Enzyme substrate for Shiga toxin detection

A fluorescence-based assay using a single-stranded oligonucleotide with a SRL sequence detects Shiga toxin activity in STEC, addressing the complexity and cost issues of current methods, providing rapid and reliable detection.

JP2026516002APending Publication Date: 2026-05-19ROBERT KOCH INSTITUTE +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ROBERT KOCH INSTITUTE
Filing Date
2024-05-03
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current methods for detecting Shiga toxin-producing Escherichia coli (STEC) are complex, costly, and require sophisticated instruments, often lacking sensitivity and specificity, especially in primary diagnostic settings, and do not account for the enzymatic activity responsible for the toxin's harmful properties.

Method used

A method using a single-stranded oligonucleotide with a sarcin-ricin loop (SRL) nucleotide sequence and a cleavage-dependent label to detect Shiga toxin (Stx) enzymatic activity, which is based on the depurination of adenine in the SRL, allowing for a simple and sensitive fluorescence-based assay.

Benefits of technology

The method enables rapid and reliable detection of Stx activity in STEC strains within 30 to 60 minutes, simplifying the detection process and reducing costs, while maintaining high sensitivity and specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026516002000007
    Figure 2026516002000007
  • Figure 2026516002000008
    Figure 2026516002000008
  • Figure 2026516002000009
    Figure 2026516002000009
Patent Text Reader

Abstract

The present invention relates to an oligonucleotide comprising a) a nucleotide sequence of a salsin-lysine loop (SRL) of a eukaryotic / mammalian 60S ribosome subunit, wherein the SRL nucleotide sequence contains at least one adenine, and b) at least one cleavage-dependent label, wherein the oligonucleotide is single-stranded. Preferably, the oligonucleotide constitutes at least one loop structure or stem-loop structure. In a further embodiment, the present invention relates to a method for detecting active Shiga toxin in a sample, comprising the steps of a) preparing at least one oligonucleotide according to the present invention, b) providing a sample to be tested for Shiga toxin, c) incubating the sample with at least one single-stranded oligonucleotide, and d) detecting a signal from the label, wherein the signal indicates the presence of Shiga toxin in the sample. The present invention also comprises a kit comprising at least one oligonucleotide according to the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of biochemistry, molecular diagnostics, and the determination of bacterial toxins.

[0002] The present invention relates to an oligonucleotide comprising: a) a nucleotide sequence of the sarcin-ricin loop (SRL) of a eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence contains at least one adenine; and b) at least one cleavage-dependent label, and the oligonucleotide is single-stranded. Preferably, the oligonucleotide forms at least one loop or stem-loop structure.

[0003] In a further aspect, the present invention relates to a method for detecting active Shiga toxin in a sample, comprising: a) preparing at least one oligonucleotide according to the present invention; b) preparing a sample to be tested for Shiga toxin; c) incubating the sample with at least one single-stranded oligonucleotide; and d) detecting a signal from the label, wherein the signal indicates the presence of Shiga toxin in the sample.

[0004] The present invention also includes a kit comprising at least one oligonucleotide according to the present invention, together with the necessary reagents described herein for toxin detection.

Background Art

[0005] The species Escherichia coli is described as both an essential part of the intestinal flora and a pathogen. The pathogen includes the Shiga toxin-producing E. coli (STEC) and the enterohemorrhagic E. coli (EHEC) prototypes. Hereafter, the comprehensive term STEC will be used, which also includes EHEC. These possess numerous toxic factors, particularly the Shiga-like toxin Stx, and can therefore cause diarrhea, bloody stools, or other very serious illnesses, such as hemolytic uremic syndrome (HUS). In Germany, the number of cases has increased in recent years, with approximately 2000 STEC infections reported in 2017, including approximately 100 cases of life-threatening hemolytic uremic syndrome (HUS). Children up to 5 years of age are particularly affected by the infection (Non-Patent Literature 1, Non-Patent Literature 2, Non-Patent Literature 3, Non-Patent Literature 4).

[0006] STEC is a significant zoonotic pathogen, primarily found in animals (especially ruminants) and corresponding foods such as meat and milk, but also in plant products (Non-Patent Documents 4, 5, and 6). By causing large-scale outbreaks like the one in 2011, and through food contamination and subsequent recall from the market, STEC incurs very high socioeconomic and economic costs (Non-Patent Documents 7, 8, and 9). Therefore, timely and qualified detection of such pathogens in humans, food, and animals is extremely important. However, although detection is increasingly being performed with the help of molecular methods (e.g., PCR) without subsequent pathogen isolation, the extraction of isolates from feces or food matrices plays a significant role in distinguishing STEC from other E. coli strains (including strains in the gut microbiota), clearly assigning pathogenicity markers such as Stx to corresponding E. coli clones, and ensuring further phylogenetic analysis for disease cluster and source identification (Non-Patent Document 10).

[0007] However, the extraction of isolates is becoming an increasingly serious problem because it is often not required for diagnosis in primary diagnostic laboratories in clinical settings, and molecular biological methods are increasingly being used directly on primary materials (stool, food) without subsequent pathogen isolation (Non-Patent Literature 10, 11, 12). Another problem is that the methods currently used for pathogen isolation (including in human, food, and veterinary reference laboratories) are very complex, requiring dozens of colonies to test for the stx gene using PCR or dot blotting after enrichment culture and single-colony plate culture. Alternatives include the equally complex immunodetection of Stx (colony immunoblotting, which was discontinued in 2015) or Vero cell culture assays (Non-Patent Literature 13, 14), and the detection of E. coli serogroup O157 based on metabolic characteristics (sorbitol fermentation and lack of β-glucuronidase activity). However, this serogroup accounts for only about 10% of STEC infections (Non-Patent Literature 15, 1, 2). Even new agar media (such as CHROM(c)STEC) cannot comprehensively detect STEC because their detection is based, for example, on the tellurite resistance of the pathogen, which only about 40% of pathogens possess (Non-Patent Literature 16). Other testing methods have also been published, but they do not currently represent a breakthrough in technology because they rely on highly complex analytical techniques (e.g., proteomic analysis by matrix-assisted laser desorption / ionization (MALDI)-time-of-flight tandem mass spectrometry) that involve expensive analytical equipment available only in a few specialized laboratories (e.g., Non-Patent Literature 17).

[0008] As a result, STECs are important zoonotic pathogens related to animals and food. In addition, these pathogens cause large-scale outbreaks and high economic costs through food contamination and subsequent product recalls. Therefore, timely and qualified detection of such pathogens in humans, food, and animals is extremely important.

[0009] Pathogen isolation is essential for further analysis of the pathogen, particularly for elucidating the chain of infection and the source of infection. However, the methods currently used are highly complex and costly, requiring the use of sophisticated instruments such as mass spectrometry, which is becoming an increasingly significant problem (Non-Patent Literature 18, 19, 20). In addition, the diversity of STECs (serogroups, metabolic characteristics, resistances) necessitates combinations of different diagnostic methods, and the use of individual test procedures based on markers not consistently present in STECs is often inconclusive. However, Stx is present in all STECs and can be detected directly by PCR using the stx gene or by ELISA. Current diagnostics are limited by the fact that these assays do not provide information on the actual enzymatic activity responsible for most of the harmful properties of Stx.

[0010] Non-patent document 21 found that Shiga toxin 1 (Stx1) can damage single-stranded DNA through depurination by measuring released adenine. Roday et al., 2007 investigated the activity of lysine and reported on the catalytic ability of lysine toxin A (RTA) to create abase-free sites in 14-mer stem-tetraloop RNA. Patent document 1 describes a multi-step test for detecting mistellectin, a ribosome inactivating protein (RIP), using a hybrid DNA-RNA construct. Non-patent document 14 describes an antibody-based LFIA immunoassay for detecting E. coli strain O157:H7. None of these documents describe the methods, oligonucleotides, or sequences thereof of the present invention.

[0011] Therefore, the availability of a simple and inexpensive method for sensitively and reliably detecting Shiga toxin and / or STEC would represent a significant advance in the fields of human, food, and veterinary medicine. [Prior art documents] [Patent Documents]

[0012] [License 1] European Patent Publication No. 1241267 [Non-licensed literature]

[0013] [Non-licensed Document 1] RKI 2016 [Non-licensed Document 2] RKI 2017 [Non-licensed Document 3] Kaper et al., 2004 [Non-licensed Document 4] Croxen et al., 2013 [Non-licensed Document 5] Persad and Lejeune, 2014 [Non-licensed Document 6] Garcia et al., 2010 [Non-licensed Document 7] Frank et al., 2011 [Non-licensed Document 8] Karch et al. 2010 [Non-licensed Document 9] COMMISSION Staff Working Document, 2011 [Non-licensed Document 10] Flieger et al., 2013 [Non-licensed Document 11] Fruth et al., 2016 [Non-licensed Document 12] FDA, 1995 [Non-licensed Document 13] Hull et al., 1993 [Non-licensed Document 14] Wang et al., 2016 [Non-licensed Document 15] Fruth et al., 2015 [Non-licensed Document 16] Kase et al., 2015 [Non-licensed Document 17] Fagerquist et al., 2014

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Summary of the Invention

[0014] The object according to the present invention is solved by the features of the independent claims. Advantageous embodiments of the present invention are described in the dependent claims.

[0015] In a preferred embodiment, the present invention a) a nucleotide sequence of the sarcin-ricin loop (SRL) of the eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence contains at least one adenine, the nucleotide sequence, and b) at least one cleavage-dependent label, and relates to an oligonucleotide comprising, wherein the oligonucleotide is single-stranded.

[0016] Preferably, the oligonucleotide constitutes at least one loop structure or stem-loop structure.

[0017] In a further preferred embodiment, the present invention relates to a method for detecting active Shiga toxin in a sample, a) preparing at least one single-stranded oligonucleotide according to the present invention; b) preparing a sample to be tested for Shiga toxin; c) incubating the sample with at least one single-stranded oligonucleotide; d) detecting a signal from the label; This includes, where the signal indicates the presence of Shiga toxin (and optionally Shiga toxin-producing pathogens) in the sample.

[0018] In the embodiment, step d) includes detecting a signal (e.g., a fluorescent signal) from a label, where the signal (e.g., a fluorescent signal) indicates the presence of Shiga toxin (and optionally Shiga toxin-producing pathogens) in the sample.

[0019] All embodiments, advantages, and features described below relate to the oligonucleotides, their uses, kits, and methods according to the present invention, unless expressly excluded or otherwise stated otherwise.

[0020] In the following, the comprehensive term STEC is used, which also includes EHEC. STEC is a significant pathogen that causes diseases in humans ranging from diarrhea to severe hemolytic uremic syndrome (HUS). STEC is found in animals and food and can cause large-scale disease outbreaks in humans, which are associated with high economic costs. Timely and qualified detection of STEC, including the extraction of isolates from patients, animals, and food, remains crucial but is also difficult and labor-intensive. In this invention, one of the inventors' objectives was to solve this problem and develop a detection method for detecting STEC. This should preferably be based on the detection of the enzymatic activity of Shiga toxin (Stx) in vitro. In addition to ease of use and low cost, the detection method should be sensitive and reliable in detecting STEC. To this end, the inventors adapted standard cultures of STEC samples in diagnostic and research. Based on these samples, the detection method was progressively improved by optimizing the SRL substrate and reaction conditions using the measured Stx activity of the culture supernatant to obtain a more specific reaction with a stronger fluorescence signal.

[0021] Therefore, the availability of reliable detection methods for STEC identification, such as the method according to the present invention, represents a tremendous advance.

[0022] STECs are a heterogeneous group with significant variation in marker genes, but Shiga toxin (STX; Stx) is present in all STECs. Stx possesses RNA N-glycosidase enzyme activity that attacks ribosomes (Bergan et al., 2012). Ribosomes are composed of two subunits (60S and 40S) mainly made up of ribosomal RNA (rRNA). Within the 60S subunit is a special structure called the salsine-lysine loop (SRL). The SRL of Stx is recognized via a recognition sequence, and a specific base (adenine) is depurinated, or cleaved, by the enzymatic activity of Shiga toxin (Menge, 2020).

[0023] For this reason, the inventors developed a detection method for Shiga toxin (Stx) based on its catalytic activity.

[0024] For the reasons stated above, the availability of a simple method and its potential use as an agar-based method for identifying stx-positive E. coli colonies represent a significant advance that could greatly improve the analysis of STECs in both human medicine and food / veterinary medicine.

[0025] As a result, the present invention provides a novel enzyme activity-based assay, which can also be agar-based, that significantly simplifies the currently complex initial detection of Stx-positive E. coli in humans, food, and veterinary medicine. The new test allows for more effective implementation of screening programs, thereby significantly simplifying and expanding monitoring and research tasks in the fields of zoonotic diseases and One Health (e.g., for a deeper understanding of animal and human infection / establishment, including transmission and contamination of various foods), which are generally based on pathogen isolation and subsequent characterization. In addition, the method according to the present invention offers significant advantages in embodiments for simple isolation / detection of pathogens as a basis for work.

[0026] The inventions described herein can fundamentally improve STEC detection in all areas of zoonotic diseases and One Health research.

[0027] For this purpose, various clinical STEC strains were analyzed, and the functionality of the method according to the present invention for their detection was verified. Multiple fluorescently labeled Stx oligonucleotide substrates were developed, the reaction conditions of the method according to the present invention were optimized, and its specificity was verified.

[0028] Figures 4 and 5 illustrate the principle of an exemplary embodiment of the detection method according to the present invention for determining the Stx activity of a STEC sample.

[0029] During development, the STEC strain was first cultured in liquid medium, and then the culture supernatant containing Stx produced by STEC was obtained. Detection of Stx activity should be based on the enzymatic activity of Shiga toxin. The native substrate (SRL) of Stx is located within ribosomes. Stx depurines the SRL within ribosomes and blocks translation. However, using ribosomes to detect Stx activity in vitro complicates / difficulties the detection assay, so a synthetic DNA-based SRL substrate was designed. To measure Stx activity, in the first embodiment, the SRL substrate was conjugated to a fluorophore / quencher pair as a label. When diluted in a reaction mix for detection and mixed with the culture supernatant, two possible outcomes can occur in this embodiment: a fluorescent signal may be detected in the detector, or no fluorescent signal may be detected. If Stx is not present in the culture supernatant, the SRL remains intact, and as a result, the fluorophore and quencher are in close proximity. The fluorescent signal of the fluorophore is absorbed by the quencher, and as a result, no signal is detected. In the presence of active Stx, the SRL is depurinated with a specific adenine. In addition, preferably, Stx start chain cleavage occurs, forming two halves of the SRL. As a result, the fluorophore and quencher separate from each other in the liquid, and the fluorescence of the fluorophore can be detected. In embodiments, in addition to culturing the STEC strain for determining Stx activity in the detection method according to the present invention, for example, the SRL substrate, reaction mix, reaction temperature and / or Shiga toxin may be relevant.

