Method for producing infertile and unisexual progeny

Abstract

This disclosure provides a fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells, wherein the chimeric gonad comprises at least one transplanted germ cell present in the germline and having a mutation that interferes with the development and / or function of somite gonadal cells, and which can be used as a breeding parent. This disclosure also provides a method for producing breeding parent fish, crustaceans, or mollusks for use in producing sterile or sex-determined sterile fish, crustaceans, or mollusks and their breeding parents.

Description

[Technical Field]

[0001] Description of government rights The aspects of the work described herein were supported by USDA-U.S. Food and Agriculture Research Institute grants 2019-67030-29002 and 2018-33522-28745. The U.S. Government may have certain rights in these inventions.

[0002] This disclosure, as a whole, relates to methods for determining sterility and sex of freshwater and marine organisms. [Background technology]

[0003] The following paragraphs do not constitute an admission that everything discussed herein is prior art or part of the knowledge of a person skilled in the art.

[0004] Genetically modified (GE) fish species are being used to produce valuable drug proteins or to incorporate advantageous traits into aquatic ecosystems. To address future demand for seafood and the need to improve sustainability in the aquatic ecosystem industry, various fish are being developed with enhanced growth rates, higher food conversion ratios, improved disease resistance, and enhanced nutritional benefits. However, the global adoption of these GE fish is hindered by concerns about their accidental release into natural ecosystems. Farmed fish have been shown to reproduce and survive in natural environments, creating wild populations. Similarly, GE fish may have natural relatives, potentially leading to the spread of genetic modification throughout wild populations and alteration of the natural gene pool. Therefore, commercial GE fish pose a potential environmental threat and present challenges to policymakers and regulatory authorities conducting risk-benefit assessments.

[0005] One approach to address one or more of the aforementioned challenges is to sterilize fish. Introducing triploidy is the most widely used and studied approach to produce sterile fish. Generally, triploid fish are created by applying temperature or pressure shock to fertilized eggs to force the introduction of a second polar body, creating cells with three sets of chromosomes (3N). Because the extra chromosome set interferes with meiosis, triploid fish do not develop normal gonads. On an industrial scale, the logistics of reliably applying pressure or temperature shock to batches of eggs are complex and costly. An alternative to physically induced triploidy is genetically induced triploidy, which is achieved by crossbreeding tetraploids with diploid fish. However, tetraploid fish are difficult to produce due to poor embryonic survival and slow growth. In some cases, triploid males can fertilize eggs, albeit with reduced efficiency, because they produce some normal haploid spermatids. Furthermore, in some species, negative performance characteristics, including reduced growth and decreased sensitivity to disease, are associated with the triploid phenotype.

[0006] Another approach to sterilizing fish involves hormonal treatment over several weeks. However, in many cases, including these comprehensive, long-term treatment processes, the desired sterilization efficiency is not achieved and / or is associated with reduced fish growth performance. Furthermore, treatments involving synthetic steroids may result in higher mortality rates.

[0007] Another approach to sterilizing fish involves using transgenic-based techniques, which include the step of incorporating transgenes that induce germ cell death or disrupt their migration patterns, resulting in their disappearance during embryonic development. However, transgenes are subject to locational influence and silencing. Consequently, such approaches undergo a long regulatory monitoring process before they can be deemed acceptable for commercial use.

[0008] Improvements are desired in the production of infertile, sex-determined fish, crustaceans, or mollusks. [Overview of the project]

[0009] introduction The following introduction is intended to introduce this specification to the reader and does not define any invention. One or more inventions may be found in the components of the apparatus or combinations or subcombinations of method steps described later, or elsewhere in this document. The inventors do not abandon or deny any one or more inventions disclosed herein solely because one or more such inventions are not described in the claims.

[0010] One or more previously proposed methods used to sterilize freshwater and marine organisms may result in: (1) insufficient efficiency; (2) increased difficulty in transmitting the sterile trait by, for example, performing genetic selection to identify subpopulations of sterile individuals and / or by repeating treatment in each generation; (3) increased operational costs, for example, by introducing significant changes in livestock practices, inability to move across multiple species, increased production time, increased percentage of sterile organisms with reduced growth and increased susceptibility to disease, increased mortality of sterile organisms, or a combination thereof; (4) gene flow into wild populations and colonization of new environments by farmed non-natural species; or (4) any combination thereof.

[0011] This disclosure provides a method for producing sex-determined sterile freshwater and marine organisms by utilizing germline and somite characteristics of nucleic acid molecules, such as genes, to produce sterile progeny. One or more examples of this disclosure may, compared with one or more previously presented methods used to sterilize freshwater and marine organisms, (1) increase sterilization efficiency by enabling mass production of sterile individuals and ensuring that all individuals are completely sterile; (2) reduce operational costs by reducing the amount of high-cost equipment or treatment, making it commercially scalable, making it transmissible across multiple species, reducing feeding, reducing production time, reducing the percentage of organisms by achieving sexual maturity, increasing the physical size of sexually mature organisms, or a combination thereof; (3) reduce gene flow to wild populations and the formation of new environmental colonies by farmed non-natural species; (4) increase farming performance by reducing energy loss for gonadal development; or (5) take any combination thereof.

[0012] This disclosure also discusses methods for producing breeding stock freshwater and marine organisms for use in the production of sterile or sex-determined sterile freshwater and marine organisms, as well as the breeding stock itself.

[0013] This disclosure provides a fish, crustacean, or mollusk that lacks endogenous germ cells and has a gonad that produces gametes with mutations that cause progeny infertility. This disclosure also provides a method for producing the above-mentioned fish, crustacean, or mollusk that lacks endogenous germ cells, and a method for breeding the above-mentioned fish, crustacean, or mollusk that lacks endogenous germ cells to produce sterile progeny or sterile progeny with determined sex. This disclosure also provides a method for producing a gonad that produces gametes with mutations that cause progeny infertility, and the gonad itself.

[0014] This disclosure also provides a fish, crustacean, or mollusk having a chimeric gonad, but lacking endogenous germ cells, wherein the chimeric gonad comprises at least one transplanted germ cell present in the germ cell line and having a mutation that interferes with the development and / or function of somite gonadal cells. This disclosure also provides a method for producing a gonad comprising at least one transplanted germ cell present in the germ cell line and having a mutation that interferes with the development and / or function of somite gonadal cells, as well as the gonad itself.

[0015] The disclosure also provides a method for producing a fish, crustacean, or mollusk that lacks endogenous germ cells, comprising the steps of: transplanting at least one transplanted germ cell having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells into a fish, crustacean, or mollusk that lacks endogenous germ cells; and creating a chimeric gonad.

[0016] This disclosure further provides a method for producing sterile fish, crustaceans, or mollusks, comprising the step of breeding (i) a female fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein with (ii) a male fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein, to produce sterile fish, crustaceans, or mollusks.

[0017] Other aspects and features of this disclosure will become apparent to those skilled in the art by examining the following specific examples in conjunction with the attached drawings.

[0018] Here, examples of the methods and living organisms disclosed herein will be described, merely as examples, with reference to the accompanying drawings. [Brief explanation of the drawing]

[0019] [Figure 1] A and B are flowcharts illustrating examples of methods disclosed herein for producing fish, crustaceans, or mollusks having chimeric gonads and lacking endogenous germ cells, and for transmitting mutant strains. [Figure 2]A - C are another flowchart showing examples of methods for generating fish, crustaceans, or mollusks having chimeric gonads and no endogenous germ cells, and methods for transmitting mutant strains, as disclosed herein. [Figure 3] A - C are another flowchart showing examples of methods for generating fish, crustaceans, or mollusks having chimeric gonads and no endogenous germ cells, and methods for transmitting mutant strains, as disclosed herein. [Figure 4] It is an illustration showing an example of the germ cell transplantation method disclosed herein for producing functional sperm having miR202 - deficient gene (mir - 202 - / -). During the generation of oogonia and spermatogonia in miR202 null fish progeny obtained from heterozygous miR202 mutant parents, no deficiency was found. At maturity, miR202 mutant males and females are infertile. miR202 is expressed in somatic cells around germ cells (Sertoli and Leydig cells), where it发挥 its activity. The lack of miR202 protein causes a defective microenvironment where gamete maturation is impaired. To restore gametogenesis, germ cell line stem cells can be isolated from juvenile miR202 mutants and transplanted into recipient embryos that have depleted their own PGCs but have a functional miR202 gene. The transplanted miR202 - / - germ cell line stem cells colonize the recipient gonads. And since miR202 is not required for the continuation of development, the recipient somatic cells can grow the transplanted germ cells, restore gametogenesis, and produce functional sperm and eggs that all have the mutant miR202 gene. [Figure 5A-C] A - D are photographs of miR-202 - / - females and graphs showing phenotypic characterization. Figure 5A shows typical photographs of ovaries in the abdominal cavity of 7 - month - old, homozygous miR202 mutant (upper) and WT control (lower) tilapia. 5B shows urogenital papillae from miR202 - / - and WT control females. 5C shows high - magnification optical microscope images of dissected ovaries. [Figure 5D] 5D shows a graphical representation of the average gonadosomatic index (GSI) from miR202 mutant females and WT controls. [Figure 6A-B] Figures A-E are photographs and graphs illustrating the involvement of maternal miR202 in PGC formation in Nile tilapia. Figures 6B, 6D, and 6E show the mean number of PGCs in 4-day-old embryos (12 or more embryos) from mutant females with mosaic (Figure 6B), heterozygous (Figure 6D), and homozygous miR202 mutations in germ cells. There is a significant difference (p≦0.01) compared to embryo progeny from wild-type control females. The vertical bars indicate the standard deviation. The upper figures in Figures 6A and 6C represent 4dpf tilapia embryo progeny from the female transgenic strain Tg (Zpc5:EGFP:nos 3'UTR) mated with a miR202 mutant male showing a normal number of PGCs. GFP(+) germ cells (mean n=40) cluster longitudinally, mainly in the anterior part of the digestive tract. The lower diagrams in Figures 6A and 6C show the torso region of progeny derived from a Tg(Zpc5:EGFP:nos3 3'UTR) female strain with a mosaic miR202 gene mutation or heterozygous miR202, exhibiting a decrease in PGC numbers at 4dpf. Bright dots represent GFP(+) cells (green). White stars indicate mislocalized PGCs. [Figure 6C-E]A to E are photographs and graphs showing the involvement of maternal miR202 in PGC formation in Nile tilapia. Figures 6B, 6D, and 6E show the average number of PGCs in 4-day-old embryos (more than 12 embryos) derived from mutant females with mosaic (Figure 6B), heterozygous (Figure 6D), and homozygous miR202 mutations in germ cells. There is a significant difference (p≤0.01) compared to embryo progeny derived from wild-type control females. Vertical bars indicate standard deviation. The upper figures in Figures 6A and 6C represent 4dpf tilapia embryo progeny of the female transgenic strain Tg(Zpc5:EGFP:nos 3’UTR) mated with miR202 mutant males, showing normal PGC numbers. GFP(+) germ cells (average n = 40) cluster longitudinally around the anterior part of the digestive tract. The lower figures in Figures 6A and 6C represent the trunk region of progeny derived from the Tg(Zpc5:EGFP:nos3 3’UTR) female strain with mosaic miR202 gene mutations or heterozygous miR202, showing a decrease in PGC numbers at 4dpf. Bright dots represent GFP(+) cells (green). White star marks indicate mislocalized PGCs. [Figure 7] A and B are diagrams of selected mutations at the miR202 locus. Figure 7A shows the secondary structure of tilapia (Oreochromis niloticus) pre-miR202 projected from the forna (force-directed RNA) RNA visualization tool (Kerpedjiev, Hammer et al. 2015). Figure 7B shows the position of the miR202 locus on Nile tilapia chromosome LG13. Figure 7B also shows the nucleotide sequence alignment of selected mutants with wild-type and a deletion shown by a dashed line covering the miR-202-5p region. The miR-202-5p sequence is shown in red ink, and the miR-202-3p sequence is shown in green ink. The seed sequence of miR-202-5p is shown in a dashed yellow box. [Figure 8]Figures A-C are photographs showing exemplary histology of miR202- / - and WT control ovarian tissue from a 7-month-old female. Figures 8A and B are exemplary histology showing stage I oocytes. Scale: 100 micrometers. Figure 8C shows a histological section of a control ovary from a 7-month-old WT female. [Figure 9] Figures A-C show photographs of miR202- / - males and graphs illustrating phenotypic characteristics. Figure 9A is a typical photograph of dissected testes from homozygous miR202 mutants (miR202- / -) and wild-caught tilapia at 7 months of age. Figure 9B is a graph showing the average gonadal index for miR202- / - and wild-caught sibling ostelapia at intervals of several months. Figure 9C is a graph showing the average sperm count from wild-caught and miR202- / - at 7 months of age. The vertical bars represent the standard deviation. [Figure 10] Figures A-D are photographs showing histological analysis of testes from miR202 mutants (Figures 10C and D) and WT controls (Figures 10A and B) at 8 months of age. Figures 10A-C show the testicular structure of the entire testis, revealing the severe depletion of testicular germ cells in miR202- / -. Figure 10B is a magnified view of the germ compartment formed by Sertoli cells surrounding germ cells at various developmental stages: SC: spermatocyte; ST: spermatocyte; and SZ: sperm in the lobular lumen; the germ compartment is surrounded by steroid-producing Leyderich cells (colored in lighter pink). D) miR202- / - cavity showing a magnified wall of Leyderich cells, but without visible germ cells. [Figure 11]These are photographs showing histological sections of gonads derived from Elavl2Δ8 / Δ8 recipients, as well as from miR202 mutant germ cell transplants (GCT) and non-transplanted Elavl2Δ8 / Δ8 controls. Ovaries and testes of recipient fish were collected 113 days after transplantation and fixed for further histological analysis. Germ cells are absent in the testes and ovaries of the non-transplanted control. Normal spermatogenesis and oogenesis were observed in germ cell transplant (GCT) recipients, representing the successful colonization, proliferation, and differentiation ability of miR202-deficient spermatogonial and oogonia. Therefore, given a suitable testicular or ovarian microenvironment, donor-derived germ cells can undergo functional gamete formation. [Figure 12] A-F are photographs representing the typical morphology and histology of elavl2- / - tilapia males transplanted with miR202- / - germ cells (upper panel) or non-transplanted elavl2- / - controls (lower panel). In contrast to the translucent testes of the non-transplanted male (Figure 12B) (Elavl2- / -), morphologically normal testes were found in the abdominal cavity of the recipient tilapia male (Figure 12A). Figures 12C and 12D are magnified views of the boxes in Figures 12A and 12B under a bright-field stereomicroscope, showing the transparent and translucent testes, respectively. Figures 12E and 12F show hematoxylin-eosin stained histological sections of the testes, indicating that donor-derived miR202- / - germ cells colonized, proliferated, and differentiated in the recipient elavl2- / - tilapia. Figure 12F shows that the testes of the non-transplanted recipient are germ cell-free. [Figure 13] This photograph shows the typical morphological appearance of ovaries derived from elavl2- / - female tilapia, transplanted with miR202- / - germ cells (upper panel) or non-transplanted elavl2- / - control (lower panel) at 8 months of age. Eight months after transplantation, morphologically normal ovaries were found in the abdominal cavity of the recipient female tilapia. Non-transplanted elavl2- / - ovaries at 7 months of age show spring-like germ cell-free ovaries. [Figure 14]The diagrams and graphs show the mating of miR202- / --GCT females (chimeric - gray) with either WT females (blue) or miR202- / --GCT males (Figures 14A and 14B, top). The graphs below Figures 14A and 14B, next to the variant region analysis, show the genotype of the progeny determined by a fin DNA PCR fragment size assay using PCR primers. Capillary electrophoresis was used to measure and detect the size of the amplified products. Fragment PCR tracking revealed 174bp and 182bp miR202 amplicons in all progeny derived from miR202- / --GCT parents (Figure 14B, bottom), as well as in all progeny derived from GCT females (Figure 14A, top) and WT males mated with a single 174bp amplicon. This clearly demonstrates that colony formation in the recipient gonads was successful through the production of 100% donor germ cells and miR202Δ8 / Δ8 progeny. [Figure 15-1] A and B are photographs showing the abdominal cavity of male and female progeny derived from SSC miR202-GCT female × miR202-GCT female at different time intervals. [Figure 15-2] A and B are photographs showing the abdominal cavity of male and female progeny derived from SSC miR202-GCT female × miR202-GCT female at different time intervals. [Figure 16A]Figures A-C show the genomic regions containing the Elavl2 and Hermes genes, as well as the selected mutations. Hermes (Rbmps) is located very close to Elavl2 (200kb, approximately 0.2 centimorgans) (Figure 16A). Functional mutation loss was created in both genes (Figure 16B). Figure 16B is a schematic diagram of the tilapia Elavl2 gene, and Figure 16C is a schematic diagram of the Hermes gene. Exons (E) are shown as shaded boxes. Arrows indicate the target locus. Figures 16B and 16C show the sequences of the selected germline mutant alleles: for Elavl2 (SEQ ID NOs. 5 and 6), there are 8 nucleotide deletions, and for Hermes (SEQ ID NOs. 7 and 8), there are 16 nucleotide insertions. The wild-type reference sequences of Elavl2 (SEQ ID NOs. 1 and 2) and Hermes (SEQ ID NOs. 3 and 4) are shown. Both mutant alleles produce cleaved proteins that terminate at amino acids 40 and 61, respectively, instead of positions 372 and 174. Figures B and 16C show the predicted protein sequences of the wild-type (WT) and cleaved mutant proteins, with the first 12 and 52 amino acids being the same as those of the wild-type Elavl2 and Hermes proteins, respectively, and the following 28 and 9 amino acids being miscoded. Modified amino acids are highlighted. [Figure 16B]Figures A-C show the genomic regions containing the Elavl2 and Hermes genes, as well as the selected mutations. Hermes (Rbmps) is located very close to Elavl2 (200kb, approximately 0.2 centimorgans) (Figure 16A). Functional mutation loss was created in both genes (Figure 16B). Figure 16B is a schematic diagram of the tilapia Elavl2 gene, and Figure 16C is a schematic diagram of the Hermes gene. Exons (E) are shown as shaded boxes. Arrows indicate the target locus. Figures 16B and 16C show the sequences of the selected germline mutant alleles: for Elavl2 (SEQ ID NOs. 5 and 6), there are 8 nucleotide deletions, and for Hermes (SEQ ID NOs. 7 and 8), there are 16 nucleotide insertions. The wild-type reference sequences of Elavl2 (SEQ ID NOs. 1 and 2) and Hermes (SEQ ID NOs. 3 and 4) are shown. Both mutant alleles produce cleaved proteins that terminate at amino acids 40 and 61, respectively, instead of positions 372 and 174. Figures B and 16C show the predicted protein sequences of the wild-type (WT) and cleaved mutant proteins, with the first 12 and 52 amino acids being the same as those of the wild-type Elavl2 and Hermes proteins, respectively, and the following 28 and 9 amino acids being miscoded. Modified amino acids are highlighted. [Figure 16C]Figures A-C show the genomic regions containing the Elavl2 and Hermes genes, as well as the selected mutations. Hermes (Rbmps) is located very close to Elavl2 (200kb, approximately 0.2 centimorgans) (Figure 16A). Functional mutation loss was created in both genes (Figure 16B). Figure 16B is a schematic diagram of the tilapia Elavl2 gene, and Figure 16C is a schematic diagram of the Hermes gene. Exons (E) are shown as shaded boxes. Arrows indicate the target locus. Figures 16B and 16C show the sequences of the selected germline mutant alleles: for Elavl2 (SEQ ID NOs. 5 and 6), there are 8 nucleotide deletions, and for Hermes (SEQ ID NOs. 7 and 8), there are 16 nucleotide insertions. The wild-type reference sequences of Elavl2 (SEQ ID NOs. 1 and 2) and Hermes (SEQ ID NOs. 3 and 4) are shown. Both mutant alleles produce cleaved proteins that terminate at amino acids 40 and 61, respectively, instead of positions 372 and 174. Figures B and 16C show the predicted protein sequences of the wild-type (WT) and cleaved mutant proteins, with the first 12 and 52 amino acids being the same as those of the wild-type Elavl2 and Hermes proteins, respectively, and the following 28 and 9 amino acids being miscoded. Modified amino acids are highlighted. [Figure 17]Figures A-D are diagrams, graphs, and photographs showing the phenotypic characteristics of the progeny of the double heterozygous mutants HermesIns16 / + and Elavl2Δ8 / +. Figure 17A shows the predicted Mendelian distribution of genotypes derived from fully coupled genes (Elavl2 and Hermes), where h represents a lethal receptor Hermes mutation. Figure 17B graphically shows the percentage of embryonic development (%) (blue bars represent the mean, vertical bars represent the standard deviation) and the percentage of deformed embryos (%) (approximately 20%, yellow bars) 0-3 days after fertilization. Figure 17C is a photograph showing 9dpf hatched larvae of HermesIns16 / Ins16 escape (EEhh) and WT control (right image) exhibiting cephalic, facial, and body axis deformities. Figure 17D shows qPCR melting curve plots of Elavl2 amplicons from N=64 surviving progeny, enabling visualization of heterozygous (Ee) and homozygous (ee) Elavl2 mutants. At 1.5 months of age, no surviving HermesIns16 / ns16(hh) mutants were found in the progeny of double heterozygous parents, confirming that Hermes KO mutants are incapable of survival. [Figure 18] These are photographs showing the progeny of hatched larvae with normal pigmentation or melanin deficiency characteristic of the homozygous tyr- / - albino mutation. Offspring of surrogate parents, transplanted with donor germ cells derived from the Tyr- / - mutant and colored with normal pigmentation, consistently exhibit albino pigmentation. Stereoscopic microscopy analysis of offspring pigmentation in 3dpf embryos (right figure) obtained from mating GCT parents (Tyr+ / +) that received germ cells from a Tyr- / - donor shows that all exhibit the albino phenotype. In contrast, crossing a surrogate female with a WT male (Tyr+ / +) produces embryos with normal pigmentation (left figure). [Figure 19A]Image A is a photograph showing a dissected ovary from a 9-month-old sibling mestilapia, distinguishing between heterozygous individuals for the miR202 gene (capable of pregnancy, with mature ovaries) and homozygous mutants (infertile, with ovaries arrested at the pre-vitelline stage). Image B is a box plot detailing the total body weight of two sibling groups (N=45 / group): fertile (miR202+ / -) and infertile (miR202- / -) females. In one analysis, the mean weight gain in the infertile group was significantly higher (17%) compared to the fertile group, with statistical significance (t-test, p<0.01). [Figure 19B] Image A is a photograph showing a dissected ovary from a 9-month-old sibling mestilapia, distinguishing between heterozygous individuals for the miR202 gene (capable of pregnancy, with mature ovaries) and homozygous mutants (infertile, with ovaries arrested at the pre-vitelline stage). Image B is a box plot detailing the total body weight of two sibling groups (N=45 / group): fertile (miR202+ / -) and infertile (miR202- / -) females. In one analysis, the mean weight gain in the infertile group was significantly higher (17%) compared to the fertile group, with statistical significance (t-test, p<0.01). [Modes for carrying out the invention]

