nanoparticles containing a therapeutic agent (e.g., a nucleic acid vector, e.g., a circular DNA vector).

[0114] Lipid-based formulations can be effective delivery systems for nucleic acid vectors due to their biocompatibility and ease of large-scale production. Cationic lipids have been widely studied as synthetic materials for nucleic acid delivery. After mixing, nucleic acids condense with cationic lipids to form lipid / nucleic acid complexes known as lipoplexes. These lipid complexes protect genetic material from the action of nucleases and can deliver it into cells by interacting with negatively charged cell membranes. Lipoplexes can be prepared by directly mixing positively charged lipids with negatively charged nucleic acids at physiological pH.

[0115] Conventional liposomes include a lipid bilayer that encapsulates an aqueous core, which can be composed of cationic, anionic, or neutral phospholipids and cholesterol. Both the lipid bilayer and the aqueous space can incorporate hydrophobic or hydrophilic compounds, respectively. Liposome properties and in vivo behavior can be altered by adding a hydrophilic polymer coating, such as polyethylene glycol (PEG), to the liposome surface to confer steric stabilization. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to their surface or to the ends of the attached PEG chains.

[0116] Liposomes are colloidal lipid-based and surfactant-based delivery systems composed of a phospholipid bilayer surrounding an aqueous compartment. They can exist as spherical vesicles and can range in size from 20 nm to several microns. Cationic lipid-based liposomes can complex with negatively charged nucleic acids via electrostatic interactions to form complexes that offer the biocompatibility, low toxicity, and potential for large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed via the endocytosis pathway, followed by the release of genetic material from the endosome / carrier into the cytoplasm.

[0117] Cationic liposomes can function as delivery system RNA. Cationic lipids such as MAP (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate) can form complexes or lipoplexes with negatively charged nucleic acids, forming nanoparticles through electrostatic interactions and providing high in vitro transfection efficiency. Furthermore, neutral lipid-based nanoliposomes are available for nucleic acid vector delivery, for example, as nanoliposomes based on neutral 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC).

[0118] Therefore, in one embodiment of the present invention, the nucleic acid vector of the present invention is complexed with cationic lipids and / or neutral lipids to form liposomes, lipid nanoparticles, lipoplexes, or neutral lipid-based nanoliposomes.

[0119] In certain embodiments, a pharmaceutical composition according to the present invention comprises a nucleic acid vector of the present invention, formulated together with a cationic or polycationic compound and / or a polymeric carrier. Thus, in further embodiments of the present invention, the nucleic acid vector as defined herein comprises a nucleic acid vector selected optionally from the range of about 5:1 (w / w) to about 0.25:1 (w / w), for example, about 5:1 (w / w) to about 0.5:1 (w / w), for example, about 4:1 (w / w) to about 1:1 (w / w), or about 3:1 (w / w) to about 1:1 (w / w), for example, about 3:1 (w / w) to about 2:1 (w / w), and a cationic or polycationic compound and / or The nucleic acid vector is bound or complexed with a cationic or polycationic compound and / or polymeric carrier in a nitrogen / phosphorus (N / P) ratio of the nucleic acid vector to the cationic or polycationic compound and / or polymeric carrier, in a weight ratio of approximately 0.1 to 10, for example, in the range of approximately 0.3 to 4 or 0.3 to 1, for example, in the range of approximately 0.5 to 1 or 0.7 to 1, for example, in the range of approximately 0.3 to 0.9 or 0.5 to 0.9. For example, the N / P ratio of the nucleic acid vector to one or more polycations is in the range of approximately 0.1 to 10, including approximately 0.3 to 4, approximately 0.5 to 2, approximately 0.7 to 2 and approximately 0.7 to 1.5.

[0120] The nucleic acid vectors described herein may also be accompanied by a vehicle, a transfection agent, or a complexing agent to increase transfection efficiency and / or the expression of regulatory genes according to the present invention.