[0030] Stx is an AB5 toxin with enzymatic activity that depurines SRL within the 60S ribosomal subunit at a specific adenine and blocks translation (Beddoe et al., 2010). The effect of Stx on SRL is preferably used for the development of the detection method according to the present invention for STEC detection based on the detection of the enzymatic activity of Stx. The salsin-lysine loop forms a loop structure within the 28S rRNA of the 60S ribosomal subunit.

[0031] In the examples disclosed herein, the inventors tested 94 bacterial strains, including 65 STEC strains, 11 Shigella strains, and 18 non-Shiga toxin-producing enteropathogenic strains (Salmonella, EAEC, EPEC, EIEC, Yersinia). Stx production was detected in 59 of the 65 STEC strains and 6 of the 11 Shigella strains using established but complex and time-consuming detection methods: Stx Western blotting and Vero cell cytotoxicity assays. This means that 6 of the 65 STEC strains, 5 of the 11 Shigella strains, and all 18 enteropathogenic pathogen strains were Stx-negative in the reference methods used and the assays newly described herein. All pure cultures examined could then be detected simply and efficiently as correctly Stx-positive or correctly Stx-negative by the methods according to the present invention. The example demonstrates that, after analysis of various fluorescently labeled oligonucleotide enzyme substrates, robust and specific Stx detection is possible within 30 to 60 minutes for a reference strain, depending on the amount and subtype of Stx. In summary, we have developed a rapid detection test for STEC based on the enzymatic activity of Stx as a major pathogenic factor.

[0032] In certain embodiments, the method can be used for the detection of simple agar-based STECs based on the enzymatic activity of Shiga toxin. Without being constrained by current theory, the underlying mechanism of the assay depends on the embodiments of the present invention. Specifically, active Shiga toxin has RNA N-glycosidase activity that depurines a specific adenine in the salsin-lysine loop (SRL) of 28S ribosomal RNA, thereby inhibiting protein synthesis in eukaryotic cells (Chan et al., 2016). The enzymatic activity preferably yields a color or fluorescence reading in a specially modified substrate, which can be read visually or with simple instruments. Exemplary embodiments are shown, for example, in Figures 1 and 4.

[0033] SRLs are essential for the GTP catalytic process during translation. Within the SRL, Stx depurines a specific adenine within the detection sequence GAGA, thereby completely blocking translation (Endo et al., 1988; Tesh et al., 1993).

[0034] In a preferred embodiment of the method according to the present invention, the oligonucleotide according to the present invention is depurinated or cleaved by the enzymatic activity of Shiga toxin, preferably not by a lyase, such as an aprinic / apirimidinic (AP) lyase, or by another cleavage reaction (e.g., by a chemical substance).

[0035] In other words, in a preferred embodiment of the method according to the present invention, the oligonucleotide according to the present invention is not cleaved by a lyase, such as an aprinic / apilimidinic (AP) lyase, and / or by another cleavage reaction, such as by a chemical substance.

[0036] In a preferred embodiment, the method does not require additional substances such as trypsin, DTT, urea, and / or TCEP for Stx activation and detection of Stx activity. The method also preferably does not require rebuffering and / or enzyme-linked adenine detection using (expensive) additional substances.

[0037] In the method according to the present invention, the presence of active Stx is indicated by the fact that active Stx depurines its target sequence in the oligonucleotide (which is SRL in the embodiment) according to the present invention with a specific adenine. In addition, preferably Stx start chain cleavage occurs, thereby cleaving the oligonucleotide into two halves.

[0038] In embodiments of this specification, the method according to the present invention is also referred to as an enzyme activity assay, an enzyme assay, or an agar-based detection method.

[0039] Therefore, the method and / or reaction buffer and / or sample according to the present invention preferably does not contain / use lyase or other nucleic acid cleavage enzymes, except for one or more Shiga toxins. As a result, the reaction buffer according to this specification preferably does not contain lyase or other nucleic acid cleavage enzymes. In some embodiments, the reaction buffer according to this specification does not contain lysine. In some embodiments, the reaction buffer and / or enzyme assay contains lysine.

[0040] The presence of one or more Shiga toxins in a sample preferably indicates the presence of Shiga toxin-producing pathogens in the sample. In embodiments, the methods according to the present invention therefore include diagnosing infection by Shiga toxin-producing pathogens (e.g., E. coli (STEC), Acinetobacter, or Shigera) when a patient sample is analyzed, or diagnosing contamination when, for example, food is tested.

[0041] In the embodiment, the oligonucleotide is present in the detection solution, reaction solution, or buffer (e.g., detection buffer, e.g., acetate buffer).

[0042] In the embodiment, the detection solution or reaction solution (detection buffer; depurination buffer) is added (to the sample) before or during steps c) and / or d) of the method according to the present invention.

[0043] In embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurination buffer) is 10 mM to 150 mM, or 10 mM to 100 mM, 20 mM to 150 mM, 30 mM to 100 mM, 40 mM to 100 mM, 50 mM to 100 mM, 60 mM to 100 mM, 70 mM to 100 mM, 80 mM to 100 mM, 90 mM to 100 mM, 100 mM to 110 mM, 100 mM to 120 mM, 100 mM to 130 mM, 100 mM to 140 mM, 100 mM to 150 mM, 50 mM to 150 mM, or 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 55 mM, 60 mM, 65 mM, 70 mM, 75 mM, 80 mM, 85 mM, 90 mM, 95 mM, 100 mM, 105 mM, 110 mM The solution contains ammonium acetate at concentrations of mM, 150 mM, 120 mM, 125 mM, 130 mM, 135 mM, or preferably 10 mM to 150 mM, 10 mM to 100 mM, 50 mM to 100 mM, or 80 mM to 110 mM, or 100 nM. In embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurination buffer) may also contain sodium acetate, potassium acetate, and / or potassium citrate instead of, or in addition to, ammonium acetate. The final concentrations of sodium acetate, potassium acetate, potassium citrate, and / or ammonium acetate in the detection solution or reaction solution may be those described above, or may be adjusted according to alternative or additional reagents.

[0044] In embodiments, the lower detection limit of Stx activity in a sample (e.g., culture supernatant, pathogen colony, or patient sample) using the method according to the present invention is 11 ng / mL to 29 ng / mL, or 10 ng / mL to 30 ng / mL, 1 ng / mL to 50 ng / mL, 5 ng / mL to 30 ng / mL, or 1 ng / mL, 2.5 ng / mL, 5 ng / mL, 7.5 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 29 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL or more, preferably at least 10 ng / mL, and more preferably 5 ng / mL or more.

[0045] In the embodiment, the detection solution or reaction solution (detection buffer; depurination buffer) includes pH 3 to 4, or pH 2.5 to 4.5, or pH 3.5 to 4.5, pH 2 to 5, pH 3, pH 3.5, pH 4, pH 4.5, pH 5, pH 5.5, pH 6, pH 6.5, or pH 7, or pH 2.5 or higher, pH 3 or higher and pH 5 or lower, pH 4 or lower, or preferably pH 3 to 4.

[0046] In embodiments, steps c) and / or d) of the method according to the present invention include a detection temperature or reaction temperature or temperature gradient of 30°C to 55°C, 40°C to 60°C, 44°C to 57°C, 37°C to 57°C, 40°C to 50°C, or 30°C, 35°C, 40°C, 44°C, 45°C, 50°C, 60°C, or 30°C or higher, 35°C or higher, 40°C or higher, 44°C or higher, 45°C or higher, 50°C or higher, or preferably 40°C or higher, 44°C or higher, or 30°C to 55°C.

[0047] In some specific embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurination buffer) contains ammonium acetate at a concentration of 10 mM to 100 mM, preferably 100 mM, and / or has a pH of 3 to 4.

[0048] In some specific embodiments, steps c) and / or d) of the method according to the present invention include a detection temperature or reaction temperature or temperature gradient of 30°C to 60°C, preferably 40°C to 60°C.

[0049] In embodiments, oligonucleotides are present in a solid, semi-solid, or liquid (bacterial) growth medium (or culture medium), preferably in a growth agar plate (as a growth medium) or in a semi-solid or liquid growth medium. In embodiments, the solid, semi-solid, or liquid growth medium is a (bacterial) growth medium (or culture medium). In embodiments, the solid, semi-solid, or liquid growth medium is an agar medium (a medium containing agar-agar or agarose).

[0050] In embodiments, the oligonucleotide is present in a solid or liquid growth medium, preferably in a growth agar plate (as the growth medium), or in a liquid growth medium containing a detection solution / buffer or reaction solution / buffer (e.g., detection buffer, e.g., acetate buffer). In embodiments, the oligonucleotide is present in a growth agar plate and / or a detection agar plate. In embodiments, the oligonucleotide is present in a liquid or solid growth medium and / or a detection medium.

[0051] In the embodiment, the oligonucleotide is present in a detection solution / buffer or reaction solution / buffer (e.g., a detection buffer, e.g., an acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as a growth medium), or in the aforementioned mixture.

[0052] In the embodiment, the oligonucleotide is present in the reaction solution or detection solution, or in the (bacterial) growth medium, or in the aforementioned mixture.

[0053] In embodiments, the oligonucleotide is present in a reaction solution or detection solution, or a bacterial growth medium, or the aforementioned mixture, where the reaction solution or detection solution, or (bacterial) growth medium, contains a dye or chromogenic dye for color detection. Such a (bacterial) growth medium is preferably a chromogenic growth medium and / or culture medium.

[0054] In embodiments, oligonucleotides are immobilized on a solid phase. In embodiments, the solid phase may be a substrate, column material, beads (e.g., magnetic beads or agarose beads), a surface, glass, plastic, resin, reaction vessel, wells of a well plate, arrays, tips, or any other surface known to those skilled in the art that is suitable for immobilizing oligonucleotides.

[0055] In some embodiments, oligonucleotides are immobilized on a solid phase, where the solid phase is part of the reaction vessel and / or culture vessel. In some embodiments, the reaction vessel and / or culture vessel is filled with or covered with reaction medium, culture medium, and / or (bacterial) growth medium. In some embodiments, the reaction vessel and / or culture vessel is a well of a (multi)well plate, or a reaction vessel having multiple wells.

[0056] In the method according to the present invention, the presence of active Stx can be detected by depurination of the active Stx at a specific adenine of its target sequence in the oligonucleotide according to the present invention, which preferably also initiates chain cleavage, causing the oligonucleotide to be cleaved into two halves.

[0057] As a result, at least one label of the oligonucleotide according to the present invention is at least a cleavage-dependent label, which can indicate cleavage of the oligonucleotide by Stx and enable detection of active Stx (e.g., in the sample). The cleavage-dependent label preferably enables signal generation and / or signal change upon cleavage of the oligonucleotide according to the present invention by Stx.

[0058] In the embodiment, at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher.

[0059] In one embodiment, at least one fluorophore and at least one quencher are arranged such that at least one quencher quenches the fluorescence of at least one fluorophore unless the oligonucleotide is cleaved.

[0060] In the embodiment, at least one cleavage-dependent label comprises at least one luminescent dye.

[0061] In the embodiment, at least one cleavage-dependent label comprises at least one chromogenic dye or a dye for color detection.

[0062] In embodiments, the chromogenic dye may be contained in a chromogenic growth medium or culture medium, or a chromogenic substrate, and / or color detection may include these. In embodiments, color detection may be based on, or include, detection of an increase in color intensity, a change in color, and / or a shift in color.

[0063] In one embodiment, the at least one cleavage-dependent label comprises at least one label at the 3' end of the oligonucleotide and / or at least one label at the 5' end. In another embodiment, the at least one cleavage-dependent label comprises at least one label within the oligonucleotide sequence, at the 3' end and / or at least one label at the 5' end of the oligonucleotide.

[0064] In embodiments, at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher within the oligonucleotide sequence, at the 3' end, and / or at the 5' end of the oligonucleotide. In embodiments, at least one cleavage-dependent label comprises at least one fluorophore at the 5' end of the oligonucleotide and at least one quencher at the 3' end. In embodiments, at least one cleavage-dependent label comprises at least one fluorophore and / or quencher within the oligonucleotide sequence. In embodiments, at least one cleavage-dependent label comprises at least one fluorophore and / or quencher at the 3' end and / or 5' end of the oligonucleotide. In embodiments, the positions of the at least one fluorophore and at least one quencher described herein may be reversed or different.

[0065] In embodiments, the oligonucleotide comprises at least one Stx target sequence and / or recognition sequence, where the Stx target / recognition sequence preferably comprises at least one adenine. In embodiments, the at least one Stx target / recognition sequence is one or a portion thereof of the nucleotide sequence of the salsin-lysine loop (SRL) of the eukaryotic / mammalian 60S ribosome subunit, where the SRL nucleotide sequence comprises at least one adenine.

[0066] In the embodiment, the oligonucleotide is preferably single-stranded and optionally constitutes at least one loop structure or stem-loop structure.

[0067] In embodiments, the presence of a stem-loop structure can enable improved Stx detection. This is a remarkable difference from other RIPs such as lysine, where activity is independent of the stem-loop (Amukele et al., 2005, Biochemistry). Optimal detection of lysine activity is observed, for example, with RNA substrates having a length of 14 nucleotides (Chen et al., 1998, Biochemistry). Therefore, a stem-loop structure is not required for the catalytic activity of lysine on DNA. Similar results have been shown for RIP saporins, which are type 1 RIPs, and which do not cleave either the GAGA sequence motif or the stem-loop, but preferably cleave a tetraloop structure having an ACG sequence motif at the start of the loop (Hauf et al., 2022, ACS chemical biology). As a result, different RIPs have very different target sequences and target structures, and these must be used in their respective detection assays.