[0020] Overall, the disclosure provides a fish, crustacean, or mollusk having a chimeric gonad, lacking endogenous germ cells, the chimeric gonad comprising at least one transplanted germ cell having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells.

[0021] The disclosure also provides a method for producing a fish, crustacean, or mollusk that lacks endogenous germ cells, comprising the steps of: transplanting at least one transplanted germ cell having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells into a fish, crustacean, or mollusk that lacks endogenous germ cells; and creating a chimeric gonad. The disclosure also provides a method for producing a sterile, sex-determined fish, crustacean, or mollusk. The method comprises the steps of (i) mating a fertile female fish, crustacean, or mollusk having a homozygous mutation with (ii) a fertile male fish, crustacean, or mollusk having a homozygous mutation to produce a sterile, sex-determined fish, crustacean, or mollusk. The mutation directly or indirectly interferes with spermatogenesis and / or directly interferes with yolk formation. The fertility of fertile female fish, crustaceans, or mollusks, and fertile male fish, crustaceans, or mollusks, has been rescued.

[0022] The Disclosure also provides a method for producing sterile fish, crustaceans, or mollusks, comprising the step of breeding (i) a female fish, crustacean, or mollusk that does not have endogenous germ cells as disclosed herein with (ii) a male fish, crustacean, or mollusk that does not have endogenous germ cells as disclosed herein, to produce sterile fish, crustaceans, or mollusks.

[0023] The Disclosure also provides a method for producing sterile fish, crustaceans, or mollusks, comprising the step of (i) breeding a female fish, crustacean, or mollusk without endogenous germ cells, produced by the method disclosed herein, with a male fish, crustacean, or mollusk without endogenous germ cells, produced by the method disclosed herein, to produce sterile fish, crustaceans, or mollusks.

[0024] The disclosure also provides fish, crustaceans, or mollusks that have chimeric gonads but lack endogenous germ cells, the chimeric gonads comprising at least one transplanted, a) oogonial stem cell (OSC) from an isomorphic female donor, such as XX, having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells, or b) spermatogonial stem cell (SCC) from an isomorphic male donor, such as ZZ, having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells.

[0025] The disclosure also provides a method for generating fish, crustaceans, or mollusks that lack endogenous germ cells, comprising the step of transplanting at least one isomorphic female donor oogonal stem cell (OSC), such as XX, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, or b) isomorphic male donor spermatogonial stem cell (SCC), such as ZZ, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, into a fish, crustacean, or mollusks that lack endogenous germ cells to create a chimeric gonad.

[0026] The disclosure also provides fish, crustaceans, or mollusks that have chimeric gonads but lack endogenous germ cells, the chimeric gonads comprising at least one transplanted, a) oogonial stem cell (OSC) from an isomorphic super-female donor, such as WW, having mutations present in the germline that interfere with the development and / or function of somite gonadal cells, or b) spermatogonial stem cell (SCC) from an isomorphic male donor, such as YY, having mutations present in the germline that interfere with the development and / or function of somite gonadal cells.

[0027] The disclosure also provides a method for generating fish, crustaceans, or mollusks that lack endogenous germ cells, comprising the step of transplanting at least one oogonal stem cell (OSC) derived from an isomorphic super-female donor, such as WW, having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells, or b) spermatogonial stem cell (SCC) derived from an isomorphic super-male donor, such as YY, having a mutation present in the germline that interferes with the development and / or function of somite gonadal cells, into a fish, crustacean, or mollusks that lack endogenous germ cells to create a chimeric gonad.

[0028] Optionally, super-females such as WW are produced by: transplanting at least one oogonal stem cell (OSC) derived from atypical female donors such as WZ, which are present in the germline and have mutations that interfere with the development and / or function of somite gonadal cells, into male and female fish, crustaceans, or mollusks that lack endogenous germ cells to create a chimeric gonad; breeding male fish, crustaceans, or mollusks that have a chimeric gonad and lack endogenous germ cells with female fish, crustaceans, or mollusks that have a chimeric gonad and lack endogenous germ cells; and selecting isotypic progeny by genotype selection.

[0029] Optionally, supermales, such as YY, are produced by: transplanting at least one spermatogonial stem cell (SCC) derived from atypical male donors, such as XY, which have mutations present in the germline that interfere with the development and / or function of somite gonadal cells, into male and female fish, crustaceans, or mollusks that lack endogenous germ cells to create a chimeric gonad; breeding male fish, crustaceans, or mollusks that lack endogenous germ cells and possess a chimeric gonad with female fish, crustaceans, or mollusks that lack endogenous germ cells and possess a chimeric gonad; and selecting isotypic progeny by genotype selection.

[0030] The Disclosure also provides a method for producing a sterile, sex-determined fish, crustacean, or mollusk, comprising the step of breeding (i) a female fish, crustacean, or mollusk that does not have endogenous germ cells as disclosed herein with (ii) a male fish, crustacean, or mollusk that does not have endogenous germ cells as disclosed herein, derived from the same sex determination system as the female in (i), to produce a sterile, sex-determined fish, crustacean, or mollusk.

[0031] The Disclosure also provides a method for producing a sterile, sex-determined fish, crustacean, or mollusk, comprising the step of (i) breeding a female, endogenous germ cell-less fish, crustacean, or mollusk, produced by the method disclosed herein, with a male, endogenous germ cell-less fish, crustacean, or mollusk, produced by the method disclosed herein, which is derived from the same sex determination system as the female in (i), to produce a sterile, sex-determined fish, crustacean, or mollusk.

[0032] In the context of this disclosure, "fish" refers to any cephalate animal that has gills and lacks fingers on its limbs. Examples of fish include carp, tilapia, salmon, trout, and catfish. In the context of this disclosure, "crustaceans" refers to any arthropod taxa. Examples of crustaceans include crabs, lobsters, crayfish, and shrimp. In the context of this disclosure, "mollusks" refers to any invertebrate that has a soft, segmentless body, usually enclosed in a calcareous shell. Examples of mollusks include bivalves, scallops, oysters, octopuses, squid, and chitons. Fish, crustaceans, or mollusks may include Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tilapia, oyster, clam, or mussel.

[0033] A sterile fish, crustacean, or mollusk is any fish, crustacean, or mollusk that has a reduced ability to produce offspring by breeding, mating, or mixing gametes compared to a wild-type paired organism; for example, a sterile fish, crustacean, or mollusk may have a reduced chance of producing live offspring by approximately 50%, 75%, 90%, 95%, or 100%. In contrast, a fertile female fish, crustacean, or mollusk is any fish, crustacean, or mollusk that is capable of producing offspring by breeding, mating, or mixing gametes. Breeding and mating is any process in which a male and a female of a species mate, or their gametes mix to produce fertile eggs, offspring, or offspring.

[0034] A sex-determined fish, crustacean, or mollusk refers to the offspring of any fish, crustacean, or mollusk whose sex has been predetermined by disrupting the sex differentiation pathway of the offspring. In some embodiments, sex-determined offspring of the same generation are monosex.

[0035] A chimeric gonad refers to a gonad that colonizes with one or more germ cells derived from a genotype different from the genotype that produces the gonad. A germ cell refers to any living cell that produces gametes of an organism. A germ cell line refers to a population of germ cells that transmit genetic material to offspring. A somatic cell refers to any cell that is not a gamete, germ cell, or stem cell, and therefore is not passed down through generations. Somite gonadal cells refer to somatic cells that produce various cell types within the testes or ovaries that support gamete formation.

[0036] Mutations present in the germline that interfere with the development and / or function of somite gonadal cells refer to any genetic mutation in a nucleic acid molecule that is inherited from one generation to another and directly or indirectly controls gonadal development and / or function in a somite manner. Direct or indirect control means (1) mutating the coding sequence of one or more nucleic acid molecules that is inherited from one generation to another and directly or indirectly controls gonadal development and / or function in a somite manner; (2) mutating a non-coding sequence that controls, at least to some extent, the transcription of one or more nucleic acid molecules that is inherited from one generation to another and directly or indirectly controls gonadal development and / or function in a somite manner; (3) mutating the coding sequence of another gene or nucleic acid molecule that is involved after the transcriptional control of one or more nucleic acid molecules that is inherited from one generation to another and directly or indirectly controls gonadal development and / or function in a somite manner; or (4) any combination of these. A mutation can be any type of modification of the target nucleotide sequence, such as nucleotide insertions, nucleotide deletions, and nucleotide substitutions. A mutation present in the germline that interferes with the development and / or function of somite gonadal cells can be a mutation in the microRNA miR202 or its ortholog.

