A modular system for converting therapeutic microRNA expression cassettes from polymerase III-based promoters to polymerase II-based promoters.

Abstract

Disclosed herein is a modular system, namely a DNA expression cassette, specifically designed to enable tissue-specific expression of miRNA while maintaining processing fidelity and efficacy, by converting the therapeutic miRNA expression cassette from the use of a ubiquitous RNA polymerase III-based promoter to the use of an RNA polymerase II-based promoter. Also disclosed herein are compositions comprising nucleic acid expression cassettes, vectors, nanoparticles, extracellular vesicles, and exosomes, as well as methods of use and therapeutic methods comprising DNA expression cassettes.

Description

[Technical Field]

[0001] Inclusion by referencing the sequence list This application includes, as a separate part of the disclosure, a computer-readable sequence listing (filename: 58942_SeqListing.xml, size: 59,830 bytes, date created: April 30, 2024), which is incorporated herein by reference in its entirety.

[0002] This disclosure relates to the field of gene therapy and the use of therapeutic microRNAs (miRNAs). Specifically, this disclosure provides a modular system, i.e., a DNA expression cassette, designed to express miRNAs in a tissue-specific manner while maintaining processing fidelity and efficacy, by converting the therapeutic miRNA expression cassette from the use of a ubiquitous RNA polymerase III-based promoter to an RNA polymerase II-based promoter. [Background technology]

[0003] Dominant genetic disorders may benefit from RNA interference (RNAi)-based gene therapy. RNAi was discovered around 1998, and since then, many RNAi-based gene therapies have been developed; however, RNAi-based approaches are still under translational and clinical development. Many RNAi-based systems rely on first-generation expression strategies using ubiquitous RNA polymerase III (pol III)-driven promoters, such as U6 or H1, to drive shRNA or miRNA expression in vivo. These systems are advantageous because they produce primary miRNA transcripts from defined transcription start and termination sites, thereby enabling consistent processing of predictable mature products via the endogenous miRNA biodevelopmental pathway. However, these pol III-based systems do not allow for cell- or tissue-specific expression. Commonly used tissue-specific promoters utilize RNA polymerase II (pol II) to drive transcription. These pol II-based systems often have multiple transcription start sites and require poly(A) signaling and transcript polyadenylation for termination. As a result of these sequence differences, converting pol III-driven miRNAs to pol II-driven systems can alter the secondary structure of primary miRNA transcripts, thereby modifying the maturation process by the RNAse enzymes Drosha and Dicer. This is important because even a single nucleotide change in the mature miRNA or shRNA sequence can affect specificity and efficiency. For this reason, converting existing pol III-based miRNA expression systems to those driven by RNA pol II while still producing the same mature miRNAs can be challenging.

[0004] Many first-generation miRNA or shRNA expression systems use RNA polymerase III-based promoters to drive expression (e.g., U6, H1, tRNA promoters). Other first-generation systems use RNA pol II-based promoters, but these are less commonly used and tend to produce primary transcripts that are not processed as predictably into mature miRNAs. Therefore, a system that enables conversion from pol III-based to pol II-based systems would allow researchers to leverage preclinical data already generated with first-generation RNA pol II-based promoter systems while restricting miRNA expression to specific cell or tissue types.

[0005] This disclosure provides several novel miRNA designs that enable conversion from existing U6 promoter-driven miRNAs to tissue-specific pol II-based systems. Novel secondary structural elements were incorporated into primary transcript regions adjacent to Drosha and Dicer processing sites, and the efficacy and expression of mature sequences were confirmed in vitro. This system enables rapid conversion from ubiquitous to tissue-specific miRNA expression systems without re-induction of read RNAi triggers, while simultaneously providing a novel approach to limiting the expression of therapeutic miRNAs.

[0006] The development of systems and products for converting existing pol III-based promoter-driven miRNA systems to tissue-specific pol II-based promoter systems while maintaining processing and efficacy fidelity demonstrates a significant unmet need in this field. [Overview of the project]

[0007] This disclosure provides a modular microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. As used herein, the terms “expression cassette,” “expression construct,” or “DNA construct” are interchangeable when considering a miRNA expression cassette, because the expression cassette includes the DNA encoding the miRNA and various components necessary for efficient tissue-specific expression of the miRNA for use with a polymerase II (pol II) promoter.

[0008] Therefore, this disclosure relates to a nucleic acid encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system, wherein the cassette is A single-stranded stem of microRNA, The 5' double-stranded stem of microRNA, The sense strand of a mature microRNA, Modified microRNA loops containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The 3' double-stranded stem of microRNA, A single-stranded stem of microRNA, The present invention provides a nucleic acid containing a DNA nucleotide sequence that codes for a poly(A) signal.

[0009] In some embodiments, the cassette includes, in the expression cassette, a single-stranded stem of the microRNA, a 5' double-stranded stem of the microRNA, a sense strand of the mature microRNA, a modified microRNA loop containing nucleotide changes to facilitate folding, an antisense strand of the mature microRNA, a 3' double-stranded stem of the microRNA, a single-stranded stem of the microRNA, and a DNA nucleotide sequence encoding a poly(A) signal, each in 5' to 3' order.

[0010] In some forms, the cassette is The mir30 single-chain stem, The mir30 5' double-chain stem, The sense strand of a mature microRNA, A modified mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The mir30 has a 3' double-strand stem, The mir30 single-chain stem, It contains a DNA nucleotide sequence that codes for a polyA signal.

[0011] In some embodiments, the cassette includes, in the expression cassette, a DNA nucleotide sequence encoding a single-stranded stem of mir30, a 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop containing nucleotide changes to facilitate folding, an antisense strand of mature microRNA, a 3' double-stranded stem of mir30, a single-stranded stem of mir30, and a poly(A) signal, in the order of 5' to 3' respectively.

[0012] In some embodiments, the single-stranded stem of mir30 includes one nucleotide sequence from sequence numbers 20 to 24, or a nucleotide sequence having at least or about 90% sequence identity with one nucleotide sequence from sequence numbers 20 to 24.

[0013] In some embodiments, the 5' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 25.

[0014] In some ways, the sense strand of a mature miRNA is the sense strand of any mature miRNA.

[0015] In some embodiments, the sense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 17 or 18.

[0016] In some embodiments, the modified mir30 loop includes the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 26.

[0017] In some embodiments, the antisense strand of a mature miRNA is the antisense strand of any mature miRNA. In some embodiments, the antisense strand of a mature miRNA includes the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 27 or 28.

[0018] In some embodiments, the 3' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 29.

[0019] In some embodiments, the mutated single-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 30.

[0020] In some embodiments, the polyadenylation (polyA) signal is the wild-type neuropilin-1 (WT NRP1) polyA signal.

[0021] In some embodiments, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 32.

[0022] In some embodiments, the cassette further includes a restriction site for cloning, and the cassette is The first restriction enzyme site, A single-stranded stem of microRNA or mir30, The 5' double-stranded stem of microRNA or mir30, The sense strand of a mature microRNA, A modified microRNA loop or mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The 3' double-stranded stem of microRNA or mir30, A single-stranded stem of microRNA or mir30, The second restriction enzyme site, Poly-A signal and, It includes a third enzyme restriction site and a DNA nucleotide sequence encoding it.

[0023] In some embodiments, the first restriction enzyme site is the AgeI site. In some embodiments, the AgeI site comprises the nucleotide sequence of SEQ ID NO: 19.

[0024] In some embodiments, the second restriction enzyme site is the AflII site. In some embodiments, the AflII site comprises the nucleotide sequence of SEQ ID NO: 31.

[0025] In some embodiments, the third restriction site is the EcoR1 site. In some embodiments, the EcoR1 site comprises the nucleotide sequence of SEQ ID NO: 33.

[0026] In some embodiments, the third restriction site is the MfeI site. In some embodiments, the MfeI site comprises the nucleotide sequence of SEQ ID NO: 34.

[0027] In some embodiments, the nucleic acid of this disclosure is a nucleotide sequence encoding the sequence of SEQ ID NO: 35 ( [ka] ) or a nucleotide sequence encoding the nucleotide sequence of SEQ ID NO: 35 and including a nucleotide sequence having at least or about 80% sequence identity, In the sequence, N at position 6 1 is U or is omitted, N at position 7 2 is C, A, or U, N at position 8 3 is C or is omitted, N at position 9 4 is C or is omitted, N at position 10 5 is C or is omitted, N at position 11 6 is A or is omitted, N at position 12 7 is A or U, N at position 16 8 is C or G, N at position 17 9 is C, A, or U, N at position 18 10 is U or G, N at position 19 11 is U or G, N at position 31 12 is U or G, N at position 104 13 is C or U, N at position 105 14 is C or U, N at position 109 15 is C or is omitted, N at position 110 16 is U or is omitted, N at position 111 17 is U or is omitted, N at position 112 18 is A or is omitted, N at position 113 19 is A or is omitted, N at position 114 20 is G or is omitted, N ranked 130th 21 is C or G, N ranked 131st 22 is C or U, N ranked 132nd 23 is C or G, N ranked 133rd 24 is C or A, N ranked 135th 25 is C or A, N ranked 136th 26 is C or G, N ranked 141st 27 is C or G, The first or most 5' underlined sequence of multiple N nucleotides represents the mature miRNA sense sequence, and the second or most 3' underlined sequence of multiple N nucleotides represents the mature miRNA antisense sequence. Optionally, the sense sequence is positioned more 3' and the antisense sequence is positioned more 5'.

[0028] In some embodiments, the nucleic acids of the Disclosure include a nucleotide sequence encoding an RNA sequence having at least or about 80% sequence identity with any one of the nucleotide sequences from SEQ ID NOs: 1-16 or 35-53, or a nucleotide sequence encoding an RNA sequence containing any one of the nucleotide sequences from SEQ ID NOs: 1-16 or 35-53.

[0029] In some embodiments, the nucleic acids of the present disclosure further comprise promoters and / or enhancers. In some embodiments, the promoter is any polymerase type II (pol II) promoter. In some embodiments, the promoter and / or enhancer is a U7 promoter and / or enhancer, an RSV promoter and / or enhancer, a human skeletal α-actin (HSA) promoter and / or enhancer, a desmin promoter and / or enhancer, a CMV promoter and / or enhancer, a minimal CMV promoter and / or enhancer, a T7 promoter and / or enhancer, an EF1-alpha promoter and / or enhancer, a minimal EF1-alpha promoter and / or enhancer, an unc45b promoter and / or enhancer, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine promoter, etc. The promoter and / or enhancer is any of the following: kinase (MCK) promoter, tMCK promoter and / or enhancer, dMCK promoter and / or enhancer, CK1 promoter and / or enhancer, CK6 promoter and / or enhancer, CK7 promoter and / or enhancer, CK8 promoter and / or enhancer, CK8e promoter and / or enhancer, synthetic promoter and / or enhancer, ubiquitous promoter and / or enhancer, neuron-specific promoter and / or enhancer, brain-specific promoter and / or enhancer, or any other muscle-specific promoter and / or enhancer. In some embodiments, the promoter and / or enhancer is a CMV promoter and / or enhancer, an HSA promoter and / or enhancer, an MPZ promoter and / or enhancer, or an MCK promoter and / or enhancer. In some embodiments, the synthetic promoter and / or enhancer is the SPc5-12 promoter and / or enhancer, the SP-301 promoter and / or enhancer, the MH promoter and / or enhancer, or the Sk-CRM4 / DES promoter and / or enhancer.In some embodiments, the neuron-specific promoter and / or enhancer is a synapsin promoter and / or enhancer.

[0030] This disclosure also provides vectors, including the nucleic acids of this disclosure. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV lacks the rep and / or cap genes. In some embodiments, the vector is a recombinant AAV (rAAV) vector. In some embodiments, the vector is a self-complementary recombinant AAV (scAAV) vector or a single-stranded recombinant AAV (ssAAV) vector. In some embodiments, the serotypes of AAV are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof. In some embodiments, the serotypes of AAV are AAV9, mAAV9, or AAV-SLB101.

[0031] This disclosure further provides nanoparticles, extracellular vesicles, or exosomes comprising the nucleic acids of this disclosure.

[0032] This disclosure relates to a composition, (a) nucleic acids of the present disclosure, (b) Vectors of the Disclosure, or (c) Nanoparticles, extracellular vesicles, or exosomes of the present disclosure The present invention provides a composition comprising a pharmaceutically acceptable carrier.

[0033] This disclosure relates to a method for reducing, inhibiting, and / or interfering with gene expression in cells, (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) Further methods are provided, including contacting with the compositions of the present disclosure. In some embodiments, the gene is any gene whose expression within a cell is associated with a pathological disease or condition. In some embodiments, the gene is PMP22 or DUX4.

[0034] This disclosure relates to a method for treating or improving a subject who has or is at risk of developing a disease associated with DUX4 expression or PMP22 expression, wherein the subject is given an effective amount (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) Further providing a method comprising administering the compositions of the present disclosure.

[0035] In some embodiments, the disease associated with DUX4 expression is facioscapulohumeral muscular dystrophy (FSHD) or cancer. In some embodiments, the disease associated with PMP22 expression is Charcot-Marie-Tooth disease type 1A (CMT1A).

[0036] This disclosure relates to the preparation of pharmaceuticals for reducing or inhibiting the expression of DUX4 or PMP22 in cells. (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) The compositions of the present disclosure Provides the use of.

[0037] This disclosure relates to the treatment or improvement of facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A). (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) The compositions of the present disclosure Provides the use of.

[0038] This disclosure relates to the preparation of pharmaceuticals for treating or improving FSHD, cancer, or CMT1A. (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) The compositions of the present disclosure Provides the use of.

[0039] This disclosure relates to methods for reducing, inhibiting, and / or interfering with gene expression in cells. (a) nucleic acids of the present disclosure, (b) Vectors of the present disclosure, (c) Nanoparticles, extracellular vesicles, or exosomes of the Disclosure, and / or (d) The compositions of the present disclosure The use of is provided. In some embodiments, the gene is any gene whose expression in cells is associated with a pathological disease or condition. In some embodiments, the gene is PMP22 or DUX4. In some embodiments, the cells are in a subject. In some embodiments, the subject is a human subject.

[0040] This disclosure relates to nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, compositions, or pharmaceuticals that are formulated for oral administration, subcutaneous or infusion, intradermal or infusion, intraventricular delivery or infusion, intracerebral (intracerebroventricular) delivery or infusion, intrathecal delivery or infusion, transdermal delivery or infusion, infusion into the bloodstream, or aerosol administration. (a) nucleic acids of the present disclosure, (b) Any one of the vectors disclosed herein, (c) Nanoparticles, extracellular vesicles, or exosomes of the herein disclosure (d) The compositions of the present disclosure (e) the methods of this disclosure, or (f) Use of this disclosure To provide.

[0041] Further aspects and advantages of the present disclosure will be apparent to those skilled in the art from a review of the following detailed description, which is provided in conjunction with the drawings. However, the detailed description (including the drawings and specific embodiments) illustrates embodiments of the subject matter disclosed, but is given only as an example, so that various changes and modifications within the spirit and scope of the present disclosure will be apparent to those skilled in the art from this detailed description.

[0042] This patent or application file includes at least one drawing prepared in color. A copy of the patent or patent application publication containing this color drawing will be provided by the Patent Office upon request, subject to payment of the necessary fees. [Brief explanation of the drawing]

[0043] [Figure 1] The structure of the pol II miRNA expression cassette (i.e., P2.mi871-4) of this disclosure is shown. The terminating 5' end of the nucleic acid construct contains the ACCGGT AgeI site (encoding ACCGGU). The terminating 3' end contains the EcoRI site (GAATTC shown here (encoding GAAUUC)) in structures 1-4, and the MfeI site (CAATTG (encoding CAAUUG)) in structures 5-8. The 3' end of stem 1 contains the AflII site (CTTAAG (encoding CUUAAG)). [Figure 2] The RNA sequence and predicted structure of U6.mi871 are shown. [Figure 3] The pol II promoter mi871.4 RNA sequence and its predicted structure are shown. [Figure 4]High levels of off-target expression of mi405 and mi871 in the heart, liver, and kidneys were observed via both intravenous (IV) and intrathecal (IT) administration routes under the control of the U6, pol III promoter. [Figure 5] These represent two different muscle-specific or Schwann cell-specific promoters that drive the expression of either mi405 or mi871, respectively. [Figure 6] This paper presents the structures of eight novel miRNA designs that convert existing U6 promoter-driven miRNAs to tissue-specific pol II-based systems. Novel secondary structural elements were incorporated into primary transcript regions adjacent to the Drosha and Dicer processing sites. [Figure 7] The structure and arrangement of the mi405-1 structure (sequence number 9) are shown. [Figure 8] The structure and arrangement of the mi405-2 construct (sequence number 10) are shown. [Figure 9] The structure and arrangement of the mi405-3 construct (SEQ ID NO: 11) are shown. [Figure 10] The structure and arrangement of the mi405-4 construct (sequence number 12) are shown. [Figure 11] The structure and arrangement of the mi405-5 construct (SEQ ID NO: 13) are shown. [Figure 12] The structure and arrangement of the mi405-6 structure (SEQ ID NO: 14) are shown. [Figure 13] The structure and arrangement of the MI405-7 structure (SEQ ID NO: 15) are shown. [Figure 14] The structure and arrangement of the mi405-8 construct (sequence number 16) are shown. [Figure 15] The structure and arrangement of the mi871-1 structure (Sequence ID 1) are shown. [Figure 16] The structure and arrangement of the mi871-2 construct (Sequence ID 2) are shown. [Figure 17] The structure and arrangement of the mi871-3 structure (Sequence ID 3) are shown. [Figure 18] The structure and arrangement of the mi871-4 construct (sequence number 4) are shown. [Figure 19] The structure and arrangement of the mi871-5 construct (sequence number 5) are shown. [Figure 20] The structure and arrangement of the mi871-6 structure (sequence number 6) are shown. [Figure 21] The structure and arrangement of the mi871-7 structure (sequence number 7) are shown. [Figure 22] The structure and arrangement of the mi871-8 structure (sequence number 8) are shown. [Figure 23-1] This disclosure provides a detailed description of eight novel miPMP22-871 expression construct sequences. Each sub-segment of the sequence is identified. [Figure 23-2] Same as above. [Figure 24-1] This disclosure provides a detailed description of eight novel mi405 expression construct sequences. It identifies each sub-segment of the sequence. [Figure 24-2] Same as above. [Figure 25-1] This disclosure provides cluster alignments of 16 novel sequences of the miRNA expression cassette, demonstrating the similarity between the sequence and the consensus sequence (SEQ ID NO: 35). [Figure 25-2] Same as above. [Figure 26] This provides cluster alignment of miRNA expression cassettes containing nucleotide sequences of sequence numbers 1-8 that demonstrate similarity between the sequence and the consensus sequence (sequence number 36). [Figure 27] This provides a cluster alignment of miRNA expression cassettes containing nucleotide sequences SEQ ID NOs. 9-16, which demonstrate the similarity between the sequence and the consensus sequence (SEQ ID NO: 37). [Figure 28] Converting pol III-driven miRNAs to pol II-driven miRNAs alters the secondary structure of primary miRNA transcripts, thereby modifying the maturation process mediated by the RNAse enzymes Drosha and Dicer. [Figure 29]This study demonstrates that pol II-driven miRNAs can be efficiently expressed in vitro and measured by a droplet digital PCR (ddPCR) assay targeting mature miRNA sequences. [Figure 30] This report demonstrates that gene target knockdown was measured using a dual luciferase assay in which either DUX4 or human PMP22 was cloned into the 3'UTR of the Renilla luciferase gene within the Psicheck2 vector. [Figure 31] This study demonstrates that eight constructs designed to knock down human PMP22 were effective in knockdown using the CMV promoter. [Figure 32] This study demonstrates that eight constructs designed to knock down human 405 were effective in knockdown using the CMV promoter. [Figure 33] Two different muscle-specific pol II promoters (CK6 and HSA) and two different Schwann cell-specific pol II promoters (rat MPZ and human MPZ) used to drive the expression of mi405 or mi871 are shown. [Figure 34] The human and rat pol II MPZ promoters were able to drive mi871 expression in rat Schwann cell cultures, respectively, resulting in a reduction of endogenous rat PMP22. Figure 34 also shows that mi871 expression in rat Schwann cells was able to reduce relative luciferase assays when co-transfected with the Psicheck.HuPMP22 construct. Human skeletal actin (HSA) and creatine kinase 6 (CK6) promoters were sufficient to drive mi405 expression in differentiated C2C12 myotubes using the novel expression cassettes disclosed herein, and both pol II promoters were effective in reducing reduced relative luciferase expression from Psicheck.DUX4. [Modes for carrying out the invention]