[0068] Since the requirements of other RIPs do not necessarily imply an ideal substrate for a particular RIP like Stx, it was particularly surprising that the nucleic acid constructs according to the present invention enable sensitive and reliable detection of Stx activity.

[0069] In some embodiments, the oligonucleotide is single-stranded RNA (ssRNA) or DNA (ssDNA). In some embodiments, the oligonucleotide is RNA or DNA. In some embodiments, the oligonucleotide comprises RNA and / or DNA.

[0070] In embodiments, the oligonucleotide contains DNA. In embodiments, the oligonucleotide is a DNA molecule. In embodiments, the oligonucleotide is (partially) single-stranded DNA (ssDNA). In embodiments, the oligonucleotide contains a partially single-stranded DNA molecule. In embodiments, the oligonucleotide is a partially single-stranded DNA molecule.

[0071] In some embodiments, the oligonucleotide comprises a single-stranded region and a double-stranded region. In some embodiments, the single-stranded region forms or includes a loop structure. In some embodiments, the double-stranded region forms or includes a stem structure.

[0072] In embodiments, the oligonucleotide comprises at least one loop structure or stem-loop structure, and preferably at least one single-stranded region and at least one double-stranded region, where the single-stranded region preferably comprises at least one loop structure and the double-stranded region preferably comprises at least one stem structure.

[0073] In some of these embodiments, the oligonucleotide comprises a stem-loop structure, where the loop structure is formed by a single-stranded region and the stem structure is formed by a double-stranded region. In some embodiments, the oligonucleotide comprises exactly one stem-loop structure having one stem structure and one loop structure.

[0074] In some preferred embodiments, at least one stem-loop structure of the oligonucleotide is, contains, or is similar to a salsine-lysine loop (SRL) structure.

[0075] In embodiments, the oligonucleotide comprises a single loop structure or a stem-loop structure and preferably has fewer than 26 nucleotides.

[0076] In embodiments, the oligonucleotide further comprises at least one linker sequence between the Stx target / recognition sequence and at least one label. In embodiments, the oligonucleotide further comprises at least one linker sequence between the SRL nucleotide sequence and at least one label.

[0077] In some embodiments, the 5' linker sequence comprises the nucleotide sequence ACTT, and / or the 3' linker sequence comprises the nucleotide sequence AGT.

[0078] In the embodiment, the SRL nucleotide sequence of the oligonucleotide includes at least one (nucleotide) sequence GAGAG.

[0079] In preferred embodiments, the oligonucleotide comprises the sequence GAGAG. In embodiments, the oligonucleotide comprises the sequence GAGAG, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. (nucleotide) sequence G A GA is considered essential as a recognition sequence (cleavage target sequence) for Stx. For the plant-derived toxin lysine (which also possesses RNA N-glycosidase activity), the recognition sequence GAGA has been shown to be sufficient (Endo et al., 1988, Glueck et al., 1992).

[0080] In some embodiments, particularly with substrates (oligonucleotides) without linkers, the detection signal generated is weak. In some embodiments, the use of at least one linker in the oligonucleotide according to the present invention is preferred. The additional use of linkers can lead to an improvement in the detection signal in such embodiments (Noble et al., 2005, Mao et al., 2018). In addition, where possible, a natural SRL structure is preferred, allowing base pairing due to the spatial proximity of F / Q.

[0081] For example, see the example comparing substrate 2 (without linker) with substrate number 4 (with linker). However, the length and sequence of the linker may be varied and, in embodiments, can be adapted for specific Stx variants or target bacterial strains of interest. In this case, the linker sequence may be shortened or may contain one or more additional nucleotides. In embodiments, the sequence outside the target motif (recognition sequence) for Stx may be varied in both its nucleotide sequence and length. For example, for lysine, mass spectrometry assays have already shown that detection of lysine is successful with a short substrate (e.g., 14-mer) containing the GAGA recognition sequence, where the structure and / or nucleotide sequence of the substrate outside this recognition sequence did not appear to be essential.

[0082] In one embodiment, the oligonucleotide comprises the sequence GAGAGGAGAG (SEQ ID NO: 1). In another embodiment, the oligonucleotide comprises the sequence GAGAGGAGAG, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0083] In one embodiment, the oligonucleotide comprises the sequence CGAGAGGAGAGG (SEQ ID NO: 2). In another embodiment, the oligonucleotide comprises the sequence CGAGAGGAGAGG, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0084] In some preferred embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC (SEQ ID NO: 3). In embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence AGTACGAGAGGAAC.

[0085] In some preferred embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence ACTTAGTACGAGAGGAACAGT.

[0086] In this embodiment, the oligonucleotide is in the sequence CTGAACTCAGTACG A Includes GAGGAACCGTTCAG (sequence number 4), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0087] In this embodiment, the oligonucleotide is CTGAACTCAGTACG A (F)GAGGAACCGTTCAG(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0088] In this embodiment, the oligonucleotide is CTGAACTCAGTACG A (M)GAGGAACCGTTCAG(M) comprises a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0089] In this embodiment, the oligonucleotide is of the sequence TCAGTACG A Includes GAGGAACC (sequence number 5), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0090] In the embodiment, the oligonucleotide is (F)-TCAGTACG A The nucleotide sequence comprises GAGGAACC-(Q), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0091] In the embodiment, the oligonucleotide is (M)-TCAGTACG A The nucleotide sequence comprises GAGGAACC-(M), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0092] In this embodiment, the oligonucleotide is of the sequence TCAGTACG A GAGG A Includes GAGGAACC (sequence number 6), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0093] In the embodiment, the oligonucleotide is (F)-TCAGTACG A GAGG A The nucleotide sequence comprises GAGGAACC-(Q), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0094] In the embodiment, the oligonucleotide is (M)-TCAGTACG A GAGG A The nucleotide sequence comprises GAGGAACC-(M), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0095] In this embodiment, the oligonucleotide is sequence ACTTAGTACG A Includes GAGGAACAGT (sequence number 7), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0096] In some of these embodiments, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end are linker sequences.

[0097] In the embodiment, the oligonucleotide is (F)-ACTTAGTACG A The nucleotide sequence comprises GAGGAACAGT-(Q), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0098] In a preferred embodiment, this oligonucleotide is number 4 in Table 1.

[0099] In this embodiment, the oligonucleotide is (M)-ACTTAGTACG A The nucleotide sequence comprises GAGGAACAGT-(M), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0100] In this embodiment, the oligonucleotide is (M)-ACTGCTTAGTACG A The nucleotide sequence comprises GAGGAACCATAGT-(M), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0101] In this embodiment, the oligonucleotide is (F)-ACTGCTTAGTACG AThe nucleotide sequence comprises GAGGAACCATAGT-(Q), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0102] In this embodiment, the oligonucleotide is of the sequence ACTTAGTAC(Q)G A Contains GAGGAACAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0103] In some embodiments, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end are linker sequences.

[0104] In this embodiment, the sequence ACT at the 5' end and / or the sequence AGT at the 3' end are linker sequences.

[0105] In the embodiment, the oligonucleotide comprises at least one 5' linker sequence and / or a 3' linker sequence.

[0106] In an embodiment, the 5' linker sequence and / or the 3' linker sequence include the sequences ACT and / or AGT. In an embodiment, the 5' linker sequence includes the sequence ACT. In an embodiment, the 3' linker sequence includes the sequence AGT. In an embodiment, the 5' linker sequence includes the sequence AGT. In an embodiment, the 3' linker sequence includes the sequence ACT.

[0107] In some embodiments, the 5' linker sequence includes the sequence ACTN, where N is preferably A, G, T, or C, and particularly preferably T or G. In some embodiments, the 3' linker sequence includes the sequence NAGT, where N is preferably A, G, T, or C, and particularly preferably A or C. In some embodiments, the 5' linker sequence includes the sequence AN, where N is preferably A, G, T, or C, and particularly preferably C, A, or T. In some embodiments, the 3' linker sequence includes the sequence NT, where N is preferably A, G, T, or C, and particularly preferably G, T, or A.

[0108] In some embodiments, the oligonucleotide comprises at least one 5' linker sequence and / or a 3' linker sequence, preferably having a length of 1 nucleotide (nt) to 10 nt. In some embodiments, the oligonucleotide comprises at least one 5' linker sequence and a 3' linker sequence. In some embodiments, the linker sequence has a length of 1 nucleotide (nt) to 10 nt, or 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, or 10 nt. In some embodiments, the linker sequence has a length of 1 nt to 5 nt, preferably 2 nt to 4 nt, 3 nt to 4 nt, or 3 nt.

[0109] In embodiments, the oligonucleotide comprises at least one 5' linker sequence and one 3' linker sequence, where the linker sequences preferably comprise complementary nucleotide sequences and / or preferably hybridize with each other (at least partially). In embodiments, the oligonucleotide comprises complementary nucleotide sequences at each of its 5' and 3' ends, preferably having a length of 1 nt to 10 nt. In embodiments, the complementary nucleotide sequences (e.g., linker sequences) hybridize at the 5' and 3' ends of the oligonucleotide to form a double-stranded stem structure (where a portion of the oligonucleotide preferably forms a single-stranded loop structure, thus forming a stem-loop structure).

[0110] In this embodiment, the oligonucleotide is (F)-ACTTAGTAC(Q)G A The nucleotide sequence comprises GAGGAACAGT-(Q), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of the at least one fluorophore and the at least one quencher may be reversed.

[0111] In this embodiment, the oligonucleotide is (M)-ACTTAGTAC(M)G A The nucleotide sequence comprises GAGGAACAGT-(M), or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where M is at least one cleavage-dependent label.

[0112] In embodiments, oligonucleotides have nucleotide (nt) lengths of 4-21, 4-25, 4-27, 4-28, 4-29, 4-30, 5-50, 5-30, or 5-20. In embodiments, oligonucleotides have nucleotide lengths of, for example, 5-25, 5-20, 5-15, 5-10, 8-30, 8-25, 8-27, 8-20, 8-15, 8-10, 9-30, 9-29, 9-28, 9-27, 9-26, 9-25, 9-24, 9-23, 9-22, 9-21, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, or 9-10. The length of an oligonucleotide can be defined by a range formed by any of the aforementioned values, for example, any value combined with any other value as the endpoint of the range.

[0113] In some embodiments of the oligonucleotides listed above, underlined nucleotides are preferably depurinated nucleotides, particularly adenine (A), within the Stx recognition sequence; bold nucleotides mark the (optionally replicated) recognition sequence; and italicized nucleotides indicate the linker sequence. In some embodiments, the font of the oligonucleotides listed above is meaningless and signifies only the nucleotide sequence itself.

[0114] In a preferred embodiment, the oligonucleotide comprises the sequence GAGA. In an embodiment, the oligonucleotide comprises the sequence GAG, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In such an embodiment, the oligonucleotide comprises at least one GAG ​​sequence because this sequence represents the shortest target sequence (substrate) or the smallest target sequence for STX. In some embodiments, the oligonucleotide (substrate) is or comprises a very long nucleic acid molecule containing at least one or more target sequences and / or non-target sequences.

[0115] In the embodiment, the oligonucleotide comprises the sequence XXXGAGAGXXX, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence containing 4 nt to 21 nt.

[0116] In embodiments, the oligonucleotide comprises the sequence NNNGAGAGNNN, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length containing nucleotides A, T, C, and / or G, preferably a sequence containing 4 nt to 21 nt.

[0117] In embodiments, the oligonucleotide comprises the sequence XXXGXGXGXXX, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence containing 4 nt to 21 nt.

[0118] In the embodiment, the oligonucleotide comprises the sequence NNNGRGRGNNN (SEQ ID NO: 14), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length, preferably a sequence containing nucleotides A, T, C, and / or G, ranging from 4 nt to 21 nt, and R represents nucleotide A or G.

[0119] In the embodiment, the oligonucleotide comprises the sequence NNNAGTACGAGAGGAACNNN (SEQ ID NO: 12), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length, preferably a sequence containing nucleotides A, T, C, and / or G, ranging from 4 nt to 21 nt.

[0120] In the embodiment, the oligonucleotide comprises the sequence NNNAGTACGRGRGGAACNNN (SEQ ID NO: 15), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length, preferably a sequence containing nucleotides A, T, C, and / or G, ranging from 4 nt to 21 nt, and R represents nucleotide A or G.

[0121] In embodiments, the oligonucleotide comprises the sequence NNNGTACGRGRGNARNNN (SEQ ID NO: 25), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length, preferably a sequence containing nucleotides A, T, C, and / or G, ranging from 4 nt to 21 nt, and R represents nucleotide A or G.

[0122] In the embodiment, the oligonucleotide comprises the sequence ACTTXXXAGTACGAGAGGAACXXXAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence containing 4 nt to 21 nt.

[0123] In the embodiment, the oligonucleotide comprises the sequence ACTXXXTAGTACGAGAGGAACXXXAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where XXX represents a nucleotide sequence of any length, preferably a sequence containing 4 nt to 21 nt.

[0124] In the embodiment, the oligonucleotide comprises the sequence ACTTNNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 8), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length containing nucleotides A, T, C, and / or G, preferably a sequence containing 4 nt to 21 nt.

[0125] In the embodiment, the oligonucleotide comprises the sequence ACTNNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 11), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, where NNN represents a nucleotide sequence of any length containing nucleotides A, T, C, and / or G, preferably a sequence containing 4 nt to 21 nt.

[0126] In the embodiment, the oligonucleotide contains at least a specific sequence GAGAG within the oligonucleotide region, where the entire oligonucleotide, including the GAGAG adjacent sequences, contains a sequence that is 70%, 80%, 90%, 95%, or 99% identical to the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). Therefore, in the embodiment, the central target sequence GAGAG can be positioned as a specific, and preferably required, sequence, where the adjacent sequences (outside the GAGAG sequence) may exhibit some degree of sequence variation.

[0127] In the embodiment, the oligonucleotide contains at least a specific sequence GAGAG within the oligonucleotide region, where the entire oligonucleotide, including the GAGAG adjacent sequences, contains a sequence that is 70%, 80%, 90%, 95%, or 99% identical to the sequence ACTGCTTAGTACGAGAGGAACCATAGT (SEQ ID NO: 13). Therefore, in the embodiment, the central target sequence GAGAG can be positioned as a specific, and preferably required, sequence, where the adjacent sequences (outside the GAGAG sequence) may exhibit some degree of sequence variation.