[0037] Somite-level control of gonadal development and / or function refers to interfering with mutations in gonadal somatic cells and / or interfering with interactions between gonadal somatic cells and germ cells within the gonad. Examples include interfering with gamete formation; interfering with the development and / or function of testicular and / or ovarian cells; interfering with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells; disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells; and disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation. At least one secreted diffusive signaling protein or growth factor protein may be glial cell-derived neurotrophic factor (GDNF); bone morphogenetic protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); CXC motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

[0038] Germ cell transplantation refers to any process in which one or more stem cells derived from a fish, crustacean, or mollusk are transplanted into another fish, crustacean, or mollusk. In some embodiments according to this disclosure, germ cell transplantation is a process comprising: obtaining one or more germline stem cells, for example, about 1 to about 6,000 germ cells or about 500 to about 6,000 germ cells, derived from a fertile, homozygous male or female fish, crustacean, or mollusk that has a mutation present in the germline that interferes with the development and / or function of somite gonadal cells; and transplanting one or more germline stem cells into a recipient male or female fish, crustacean, or mollusk that does not have endogenous germ cells. The recipient male or female fish, crustacean, or mollusk is any embryo that is homozygous wild-type in the germline but has its own germ cells depleted at a locus for a mutation present in the donor male or female fish, crustacean, or mollusk. Optionally, the donor male or female fish, crustacean, or mollusk may be juvenile or adult. The juvenile fish, crustacean, or mollusk is in the maturation stage, prior to sexual maturity or the development and / or production of hormones associated with puberty, and is approximately 1 to 9 months old, for example, approximately 6 to 9 months old, and / or has a gonadal index (GSI) of approximately 0.1% to 0.5%. The recipient after transplantation is a fish, crustacean, or mollusk with normal somatic cells, but with chimeric gonads having mutant germ cell lines. Optionally, at least one germ cell is transplanted into the peritoneal cavity of the recipient, for example, an embryo or hatched larva of a fish, crustacean, or mollusk that lacks endogenous germ cells.

[0039] By using genetic mutations, ploidy manipulation (e.g., triploidy), hybridization strategies, exposure to high levels of sex hormones, morpholino to disrupt primordial germ cell development, and sterile hybrids, exposure to chemicals and high temperatures, germ cell-free recipients can be produced. Hunter et al,1982;Solar et al,1984;Piferrer et al,1994;Hunter,GA,EMDonaldson,FWGoetz,and PREdgell.1982.Production of all-female and sterile Coho salmon,and experimental evidence for male heterogamety.Transactions of the American Fisheries Society 111:367-372;Piferrer,F,M Carillo, S. Zanuy, IISolar, and EMDonaldson.1994.Induction of sterility in Coho salmon(Oncorhynchus kisutch) by androgen immersion before first feeding.Aquaculture 119:409-423;Solar,I.,EMDonaldson,and GAHunter.1984.Optimization of treatment regimes for controlled sex differentiation and sterilization in wild rainbow trout(Salmo gairdeneri Richardson) by oral administration of See 17α-methyltestosterone, Aquaculture 42:129-139; and the example described in PCT International Publication No. WO2020 / 033940.Regarding interspecific hybridization, see Saito, T.; Goto-Kazeto, R.; Arai, K.; Yamaha, E. Xenogenesis in Teleost Fish through Generation of Germ-Line Chimeras by Single Primordial Germ Cell Transplantation. Biol. Reprod. 2008, 78, 159-166; Yoshikawa, Hiroyuki, et al. "Hybrid sterility in fish caused by mitotic arrest of primordial germ cells." Genetics 209.2(2018):507-521. Yoshikawa, H.; Xu, D.; Ino, Y.; Yoshino, T.; Hayashida, T.; Wang, J.; Yazawa, R.; Yoshizaki, G.; Takeuchi, Y. Hybrid Sterility in Fish Caused by Mitotic Arrest of Primordial Germ Cells. Genetics See the example described in Biol. Reprod. 2018, 209, 507-521; Xu, D.; Yoshino, T.; Konishi, J.; Yoshikawa, H.; Ino, Y.; Yazawa, R.; Dos Santos Nassif Lacerda, SM; De Franca, LR; Takeuchi, Y. Germ Cell-Less Hybrid Fish: Ideal Recipient for Spermatogonial Transplantation for the Rapid Production of Donor-Derived Sperm. Biol. Reprod. 2019, 101, 492-500.For triploidization, see Lee,S.;Bang,WY;Yang,HS;Lee,DS;Song,HYProduction of Juvenile Masu Salmon(Oncorhynchus masou) from Spermatogonia-Derived Sperm and Oogonia-Derived Eggs via Intraperitoneal Transplantation of Immature Germ Cells.Biochem.Biophys.Res.Commun.2021,535,6-11,Seki,S.;Kusano,K.;Lee,S.;Iwasaki,Y.;Yagisawa,M.;Ishida,M.;Hiratsuka,T.;Sasado,T.;Naruse,K.;Yoshizaki,G.Production of the Medaka Derived from Vitrified Whole Tests by Germ Cell See the example described in Transplantation. Sci. Rep. 2017, 7, 43185; Yoshikawa, H.; Takeuchi, Y.; Ino, Y.; Wang, J.; Iwata, G.; Kabeya, N.; Yazawa, R.; Yoshizaki, G. Efficient Production of Donor Derived Gametes from Triploid Recipients Following Intra-Peritoneal Germ Cell Transplantation into a Marine Teleost, Nibe Croaker (Nibea mitsukurii). Aquaculture 2017, 478, 35-47.Regarding Dnd-morpholino, see Saito, T.; Goto-Kazeto, R.; Arai, K.; Yamaha, E. Xenogenesis in Teleost Fish through Generation of Germ-Line Chimeras by Single Primordial Germ Cell Transplantation. Biol. Reprod. 2008, 78, 159-166. Franek, R.; Kaspar, V.; Shah, MA; Gela, D.; Psenicka, M. Production of Common Carp Donor-Derived Offspring from Goldfish Surrogate Broodstock. Aquaculture 2021, 534, 736252. Yoshizaki, G.; Takashiba, K.; Shimamori, S.; Fujinuma, K.; Shikina, S.; Okutsu, T.; Kume, S.; Hayashi, M. Production of Germ Cell-Deficient Salmonids by dead end Gene See the example described in Knockdown, and Their Use as Recipients for Germ Cell Transplantation. Mol.Reprod.Dev.2016,83,298-311.For examples of dead end knockout, please refer to the following: Yoshizaki, G. Germ Cell Transplantation in Fish: Mutant dead end Rainbow Trout Can Produce Chinook Salmon Gametes. In Proceedings of the 2021 Exotic Species Webinar Series Recordings, 10 February 2021; Society for the Study of Reproduction: Reston, VA, USA, 2021. Li, Q.; Fujii, W.; Naito, K.; Yoshizaki, G. Application of dead end-Knockout Zebrafish as Recipients of Germ Cell Transplantation. Mol. Reprod. Dev. 2017, 84, 1100-1111.Regarding chemical substances and high temperatures, see Chemical with high temperature: 100, 32, 72 Majhi, SK; Hattori, RS; Rahman, SM; Strussmann, C. Surrogate Production of Eggs and Sperm by Intrapapillary Transplantation of Germ Cells in Cytoablated Adult Fish. PLoS ONE 2014. Ren, Y.; Sun, Z.; Wang, Y.; Yu, Q.; Wang, G.; He, Z.; Liu, Y.; Jiang, X.; Kang, X.; Hou, J. Production of Donor-Derived Offsprings by Allogeneic Transplantation of Oogonia in the Adult Japanese Flounder (Paralichthys olivaceus). Aquaculture See the example described in 2021,543,736977.Lacerda,SMSN;Batlouni,SR;Costa,GMJ;Segatelli,TM;Quirino,BR;Queiroz,BM;Kalapothakis,E.;Franca,LRA New and Fast Technique to Generate Offspring after Germ Cells Transplantation in Adult Fish: The Nile Tilapia (Oreochromis niloticus) Model.PLoS ONE 2010. Each reference in this paragraph is invoked by reference. In the example of generating germ cell-free recipients using genetic mutations, the recipients may have null mutations in dnd1, Elavl2, vasa, nanos3, and / or piwi-like genes.

[0040] At least one germ cell may be a spermatogonial stem cell (SCC) or an oogonial stem cell (OSC). At least one germ cell may be derived from a heterozygous male donor such as XY; from a homozygous female donor such as XX; from a homozygous male donor such as ZZ; from a heterozygous female donor such as WZ; from a homozygous hyper-female donor such as WW; or from a homozygous hyper-male donor such as YY.

[0041] In some preferred embodiments for producing sterile fish, crustacean, or mollusk progeny, at least one oogonal stem cell (OSC) as disclosed herein, derived from a female donor, is transplanted into a female fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustacean, or mollusk reproduce and produce sterile fish, crustacean, or mollusk progeny.

[0042] In some other embodiments where the production of sterile fish, crustacean, or mollusk progeny is preferred, at least one spermatogonial stem cell (SCC) as disclosed herein, derived from a male donor, is transplanted into a female fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustacean, or mollusk reproduce and produce sterile fish, crustacean, or mollusk progeny.

[0043] In some preferred embodiments for producing sterile female fish, crustaceans, or mollusks, at least one oogonal stem cell (OSC) as disclosed herein, derived from an isomorphic female donor such as XX, is transplanted into a female fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustaceans, or mollusks reproduce and produce female sterile fish, crustaceans, or mollusks.

[0044] In other embodiments where the production of sterile female fish, crustaceans, or mollusks is preferred, at least one oogonal stem cell (OSC) as disclosed herein, derived from an isomorphic super-female donor such as WW, is transplanted into a female fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusk lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustaceans, or mollusks reproduce and produce female sterile fish, crustaceans, or mollusks. Hyperfemales such as WW can be produced by: transplanting at least one oogonal stem cell (OSC) as disclosed herein, derived from atypical female donors such as WZ, into a fish, crustacean, or mollusk that does not contain male and female endogenous germ cells and produces a chimeric gonad as disclosed herein; breeding a male fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells with a female fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells; and selecting isotypic offspring by genotype selection.

[0045] In some preferred embodiments for producing sterile male fish, crustaceans, or mollusks, at least one spermatogonial stem cell (SCC) as disclosed herein, derived from an isomorphic male donor such as ZZ, is transplanted into a female fish, crustacean, or mollusks lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusks lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustaceans, or mollusks reproduce and produce sterile male fish, crustaceans, or mollusks.

[0046] In other embodiments where the production of sterile male fish, crustaceans, or mollusks is preferred, at least one spermatogonial stem cell (SCC) as disclosed herein, derived from an isomorphic supermale donor such as YY, is transplanted into a female fish, crustacean, or mollusks lacking endogenous germ cells as disclosed herein, and a male fish, crustacean, or mollusks lacking endogenous germ cells as disclosed herein; the male and female recipient fish, crustaceans, or mollusks reproduce and produce sterile male fish, crustaceans, or mollusks. Supermales such as YY can be produced by: transplanting at least one spermatogonial stem cell (SCC) as disclosed herein, derived from atypical female donors such as WX, into a fish, crustacean, or mollusk that does not contain male and female endogenous germ cells and produces a chimeric gonad as disclosed herein; breeding a male fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells with a female fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells; and selecting isotypic offspring by genotype selection.

[0047] Figure 1 is a flowchart illustrating a method for generating fish, crustaceans, or mollusks having chimeric gonads and lacking endogenous germ cells, and a method for propagating mutant strains, i.e., an example of a method for generating sterile fish, crustaceans, or mollusks from mutant strains, as disclosed herein. The mutant donor has a mutation present in the germline that interferes with the development and / or function of somite gonadal cells. In this example, the mutation is miR202. The mutation causes a defect in the testicular and ovarian microenvironment or niche, resulting in cessation of germ cell development and infertility in adult homozygous mutant males and females (Figure 1A). Chimeras are created using germ cell transplantation to generate males and females that produce only oocytes and sperm with the mutation. To create chimeras, ovarian or testicular cell suspensions obtained from homozygous mutant fish, crustaceans, or mollusks are transplanted into the peritoneal cavity of recipient embryos or hatched larvae of fish, crustaceans, or mollusks that are wild-type for the mutation that produces chimeric gonads and lack endogenous germ cells. The host chimeric recipient has normal somatic cells and mutant germ cell lines. In the chimeric recipient, the mutation is silent and does not block germ cell development. The chimeric recipient has ovaries and testes that can grow mutant germ cells and produce only gametes derived from donors carrying the mutant gene (Figure 1B). The recipient fish, crustaceans, or mollusks can be used as commercial breeding stock for the mass production of sterile fish, crustaceans, or mollusks.

[0048] Figure 2 is a flowchart illustrating a method for generating fish, crustaceans, or mollusks having chimeric gonads and lacking endogenous germ cells, and a method for propagating mutant strains, i.e., an example of a method for generating parthenogenetically infertile fish, crustaceans, or mollusks, as disclosed herein. The mutant donor has a mutation present in the germline that interferes with the development and / or function of somite gonadal cells. In this example, the mutation is miR202. When spermatogonial stem cells (XY) derived from the donor are transplanted into the recipient, only X and Y gametes are produced, resulting in sperm and eggs containing X and Y chromosomes (Figure 2A). When oogonial stem cells (OSCs) are transplanted into the donor, only X gametes are produced, resulting in sperm and eggs containing an X chromosome. Mating recipients produces offspring with various male-female sex ratios: after SSC transplantation, Y eggs are produced, resulting in XX, XY, and YY in a Mendelian distribution with a 1:2:1 ratio; and after OSC(XX) transplantation, males and females are produced that produce gametes containing only X chromosomes. Mating OSC-derived recipients with transplanted germ cells results in an excess of female offspring (Figure 2B). When SSC(YY) is transplanted, only Y gametes are produced, resulting in sperm and eggs containing Y chromosomes. Mating recipients from this group produces 100% male infertile progeny (Figure 2C). In some embodiments, the propagation and mating disclosed herein can be carried out by mixing sperm and eggs.

[0049] Figure 3 is a flowchart illustrating a method for generating fish, crustaceans, or mollusks having chimeric gonads and lacking endogenous germ cells, and a method for propagating mutant strains, i.e., an example of a method for generating parthenogenetically infertile fish, crustaceans, or mollusks, as disclosed herein. The mutant donor has a mutation present in the germline that interferes with the development and / or function of somite gonadal cells. In this example, the mutation is miR202. When spermatogonial stem cells (ZZ) derived from the donor are transplanted into the recipient, only Z gametes are produced, resulting in sperm and eggs containing the Z chromosome (Figure 3A). When oogonial stem cells (OSCs) are transplanted, Z and W gametes are produced, resulting in sperm and eggs containing either the Z or W chromosome. Mating of germ cell transplant recipients produces offspring with various male-female sex ratios: After OSC transplantation, W sperm are produced, resulting in XX, XY, and YY in a Mendelian distribution with a 1:2:1 ratio, leading to 75% female progeny, and subsequent SSC(ZZ) transplantation produces males and females that produce gametes containing only the Z chromosome. Mating SSC-derived recipients with transplanted ZZ germ cells results in an excess of male offspring (Figure 3A). When OSC(WW) derived from super-females is transplanted, only W gametes are produced, resulting in sperm and eggs containing the W chromosome. Mating of recipients from this group produces only female progeny (Figure 3C). In some embodiments, the propagation and mating disclosed herein can be carried out by mixing sperm and eggs.

[0050] Surprisingly, we discovered that the miR202 mutant tilapia strain produced a systemic male and female infertility phenotype. This high level of infertility described herein was unexpected, considering that the same gene mutation did not impair zebrafish fertility and only caused partial infertility in medaka.

[0051] The inventors further discovered that, despite the presence of miR202 regulatory mRNA targets within germ cells, infertility in tilapia resulted from the loss of miR202 function in somite gonadal cells. These miR202 characteristics presented the potential for mass production of infertile tilapia. The inventors' results represent the first method for mass-producing predictably specific sex-specific infertile fish, crustaceans, or mollusks by combining a single gene mutation with germ cell transplantation. [Examples]

[0052] Example 1 - Materials and Method

[0053] Animals used and ethical statements: All experiments complied with US regulations ensuring animal welfare and followed livestock procedures in accordance with the IACUC-approved animal protocol CAT-004. The tilapia (Oreochromis niloticus) strain used in this study originated from a Brazilian strain and possessed a transgene in which an oocyte-specific promoter was functionally linked to the "eGFP:nos3 3'UTR" cassette. The resulting transgenic female strain expressed green fluorescent protein (GFP) in the PGCs of its offspring embryos. The tilapia were housed in multiple recirculating aquatic preservation systems to accommodate all life stages. The culture system was maintained at 27°C (12H light, 12H dark).