[0044] This disclosure provides a novel system for accurately and rapidly converting a ubiquitous RNA polymerase III-driven microRNA (miRNA) expression system to an RNA polymerase II-dependent ubiquitous or tissue-specific miRNA expression system. Because the system is modular, any pol II-based promoter can be swapped into the expression cassette without re-inducing the read RNAi trigger, and simultaneously, it provides a novel approach for restricting the expression of therapeutic miRNAs.

[0045] RNA interference (RNAi) is a gene regulation mechanism in eukaryotic cells and is being considered for the treatment of various diseases. RNAi is a gene silencing mechanism mediated by small RNAs. Effective and stable gene knockdown can be achieved by the expression of genetically engineered artificial miRNAs (also called miRNA shuttles) or short hairpin RNAs (shRNAs), both of which are processed into small interfering RNAs (siRNAs). For this reason, miRNA and shRNA expression cassettes are designed to mimic native miRNA genes and deliver therapeutic miRNAs. The main distinction between engineered miRNAs and shRNAs is the amount of processing required in the cell to yield a mature siRNA-like product. Specifically, miRNAs are processed by Drosha, Exportin-5, and Dicer, while shRNAs are processed only by Exportin-5 and Dicer. miRNAs or shRNAs driven by RNA polymerase II or RNA polymerase III promoters can induce efficient, stable, and regulated silencing in cultured cells and animal models. The expression of such shRNAs depends on the presence of miRNA biodevelopmental factors. Therefore, a mechanical understanding of miRNA processing is crucial for the rational design of accurate and efficient engineered miRNAs or shRNAs.

[0046] RNAi refers to the post-transcriptional regulation of gene expression mediated by microRNAs (miRNAs). miRNAs are small (21-25 nucleotides) non-coding RNAs that share sequence homology and base-pair with the 3' untranslated region of congeneral messenger RNAs (mRNAs). The interaction between miRNAs and mRNAs directs cellular gene silencing mechanisms to either reduce the intracellular level of target mRNA or inhibit mRNA translation. The RNAi pathway is summarized in Chapter 7, Section 7.3 of Duan (Ed.), *Muscle Gene Therapy*, Springer Science+Business Media, LLC (2010).

[0047] As our understanding of natural RNAi pathways has advanced, researchers have designed artificial miRNAs for use in regulating the expression of target genes to treat diseases. miRNAs are small, endogenous, single-stranded, non-coding RNA molecules that can regulate gene expression at the post-transcriptional level. In their mature form, miRNAs bind to target mRNA by base-pairing their seed sequence with a region located in the target 3'-UTR (3'-UTR). This binding results in repression of gene expression by inhibiting mRNA translation and / or promoting its degradation. Artificial miRNAs can be transcribed from DNA expression cassettes, as disclosed herein. A miRNA sequence specific to a target gene is transcribed along with sequences necessary to direct the processing of the miRNA in the cell.

[0048] miRNA biogenesis begins with the transcription of a long primary transcript called pri-miRNA, which is processed in the nucleus via the canonical pathway by the Drosha and DiGeorge syndrome critical region gene 8 (DCGR8) enzyme (forming a microprocessor complex) and converted to a shorter transcript called pre-miRNA after stem-loop cropping. In the cytoplasm, the pre-miRNA transcript is further processed by the endonuclease Dicer, which produces a small RNA double-stranded intermediate (approximately 22 nucleotides). The RNA-induced silencing complex (RISC) is formed together with the Argonaute (AGO) protein, which incorporates one strand of the miRNA double helix as a template and binds complementaryly to a region in the 3'-UTR of the target mRNA. This binding is typically mediated by a conserved heptameric sequence called a seed sequence, spanning nucleotides 2-7 at the 5' end of the microRNA sequence.

[0049] The Drosha-DGCR8 complex initiates microRNA maturation by precisely cleaving the stem-loop embedded in the primary transcript (pri-miRNA). Han et al. (Cell 125(5):P887-901,2006; "Han") proposed a model of this process based on evidence from both computational and biochemical analyses. Han explained that a typical metazoan pri-miRNA consists of a stem of approximately 33 bp with a terminal loop and an adjacent segment. Han concluded that the terminal loop is not essential, but the adjacent ssRNA segment is crucial for processing. Han published that the cleavage site is determined primarily by the distance from the stem-ssRNA junction (approximately 11 bp), and that purified DGCR8 interacts directly and specifically with pri-miRNA, with the adjacent ssRNA segment being essential for this binding to occur. Therefore, DGCR8 may function as a molecular anchor for measuring the distance from the dsRNA-ssRNA junction.

[0050] The miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNAs (primary miRNAs) of varying lengths, which are then processed in the nucleus by Drosha into approximately 70-nucleotide stem-loop precursors called pre-miRNAs (precursor miRNAs), followed by processing by the Dicer enzyme to produce a mature product of approximately 22 nucleotides. In this case, the mature sequence is derived from both the 3'(miR-30) arm and the 5'(mir-97-6) arm of the precursor. The product is thought to have a regulatory role through complementarity with mRNA.

[0051] Converting pol III-driven miRNAs to pol II-driven systems (i.e., expression cassettes) alters the secondary structure of the primary miRNA transcript, thereby modifying the maturation process by the RNAse enzymes Drosha and Dicer. For example, various features of this system need to be converted to accommodate the use of pol III promoters. For instance, the U6 pol III promoter is used with the RNA pol III termination signal, while tissue-specific pol II promoters such as CMV are used with the RNA pol III polyA signal (Figure 5). The use of pol II promoters is important in the novel modular expression cassette constructs disclosed herein because it enables tissue-specific expression of therapeutic miRNAs. Therefore, this disclosure provides modular expression cassettes designed to take these factors into account and to facilitate the substitution of various miRNAs into cassettes.

[0052] The miRNA expression cassette is designed to precisely position the RNAse III enzyme Drosha at the junction between stem 2 and stem 1, with stem 1 designed to contain as many single-stranded structures as possible. The Drosha / DGCR8 complex (referred to as the microprocessor) is positioned at the junction of single-stranded and double-stranded RNA structures (Han et al., Cell 125(5):P887-901, 2006).

[0053] We designed eight novel miRNA expression cassettes that convert existing U6 promoter-driven miRNAs to tissue-specific pol II-based systems. Novel secondary structural elements were incorporated into primary transcript regions adjacent to the Drosha and Dicer processing sites. Figure 6 shows a comparative structure of these eight constructs incorporating the DNA sequence encoding the exemplary miRNA of interest, mi405 (DUX4-specific miRNA). The structures of the new mi405 constructs are shown in Figures 7-14, and the structures of the new mi871 constructs are shown in Figures 15-22. The RNA nucleotide sequences encoded by the new miPMP22-871 constructs (SEQ ID NOs: 1-8) are shown in Figure 23, and the RNA nucleotide sequences encoded by the new miDUX4-405 constructs (SEQ ID NOs: 9-16) are shown in Figure 24.

[0054] The disclosed DNA expression cassettes are designed for use in expressing any miRNA of interest and are not limited to expression cassettes containing exemplary miRNAs used herein to test the efficacy of the disclosed expression cassettes. Numerous miRNAs are known in the art, and the disclosed expression cassettes are designed to be used with each of the miRNAs listed in the microRNA database known as miRBase (www.mirbase.org). In some embodiments, these miRNAs include: www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism=hsa(Homo sapiens miRNA), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =mmu(Mus musculus miRNA), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =rno(Rattus norvegicus This includes, but is not limited to, the microRNAs listed on miRNA. Therefore, this disclosure includes using any of these microRNAs in a modular system, i.e., a DNA expression cassette, designed to express miRNAs in a tissue-specific manner while maintaining processing fidelity and efficacy, by converting the therapeutic miRNA expression cassette from the use of a ubiquitous RNA polymerase III-based promoter to an RNA polymerase II-based promoter, as described herein.

[0055] Cluster alignment of the constructs was performed to induce a consensus sequence for the novel constructs (SEQ ID NOs. 35-53) to demonstrate sequence similarity and to allow these constructs to be used with the target miRNA (see Figures 25-27).

[0056] Each miRNA expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising a DNA nucleotide sequence encoding the single-stranded stem of mir30, the 5' double-stranded stem of mir30, the sense strand of a mature microRNA, a modified mir30 loop containing nucleotide changes to facilitate folding, the antisense strand of a mature microRNA, the 3' double-stranded stem of mir30, the single-stranded stem of mir30, and a polyadenylation (poly-A) signal.

[0057] In some embodiments, each miRNA expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising, in 5' to 3' order, a DNA nucleotide sequence encoding the single-stranded stem of mir30, the 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop containing nucleotide changes to facilitate folding, an antisense strand of mature microRNA, the 3' double-stranded stem of mir30, the single-stranded stem of mir30, and a polyadenylation (poly-A) signal.

[0058] By designing this pol II-driven miRNA expression cassette as a module, it is possible to use it with (1) any desired RNA polymerase II-based promoter and (2) any mature sense and antisense strands of the microRNA sequence of interest (not limited to the exemplary miRNA sequences disclosed herein). In various embodiments, the expression cassettes disclosed herein are chemically synthesized.

[0059] In some embodiments, the expression cassette of the present disclosure may also include restriction enzyme sites for cloning. For this reason, in some embodiments, the expression cassette is a nucleic acid comprising, in 5' to 3' order, a DNA nucleotide sequence encoding a first restriction enzyme site, a single-stranded stem of mir30, a 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop including nucleotide changes to facilitate folding, an antisense strand of mature microRNA, a 3' double-stranded stem of mir30, a single-stranded stem of mir30, a second restriction enzyme site, a polyadenylation (poly-A) signal, and a third enzyme restriction site.

[0060] In some embodiments, the pol II-driven miRNA expression cassettes of the present disclosure are designed to be modular, thereby enabling (1) any desired RNA polymerase II-based promoter at the indicated Age I site, and (2) cleavage and pasting of any mature sense and antisense strands of the microRNA sequence of interest (not limited to the exemplary miRNA sequences disclosed herein) between the Age I site and the Afl II site within the expression cassette.

[0061] Therefore, the modular expression cassettes described herein are designed to be used with any microRNA known in the art. The expression cassettes of this disclosure not only (1) enable the cleavage and attachment of any desired RNA polymerase II-based promoter at the indicated Age I site, but also (2) enable the cleavage and attachment of any mature sense and antisense strands of the microRNA sequence of interest. Thus, nucleotide sequences encoding any mature sense and antisense strands of the miRNA of interest may be simply replaced in the expression cassettes of this disclosure. Exemplary microRNAs miDUX4-450 and miPMP22-871 are described and used in the examples provided herein, but the modular expression cassettes of this disclosure are designed and intended to be used with any microRNA of interest and any pol II-based promoter associated with a particular miRNA.

[0062] It is important to note that the expression cassette constructs disclosed herein may be chemically synthesized. Therefore, it is not necessary for restriction enzyme sites to be present in the constructs.

[0063] Therefore, in some embodiments, the pol II-driven expression cassette is not limited to the use of only AgeI and AflII restriction styles. For example, to produce the constructs shown in SEQ ID NO: 8 and SEQ ID NO: 16, the AflI site was removed to facilitate unfolding of stem 1 into the 5' and 3' single-stranded regions. In an exemplary embodiment where this design is preferred, the microRNA can be designed to contain the Nrp I polyA signal and cloned into the AgeI and EcoRI sites. This is a strategy that can be applied to the insertion of miRNAs for various purposes.

[0064] In an exemplary embodiment, the first restriction enzyme site is the AgeI site. In an exemplary embodiment, the AgeI site comprises a nucleotide sequence encoding ACCGGU (SEQ ID NO: 19).

[0065] In an exemplary embodiment, the single-stranded stem of mir30 includes a nucleotide sequence encoding GGUUGCUGUUGA (SEQ ID NO: 20), GGUUUGCUGAGGA (SEQ ID NO: 21), GGUUUGCUCCUUA (SEQ ID NO: 22), GGUAAGCUCCUUA (SEQ ID NO: 23), or GGUCCCCAAGCUCCUUA (SEQ ID NO: 24).

[0066] In an exemplary embodiment, the 5' double-stranded stem of mir30 contains a nucleotide sequence encoding CAGUGAGCGAN (SEQ ID NO: 25), where N is A, U, C, or G (in the miPMP22-871 construct, N is G; in the miDUX4-405 construct, N is U).

[0067] In various embodiments, the sense strand and antisense strand of a mature miRNA are strands of the mature miRNA of any gene of interest. This is therefore the objective of the disclosed modular system design, namely to allow the simple insertion of a sequence encoding any miRNA into a construct for pol II tissue-specific expression of the miRNA.

[0068] Any miRNA includes, but is not limited to, microRNAs found in the miRBase (https: / / www.mirbase.org / ) and other databases known in the art. In some aspects, these miRNAs include: www.mirbase.org / forward / browse / forward / results / forward / ?organism=hsa(Homo sapiens miRNA), www.mirbase.org / forward / browse / forward / results / forward / ?organism=mmu(Mus musculus miRNA), www.mirbase.org / forward / browse / forward / results / forward / ?organism=rno(Rattus norvegicus This includes, but is not limited to, the microRNAs listed on miRNA. Therefore, this disclosure includes using any of these microRNAs in a modular system, i.e., a DNA expression cassette, designed to express miRNAs in a tissue-specific manner while maintaining processing fidelity and efficacy, by converting the therapeutic miRNA expression cassette from the use of a ubiquitous RNA polymerase III-based promoter to an RNA polymerase II-based promoter, as described herein.

[0069] In an exemplary embodiment, the sense strand of a mature miRNA contains a nucleotide sequence encoding miPMP22-871 (i.e., GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17)) or miDUX4-405 (i.e., CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18)).

[0070] In an exemplary embodiment, the modified mir30 loop includes a nucleotide sequence encoding GUAAAGCCACAGAUGGG (SEQ ID NO: 26).

[0071] In various embodiments, the antisense strand of a mature miRNA is a strand of mature miRNA of any gene of interest. As discussed herein, this is the objective of designing the disclosed modular expression system, namely to allow the simple insertion of a sequence encoding any miRNA into a construct for pol II tissue-specific expression of the miRNA. In exemplary embodiments, the antisense strand of a mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., UCUUCAAUCAACAGCAAUCCCC) (SEQ ID NO: 27) or miDUX4-405 (i.e., AAACCAGAUCUGAAUCCUGGAC) (SEQ ID NO: 28).

[0072] In an exemplary embodiment, the 3'ds stem of mir30 contains a nucleotide sequence encoding UGCCUACUG (SEQ ID NO: 29).

[0073] In an exemplary embodiment, the ss stem (mutant) of mir30 contains a nucleotide sequence encoding CCUUUUACUU (SEQ ID NO: 30).

[0074] In an exemplary embodiment, the second restriction enzyme site is the AflII site. In an exemplary embodiment, the AflII site includes a nucleotide sequence encoding CUUAAG (SEQ ID NO: 31).

[0075] In an exemplary embodiment, the polyA signal is a wild-type neuropilin-1 polyadenylation (WT NRP1 polyA) signal. In an exemplary embodiment, the WT NRP1 polyA signal comprises a nucleotide sequence encoding AAUAAAAUACGAAAUGUGACAGA (SEQ ID NO: 32).

[0076] In an exemplary embodiment, the third restriction site is the EcoR1 site. In an exemplary embodiment, the EcoR1 site includes a nucleotide sequence encoding GAAUUC (SEQ ID NO: 33). In an exemplary embodiment, the third restriction site is the MfeI site. In an exemplary embodiment, the MfeI site includes a nucleotide sequence encoding AAUUG (SEQ ID NO: 34).