[0128] In the embodiment, the oligonucleotide includes the sequence ACTAGTACGAGAGGAACGT (SEQ ID NO: 16), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0129] In the embodiment, the oligonucleotide includes the sequence AATAGTACGAGAGGAACTT (SEQ ID NO: 17), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0130] In the embodiment, the oligonucleotide includes the sequence ACTTAGTACGAGAGGAAAAGT (SEQ ID NO: 18), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0131] In the embodiment, the oligonucleotide includes the sequence ACTGAGTACGAGAGGAACAGT (SEQ ID NO: 19), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0132] In the embodiment, the oligonucleotide includes the sequence ATTAGTACGAGAGGAACAT (SEQ ID NO: 20), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0133] In the embodiment, the oligonucleotide includes the sequence ACTTAGTACGGGAGGAACAGT (SEQ ID NO: 21), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0134] In the embodiment, the oligonucleotide includes the sequence ACTTAGTACGAGGGGAACAGT (SEQ ID NO: 22), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0135] In the embodiment, the oligonucleotide includes the sequence ACTTAGTACGGGGGGAACAGT (SEQ ID NO: 23), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0136] In the embodiment, the oligonucleotide includes the sequence AGTTTGTACGAGAGCAGGACT (SEQ ID NO: 24), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.

[0137] [Table 1] Table 1: Embodiments of oligonucleotides according to the present invention. These can function as synthetic ssDNA substrates based on the salsin-lysine loop (SRL) sequence for detecting Stx enzyme activity. SRL substrates investigated in order of development are shown with their respective sequences, characteristics, fluorophores (F): Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein) and quencher (Q). Sequence color coding: Underlined = depurinated adenine in the Stx recognition sequence (A); Bold = (repeated) recognition sequence; Italicized = linker sequence. Oligonucleotide number 4 was investigated for Stx activity in several examples (e.g., at a concentration of 100 μM). Substrate designation:Substrate name Sequence (5'→3'): Sequence (5'→3') Fluorophore (F): Fluorophore (F) Quencher (Q): Quencher (Q) Feature: Adenine label: Adenine label Reduced sequence: Reduced sequence Double recognition sequence (GAGAG): Modified ends before F / Q: sequence identical to substrate 5. Two quenchers (internal "Zen", terminal): Larger loop structure: Shortened stem: shortened stem Shortened stem with A / T pairing (2 van der Waals):

[0138] [Table 2] Table 2: Embodiments of oligonucleotides according to the present invention. These can function as synthetic ssDNA substrates based on the salsin-lysine loop (SRL) sequence for detecting Stx enzyme activity (see also Figure 3). The SRL substrates investigated are shown with their respective sequences, features, fluorophores (F), and quenchers (Q). Sequence color coding: Underlined = depurinated adenine (A) in the Stx recognition sequence; Bold = (duplicate) recognition sequence; Italic = linker sequence. Substrate name:Substrate name Feature: Features Sequence (5'→3'): Sequence (5'→3') Fluorophore labeling at adenine: F / Q at the 5'- / 3' end: F / Q at the 5'- / 3' end Recognition sequence GAGAG 2x: Recognition sequence GAGAG 2x Modified linkers: Modified linkers Larger loop structure: Shortened stem: shortened stem Shortened stem with A / T pairing (2 van der Waals): RNA substrate; modified linkers: RNA substrate; modified linker Exclusively A: A only Shortened sequence: abbreviated sequence

[0139] In the foregoing, a method for detecting active Shiga toxin in a sample is: a) A step of preparing at least one single-stranded oligonucleotide according to the present invention, b) The process of preparing the sample to be tested for Shiga toxin, c) A step of incubating the sample with at least one single-stranded oligonucleotide, wherein a signal, such as a fluorescent signal, is generated as soon as Shiga toxin depurines at least one adenine of the oligonucleotide, and the oligonucleotide is cleaved therein. d) A step of detecting a signal from a label, wherein the signal indicates the presence of Shiga toxin in the sample and, if necessary, Shiga toxin-producing pathogens. Includes.

[0140] [Table 3] Table 3: Examples of embodiments of oligonucleotides according to the present invention. The sequences disclosed in this table may include both DNA and RNA sequences (therefore, in this specification, T (thymine) also represents U (uracil)). "NNN" represents a nucleotide sequence of any length containing nucleotides A, T, C, and / or G, and "R" represents nucleotide A or G. Sequence: Array Description: SLR Homo sapiens Rattus Norvegicus

[0141] In an embodiment of the method according to the present invention, in step c), as soon as Shiga toxin depurines at least one adenine of the oligonucleotide, a signal (from at least one label), such as a fluorescent signal, is generated, and the oligonucleotide is cleaved.

[0142] In embodiments of the method according to the present invention, the Shiga toxin contained in the sample is selected from the group including Stx1 and Stx2, or related Stx types.

[0143] In embodiments of the method according to the present invention, the Shiga toxin contained in the sample is selected from the group including Stx1 and Stx2, Stx1a to Stx1d, and Stx2a to Stx2g. In embodiments of the method according to the present invention, the Shiga toxin contained in the sample is selected from the group including Stx1 and Stx2, Stx1a to Stx1d, and Stx2a to Stx2o.

[0144] In embodiments of the method according to the present invention, the Shiga toxin-producing pathogen is Shiga toxin-producing E. coli bacterium (STEC), Acinetobacter and / or Shigella bacteria, such as Shigella dysenteriae.

[0145] In embodiments of the method according to the present invention, the Shiga toxin-producing pathogen is Shiga toxin-producing E. coli bacterium (STEC).

[0146] In embodiments of the method according to the present invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing Shigera bacterium, such as Shigera decentellie.

[0147] In embodiments of the method according to the present invention, the Shiga toxin-producing pathogen is a Shiga toxin-producing Acinetobacter bacterium.

[0148] In an embodiment of the method according to the present invention, the oligonucleotide in step a) is present in the agar medium, and in step b) the sample is applied to the agar medium.

[0149] In embodiments of the method according to the present invention, the detection in step d) includes signal recognition in an agar medium.

[0150] In some embodiments, the agar medium is solid, semi-solid (viscous), or liquid. In some embodiments, the agar medium is solid or semi-solid (viscous) and is present in a culture plate / culture dish (as "agar plate").

[0151] In embodiments of the method according to the present invention, step a) the oligonucleotide is present in the agar medium, step b) the sample is applied to the agar medium, and / or step d) detection includes signal recognition in the agar medium.

[0152] In an embodiment of the method according to the present invention, the oligonucleotide is immobilized on a solid phase in step a).

[0153] In some embodiments, the solid phase can be a substrate, column material, beads (e.g., magnetic beads or agarose beads), a surface, glass, plastic, resin, a reaction vessel, a well or surface within a well plate, an array, a tip, or any other surface or solid phase known to those skilled in the art that is suitable for immobilizing oligonucleotides. In some embodiments, in step a), the oligonucleotides are immobilized on a solid phase, where the solid phase is part of the reaction vessel and / or culture vessel. In some embodiments, the reaction vessel and / or culture vessel is filled with or covered with reaction medium, culture medium, and / or (bacterial) growth medium.

[0154] In an embodiment of the method according to the present invention, in step a), the oligonucleotide is present in a liquid reaction solution or detection solution, and in step b), the sample is introduced into a liquid reaction medium.

[0155] In the embodiment, the oligonucleotide is present in the reaction solution, detection solution, (bacterial) growth medium, or the aforementioned mixture in step a), where the reaction solution, detection solution, or (bacterial) growth medium is present in the wells of the reaction vessel or well plate.

[0156] In the embodiment, the oligonucleotide in step a) is present in the reaction solution, detection solution, (bacterial) growth medium, or the aforementioned mixture, where the reaction solution, detection solution, or (bacterial) growth medium contains a dye or chromogenic pigment for color detection. Such a (bacterial) growth medium is preferably a chromogenic growth medium and / or a chromogenic culture medium. In the embodiment, color detection also includes fluorescence detection.

[0157] In the embodiment, the oligonucleotide is present in the detection solution, reaction solution, or buffer (e.g., detection buffer, e.g., acetate buffer).

[0158] In embodiments of the method according to the present invention, the oligonucleotide is present in a reaction medium or reaction solution (liquid, semi-solid, or solid) in step a), and in step b), the sample is introduced into a liquid or (semi-)solid reaction medium.

[0159] In the embodiment, the oligonucleotide is present in a solid or liquid (bacterial) growth medium, preferably in a growth agar plate (as the growth medium).

[0160] In embodiments, the oligonucleotide is present in a growth agar plate (as the growth medium) containing a solid or liquid growth medium, preferably a detection solution or reaction solution / buffer (e.g., a detection buffer, e.g., an acetate buffer). In embodiments, the oligonucleotide is present in the growth agar plate and / or the detection agar plate. In embodiments, the oligonucleotide is present in a liquid or solid growth medium and / or the detection medium.

[0161] In the embodiment, the oligonucleotide is present in the detection solution or reaction solution / buffer (e.g., detection buffer, e.g., acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as a growth medium), or the aforementioned mixture.

[0162] In embodiments, the present invention includes at least, a) Oligonucleotides according to the present invention, b) Optionally, at least one reaction buffer, the reaction buffer is preferably a depurinating buffer containing ammonium acetate, Regarding the kit that includes this.

[0163] In embodiments, the present invention includes at least, a) Oligonucleotides according to the present invention, b) Optionally, at least one reaction solution and / or detection solution, wherein the reaction solution and / or detection solution is preferably a depurinating buffer containing ammonium acetate, Regarding the kit that includes this.

[0164] In embodiments, the depurination buffer may also contain sodium acetate, potassium acetate, or potassium citrate instead of, or in addition to, ammonium acetate.

[0165] In embodiments, the present invention relates to a kit for carrying out a method according to the present invention, wherein the kit preferably comprises at least one oligonucleotide according to the present invention.

[0166] This disclosure also includes kits, packs, and multi-container units comprising one or more kit components or assay components described herein.

[0167] The embodiments and features of the present invention described in relation to methods, oligonucleotides, and kits are deemed to be disclosed in relation to any other aspect of this disclosure, and as a result, features that characterize a method can be used to characterize an oligonucleotide or kit, and vice versa. The various aspects of the present invention are united by the common and remarkable finding that active Stx can be detected by providing oligonucleotides according to the present invention, and therein they benefit from, are based on, and / or relate to.

[0168] Detailed description of the invention All cited patent and non-patent literature documents, by reference, become part of this specification in their entirety.

[0169] A "nucleotide" is an organic molecule composed of three subunits: a nucleic acid base, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphate groups. A "nucleic acid base" is a nitrogen-containing biological compound and may also be called a "nucleic acid base" or "base." Therefore, these terms may be used interchangeably herein. In the case of the major or standard nucleic acid bases of DNA, the nucleic acid bases include guanine (G), adenine (A), cytosine (C), and thymine (T), while in RNA, uracil (U) is used instead of thymine. In addition to the major or standard nucleic acid bases of DNA and RNA, other synthetic and / or naturally occurring nucleic acid bases, and / or (chemically) modified nucleic acid bases, such as hm5C (5-hydroxymethylcytidine), m5C (5-methylcytidine), N4-methylcytosine, m6A (N6-methyladenosine), 5-methylaminomethyl-2-thiouridine (mam5s2u), 1-methyladenosine, 1-methylpseudolidine, 1-methylguanosine, 1-methylinosine, 2,2-Dimethylguanosine, 2-Methyladenosine, 2-Methylguanosine, 3-Methylcytidine, N4-Methylcytosine, 5-Methylcytidine, N6-Methyladenosine, 7-Methylguanosine, 5-Methylaminomethyluridine, Beta-D-Mannosylkeosin, 5-Methoxycarbonylmethyl-2-thiouridine, 5-Methoxycarbonylmethyluridine, 5-Methoxyuridine, 2-Methylthio-N6-Isopentenyladenosine, N-((9-Beta-D-Ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-Beta-D-Ribofuranosylpurine-6-yl),N-methylcarbamoyl)threonineuridine-5-oxoacetateuridine-5-oxyacetic acid, Weibtoxosin, Pseudouridine, Keosin, 2-Thiocytidine , 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6-yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridinewybutosine, 3-(3-amino-3-carboxypropyl)uridine, 4-acetylcytidine, 5-(carboxyhydroxylmethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseuduridine, 2'-O-methylguanosineinosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseuduridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methylguanosine, 3-methylcytidine, p(pseudolidine), q(keosin), s2c(2-thiocytidine), 5fC(5-formylcytosine), 5caC(5-carboxylcytosine), 2'-fluoro, 2'-O-methyl, 2'-fluoroarabinose nucleic acid, hexitol nucleic acid, 2'-O-methoxyethyl, ribuloNA, (1'-3')-β-L-liburo nucleic acid, α-L-threose nucleic acid, 3'-2'-phosphonomethylthreosyl nucleic acid, and 2'-deoxyxyl nucleic acid may be used in the context of the present invention. All possible chemical modifications, as well as synthetic and / or naturally occurring nucleic acid bases, are known to those skilled in the art (e.g., McCown et al., 2020, WIREs RNA; Sood et al., 2019, J Cheminform; https: / / dnamod.hoffmanlab.org / ).

[0170] In embodiments, each nucleic acid base of DNA: guanine (G), adenine (A), cytosine (C), and thymine (T), and uracil (U) may be chemically modified and / or replaced by one of the above bases. In embodiments, "X" in the nucleotide sequence includes any chemically modified base and / or any of the above bases.

[0171] In the context of the present invention, an oligonucleotide or nucleic acid sequence “sequence variant” or “variant” may represent a nucleic acid sequence different from the original sequence due to one or more mutations, such as one or more substitutions, insertions, and / or deletions of nucleotides. In embodiments, the sequence variations described herein may apply with respect to conserved substitutions and / or percent identity for one or more embodiments described throughout this application. A nucleic acid substitution as defined herein is a change to the nucleic acid sequence of a nucleic acid molecule, where one or more nucleic acids are replaced by an equal number of (different) nucleic acids, resulting in a change in the nucleic acid sequence. As with additions, substitutions may be natural or artificial. An oligonucleotide “variant” as defined in the context of the present invention may represent one or more conserved nucleic acid substitutions compared to their native, i.e., non-mutated physiological sequence. These nucleic acid sequences are, in particular, included in the term “variant” as defined herein.