[0121] In some cases, the pharmaceutical composition contains a nucleic acid vector complexed with one or more polycations (e.g., protamine or oligofectamine). Further cationic or polycationic compounds that can be used as transfection agents or complexing agents include cationic polysaccharides, e.g., chitosan, polybrene; cationic polymers, e.g., polyethyleneimine (PEI); cationic lipids, e.g., DOTMA:[1-(2,3-sioleyloxy(sioleyloxy))propyl)]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPE, LEAP, DOPE: dioleylphosphatidylethanolamine, DOSPA, DODAB, DOIC, DMEPC, DOGS: dioctadecylamideglycylspermine, DIMRI: dimyristooxypropyldimethylhydroxyethylammonium Mubromide, MAP: Dioleoyloxy-3-(trimethylammonio)propane, DC-6-14: O,O-Ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride, CLIP1: rac-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3-dihexadecyloxypropyloxymethyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyloxypropyloxysuccinyloxy)ethyl]trimethylammonium, oligofectamine, or cationic or polycationic polymers, e.g., modified polyamino acids, e.g., β-amino acid polymers or reversed polyamides. Modified polyethylene, such as polyamide, for example PVP (poly(N-ethyl-4-vinylpyridinium bromide)), modified acrylate, for example pDMAEMA (poly(dimethylaminoethyl methacrylate)), modified amide amine, for example pAMAM (poly(amide amine)), modified polybeta-aminoester (PBAE), for example diamine-terminated 1,Examples include 4-butanediol diacrylate-co-5-amino-1-pentanol polymer, dendrimers such as polypropylamine dendrimers or pAMAM-based dendrimers, polyimines such as PEI: poly(ethyleneimine), poly(propyleneimine), polyallylamine, polymers based on sugar skeletons such as cyclodextrin, polymers based on dextran, chitosan, polymers based on silane skeletons such as PMOXA-PDMS copolymer, block polymers consisting of a combination of one or more cationic blocks (e.g., selected from the cationic polymers mentioned above), and block polymers consisting of one or more hydrophilic or hydrophobic blocks (e.g., polyethylene glycol).

[0122] In particular embodiments, the pharmaceutical compositions of the present invention include a therapeutic agent, such as a nucleic acid vector (e.g., a circular DNA vector), encapsulated within or conjugated to a polymeric carrier. The polymeric carrier used in accordance with the present invention may be a polymeric carrier formed from disulfide-crosslinked cationic components. The disulfide-crosslinked cationic components may be the same as or different from one another. The polymeric carrier may also include further components. It is also particularly preferable that the polymeric carrier used in accordance with the present invention comprises a mixture of a cationic peptide, protein, or polymer crosslinked by disulfide bonds as described herein, and optionally further components as defined herein. In this context, the disclosure of International Publication No. 2012 / 013326 is incorporated herein by reference. In this context, the cationic component that forms the basis for the polymeric support by disulfide crosslinking is typically selected from any suitable cationic or polycationic peptide, protein, or polymer suitable for this purpose, in particular any cationic or polycationic peptide, protein, or polymer capable of complexing with further nucleic acids to be included in the nucleic acid vector or composition as defined herein, thereby preferably condensing the nucleic acid vector. The cationic or polycationic peptide, protein, or polymer may be a linear molecule; however, branched cationic or polycationic peptide, protein, or polymer may also be used.

[0123] All disulfide-crosslinkable cationic or polycationic proteins, peptides, or polymers of polymeric carriers that can be used to complex a nucleic acid vector according to the present invention, which may be included as part of a pharmaceutical composition of the present invention, may contain at least one SH moiety (e.g., at least one cysteine ​​residue or any further chemical group presenting an SH moiety) capable of forming a disulfide bond upon condensation with at least one further cationic or polycationic protein, peptide, or polymer as the cationic component of the polymeric carrier as referred to herein.

[0124] Such polymeric carriers used to complexate the nucleic acid vectors of the present invention can be formed from disulfide-crosslinked cationic (or polycationic) components. In particular, such cationic or polycationic peptides, proteins, or polymers of polymeric carriers containing or additionally modified to contain at least one SH moiety can be selected from proteins, peptides, and polymers as complexing agents.