[0077] This disclosure provides eight exemplary structures designed to replace one pol II promoter with another, and each of these eight structures was tested with two exemplary miRNAs, miPMP22-871 or mi-871(GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17) and miDUX4-405 or mi-405(CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18)).For example, see WO2022 / 119826 and U.S. Patent Nos. 9,469,851 and 10,301,649, as well as Marina Stavrou et al., (2022) A miRNA-based gene silencing approach for the treatment of CMT1A. Journal of Clinical Investigation Jul 1;132(13):e159814, Wallace et al., (2012) RNA interference inhibits DUX4-induced muscle toxicity in vivo: Implications for a targeted FSHD therapy. Molecular Therapy July;20(7):1417-23, Wallace et al., Pre-clinical safety studies to support translation of AAV-mediated RNAi therapy for FSHD. Mol Ther Methods Clin Dev. Dec 24,8:121-130, and Amini-Chermahini et al., (2019) RNAscope in situ hybridization-based See Method for Detecting DUX4 Expression in Vitro.RNA Sep;25(19):1211-1217, and Saad et al., (2021) Human microRNA mir-675 inhibits DUX4 expression and may be exploited as a potential treatment for FSHD. Nature Communications. Dec 8;12(1):7128.

[0078] mi871 is used to induce silencing of overexpressed peripheral myelin protein 22 (PMP22), and the constructs of the present disclosure are designed to do the same. mi405 is used to induce silencing of the DUX4 protein, and the constructs of the present disclosure are designed to do the same.

[0079] Exemplary embodiments of this system are designed to include a small polyadenylation signal derived from the human neuropilin-1 (Nrp1) gene, or a modified human neuropilin-1 polyadenylation signal in which seven indicated nucleotides (5'-GTGACAG-3' (SEQ ID NO: 54), DNA; 5'GUGACAG (SEQ ID NO: 55), RNA) are mutated to C nucleotides to enhance the potential single-stranded nature of stem 1.

[0080] In exemplary embodiments of this system, the stem 1 region of the cassette is designed to contain a nucleotide sequence having 5' and 3' ends in the range of about 15 to about 46 nucleotides in length. However, in various embodiments, the stem 1 region may contain a nucleotide sequence that is less than or greater than these indicated lengths.

[0081] Exemplary embodiments of the 5' end of the stem 1 region include base pairs containing G:U RNA fluctuation base pairs in the range of about 0–50% base pairing. Therefore, in some embodiments, the base pairings are about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%. However, in some embodiments, the stem 1 region also includes base pairings exceeding about 50%.

[0082] Exemplary embodiments of the 3' end of the stem 1 region include base pairs containing G:U RNA fluctuation base pairs in the range of about 0–30% base pairing. Thus, in some embodiments, the base pairings are about 5%, about 10%, about 15%, about 20%, about 25%, or about 30%. However, in some embodiments, the stem 1 region also includes base pairings exceeding about 30%, and in some embodiments, it may exceed about 50% base pairings.

[0083] Exemplary embodiments of the microRNA (miRNA) region of the cassette include a miRNA nucleotide sequence in the range of about 100 to about 200 nucleotides, although the miRNA coding region may include a sequence shorter than or longer than the indicated length. In some embodiments, the miRNA nucleotide sequence is in the range of about 120 to about 180 nucleotides in length. In exemplary embodiments of this disclosure, the miRNA region is in the range of about 136 to 167 nucleotides in length (see Table 1). The cassette is designed to contain either natural or artificial microRNA.

[0084] This disclosure provides nucleic acids comprising nucleotide sequences encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. In some embodiments, the cassette comprises a DNA nucleotide sequence encoding a single-stranded stem of mir30, a 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop including nucleotide changes to facilitate folding, an antisense strand of mature microRNA, a 3' double-stranded stem of mir30, a single-stranded stem of mir30, and a poly(A) signal.

[0085] In some embodiments, the single-stranded stem of mir30 includes one nucleotide sequence from sequence numbers 20-24, or a nucleotide sequence having at least or about 90% identity with one of sequence numbers 20-24.

[0086] In some embodiments, the 5' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence having at least or about 90% identity with SEQ ID NO: 25.

[0087] In some ways, the sense strand of a mature miRNA is the sense strand of any mature miRNA.

[0088] In some embodiments, the sense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 17 or 18.

[0089] In some embodiments, the modified mir30 loop includes the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 26.

[0090] In some aspects, the antisense strand of a mature miRNA is the antisense strand of any mature miRNA.

[0091] In some embodiments, the antisense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 27 or 28.

[0092] In some embodiments, the 3' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 29.

[0093] In some embodiments, the mutated single-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 30.

[0094] In some embodiments, the polyadenylation (polyA) signal is the wild-type neuropilin-1 polyA signal.

[0095] In some embodiments, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 32.

[0096] In some embodiments, the cassette contains each of the above components in the order 5' to 3'. Therefore, in some embodiments, the present disclosure contains each of the above components in the order 5' to 3'. The mir30 single-chain stem, The mir30 5' double-chain stem, The sense strand of a mature microRNA, A modified mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The mir30 has a 3' double-strand stem, The mir30 single-chain stem, Provides a poly-A signal.

[0097] In some embodiments, the disclosure provides nucleic acids comprising nucleotide sequences encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. In some embodiments, the cassette is The first restriction enzyme site, The mir30 single-chain stem, The mir30 5' double-chain stem, The sense strand of a mature microRNA, A modified mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The mir30 has a 3' double-strand stem, The mir30 single-chain stem, The second restriction enzyme site, Poly-A signal and, It includes a third enzyme restriction site and a DNA nucleotide sequence encoding it.

[0098] In some embodiments, the first restriction enzyme site is the AgeI site. In some embodiments, the AgeI site comprises the nucleotide sequence of SEQ ID NO: 19.

[0099] In some embodiments, the single-stranded stem of mir30 includes one nucleotide sequence from sequence numbers 20-24, or a nucleotide sequence having at least or about 90% identity with one of sequence numbers 20-24.

[0100] In some embodiments, the 5' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence having at least or about 90% identity with SEQ ID NO: 25.

[0101] In some ways, the sense strand of a mature miRNA is the sense strand of any mature miRNA.

[0102] In some embodiments, the sense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 17 or 18.

[0103] In some embodiments, the modified mir30 loop includes the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 26.

[0104] In some aspects, the antisense strand of a mature miRNA is the antisense strand of any mature miRNA.

[0105] In some embodiments, the antisense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 27 or 28.

[0106] In some embodiments, the 3' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 29.

[0107] In some embodiments, the mutated single-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 30.

[0108] In some embodiments, the second restriction enzyme site is the AflII site. In some embodiments, the AflII site comprises the nucleotide sequence of SEQ ID NO: 31.

[0109] In some embodiments, the polyadenylation (polyA) signal is the wild-type neuropilin-1 polyA signal.

[0110] In some embodiments, the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO: 32.

[0111] In some embodiments, the third restriction site is the EcoR1 site. In some embodiments, the EcoR1 site comprises the nucleotide sequence of SEQ ID NO: 33.

[0112] In some embodiments, the third restriction site is the MfeI site. In some embodiments, the MfeI site comprises the nucleotide sequence of SEQ ID NO: 34.

[0113] Further provided herein are nucleic acids comprising nucleotide sequences encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system. In some embodiments, the cassette comprises a nucleotide sequence encoding SEQ ID NO: 35 ( [ka] ) or a nucleotide sequence having at least or approximately 80% identity with the nucleotide sequence encoding the sequence of Sequence ID No. 35, wherein the sequence contains N at position 6. 1It is either U, or omitted, and N in the 7th position. 2 It is C, A, or U, and the 8th position is N 3 It is either C, or omitted, and N in the 9th position. 4 It is either C, or omitted, and N in the 10th position. 5 It is either C, or omitted, and is the 11th position N 6 It is either A, or omitted, and N in the 12th position. 7 It is A or U, and the 16th position is N 8 It is C or G, and N is in 17th place. 9 It is C, A, or U, and the 18th position N 10 It is U or G, and N is ranked 19th. 11 It is U or G, and N is ranked 31st. 12 It is U or G, and N is ranked 104th. 13 It is C or U, and the 105th position is N 14 is C or U, and is N at position 109. 15 It is either C, or omitted, and N at position 110. 16 It is either U, or omitted, and N at position 111. 17 It is either U, or omitted, and is the 112th N 18 It is either A, or omitted, and N is in the 113th position. 19 It is either A, or omitted, and is N at position 114. 20 It is either G, or omitted, and N at position 130. 21 It is C or G, and N is at position 131. 22 is C or U, and is N at position 132. 23 It is C or G, and N is at position 133. 24 It is C or A, and is N at rank 135. 25 It is C or A, and is the 136th ranked N 26 It is C or G, and N is at position 141. 27 is either C or G, and each of the underlined sequence of multiple N nucleotides represents the mature sense and antisense sequences, respectively.

[0114] In exemplary embodiments, this disclosure includes a miRNA expression cassette, where the sense strand of the miRNA is 5' relative to the antisense strand of the miRNA in the expression cassette. However, theoretically, since many microRNAs naturally express both strands, the miRNA expression cassette of this disclosure may also include an antisense strand of the miRNA that is 5' relative to the sense strand of the miRNA in the expression cassette.

[0115] However, in the exemplary designs disclosed herein, more A:U base pairs are incorporated into the 5' end of the mature sequence, and more G:C base pairs are incorporated into the 3' end of the antisense sequence, biasing the incorporation of the antisense strand into the RNA-induced silencing complex (RISC). Since AU has only two hydrogen bonds and GC has three, GC base pairs are stronger and can preferentially incorporate the more thermodynamically unstable ends of the mature miRNA into the RISC.

[0116] In various embodiments, the Disclosure provides nucleic acids comprising nucleotide sequences encoding microRNA (miRNA) expression cassettes for converting RNA polymerase III-based promoter systems to RNA polymerase II-based promoter systems, comprising nucleotide sequences having 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or approximately 70% identity with any of the nucleotide sequences represented by any of the nucleotide sequences 1–16 or 35–53 (see Table 1). [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]

[0117] This disclosure includes, essentially consists of, or comprises various nucleic acids comprising various nucleotide sequences described herein. In some embodiments, nucleic acids include nucleotide sequences. In some embodiments, nucleic acids consist essentially of nucleotide sequences. In some embodiments, nucleic acids consist of nucleotide sequences.

[0118] Exemplary nucleotide sequences used for miRNA targeting are described herein and include, but are not limited to, those identified in Table 1 and Figure. As disclosed herein, the miRNA expression cassettes of this disclosure are designed to be used with any miRNA and are not limited to the exemplary miRNAs disclosed herein.

[0119] Such miRNAs include, but are not limited to, those disclosed in microRNA databases known in the art, including those listed in the microRNA database known as miRBase (www.mirbase.org). In some embodiments, these miRNAs include: www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism=hsa(Homo sapiens miRNA), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =mmu(Mus musculus miRNA), www.mirbase.org_forward slash_browse_forward slash_ results_forward slash_?organism =rno(Rattus norvegicus This includes, but is not limited to, the microRNAs listed on miRNA. Therefore, this disclosure includes using any of these microRNAs in a modular system, i.e., a DNA expression cassette, designed to express miRNAs in a tissue-specific manner while maintaining processing fidelity and efficacy, by converting the therapeutic miRNA expression cassette from the use of a ubiquitous RNA polymerase III-based promoter to an RNA polymerase II-based promoter, as described herein.

[0120] In some embodiments, the disclosure includes constructs for RNA interference to reduce or inhibit the expression of a gene associated with adverse effects when it is expressed. In some embodiments, the disclosure provides constructs to be used with any such miRNA to reduce or inhibit the expression of a gene designed to be targeted by the miRNA.

[0121] In some exemplary embodiments, this disclosure provides constructs used to inhibit the expression of PMP22 or DUX4. In some exemplary embodiments, the miRNA targeting PMP22 is mi871.

[0122] mi871 is a microRNA that targets the PMP22 gene and is used to treat CMT1A (see WO2022 / 119826, which is incorporated in its entirety herein by reference). Therefore, this disclosure provides constructs and methods for targeting PMP22 and treating CMT1A. CMT1A is thought to be dependent on the gene dosage effect of PMP22, as PMP22 mRNA levels [Yoshikawa et al., Ann. Neurol., 35(4):445-450 (1994)] and protein levels [Gabriel et al., Neurology, 49(6):1635-1640 (2015)] are elevated in peroneal nerve biopsies in patients with CMT1A. Individuals with a combination of one deleted and one duplicated PMP22 allele have a balanced gene dosage and therefore do not exhibit a CMT1A-like phenotype. Some CMT1A phenotypes can also arise from duplications of different sizes or types on chromosome 17p that affect PMP22 expression [Pantera, above]. CMT1A patients with a 1.4 Mb duplication may have different PMP22 levels on skin biopsy, which does not necessarily correlate with disease severity [Nobbio et al., Brain, 137(Pt 6):1614-1620(2014) and Katona et al., Brain, 132(Pt 7):1734-1740(2014)].Nevertheless, supporting the effect of PMP22 gene administration as the driving mechanism of CMT1A, rodent models overexpressing PMP22 reproduce the CMT1A-like phenotype [Sereda et al., Neuron, 16(5):1049-60 (1996), Huxley et al., Hum.Mol.Genet., 5(5):563-569 (1996), Huxley et al., Hum.Mol.Genet., 7(3):449-458 (1998), Magyar et al., J. Neuroscience, 16(17):5351-5360 (1996), Perea et al., Hum.Mol.Genet., 10(10):p.1007-1018 (2001), Robaglia-Schlupp et al., Brain, 125 (Pt [10):2213-2221(2002), and Robertson et al., J. Anat., 200(4):377-390(2002)], this was improved after blocking PMP22 overexpression [Fledrich et al., Nat. Med., 20(9):1055-1061(2014), Lee, above, Perea, above, Sereda et al., Nat. Med., 9(12):1533-1537(2003), Passage et al., Nat. Med., 10(4):396-401(2004), Meyer et al., Ann. Neurology, 61(1):61-72(2007), Chumakov et al., Orphanet Journal of Rare Diseases, 9(1):201(2014), Lee et al., Neurobiology of Disease, 100:99-107(2017), Zhao et al., J.Clin.Invest.,128(1):359-368(2018), Prukop et al., PLoS One,14(1):e0209752(2019), and Lee et al., Nuc. Acids Res.,48(1):130-140(2020)].

[0123] Overexpression of PMP22 has been shown to saturate the proteasome's ability to degrade, leading to PMP22 accumulation in the perinuclear or cytoplasm, decreased overall proteasome activity, and ER stress. PMP22 is also involved in the early stages of myelin formation, determining myelin thickness and maintenance. PMP22 duplication destabilizes the structure, protein stoichiometry, and function of the myelin sheath and SCs, leading to demyelination, remyelin formation, characteristic onion valve formation, and SC apoptosis. As a result, impaired and dysfunctional neurofilament structures of SC axonal interactions result in higher packing density and less phosphorylation of neurofilaments, accompanied by slower axonal transport and myelin formation rates.

[0124] Current treatment for CMT1A remains focused on general symptom management in the form of physical therapy or corrective surgery.

[0125] A method for the prevention or treatment of CMT1A is provided, comprising administering a delivery vehicle (such as rAAV) containing DNA encoding miPMP22 as described herein. The method provided restores PMP22 expression to at least or about 25 percent, at least or about 30 percent, at least or about 40 percent, at least or about 50 percent, at least or about 60 percent, at least or about 70 percent, at least or about 80 percent, at least or about 90 percent, at least or about 95 percent, at least or about 98 percent, at least or about 99 percent, or 100 percent or more of normal PMP22 expression in an unaffected subject.

[0126] In some embodiments, the miRNA that targets DUX4 is mi405. Therefore, this disclosure provides constructs and methods for inhibiting DUX4 expression and thus treating facioscapulohumeral muscular dystrophy (FSHD). The role of DUX4 in the pathogenesis of FSHD can be explained as follows: Firstly, the D4Z4 repeat is not a pseudogene. The DUX4 locus produces 1.7kb and 2.0kb full-length mRNAs with identical coding regions, and the D4Z4 repeat also harbors smaller sense and antisense transcripts, some of which are microRNA-like. Overexpressed DUX4 transcripts and full-length DUX4 protein of approximately 50kDa are found in biopsies and cell lines derived from FSHD patients. These data are consistent with a transcriptional derepression model of FSHD pathogenesis. In addition, unlike pseudogenes, D4Z4 repeats and DUX4 are likely to have functional importance because the D4Z4 repeat in the tandem array is conserved in at least 11 different placental mammalian species (non-placental animals lack the D4Z4 repeat), and the greatest sequence conservation occurs within the DUX4 ORF. Secondly, overexpressed DUX4 is toxic to tissue culture cells and embryonic precursors of developing lower organisms in vivo. This toxicity arises at least partially via a pro-apoptotic mechanism, as indicated by the activation of caspase-3 in DUX4-transfected cells and the presence of TUNEL-positive nuclei in developmentally arrested Xenopus embryos injected with DUX4 mRNA at the two-cell stage. These findings are consistent with studies showing that several pro-apoptotic proteins, including caspase-3, are present in the muscles of FSHD patients. In addition to stimulating apoptosis, DUX4 may negatively modulate myogenesis. Human DUX4 inhibits the differentiation of mouse C2C12 myoblasts in vitro, possibly by interfering with PAX3 and / or PAX7, and when delivered to zebrafish or Xenopus embryonic progenitor cells, causes developmental arrest and reduced staining of several muscle markers. Finally, abnormal DUX4 function is directly linked to potentially significant molecular changes observed in the muscles of FSHD patients.Specifically, full-length human DUX4 encodes a bihomeodomain transcription factor of approximately 50 kDa, and its only known target, Pitx1, was elevated in the muscles of FSHD patients overexpressing DUX4. These data support the idea that DUX4 catalyzes numerous downstream molecular changes that are incompatible with maintaining normal muscle integrity. See also U.S. Patents 9,469,851 and 10,301,649, which are incorporated herein by reference in their entirety.