[0054] Gene editing:miR202 knockout tilapia were generated using genome editing technology. The tilapia miR202 gene (MiRBase; Ensemble: ENSONIG00000021943) is located in the intergenetic region of linking group 13 (presumably a chromosome). The adjacent sequence 5'-GTATGTGCATAGGAAAA-3' (SEQ ID NO: 9) was selected as a single guide RNA targeting the tilapia miR-202-5p seeding sequence. These founders were genotyped by PCR fragment analysis. Tilapia strains with 7, 8, and 19-bp deletions around the miR202 seeding sequence (TTCCTTT (SEQ ID NO: 10), TTTTCCTA (SEQ ID NO: 11), and TCCTTTTTCCTATGCACAT (SEQ ID NO: 12)) were selected and propagated for this project (see Figure 7).

[0055] Fluorescence PCR for F0 genotyping:For the PCR reaction, 1 μL of primer mix was used, along with 3.8 μL of water, 0.2 μL of fin-DNA, and 5 μL of PCR master mix (Quiagen Multiplex PCR), each consisting of the following three primers: a labeled tail primer with a fluorescent tag (6-FAM, NED), amplicon-specific forward primers with a forward tail (5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 13) and 5'-TAGGAGTGCAGCAAGCAT-3' (SEQ ID NO: 14)), and amplicon-specific reverse primers (5'-GTTCCAGTGTCCAGAATCGGG-3' (SEQ ID NO: 15) and 5'-CTGGTGGAATACCTCTGC-3' (SEQ ID NO: 16)). The PCR conditions were as follows: denaturation at 95°C for 15 minutes, followed by 30 cycles of amplification (30 seconds at 94°C, 45 seconds at 57°C, and 45 seconds at 72°C), followed by 8 cycles of amplification (8 seconds at 94°C, 45 seconds at 53°C, and 45 seconds at 72°C), final extension at 72°C for 10 minutes, and indefinite retention at 4°C. A 1:10 dilution (1-2 microliters) of the obtained amplicon was resolved by capillary electrophoresis (CE) using an additional LIZ-labeled size standard, and the accurate amplicon size was measured relative to base pair resolution (Retrogen Inc., San Diego). The trace files were analyzed using Peak Scanner software (ThermoFisher). Peak size relative to the wild-type peak control determines the nature (insertion or deletion) and length of the mutation. The number of peaks indicates the level of mosaicism. F0 mosaic founders with the fewest mutant alleles (preferably 2-4 peaks) were selected. Allele size was used to calculate the observed indel mutations. Mutations that were not multiples of 3 bp and therefore expected to be frameshift mutations were selected for further confirmation by sequencing, excluding mutations in the non-coding sequences of the target gene. Mutations larger than 8 bp and smaller than 30 bp were preferred to facilitate genotyping by QPCR fusion analysis of subsequent generations. For sequence confirmation, the PCR products of the selected indels were further sequenced.PCR sequencing chromatography showing two simultaneous readouts indicates the presence of indels. The divergence of the sequence readouts usually marks the start of a deletion or insertion. The dual sequences are then carefully analyzed to detect unique nucleotide readouts. The pattern of unique nucleotide readouts is then analyzed against a series of artificial single readout patterns generated by gradually shifting the wild-type sequence to itself.

[0056] Quantification of PGC count in early embryos: In the transgenic strain Tg (Zpc5:eGFP:tnos 3'UTR), the tilapia Zpc5 promoter is an oocyte-specific promoter that is active during oogenesis before the first meiosis. Therefore, all embryos derived from heterozygous or homozygous transgenic females inherit eGFP:tnos 3'UTR mRNA, which is exclusively localized and expressed in PGCs by the action of a cis-active RNA element in the 3'UTR (tilapia nos3 3'UTR). Embryos (4 days after gestation) were euthanized with an excess dose of tricaine methanesulfonate (MS-222, 200-300 mg / L) by extending immersion for at least 10 minutes. The active preparation was 4 g / L 10 (bicarbonate:MS-22=2:1) ​​buffered to pH 7 in sodium bicarbonate. Embryos were transferred to a glass surface of PBS and the yolk was removed. The yolk-removed embryos were crushed between a microscope slide and a cover tip and analyzed under a fluorescence microscope equipped with an imaging camera. Images were captured using either bright-field or epifluorescence with an enhanced green fluorescent protein filter.

[0057] F1 Genotyping:Selected male founders were mated with female tilapia possessing the ZPC5:eGFP:tnos 3'UTR construct. The F1 progeny were raised to 2 months of age, euthanized by immersion in 200 mg / L MS-22 (tricaine), and transferred to a clean surface using a plastic spoon. The fins were cut with a razor blade and placed in wells (a 96-well plate with caps). The fish, with their fins clipped, were then placed in individual jars, and the fin DNA was analyzed by fluorescence PCR. Briefly, a 60 μL solution containing 9.4% Chelex and 0.625 mg / mL of proteinase K was added to each well in a 55°C incubator for overnight tissue immersion and gDNA extraction. The plates were then vortexed and centrifuged. The gDNA extract was then diluted 10-fold with ultraclean water to remove any PCR inhibitors in the mixture. Typically, 80 juvenile fish / founders were analyzed to raise batches of approximately 20 juvenile fish with the same size variation. In some embodiments, the mating disclosed herein can be carried out by mixing sperm and eggs.

[0058] QPCR genotyping of F1 and F2 generations:Real-time qPCR was performed using the ROTOR-GENE RG-3000 REAL TIME PCR SYSTEM (Corbett Research). 1 μL of genomic DNA (gDNA9 template (diluted at 5-20 ng / μL)) was mixed with 0.15 μM forward and reverse primers, and 5 μL of 2x QPCR master mix (Apex). A total volume of 10 μL of solution containing the Bio-research product was used. The qPCR primers used were 5'-GTTCCAGTGTCCAGAATCGGG-3' (SEQ ID NO: 15) and 5'-CTGGTGGAATACCTCTGC-3' (SEQ ID NO: 16). qPCR was performed using 40 cycles of 15 seconds at 95°C and 60 seconds at 60°C, and the specificity of the assay was subsequently confirmed by melting curve analysis (67°C to 97°C). In this approach, a short PCR amplicon (approximately 120-200 bp) containing the target region is generated from the gDNA sample and passed through temperature-dependent dissociation (melting curve). If the induced indel is present in heterozygous gDNA, the heterozygous gDNA... Rhoduplexes and various homoduplex molecules are formed. The presence of multiple morphological duplex molecules is detected by the melting profile, indicating whether the duplex melting functions as a single species or two or more species. Generally, the symmetry of the melting curve and melting temperature suggests the homogeneity and length of the dsDNA sequence. Therefore, homozygous and wild-type (WT) exhibit symmetrical melting curves that can be distinguished by various melting temperatures. Melting analysis was performed by comparing with reference DNA samples (derived from control wild-type DNA) amplified in parallel with the same master mix reaction. Simply put, variations in the melting profile distinguish amplicons generated from homozygous, heterozygous, and WT gDNA (Figure 5).

[0059] Investigation of male infertility:For each genotype, the volume of exfoliable sperm and sperm density were measured from 10 males (5 months old). Sperm were counted using Neubauer hemocytometer slides and spectrophotometric methods (optical density (OD) at 600 nm) in serially diluted samples. Sperm motility was measured as the percentage of motile sperm in the field of view [1]. Morphology of eosin-nigrosine-stained spermatids was analyzed using a 400x optical microscope. Sperm fertilization capacity was investigated by in vitro fertilization of wild-type eggs from three different females at an optimal sperm-to-egg ratio (100 eggs for 5.106 sperm). The quality of wild-type eggs was simultaneously tested using sperm from wild-type males. Fertilization rate was expressed as the percentage of live embryos to total eggs collected 24 hours after fertilization. Mean values ​​obtained from these studies were compared across mutant genotypes using a one-sided t-test.

[0060] Investigation of infertility in females: The weight of all sampled fish was recorded. For each genotype, a minimum of six females were excised at 4 and 6 months of age, and the gonads were photographed in situ before excision. The mean total gonadal index was statistically compared across all genotypes (one-sided t-test). The survival of eggs, embryos, and larvae produced from a minimum of six mutant females outcrossed with wild-type males was statistically analyzed (one-sided t-test) and compared with controls (wild-type females mated with mutant males). In some examples, the outcrossing disclosed herein can be carried out by mixing sperm and eggs.

[0061] Histology: The fixed specimens were dehydrated and embedded in paraffin; 5 μm thick (paraffin) sections were cut and the paraffin sections were stained with hematoxylin-eosin for histological examination under a light microscope [2].

[0062] Isolation of donor cells and germ cell transplantation:Germ cell stem cells were recovered from the gonads of 3-4 month old fish (approximately 50-70 g) by enzymatic digestion as described by Lacerda[3]. Briefly, the newly isolated gonads were ground and incubated for 3-4 hours at 25°C in 1 mL of 0.5% trypsin (Worthington Biochemical Corp., Lakewood, NJ) in PBS (pH 8.2) containing 1 mL of 5% fetal bovine serum (Gibco Invitrogen Co., Grand Island, NY) and 0.05% DNase I (Roche Diagnostics, Mannheim, Germany). During incubation, gentle pipetting was applied to physically destroy any intact parts remaining in the gonads. The resulting cell suspension was filtered through a nylon screen with a pore size of 42 μm (N-No.330T; Tokyo Screen Co. Ltd., Tokyo, Japan) to remove any undissociated cell clumps. The suspension was then resuspended in L-15 medium (Gibco Invitrogen Co.) and stored on ice until transplantation.

[0063] Hapa egg-laying experiment: In each Hapa, three wild-type (WT) females, 9-12 months old, with an average weight of 700g, were mated with one male selected from two genotypes (miR202+ / - and miR202- / -), all derived from heterozygous parents and having an average weight of 800g at 12 mpf (mpf: months after fertilization). These fish were allowed to spawn naturally for a maximum period of 30 days. Female fish were monitored every other day to detect the presence of eggs in the mouth. Upon detection, females with eggs were captured and the eggs were extracted from their mouths. The pit tag number of each egg-bearing female was recorded and then replaced with a new WT female. The total number of eggs from each spawning was calculated, and the fertile embryos were then incubated until they reached stage 14-16 during the pharyngeal embryonic stage. For each spawning, the ratio of the total number of eggs to the number of live embryos at the pharyngeal embryonic stage was recorded.

[0064] Generating germ cell-free recipients:Germ cell-free larvae (5-7 dpf) were anesthetized with 0.01% ethylmethanesulfonate 3-aminobenzoate (Sigma-Aldrich Inc.) and transferred to petri dishes coated with 2% agar. The transplant needles were prepared by pulling glass capillaries using an electric puller (PB-7, Narishige). The needle tips were sharpened using a grinder (EG-4, Narishige) until the opening reached 30 μm. Cell transplantation was performed by injecting approximately 15,000 testicular cells into the peritoneal cavity of approximately 100 larval progeny derived from Elavl2 Hermes heterozygotes or Dnd1 heterozygote mutant parents. After transplantation, the recipient larvae were returned to aerated embryo incubation water and allowed to grow to adulthood.

[0065] growth research To generate groups for use in the proliferation performance test, embryos were prepared from single-mating miR202- / - oogonia GCT-males × miR202- / - oogonia GCT-females, and from miR20- / -2 oogonia GCT-females × WT males (XY, miR202+ / +). Treated (miR202- / -) and control (miR202+ / -) embryos were reared individually using established incubation procedures. At 2 months of age, the control fish (miR202+ / -) were sexed based on the structure of the urogenital opening, and males were removed. As expected from the XX sex chromosome pairing, only female fish were selected as the miR202- / - test group. All fish were pit-tagged and arranged in a 1000L tank (total of 100 fish, 50 fish / group). All fish were fed three times a day until satiated. Each fish was weighed individually, monthly, over the period required to reach market size (approximately 600-700g, 9 months). At the end of the experiment, the fish were sacrificed and their individual total weight was recorded. The individual weight of the ovaries, which were removed for the calculation of the Total Gonadal Index (GSI), was also recorded. In some embodiments, the mating disclosed herein can be carried out by mixing sperm and eggs.

[0066] Example 2 - Generation of the founder strain and related phenotypes.

[0067] To understand the role of miR202 in Nile tilapia, its function was deactivated using a modified nuclease. The target was a region of the precursor miR202 gene adjacent to the seed sequence. The pigmentation gene (tyrosinase: tyr), which acts as a selection marker for mutation introduction, was targeted simultaneously with the miR202 sequence. Twenty embryos with the most severe pigmentation defects were selected and raised to adulthood. All selected miR202 F0 embryos were observed to develop normally. Since miR-202-5p has been described as a maternal factor in zebrafish studies [4], we investigated whether PGC development affects maternal defects in miR202 mutant embryos. Two F0 mutant females were crossed with wild-type (WT) ostelapia, and the embryonic progeny were analyzed using a fluorescence microscope to score the number of GFP-PGCs. The number of PGCs in embryos 4 days post-fertilization (dpf) was significantly lower than that in embryos from wild-type mothers (Figure 6B), with approximately 50% of embryos showing mislocalized PGCs (Figure 6A, bottom). No evidence of PGC development deficiency was found in progeny derived from F0 mutant males × wild-type females (Figure 6B), suggesting that the miR202 mutation is not influenced by the parent or zygote. Germline transmission of the indel mutation in F1 progeny derived from F0 males × wild-type females was further screened. For this purpose, F1 embryos were grown to 3 months of age and genotyped by Sanger sequencing of PCR amplicons containing the target miR202 locus. To establish mutant strains for further analysis, F1 fish were selected that had mutations completely or partially removing the miR-202-5p seed sequence with 7-bp (SEQ ID NO: 17), 8-bp (SEQ ID NO: 18), and 15-bp (SEQ ID NO: 19) deletions (Figure 7). In some embodiments, the mating disclosed herein can be carried out by mixing sperm and eggs.

[0068] Example 3 - Dose sensitivity of maternal miR-202 in tilapia embryogenesis to control PGC development.

[0069] F1 tilapia possessing all heterozygous miR202 mutant alleles were observed to develop normally, exhibit a healthy appearance, and differentiate into fertile adults of both sexes. The absence of a reproductive phenotype in these sexually mature F1 generations is not surprising, given that all cells of the selected mutants contain the WT allele. Considering the clear and important role of miR202 in PGC development, we further investigated whether reducing the maternal dose of functional miR202 would reduce the number of PGCs. Indeed, in the oocytes of heterozygous mutant females, both alleles are expressed, but only one encodes the functional miR. Therefore, if the miR202 gene functions in a dose-dependent manner, it should be expected that progeny derived from heterozygous females mated with WT or mutant males will show a reduction in the number of PGCs. Regardless of the embryonic genotype and the paternal genotype, we found that miR202+ / - mutant mothers produce progeny with a 50% reduction in the number of PGCs (Figure 6D). This result confirmed that this gene dose sensitivity is maternal-specific and unaffected by parental or zygote influences. Our findings suggest that miR202 is expressed in the mother in oocytes, is remembered as a maternal transcript in infertile eggs, and functions as an important component of the germ plasm during embryonic development.

[0070] Example 4 - Tilapia miR202 is necessary for successful female reproduction.

[0071] Using F1 fish with 7-bp, 8-bp, and 15-bp deletions, stable heterozygous F2 strains were generated for each allele. Crossbreeding of the F2 strains produced homozygotes for each mutation at the assumed Mendelian ratio (25%). Except for the undeveloped urogenital papilla in the miR202- / - homozygotes, no external morphological abnormalities were observed in any of the generated genotypes (Figure 5B). Controls (miR202+ / + and miR202+ / -) and homozygous mutant females were excised at regular time intervals, and the overall morphology and histology of the gonads were analyzed (Figure 5). Comparing fish of similar height and weight, mutant ovaries were observed to be significantly smaller and thinner than those of control individuals (Figure 5A), as evidenced by a significantly lower total gonadal index (GSI = gonadal weight / total body weight; P<.05) (Figure 5D). In all female mutants analyzed (N>100), these immaturities and screw-like ovaries were observed across all age groups from 3 to 9 months (Figure 5C). Histological analysis showed that ovaries from control fish (miR202+ / + and miR202+ / -) contained follicles at all developmental stages, including early and late primary and fully proliferating follicles (Figure 8C). In contrast, ovaries from miR202- / - fish contained almost exclusively early pre-vitelline follicles, suggesting a deficiency control in the early stages of follicular formation (Figures 8A and B). Consistent with these analyses, mutant females aged 6-9 months in tanks were unable to spawn, while control females showed a normal spawning cycle and number of eggs compared to females aged approximately 6-7 months (spawning once every 3-4 weeks). Combined, our results indicate that complete cessation of follicular development during the primary proliferative stage (pre-vitellogenesis) until at least 9 months of age resulted in a stable and fully penetrating female infertility phenotype. At 9 months of age, infertile females were observed to grow significantly larger than their fertile siblings (see Figure 19). In some examples, the interbreeding of inbred lines disclosed herein can be carried out by mixing sperm and eggs.