[0172] In embodiments of the present invention, the oligonucleotide or target sequence may exhibit some variation in sequence and / or length compared to the specific sequences described herein. In embodiments, nucleic acid molecules such as oligonucleotides may have the addition or deletion of 0 to 10 nucleotides at the 5' or 3' end (end / terminus) of the sequence with reference to the specific sequences described herein. As used herein, the term "addition or deletion of 0 to 10 nucleotides at the 5' or 3' end of a sequence" means that a nucleic acid has a) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides deleted at its 3' end, or b) has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 3' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, or 8 additional nucleotides at its 5' end. c) having 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 3' end, or d) having 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides deleted at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides deleted at its 3' end.

[0173] In embodiments, the methods, kits, or oligonucleotides of the present invention are characterized in that the oligonucleotide and / or one or more Stx target sequences contain a nucleotide sequence having 80% or more, 85% or more, or preferably 90% or 95% or more sequence identity with respect to the sequences provided herein, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. Sequence variants having 80% to 99% sequence identity are preferably functionally similar, i.e., sequences that differ in nucleotide sequence but still exhibit similar specificity to the detected Stx, and as a result, the function of the oligonucleotide and / or one or more Stx target sequences is maintained within the scope of the present invention. Functionally similar sequences can be tested without inventive steps by a person skilled in the art, based on the information provided herein, by testing their Stx cleavage and / or depurination properties and priority, for example, within the scope of the methods described herein.

[0174] As used herein, a specific “reference sequence,” for example, “percent (%) sequence identity,” “sequence with % identity,” “percent (%) sequence homology,” or “sequence with % homology” to one of the nucleic acid sequences disclosed herein, means the percentage of nucleotides in a particular sequence that are identical to the nucleotides of the reference sequence, determined by comparing two optimally aligned sequences through a comparison window, where the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (which does not include additions or deletions) for optimal alignment of two or more sequences. The percentage is calculated by determining the number of positions in which identical nucleic acid bases or amino acid residues occur in two or more sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.

[0175] As used herein, “sequence identity,” “identity,” “sequence homology,” or “homonymy” with respect to two nucleic acid sequences refers to a specific percentage of residues that are the same in two sequences when aligned to maximum match through a specific comparison window, as measured by a sequence comparison algorithm or by visual inspection.

[0176] Insertions and substitutions are possible, in particular, at sequence locations where the three-dimensional structure of the target sequence is not altered, or is altered only to a desired extent.

[0177] In the sense of the present invention, a “cleavage-dependent label” is a detectable label that generates a signal, where the cleavage of an oligonucleotide triggers a change in the signal. Therefore, all detectable labels that exhibit a signal change upon cleavage of an oligonucleotide according to the present invention can be used. Examples of cleavage-dependent labels are described herein and will not require undue effort from those skilled in the art to identify or use such labels.

[0178] In the context of the present invention, “labeling” may, in embodiments, indicate one or more fluorophores or one or more quenchers. Thus, in the context of the present invention, an oligonucleotide may, in embodiments, support or contain one or more fluorophores and / or quenchers. The proximity of the fluorophores to the quenchers prevents the detection of their fluorescence, but cleavage of the oligonucleotide by Stx interrupts the proximity of the dye (fluorophore)-quencher, enabling the emission of unquenched fluorescence, which can be detected, for example, upon laser excitation. In embodiments, the oligonucleotide comprises at least one fluorophore and at least one quencher (these preferably exist “in pairs”), where the quencher preferably suppresses the fluorophore signal as long as the oligonucleotide is not cleaved, where the at least one fluorophore and at least one quencher are relative to each other at either their respective ends (3' and 5') and / or within the oligonucleotide sequence.

[0179] In embodiments where multiple quencher-fluorophore pairs are present within the oligonucleotide, the pairs may also be located, for example, at at least one end of the oligonucleotide and / or at different positions within the sequence. The oligonucleotide may, in embodiments, be unlabeled, contain one or more labels, for example, unlabeled, or with at least one, two, three, four, or five labels, or even up to six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty labels, or exactly zero, one, two, three, four, or five labels, or even six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty labels. In some embodiments, the oligonucleotide may be unlabeled, or have one, two, or up to three labels. In other embodiments, the oligonucleotide may be unlabeled, or have one, two, three, four, five, or six or more labels.

[0180] The term "nucleic acid" refers without limitation to nucleic acid molecules, including DNA, ssDNA, dsDNA, RNA, mRNA, tRNA, lncRNA, ncRNA, microRNA, siRNA, rRNA, sgRNA, piRNA, rmRNA, snRNA, snoRNA, scaRNA, gRNA, or viral RNA. In this specification, a nucleic acid sequence refers to a sequence of nucleotides, where nucleotides are represented by their nucleic acid bases in DNA (guanine (G), adenine (A), cytosine (C), and thymine (T)) and in RNA (guanine (G), adenine (A), cytosine (C), and uracil (U)). In this specification, a nucleic acid sequence may also refer to a sequence of consecutive letters or nucleic acid bases (consisting of G, A, C, and T or U) representing an actual sequence of consecutive nucleic acids in a DNA or RNA strand. This nucleic acid sequence can be identified and characterized biochemically and bioinformatically using DNA sequencing or RNA sequencing, or it can be specifically detected by a complementary nucleic acid probe (e.g., a mediator probe in the embodiments herein) in the context of a detection reaction, for example, PCR, real-time PCR, or digital PCR. Sequence analysis may also include comparing the obtained nucleic acid sequence or a detection signal specific to it with the detection signals of one or more reference nucleic acid sequences and / or housekeeping genes. The term nucleotide may be abbreviated as "nt". The term base pair (two nucleic acid bases linked to each other via a hydrogen bond) may be abbreviated as "bp".

[0181] As used herein, the term “oligonucleotide” refers to, or may include, nucleic acid molecules having a specific length of consecutive nucleotides. In the context of the present invention, the terms “oligonucleotide” and “nucleic acid molecule,” or in some contexts, “oligonucleotide” and “SRL,” may be used interchangeably. Oligonucleotides are short DNA or RNA molecules (oligomers). Oligonucleotides are generally characterized by the sequence of nucleotide residues that make up the molecule. Oligonucleotides can usually form sequence-specific structures, sometimes double-stranded or double-stranded structures, as well as single-stranded and / or loop structures that extend / form over the entire sequence or part thereof.

[0182] In the context of the present invention, “target sequence” (or recognition sequence) refers to any desired nucleic acid sequence that can function as a target sequence for depurination and / or cleavage by Stx in the method or oligonucleotide according to the present invention. The target sequence may preferably be a DNA sequence or an RNA sequence. The target sequence may represent part or all of the nucleic acid sequence of the target DNA or oligonucleotide.

[0183] In the context of the present invention, “signal change” refers to a change or appearance of a detectable signal. In embodiments, this may be, for example, a change in fluorescence, a change in color, a coloration, an emission signal or light signal, or any other detectable signal. This signal change is preferably a significant, distinguishable, and / or characteristic change in a single signal that is clearly distinguishable from a potential baseline or background signal, or ambient noise or background noise (e.g., a negative control or buffer / culture control). Those skilled in the art will recognize that under certain test conditions in the context of signal detection, fluorophores, dyes, or other labels may generate nonspecific signals, baseline signals, or ambient noise or background noise. Therefore, in the context of the present invention, a signal change preferably refers to a significant, distinguishable, and / or characteristic change in a (detectable) signal, and does not refer to a baseline or background signal, or ambient noise or background noise. In embodiments, this signal change may mean an increase in fluorescence intensity, in other words, an increase in fluorescence signal. In embodiments, this signal change may mean an increase in emission intensity, in other words, an increase in emission signal. In some embodiments, this signal change may mean an increase in color intensity or a change in color. In some embodiments, the signal change is a decrease in signal. An increase in signal is preferably due to the fact that the oligonucleotide according to the present invention is cleaved and / or depurinated by Stx in the presence of Stx.

[0184] In embodiments, the number of cleavages, digestions, and / or separations that occur at each label increases, thereby, for example, in embodiments, at least one fluorophore is released and / or separated from its quencher (i.e., the distance between the quencher and the fluorophore increases, and as a result, the fluorescence signal is no longer quenched by the quencher). Thus, the increase in released and / or unquenched fluorophores (increase in number) results in an increase in the fluorescence signal, which is specific and indicates the presence of (enzymatically) active Stx.

[0185] A "fluorophore" (or fluorochrome, similar to a chromophore) is a fluorescent chemical compound that can re-emit light when excited by light. The fluorophores used as labels in the construction of the labeled probes of the present invention are not limited to rhodamine and its derivatives such as Texas Red, fluorescein and its derivatives such as 5-bromomethylfluorescein, pyrentrisulfonates such as Lucifer Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, monobromoviman, Cascade Blue, monobromotrimethylammoniobuimane, 7-NH2-4CH3-25-coumarin-3-acetate (AMCA), FAM, TET, CAL Fluor Gold 540, JOE, VIC, Quasar 570, CAL Fluor Orange 560, Cy3, NED, Oyster 556, TMR, CAL Fluor Red 590, HEX, ROX, LC Red 610, CAL Fluor Red 610, Texas Red, LC Red 610, CAL Fluor Red 610, LC Red 640, CAL Fluor Red 635, Cy5, LC Red 670, Quasar 670, Oyster 645, LC Red 705, Cy5.5, BODIPY FL, Rhodamine Green, Oregon Green 30 488, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, Cal Orange, BODIPY TMR-X, JOE, HEX, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591, Cy3.5, Cal Red / Texas Red, BODIPY TR-X, BODIPY 630 / 665-X, Quasar-670 / Cy5, Pulsar-650, Dy490, Atto-488, Atto532, Atto-Rho-6G, Dy590, Atto-Rho101, Cy5, Dy-636, Atto-647N, Cy5.5, Dy682, Atto-680, BMN-488, BMN-505, BMN-536, BMN-562, derivatives such as rhodamine and Texas Red, derivatives such as fluorescein and 5-bromomethylfluorescein, Lucifer Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, 7-NH2-4CH3-25-coumarin-3-acetate (AMCA), monobromovimane, pyrentrisulfonates, e.g., Cascade Blue, and monobromotrimethylammoniobuimane, FAM, TET, CAL Fluor Gold 540, HEX, JOE, VIC, CAL Fluor Orange 560, Cy3, NED, Quasar 570, Oyster 556, TMR, CAL Fluor Red 590, ROX, LC red 610, CAL Fluor Red 610, Texas red, LC red 610, CAL Fluor Red 610, LC red 640, CAL Fluor Red 635, Cy5, LC red 670, Quasar 670, Oyster 645, LC red 705, Cy5.5, BODIPY FL, Oregon Green 30 488, Rhodamine Green, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, JOE, HEX, Cal Orange, BODIPY TMR-X, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591, Cy3.5, Cal Red / Texas Red, BODIPY TR-X, BODIPY Includes 630 / 665-X, Pulsar-650, and Quasar-670 / Cy5.

[0186] Quenching refers to any process that reduces the fluorescence intensity of a given substance. Quenching underlies Förster resonance energy transfer (FRET) assays, static or contact quenching assays, or a combination of both. FRET is a dynamic quenching mechanism, as energy transfer occurs while the donor is in an excited state. Contact quenching requires immediate spatial proximity in the form of physical contact between the donor and the quencher. A quencher is a molecule that eliminates the fluorescence emitted from a fluorophore when the fluorophore is excited by the light source of a PCR cycler or detector. Quenchers used as labels in the design of the labeled signal oligo and / or base chain of the present invention include, without limitation, DDQ-I, Iowa Black, Iowa Black FQ, QSY-9, BHQ-1, QSY-7, BHQ-2, DDQ-II, 22 Eclipse, Iowa Black RQ, QSY-21, BHQ-3 Dabcyl, QSY-35, BHQ-0, ElleQuencher, BMN-Q1, BMN-Q2, BMN-Q60, BMN-Q-535, BMN-Q590, BMN-Q620, and BMN-Q650. Those skilled in the art are familiar with suitable reporter-quencher pairs and know which to select for a particular application.

[0187] In the context of the present invention, “sample” preferably refers to a biological sample obtained or isolated from a patient, subject, tissue, cell, yeast, or bacterial culture, from the environment, or preferably from food, animal, plant, or other biological source. As used herein, the term “sample” may refer, for example, to a sample of bodily fluid or tissue obtained for the purpose of diagnosis, prognosis, or evaluation of a subject of interest, such as a patient. Preferably, the sample is a sample of bodily fluid such as feces, blood, serum, plasma, cerebrospinal fluid, urine, saliva, sputum, pleural fluid, cells, cell extracts, tissue samples, tissue biopsies, or fecal samples. In particular, the sample is blood, plasma, serum, or urine. Alternatively, the sample may be obtained from tissue, cell, yeast, or bacterial culture, from the environment, or from food or another biological source.

[0188] The sample may be selected from the group including liquid samples, solid samples, biopsies, liquid biopsies, tissue samples, cell culture samples, food samples, environmental samples, or samples derived from exchange. The sample may further include, or may be, body fluids, whole blood or blood components, plasma, serum, cells, tissues, saliva, sputum, mucus, phlegm, semen, vaginal fluid, cerebrospinal fluid, urine, or pleural fluid.

[0189] Culture media, also known as growth media (these terms may be used interchangeably herein), are used to culture microorganisms, cells, and tissues, and can be distinguished, for example, between liquid (e.g., broth, nutrient broth, or nutrient solution), semi-liquid (viscous), and gelled ("solid") culture media (nutrient media).

[0190] Solid culture media are culture media that are in gel form due to the addition of a gelling agent (e.g., agar-agar). Solid culture media are mainly used for analytical purposes, as they also allow for the quantification of microorganisms. Semi-solid culture media are mainly used in a high-level state (called "high-level tubes") in test tubes. This so-called "soft agar" contains a lower concentration of agar-agar than is usually found in more solid culture media. In embodiments, the culture medium may contain nutrients for bacterial or cell growth, or it may contain additional substrates such as oligonucleotides and / or buffer reagents and / or detection reagents as described herein.