[0127] RNA interference (RNAi) is a gene regulation mechanism in eukaryotic cells and is being considered for the treatment of various diseases. RNAi refers to the post-transcriptional regulation of gene expression mediated by miRNAs. miRNAs are small (approximately 21-25 nucleotides) non-coding RNAs that share sequence homology with and base-pair with the sequence target site of a congeneral messenger RNA (mRNA). In exemplary embodiments, miRNAs are approximately 22 nucleotides. The interaction between miRNA and mRNA directs cellular gene silencing mechanisms that induce mRNA breakdown and / or prevent mRNA translation into proteins.

[0128] As our understanding of natural RNAi pathways has advanced, researchers have designed artificial shRNAs and snRNAs for use in regulating the expression of target genes to treat diseases. Several classes of small RNAs are known to induce RNAi processes in mammalian cells, including short (or small) interfering RNAs (siRNAs), as well as short (or small) hairpin RNAs (shRNAs) and microRNAs (miRNAs), which constitute similar classes of vector expression triggers [Davidson et al., Nat. Rev. Genet. 12:329-40, 2011; Harper, Arch. Neurol. 66:933-8, 2009]. Since shRNAs and miRNAs are expressed in vitro from plasmids or virus-based vectors, long-term gene silencing can be achieved with a single dose, provided the vector is present in the target cell nucleus and the driving promoter is active [Davidson et al., Methods Enzymol. 392:145-73, 2005]. Importantly, this vector expression approach leverages advances already made over decades in the field of gene therapy, but instead of expressing protein-coding genes, the vector cargo in RNAi therapeutic strategies is an artificial shRNA or miRNA cassette that targets the disease gene of interest.

[0129] This disclosure provides a novel construct for microRNA (miRNA) delivery using a pol II tissue-specific promoter. MicroRNAs (miRNAs) are a class of non-coding RNAs that play a crucial role in regulating RNA silencing and gene expression. The vast majority of miRNAs are transcribed from DNA sequences into primary miRNAs, processed into precursor miRNAs, and ultimately become mature miRNAs. In most cases, miRNAs interact with the 3′ untranslated region (3′UTR) of target mRNA to induce mRNA degradation and translational repression. However, interactions of miRNAs with other regions, including the 5′UTR, coding sequences, and gene promoters, have also been reported. Under certain conditions, miRNAs can also activate translation or regulate transcription. The interaction between miRNAs and their target genes is dynamic and depends on many factors, including the intracellular location of the miRNA, the abundance of miRNA and target mRNA, and the affinity of the miRNA-mRNA interaction.

[0130] Most studies to date have shown that miRNAs bind to specific sequences in the 3′UTR of their target mRNAs, inducing translational repression and deadenylation and decapping of the mRNA. miRNA binding sites have also been detected in the 5′UTR and other mRNA regions, including coding sequences, as well as within promoter regions. While miRNA binding to the 5′UTR and coding regions has a silencing effect on gene expression, miRNA interactions with promoter regions have been reported to induce transcription.

[0131] As disclosed herein, the miRNA constructs of this disclosure are designed to be modular constructs in which any miRNA is substituted into the construct for expression under an RNA pol II promoter. Therefore, the miRNA constructs of this disclosure are expressed under a variety of promoters and / or enhancers, including but not limited to any RNA polymerase type II (pol II) promoter and / or enhancer. For this reason, in some embodiments, the promoters and / or enhancers include the U7 promoter and / or enhancer, RSV promoter and / or enhancer, human skeletal α-actin (HSA) promoter and / or enhancer, desmin promoter and / or enhancer, CMV promoter and / or enhancer, minimal CMV promoter and / or enhancer, T7 promoter and / or enhancer, EF1-alpha promoter and / or enhancer, minimal EF1-alpha promoter and / or enhancer, unc45b promoter and / or enhancer, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase ( These include MCK promoters, tMCK promoters and / or enhancers, dMCK promoters and / or enhancers, CK1 promoters and / or enhancers, CK6 promoters and / or enhancers, CK7 promoters and / or enhancers, CK8 promoters and / or enhancers, CK8e promoters and / or enhancers, myelin protein zero (MPZ) promoters and / or enhancers, synthetic promoters and / or enhancers, ubiquitous promoters and / or enhancers, neuron-specific promoters and / or enhancers, brain-specific promoters and / or enhancers, or any other muscle-specific promoters.

[0132] In some embodiments, the promoter and / or enhancer is one of the promoters and / or enhancers disclosed by Skopenova et al. (Acta Naturae. 2021;13(1):47-58) (the whole of which is incorporated herein by reference).

[0133] In some embodiments, the synthetic promoter is the SPc5-12 promoter, the SP-301 promoter, the MH promoter, or the Sk-CRM4 / DES promoter.

[0134] In some embodiments, neuron-specific or brain-specific promoters are human synapsin 1 (hSyn1), neuron-specific enolase (Nse), MeCP2, mDLX, mDLX5 / 6, calmodulin-dependent kinase II (CaMKII or Camk2a), or MPZ promoters. In some embodiments, the promoter and / or enhancer is any of the promoters and enhancers disclosed by Haery et al. (the entirety of which is incorporated herein by reference, Front Neuroanat. 2019;13:93;PMID:31849618, "Haery"), including, but not limited to, the promoters and enhancers disclosed in Tables 3 and 4 of Haery.

[0135] In some embodiments, the Disclosure includes a vector containing any of the nucleic acids described herein for delivering a nucleic acid encoding miRNA. Therefore, embodiments of the Disclosure utilize a vector (e.g., a viral vector such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, herpes simplex virus, poliovirus, Sindbisvirus, vaccinia virus, or synthetic virus (e.g., chimeric virus, mosaic virus, or pseudotyped virus), and / or a virus containing foreign proteins, synthetic polymers, nanoparticles, or small molecules) for delivering the nucleic acids disclosed herein.

[0136] In some embodiments, the disclosure utilizes adeno-associated virus (AAV) to deliver miRNA-encoding nucleic acids. AAV is a replication-defective parvovirus whose single-stranded DNA genome is approximately 4.7 kb long and contains 145 nucleotide inverted end repeats (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV1 is provided to GenBank acceptance number NC_002077, the complete genome of AAV2 is provided to GenBank acceptance number NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV3 is provided to GenBank acceptance number NC_1829, the complete genome of AAV4 is provided to GenBank acceptance number NC_001829, the genome of AAV5 is provided to GenBank acceptance number AF085716, and the complete genome of AAV6 is provided to GenBank acceptance number NC_00 The AAV7 genome was provided in 1862, and at least portions of the AAV7 and AAV8 genomes were provided to GenBank acceptance numbers AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 for AAV8). The AAV9 genome was provided to Gao et al., J. Virol., 78:6381-6388 (2004). The AAV10 genome was provided to Mol. Ther., 13(1):67-76 (2006). The AAV11 genome was provided to Virology, 330(2):375-383 (2004). The AAV12 genome was provided to J. Virol. 2008. The AAV13 genome is provided in Feb;82(3):1399-406 and in J.Virol.2008;82:8911. Cis-acting sequences that induce viral DNA replication (rep), capsid formation / packaging, and integration into host cell chromosomes are contained within the AAV ITR. Three AAV promoters (named p5, p19, and p40 after their relative map locations) drive the expression of two AAV-internal open reading frames encoding the rep and cap genes.Two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to the replication of the viral genome. The Cap gene, expressed from the p40 promoter, encodes three capsid proteins (VP1, VP2, and VP3). Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single-consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are discussed in Muzyczka (Current Topics in Microbiology and Immunology, 158:97-129 (1992)).

[0137] AAV possesses unique characteristics that make it attractive, for example, as a vector for delivering foreign DNA to cells in gene therapy. AAV infection of cells in culture is non-cytotoxic, and natural infection in humans and other animals is asymptomatic. AAV infects many mammalian cells, offering the potential to target many different tissues in vivo. AAV transducers slow-dividing and non-dividing cells and can essentially persist throughout the lifespan of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in a plasmid, enabling the construction of recombinant genomes. Furthermore, because signals inducing AAV replication, genomic capsid formation, and integration are contained within the ITR of the AAV genome, some or all of the approximately 4.3kb of genome inside (rep-cap, encoding replication and structural capsid proteins) can be replaced with foreign DNA. In some embodiments, the rep and cap proteins are supplied trans. Another important characteristic of AAV is that it is an extremely stable and robust virus. This reduces the importance of chilling AAV because it readily withstands the conditions used to inactivate adenoviruses (56°C to 65°C for several hours). AAV can also be freeze-dried, and AAV-infected cells are not resistant to co-infection.

[0138] AAV possesses unique characteristics that make it attractive, for example, as a vector for delivering foreign DNA to cells in gene therapy. AAV infection of cells in culture is non-cytotoxic, and natural infection in humans and other animals is asymptomatic. AAV infects many mammalian cells, offering the potential to target many different tissues in vivo. AAV transducers slow-dividing and non-dividing cells and can essentially persist throughout the lifespan of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in a plasmid, enabling the construction of recombinant genomes. Furthermore, because signals inducing AAV replication, genomic capsid formation, and integration are contained within the ITR of the AAV genome, some or all of the approximately 4.3kb of genome inside (rep-cap, encoding replication and structural capsid proteins) can be replaced with foreign DNA. In some embodiments, the rep and cap proteins are supplied trans. Another important characteristic of AAV is that it is an extremely stable and robust virus. This reduces the importance of chilling AAV because it readily withstands the conditions used to inactivate adenoviruses (56°C to 65°C for several hours). AAV can also be freeze-dried, and AAV-infected cells are not resistant to co-infection.

[0139] In some embodiments, the viral vector is an adeno-associated virus (AAV), for example, AAV1 (i.e., an AAV containing an AAV1 inverted terminal repeat (ITR) and / or an AAV1 capsid protein), AAV2 (i.e., an AAV containing an AAV2 ITR and / or an AAV2 capsid protein), AAV3 (i.e., an AAV containing an AAV3 ITR and / or an AAV3 capsid protein), AAV4 (i.e., an AAV containing an AAV4 ITR and / or an AAV4 capsid protein), AAV5 (i.e., an AAV5 ITR and / or an AAV5 capsid protein), AAV6 (i.e., an AAV6 ITR and / or an AAV6 capsid protein), AAV7 (i.e., an AAV7 ITR and / or an AAV7 capsid protein), AAV8 (i.e., an AAV8 AAVs containing ITR and / or AAV8 capsid protein), AAV9 (i.e., AAV9 ITR and / or AAV9 capsid protein), AAV.rh74 (i.e., AAV.rh74 ITR and / or AAV.rh74 capsid protein), AAV.rh8 (i.e., AAV.rh8 ITR and / or AAV.rh8 capsid protein), AAV.rh10 (i.e., AAV.rh10 ITR and / or AAV.AAV containing rh10 capsid protein), AAV11 (i.e., AAV11 ITR and / or AAV11 capsid protein), AAV12 (i.e., AAV12 ITR and / or AAV12 capsid protein), AAV13 (i.e., AAV13 ITR and / or AAV13 capsid protein), AAV14 (i.e., AAV14 ITR and / or AAV14 capsid protein), AAV15 (i.e., AAV15 ITR and / or AAV15 capsid protein), AAV16 (i.e., AAV16 ITR and / or AAV16 capsid protein), AAV-anc80 (i.e., AAV-anc80 ITR and / or AAV-anc80 capsid protein), AAV-B1 (i.e., AAV-B1 These include AAVs containing ITR and / or AAV-B1 capsid protein, AAV.PHP.EB (i.e., AAV-PHP.EB ITR and / or AAV-PHP.EB capsid protein), AAVv66 (i.e., AAVv66 ITR and / or AAVv66 capsid protein), MYOAAV, or AAVMYO (i.e., AAV-AAVMYO ITR and / or AAVMYO capsid protein), and optionally MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or the same as AAV-SLB101, or any derivative thereof. In some embodiments, the AAVs are laboratory-engineered AAVs that are not typically isolated in nature.

[0140] Therefore, in some embodiments, AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof.

[0141] Other types of rAAV variants, such as rAAVs with capsid mutations, are also included in this disclosure. See, for example, Marsic et al., Molecular Therapy 22(11):1900-1909 (2014). As stated above, the nucleotide sequences of various AAV serotype genomes are known in the art. The use of congeneral components is specifically intended. The production of pseudotype rAAV is disclosed, for example, in WO01 / 83692 (which is incorporated herein by reference in its entirety).

[0142] The recombinant AAV genomes of this disclosure comprise one or more AAV ITRs adjacent to the novel nucleic acid constructs of this disclosure. Such AAV genomes of this disclosure comprise one of the various AAV serotypes known in the art. In some embodiments, the AAV vector is a single-stranded AAV vector. In some embodiments, the AAV is recombinant AAV (rAAV). In some embodiments, the rAAV lacks rep and cap genes. In some embodiments, the rAAV is self-complementary (sc)AAV.

[0143] The DNA plasmids of this disclosure include the rAAV genome of this disclosure. The DNA plasmids are introduced into cells to which infection with an AAV helper virus (e.g., adenovirus, E1 deletion adenovirus, or herpesvirus) is tolerated in order to assemble the rAAV genome into infectious viral particles. Techniques for producing rAAV particles that provide the AAV genome, rep gene and cap gene, and helper virus function to be packaged are standard in the art. The production of rAAV requires that the following components, the rAAV genome, the AAV rep gene and cap gene isolated from (i.e., not present in) the rAAV genome, and helper virus function, be present in a single cell (referred to herein as a packaging cell). The AAV rep gene may be from any AAV serotype from which the recombinant virus can originate, and may be from an AAV serotype different from the rAAV genome ITR, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof.In some embodiments, the AAV DNA in the rAAV genome may be from any AAV serotype from which the recombinant virus may originate, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV.PHP.EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof. Other types of rAAV variants, such as rAAVs with capsid mutations, are also included in this disclosure. See, for example, Marsic et al., Molecular Therapy 22(11):1900-1909 (2014). As stated above, the nucleotide sequences of various AAV serotype genomes are known in the art. The use of congeneral components is specifically intended. The production of pseudotype rAAV is disclosed, for example, in WO01 / 83692 (which is incorporated herein by reference in its entirety).

[0144] In some embodiments, packaging cells are provided. The packaging cells are created to have a cell line that stably expresses all the components necessary for AAV particle production. The retroviral vector is created by removing the retroviral gag, pol, and env genes. These are replaced by therapeutic genes. Packaging cells are essential for vector particle production. The packaging cell line provides all the viral proteins necessary for capsid production and vector virion maturation. Therefore, the packaging cell lines are constructed to contain the gag, pol, and env genes. Once the desired genes are inserted into the retroviral DNA vector and a suitable packaging cell line is maintained, the preparation of the retroviral vector is straightforward.

[0145] For example, a plasmid (or multiple plasmids) containing an rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes isolated from the rAAV genome, and a selection marker (e.g., a neomycin resistance gene) is incorporated into the cell genome. The AAV genome is introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081], addition of a synthetic linker containing restriction endonuclease cleavage sites [Laughlin et al., 1983, Gene, 23:65-73], or direct blunt-end ligation [Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantage of this method is that cells are selectable and it is suitable for large-scale production of rAAV. Another example of a preferred method is to use an adenovirus or baculovirus, rather than a plasmid, to introduce the rAAV genome and / or rep and cap genes into packaging cells.

[0146] Therefore, in some embodiments, methods are provided for generating packaging cells to create cell lines that stably express all the components necessary for the production of AAV particles. For example, a plasmid (or a group of plasmids) containing an rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes isolated from the rAAV genome, and a selection marker (e.g., a neomycin resistance gene) is incorporated into the cell genome. The AAV genome has been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081], addition of a synthetic linker containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy et al., 1984, J. Biol. Chem., 259:4661-4666). Next, the packaging cell line is infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and it is suitable for large-scale production of rAAV. Another example of a preferred method is to use adenovirus or baculovirus instead of plasmids to introduce the rAAV genome and / or rep and cap genes into the packaging cells.

[0147] The general principles of rAAV production are discussed, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbiol. and Immunol. 158:97-129). Various approaches are described below: Ratschin et al., Mol.Cell.Biol.4:2072(1984), Hermonat et al., Proc.Natl.Acad.Sci.USA,81:6466(1984), Tratschin et al., Mo1.Cell.Biol.5:3251(1985), McLaughlin et al., J.Virol.,62:1963(1988), and Lebkowski et al., 1988 Mol.Cell.Biol.,7:349(1988). Samulski et al. al., J. Virol., 63:3822-3828 (1989), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al., Vaccine, 13:1244-1250 (1995), Paul et al. al., Human Gene Therapy, 4:609-615 (1993), Clark et al., Gene Therapy, 3:1124-1132 (1996), U.S. Patent Nos. 5,786,211, 5,871,982, and 6,258,595, and McCarty, Mol. Ther., 16(10):1648-1656 (2008). The aforementioned documents are incorporated herein by reference in their entirety, with particular emphasis on the sections relating to rAAV production. Various types of rAAV production and use are specifically contemplated and illustrated.Therefore, recombinant AAV (i.e., infectious capsidized rAAV particles) are provided herein. In some embodiments, the rAAV genome lacks the genes for AAV rep and cap, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome. In some embodiments, the AAV is recombinant linear AAV (rAAV), single-stranded AAV (ssAAV), or recombinant self-complementary AAV (scAAV).

[0148] Therefore, this disclosure provides packaging cells that produce infectious rAAV in several embodiments. In one embodiment, the packaging cells are stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (congener 293 strain). In another embodiment, the packaging cells are non-transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus macaque fetal lung cells).

[0149] In some embodiments, rAAV is purified by methods standard in the art (e.g., by column chromatography or a cesium chloride gradient). Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.