[0072] Example 5 - Tilapia MiR202 is necessary for successful male reproduction.

[0073] Compared to controls (miR202+ / + and miR202+ / -), homozygous mutations in the miR202 gene resulted in the development of atrophic male urogenital papillae and smaller, more translucent testes (Figure 9A). While the reduction in GSI was measured in juvenile miR202 (Figure 9B), mutant fish older than 6 months showed varying levels of testicular hydration, including hyperhydrated testes in older groups (9-12 months), and exhibited a significant increase in GSI. Histological analysis of the testes of 6-month-old control fish showed a dense population of spermatogenic cells at all developmental stages, including spermatogonia, spermatocytes, and spermatids located in the follicular structure. Sperm were also found at high density in the lumen of the seminiferous tubules of control male testes (Figures 10A and B). In contrast, testes derived from sibling- / - fish revealed a pattern of defects and a dramatic reduction in the total number of epididymal cysts (Figures 10C and D). Consistent with severe spermatogenesis defects at the morphological and histological levels, sperm counts in the seminal plasma of miR202 mutants ranged from 100 to 1000 cells / mL compared to 1 million to 5 million spermatids / mL in WT controls (Figure 9C). Reproductive success of control and miR202- / - males in breeding hapas was further tested. Our study found that 75% of randomly selected miR202- / - males were unable to impregnate eggs from wild-type females during repeated matings with spontaneous spawning. Of these males, the remaining 25% (2 out of 8) managed to produce a small number of live embryos, achieving an average fertilization success rate of 4% (detailed in Table 1). The overall average fertilization success rate for all miR202- / - males was 0.7%. In contrast, miR202+ / + sibling males showed a significantly higher success rate, yielding 85% live embryos (see Table X1). In contrast, miR202+ / - sibling males mated with the same WT females became pregnant with 85% of the eggs laid (Table 2).

[0074] [Table 1]

[0075] [Table 2]

[0076] The miR202- / - males under study were individually tagged and placed in a natural spawning tank with three wild-type (WT) females aged 12-13 months. Eggs or yolk stage juveniles were collected and counted at least twice a week. Each spawning was identified by tag number, and the count included unfertilized eggs or collected developing embryos. The fertilization rate was measured as the percentage of fertilized eggs among all collected eggs. Females with eggs in their mouths were removed and replaced. After one month, the miR202- / - males were removed from the breeding tank and replaced with fertile miR202+ / - sibling controls from the same parent mating (miR202+ / - parents). The number of spawnings and fertilization success rates were recorded. In some embodiments, the mating disclosed herein can be carried out by mixing sperm and eggs.

[0077] Combined, our results indicate highly permeable male spermatogenesis inhibition associated with low fertility in males.

[0078] Example 6 - The reproductive capacity of tilapia is controlled by miR202 expression in somite gonadal cells.

[0079] Our results indicate that miR202 is a germplasm-specific RNA involved in PGC survival and migration, and that it is expressed in maternal oocytes. We further established that miR202 plays a key regulatory role at various developmental stages of the male and female gonads. It remains unclear whether gonadal somiteness or germ cell miR202 expression is a cause of infertility. To analyze the tissue-specific contribution of miR202 to germ cell generation, we created chimeras using miR202+ / + somatic cells and miR202- / - germ cells. Our approach to generating germ cell exchange chimeras is outlined in Figure 4. To ensure that recipient fish reliably produce only donor-derived gametes, germ cells extracted from juvenile fish donors (miR202- / - or WT controls) were transplanted into recipient embryo progeny of dnd1 or Elavl2 heterozygotes. Only the transplanted dnd1- / 1[5] or elavl2- / -[5] and untransplanted controls were raised to adulthood. The dnd1 and Elavl2 alleles are sufficiently penetrant recessive zygote-inferiority mutations that cause the loss of endogenous germ cells (Figures 11-13). In these mutants, the genes are exclusively expressed in germ cells, so the gonadal microenvironment is considered normal. Histological analysis of the testes and ovaries of transplanted and control fish at 4 months of age revealed normal spermatogenesis and oogenesis in 66% (N=4 / 6) and 50% (3 / 6) of miR202 transplant recipients, respectively, while all non-transplanted elavl2- / - individuals were germ cell-free (Figure 11). Of all chimeras that survived to adulthood, 20 and 10 were derived from miR202 mutants and WT donors, respectively. Of the 20 mature miR202 chimeras, 12 (4 females and 8 females) were proven to be fertile. Of the 10 chimeras derived from WT donors, 9 were proven to be fertile. The high colony formation efficiency of the WT donor-derived individuals suggests that a large number of germline stem cells were present in the gonads of WT fish compared to miR202- / -.

[0080] We found that Elavl2 homozygous recipient males who underwent germ cell transplantation (GTP) successfully received miR202 mutant sperm at the same concentration as chimeras receiving germ cells from a WT donor. This suggests that miR202- / - germ cells possess unimpeded proliferation and differentiation capabilities. We also found that female chimeras developed functional ovaries, indicating that miR202 expression in oocytes is unnecessary for oogenesis (Figure 13). In contrast, male and female recipients who did not undergo GTP did not show gonadal development and remained infertile (Figures 11-13). Our results demonstrate the successful long-term survival, proliferation, and differentiation of donor-derived spermatogonial or oogonia into fully functional gametes in allogeneic recipient testes and ovaries.

[0081] Combined, these findings indicate that miR202 expression in gonadal somatic cells (Sertoli and granulosa cells) is necessary for normal gamete formation. Therefore, in tilapia, tilapia infertility caused by miR202 deficiency does not occur simultaneously with the germ cells themselves, but simultaneously with the somatic cell types that produce the spermatogenesis and oogenetic microenvironment. We concluded that somite miR202 is important for gonadal somatic cell development, or for the interaction between somite cells and germ cells.

[0082] Example 7 - The reproductive capacity of tilapia is controlled by miR202 expression in somite gonadal cells.

[0083] By completely replacing the host germline with a sterile donor miR202 germline, maternal mutants against miR202 were generated, providing a tool to study the full maternal influence of these zygote infertility mutations. Germ cell transplant (GCT) females mated with wild-type males were confirmed to produce live embryos. These embryos showed a 60% reduction in PGC (mean = 16 and 40, PGC / embryo, Figure 6E). miR202-GCT recipients were crossed between inbred lines, and the progeny were genotyped. All 25 embryos tested were found to be homozygous miR202 mutants (Figure 14B). Progeny from this mating were raised, and sex and gonadal structure were analyzed at time intervals. We found that the progeny grew into a mixed sex population of sterile females (Figure 15A) and sterile males (Figure 15B) with immature gonads up to 14 months of age. In some embodiments, the mating or inbreeding disclosed herein can be carried out by mixing sperm and eggs.

[0084] Example 8 - The miR202-GCT parent can mass-produce sterile progeny.

[0085] To test whether donor-derived cells completely replaced the host germline, (tyr- / -, miR202- / -) germ cells were transplanted into (Elavl2- / -) recipients. Chimeric GCT females were bred with WT stocks, and chimeric GCT males and progeny pigmentation were first analyzed. Progeny of GCT females with WT males consisted only of embryos with dark melanin pigmentation. Progeny of GCT female × GCT males consisted of embryos with a completely white phenotype, characteristic of homozygous tyr- / - albino mutation (Figure 18). This indicates that the germ cells derived from the recipients had the Tyr mutant allele, as complete albino can only be produced from mating shells in which both male and female gametes have the Tyr mutation. To further confirm the progeny genotype, DNA was analyzed from 100 embryo progeny resulting from mating of female and male recipients. From these crosses and inbred crosses, 3 × 30 progeny were identified, with 3 × 30 heterozygotes (miR202+ / -) and 3 × 30 homozygous miR202- / - mutants. This further indicated that both tyr and miR202 haplotypes were transmitted to the recipient progeny. Therefore, all GCT animals obtained were able to produce only host-derived gametes, as our analysis showed no significant deviation from the expected genotype for all chimeras tested. Three GCT females were individually crossed with at least one GCT male and one WT male inbred lines, producing a total of 2 × 5 cubs of gastric parent-sibling offspring. Genotyping of 20 offspring representatives from each gastric parent-sibling group was performed by PCR fragment analysis, confirming 100% and 100% miR202- / -. All progeny batches showed normal development and differentiated into phenotypic males and females. In miR202- / - progeny, a skewed sex ratio of over 70% to males was systematically observed. A skewed sex ratio is expected in progeny derived from GCT females. In fact, germ cell grafts were prepared using testicular extracts (XY germ cells) transplanted into infertile male and female recipient embryos. Therefore, half of all recipients involved hosts and donors of a different sex than the GCT females that develop sex-reversed XY oocytes.Therefore, the mestilapia transplanted with spermatogonial stem cells produced X and Y eggs, resulting in a female-to-male ratio of 1:3 in the offspring derived from the donor (XY × XY = 1XX + 2XY + 1YY over-male).

[0086] [Table 3]

[0087] Table 3 shows the sex ratios obtained from germ cell-transplanted males and mestilapia that received spermatogonial cells (XY), as well as from control matings between GCT males and WT (XY) females. Phenotypic sex was determined at 3 months of age by morphological examination of the urogenital papilla and excision of the gonads. In some examples, the mating or interbreeding disclosed herein can be carried out by mixing sperm and eggs.

[0088] Example 9 - The surrogate parent can produce a progeny population that is predominantly male or female, depending on the donor's sex.

[0089] All batches of offspring showed normal development, differentiating into phenotypic males and females, with a strong sex ratio biased towards either males (>73%) or females (>95%) (see Tables 3 and 4, respectively). This bias depended on whether the transplanted germ cells were oogonia or spermatogonial cells. This sex ratio bias was expected because germ cell grafts were prepared using testicular extracts (XY germ cells) or ovarian extracts (XX germ cells) and transplanted into infertile male and female recipient hatchlings. Consequently, the progeny obtained from oogonia-injected recipients all possessed only X chromosomes, resulting in all XX females, with a frequency ranging from 92% to 100% (see Table 4). Conversely, females and ostylapia transplanted with spermatogonial stem cells produced both X and Y eggs (pseudofemales) and sperm, resulting in a female-to-male ratio of 1:3 in the donor-derived offspring (XY × XY = 1XX + 2XY + 1YY supermales) (see Figure 3).

[0090] The identification of YY supermales and their impact on male offspring was achieved as follows: Six males were randomly selected from the offspring of a cross between a pseudofemale (XY) and a genetic male (XX) and mated with regular wild-type females. Of the resulting offspring, two F2 males (#2 and 4, Table 5) produced 100% and 96% male F3 offspring, respectively. In contrast, the remaining four F2 males produced F3 offspring with a male-to-female ratio ranging from 47% to 67%, similar to the control group (see Table 5). Therefore, two of the six F2 males (30.0%) were identified as YY supermales.

[0091] To verify the reliability of the YY+ males, two further populations were established by crossbreeding them with females from different farms or from the same family as the YY+ males. Offspring from females obtained from other farms showed a dramatic 99.5% male rate out of 200 individuals (n=200). Similarly, offspring from females of the same family as the YY+ males showed a 94.1% male rate out of 187 individuals (n=187). These findings highlight the suitability of the offspring produced in this study to the tilapia aquatic population.

[0092] [Table 4]

[0093] Table 4 shows the sex ratios obtained from germ cell transplant males and mestilapia that received oogonia (XY), as well as from control matings of GCT females and WT (XY) males. Phenotypic sex was determined at 3 months of age by morphological examination of the urogenital papilla and excision of the gonads.

[0094] [Table 5]

[0095] Table 5 shows the fertilization rate and the percentage of males and females (%) obtained from potential YY males of Nile tilapia (derived from the matings described in Table Y1) mated with WT females. Phenotypic sex was determined at 3 months of age by morphological examination of the urogenital papilla and excision of the gonads. In some examples, the matings disclosed herein can be carried out by mixing sperm and eggs.

[0096] Example 10: Infertile female fish (miR202- / -) outperformed fertile control fish (miR202+ / -) in terms of performance.

[0097] No difference in body weight was observed between miR202+ / - and miR202- / - females until 6 months of age. However, a gradual improvement in growth rate was observed after 3 months. By 9 months of age, homozygous mutant females showed a significant 17% increase in average body weight compared to the control miR202+ / - group. Unsurprisingly, females with the miR202- / - mutation at 9 months of age had gonads that had stopped at the pre-vitelline stage, while the gonads of the control group were fully mature. Therefore, the miR202- / - mutation in females does not have a recognizable positive or negative effect on the overall performance of fish up to 6 months of age, when females normally begin sexual maturation. Interestingly, female tilapia with atrophic gonads were observed to gradually outperform fully fertile female tilapia. This finding supports the idea that energy not allocated to ovarian development can be redirected to segment growth.

[0098] Example 11 - Gene balance strategy for maintaining the lineage of the Elavl2 mutation in heterozygotes.

[0099] In previous studies, we showed that both Elavl2 and dnd1 heterozygous mutant parents could produce 25% of germ cell-free homozygous recipient hatchlings for intraperitoneal transplantation of germ cell extracts (see PCT International Publication No. WO2020 / 033940, which is incorporated by reference). To maintain Elavl2 hemizygous individuals and ensure a further increase in the pool of acceptable hatchling recipients for germ cell transplantation, a recessive lethal mutation was created in another gene adjacent to Elavl2 on the homologous chromosome. Hermes (Rbmps) was placed very close to Elavl2 (200 kb, approximately 0.2 centimorgan) (Figure 16A), and a mutant allele of Hermes was generated by a 16-nucleotide insertion, as expected by transposition, producing a truncated Hermes protein (Figure 16B). The frameshift mutant Hermes Ins16 / Ins16 strains were found by us not to survive. Then, female Hermes Ins16 / + was bred with male Elavl2 Δ8 / + to obtain double heterozygous mutant Hermes Ins16 / + , Elavl2 Δ8 / + and raised them to adult fish (Figure 17A). Finally, the double heterozygous mutants were inbred and 200 offspring were raised for further analysis. It was found that approximately 20% of the offspring showed deformities at 3 - 4 dpf. The offspring were genotyped and it was found that approximately 75% of the Hermes homozygous mutants died within 7 days of fertilization (Figure 17B). Nine days after fertilization, the remaining Hermes Ins16 / Ins16 escapes showed craniofacial and body axis deformities (Figure 17C). At 1 month of age, after separating the offspring from the heterozygotes, it was scored that there were no surviving Hermes Ins16 / Ins16 , and it was confirmed that the Hermes Ins16 / Ins16 mutants were non-viable (Figure 17D). This offspring population was further used for germ cell transplantation experiments. Forty-five days after transplantation, by genotyping the hatchlings transplanted with germ cells, approximately 37% of the treated fish became Elavl2 Δ8 / Δ8 , while the rest were double heterozygotes (Hermes Ins / 16+ , Elavl2 D8 / +It was either , or eHhH). Using lethal balance mutations, Elavl2 was selected from the progeny pool. + / + These results confirm that zygotes can be estimated. Our results were in near-perfect agreement with the predicted Mendelian distribution of genotypes (33% and 66%) from fully related genes. Furthermore, considering that germ cell-free Elavl2 knockouts are suitable recipients only for germ cell transplantation, this strategy offers the additional benefit of increasing the number of recipient sterile fish required to produce only donor-derived germ cells by approximately 30%. In some embodiments, the inbred crosses disclosed herein can be carried out by mixing sperm and eggs.