[0191] The terms “patient” and “host” may be used interchangeably herein. A patient or host may be an organism, a cell culture of patient cells or cell lines, an animal, or a cell culture of animal cells or cell lines. A patient preferably refers to the species from which the sample is taken, and / or the species whose biological material constitutes the majority of the biological material in the sample. A patient may be selected from the group consisting of vertebrates, animals, livestock, mammals, and humans, and is preferably a mammal or a human.

[0192] In this specification, the method according to the present invention may also be referred to as an enzyme assay or simply an assay.

[0193] The present invention will be further illustrated by the following drawings. These drawings do not limit the scope of the present invention, but represent preferred embodiments of the present invention given to illustrate the invention described herein. [Brief explanation of the drawing]

[0194] [Figure 1-1] This figure shows the analytical principle of an embodiment of the method according to the present invention, including agar-based detection of Stx activity. A) Enzymatic reaction of Stx; B) Visualization using an example of a modified chromogenic probe (other readouts are also possible); C) Principle of probe application in laboratory diagnostics. [Figure 1-2] Same as above [Figure 2] This figure compares the 28S rRNA sequences of the salsin-lysine loop (SRL) in Homo sapiens and Rattus norvegicus. The 28S rRNA sequences of Homo sapiens (left; PDB 7UCR; SEQ ID NO: 9) and Rattus norvegicus (right; PDB 1SCL; SEQ ID NO: 10) are shown. Highly conserved regions are highlighted in bold. The SRL recognition sequence GAGAG is printed in gray. Light gray underline = depurinated adenine (A) within the Stx recognition sequence. Watson-Crick base pairs are represented by dotted lines. This figure was created using BioRender.com. [Figure 3-1]This figure shows embodiments of oligonucleotides according to the present invention, in which these embodiments represent synthetic single-stranded substrates (ssDNA with fluorophores and quenchers) based on the SRL sequence, which can be used to investigate Stx activity. Substrates 1 to 4 (StxSense1 to StxSense4), substrate 4 as an RNA sequence ("4 RNA"), and substrates 5, 9, 12, 15, and 16 (StxSense5, StxSense9, StxSense12, StxSense15, and StxSense16) are shown. Exemplary embodiments of oligonucleotides according to the present invention are shown, where embodiments 4 and 12 may be particularly preferred in some embodiments. Q = quencher; fluorophore (F): Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein). Sequence color coding: Light gray underline = depurinated adenine (A) within the Stx recognition sequence; dark gray (GAGAG) at 3 = duplicated recognition sequence; underlined nucleotide = linker sequence. Substrate images were created using BioRender.com. [Figure 3-2] Same as above [Figure 4] This figure shows the location of the salsin-lysine loop (SRL) targeted by Stx activity within the 60S subunit of the ribosome. Synthetic SRL mimes with a fluorophore (6-FAM) and a quencher (Q) are used in vitro to detect the enzymatic activity of Stx. In the presence of Stx, the SRL is depurinated and its sugar phosphate backbone is cleaved. As a result, the fluorophore and quencher are no longer physically close to each other, producing a fluorescence signal. [Figure 5]This figure shows a schematic diagram of a test procedure for an embodiment of the method according to the present invention for obtaining traces of Stx activity from a sample. Traces of Stx activity are obtained here using a synthetic substrate that mimics SRL. The substrate is bound to a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the formation of a fluorescent signal. Based on this test procedure, the intensity of the fluorescent signal induced by an Stx-positive sample can also be increased by a modified sequence of the SRL substrate. [Figure 6] This figure shows a comparative analysis of several embodiments of the developed SRL substrate (oligonucleotide) for the specific detection of Stx activity. The comparative analysis is from Example 1, where embodiments of the oligonucleotide according to the present invention were used as SRL substrates for the specific detection of Stx activity. Analysis of different SRL substrates over 12 hours (see also Figure 3) based on (A) reference strain EDL933 O157:H7(stx1a / 2a) and (B) 16-02409 O157:H7(stx2a). Using the substrate "5'FAM-Stem-[SRL]" (substrate number 4; StxSense4; SEQ ID NO: 7), Stx enzymatic activity could be detected in both strains, but not in EDL933 Δstx1 / 2. Statistical analysis of both strains using substrate 4 (StxSense4) shows a significant difference in fluorescence signal compared to EDL933 Δstx1 / 2 and other substrates tested. A curve (median) is shown. Statistical analysis was performed on EDL933 Δstx1 / 2 using the Mann-Whitney test for non-normally distributed data and Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]. [Figure 7]This figure shows that 100 mM ammonium acetate (depurination buffer) is preferred in this test and can enhance the fluorescence signal of Stx-positive samples. STEC strains were incubated in LB (pH 7) containing ciprofloxacin (Cip) at 37°C and 250 rpm for 24 hours. The Stx activity of the culture supernatant was then compared with 10 mM and 100 mM ammonium acetate, respectively. The results of three independent experiments are shown. The enzymatic activity of Stx produced in the culture supernatant was measured in two series over 12 hours for all cultures using radiofluorescence (RFU). Data are presented as medians. Statistical analysis was performed on EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]. [Figure 8] This figure shows that the enzymatic activity of Stx using a DNA-based SRL substrate is preferentially performed at acidic pH. Bacterial strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. Subsequently, the Stx activity of the culture supernatant was determined in 100 mM ammonium acetate with pH values ​​ranging from pH 3 to pH 7. Results from three independent experiments are shown. The enzymatic activity of Stx produced in the culture supernatant was measured in two series over 12 hours for all cultures using chromogenic fluorescence (RFU). Data are presented as medians. Statistical analysis was performed on EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). D. RFU, relative fluorescence units; t[h], time[hours]. [Figure 9]This figure shows that the preferred minimum SRL concentration for significant Stx detection in this study is 2 μM, and that the curve saturates with maximum RFU at 4 μM SRL (EDL933) and 5 μM SRL (16-02409). Bacterial strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. The culture supernatant was then tested to examine the enzyme activity in 100 mM ammonium acetate (pH 4) with SRL substrates of different concentrations (1 μM to 8 μM). The median results over time for strains (A) EDL933 and (B) 16-02409 from three independent experiments are shown. The enzyme activity of Stx produced in the culture supernatant was measured in two consecutive sets over 12 hours for all cultures using fluorescence colorimetric analysis (RFU). Statistical analysis was performed on EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data for endpoint analysis (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]. [Figure 10-1] This figure shows that the detection of Stx activity in different samples can be optimized by relatively adjusting the reaction temperature and sample dilution. Bacterial strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. The culture supernatant was then tested to examine the enzyme activity of (A) EDL933 and (B) 16-02409 at reaction temperatures of 37°C to 57°C (100 mM ammonium acetate, pH 4). The Stx activity (C, D) of culture supernatants diluted 1:2 and 1:5 was also examined in the temperature range of 37°C to 45°C. The time-series results (median) from three independent experiments are shown. The enzyme activity of Stx produced in the culture supernatant was measured in a 2x series over 12 hours for all cultures using chromogenic fluorescence (RFU). Data are presented as medians. Statistical analysis was performed on EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]. [Figure 10-2] Same as above [Figure 11-1] This figure shows that the enzyme assay can detect Stx2a-Stx2g and Stx1a-Stx1c in the culture supernatant, preferably 30 minutes to 8 hours later, again depending on the Stx concentration. To verify whether the enzyme assay can detect all subtypes of Shiga toxin, STEC strains covering subtypes Stx1a-Stx1d and Stx2a-Stx2g were incubated in LB (pH 7) containing 12 ng / mL of Cip at 37°C and 250 rpm for 24 hours. Stx production was analyzed using a cytotoxicity assay with Vero cells, by Western blotting (C) for detection of Stx2 in the culture supernatant using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). The culture supernatant was then analyzed to examine enzyme activity in the enzyme assay (100 mM ammonium acetate, pH 4) (A, B). The enzymatic activity of Stx produced in the culture supernatant of three independent cultures was measured in two consecutive lines over 12 hours for all cultures using radiofluorescence (RFU). The gray area indicates the range in which a sample is classified as negative (against EDL933 Δstx1 / 2). Data are presented as medians. Statistical analysis was performed against EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data for endpoint analysis (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]; MW[kDa], molecular weight. [Figure 11-2] Same as above [Figure 11-3] Same as above [Figure 12-1]This figure shows that the detection of STEC using an enzyme assay is based on the detection of Stx and is independent of the STEC serogroup. To investigate whether the enzyme assay detects other important serogroups in addition to O157 based on the Stx produced, three STEC strains were selected from the strain collection of the National Reference Center [NRZ(RKI)], each from serogroups O26, O91, O111, O113, O121, and O145. These strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. The culture supernatant was then analyzed to examine Stx activity in the enzyme assay (100 mM ammonium acetate, pH 4) (A, B). Representative STEC strains from each serogroup are shown. Stx production was investigated using a cytotoxicity assay with Vero cells (D), and Western blotting (C) to detect Stx2 in the culture supernatant using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). Stx activity in three independent cultures was measured in two consecutive lines over 12 hours for all cultures using fluorescence colorimetric analysis (RFU). The gray area indicates the range in which a sample is classified as negative (against EDL933 Δstx1 / 2). Data are presented as medians. Statistical analysis was performed against EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data for endpoint analysis (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence unit; t[h], time[hours]; MW[kDa], molecular weight. [Figure 12-2] Same as above [Figure 13-1]This figure shows the detection of Stx-producing Shigella strains. The Stx produced by Shigella dysenteriae (Stx1) and Shigella flexneri (Stx2) is 95% (Stx1) and 55% (Stx2) identical to that produced by STEC. To investigate whether the enzyme assay also detects Stx produced by Shigella, five strains of S. dysenteriae and six strains of S. flexneri were selected from the NRZ (RKI) strain collection. Each strain represents a typical Shigella strain. The strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. Stx production was investigated using a cytotoxicity assay with Vero cells (A) and Western blotting for the detection of Stx2 in the culture supernatant using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.) (B). (C) Stx activity of three independent cultures was measured in two consecutive lines over 12 hours for all cultures using fluorescence chromogenic fluid (RFU). The gray area indicates the range in which a sample is classified as negative (against EDL933 Δstx1 / 2). Data are presented as medians. Statistical analysis was performed against EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data for endpoint analysis (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence unit; t[h], time[hours]; MW[kDa], molecular weight. [Figure 13-2] Same as above [Figure 14-1]This figure shows no cross-reactivity of enzyme activity with SRL substrates with other enteropathogenic E. coli strains (EAEC, EPEC, EIEC) that do not produce Stx. Since patient samples from diarrheal diseases may also contain other enteropathogenic E. coli strains, the cross-reactivity of these strains to specific SRL substrates was investigated. Two strains were selected from the NRZ (RKI) strain collection. The strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. Stx production was examined by (A) cytotoxicity assays using Vero cells and (B) Western blotting for detection of Stx2 in the culture supernatant using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity of three independent cultures was measured in two consecutive units over 12 hours for all cultures using fluorescence colorimetric (RFU) chromogenic fluorescence (RFU). The gray area indicates the range in which the sample is classified as negative (against EDL933 Δstx1 / 2). Data are presented as medians. Statistical analysis was performed on EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]; MW[kDa], molecular weight. [Figure 14-2] Same as above [Figure 15-1]This figure shows that no nonspecific reactions were detected in the enzyme activity using SRL substrates for other enteropathogenic pathogens (Salmonella, Yersinia) that do not possess Stx. In addition to the already investigated enteropathogenic E. coli, other enteropathogenic pathogens can also cause diarrhea. To eliminate nonspecific reactions to enzyme assays for these pathogens, strains of four Yersinia sp. and six Salmonella spp. were examined. The strains were incubated in LB (pH 7) containing Cip at 37°C and 250 rpm for 24 hours. Stx production was examined using (A) a cytotoxicity assay with Vero cells and (B) Western blotting to detect Stx2 in the culture supernatant using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity of three independent cultures was measured in two consecutive lines over 12 hours for all cultures using radiofluorescence (RFU). The gray area indicates the range in which a sample is classified as negative (against EDL933 Δstx1 / 2). Data are presented as medians. Statistical analysis was performed against EDL933 Δstx1 / 2 using Student's t-test with Welch correction for normally distributed data (*, p<0.05; **, p<0.01; ***, p<0.001). RFU, relative fluorescence units; t[h], time[hours]; MW[kDa], molecular weight. [Figure 15-2] Same as above [Figure 16]This figure shows an embodiment of the method according to the present invention for detecting the enzymatic activity of Shiga toxin in vitro. The sample is cultured in LB medium containing 12 ng / mL of Cip, or on LB agar containing 12 ng / mL of Cip, at 37°C and 250 rpm for 24 hours. From the resulting culture supernatant, 5 μL or 1 to 3 single colonies are added to a 96-well white plate with the prepared reaction mix. The enzymatic reaction is carried out at 44°C for 1 to 12 hours. The fluorescence signal (RFU, relative fluorescence units) is detected using a fluorescence detector such as a real-time cycler. The culture supernatant / colony of reference strain EDL933 is used as a positive control, and LB and EDL933 Δstx1 / 2 function as negative controls and define the threshold. The image was created with BioRender.com. [Figure 17] A) Detection of Stx activity using STEC strain EDL933 O157:H7 that produces substrates StxSense1 to StxSense4, as well as Stx1a and Stx2a. B) Detection of Stx activity using STEC strain 16-02409 O157:H7 that produces substrates StxSense1 to StxSense4, as well as Stx2a. [Figure 18] A) Detection of Stx activity using STEC strain EDL933 O157:H7 that produces substrates StxSense4, StxSense5, StxSense9, StxSense12, StxSense15, and StxSense16, as well as Stx1a and Stx2a. B) Detection of Stx activity using STEC strain 16-02409 O157:H7 that produces substrates StxSense4, StxSense5, StxSense9, StxSense12, StxSense15, and StxSense16, as well as Stx2a. [Figure 19]A) Detection of Stx activity using substrates StxSense1 to StxSense4, and the knockout mutant EDL933 O157:H7 which does not produce either Stx1 or Stx2. B) Detection of Stx activity using substrates StxSense4, StxSense5, StxSense9, StxSense12, StxSense15, and StxSense16, as well as the knockout mutant EDL933 O157:H7 which does not produce either Stx1 or Stx2. [Figure 20] This figure shows a comparison of DNA / RNA substrate StxSense4. It analyzes the enzymatic activity of Stx using DNA-based and RNA-based StxSense4 for STEC strain EDL933 O157:H7 (stx1a / 2a) and the knockout mutant EDL933 O157 Δstx1 / 2. [Modes for carrying out the invention] [Examples]

[0195] The present invention will be further illustrated by the following embodiments. These are not intended to limit the scope of the present invention, but rather to represent preferred embodiments of various aspects of the invention provided for illustrative purposes.