[0150] In some embodiments, the Disclosure includes compositions comprising any of the nucleic acids or vectors described herein in combination with a diluent, excipient, or buffer. In some embodiments, the Disclosure provides compositions comprising vectors, such as viral vectors, as described herein. For this purpose, compositions comprising delivery vehicles (such as rAAV) as described herein are provided. In various embodiments, such compositions also include pharmaceutically acceptable carriers. Generally as used herein, “pharmaceutically acceptable carrier” means all aqueous and non-aqueous solutions, sterile solutions, solvents, buffers, such as phosphate-buffered saline (PBS) solutions, water, suspensions, emulsions such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media, and coatings that are appropriate for pharmaceutical administration, particularly parenteral administration. The use of such media and drugs in pharmaceutical compositions is well known in the art, and compositions comprising such carriers can be formulated by well known conventional methods.

[0151] In various embodiments, any composition of the present disclosure also comprises other components such as diluents, excipients, and / or adjuvants. Acceptable carriers, diluents, excipients, and adjuvants are nontoxic to the recipient and preferably inactive at the doses and concentrations used, and include buffers such as phosphoric acid, citrate, or other organic acids; antioxidants such as ascorbic acid; proteins such as low molecular weight polypeptides, serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparaginine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween®, Pluronic®, or polyethyl glycol (PEG).

[0152] In some other embodiments, nucleic acids are introduced into cells via vector-free delivery. For this purpose, in some embodiments, the Disclosure includes vector-free delivery of any of the miRNA expression cassette constructs disclosed herein. In some embodiments, in this context, a synthetic carrier capable of complexing with nucleic acids and protecting them from extracellular and intracellular nucleases is an alternative to a viral vector. In some embodiments, such vector-free delivery includes the use of nanoparticles, extracellular vesicles, or exosomes containing the nucleic acids of the Disclosure. The Disclosure also includes compositions comprising any of the constructs described herein, either alone or in combination.

[0153] Sterile injectable solutions are prepared by combining the required amount of rAAV in a suitable solvent, along with various other components listed above as needed, and then sterilizing by filtration. Generally, dispersants are prepared by combining the sterilized active ingredient in a sterile vehicle containing a basic dispersion medium and other required components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired components from those solutions that have been previously sterilized and filtered.

[0154] The titer of rAAV administered by the method of this disclosure will vary depending, for example, on the specific rAAV, the method of administration, the therapeutic target, the individual, and the cell type being targeted, and may be determined by standard methods in the art. The titer of rAAV is approximately 1 × 10⁶ per ml. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~Approx. 1×10 14 , or a range of DNase-resistant particles (DRPs) above. The dosage may also be expressed in units of viral genome (vg) (e.g., 1 × 10⁻¹⁶ each). 7vg, 1×10 8 vg, 1×10 9 vg, 1×10 10 vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg, and 1 × 10 14 (vg).

[0155] Accordingly, in some embodiments, the Disclosure provides a method for delivering one or more of the miRNA expression cassette constructs disclosed herein to a cell or subject. In some embodiments, the Method includes delivering the nucleic acid constructs with one or more AAV vectors. In some embodiments, the Method includes delivering the nucleic acids to cells by vector-free delivery.

[0156] In some embodiments, the method involves administering an AAV containing one or more miRNA expression cassette constructs disclosed herein to cells or subjects.

[0157] In some embodiments, the Disclosure provides AAV-transduced cells for the delivery of nucleic acids encoding miRNAs described herein. Methods for transducing target cells with rAAV in vivo or in vitro are included in the Disclosure. The methods include the step of administering a composition comprising an effective dose or multiple effective doses of rAAV of the Disclosure to a subject, including an animal (such as a human) that requires it. If the dose is administered before the onset of symptoms of a disease, or other symptoms of a disease or disorder associated with a gene mutation or pathogenic expression, the administration is prophylactic. If the dose is administered after the onset of symptoms of a disease or disorder, the administration is therapeutic or ameliorative. In embodiments of this disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom of a disease or disorder associated with a variant or pathogenic expression of a gene targeted by miRNA, delays or prevents the progression of symptoms of a disease or disorder associated with a variant or pathogenic expression of a gene, and / or results in remission (partial or complete) of symptoms of a disease or disorder associated with a variant or pathogenic expression of a gene.

[0158] In some embodiments, this disclosure provides vector-free delivery of nucleic acids encoding miRNAs described herein. In some embodiments, nucleic acids or compositions comprising nucleic acids are delivered by nanoparticles, extracellular vesicles, or exosomes.

[0159] Combination therapies are also contemplated in this disclosure. To this end, this disclosure includes possible combination therapies (one or more) comprising one or more other compounds or compositions, including other RNA inhibitory compounds or small molecule compounds for downregulating gene expression. Combinations used herein may include concurrent or sequential therapies. The methods described herein are specifically intended to be combined with standard medical treatments and supportive therapies, as well as therapies such as physical and occupational therapy, speech therapy, developmental specialist therapy for neurodevelopmental delays and autistic symptoms, medications to address behavioral problems (including but not limited to alpha-2 adrenergic agonists, antipsychotics, selective serotonin reuptake inhibitors (SSRIs), etc.), medications to address sleep problems (including but not limited to melatonin, trazodone, benzodiazepines, doxepin, eszopiclone, lemborexant, ramelteon, suvorexant, zaleplon, zolpidem, etc.), and medications to address seizures and / or EEG abnormalities (carbamazepine, eslicarbazepine). Combinations with other inhibitory RNA constructs are also being considered, including but not limited to any of the many antiseizure drugs known in the art, such as ethosuximide, everolimus, gabapentin, lacosamide, oxcarbazepine, lamotrigine, phenobarbital, phenytoin, pregabalin, thiagabin, vigabatrin, valproic acid, acetazolamide, buribaracetam, cannabidiol, cenovamate, clobazam, clonazepam, clorazepate, diazepam, divalproex, felbamate, fenfluramine, lamotrigine, levetiracetam, lorazepam, metosuximide, perampanel, primidone, rufinamide, stiripentol, topiramate, valproic acid, or zonisamide.

[0160] Administration of an effective dose of the compositions of the Disclosure, comprising AAVs containing nucleic acids, nanoparticles, extracellular vesicles, and exosomes, may be by routes standard in the art, including but not limited to intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, transpulmonary, intracranial, intraventricular, intrathecal, intraosseous, intrafocal, intraocular, transrectal, or vaginal. The route of administration and serotype of the AAV components of the rAAV of the Disclosure (in particular, AAV ITR and capsid protein) may be selected and / or adapted by those skilled in the art, taking into account the disease condition being treated and the target cells / tissues, e.g., cells expressing downregulated genes, such as DUX4 or PMP22 in some embodiments of the Disclosure. In some embodiments, the compositions or pharmaceuticals are formulated for intraventricular infusion, intrathecal infusion, intramuscular infusion, oral administration, subcutaneous, intradermal or transcutaneous transport, injection into the bloodstream, or aerosol administration. In some embodiments, the route of administration is intraventricular. In some embodiments, the route of administration is intravenous.

[0161] In some embodiments, the actual administration of rAAV according to this disclosure may be achieved by using any physical method for transporting the rAAV recombinant vector to a target tissue in an animal. Administration according to this disclosure includes, but is not limited to, direct injection into the brain, bloodstream, central nervous system, and / or other organs. It has been demonstrated that simply resuspending rAAV in phosphate-buffered saline is sufficient to provide a vehicle useful for expression in the brain, and there are no known limitations on carriers or other components that can be co-administered with rAAV (however, compositions that degrade DNA should be avoided in conventional methods using rAAV). The capsid protein of rAAV may be modified so that rAAV is targeted to a specific target tissue of interest, such as the brain. See, for example, WO02 / 053703 (its disclosure is incorporated herein by reference). Pharmaceutical compositions can be prepared for oral administration, as injectable formulations, or as topical formulations delivered to muscle by subcutaneous, intradermal, and / or transdermal transport. Numerous formulations for both intramuscular injection and transdermal delivery have already been developed and can be put into practice in this disclosure. rAAV can be used with any pharmaceutically acceptable carrier to facilitate administration and handling.

[0162] For injection purposes, in some embodiments, solutions such as sterile aqueous solutions are used. Such aqueous solutions can be buffered as needed, and the liquid diluent can be isotonic first with physiological saline or glucose. Solutions of rAAV as free acid (DNA containing acidic phosphate groups) or pharmacokinetically acceptable salts can be prepared in water suitably mixed with a surfactant such as hydroxypropyl cellulose. Dispersions of rAAV can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oil. Under normal storage and use conditions, these preparations contain preservatives that prevent microbial growth. In this regard, all sterile aqueous media used can be readily obtained by standard techniques well known to those skilled in the art.

[0163] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid enough to be readily usable in a syringe. It must be stable under manufacturing and storage conditions and protected against microbial contamination such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. In some embodiments, adequate fluidity is maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be provided by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it would be preferable to include an isotonic agent, such as sugar or sodium chloride. The prolonged absorption of injectable compositions can be achieved by using absorption-delaying agents, such as aluminum monostearate and gelatin.

[0164] In some embodiments, the formulation includes a stabilizer. The term “stabilizer” refers to a substance or excipient that protects the formulation from adverse conditions, such as those occurring during heating or freezing, and / or extends the stability or shelf life of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars such as sucrose, lactose, and mannose; sugar alcohols such as mannitol; amino acids such as glycine or glutamic acid; and proteins such as human serum albumin or gelatin.

[0165] In some embodiments, the formulation includes an antimicrobial preservative. The term “antimicrobial preservative” refers to any substance added to the composition that inhibits the growth of microorganisms that may be introduced during repeated punctures of the vial or container used. Examples of antimicrobial preservatives include, but are not limited to, thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0166] The term "transduction" is used to refer to the administration / delivery of one or more nucleic acid constructs encoding miRNAs described herein to recipient cells, either in vivo or in vitro, via the replication-deficient rAAV of this disclosure, resulting in a reduction in the expression of target genes by the recipient cells.

[0167] In one embodiment, transduction with rAAV is performed in vitro. In one embodiment, desired target cells are isolated from a subject, transduced with rAAV, and reintroduced into the subject. Alternatively, syngeneic or heterogeneous cells can be used if those cells do not produce an inappropriate immune response in the subject.

[0168] Suitable methods for transduction into a target and reintroduction of transduced cells are known in the art. In one embodiment, cells are transduced in vitro by combining rAAV with the cells in a suitable culture medium, for example, and screening for cells possessing the DNA of interest using conventional techniques such as Southern blotting and / or PCR, or by using a selectable marker. The transduced cells are then formulated into a pharmaceutical composition, which can be introduced into a target by various techniques, for example, by intraventricular, intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or by injection into the brain or smooth muscle and cardiac muscle using a catheter, for example.

[0169] This disclosure provides a method for administering an effective dose (or a dose administered essentially simultaneously or at regular intervals) of rAAV, comprising DNA encoding a microRNA designed to reduce or inhibit the expression of a gene targeted by miRNA inhibition. In some embodiments, the microRNA is designed to reduce or inhibit the expression of any gene whose expression within a cell or within a target (including, but not limited to, a human target) is associated with a pathological disease or condition. In some embodiments, the microRNA is mi405 for targeting DUX4.

[0170] In some embodiments, the microRNA mi871 is used to target PMP22 to cells or to targets that require it. In some embodiments, the effective dose is therefore the therapeutically effective dose.

[0171] In some embodiments, the dose or effective dose of rAAV administered is approximately 1.0 × 10⁻⁶ 10 vg / kg ~ approx. 1.0×10 16 It is vg / kg. In some embodiments, 1.0 × 10 10 vg / kg is also specified as 1.0 E10vg / kg, which is simply another way of indicating scientific notation. Similarly, 10 11 This is equivalent to E11, and so on. In some embodiments, the dose of rAAV administered is approximately 1.0 × 10⁻⁶. 11 vg / kg ~ approx. 1.0×10 15 The value is vg / kg. In some embodiments, the dose of rAAV is approximately 1.0 × 10⁻⁶. 10 vg / kg, approx. 2.0×10 10 vg / kg, approx. 3.0×10 10 vg / kg, approximately 4.0×10 10 vg / kg, approximately 5.0×10 10 vg / kg, approximately 6.0×10 10 vg / kg, approximately 7.0×10 10 vg / kg, approximately 8.0×10 10 vg / kg, approximately 9.0×10 10 , about 1.0×10 11vg / kg, approximately 2.0×10 11 vg / kg, approximately 3.0×10 11 vg / kg, approximately 4.0×10 11 vg / kg, approximately 5.0×10 11 vg / kg, approximately 6.0×10 11 vg / kg, approximately 7.0×10 11 vg / kg, approximately 8.0×10 11 vg / kg, approximately 9.0×10 11 vg / kg, approximately 1.0×10 12 vg / kg, approximately 2.0×10 12 vg / kg, approximately 3.0×10 12 vg / kg, approximately 4.0×10 12 vg / kg, approximately 5.0×10 12 vg / kg, approximately 6.0×10 12 vg / kg, approximately 7.0×10 12 vg / kg, approximately 8.0×10 12 vg / kg, approximately 9.0×10 12 vg / kg, approximately 1.0×10 13 vg / kg, approximately 2.0×10 13 vg / kg, approximately 3.0×10 13 vg / kg, approximately 4.0×10 13 vg / kg, approximately 5.0×10 13 vg / kg, approximately 6.0×10 13 vg / kg, approximately 7.0×10 13 vg / kg, approximately 8.0×10 13 vg / kg, approximately 9.0×10 13 vg / kg, approximately 1.0×10 14 vg / kg, approximately 2.0×10 14 vg / kg, approximately 3.0×10 14 vg / kg, approximately 4.0×10 14 vg / kg, approximately 5.0×10 14 vg / kg, approximately 6.0×10 14 vg / kg, approximately 7.0×10 14 vg / kg, approximately 8.0×10 14 vg / kg, approximately 9.0×10 14 vg / kg, approximately 1.0×10 15 vg / kg, approximately 2.0×10 15 vg / kg, approximately 3.0×10 15 vg / kg, approximately 4.0×1015 vg / kg, about 5.0×10 15 vg / kg, about 6.0×10 15 vg / kg, about 7.0×10 15 vg / kg, about 8.0×10 15 vg / kg, about 9.0×10 15 vg / kg, or about 1.0×10 16 vg / kg.

[0172] In some embodiments, the dosage is about 1.0×10 11 vg / kg to about 1.0×10 15 vg / kg. In some embodiments, the dosage is about 1.0×10 13 vg / kg to about 5.0×10 13 vg / kg. In some embodiments, the dosage is about 2.0×10 13 vg / kg to about 4.0×10 13 vg / kg. In some embodiments, the dosage is about 3.0×10 13 vg / kg.

[0173] In some embodiments, after the initial dosage, a second, higher dosage follows. In some embodiments, after the initial dosage, a second, identical dosage follows. In some embodiments, after the initial dosage, one or more lower dosages follow. In some embodiments, after the initial dosage, multiple dosages that are the same or higher follow.

[0174] A method is envisioned for transducing target cells with a delivery vehicle (e.g., rAAV) in vivo or in vitro. Transduction of cells with rAAV according to this disclosure results in sustained expression of a miRNA sequence. Therefore, this disclosure provides rAAVs that express a miRNA sequence in vitro or in vivo in cells of a subject, and methods for administering / delivering rAAVs. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human. These methods involve transducing cells and tissues (including, but not limited to, tissues such as the brain) with one or more rAAVs described herein. Transduction may be performed using a gene cassette containing cell-specific regulatory elements. The term “transduction” is used, for example, to refer to the administration / delivery of a nucleic acid containing miRNA sequences, e.g., nucleotide sequences encoding DUX4 or PMP22 miRNA, i.e., mi405 or mi871, respectively, to target cells either in vivo or in vitro via the replication defect rAAV described herein, resulting in the manipulation of the expression of target genes, e.g., DUX4 or PMP22, by target cells.

[0175] An in vivo method includes the step of administering an effective dose or multiple effective doses of a composition containing a delivery vehicle (such as rAAV) to a subject in need (including a human subject). Therefore, a method is provided for administering an effective dose of the rAAV described herein (or doses administered essentially simultaneously or at regular intervals) to a subject in need. If the dose or multiple doses are administered before the onset of the disorder / disease, the administration is prophylactic. If the dose or multiple doses are administered after the onset of the disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease condition being treated, delays or prevents progression to the disorder / disease condition, delays or prevents progression to the disorder / disease condition, reduces the severity of the disease, results in remission (partial or complete) of the disorder / disease condition, and / or prolongs survival.

[0176] In some embodiments, the compositions and methods of the present disclosure are used to treat, improve, or prevent diseases or disorders associated with the expression of the DUX4 or PMP22 gene, such as FSHD or CMT1A disease.

[0177] In some embodiments, the level of target gene expression or protein expression in the target cells decreases after administration of the miRNA-encoding nucleic acid or vector containing the miRNA-encoding nucleic acid, e.g., rAAV, compared to the level of miRNA gene expression or protein expression before administration of the miRNA-encoding nucleic acid or vector, e.g., rAAV. In some embodiments, the expression of the target gene changes by at least or about 10%, at least or about 20%, at least or about 30%, at least or about 40%, at least or about 50%, at least or about 60%, at least or about 70%, at least or about 80%, at least or about 90%, at least or about 95%, at least or about 98%, at least or about 99%, at least or about 100%, or at least more than about 100%.

[0178] The administration of an effective dose of the nucleic acids, viral vectors, nanoparticles, extracellular vesicles, exosomes, or compositions of this disclosure may be by routes standard in the art, including but not limited to intraventricular, intrathecal, intravenous, intracranial, oral, intrabuccal, nasal, intraosseous, intramuscular, parenteral, intravascular, transpulmonary, intraocular, transrectal, or transvaginal. In some embodiments, the effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration to the circulatory system such that the entire body is affected. Such systemic administration is carried out in various embodiments by enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various embodiments, the effective dose is delivered by a combination of routes. For example, in various embodiments, the effective dose is delivered intravenously and / or intramuscularly, or intravenously and intraventricularly, etc. In some embodiments, the effective dose is delivered sequentially or consecutively. In some embodiments, the effective dose is delivered simultaneously.

[0179] In some embodiments, nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, compositions, or pharmaceuticals are formulated for delivery of an effective dose by oral administration, subcutaneous administration or infusion, intradermal administration or infusion, intraventricular delivery or infusion, intracerebral delivery or infusion, intrathecal delivery or infusion, transdermal delivery or infusion, infusion into the bloodstream, or aerosol administration.