[0125] In other embodiments, pharmaceutical compositions according to the present invention can be administered in their unencumbered form without any further vehicle, transfection agent, or complexing agent.

[0126] IV. Kits and Products In another aspect of the present invention, a product or kit is provided that contains a substance useful for the above-mentioned treatment. The product includes a container and a label or accompanying information on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, and IV solution bags. The container can be formed from a variety of materials, such as glass or plastic. The container can hold the composition alone or in combination with another composition effective for treating, preventing and / or diagnosing a condition and may have a sterile access port (for example, the container may be an intravenous solution bag or vial with a stopper that can be punctured with a subcutaneous injection needle). At least one activator in the composition is the therapeutic agent of the present invention (e.g., a nucleic acid vector (e.g., a non-viral DNA vector, e.g., a circular DNA vector lacking a bacterial origin of replication, a drug resistance gene, and / or a recombination site)) or a pharmaceutical composition containing the therapeutic agent of the present invention. The label or accompanying information indicates that the composition is used to treat a particular disease or disorder. The product may further include accompanying information indicating that the composition can be used to treat a particular condition (e.g., Fuchs dystrophy). Alternatively or additionally, the product may further include a second container containing a pharmaceutically acceptable carrier, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, dextrose solution, or any of the pharmaceutically acceptable carriers disclosed above. The product may further include other substances desirable from a commercial and user perspective, including other buffers, diluents, filters, needles, and syringes.

[0127] In certain embodiments of the present invention, a kit is provided comprising (i) one or more of the above-mentioned substances (e.g., any and / or one or more pharmaceutically acceptable carriers of the therapeutic agents of the present invention described above) and (ii) one or more elements of an energy delivery device (e.g., a device comprising electrodes for transmitting an electric field to a tissue (e.g., the retina), such as any of the above-mentioned preferred devices or systems). In some embodiments, a kit comprising a therapeutic agent of the present invention (e.g., a nucleic acid vector (e.g., a nonviral DNA vector, e.g., a circular DNA vector)) and electrodes is provided herein. In some embodiments, a kit comprising a pharmaceutical composition comprising a therapeutic agent of the present invention (e.g., a nucleic acid vector (e.g., a nonviral DNA vector, e.g., a circular DNA vector)) and electrodes is provided herein. [Examples]

[0128] Example 1: C 3 GFP expression in corneal endothelium by electrotransduction of DNA Dutch Belted rabbits were anesthetized, and their eyeballs were prepared in a sterile manner. Approximately 100 microliters of C2 containing the reporter gene GFP were added. 3 DNA was injected into the anterior chamber of the rabbit eye. Electrical introduction mediated by a pulsed electric field was performed using C 3 The procedure was performed immediately after DNA injection. The needle electrode was positioned in the anterior chamber, close to the posterior surface of the cornea. Figure 1A shows the relative positions of the injection needle and electrode.

[0129] Eight -50V pulses with a duration of 5ms were applied. GFP expression in the cornea was visualized in live animals on postoperative day 7 using a RetCam equipped with a gonioscope lens and a fluorescence filter. Subsequently, the rabbits were sacrificed, their eyeballs were excised, and processed for histological analysis. The localization of GFP in the corneal endothelium was confirmed by immunofluorescence microscopy using an anti-GFP antibody (Figure 1C).

[0130] Example 2: C 3 GFP expression in the corneal stroma by electrotransduction of DNA Dutch Belted rabbits were anesthetized, and their eyeballs were prepared in a sterile manner. Approximately 50 microliters of C2 containing the reporter gene GFP were added. 3 DNA was injected into the corneal stroma of rabbit eyes. Fluid delivery into the corneal stroma was demonstrated by corneal whitening. Electrical introduction mediated by a pulsed electric field was performed using C 3 The procedure was performed immediately after DNA injection. The COMET electrode was positioned in the anterior chamber, close to the posterior surface of the cornea. Figure 2A shows the relative positions of the injection needle and electrode.