[0196] Materials and methods In this embodiment, a synthetic single-stranded DNA substrate was used to detect the enzymatic activity of Stx. Figure 4 shows the location of the salsin-lysine loop (SRL) targeted by Stx activity within the 60S subunit of the ribosome. A synthetic SRL mimetic with a fluorophore (6-FAM) and a quencher (Q) was used in vitro to detect the enzymatic activity of Stx. In the presence of Stx, the SRL is depurinated and its sugar phosphate backbone is cleaved. As a result, the fluorophore and quencher are no longer physically close to each other, generating a fluorescence signal.

[0197] bacterial strain As the basis of this invention, the inventors examined a total of 94 strains from 1998 to 2021 from the National Reference Center (NRZ) strain collection for Salmonella and other bacterial enteropathogenic pathogens at the Robert Koch Institute (RKI), as well as two established reference strains, EDL933 and EDL933 Δstx1 / 2. Stx was confirmed by PCR in all strains. These strains covered different serotypes, types, and subtypes of Shiga toxin. The STEC strains examined contained a combination of stx1, stx2, or stx1 / 2.

[0198] For example, the selection of exemplary strains used to develop the method according to the present invention as an enzyme assay consisted of reference strains EDL933 O157:H7 and STEC strain 16-02409 O157:H7 as positive controls, and E. coli C600 and the KO mutant EDL933 Δstx1 / 2 O157:H7 as negative controls. In addition, other enteropathogenic E. coli without Stx were used as control strains: three enteropathogenic E. coli (EPEC), three enteroaggregative E. coli (EAEC), and two enteroinvasive E. coli (EIEC). Furthermore, six Salmonella species, four Yersinia enterocolitica, and eleven Sigella flexinelli and Sigella dicentellie were examined.

[0199] [Table 4] Table 4: Selection of strains from positive and negative controls used in the development of the enzyme assay in this embodiment Serotype: Serotype Reference: See Positive control: Negative control: Negative control

[0200] Culture and induction of Stx production by STEC strain in liquid cultures and on agar plates. Preparation of culture supernatant (STX induction) For each bacterial strain, 3 mL of LB medium warmed to room temperature was placed in a sterile glass tube. For overnight incubation, the STEC strain was transferred using a sterile glass rod to an LB tube prepared from glycerol stock and inoculated. Incubation was carried out overnight in an incubator shaker (New Brunswick Scientific, Innova 42) at 37°C and 250 rpm for 16 hours. The following day, the OD600 of each culture was determined using a spectrophotometer (Beckman Coulter, DU720). All cultures were then adjusted to an OD600 of 0.05 in 4 mL of fresh LB medium in a new sterile glass tube. To induce Stx production, 5 μL of 10 μg / mL Cip was added to the culture tube (final Cip concentration: 12 ng / mL). The samples were then incubated in an incubator shaker at 37°C and 250 rpm for 24 hours. During the testing of the optimal inducer for Shiga toxin induction, mitomycin C (MMC, 1 mg / mL), gentamicin (1.2 μg / mL), and ethylenediaminetetraacetic acid (EDTA, 20 mM) were also investigated.

[0201] To obtain the culture supernatant, 3 mL of bacterial culture was transferred to a 1.5 mL reaction tube (Eppendorf) and centrifuged at 9000 × g for 5 minutes. The supernatant and pellet were separated. The culture supernatant was then aseptically filtered using a 0.2 μm filter (Sartorius) and stored at 4°C for up to 1 week before use in experiments, while the pellet was stored at -20°C.

[0202] Concentration of Stx culture supernatant (preferably not required) If necessary, 2 mL of Stx-induced, sterile-filtered supernatant was concentrated to 100 μL using a centrifugal filter (Amicon Ultra 0.5 mL Centrifugal Filter, fractionation size 10 kDa, Merck Millipore) (10- or 20-fold concentrate). For this purpose, 500 μL of Stx culture supernatant was centrifuged at 14000 × g for 6 minutes in four centrifugation rounds. The concentrated volume of 100 μL was then transferred to a new 1.5 mL reaction vessel by inverting the filter column and centrifuging at 1000 rpm for 2 minutes. The concentrate was stored at 4°C for up to 1 week, then at -20°C.

[0203] STEC strain culture on LB agar The selected strains were further cultured on LB agar plates supplemented with 12 ng / mL Cip. For this purpose, 100 μL of 12 ng / mL Cip was seeded onto sterile LB agar plates, and then a small amount of STEC strain from the corresponding cryotube was streaked onto the agar plate using a sterile glass rod. The agar plates were incubated at 37°C for 18 hours.

[0204] Optimization of liquid-based, enzymatically active Stx detection. To amplify the fluorescence signal (relative fluorescence units, RFU) of Stx-positive samples, various parameters of the liquid-based assay were adjusted and compared to previous optimal settings. The following parameters were investigated: plate type (white / clear, different manufacturers), depurination buffer with 10 mM and 100 mM ammonium acetate (pH 4), depurination buffer at pH 4 / pH 5 / pH 6 / pH 7, temperature gradient from 30°C to 55°C, and different concentrations of fluorescent SRL substrate (final concentration 1 μM to 8 μM).

[0205] Enzyme activity assay using STEC single colony Routine culture of the STEC strain on agar plates also results in the secretion of Stx into LB agar (Kimmitt et al., 2000). For this purpose, 20 μL of the reaction mixture (19.5 μL of 10 mM ammonium acetate, pH 4, with 0.5 μL of SRL stock solution per sample) was pipetted into the wells of a 96-well white plate. Next, 1 to 3 colonies randomly selected from the induced STEC strain grown on LB agar were transferred to the prepared reaction buffer in 20 μL of reaction buffer using an inoculation loop. Since not all individual colonies produce Stx (Scotland et al., 1988), triplicate measurements were performed for each sample. Enzymatic Stx activity was determined in the same manner as in the induced Stx culture supernatant.

[0206] Determination of specificity for Stx STEC strains forming different Stx subtypes, Stx1 and Stx2, were used to determine the specificity of the enzyme assay. In addition to the "classic" STEC serotype O157:H7, other serotypes were also investigated. To rule out nonspecific cross-reactivity with other diarrheal pathogens, various enteropathogenic E. coli (EAEC, EPEC, EIEC), as well as other enteropathogens such as Shigella species, Yersinia, and Salmonella enterica, were examined.

[0207] substrate To optimally determine detectable Stx enzyme activity in vitro, five different substrates were designed based on salsin-lysine loops (SRLs) and manufactured by idt Integrated DNA Technologies (see Table 1). Each SRL substrate was conjugated with a fluorophore / quencher pair, where the quencher was located at the 3' end for all substrates. For substrate 1, the Cy5 fluorophore was directly conjugated to the adenine (manufacturer biomers.net) that is depurinated by Stx. All other substrates (substrates 2-4, manufacturer idt) were labeled with a 6-FAM fluorophore at the 5' end. In the initial state without Stx addition, the fluorophore and quencher are in close proximity for all substrates, resulting in absorption of the fluorophore fluorescence by the quencher and no detectable fluorescence signal. When enzymatically active Stx depurifies a specific adenine, and further ssDNA strand breaks generate fluorophore and quencher fragments, the fluorescence can no longer be absorbed by the quencher. Various synthetic SRL substrates (numbers 1-4; as embodiments of oligonucleotides according to the present invention) are shown in Figure 3. Cy5 and FAM (6-FAM herein) represent fluorescent markers, and Q represents the quencher (BMN-Q620 in substrate 1, and BHQ-1 in substrates 2-5). The Stx recognition sequence is highlighted in gray and embedded in the SRL sequence of Lattus norbegicus, and the adenine target for depurination is underlined. Substrate 3 contains two recognition sequences, and substrate 5'FAM-Zen-SRL contains an additional internal quencher (Zen). Substrates 4 and 5'FAM-Zen-SRL contain sequence ends (5'ACTT and 3'TGA) adapted to improve the fluorescence signal. Images were prepared using BioRender.com. The oligonucleotides used in the examples and shown in Figure 4 ("ssDNA substrates") and their nucleotide sequences are also listed in Table 1.

[0208] Using these embodiments of the oligonucleotide according to the present invention, analysis was performed according to the method according to the present invention.

[0209] Figure 5 shows the most important step in an enzymatic test for detecting Stx activity using a synthetic substrate that mimics SRL (an embodiment of the oligonucleotide according to the present invention). The substrate is bound to a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the formation of a fluorescent signal. Fluorescently labeled single-stranded DNA substrates based on salsin-lysine loops (SRLs) can be used to detect Shiga toxin enzyme activity.

[0210] Enzyme activity assay using Stx culture supernatant Enzymatic detection of active Shiga toxin was performed in a 96-well format as an enzyme activity assay using STEC culture supernatant. The enzyme activity of a sample, e.g., prepared STEC culture supernatant, could be verified by substrate conversion. Depending on the fluorescent labeling, fluorescence was detected using a real-time cycler equipped with a FAM filter or Cy5 filter. The reaction was carried out in a 96-well white plate (Eppendorf SE (twin-tec®)). The reaction was carried out in a reaction mix consisting of 100 mM ammonium acetate (pH 4) and SRL substrate. The ammonium acetate was stored at room temperature, and the SRL substrate was stored at -20°C until use. For each sample, 14.6 μL of 100 mM ammonium acetate (pH 4) was mixed with 0.4 μL of SRL substrate (100 mM stock solution; final concentration 2 μM) and added to the well. To examine the sample, 5 μL of Stx culture supernatant was then added to the reaction mixture, and the reaction was carried out in a real-time cycler (CFX Opus 96, BioRad Laboratories). Stx activity was analyzed using measured RFU values ​​in Excel and graphical representations in GraphPad Prism 9 (GraphStats Technologies).

[0211] [Table 5] Table 5: Real-time cycler configuration for running enzyme activity assays Parameter: parameter Place: Settings Temperature:Temperature Optimal 44℃: Optimal 44℃ Cycles: cycles 48 (1 programmed cycle with 47 repetitions): 48 times (1 programmed cycle with 47 repetitions) Duration of a cycle: 15 min: 15 minutes Total assay duration: Total duration of the assay 12 hours (48 cycles of 15 minutes each): Fluorescence measurement: Fluorescence measurement FAM filter or Cy5 filter; measurement at the end of a cycle (i.e., every 15 minutes):

[0212] Detection of enzyme activity in a reaction vessel The possibility of detecting the enzymatic activity of Stx in a reaction vessel using ChemiDoc MP was investigated. For this purpose, 37.5 μL of 2 μM 5'FAM-Stem-SRL in 100 mM depurinating buffer was mixed with 12.5 μL of Stx culture supernatant in a 1.5 mL reaction vessel and incubated at 44°C (thermomixer, Eppendorf SE). This approach was carried out similarly to the 96-well format using the same reaction mix:culture supernatant ratio. The enzymatic reaction was then examined using ChemiDoc (Bio-Rad Laboratories, Inc.) equipped with a fluorescein filter. 6-carboxyfluorescein (6-FAM), a fluorophore attached to the SRL substrate, requires an excitation wavelength of λ=495 nm and emits light at a wavelength of λ=517 nm.

[0213] Example 1 This embodiment illustrates the principle of an enzymatic assay based on RNA N-glycosidase activity, which is made possible by embodiments of the present invention. For development, the inventors used SRL from bacteria, yeast, or rat (Lattus norbegicus), among others. The SRL sequences between humans and rats differ in isolated nucleotides (see Figure 2 and Table 1). The nucleotide sequence of 28S rRNA, and therefore SRL, is highly conserved in eukaryotic cells, particularly at positions 4320–4329. The Stx recognition sequence GAGA is also localized in this region (Iordanov et al., 1997), which means that the effect on SRL should be organism-independent.

[0214] Based on the natural SRL sequence, five synthetic SRL substrates were designed to detect Stx enzymatic activity. A sufficiently strong fluorescence signal is required to detect Stx activity, thereby reliably distinguishing Stx-positive and Stx-negative samples after a short test time. To evaluate the developed substrates, the culture supernatants of the reference strain EDL933 O157:H7, STEC strain O157:H7 16-02409, and culture medium LB and the KO mutant EDL933 Δstx1 / 2 O157:H7 were used as negative controls (Gobert et al., 2007). Since this strain cannot form either Stx1 or Stx2, a positive signal from its culture supernatant indicates a nonspecific reaction with the substrate. Further information regarding strain selection is provided in Section 3.2.1. The enzymatic reaction was carried out at 44°C in a 96-well white plate (TwinTec) manufactured by Eppendorf, using 100 mM ammonium acetate (pH 4) and 2 μM substrate.

[0215] result The results are shown in Figure 6. The curves for two Stx-producing strains, EDL933 and 16-02409, over 12 hours (h) are shown.

[0216] Analysis of all five substrates using three different strains was performed in a 96-well white plate during the same reaction process using a real-time instrument. Detection of Stx activity using the five different SRL substrates was performed using the same culture supernatant in each case, allowing for direct comparison of substrate efficacy. Stx production in the culture supernatant was validated using Vero cell cytotoxicity assays, Western blotting, and Stx ELISA. The EDL933 Δstx1 / 2 curves were within the range of the medium control over the entire period for all SRL substrates, with fluorescence intensity varying between SRL substrates. Stx could be detected in the culture supernatant in both Stx-producing strains using established methods. For EDL933, increases in the curves were detected for substrate 2 (5'FAM-SRL or "StxSense2"; see Table 1) and substrate 4 (5'FAM-Stem-SRL or "StxSense4"; see Table 1). When substrate number 4 was used, these were significantly above the negative control, allowing for Stx detection in both strains after 1 hour of reaction time. For comparison, when substrate number 2 (5'FAM-SRL or "StxSense2") was used, Stx activity could be evaluated as positive after a reaction time of 6 hours. Substrate number 4 ("5'FAM-Stem-SRL" or "StxSense4") enabled detection of EDL933 6 times faster than substrate number 2. The other three substrates tested did not show an increase in the curve, which means that, at least under selected specific conditions (assay conditions, EDL933 strain, etc.), substrates 1, 3, and 5'FAM-Zen-SRL (see Table 1) are less suitable than the other two substrates for detecting Stx activity in the EDL933 strain. Two positive curves were also detected for strain 16-02409 (substrate number 4 and substrate 5'FAM-Zen-SRL). Similar to EDL933, when using substrate 4, active Stx could be detected in the culture supernatant after only 1 hour of reaction time, whereas detection with substrate 5'FAM-Zen-SRL took approximately 7 times longer. For the other three substrates, no positive signal could be detected in the Stx culture supernatant (see Figure 6; Table 1).Under the given conditions, Stx activity could be detected in both strains only when two of the developed substrates were used. Substrate 4 detected Stx earlier compared to other substrates, so due to the rapid detection in both STEC strains and the lack of reaction with the negative control, substrate number 4 ("5'FAM-Stem-SRL" or "StxSense4") was selected as the optimal substrate for all subsequent tests.