[0180] The routes of administration and serotypes of the AAV components of the rAAVs of this disclosure (in particular, AAV ITR and capsid proteins) are selected and / or adapted by those skilled in the art in various embodiments, taking into consideration the state or pathology of the disease or disorder being treated, the state, pathology, or age of the subject, and the target cells / tissues expressing nucleic acids or proteins.

[0181] In particular, the actual administration of a delivery vehicle (e.g., rAAV) can be achieved by using any physical method to transport the delivery vehicle (e.g., rAAV) to target cells in an animal. Administration includes, but is not limited to, injection into the brain, nervous system, liver, or bloodstream. It has been demonstrated that simply resuspending rAAV in phosphate-buffered saline is sufficient to provide a vehicle useful for expression in the brain, and there are no known restrictions on carriers or other components that can be administered co-administered with rAAV (however, compositions that degrade DNA should be avoided in the usual methods using rAAV). The capsid protein of rAAV may be modified so that rAAV targets specific target tissues of interest, such as neurons. See, for example, WO02 / 053703 (its disclosure is incorporated herein by reference). Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations delivered to muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have already been developed and can be put into practice in this disclosure. The delivery vehicle (e.g., rAAV) can be used with any pharmaceutically acceptable carrier to facilitate administration and handling.

[0182] Dispersions of the delivery vehicle (e.g., rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycol, and mixtures thereof, as well as in oil. Under normal storage and use conditions, these preparations contain preservatives that prevent microbial growth. In this regard, all sterile aqueous media used can be readily obtained by standard techniques known to those skilled in the art.

[0183] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid enough to allow for easy syringeability. It must be stable under manufacturing and storage conditions and protected against microbial contamination, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, sorbitol, etc.), suitable mixtures thereof, and vegetable oils. Adequate fluidity can be maintained, for example, by using a coating agent such as lecithin, by maintaining the required particle size in the case of dispersions, and by using a surfactant. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it would be preferable to include an isotonic agent, such as sugar or sodium chloride. The prolonged absorption of injectable compositions can be achieved by using absorption-delaying agents, such as aluminum monostearate and gelatin.

[0184] Sterile injectable solutions are prepared by combining the required amount of rAAV in a suitable solvent, along with various other components listed above as needed, and then sterilizing by filtration. Generally, dispersants are prepared by combining the sterilized active ingredient in a sterile vehicle containing a basic dispersion medium and other required components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired components from those solutions that have been previously sterilized and filtered.

[0185] "Treating" includes improving, reducing, or inhibiting one or more symptoms of a disease or condition associated with the expression of a target gene, i.e., a gene whose expression is designed to be knocked down by a microRNA. "Preventing" includes inhibiting or blocking one or more symptoms of a disease or condition associated with the expression of a target gene, i.e., a gene whose expression is designed to be knocked down by a microRNA. Such prevention includes, in some embodiments, inhibiting gene expression to a level that does not allow for the manifestation of symptoms of the disease or condition associated with gene expression.

[0186] Therefore, in some embodiments, methods are provided for administering an effective dose of rAAV described herein (or doses administered essentially simultaneously or at regular intervals) to subjects in need thereof. When a dose or multiple doses are administered before the onset of the disorder / disease, the administration is prophylactic. When a dose or multiple doses are administered after the onset of the disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease condition being treated, delays or prevents progression to the disorder / disease condition, delays or prevents progression to the disorder / disease condition, reduces the severity of the disease, results in remission (partial or complete) of the disorder / disease condition, and / or prolongs survival.

[0187] In some embodiments, the compositions and methods of the present disclosure are used to treat, improve, or prevent diseases such as muscular dystrophy (MD) associated with the expression of the double homeobox 4 (DUX4) gene.

[0188] In various aspects, such MD is facioscapulohumeral muscular dystrophy (FSHD). FSHD is caused by the abnormal expression of the DUX4 gene, which produces a transcription factor toxic to skeletal muscle. DUX4 normally functions during the two-cell stage of human development, but is subsequently suppressed in virtually all other tissues, except perhaps the testes. In the skeletal muscle of individuals with FSHD, certain genetic and epigenetic factors simultaneously enable DUX4 disinhibition, which then initiates several abnormal gene expression cascades, including those involved in differentiation abnormalities, oxidative stress, inflammatory infiltration, cell death, and muscle atrophy.

[0189] FSHD is the most commonly inherited muscular dystrophy, estimated to affect as many as 870,000 people. The classic description of FSHD symptoms includes progressive weakness in the face, shoulder girdle, and arms, but the disease can manifest more broadly, including the muscles of the torso and lower extremities. Variability is also common within individuals, and asymmetrical weakness is common. The age of onset can range from infancy to adulthood and is usually related to the severity of the disease, with earlier onset often associated with more severe weakness. Most patients with FSHD have a normal lifespan, but respiratory failure can occur, the disease can be debilitating, and approximately 25% of affected individuals may become wheelchair dependent by their 50s, even earlier in more severe forms of the disease, while others maintain walking ability throughout their lives.

[0190] In families known to have pathological FSHD, the methods of the present disclosure are, in various embodiments, methods for preventing the disease, and they are performed before the onset of the disease. In other various embodiments, the methods of the present disclosure are performed after diagnosis and are therefore methods for treating or improving the disease.

[0191] In several additional embodiments, the nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, and compositions of this disclosure are used in treating, improving, or preventing diseases such as cancer. DUX4 has been shown to be activated in several cancer types, in which DUX4 functions to mask tumor cells from the immune system [Chew et al., Dev. Cell 50(5):658-71 (2019)]. For example, DUX4 protein fusion is known to cause cancers such as rhabdomyosarcoma and Ewing sarcoma. CIC-DUX4 gene fusion induces sarcoma and drives sarcoma metastasis [Yoshimoto et al., Cancer Res. 2017 Jun 1;77(11):2927-2937, Okimoto et al., J Clin Invest. 2019; 129(8):3401-3406]. Other cancerous tissues, such as those from the adrenal gland, B-cell lymphoma, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain (e.g., low-grade glioma), lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testis, and thymus, have also been shown to express DUX4 [Chew et al., Dev. Cell 50(5):658-71 (2019)]. For this reason, the nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, and compositions of this disclosure described herein are used to inhibit DUX4 expression in the treatment, improvement, or prevention of cancer.

[0192] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the products and methods disclosed herein in reducing the expression of the DUX4 gene and protein and treating muscular dystrophy such as FSHD. Outcome measures are described, for example, in Chapters 32, 35, and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4th Edition, Volume 1 (2005), and in Burgess et al., Methods Mol. Biol., 602:347-393 (2010). Outcome measures include, but are not limited to, reduction or elimination of DUX4 mRNA or protein in affected tissue. Absence of DUX4 expression in cells and / or downregulation of DUX4 expression are detected by measuring the level of DUX4 protein in muscle biopsies before and after rAAV administration by methods known in the art, including but not limited to RT-PCR, QRT-PCR, RNA scoping, Western blotting, immunofluorescence, or immunohistochemistry, in order to determine enhancement.

[0193] In some embodiments, the level of DUX4 gene expression or protein expression in a target cell is decreased following administration of a nucleic acid or vector encoding a DUX4 miRNA, such as rAAV, as compared to the level of DUX4 gene expression or protein expression prior to administration of the nucleic acid or vector encoding a DUX4 miRNA, such as rAAV. In some aspects, expression of DUX4 is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or more than at least about 100%. In various aspects, improved muscle strength, improved muscle function, and / or improved mobility and stamina are shown to be improved by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100%, or more than at least about 100%.

[0194] Other outcome measures include measuring the levels of serum creatine kinase (CK) in a subject before and after treatment. Increased CK levels are characteristic of muscle injury. In patients with muscular dystrophy, CK levels are significantly increased above the normal range (10 to 100 times normal levels since birth). When elevated CK levels are observed in a blood sample, it usually means that the muscle is being disrupted by some abnormal process such as muscular dystrophy or inflammation. Thus, a positive treatment outcome by the methods of the present disclosure is a reduction in the level of serum creatine kinase after administration of rAAV as compared to the level of serum creatine kinase before administration of rAAV.

[0195] Other outcome measures include, but are not limited to, measurements to determine whether there is an improvement in muscle strength, muscle function, mobility, stamina, or a combination of two or more of these in subjects after treatment. Such outcome measures are important in determining the progression of muscular dystrophy in subjects and are measured by a variety of tests known in the art. Some of these tests include, but are not limited to, the 6-minute walk test, stand-to-stand time test, 4-step uphill test, 4-step uphill / downhill test, Northstar gait assessment (NSAA) test, 10-meter timed test, 100-meter timed test, handheld strength measurement (HHD) test, timed up-and-go test, gross motor subtest scale (Bayley-III) score, maximal voluntary isometric contraction test (MVICT), or a combination of two or more of these.

[0196] Combination therapies are also contemplated in this disclosure. Combination therapies, as used herein, include both concurrent and sequential treatments. Combinations of the methods described herein with standard medical treatments and supportive therapies are specifically contemplated, as are combinations with therapies such as glucocorticoids. All types of glucocorticoids are included for use in the combination therapies disclosed herein. Such glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.

[0197] Other combination therapies included in this disclosure are combinations of DUX4 miRNA with other miRNAs as described herein, or combinations of U7-snRNA-based gene therapy, small molecule inhibitors of DUX4 expression, oligonucleotides that inhibit DUX4 via RNAi or RNAse H or exon skipping mechanisms, U7-snRNA, and theoretical CRISPR-based gene therapy approaches.

[0198] In some embodiments, the nucleic acids, vectors, nanoparticles, extracellular vesicles, endosomes, compositions, and methods of this disclosure are used to treat, improve, or prevent diseases such as Charcot-Marie-Tooth disease (CMT), which include, but are not limited to, CMT1A associated with the expression of the PMP22 gene. In families known to have a pathological PMP22 gene duplication or mutation, subjects are treated before the onset of the disease, and therefore the disease is prevented. In other embodiments, subjects are diagnosed with a pathological PMP22 gene duplication or mutation, and subjects are treated after the onset of the disease, and therefore the disease is treated or improved.

[0199] CMT disorders refer to a heterogeneous group of hereditary peripheral neuropathy affecting approximately 1 in 2500 people. The most common type, CMT1, is a demyelinating peripheral neuropathy. The CMT1 subtype, affecting over 50% of all CMT cases and approximately 70-80% of CMT1 cases, is autosomal dominant demyelinating CMT neuropathy type 1A [CMT1A(MIM118220)]. CMT1A is most frequently caused by a dominant inheritance of 1.4 Mb of tandem intrachromosomal duplication on chromosome 17p11.2-p12. Duplication results in three copies of peripheral myelin protein 22 (PMP22), which are translated into the PMP22 protein [Timmerman et al., Nature Genetics, 1(3):171-175 (1992) and Valentijn et al., Nature Genetics, 1(3):166-170 (1992)]. In some cases, point mutations in PMP22 can also lead to dominant CMT1A, generally presenting with the most severe phenotype [Matsunami et al., Nature Genetics, 1(3):176-179 (1992), Patel et al., Nature Genetics, 1(3):159-165 (1992), Timmerman et al., see above]. Patients with CMT1A develop progressive distal muscle weakness and atrophy, loss of sensation, and reflexes, typically with onset during adolescence. CMT1A exhibits high variability in disease severity even within the same family. Sensory responses typically show uniform and symmetrical findings across different nerves, with motor nerve conduction velocity (MNCV) usually slowed in the forearm by 5–35 m / s, although most cases average around 20 m / s. While MNCV remains largely unchanged over decades, motor amplitude and motor unit count slowly decrease, reflecting axonal loss that correlates with clinical impairment.

[0200] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of this method. Outcome measures are described, for example, in Chapters 32, 35, and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4th Edition, Volume 1 (2005), and in Burgess et al., Methods Mol. Biol., 602:347-393 (2010). Outcome measures include, but are not limited to, one or more of the following: reduction or elimination of mutant PMP22 mRNA or protein in affected tissue, knockdown of the PMP22 gene, weight gain, and improvement in muscle strength. Other measures include, but are not limited to, neurohistochemistry (axon number, axon size, and myelin formation), neuromuscular junction analysis, and muscle weight and / or myohistology. Other methods include, but are not limited to, nerve conduction velocity (NCV), electromyography (EMG), and synaptic physiology.

[0201] In the methods of the present disclosure, PMP22 expression in the subject is inhibited by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% compared to the expression in the subject before treatment.

[0202] Combination therapy is also intended by this invention. The combinations used herein include both concurrent and sequential therapies. Combinations of the methods described herein with standard medical treatments and supportive therapies are particularly intended.

[0203] This disclosure also provides kits comprising the nucleic acids, vectors, or compositions of this disclosure, or manufactured in accordance with the processes of this disclosure. In the context of this disclosure, the term “kit” means two or more components, one of which corresponds to the nucleic acids, vectors, or compositions of this disclosure, and the other to a container, recipient, instructions, or other. Thus, a kit is, in various embodiments, a set of products sufficient to achieve a particular objective and can be sold as a single unit.

[0204] The kit may include one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags, etc.) of any suitable shape, size, and material containing the nucleic acids, vectors, or compositions of this disclosure in an appropriate dosage for administration (see above). The kit may additionally include instructions or instructions for use (e.g., in the form of a leaflet or instruction manual), means for administering the nucleic acids, vectors, or compositions, such as syringes, pumps, injectors, means for reconstituting the nucleic acids, vectors, or compositions, and / or means for diluting the nucleic acids, vectors, or compositions.

[0205] In some embodiments, the kit includes a label and / or instructions describing the use of the reagents provided in the kit. The kit also optionally includes a catheter, syringe, or other delivery device for delivering one or more of the compositions used in the methods described herein.

[0206] The present invention also provides kits for single-dose or multiple-dose units. In some embodiments, the disclosure provides kits comprising single-chamber and multi-chamber pre-filled syringes.

[0207] The entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features is not found together in the same sentence, paragraph, or section of this document. The disclosure also includes all embodiments of the disclosure, for example, that are somewhat narrower in scope than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered distinct aspects of the disclosure. With respect to aspects of the disclosure described or claimed as "a" or "an," it should be understood that these terms mean "one or more" unless the context explicitly requires a more limited meaning.

[0208] Unless otherwise specified, the term “at least” preceding a set of elements should be understood to refer to all elements in that set. Those skilled in the art will be able to recognize, or verify by use without going beyond routine experimentation, many equivalents to the specific embodiments of this disclosure described herein. Such equivalents are intended to be encompassed by this disclosure.

[0209] As used herein, the terms "and / or" include, at any time, "and," "or," and "all or any other combination of the elements connected by such terms."

[0210] As used herein, the terms “about” or “approximately” mean within 20%, preferably within 10%, and more preferably within 5% of a given value or range. However, it also includes specific numbers; for example, “about 10” includes 10.

[0211] Throughout this specification and the subsequent claims, unless otherwise required by context, the word “comprise,” and variations such as “comprises” and “comprising,” should be understood to mean including any integer or step or group of integers or steps described, but not to mean excluding any other integer or step or group of integers or steps. Where used herein, the term “comprising” may be replaced by the terms “containing” or “including,” or, where sometimes used herein, by the term “having.”

[0212] As used herein, “consisting of” excludes any element, step, or component not specified in the elements of the claims. As used herein, “essentially consisting of” does not exclude any material or step that does not substantially affect the basic and novel features of the claims.

[0213] In each example herein, any of the terms “comprising,” “consisting essentially of,” and “consisting of” may be replaced by any of the other two terms.

[0214] This disclosure is not limited to, and is therefore subject to change, the specific methodologies, protocols, materials, reagents, and substances described herein. Terms used herein are intended solely to describe specific embodiments and are not intended to limit the scope of the subject matter defined solely by the claims.

[0215] All publications and patents cited throughout this Specified (including all patents, patent applications, scientific publications, manufacturer specifications, instructions, etc.) are incorporated herein by reference in their entirety, whether above or below. To the extent that any material incorporated by reference is inconsistent with or contradicts this Specified, this Specified shall prevail over any such material.

[0216] A better understanding of this disclosure and its merits will be obtained from the following examples, which are provided for illustrative purposes only. The examples are not intended to limit the scope of this disclosure. The examples and embodiments described herein are for illustrative purposes only, and various modifications or changes in their respects will be suggested to those skilled in the art, but should be understood to be included within the spirit and scope of this application and the appended claims. [Examples]

[0217] Additional aspects and details of this disclosure will become apparent from the following examples, which are intended to be illustrative and not limiting.

[0218] Example 1 Materials and methods Test design. U6 promoter-driven systems have been previously developed and reported that express therapeutic miRNAs that target and reduce several dominant disease genes. See, at least, U.S. Patents 9,469,851 and 10,301,649 (i.e., DUX4 miRNA, e.g., mi405) which provide miRNAs targeting the DUX4 gene, and WO2022 / 119826 (PMP22 miRNA, e.g., mi-871) which targets the PMP22 gene associated with facioscapulohumeral muscular dystrophy (FSHD) and Charcot-Marie-Tooth disease type 1A (CMT1A), respectively. In vitro and in vivo trials of these RNAi therapies targeting DUX4 and PMP22 have demonstrated the ability of specially designed synthetic miRNAs to reduce mRNA and protein levels while mitigating disease-related outcomes in target tissues.

[0219] While these therapies have demonstrated efficacy in targeting genes associated with dominant genetic disorders, high levels of off-target expression of scAAV9, including these miRNAs, have also been observed in the heart, liver, and kidneys via both intravenous (IV) and intrathecal (IT) pathways (Figure 4).

[0220] Therefore, the objective of this study was to design modular expression cassettes (i.e., modular constructs) that would allow researchers to convert previously developed and reported pol III (e.g., U6- and H1) promoter-driven miRNA expression cassettes into novel tissue-specific pol II promoter-driven miRNA expression cassettes, thereby enabling more specific expression of therapeutic miRNAs in target tissues to treat diseases associated with abnormal genes.