[0131] Eight -20V pulses with a duration of 20ms were applied. GFP expression in the cornea was visualized in live animals on postoperative day 7 using a RetCam equipped with a gonioscope lens and a fluorescence filter. Surprisingly, widespread GFP expression was observed across a large portion of the corneal surface (Figure 2B). Subsequently, the rabbits were sacrificed, their eyeballs were extracted, and processed for histological analysis. The localization of GFP within the corneal stroma was confirmed by immunofluorescence microscopy using an anti-GFP antibody (Figure 2C).

[0132] [Table 1]

[0133] Other Embodiments All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication or patent application is specifically and individually indicated to be incorporated by reference.

[0134] While the present invention has been described in relation to its specific embodiments, further modifications are possible, and it will be understood that this application is intended to extend to any modification, use, or adaptation of the present invention, which can be applied to the essential features described above and is subject to the scope of the claims, including any deviations from this disclosure that are in accordance with the principles of the present invention and that fall within the known or customary practice of the art to which the present invention belongs.

[0135] Other embodiments are included in the claims.

Claims

1. A method for expressing a transgene in eye cells of the anterior segment of the eyeball in an individual, (a) A step of administering a circular DNA vector into the anterior segment of the eyeball, wherein the circular DNA vector lacks one or more components of a plasmid backbone and encodes a transgene; (b) The step of placing one or more electrodes in and / or around the eyeball; and (c) A step of transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of a circular DNA vector into ophthalmic cells of the anterior segment of the eye, thereby expressing the transgene in the ophthalmic cells of the anterior segment of the eye. Methods that include...

2. The method according to claim 1, wherein a circular DNA vector is expressed in ophthalmic cells of the anterior segment of the eye 8 days after administration.

3. The method according to claim 1 or 2, wherein the transgene expressed by a circular DNA vector in ophthalmic cells of the anterior segment of the eye is more persistent than the transgene encoded by a plasmid DNA vector encoding the transgene.

4. The method according to any one of claims 1 to 3, wherein the circular DNA vector in the ophthalmic cells of the anterior segment of the eye is less immunogenic than the plasmid DNA vector encoding the transgene.

5. The method according to any one of claims 1 to 4, wherein one or more components of the plasmid backbone missing in the circular DNA vector include a drug resistance gene and / or an origin of replication.

6. The method according to any one of claims 1 to 5, wherein the circular DNA vector is a nonviral circular DNA vector.

7. The method according to claim 6, wherein the nonviral circular DNA vector is a naked circular DNA vector.

8. The method according to claim 6 or 7, wherein the DNA vector is a synthetic circular DNA vector.

9. The method according to any one of claims 1 to 7, wherein the DNA vector includes an origin of replication.

10. The method according to any one of claims 1 to 9, wherein the DNA vector lacks a selectable marker.

11. The method according to claim 9, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.

12. The method according to any one of claims 1 to 11, wherein step (a) includes administering a circular DNA vector into the anterior chamber or corneal stroma.

13. The method according to any one of claims 1 to 12, wherein step (b) includes placing one or more electrodes in the anterior chamber, and step (c) includes transmitting electrical energy through the one or more electrodes placed in the anterior chamber.

14. The method according to claim 12 or 13, wherein the anterior chamber position of one or more electrodes is within 5 mm of the corneal endothelium.

15. The method according to any one of claims 1 to 14, wherein at least one of the one or more electrodes is a needle electrode.

16. The method according to any one of claims 1 to 5, wherein the ophthalmic cells of the anterior segment of the eye expressing a circular DNA vector are corneal cells, trabecular reticular cells, iris cells, lens cells, ciliary cells, and / or Schlemm's canal cells.

17. The method according to claim 16, wherein the corneal cells are corneal endothelial cells or corneal stromal cells.

18. The method according to any one of claims 1 to 17, wherein the introduced gene encodes a protective factor that promotes corneal endothelial cell survival.

19. The method according to claim 18, wherein the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway.

20. The method according to any one of claims 1 to 19, wherein a circular DNA vector silences, modifies, or replaces a mutant gene associated with Fuchs dystrophy.