[0100] References 1.Tait-Burkard, C., et al., Livestock 2.0-genome editing for fitter, healthier, and more productive farmed animals.Genome biology, 2018.19(1):p.1-11. 2.Modzelewski, AJ, et al., Dgcr8 and Dicer are essential for sex chromosome integrity during meiosis in males. Journal of cell science, 2015.128(12):p.2314-2327. 3.Dong, Z., et al., Generation of myostatin B knockout yellow catfish(Tachysurus fulvidraco) using transcription activator-like effector nucleases. 2015:2630-2637).Zebrafish,2014.11(3):p.265-274. 4. Zhang, J., et al., MiR-202-5p is a novel germ plasm-specific microRNA in zebrafish. Scientific reports, 2017. 7(1): p. 1-7. 5. PCT International Publication No. WO2020 / 033940.

[0101] Sequence Listing Sequence IDs 1 and 2 (wild-type Elavl2) Length: 1119 bp and 372 aa Types: cDNA (SEQ ID NO: 1) and Protein (SEQ ID NO: 2) Organism: Nile tilapia 1 CAGGTAATTGCTGCCATGGAAACACAGCTATCCAATGGGCCCACTTGCAACAACACAAGC 60 1 -Q--V--I--A--A--M--E--T--Q--L--S--N--G--P--T--C--N--N--T--S- 20 61 AACGGTCCTTCAACTATCACAAACAACTGCTCCTCACCTGTAGAGTCAGGGAGCGTAGAG 120 21 -N--G--P--S--T--I--T--N--N--C--S--S--P--V--E--S--G--S--V--E- 40 121 GACAGTAAAACTAACTTGATAGTCAACTATCTGCCTCAGAACATGACCCAGGAGGAACTG 180 41 -D--S--K--T--N--L--I--V--N--Y--L--P--Q--N--M--T--Q--E--E--L- 60 181 AAGAGTTTGTTTGGGAGCATCGGAGAAATTGAGTCCTGTAAACTAGTTCGAGACAAAATC 240 61 -K--S--L--F--G--S--I--G--E--I--E--S--C--K--L--V--R--D--K--I- 80 241 ACAGGGCAGAGCCTAGGCTATGGATTTGTGAATTATGTGGACCCAAAGGATGCAGAAAAG 300 81 -T--G--Q--S--L--G--Y--G--F--V--N--Y--V--D--P--K--D--A--E--K- 100 301 GCCATCAATACCTTAAATGGCTTGAGACTTCAGACCAAAACCATCAAGGTTTCCTATGCG 360 101 -A--I--N--T--L--N--G--L--R--L--Q--T--K--T--I--K--V--S--Y--A- 120 361 CGTCCAAGCTCCGCCTCCATCAGAGATGCAAATTTTATACGTCAGTGGCCTGCCAAAAACT 420 121 -R--P--S--S--A--S--I--R--D--A--N--L--Y--V--S--G--L--P--K--T- 140 421 ATGACTCAGAAGGAACTGGAGGCAGCTCTTCTCTCAGTACGGACGCATTATTACCTCACGC 480 141 -M--T--Q--K--E--L--E--Q--L--F--S--Q--Y--G--R--I--I--T--S--R- 160 481 ATTCTGGTGGACCAGGTGACTGGTGTTTCCAGAGGAGTTTGGCTTCATTCGTTTTGACCGG 540 161 -I--L--V--D--Q--V--T--G--V--S--R--G--V--G--F--I--R--F--D--R- 180 541 CGAGTTGAGGCTGAGGAGGCCATCAAGGGTCTGAACTGTCAGAAGCCGCCTGGTGGCCACC 600 181 -R--V--E--A--E--E--A--I--K--G--L--N--C--Q--K--P--P--G--A--T- 200 601 GAACCCATTACAGTCAAGTTTTGCAAACAACCCGAGCCAAAAGACCAGCCAGGCACTGCTG 660 201 -E--P--I--T--V--K--F--A--N--N--P--S--Q--K--T--S--Q--A--L--L- 220 661 TCCCAGCTCTATCAGTCACCCAATCGAAGGTACCCAGGACCCCTCGCACAGCAGGCACAA 720 221 -S--Q--L--Y--Q--S--P--N--R--R--Y--P--G--P--L--A--Q--Q--A--Q- 240 721 CGCTTCAGGTTGGACAATCTGCTGAACATGGCCTACGGAGTCAAAAGCTCTATGGCAGTA 780 241 -R--F--R--L--D--N--L--L--N--M--A--Y--G--V--K--S--S--M--A--V- 260 781 TTGTGTAGCAGGTTCTCCCCGATGGCCATTGACGGGGTGACCAGCTTGGCTGGCATCAAC 840 261 -L--C--S--R--F--S--P--M--A--I--D--G--V--T--S--L--A--G--I--N- 280 841 ATCCCGGGGCACGCGGGCACTGGCTGGTGCATCTTCGTCTACAACCTGGCTCCGGACGCA 900 281 -I--P--G--H--A--G--T--G--W--C--I--F--V--Y--N--L--A--P--D--A- 300 901 GATGAAAGCATCCTTTGGCAGATGTTCGGGCCGTTTGGTGCTGTCACAAACGTCAAGGTT 960 301 -D--E--S--I--L--W--Q--M--F--G--P--F--G--A--V--T--N--V--K--V- 961 ATCCGCGACTTTAACACAAACAAGTGCAAAGGATTTGGTTTTGTCACCATGACTAATTAC 1020 321 -I--R--D--F--N--T--N--K--C--K--G--F--G--F--V--T--M--T--N--Y- 1021 GACGAGGCAGCTGTGGCCATCGCCAGCTTGAATGGATACCGCCTTGGGGACAGAGTTCTG 1080 341 -D--E--A--A--V--A--I--A--S--L--N--G--Y--R--L--G--D--R--V--L- 360 1081 CAAGTGTCATTCAAAACCAAAAACACAAAGCCTGA 1119 361 -Q--V--S--F--K--T--N--K--T--H--K--A--*-

[0102] Sequence IDs 5 and 6 (Elavl2 mutant allele - 8nt deletion) Distance: 1119bp(-8bp) at 40aa Type: cDNA (chain complex 5) and scaffold (chain complex 6) Residence: イルテラピア 1 CAGGTAATTGCTGCCATGGAAACACAGCTATCCAACTTGCAACAACACAAGCAACGGTCC 1 -Q--V--I--A--A--M--E--T--Q--L--S--N- -L--Q--Q--H--K--Q--R--S- 20 61 TTCAACTATCACAAACAACTGCTCCTCACCTGTAGAGTCAGGGAGCGTAGAGGACAG TAA 120 21 -F--N--Y--H--K--Q--L--L--L--T--C--R--V--R--E--R--R--G--Q--*- 40

[0103] Sequence IDs 3 and 4 (wild-type Hermes) Distance: 525bp at 174aa Type: cDNA (chain complex 3) and scaffold (chain complex 4) Residence: イルテラピア 1 CAGGTCCGAACACTATTTGTCAGTGGGCTACCACTGGATATTAAACCGCGGGAGCTCTAC 1 -Q--V--R--T--L--F--V--S--G--L--P--L--D--I--K--P--R--E--L--Y- 61 CTCCTCTTCAGACCATTTAAGGGCTATGAAGGCTCCTTGATAAAGCTCACTTCTAAACAG 21 -L--L--F--R--P--F--K--G--Y--E--G--S--L--I--K--L--T--S--K--Q- 121 CCAGTGGGGTTTGTCAGTTTTGACAGTCGATCAGAGGCGGAGGCTGCTAAGAATGCCTTG 180 41 -P--V--G--F--V--S--F--D--S--R--S--E--A--E--A--A--K--N--A--L- 181 AACGGGGTACGATTTGACCCAGAGATTCCCCAGACTCTGCGGCTGGAGTTCGCCAAGGCC 240 61 -N--G--V--R--F--D--P--E--I--P--Q--T--L--R--L--E--F--A--K--A- 241 AACACCAAGATGGCCAAAAACAAGCTGGTTGGCACTCCCAACCCCCCACCTTCTCAGCAG 300 81 -N--T--K--M--A--K--N--K--L--V--G--T--P--N--P--P--P--S--Q--Q- 301 AGCCCCGGGCCACAGTTCATAAGCAGAGACCCATGAGCTCACAGTGCCTGCTCTCTAT 360 101 -S--P--G--P--Q--F--I--S--R--D--P--Y--E--L--T--V--P--A--L--Y- 361 CCCAGCAGCCCAGACGTGTGGGCCTCATACCCGCTGTACCCGGCGGAGCTGTCGCCGGCC 420 121 -P--S--S--P--D--V--W--A--S--Y--P--L--Y--P--A--E--L--S--P--A- 140 421 CTTCCACCCGCTTTCACCTACCCCTCCTCGCTCCACGCTCAGATTCGTTGGCTCCCGCCT 480 141 -L--P--P--A--F--T--Y--P--S--S--L--H--A--Q--I--R--W--L--P--P- 481 GCAGATGGAACTCCTCAGGGATGGAAGTCCAGGCAGTTCTGCTGA 525 161 -A--D--G--T--P--Q--G--W--K--S--R--Q--F--C--*-

[0104] Sequence IDs 7 and 8 (Hermes mutant allele - 16nt insertion) Distance: 525bp(+16bp) at 61aa Type: cDNA (chain complex 7) and scaffold (chain complex 8) Residence: イルテラピア 1 CAGGTCCGAACACTATTTGTCAGTGGGCTACCACTGGATATTAAACCGCGGGAGCTCTAC 1 -Q--V--R--T--L--F--V--S--G--L--P--L--D--I--K--P--R--E--L--Y- 61 CTCCTCTTCAGACCATTTAAGGGCTATGAAGGCTCCTTGATAAAGCTCACTTCTAAACAG 21 -L--L--F--R--P--F--K--G--Y--E--G--S--L--I--K--L--T--S--K--Q- 121 CCAGTGGGGTTTGTCAGTTTTGACAGTCGATCAGAG TCGATCACACCTACGAT CGGAGGC 180 41 -P--V--G--F--V--S--F--D--S--R--S--E-- S--I--T--P--T--I--G--G - 60 181 TGC TAA GAATGCCTTGAACGGGGTACGATTTGACCCAGAGATTCCCCAGACTCTGCGGCT 61 - C--*- 61

[0105] Sequence IDs 20 and 21 (wild-type dnd1) Distance: 1653bp at 320aa Type: cDNA (chain complex 20) and scaffold (chain sequence 21) Residence: イルテラピア 1 AGACAATGCACAATAGGTTACAAAAAAGTTTAAAAGCAGTCCTCCATACACAGCCGTTTG ............................................................ 61 GTATTTGTGACAAAATTTCATTCCATACCTTAGCGACGGGCTATGCTAGGCCCCGCCCAC ............................................................ 121 GGCTCAGTGGGCACTAAAGACATAGCATCGAGTGTACGCTGGACTACTGCAGTTGGAAAC 180 ............................................................ 181 GGGCTACAAAGTGGCGTCCGCTGTGCGCACAAACACGCTGAGACGATGGAAAACACGCAAA 240 ............................................-M--E--N--T--Q-- 5 241 GCCAGGTGCTGAACCTTGAACGGGTGCAGGCCCTGGAAATCTGGTTGAAAGCAACCAACA 300 6 S--Q--V--L--N--L--E--R--V--Q--A--L--E--I--W--L--K--A--T--N-- 25 301 CAAAGCTGACTCAAGTTAATGGCCAGAGGAAATATGGAGGACCACCTGAGGTGTGGGAAG 360 26 T--K--L--T--Q--V--N--G--Q--R--K--Y--G--G--P--P--E--V--W--E-- 45 361 GTCCCACACCGGGACCGCCGCTGTGAAGTCTTCATCAGCCAGATCCCACGGGACACGTATG 420 46 G--P--T--P--G--P--R--C--E--V--F--I--S--Q--I--P--R--D--T--Y-- 65 421 AGGACATCCTTATTCCCCTTGTTCAGCTCCATTGGGCCACTCTGGGAGTTCCGGCTGATGA 480 66 E--D--I--L--I--P--L--F--S--S--I--G--P--L--W--E--F--R--L--M-- 481 TGAACTTCAGTGGGCAGAACCGCGGCTTTGCGTATGCCAAATATGGCTCAGCTGCTATAG 540 86 M--N--F--S--G--Q--N--R--G--F--A--Y--A--K--Y--G--S--A--A--I-- 105. 541 CTGTTGAAGCCATACGACAGCTGCACGGTCACATGGTGGAGCCTGGCTACCGCATCAGTG 600 106 A--V--E--A--I--R--Q--L--H--G--H--M--V--E--P--G--Y--R--I--S-- 125. 601 TACGGCGGAGCACAGAGAAGCGACACCTTTGTATTGGAGGTCTGCCTGCTTCCACTAGAC 660 126 V--R--R--S--T--E--K--R--H--L--C--I--G--G--L--P--A--S--T--R-- 145. 661 AAGAAGGCATACTGCAGGTGCTGCGTATGCTGGTAGAGGGGGTGGAGAGTTTCCCTGA 720 146 Q--E--G--I--L--Q--V--L--R--M--L--V--E--G--V--E--R--V--S--L-- 721 AGGCCGGACCTGGTATAGAGGGGGTATCTGCTACTGTTGCTTTCTCATCTCACCATGCAG 780 166 K--A--G--P--G--I--E--G--V--S--A--T--V--A--F--S--S--H--H--A-- 781 CTTCTATGGCTAAGAAAGTGCTGGTGGAAGCATTTAAGAAGCAGTTTGCAATGTGTGTGT 840 186 A--S--M--A--K--K--V--L--V--E--A--F--K--K--Q--F--A--M--C--V-- 205 841 CAGTCAAGTGGCAGCCAACAGAGAAGCCAAACCCTGACGAGCCACGATGCCCTCAGAAAC 900 206 S--V--K--W--Q--P--T--E--K--P--N--P--D--E--P--R--C--P--Q--K-- 225 901 GTGCAAAGAGCCTGTTGCCGTCACACCTAGGGCCCCTGCACCACAGTTCTCCACAACCCT 960 226 R--A--K--S--L--L--P--S--H--L--G--P--L--H--H--S--S--P--Q--P-- 245 961 CAGGCCCGCCTTCATTCCTGACCCTCCCTGCATCCATACCCGCAGGTTTCTGCAGAGCAG 1020 246 S--G--P--P--S--F--L--T--L--P--A--S--I--P--A--G--F--C--R--A-- 265 1021 TGGGAGGGCCCACTGCTCCTCAGCTCGCTCACCCTACATGCTCTTTTCCCAATTCCTCCA 1080 266 V--G--G--P--T--A--P--Q--L--A--H--P--T--C--S--F--P--N--S--S-- 285 1081 CCCAAGGCCATCTTGTATTTGCAGCATCCCCAGTGATGCTTCTCAGTGCAGATCCGCGGG 1140 286 T--Q--G--H--L--V--F--A--A--S--P--V--M--L--L--S--A--D--P--R-- 305 1141 ATCACTGCCGCTTTCAAGGGGTTGGTCATGATCTTACCGGGTCCTAATGCCAGCACCATG 1200 306 D--H--C--R--F--Q--G--V--G--H--D--L--T--G--S--*-............. 320 1201 CTAGAGGAGGCTCAGAAGGCTGTAGCCCAGCAGGTCCTGCAGAAGATGTACAACACTGGT 1260 ............................................................ 1261 CTCACACACTAAACAGCTGATGCCGTCCTGCAGTTCTGTTTCACCTTGTTTGTGTTATGT 1320 ............................................................ 1321 GGTTTCATTTTCTGCATGTTTTTACTAGAGTAGCACCAAGTTTGTTTCTCTGACTATAAC 1380 ............................................................ 1381 TTGTGGTTTGTTTTATGCATGATTTTTACTGTACATTAGTGTTCTGTGTTACTGGATTGG 1440 ............................................................ 1441 TTCTCATTTTAATTAAATGAGCTTTGAAAAGAAAGTGTCGGCGTTTCTTTCAAATTAATG 1500 ............................................................ 1501 AAAGATTTAAATTAACTTAGGAAAATGGTAAAGCAGTTATTATTGTCTCACTTCATGCTG 1560 ............................................................ 1561 TTATGAACCCTAGTGATTCTCATCCAGACCTTTACGTATCTTTGAAGGTTGTGGATTGAG 1620 ............................................................ 1621 ACTAACCCCCCTCAGTGGTTTGGCATTTTAAAC 1653 .................................