[0221] Converting pol III-driven miRNAs to pol II-driven systems (i.e., expression cassettes) alters the secondary structure of the primary miRNA transcript, thereby modifying the maturation process by the RNAse enzymes Drosha and Dicer. For example, various features of this system need to be converted to accommodate the use of pol III promoters. For instance, the U6 pol III promoter is used with the RNA pol III termination signal, while tissue-specific pol II promoters such as CMV are used with the RNA pol III polyA signal (Figure 5). The use of pol II promoters is important in the novel modular expression cassette constructs disclosed herein because it enables tissue-specific expression of therapeutic miRNAs. Therefore, this disclosure provides modular expression cassettes designed to take these factors into account and to facilitate the substitution of various miRNAs into cassettes.

[0222] In this study, the novel miRNA expression cassette was designed to precisely position the RNAse III enzyme Drosha at the junction between stem 2 and stem 1, with stem 1 designed to contain as many single-stranded structures as possible. The Drosha / DGCR8 complex (referred to as the microprocessor) is positioned at the junction of single-stranded and double-stranded RNA structures (Han et al., Cell 125(5):P887-901, 2006). In this study, eight novel miRNA expression cassettes were designed to convert existing U6 promoter-driven miRNAs to tissue-specific pol II-based systems. Novel secondary structural elements were incorporated into the primary transcript region adjacent to the Drosha and Dicer processing sites. Figure 6 shows a comparative structure of these eight constructs incorporating the DNA sequence encoding the exemplary miRNA of interest, mi405 (DUX4-specific miRNA). The structures of the new mi405 constructs are shown in Figures 7-14, and the structures of the new mi871 constructs are shown in Figures 15-22. The RNA nucleotide sequences encoded by the new miPMP22-871 constructs (sequence numbers 1-8) are shown in Figure 23, and the RNA nucleotide sequences encoded by the new miDUX4-405 constructs (sequence numbers 9-16) are shown in Figure 24. The novel general structures of each of the eight constructs are shown in Figures 25-27, and their nucleotide sequences are shown in sequence numbers 38-53.

[0223] Each miRNA expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system is a nucleic acid comprising, in 5' to 3' order, a DNA nucleotide sequence encoding the single-stranded stem of mir30, the 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop containing nucleotide changes to facilitate folding, an antisense strand of mature microRNA, the 3' double-stranded stem of mir30, the single-stranded stem of mir30, and a polyadenylation (poly-A) signal. The cassettes designed in our laboratory include restriction sites for cloning, but these restriction sites are not required for the expression cassettes disclosed herein. It is important to note that the expression cassette constructs disclosed herein may be chemically synthesized, and therefore the restriction sites considered in this example are not required for the final product.

[0224] Nevertheless, in various embodiments, in experimental designs, each miRNA expression cassette includes, in 5' to 3' order, a DNA nucleotide sequence encoding a first restriction enzyme site, a single-stranded stem of mir30, a 5' double-stranded stem of mir30, a sense strand of mature microRNA, a modified mir30 loop containing nucleotide changes to facilitate folding, an antisense strand of mature microRNA, a 3' double-stranded stem of mir30, a single-stranded stem of mir30, a second restriction enzyme site, a polyadenylation (poly-A) signal, and a third enzyme restriction site.

[0225] The pol II-driven miRNA expression cassette of this disclosure is designed to be modular, thereby enabling (1) any desired RNA polymerase II-based promoter at the indicated Age I site, and (2) any mature sense and antisense strands of the microRNA sequence of interest (not limited to the exemplary miRNA sequences disclosed herein) between the Age I site and the Afl II site within the expression cassette.

[0226] Therefore, in some embodiments, the pol II-driven expression cassette is not limited to the use of only AgeI and AflII restriction styles. For example, to produce the constructs shown in SEQ ID NO: 8 and SEQ ID NO: 16, the AflI site was removed to facilitate unfolding of stem 1 into the 5' and 3' single-stranded regions. In an exemplary embodiment where this design is preferred, the microRNA can be designed to contain the Nrp I polyA signal and cloned into the AgeI and EcoRI sites. This is a strategy that can be applied to the insertion of miRNAs for various purposes.

[0227] In an exemplary embodiment, the first restriction enzyme site is the AgeI site. In an exemplary embodiment, the AgeI site comprises a nucleotide sequence encoding ACCGGU (SEQ ID NO: 19).

[0228] In an exemplary embodiment, the single-stranded stem of mir30 includes a nucleotide sequence encoding GGUUGCUGUUGA (SEQ ID NO: 20), GGUUUGCUGAGGA (SEQ ID NO: 21), GGUUUGCUCCUUA (SEQ ID NO: 22), GGUAAGCUCCUUA (SEQ ID NO: 23), or GGUCCCCAAGCUCCUUA (SEQ ID NO: 24).

[0229] In an exemplary embodiment, the 5' double-stranded stem of mir30 contains a nucleotide sequence encoding CAGUGAGCGAN (SEQ ID NO: 25), where N is A, U, C, or G (in the miPMP22-871 construct, N is G; in the miDUX4-405 construct, N is U).

[0230] In various embodiments, the sense strand and antisense strand of a mature miRNA are strands of a mature miRNA of any gene of interest. This is therefore the objective of the disclosed modular system design, namely to allow the simple insertion of a sequence encoding any miRNA into a construct for pol II tissue-specific expression of the miRNA. In an exemplary embodiment, the sense strand of a mature miRNA contains a nucleotide sequence encoding miPMP22-871 (i.e., GGGUUGCUGUUGAUUGAAGACU) (SEQ ID NO: 17) or miDUX4-405 (i.e., CCAGGAUUCAGAUCUGGUUUCU) (SEQ ID NO: 18).

[0231] In an exemplary embodiment, the modified mir30 loop includes a nucleotide sequence encoding GUAAAGCCACAGAUGGG (SEQ ID NO: 26).

[0232] In various embodiments, the antisense strand of a mature miRNA is a strand of mature miRNA of any gene of interest. As discussed herein, this is the objective of designing the disclosed modular expression system, namely to allow the simple insertion of a sequence encoding any miRNA into a construct for pol II tissue-specific expression of the miRNA. In exemplary embodiments, the antisense strand of a mature miRNA comprises a nucleotide sequence encoding miPMP22-871 (i.e., UCUUCAAUCAACAGCAAUCCCC) (SEQ ID NO: 27) or miDUX4-405 (i.e., AAACCAGAUCUGAAUCCUGGAC) (SEQ ID NO: 28).

[0233] In an exemplary embodiment, the 3'ds stem of mir30 contains a nucleotide sequence encoding UGCCUACUG (SEQ ID NO: 29).

[0234] In an exemplary embodiment, the ss stem (mutant) of mir30 contains a nucleotide sequence encoding CCUUUUACUU (SEQ ID NO: 30).

[0235] In an exemplary embodiment, the second restriction enzyme site is the AflII site. In an exemplary embodiment, the AflII site includes a nucleotide sequence encoding CUUAAG (SEQ ID NO: 31).

[0236] In an exemplary embodiment, the polyA signal is a wild-type neuropilin-1 polyadenylation (WT NRP1 polyA) signal. In an exemplary embodiment, the WT NRP1 polyA signal comprises a nucleotide sequence encoding AAUAAAAUACGAAAUGUGACAGA (SEQ ID NO: 32).

[0237] In an exemplary embodiment, the third restriction site is the EcoR1 site. In an exemplary embodiment, the EcoR1 site includes a nucleotide sequence encoding GAAUUC (SEQ ID NO: 33). In an exemplary embodiment, the third restriction site is the MfeI site. In an exemplary embodiment, the MfeI site includes a nucleotide sequence encoding AAUUG (SEQ ID NO: 34).

[0238] We designed various exemplary structures for substituting a pol II promoter with another pol II promoter. Each of the eight structures was tested with two exemplary miRNAs: miPMP22-871 or mi-871(GGGUUGCUGUUGAUUGAAGACU (SEQ ID NO: 17) and miDUX4-405 or mi-405(CCAGGAUUCAGAUCUGGUUUCU (SEQ ID NO: 18)). The sense strand of miPMP22-871 contains the nucleotide sequence of SEQ ID NO: 17. The antisense strand of miPMP22-871 contains the nucleotide sequence of SEQ ID NO: 27. The sense strand of miDUX4-405 contains the nucleotide sequence of SEQ ID NO: 18. The antisense strand of miDUX4-405 contains the nucleotide sequence of SEQ ID NO: 28.For example, see WO2022 / 119826 and U.S. Patent Nos. 9,469,851 and 10,301,649, as well as Marina Stavrou et al., (2022) A miRNA-based gene silencing approach for the treatment of CMT1A. Journal of Clinical Investigation Jul 1;132(13):e159814, Wallace et al., (2012) RNA interference inhibits DUX4-induced muscle toxicity in vivo: Implications for a targeted FSHD therapy. Molecular Therapy July;20(7):1417-23, Wallace et al., Pre-clinical safety studies to support translation of AAV-mediated RNAi therapy for FSHD. Mol Ther Methods Clin Dev. Dec 24,8:121-130, and Amini-Chermahini et al., (2019) RNAscope in situ hybridization-based See Method for Detecting DUX4 Expression in Vitro.RNA Sep;25(19):1211-1217 and Saad et al., (2021) Human microRNA mir-675 inhibits DUX4 expression and may be exploited as a potential treatment for FSHD. Nature Communications. Dec 8;12(1):7128. mi871 has been used to induce silencing of overexpressed peripheral myelin protein 22 (PMP22), and the constructs of the present disclosure are designed to do the same. PMP22 is a transmembrane glycoprotein component of myelin that is important for myelin function. Mutations in the PMP22 gene cause Charcot-Marie-Tooth disease.Using mi405, we induce silencing of DUX4, also known as DUX4, a protein encoded by the DUX4 gene in humans, whose misexpression is the cause of facioscapulohumeral muscular dystrophy (FSHD).

[0239] The expression cassette constructs were designed to include either a small polyadenylation signal derived from the human neuropilin-1 (Nrp1) gene, or a modified human neuropilin-1 polyadenylation signal in which seven indicated nucleotides (5'-GTGACAG-3' (SEQ ID NO: 54), DNA; 5'GUGACAG (SEQ ID NO: 55), RNA) were mutated to C nucleotides to enhance the potential single-stranded nature of stem 1.

[0240] The expression cassette construct was designed such that the stem 1 region of the cassette contains a nucleotide sequence having 5' and 3' ends in the range of approximately 15 to approximately 46 nucleotides in length. However, in various embodiments, the stem 1 region may contain a nucleotide sequence that is less than or greater than these indicated lengths.

[0241] Exemplary embodiments of the 5' end of the stem 1 region include base pairs containing G:U RNA fluctuation base pairs in the range of approximately 0–50% base pairing. However, in some embodiments, the stem 1 region also includes base pairings exceeding approximately 50% base pairing.

[0242] Exemplary embodiments of the 3' end of the stem 1 region include base pairs containing G:U RNA fluctuation base pairs in the range of about 0–30% base pairing. However, in some embodiments, the stem 1 region also includes base pairings exceeding about 30% base pairing, and in some embodiments, it may exceed about 50% base pairing.

[0243] Exemplary embodiments of the microRNA (miRNA) region of the cassette include a miRNA nucleotide sequence in the range of about 100 to about 200 nucleotides, although the miRNA coding region may include a sequence shorter than or longer than the indicated length. In some embodiments, the miRNA nucleotide sequence is in the range of about 120 to about 180 nucleotides in length. In exemplary embodiments of this disclosure, the miRNA region is in the range of 136 to 167 nucleotides in length (see Table 2). The cassette is designed to contain either natural or artificial microRNA. [Table 2]

[0244] Several novel miRNA designs were developed to demonstrate how existing U6 promoter-driven miRNAs function by converting them to tissue-specific pol II-based systems. Novel secondary structural elements were incorporated into primary transcript regions adjacent to Drosha and Dicer processing sites, and the efficacy and expression of mature sequences were confirmed in vitro.

[0245] This novel system is designed to enable rapid conversion from ubiquitous to tissue-specific miRNA expression systems without re-induction of read RNAi triggers, while simultaneously providing a new approach to restrict the expression of therapeutic miRNAs.

[0246] HEK-293 cell culture. HEK-293 (ATCC) cells were grown at 37°C in Gibco® DMEM, high glucose, glutamine-free (ThermoFisher), supplemented with 1% L-glutamine, 1% penicillin / streptomycin, and 10% FBS by volume. Cells were subculturized at 90% confluence using trypsin-EDTA (0.25%) and phenol red (ThermoFisher). For the dual luciferase assay, 65,000 cells were pre-plated in white 96-well plates and transfected with a total of 200 ng of DNA using Lipofectamine® 2000 transfection reagent (ThermoFisher) according to the manufacturer's protocol.

[0247] Rat Schwann cell culture. RT4-D6P2T rat Schwann cells (ATCC) were grown at 37°C in Gibco® DMEM, high glucose, glutamine-free (ThermoFisher), supplemented with 1% L-glutamine, 1% sodium pyruvate, 1% penicillin / streptomycin, and 10% FBS by volume. Cells were passaged at 90% confluence using Gibco® TrypLE® Express Enzyme (1x) and phenol red (ThermoFisher). For the dual luciferase assay, 65,000 cells were pre-plated in white 96-well plates and transfected with a total of 200 ng of DNA using Lipofectamine® 3000 transfection reagent (ThermoFisher) according to the manufacturer's protocol. For ddPCR expression and knockdown assays, 250,000 cells were pre-plated in white 96-well plates and transfected with a total of 500 ng of DNA using Lipofectamine® 3000 transfection reagent (ThermoFisher) according to the manufacturer's protocol.

[0248] RNA extraction. Total RNA was extracted according to the mirVana® miRNA isolation kit (Invitrogen) total RNA isolation protocol, using 600 μL of lysis buffer to elute RNA in 100 μL of upH2O (Invitrogen). After elution, 10 μL of 3M sodium acetate pH 5.5 (Invitrogen) and 200 μL of 190 proof EtOH (Decon) were added to the sample, mixed, and left overnight at -20°C. The sample was rotated at maximum speed at 4°C for 30 minutes, and the supernatant was discarded without disturbing the precipitated RNA. 100 μL of 70% EtOH was added, and the sample was rotated at maximum speed at 4°C for 15 minutes, and the supernatant was discarded without disturbing the precipitated RNA. The sample was placed in a DNA Speed ​​Vac and rotated at low speed for 3 minutes. The sample was resuspended using 50 μL of upH2O, and the concentration was subsequently measured by Nanodrop. 200 ng of RNA was treated with DNase by adding 20 U of RNase inhibitor and human placenta (New England Biolabs) according to the protocol of the manufacturer of the DNA-free™ DNA removal kit (Invitrogen), and by using thermal enzyme inactivation at 75°C for 10 minutes instead of the included inactivation reagent. After DNase treatment, a large volume cDNA reverse transcription kit (Applied Biosystems) was used, and oligo(dT) was used instead of 10x RT random primers according to the manufacturer's instructions. 18 cDNA was generated using primers (Thermo Scientific).

[0249] Droplet digital PCR (ddPCR). The ddPCR reaction mixture (25 μL) contained 1x ddPCR supermix (without dUTP) for the probe, 1x TaqMan probes (ThermoFisher) for Pmp22 and Rpl13a, and 0.5 ng of synthetic cDNA. For the mi871 ddPCR reaction (25 μL), 1x ddPCR supermix (without dUTP) for the probe, 0.25 ng of cDNA, 1.5 μM forward primer (IDT), 0.70 μM reverse primer (IDT), and 0.20 μM probe (Applied Biosystems) were used. The reaction mixture was dispensed into droplets using an AutoDG droplet generator (BioRad). Droplet amplification was performed according to the following PCR conditions: 40 cycles of 10 minutes at 95°C, 30 seconds at 94°C, and 1 minute at 60°C, followed by 10 minutes at 98°C, and holding at 12°C, maintaining a ramp rate of 2°C / second throughout all steps. The fluorescence intensity of all samples was measured using a QX200 droplet reader, and the concentration (copies / μL) of each target was determined using Qx Manager Software 2.0 Standard Edition with Poisson distribution analysis. Wells with fewer than 10,000 droplets were deemed unsuitable for further analysis and marked for remeasurement. The copies of mi871 and Pmp22 per μL were normalized to the copies of Rpl13a per μL and graphed using Prism 9 Software (Prism).

[0250] Dual luciferase assay. Dual luciferase plasmids were generated from the Psicheck2 vector (Promega). Briefly, DUX4.V5 or human full-length PMP22 cDNA was cloned into the XhoI and NotI sites located within the 3'UTR region of the Renilla luciferase gene prior to the synthetic poly(A) sequence. Each construct was then co-transfected with the corresponding set of test miRNAs as previously described. After 24–48 hours, the culture medium was removed from the cells, 30 μl of passive lysis buffer was added, and the cells were left on a 425 rpm plate shaker at room temperature for 20 minutes. The plates were then transferred to a GloMax Discover (Promega) plate reader, and Renilla and Firefly expression was quantified according to the Dual-Luciferase® Reporter Assay System Technical Manual (Promega). The Renilla:Firefly expression ratio was quantified and normalized to the control wells of the Dual-Luciferase plasmid and the empty U6T6 construct. Next, these ratios were graphed and represented using Prism 9 (Graphpad).

[0251] Example 2 Testing the expression and knockdown efficiency of pol II promoter-driven miRNAs. Pol II-driven miRNAs were efficiently expressed in vitro by droplet digital PCR (ddPCR) assays targeting mature miRNA sequences. Briefly, HEK-293 cells were transfected with plasmids expressing mi871 / mi405 structures 1-8 driven by the CMV promoter. Control conditions included HEK-293 cells undergoing simulated transfection, transfection with plasmids expressing mi871 / mi405 under the pol III U6 promoter system, and transfection with miGFP, a non-targeted miRNA driven by the pol III U6 promoter system. Each condition was performed in triplicate according to the above conditions. 48 hours after transfection, total RNA was isolated, samples were treated with rDNase, and cDNA was synthesized according to the protocol described above. Finally, mi871 / mi405 expression (in addition to expression of the normalized gene Rpl13a) was measured for each sample using ddPCR. The number of copies of mi871 / mi405 per 1 μL is normalized to the number of copies of Rpl13a per 1 μL, and then plotted using Prism 9 (Graphpad).