21. The method according to claim 19, wherein the gene associated with Fuchs dystrophy is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

22. A method for expressing therapeutic proteins in eye cells of the anterior segment of an individual, (a) A step of administering a nucleic acid vector into the anterior segment of the eyeball, wherein the nucleic acid vector encodes a therapeutic protein; (b) The step of placing one or more electrodes in and / or around the eyeball; and (c) A step of transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of a nucleic acid vector into ophthalmic cells of the anterior segment of the eye, thereby expressing a therapeutic protein in the ophthalmic cells of the anterior segment of the eye. Methods that include...

23. The method according to claim 22, wherein the therapeutic protein is a protective factor that promotes corneal endothelial cell survival.

24. The method according to claim 23, wherein the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway.

25. The method according to any one of claims 22 to 24, wherein the nucleic acid vector silences, modifies, or replaces a mutant gene associated with Fuchs dystrophy.

26. The method according to claim 25, wherein the gene associated with Fuchs dystrophy is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

27. The method according to claim 25 or 26, wherein the individual has Fuchs dystrophy.

28. A method for treating Fuchs dystrophy in individuals requiring treatment, (a) A step of administering a nucleic acid vector to the anterior segment of the eyeball in an individual, wherein the nucleic acid vector encodes a protective factor that promotes corneal endothelial cell survival; (b) The step of placing one or more electrodes in and / or around the eyeball; and (c) A step of transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of a nucleic acid vector into anterior segment ophthalmic cells, thereby causing protective factors to be expressed in an amount sufficient to treat Fuchs dystrophy in the anterior segment ophthalmic cells. Methods that include...

29. A method for treating Fuchs dystrophy in individuals requiring treatment, (a) A step of administering a nucleic acid vector to the anterior segment of the eyeball in an individual, wherein the nucleic acid vector silences, modifies, or replaces a mutant gene associated with Fuchs dystrophy; (b) The step of placing one or more electrodes in and / or around the eyeball; and (c) A step of transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of a nucleic acid vector into ophthalmic cells of the anterior segment of the eye, thereby silencing, modifying, or replacing a mutant gene in an amount sufficient to treat Fuchs dystrophy. Methods that include...

30. The method according to claim 28 or 29, wherein the nucleic acid vector lacks one or more components of a plasmid backbone.

31. The method according to any one of claims 28 to 30, wherein the nucleic acid vector includes an origin of replication.

32. The method according to any one of claims 28 to 31, wherein the DNA vector lacks a selectable marker.

33. The method according to claim 31, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.

34. A circular DNA vector, (a) Eukaryotic cell promoter; (b) A code array, (i) Encodes a protective factor that promotes corneal endothelial cell survival; or (ii) Silence, modify, or replace mutant genes associated with Fuchs dystrophy. Code array; and (c) Bacterial replication origins less than 50 bp in length A circular DNA vector containing and lacking a selectable marker.

35. The circular DNA vector according to claim 34, wherein the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway.

36. The circular DNA vector according to claim 34, wherein the gene associated with Fuchs dystrophy is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.

37. A circular DNA vector according to any one of claims 34 to 36, wherein the 3' end of the coding sequence is ligated to the 5' end of the promoter by a sequence containing a bacterial origin of replication, and the sequence containing the bacterial origin of replication is less than 100 bp in length.

38. (a) A circular DNA vector according to any one of claims 34 to 37, and (b) Suitable carriers for use in the delivery of pharmaceutical compositions to solids A pharmaceutical composition containing the following:

39. A method for delivering a circular DNA vector according to any one of claims 34 to 38 to eye cells in the anterior segment of an individual, (a) A step of administering a circular DNA vector into the anterior segment of the eyeball; (b) The step of placing one or more electrodes in and / or around the eyeball; and (c) A step of delivering the circular DNA vector to the anterior segment eye cells by transferring electrical energy through one or more electrodes under conditions suitable for the electrical introduction of the circular DNA vector into the anterior segment eye cells. Methods that include...