[0106] Sequence IDs 22 and 23 (dnd mutant allele - 5nt deletion) Length: 1653bp (-5bp) and 324aa Type: cDNA (SEQ ID NO: 22) and protein (SEQ ID NO: 23) Living organism: Nile tilapia 1 AGACAATGCACAATAGGTTACAAAAAAGTTTAAAAGCAGTCCTCCATACACAGCCGTTTG 60 ............................................................ 61 GTATTTGTGACAAAATTTCATTCCATACCTTAGCGACGGGCTATGCTAGGCCCCGCCCAC 120 ............................................................ 121 GGCTCAGTGGGCACTAAAGACATAGCATCGAGTGTACGCTGGACTACTGCAGTTGGAAAC 180 ............................................................ 181 GGGCTACAAAGTGGCGTCCGCTGTGCGCACAAACACGCTGAGACGATGGAAAACACGCAAA 240 ............................................-M--E--N--T--Q-- 5 241 GCCAGGTGCTGAACCTTGAACGGGTGCAGGCCCTGGAAATCTGGTTGAAAGCAACCAACA 300 6 S--Q--V--L--N--L--E--R--V--Q--A--L--E--I--W--L--K--A--T--N-- 25 301 CAAAGCTGACTCAAGTTAATGGCCAGAGGAAATATGGAGGACCACCTGAGGTGTGGGAAG 360 26 T--K--L--T--Q--V--N--G--Q--R--K--Y--G--G--P--P--E--V--W--E-- 45 361 GTCCCACACCGGGACCGCCGCTGTGAAGTCTTCATCAGCCAGATCCCACGGGACACGTATG 420 46 G--P--T--P--G--P--R--C--E--V--F--I--S--Q--I--P--R--D--T--Y-- 65 421 AGGACATCCTTATTCCCCTTGTTCAGCTCCATTGGGCCACTCTGGGAGTTCCGGCTGATGA 480 66 E--D--I--L--I--P--L--F--S--S--I--G--P--L--W--E--F--R--L--M-- 85 481 TGAACTTCAGTGGGCAGAACCGCGGCTTTGCGTATGCCAAATATGGCTCAGCTGCTATAG 540 86 M--N--F--S--G--Q--N--R--G--F--A--Y--A--K--Y--G--S--A--A--I-- 105. 541 CTGTTGAAGCCATACGACAGCTGCACGGTCACATGGTGGAGCCTGGCTACCGCATCAGTG 600 106 A--V--E--A--I--R--Q--L--H--G--H--M--V--E--P--G--Y--R--I--S-- 125. 601 TACGGCGGAGCACAGAGAAGCGACACCTTTGTATTGGAGGTCTGCCTGCTTCCACTAGAC 660 126 V--R--R--S--T--E--K--R--H--L--C--I--G--G--L--P--A--S--T--R-- 145. 661 AAGAAGGCATACTGCAGGTGCTGCGTATGCTGGTAGAGGGGGTGGAGAGTTTCCCTGA 720 146 Q--E--G--I--L--Q--V--L--R--M--L--V--E--G--V--E--R--V--S--L-- 721 AGGCCGGACCTGGTATAGAGGGGGTATCTGCTACTGTTGCTTTCTCATCTCACCATGCAG 780 166 K--A--G--P--G--I--E--G--V--S--A--T--V--A--F--S--S--H--H--A-- 781 CTTCTATGGCTAAGAAAGTGCTGGTGGAAGCATTTAAGAAGCAGTTTGCAATGTGTGTGT 840 186 A--S--M--A--K--K--V--L--V--E--A--F--K--K--Q--F--A--M--C--V-- 205 841 CAGTCAAGTGGCAGCCAACAGAGAAGCCAAACCCTGACGAGCCACGATGCCCTCAGAAAC 900 206 S--V--K--W--Q--P--T--E--K--P--N--P--D--E--P--R--C--P--Q--K-- 225 901 GTGCAAAGAGCCTGTTGCCGTCACACCTAGGGCCCCTGCACCACAGTTCTCCACAACCCT 960 226 R--A--K--S--L--L--P--S--H--L--G--P--L--H--H--S--S--P--Q--P-- 245 961 CAGGCCCGCCTTCATTCCTGACCCTCCCTGCATCCATACCCGCAGGTTTCTGCAGAGCAG 1020 246 S--G--P--P--S--F--L--T--L--P--A--S--I--P--A--G--F--C--R--A-- 265 1021 TGGGAGGGCCCACTGCTCCTCAGCTCGCTCACCCTACATGCTCTTTTCCCAATTCCTCCA 1080 266 V--G--G--P--T--A--P--Q--L--A--H--P--T--C--S--F--P--N--S--S-- 285 1081 CCCAAGGCCATCTTGTATTTGCAGCATCCCCAGTGATGCTTCTCAGTGCAGATCCGCGGG 1140 286 T--Q--G--H--L--V--F--A--A--S--P--V--M--L--L--S--A--D--P--R-- 305 1141 ATCACTGCCGCTTTCAAGGGGTTGGTCATGATCGGGTCCTAATGCCAGCACCATGC TAG A 1200 306 D--H--C--R--F--Q--G--V--G--H--D- -R--V--L--M--P--A--P--C--*. . 324

[0107] Sequence ID 24 (miR202 wild-type allele) Length: 94bp Type: Genomic DNA (SEQ ID NO: 24) Living organism: Nile tilapia 1 CTCGCTGTTCCTTT TTCCTATGCACATACTTCTTTGAGATTTAACTTTAAAGAGGCATAA 60 ............................................................ GGCATGGGAAAAT GGGGCTGCAGAGGTATTCCAC 94 ..................................

[0108] Sequence ID 17 (miR202 mutant allele -7nt deletion) Length: 87bp (-7pb) Type: Genomic DNA (SEQ ID NO: 17) Living organism: Nile tilapia 1 CTCGCTG TTCCTATGCACATACTTCTTTGAGATTTAACTTTAAAGAGGCATAAGGCATGG 60 ............................................................ GAAAAT GGGGCTGCAGAGGTATTCCAC 87 ...........................

[0109] Sequence ID No. 18 (MIR202 mutant allele - 8nt deletion) Length: 86bp (-8pb) Type: Genomic DNA (SEQ ID NO: 18) Living organism: Nile tilapia 1 CTCGCTGTTCCT TGCACATACTTCTTTGAGATTTAACTTTAAAGAGGCATAAGGCATGGG 60 ............................................................ AAAAT GGGGCTGCAGAGGTATTCCAC 86 ..........................

[0110] Sequence ID 19 (miR202 mutant allele -19nt deletion) Length: 75bp (-19pb) Type: Genomic DNA (SEQ ID NO: 19) Living organism: Nile tilapia 1 CTCGCTGT ACTTCTTTGAGATTTAACTTTAAAGAGGCATAAGGCATGGGAAAAT GGGGCT 60 ............................................................ GCAGAGGTATTCCAC 75 Complete.

[0111] The preceding description includes many details for illustrative purposes to provide a complete understanding of the embodiments. However, it will be apparent to those skilled in the art that these specific details are unnecessary.

[0112] The embodiments described above are intended to be merely examples. Those skilled in the art can modify, improve, and vary the specific embodiments. The claims should not be limited by the specific embodiments described herein and should be interpreted in accordance with the specification as a whole.

Claims

1. A fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells, wherein the chimeric gonad contains at least one transplanted germ cell that is present in the germ cell line and has a mutation that interferes with the development and / or function of somite gonadal cells.

2. The fish, crustacean, or mollusk that lacks endogenous germ cells is homozygous wild-type in the germ cell line at the mutation site present in the germ cell line that interferes with the development and / or function of somite gonadal cells, according to claim 1.

3. A fish, crustacean, or mollusk lacking endogenous germ cells, according to claim 1 or 2, wherein interference with the development and / or function of somite gonadal cells includes interference with gamete formation.

4. A fish, crustacean, or mollusk lacking endogenous germ cells, according to any one of claims 1 to 3, wherein interference with the development and / or function of somite gonadal cells includes interference with the development and / or function of testicular and / or ovarian cells.

5. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 4, wherein interference with the development and / or function of somite glandular cells includes interference with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

6. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 5, comprising disrupting the development and / or function of somite glandular cells by disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

7. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 6, comprising disrupting the development and / or function of somite gonadal cells, thereby disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation.

8. A fish, crustacean, or mollusk lacking endogenous germ cells according to claim 7, wherein at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

9. A fish, crustacean, or mollusk lacking endogenous germ cells, according to any one of claims 1 to 8, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

10. A fish, crustacean, or mollusk that does not have endogenous germ cells, according to any one of claims 1 to 9, wherein the at least one germ cell is approximately 500 to approximately 6,000 germ cells.

11. A fish, crustacean, or mollusk that does not have endogenous germ cells, according to any one of claims 1 to 10, wherein the at least one germ cell is a spermatogonial stem cell (SCC); or an oogonial stem cell (OSC).

12. A fish, crustacean, or mollusk that does not have endogenous germ cells according to any one of claims 1 to 11, wherein at least one germ cell is derived from a heterozygous male donor such as XY.

13. A fish, crustacean, or mollusk that does not have an endogenous germ cell according to any one of claims 1 to 11, wherein the at least one germ cell is derived from an isomorphic female donor such as XX.

14. A fish, crustacean, or mollusk that is female and lacks the endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks the endogenous germ cells, the fish, crustacean, or mollusk that lacks the endogenous germ cells, wherein at least one germ cell transplanted into the fish, crustacean, or mollusk that lacks the endogenous germ cells is an oogonal stem cell (OSC) derived from an isomorphic female donor, such as XX, according to any one of claims 1 to 11.

15. A fish, crustacean, or mollusk that is female and lacks the endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks the endogenous germ cells, the at least one germ cell transplanted into the fish, crustacean, or mollusk that is male and lacks the endogenous germ cells is a spermatogonial stem cell (SCC) derived from an atypical male donor such as XY, according to any one of claims 1 to 11.

16. A fish, crustacean, or mollusk that does not have an endogenous germ cell according to any one of claims 1 to 11, wherein the at least one germ cell is derived from an isomorphic male donor such as ZZ.

17. A fish, crustacean, or mollusk that does not have endogenous germ cells according to any one of claims 1 to 11, wherein at least one germ cell is derived from a dysmorphic female donor such as WZ.

18. A fish, crustacean, or mollusk that is female and lacks endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks endogenous germ cells, the fish, crustacean, or mollusk that lacks endogenous germ cells, wherein at least one germ cell transplanted into the fish, crustacean, or mollusk that lacks endogenous germ cells is an oogonal stem cell (OSC) derived from a dysplastic female donor, such as WZ, according to any one of claims 1 to 11.

19. A fish, crustacean, or mollusk that is female and lacks the endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks the endogenous germ cells, wherein at least one germ cell transplanted into the fish, crustacean, or mollusk that is male and lacks the endogenous germ cells is a spermatogonial stem cell (SCC) derived from an isomorphic male donor such as ZZ, according to any one of claims 1 to 11.

20. A fish, crustacean, or mollusk that is female and lacks the endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks the endogenous germ cells, the fish, crustacean, or mollusk that lacks the endogenous germ cells, wherein at least one germ cell transplanted into the fish, crustacean, or mollusk that lacks the endogenous germ cells is an oogonal stem cell (OSC) derived from an isomorphic super-female donor such as WW.

21. A fish, crustacean, or mollusk that is female and lacks the endogenous germ cells; and a fish, crustacean, or mollusk that is male and lacks the endogenous germ cells, wherein at least one germ cell transplanted into the fish, crustacean, or mollusk that is male and lacks the endogenous germ cells is a spermatogonial stem cell (SCC) derived from an isomorphic hyper-male donor such as YY, according to any one of claims 1 to 11.

22. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 21, wherein the at least one germ cell is transplanted into the peritoneal cavity of the embryo or hatched larva of the fish, crustacean, or mollusk lacking endogenous germ cells.

23. The fish, crustacean, or mollusk that lacks endogenous germ cells, as described in any one of claims 1 to 22, has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

24. The fish, crustacean, or mollusk that lacks endogenous germ cells is produced using a ploidy operation such as triploidy, according to any one of claims 1 to 22.

25. The fish, crustacean, or mollusk that lacks endogenous germ cells is produced by hybridization, according to any one of claims 1 to 22.

26. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 22, which is produced by exposure to high levels of sex hormones.

27. The fish, crustacean, or mollusk that lacks endogenous germ cells is made using morpholino, according to any one of claims 1 to 22.

28. The fish, crustacean, or mollusk lacking endogenous germ cells is produced using a sterile hybrid, according to any one of claims 1 to 22.

29. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 1 to 22, which is produced by chemical exposure.

30. The fish, crustacean, or mollusk that does not have endogenous germ cells is according to any one of claims 1 to 29, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

31. The fish, crustacean, or mollusk that does not have endogenous germ cells, as described in any one of claims 1 to 24, wherein the fish, crustacean, or mollusk is tilapia.

32. The steps include transplanting at least one transplanted germ cell, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, into a fish, crustacean, or mollusk that does not have endogenous germ cells, and creating a chimeric gonad. A method for producing fish, crustaceans, or mollusks that do not have endogenous germ cells, including [the specified element].

33. The method according to claim 32, wherein the recipient fish, crustacean, or mollusk is homozygous wild-type in the germline at the mutation site present in the germline that interferes with the development and / or function of somite gonadal cells.

34. The method according to claim 32 or 33, wherein interfering with the development and / or function of somite glandular cells includes interfering with gamete formation.

35. The method according to any one of claims 32 to 34, wherein interfering with the development and / or function of somite gonadal cells includes interfering with the development and / or function of testicular and / or ovarian cells.

36. The method according to any one of claims 32 to 35, wherein interfering with the development and / or function of somite glandular cells includes interfering with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

37. The method according to any one of claims 32 to 36, wherein interfering with the development and / or function of somite glandular cells comprises disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

38. The method according to any one of claims 32 to 37, comprising disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation, thereby interfering with the development and / or function of somite gonadal cells.

39. The method according to claim 38, wherein the at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

40. The method according to any one of claims 32 to 39, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

41. The method according to any one of claims 32 to 40, wherein the at least one germ cell is approximately 500 to approximately 6,000 germ cells.

42. The method according to any one of claims 32 to 41, wherein the at least one germ cell is a spermatogonial stem cell (SCC); or an oogonial stem cell (OSC).

43. The method according to any one of claims 32 to 42, wherein the at least one germ cell is derived from a dysplastic male donor such as XY.

44. The method according to any one of claims 32 to 42, wherein the at least one germ cell is derived from an isomorphic female donor such as XX.

45. The method according to any one of claims 32 to 42, wherein the at least one germ cell transplanted into a female fish, crustacean, or mollusk that lacks the endogenous germ cells, and a male fish, crustacean, or mollusk that lacks the endogenous germ cells, is an oogonial stem cell (OSC) derived from an isomorphic female donor, such as XX.

46. The method according to any one of claims 32 to 42, wherein the female fish, crustacean, or mollusk lacking the endogenous germ cells, and the at least one germ cell transplanted into the male fish, crustacean, or mollusk lacking the endogenous germ cells are spermatogonial stem cells (SCCs) derived from atypical male donors such as XY.

47. The method according to any one of claims 32 to 42, wherein the at least one germ cell is derived from an isomorphic male donor such as ZZ.

48. The method according to any one of claims 32 to 42, wherein the at least one germ cell is derived from a dysplastic female donor such as WZ.

49. The method according to any one of claims 32 to 42, wherein the female fish, crustacean, or mollusk lacking the endogenous germ cells, and the at least one germ cell transplanted into the male fish, crustacean, or mollusk lacking the endogenous germ cells is an oogonial stem cell (OSC) derived from a dysplastic female donor, such as WZ.

50. The method according to any one of claims 32 to 42, wherein the female fish, crustacean, or mollusk lacking the endogenous germ cells; and the at least one germ cell transplanted into the male fish, crustacean, or mollusk lacking the endogenous germ cells is a spermatogonial stem cell (SCC) derived from an isomorphic male donor such as ZZ.