[0252] Knockdown of the gene target was measured using a dual luciferase assay in which either DUX4 or human PMP22 was cloned into the 3'UTR of the Renilla luciferase gene in a Psicheck2 vector. Briefly, each CMV-driven miRNA variant was co-transfected into HEK293 cells with a Psicheck2 vector containing the target sequence. After 24 hours, Renilla and Firefly luciferase expression was measured using a GloMax Discover luminescence plate reader (Promega), and the knockdown rate was calculated by normalizing the Renilla:Firefly expression ratios against a positive control and an empty U6T6 vector (Figures 31, 32). CMV.mi871-4 showed the best knockdown of the human PMP22 target at 83%, compared to 90% knockdown by the Pol III U6.mi871 system (Figure 31). CMV.mi405-4 showed a maximum knockdown of 64% of the DUX4 target, compared to 58% for U6.mi405 (Figure 32). Therefore, Pol II-driven miRNA systems exhibit target knockdown equivalent to their Pol III counterparts.

[0253] Example 3 Testing of miRNA expression and knockdown efficiency from tissue-specific promoters To measure the miRNA expression and knockdown efficiency of tissue-specific promoters in novel constructs, two different muscle-specific or Schwann cell-specific promoters were tested for their ability to drive the expression of either mi405 or mi871, respectively. Briefly, rat Schwann cells or C2C12 cells were transfected with plasmids expressing mi871 or mi405 structures 4 and 8, respectively, driven by hMPZ / rMPZ or CK6 / HSA promoters, respectively. Control conditions included HEK-293 cells undergoing simulated transfection, transfection with plasmids expressing mi871 / mi405 under the pol III U6 promoter system, and transfection with the untargeted miRNA miLacZ driven by the pol III U6 promoter system. Each condition was performed in triplicate according to the conditions described above. Forty-eight hours after transfection, total RNA was isolated, samples were treated with rDNase, and cDNA was synthesized according to the protocol disclosed herein.

[0254] Finally, the expression of mi871 / mi405, the target genes rPmp22 and DUX4, and the normalization gene Rpl13a was measured for each sample using ddPCR. The number of copies of mi871 / mi405 and the target genes rPmp22 / DUX4 per μL was normalized to the number of copies of Rpl13a per μL and plotted using Prism 9 (Graphpad). Human and rat MPZ promoters were able to drive mi871 expression in rat Schwann cell cultures, respectively (Figure 34). The pol II tissue-specific system showed rat Pmp22 knockdown (hMPZ.mi871-4: 49% knockdown, rMPZ.mi871-4: 51% knockdown) equivalent to the pol III system (U6.mi871: 66% knockdown) (Figure 34). Data on mi405 expression from CK6 and HSA promoters, as well as DUX4 knockdown, in C2C12 cells are currently being generated.

[0255] In rat Schwann cells, mi871 expression reduced relative luciferase expression when co-transfected with the Psicheck.Human-PMP22 construct. Briefly, human PMP22 was cloned into the 3' UTR of the Renilla luciferase gene in the Psicheck2 plasmid (Promega). The CMV promoter in the aforementioned mi871-4 and mi871-8 constructs was replaced with a human or rat MPZ promoter sequence whose 3' end was cloned into the AgeI region of each miRNA construct (Figure 33). The resulting constructs were co-transfected with Psicheck.Human-PMP22 into rat Schwann cells, in addition to testing them with CMV-driven precursors, U6.mi871, an empty U6T6 vector, and a control U6-driven miRNA. After 48 hours, Renilla and Firefly luciferase expression was measured using a GloMax Discover luminescence plate reader (Promega), and the knockdown rate was calculated by normalizing the Renilla:Firefly expression ratios relative to the positive control—empty U6T6 vector (Figure 34). hMPZ.mi871-4 showed an 85% knockdown efficiency compared to 93% for U6.mi871 (Figure 34). This demonstrated that a similar level of knockdown could be achieved while driving mi871 expression from a Schwann cell-specific promoter, compared to the Pol III system.

[0256] The foregoing explanation is given solely for clarity of understanding, and modifications within the scope of the invention may be obvious to those skilled in the art; therefore, no unnecessary limitations should be inferred therefrom.

[0257] Throughout this specification and the subsequent claims, unless otherwise required by context, the word “comprise” and variations such as “comprises” and “comprising” should be understood to mean including the integer or step or group of integers or steps described, but not to mean excluding any other integer or step or group of integers or steps.

[0258] Throughout this specification, where a composition is described as comprising components or materials, unless otherwise stated, the composition is intended to consist essentially of, or comprise, any combination of the listed components or materials. Similarly, where a method is described as comprising certain steps, unless otherwise stated, the method is also intended to consist essentially of, or comprise, any combination of the listed steps. The inventions disclosed herein by example can be suitably carried out without any elements or steps not specifically disclosed herein.

[0259] The methods disclosed herein, and their individual steps, can be carried out manually and / or with the assistance of electronic devices or automation provided thereby. Although the processes are described with reference to specific embodiments, those skilled in the art will readily understand that other methods can be used to perform the actions associated with the methods. For example, various orders of the steps can be changed without departing from the scope or spirit of the methods unless otherwise noted. In addition, some of the individual steps can be combined, omitted, or subdivided into further additional steps.

[0260] All patents, publications, and references cited herein are incorporated entirely by reference. In the event of any conflict between this disclosure and the incorporated patents, publications, and references, this disclosure shall prevail.

Claims

1. A nucleic acid encoding a microRNA (miRNA) expression cassette for converting an RNA polymerase III-based promoter system to an RNA polymerase II-based promoter system, wherein the cassette is A single-stranded stem of microRNA, The 5' double-stranded stem of microRNA, The sense strand of a mature microRNA, Modified microRNA loops containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The 3' double-stranded stem of microRNA, A single-stranded stem of microRNA, A nucleic acid containing a DNA nucleotide sequence that codes for a poly(A) signal.

2. The nucleic acid according to claim 1, wherein the cassette comprises a DNA nucleotide sequence encoding, in the expression cassette, in the order of 5' to 3', a single-stranded stem of the microRNA, a 5' double-stranded stem of the microRNA, a sense strand of the mature microRNA, a modified microRNA loop including nucleotide changes to facilitate folding, an antisense strand of the mature microRNA, a 3' double-stranded stem of the microRNA, a single-stranded stem of the microRNA, and the poly(A) signal.

3. The aforementioned cassette The single-chain stem of the MIR30, The MIR30 5' double-strand stem, The sense strand of the aforementioned mature microRNA, A modified mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of the aforementioned mature microRNA, The mir30 3' double-strand stem, The single-chain stem of the MIR30, The nucleic acid according to claim 1, comprising a DNA nucleotide sequence encoding the polyA signal.

4. The nucleic acid according to any one of claims 1 to 3, wherein the cassette comprises the DNA nucleotide sequence encoding, in the expression cassette, a single-stranded stem of the mir30, a 5' double-stranded stem of the mir30, a sense strand of the mature microRNA, a modified mir30 loop including nucleotide changes to facilitate folding, an antisense strand of the mature microRNA, a 3' double-stranded stem of the mir30, a single-stranded stem of the mir30, and the poly(A) signal, in the order of 5' to 3', respectively.

5. The nucleic acid according to claim 4, wherein the single-stranded stem of mir30 includes any one nucleotide sequence from sequence numbers 20 to 24, or a nucleotide sequence having at least or about 90% sequence identity with any one nucleotide sequence from sequence numbers 20 to 24.

6. The nucleic acid according to claim 4 or 5, wherein the 5' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO:

25.

7. The nucleic acid according to any one of claims 1 to 6, wherein the sense strand of the mature miRNA is the sense strand of any mature miRNA.

8. The nucleic acid according to any one of claims 1 to 7, wherein the sense strand of the mature miRNA includes the nucleotide sequence of SEQ ID NO: 17 or 18, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 17 or 18.

9. The nucleic acid according to any one of claims 4 to 8, wherein the modified mir30 loop comprises the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence having at least or about 90% identity with the nucleotide sequence of SEQ ID NO:

26.

10. The nucleic acid according to claim 1, wherein the antisense strand of the mature miRNA is the antisense strand of any mature miRNA.

11. The nucleic acid according to any one of claims 1 to 10, wherein the antisense strand of the mature miRNA comprises the nucleotide sequence of SEQ ID NO: 27 or 28, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO: 27 or 28.

12. The nucleic acid according to any one of claims 4 to 11, wherein the 3' double-stranded stem of mir30 includes the nucleotide sequence of SEQ ID NO: 29, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO:

29.

13. The nucleic acid according to any one of claims 4 to 12, wherein the mutated single-stranded stem of mir30 comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO:

30.

14. The nucleic acid according to any one of claims 1 to 13, wherein the polyadenylation (polyA) signal is a wild-type neuropilin-1 (WT NRP1) polyA signal.

15. The nucleic acid according to claim 12, wherein the WT NRP1 polyA signal comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least or about 90% sequence identity with the nucleotide sequence of SEQ ID NO:

32.

16. The cassette further includes a restriction region for cloning, and the cassette, The first restriction enzyme site, A single-stranded stem of microRNA or mir30, A 5' double-stranded stem of microRNA or mir30, The sense strand of a mature microRNA, A modified microRNA loop or mir30 loop containing nucleotide changes to facilitate folding, The antisense strand of a mature microRNA, The 3' double-stranded stem of microRNA or mir30, A single-stranded stem of microRNA or mir30, The second restriction enzyme site, Poly-A signal and, The nucleic acid according to claim 1 or 3, comprising a DNA nucleotide sequence encoding a third enzyme restriction site.

17. The nucleic acid according to claim 16, wherein the first restriction enzyme site is an AgeI site.

18. The nucleic acid according to claim 17, wherein the AgeI site includes the nucleotide sequence of sequence number 19.

19. The nucleic acid according to claim 16, wherein the second restriction enzyme site is the AflII site.

20. The nucleic acid according to claim 19, wherein the AflII site includes the nucleotide sequence of SEQ ID NO:

31.

21. The nucleic acid according to claim 16, wherein the third restricting site is the EcoR1 site.

22. The nucleic acid according to claim 21, wherein the EcoR1 site includes the nucleotide sequence of sequence number 33.

23. The nucleic acid according to claim 16, wherein the third restricting site is an MfeI site.

24. The nucleic acid according to claim 23, wherein the MfeI site includes the nucleotide sequence of sequence number 34.

25. The nucleotide sequence that encodes the sequence of sequence number 35 ( 【Chemistry 1】 ), or a nucleotide sequence having at least or about 80% sequence identity with the nucleotide sequence encoding the nucleotide sequence of Sequence ID No. 35, In the array, the 6th position N １ However, it is either U or omitted, 7th place N ２ However, it is C, A, or U, 8th place N ３ However, it is either C or omitted, N in 9th place ４ However, it is either C or omitted, N in 10th place ５ However, it is either C or omitted, 11th place N ６ However, it is either A or omitted, 12th place N ７ However, it is A or U, 16th place N ８ However, it is C or G, 17-bit N ９ is C, A, or U, 18th place N １０ However, it is U or G, 19th place N １１ However, it is U or G, 31st place N １２ However, it is U or G, N, ranked 104th １３ However, it is C or U, N, ranked 105th １４ However, it is C or U, N, ranked 109th １５ However, it is either C or omitted, N ranked 110th １６ However, it is either U or omitted, N ranked 111th １７ However, it is either U or omitted, N, ranked 112th １８ However, it is either A or omitted, N, ranked 113th １９ However, it is either A or omitted, N, ranked 114th ２０ However, it is either G or omitted, N ranked 130th ２１ However, it is C or G, N, ranked 131st ２２ However, it is C or U, N, ranked 132nd ２３ However, it is C or G, N, ranked 133rd ２４ However, it is C or A, N, ranked 135th ２５ However, it is C or A, N, ranked 136th ２６ However, it is C or G, N, ranked 141st ２７ However, it is C or G, The nucleic acid according to any one of claims 1 to 24, wherein a first or most 5' underlined series of N nucleotides represents a mature miRNA sense sequence, and a second or most 3' underlined series of N nucleotides represents a mature miRNA antisense sequence, and optionally the sense sequence is positioned more 3' and the antisense sequence is positioned more 5'.

26. The nucleic acid according to any one of claims 1 to 25, comprising a nucleotide sequence encoding an RNA sequence having at least or about 80% sequence identity with any one nucleotide sequence from sequence numbers 1 to 16 or 35 to 53, or a nucleotide sequence encoding an RNA sequence containing any one nucleotide sequence from sequence numbers 1 to 16 or 35 to 53.

27. The nucleic acid according to any one of claims 1 to 26, further comprising a promoter and / or enhancer.

28. The nucleic acid according to claim 27, wherein the promoter is any polymerase type II (pol II) promoter.

29. The promoter and / or enhancer is a U7 promoter and / or enhancer, an RSV promoter and / or enhancer, a human skeletal α-actin (HSA) promoter and / or enhancer, a desmin promoter and / or enhancer, a CMV promoter and / or enhancer, a minimal CMV promoter and / or enhancer, a T7 promoter and / or enhancer, an EF1-alpha promoter and / or enhancer, a minimal EF1-alpha promoter and / or enhancer, an unc45b promoter and / or enhancer, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter. The nucleic acid according to claim 27 or 28, wherein the promoter is any one of the following: tMCK promoter and / or enhancer, dMCK promoter and / or enhancer, CK1 promoter and / or enhancer, CK6 promoter and / or enhancer, CK7 promoter and / or enhancer, CK8 promoter and / or enhancer, CK8e promoter and / or enhancer, synthetic promoter and / or enhancer, ubiquitous promoter and / or enhancer, neuron-specific promoter and / or enhancer, brain-specific promoter and / or enhancer, or any other muscle-specific promoter and / or enhancer.

30. The nucleic acid according to any one of claims 27 to 29, wherein the promoter and / or enhancer is a CMV promoter and / or enhancer, an HSA promoter and / or enhancer, an MPZ promoter and / or enhancer, or an MCK promoter and / or enhancer.

31. The nucleic acid according to any one of claims 27 to 29, wherein the synthetic promoter and / or enhancer is an SPc5-12 promoter and / or enhancer, an SP-301 promoter and / or enhancer, an MH promoter and / or enhancer, or a Sk-CRM4 / DES promoter and / or enhancer.

32. The nucleic acid according to any one of claims 27 to 29, wherein the neuron-specific promoter and / or enhancer is a synapsin promoter and / or enhancer.

33. A vector comprising the nucleic acid according to any one of claims 1 to 32.

34. The vector according to claim 33, wherein the vector is an adeno-associated virus (AAV) vector.

35. The vector according to claim 34, wherein the AAV lacks the rep and / or cap genes.

36. The vector according to claim 34 or 35, wherein the vector is a recombinant AAV (rAAV) vector.

37. The vector according to any one of claims 34 to 36, wherein the vector is a self-complementary recombinant AAV (scAAV) vector or a single-stranded recombinant AAV (ssAAV) vector.

38. The AAV serotypes are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV. rh74, AAV. rh8, AAV. rh10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-anc80, AAV-B1, AAV-BR1, AAV. PHP. The vector according to any one of claims 34 to 37, which is EB, AAVv66, AAV2 / 1, AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101, or any derivative thereof.

39. The vector according to any one of claims 34 to 38, wherein the serotype of the AAV is AAV9, mAAV9, or AAV-SLB101.

40. Nanoparticles, extracellular vesicles, or exosomes comprising the nucleic acid according to any one of claims 32.

41. A composition, (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, or (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, A composition comprising a pharmaceutically acceptable carrier.

42. A method for reducing, inhibiting, and / or interfering with gene expression in cells, wherein the cells (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) A method comprising contacting the composition according to claim 41.

43. The method according to claim 42, wherein the gene is any gene whose expression within a cell is associated with a pathological disease or condition.

44. The method according to claim 42 or 43, wherein the gene is PMP22 or DUX4.

45. A method for treating or improving a subject who has or is at risk of developing a disease associated with DUX4 expression or PMP22 expression, wherein the subject is given an effective amount (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) A method comprising administering the composition according to claim 41.

46. The method according to claim 45, wherein the disease associated with DUX4 expression is facioscapulohumeral muscular dystrophy (FSHD) or cancer.

47. The method according to claim 45, wherein the disease associated with PMP22 expression is Charcot-Marie-Tooth disease type 1A (CMT1A).

48. For the preparation of pharmaceuticals to reduce or inhibit the expression of DUX4 or PMP22 in cells, (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) The composition according to claim 41, Use.

49. For the treatment or improvement of facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A), (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) The composition according to claim 41, Use.

50. For the preparation of pharmaceuticals for the treatment or improvement of facioscapulohumeral muscular dystrophy (FSHD), cancer, or Charcot-Marie-Tooth disease type 1A (CMT1A), (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) The composition according to claim 41, Use.

51. For reducing, inhibiting, and / or interfering with gene expression in cells, (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, and / or (d) The composition according to claim 41, Use.

52. The use according to claim 51, wherein the gene is any gene whose expression within a cell is associated with a pathological disease or condition.

53. The use according to claim 51 or 52, wherein the gene is PMP22 or DUX4.

54. The use according to any one of claims 51 to 53, wherein the aforementioned cells are present in the subject.

55. The use according to claim 54, wherein the subject is a human subject.

56. The nucleic acids, vectors, nanoparticles, extracellular vesicles, exosomes, compositions, or pharmaceuticals are formulated for oral administration, subcutaneous administration or infusion, intradermal administration or infusion, intracerebral delivery or infusion, intracerebral delivery or infusion, intrathecal delivery or infusion, transdermal delivery or infusion, infusion into the bloodstream, or aerosol administration. (a) The nucleic acid according to any one of claims 1 to 32, (b) The vector according to any one of claims 33 to 39, (c) Nanoparticles, extracellular vesicles, or exosomes according to claim 40, (d) The composition according to claim 41, (e) The method according to any one of claims 42 to 47, or (f) Use of any one of claims 48 to 55.

Images