51. The method according to any one of claims 32 to 42, wherein the female fish, crustacean, or mollusk lacking the endogenous germ cells, and the at least one germ cell transplanted into the male fish, crustacean, or mollusk lacking the endogenous germ cells is an oogonial stem cell (OSC) from an isomorphic super-female donor, such as WW.

52. The method according to any one of claims 32 to 42, wherein the female fish, crustacean, or mollusk lacking the endogenous germ cells, and the at least one germ cell transplanted into the male fish, crustacean, or mollusk lacking the endogenous germ cells, is a spermatogonial stem cell (SCC) derived from an isomorphic hyper-male donor such as YY.

53. The method according to any one of claims 32 to 52, wherein the at least one germ cell is transplanted into the peritoneal cavity of an embryo or hatched larva of a fish, crustacean, or mollusk that does not have the endogenous germ cell.

54. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk that lacks endogenous germ cells has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

55. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk that lacks the endogenous germ cells is produced by ploidy manipulation such as triploidy.

56. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by hybridization.

57. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by exposure to high levels of sex hormones.

58. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk that lacks endogenous germ cells is prepared using morpholino.

59. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced using a sterile hybrid.

60. The method according to any one of claims 32 to 53, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by chemical exposure.

61. The method according to any one of claims 32 to 60, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

62. The method according to any one of claims 32 to 61, wherein the fish, crustacean, or mollusk is tilapia.

63. A fish, crustacean, or mollusk produced by the method described in any one of claims 32 to 62.

64. A method for producing sterile fish, crustaceans, or mollusks, A method comprising the step of (i) breeding a female fish, crustacean, or mollusk that does not have endogenous germ cells as described in any one of claims 1 to 31 and 63 with a male fish, crustacean, or mollusk that does not have endogenous germ cells as described in any one of claims 1 to 31 and 63 to produce the sterile fish, crustacean, or mollusk.

65. A method for producing sterile fish, crustaceans, or mollusks, A method comprising the step of (i) breeding a female fish, crustacean, or mollusk, which is produced by any one of claims 32 to 62 and lacks endogenous germ cells, with a male fish, crustacean, or mollusk, which is produced by any one of claims 32 to 62 and lacks endogenous germ cells, to produce a sterile fish, crustacean, or mollusk.

66. A fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells, wherein the chimeric gonad contains at least one transplanted oogonial stem cell (OSC) from an isomorphic female donor, such as XX, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, or b) spermatogonial stem cell (SCC) from an isomorphic male donor, such as ZZ, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells.

67. The fish, crustacean, or mollusk that lacks endogenous germ cells is homozygous wild-type in the germ cell line at the mutation site present in the germ cell line that interferes with the development and / or function of somite gonadal cells, according to claim 66.

68. A fish, crustacean, or mollusk lacking endogenous germ cells according to claim 66 or 67, wherein interference with the development and / or function of somite gonadal cells includes interference with gamete formation.

69. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 58, wherein interference with the development and / or function of somite gonadal cells includes interference with the development and / or function of testicular and / or ovarian cells.

70. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 69, wherein interference with the development and / or function of somite glandular cells includes interference with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

71. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 70, comprising disrupting the development and / or function of somite glandular cells by disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

72. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 71, comprising disrupting the development and / or function of somite gonadal cells, which includes disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation.

73. A fish, crustacean, or mollusk lacking endogenous germ cells according to claim 72, wherein at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

74. A fish, crustacean, or mollusk lacking endogenous germ cells, according to any one of claims 66 to 73, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

75. A fish, crustacean, or mollusk that does not have endogenous germ cells, according to any one of claims 66 to 74, wherein the at least one germ cell is approximately 500 to approximately 6,000 germ cells.

76. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 75, wherein the at least one germ cell is transplanted into the peritoneal cavity of the embryo or hatched larva of the fish, crustacean, or mollusk lacking endogenous germ cells.

77. The fish, crustacean, or mollusk that lacks endogenous germ cells, as described in any one of claims 66 to 76, has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

78. The fish, crustacean, or mollusk that lacks endogenous germ cells is produced using a ploidy operation such as triploidy, according to any one of claims 66 to 76.

79. The fish, crustacean, or mollusk that lacks endogenous germ cells is produced by hybridization, according to any one of claims 66 to 76.

80. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 76, which is produced by exposure to high levels of sex hormones.

81. The fish, crustacean, or mollusk that lacks endogenous germ cells is made using morpholino, according to any one of claims 66 to 76.

82. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 76, which is produced using a sterile hybrid.

83. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 66 to 76, which is produced by chemical exposure.

84. The fish, crustacean, or mollusk that does not have endogenous germ cells is according to any one of claims 66 to 83, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

85. The fish, crustacean, or mollusk that does not have endogenous germ cells, as described in any one of claims 66 to 84, wherein the fish, crustacean, or mollusk is tilapia.

86. A method for producing fish, crustaceans, or mollusks that lack endogenous germ cells, comprising the step of transplanting at least one oogonal stem cell (OSC) from an isomorphic female donor, such as XX, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, or b) spermatogonial stem cells (SCC) from an isomorphic male donor, such as ZZ, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, into a fish, crustacean, or mollusk that lacks endogenous germ cells to produce a chimeric gonad.

87. The method according to claim 86, wherein the recipient fish, crustacean, or mollusk is homozygous wild-type in the germline at the mutation site present in the germline that interferes with the development and / or function of somite gonadal cells.

88. The method according to claim 86 or 87, wherein interfering with the development and / or function of somite glandular cells includes interfering with gamete formation.

89. The method according to any one of claims 86 to 88, wherein interfering with the development and / or function of somite gonadal cells includes interfering with the development and / or function of testicular and / or ovarian cells.

90. The method according to any one of claims 86 to 89, wherein interfering with the development and / or function of somite glandular cells includes interfering with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

91. The method according to any one of claims 86 to 90, wherein interfering with the development and / or function of somite glandular cells comprises disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

92. The method according to any one of claims 86 to 91, comprising disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation, thereby interfering with the development and / or function of somite glandular cells.

93. The method according to claim 92, wherein the at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

94. The method according to any one of claims 86 to 93, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

95. The method according to any one of claims 86 to 94, wherein the at least one germ cell is approximately 500 to approximately 6,000 germ cells.

96. The method according to any one of claims 86 to 95, wherein the at least one germ cell is transplanted into the peritoneal cavity of an embryo or hatched larva of a fish, crustacean, or mollusk that does not have the endogenous germ cell.

97. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk that lacks endogenous germ cells has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

98. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk that does not have male or female endogenous germ cells has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

99. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk that does not have endogenous germ cells is produced by ploidy manipulation such as triploidy.

100. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by hybridization.

101. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by exposure to high levels of sex hormones.

102. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is prepared using morpholino.

103. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced using a sterile hybrid.

104. The method according to any one of claims 86 to 96, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by chemical exposure.

105. The method according to any one of claims 86 to 104, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

106. The method according to any one of claims 86 to 105, wherein the fish, crustacean, or mollusk is tilapia.

107. A fish, crustacean, or mollusk produced by the method described in any one of claims 86 to 106.

108. A method for producing sterile, sex-determined fish, crustaceans, or mollusks, A method comprising the step of (i) breeding a female fish, crustacean, or mollusk lacking endogenous germ cells as described in any one of claims 66 to 85 and 107 with a male fish, crustacean, or mollusk lacking endogenous germ cells as described in any one of claims 66 to 85 and 107, from the same sex determination system as the female in (i), to produce the sterile, sex-determined fish, crustacean, or mollusk.

109. A method for producing sterile, sex-determined fish, crustaceans, or mollusks, A method comprising the step of producing a sterile fish, crustacean, or mollusk by breeding (i) a female fish, crustacean, or mollusk without endogenous germ cells, produced by the method of any one of claims 86 to 106, with (ii) a male fish, crustacean, or mollusk without endogenous germ cells, produced by the method of any one of claims 86 to 106, from the same sex determination system as the female in (i), thereby producing the sterile fish, crustacean, or mollusk.

110. A fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells, wherein the chimeric gonad contains at least one transplanted oogonial stem cell (OSC) from an isomorphic super-female donor, such as WW, which is present in the germline and has mutations that interfere with the development and / or function of somite gonadal cells, or b) spermatogonial stem cell (SCC) from an isomorphic male donor, such as YY, which is present in the germline and has mutations that interfere with the development and / or function of somite gonadal cells.

111. The fish, crustacean, or mollusk that lacks endogenous germ cells is homozygous wild-type in the germ cell line at the mutation site present in the germ cell line that interferes with the development and / or function of somite gonadal cells, according to claim 110.

112. A fish, crustacean, or mollusk lacking endogenous germ cells according to claim 110 or 111, wherein interference with the development and / or function of somite gonadal cells includes interference with gamete formation.

113. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 112, wherein interference with the development and / or function of somite gonadal cells includes interference with the development and / or function of testicular and / or ovarian cells.

114. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 113, wherein interference with the development and / or function of somite gonadal cells includes interference with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

115. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 114, comprising disrupting the development and / or function of somite gonadal cells by disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

116. A fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 115, comprising disrupting the development and / or function of somite gonadal cells, thereby disrupting at least one secreted diffusive signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation.

117. A fish, crustacean, or mollusk lacking endogenous germ cells according to claim 116, wherein at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

118. A fish, crustacean, or mollusk lacking endogenous germ cells, according to any one of claims 110 to 117, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

119. A fish, crustacean, or mollusk that does not have endogenous germ cells, according to any one of claims 110 to 118, wherein the at least one germ cell is approximately 50 to approximately 6,000 germ cells.

120. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 119, wherein the at least one germ cell is transplanted into the peritoneal cavity of the embryo or hatched larva of the fish, crustacean, or mollusk lacking endogenous germ cells.

121. The fish, crustacean, or mollusk that lacks endogenous germ cells, as described in any one of claims 110 to 120, has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like genes.

122. The fish, crustacean, or mollusk that lacks endogenous germ cells is produced using a ploidy operation such as triploidy, according to any one of claims 110 to 120.

123. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 120 is produced by hybridization.

124. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 120, which is produced by exposure to high levels of sex hormones.

125. The fish, crustacean, or mollusk that lacks endogenous germ cells is made using morpholino, according to any one of claims 110 to 120.

126. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 120 is produced using a sterile hybrid.

127. The fish, crustacean, or mollusk lacking endogenous germ cells according to any one of claims 110 to 120, which is produced by chemical exposure.

128. The fish, crustacean, or mollusk that does not have endogenous germ cells is according to any one of claims 110 to 127, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

129. The fish, crustacean, or mollusk that does not have endogenous germ cells, as described in any one of claims 110 to 128, wherein the fish, crustacean, or mollusk is tilapia.

130. A method for producing fish, crustaceans, or mollusks that lack endogenous germ cells, comprising the step of transplanting at least one oogonal stem cell (OSC) derived from an isomorphic super-female donor, such as WW, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, or b) spermatogonial stem cells (SCC) derived from an isomorphic male donor, such as YY, which is present in the germline and has a mutation that interferes with the development and / or function of somite gonadal cells, into a fish, crustacean, or mollusk that lacks endogenous germ cells to produce a chimeric gonad.

131. Super females like WW are To create a chimeric gonad by transplanting at least one oogonal stem cell (OSC) derived from atypical female donors, such as WZ, which are present in the germline and have mutations that disrupt the development and / or function of somite gonadal cells, into male and female fish, crustaceans, or mollusks that lack endogenous germ cells; Breeding a male fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells with a female fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells; Selecting offspring with the same genotype through genotype selection, The method according to claim 130, which is produced by...

132. Super males like YY are To create a chimeric gonad by transplanting at least one spermatogonial stem cell (SCC) derived from atypical male donors, such as XY, that are present in the germline and have mutations that disrupt the development and / or function of somite gonadal cells, into male and female fish, crustaceans, or mollusks that lack endogenous germ cells; Breeding a male fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells with a female fish, crustacean, or mollusk having a chimeric gonad and lacking endogenous germ cells; Selecting offspring with the same genotype through genotype selection, The method according to claim 130, which is produced by...

133. The method according to any one of claims 130 to 132, wherein the recipient fish, crustacean, or mollusk is homozygous wild-type in the germline at the mutation site present in the germline that interferes with the development and / or function of somite gonadal cells.

134. The method according to any one of claims 130 to 133, wherein interfering with the development and / or function of somite glandular cells includes interfering with gamete formation.

135. The method according to any one of claims 130 to 134, wherein interfering with the development and / or function of somite gonadal cells includes interfering with the development and / or function of testicular and / or ovarian cells.

136. The method according to any one of claims 130 to 135, wherein interfering with the development and / or function of somite glandular cells includes interfering with the development and / or function of Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

137. The method according to any one of claims 130 to 136, wherein interfering with the development and / or function of somite glandular cells comprises disrupting at least one signaling molecule produced by Sertoli cells, theca cells, granulosa cells, and / or Leydig cells.

138. The method according to any one of claims 130 to 137, comprising disrupting at least one secreted diffusible signaling protein or growth factor protein that controls spermatogonial stem cell (SCC) and / or oogonial stem cell (OSC) regeneration and / or differentiation, thereby interfering with the development and / or function of somite gonadal cells.

139. The method according to claim 138, wherein the at least one secreted diffusible signaling protein or growth factor protein is glial cell-derived neurotrophic factor (GDNF); bone morphogenesis protein 4 (BMP4); stem cell factor (SCF); fibroblast growth factor 2 (FGF2); C-X-C motif chemokine 12 (CXCL12); and / or epidermal growth factor (EGF).

140. The method according to any one of claims 130 to 139, wherein the mutation present in the germline and interfering with the development and / or function of somite gonadal cells is a mutation in microRNA miR-202.

141. The method according to any one of claims 130 to 140, wherein the at least one germ cell is approximately 500 to approximately 6,000 germ cells.

142. The method according to any one of claims 130 to 141, wherein the at least one germ cell is transplanted into the peritoneal cavity of an embryo or hatched larva of a fish, crustacean, or mollusk that does not have the endogenous germ cell.

143. The method according to any one of claims 130 to 142, wherein the fish, crustacean, or mollusk that lacks endogenous germ cells has a null mutation in the dnd1, Elavl2, vasa, nanos3, and / or piwi-like gene.

144. The method according to any one of claims 130 to 143, wherein the fish, crustacean, or mollusk that lacks endogenous germ cells is produced by ploidy manipulation such as triploidy.

145. The method according to any one of claims 130 to 144, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by hybridization.

146. The method according to any one of claims 130 to 144, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by exposure to high levels of sex hormones.

147. The method according to any one of claims 130 to 144, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is prepared using morpholino.

148. The method according to any one of claims 130 to 144, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced using a sterile hybrid.

149. The method according to any one of claims 130 to 144, wherein the fish, crustacean, or mollusk lacking endogenous germ cells is produced by chemical exposure.

150. The method according to any one of claims 130 to 149, wherein the fish, crustacean, or mollusk is Atlantic salmon, rainbow trout, coho salmon, tilapia, amberjack, yellowtail, grouper, snapper, barramundi, sea bream, sea bass, lumpfish, sturgeon, Pacific white shrimp, tiger prawn, oyster, clam, or mussel.

151. The method according to any one of claims 130 to 150, wherein the fish, crustacean, or mollusk is tilapia.

152. A fish, crustacean, or mollusk produced by the method described in any one of claims 130 to 151.

153. A method for producing sterile, sex-determined fish, crustaceans, or mollusks, A method comprising the step of (i) breeding a female fish, crustacean, or mollusk lacking endogenous germ cells as described in any one of claims 110-129 and 152 with a male fish, crustacean, or mollusk lacking endogenous germ cells as described in any one of claims 110-129 and 152, from the same sex determination system as the female in (i), to produce the sterile, sex-determined fish, crustacean, or mollusk.

154. A method for producing sterile, sex-determined fish, crustaceans, or mollusks, A method comprising the step of producing a sterile fish, crustacean, or mollusk by breeding (i) a female fish, crustacean, or mollusk without endogenous germ cells, produced by the method of any one of claims 130 to 151, with (ii) a male fish, crustacean, or mollusk without endogenous germ cells, produced by the same sex determination system as the female in (i), according to any one of claims 130 to 151.

Images