[0217] The fluorescence detected served as a marker for substrate hydrolysis by Stx from the positive control EDL933, the test strain STEC 16-02409, and the negative control EDL933 Δstx1 / 2. For both Stx-producing strains (EDL933 and 16-02409), the substrate 5'FAM-Stem-SRL ("StxSense4"; number 4) was the optimal substrate for detecting Stx activity. The results represent the median of triplicate samples (n = 3) and are from three independent experiments. Statistical analysis was performed using Student's t-test corrected according to Welch's method ( * , p < 0.05; ** , p < 0.01; *** , p < 0.001), where the results were compared to those of EDL933 Δstx1 / 2. RFU, relative fluorescence units; t[h], time [hours].

[0218] Optimization of the method (enzymatic assay) according to the invention The enzymatic reaction is a sensitive equilibrium. To date, the activity of Stx has been little studied. The study by Basu et al. dealt with in vitro Stx activity using RNA substrates and DNA substrates. They found that these reactions require an acidic pH and can be carried out at both 20 °C and 37 °C (Basu et al., 2016). Stx activity is independent of cofactors such as NADP (Jackson, 1990).

[0219] After the embodiments of the present invention were determined in different substrate forms, the fluorescence signal of the Stx-positive sample, as well as the enzyme reaction and the stability of the test, were aimed to be improved. Therefore, various components of the enzyme test were systematically investigated and adjusted. For this purpose, the reaction solution containing ammonium acetate and SRL substrate, the reaction temperature, and the sample dilution were examined.

[0220] Example 2 - The use of buffers containing 10 mM to 100 mM ammonium acetate enhances the fluorescence signal in the detection of Stx-positive samples The detection of Stx activity was performed in a depurination buffer consisting of ammonium acetate and SRL substrate. A buffer concentration of 10 mM has been described in the literature (Roday et al., 2008, Non-Patent Document 20) for examining the enzyme activity of ribosome-inactivating proteins and for mass spectrometry. In previous examinations of Stx activity, RNA-based SRL substrate concentrations of 1 mM to 2 μM have been used (Basu et al., 2016, Non-Patent Document 20), which corresponds to a substrate cost of approximately 0.20 euros per sample of substrate number 4 (5'FAM-Stem-SRL; "StxSense4"). The influence of the ammonium acetate concentration was analyzed at 44°C for 12 hours using 2 μM SRL substrate. The pH of both solutions was adjusted to pH 4. Stx activity was examined using 10 mM and 100 mM ammonium acetate, respectively (Figure 7). The Stx activities of the strain selections (EDL933, 16-02409, and EDL933 Δstx1 / 2) and the negative control were examined under the above conditions.

[0221] Under the two conditions tested, no nonspecific reaction was detected for the negative control at any time. Background noise based on the RFU value of the negative control was RFU=1167 for 10 mM ammonium acetate and RFU=905 for 100 mM ammonium acetate. In direct comparison of the depurinating buffer, higher Stx activity was determined for both Stx-producing strains with 100 mM ammonium acetate. 100 mM ammonium acetate increased the fluorescence signal immediately after the start of the reaction in both 16-02409 (stx2a) and EDL933 (stx1a / 2a), showing a 1.7-fold increase in RFU after only 2 hours. Eight hours after the start of the reaction, the curve for 16-02409 reached a plateau and remained constant until the end of the enzyme assay (12 hours). Two hours after the start of the reaction, the curve with 100 mM ammonium acetate could be considered clearly positive for 16-02409 compared to the negative control. The curve for 10 mM ammonium acetate can also be considered positive 2 hours after the start of the reaction. However, the increase in RFU is lower, and the maximum RFU value for 100 mM ammonium acetate is only reached after 12 hours of reaction.

[0222] For the two STEC strains examined and their culture supernatants, the use of 100 mM ammonium acetate resulted in enhanced fluorescence signals, which were essential for detecting Stx activity in EDL933.

[0223] Example 3 - A pH value of less than 5 is preferred during enzymatic Stx detection. For example, when synthetic RNA substrates are used to investigate the enzymatic activity of toxins, an acidic pH value is essential (Roday et al., 2008). Previous publications have already investigated the activity of ribosome-inactivating proteins such as lysine (Non-Patent Literature 20), and Stx in isolated cases (Non-Patent Literature 18). Therefore, in the following section, Stx activity was investigated at pH values ​​of 3 to 7 in 100 mM ammonium acetate (Figure 8).

[0224] The curves were similar for EDL933(stx1a / stx2a) and 16-02409(stx2a). The negative controls, EDL933 Δstx1 / 2 and LB, did not show nonspecific reactions at the pH values ​​examined. For pH values ​​3 and 4, a significantly increased fluorescence signal (RFUpH3=16862 and RFUpH4=26113, respectively) was measured 1 hour after the start of the reaction for EDL933. The pH 4 curve showed a 1.5 times higher RFU value compared to the pH 3 curve. Raising the pH to pH 5 resulted in a flatter curve, allowing for a positive signal after 7-8 hours of reaction time. Depurinating buffers with pH values ​​above pH 6 were unsuitable for in vitro detection of Stx activity, as they did not allow for the detection of Stx activity despite the presence of Stx-positive culture supernatant.

[0225] Acidic pH values ​​(pH 3 and pH 4) were shown to be optimal for detecting Stx activity. Since the fluorescence signal was amplified in 100 mM ammonium acetate, the conditions were adjusted for subsequent experiments, and 100 mM ammonium acetate at pH 4 was used for the culture supernatant.

[0226] Example 4 - The preferred minimum oligonucleotide concentration for reliable Stx activity detection is 2 μM at the parameters of this test. The activity of lysine and purified Stx has already been successfully tested using RNA substrates at concentrations of 10 nM to 2 μM (Non-Patent Literature 18), but not with DNA substrates. Due to the reduced sensitivity of DNA substrates, testing was performed with SRL concentrations in the μM range of 1 μM to 8 μM. To select the optimal strain, the optimal concentration of the substrate 5'FAM-Stem-SRL ("StxSense4"; number 4; sequence number 7) was determined.

[0227] The determination was made using the same culture supernatant in the same 96-well plate under the same reaction conditions (100 mM ammonium acetate, reaction temperature of 44°C). Figure 9 shows representative curves for different SRL concentrations for EDL933(A) and 16-02409(B). The negative control showed no nonspecific reaction. A positive RFU signal for EDL933(stx1a / 2a) was detected at all SRL concentrations tested. Nevertheless, the curves for different SRL concentrations differed in their slope and fluorescence intensity. Higher SRL concentrations resulted in stronger fluorescence signals for the same culture supernatant. At SRL concentrations above 4 μM, a significant saturation effect of the reaction was observed approximately 4 hours after the reaction time. Further increases in SRL concentration did not result in an increase in RFU values. Different SRL concentrations yielded comparable but nevertheless different curves for 16-02409(stx2a). All SRL concentrations tested produced a positive fluorescence signal after a reaction time of 7 hours, with the signal being stronger at SRL concentrations of 1 μM to 6 μM. However, no plateau formation in the fluorescence signal was detected. Furthermore, SRL concentrations above 5 μM showed a stronger saturation effect, which negatively affected the fluorescence signal at subsequent time points. SRL concentrations of 1 μM to 4 μM also produced an increase in fluorescence signal with increasing concentration, but SRL concentrations above 5 μM resulted in a weaker fluorescence signal at higher concentrations.

[0228] For the two STEC strains tested, Stx activity was found to be optimally detectable at SRL concentrations of 4 μM–5 μM. This corresponds to a substrate cost of approximately €0.4–€0.50 per sample. The tests also determined that a 2 μM SRL concentration is the preferred minimum SRL concentration, enabling efficient Stx detection and ensuring reliable detection. Considering the costs associated with developing this rapid test, subsequent experiments used a minimum SRL concentration of 2 μM, which represented a 50% reduction in the cost of using SRL.

[0229] Example 5 - For detecting Stx activity in the culture supernatant, a reaction temperature of 40°C or higher is advantageous. In the diagnosis of human infectious diseases, standard culture of STEC is performed at 37°C. However, better concentration and recovery of STEC from food have been reported at a culture temperature of 44°C (Tzschoppe et al., 2012, Amagliani et al., 2018). Therefore, the temperature range of 37°C to 57°C was investigated for enzyme assays. Figure 10 shows representative curves for two STEC strains, EDL933(A) and 16-02409(B). With one exception, the graphs of the negative control were evaluated as negative: EDL933 Δstx1 / 2 showed a nonspecific reaction to the SRL substrate at temperatures above 57°C.

[0230] In the temperature range of 37°C to 57°C, Stx activity increased with increasing temperature for both EDL933(A) and 16-02409(B). At reaction temperatures below 55.8°C, the RFU value for EDL933 was 1.25 to 5 times lower than that for 16-02409. An increase in RFU value was detected up to a reaction temperature of 57°C. All other reaction temperatures showed flatter curves. For 16-02409, the increase in RFU value from 37°C to 49.5°C was lower compared to reaction temperatures above 50°C. At temperatures above 50°C, the curve rose more rapidly within the first two hours of the reaction, resulting in a steeper curve.

[0231] For EDL933, compared to STEC strain 16-02409, a generally lower curve was observed for both the temperature gradient and the SRL substrate concentration. Since saturation can lead to decreased Stx activity during the enzymatic reaction (Bisswanger, 2014), the Stx activity for EDL933 was determined using 1:2 and 1:5 diluted culture supernatants under a temperature gradient of 37°C to 45°C (Figures 10C and 10D). Within this range, the curve showed the lowest RFU value (see Figure 10A). The reaction was carried out without modification in 100 mM ammonium acetate (pH 4) containing 2 μM SRL substrate. The negative control showed no nonspecific reactions. It was also evident that for both dilutions, higher reaction temperatures resulted in higher RFU values ​​and curves. The temperature dependence was more pronounced as the sample was diluted. By diluting the EDL933 culture supernatant, the RFU signal could be increased from 0.6 times at 40°C to 5 times at 43.7°C. Overall, sample dilution resulted in a decrease in reaction temperature. The adjusted conditions led to Stx detection after 30 minutes to 3 hours of reaction time.

[0232] Both the dilution of the culture supernatant and the reaction temperature affected Stx activity. The ideal reaction temperature was at least 44°C under the given conditions.

[0233] Example 6 - Detection of Stx variants STECs are characterized by a high degree of heterogeneity, for example, due to serogroups, but stx is defined as the pathogenic factor of all STECs. Based on their amino acid sequence, Stx is divided into two types, Stx1 and Stx2. These two types are approximately 56% identical in their sequence. These two Stx types are further divided into subtypes: currently, three subtypes of Stx1 (stx1a, stx1c, stx1d) have been described, and for Stx2, following the introduction of nomenclature by Scheutz et al. in 2011 (Scheutz et al., 2012), seven subtypes from stx2a to stx2g have been described. Although the Stx subtypes differ, the mechanism of action of all Stx is similar and forms the basis of this enzyme assay. Therefore, we used different STEC strains that encompass the diversity of Stx and investigated them in terms of their activity.

[0234] Severe illnesses associated with HUS are particularly frequently caused by Stx subtype Stx1a within Stx1, and by Stx2a and Stx2c within Stx2 (De Rauw et al., 2018, Byrne et al., 2020). For these Stx subtypes, we were able to select strains with the same serotype O157:H7. Stx1 concentrations were, on average, 7 times lower compared to Stx2 culture supernatant. Overall, Stx concentrations varied significantly among different strains under the same culture conditions. The highest concentrations were detected for Stx2a–Stx2d, while Stx concentrations in Stx2e–Stx2g were 9 to 170 times lower than in highly Stx2-producing STEC strains. This difference in Stx expression could be detected in all Stx-producing strains in both Western blotting and Vero cell cytotoxicity assays.

[0235] Although the Stx1 concentration in the culture supernatant was lower than the Stx2 concentration due to the absence of phage lysis (Wagner et al., 2002), the enzyme assay detected not only the Stx2 subtypes Stx2a to Stx2g used in the study, but also Stx1 subtypes Stx1a and Stx1d (Figures 11A and 11B). The negative control, EDL933 Δstx1 / 2, showed no Stx activity, supporting the negative results in Western blotting (Figure 11C) and cytotoxicity assay (Figure 11D). The Stx activity detected by the enzyme assay differed among different strains. After 12 hours of reaction time, the strongest signals were detected for Stx2a (RFU=97309), Stx2b (RFU=111296), and Stx1a / 2a (RFU=85722), while Stx1a (RFU=14062), Stx2e (RFU=19653), and Stx1d (RFU=5522) showed the weakest signals in the culture supernatant.

[0236] The gradient of Stx activity accompanied by bands in Western blots showed only a rough correlation, and consequently, high signals in Western blots were not always equivalent to high Stx activity. The discrepancy between Western blot signals and Stx activity was particularly pronounced in two Stx1a / 2a-producing strains, EDL933 and 17-00261. While the signals in Western blots showed similar band intensity in both samples, the RFU signals differed by a factor of 2.5. 17-00261 was stronger than EDL933 and showed the third strongest fluorescence signal overall among all strains examined. This discrepancy in intensity was also evident in other strains. For the Stx2a-producing strain 16-02409, a weaker signal was detected than in the two strains mentioned above, while the detected Stx activity was 1.1 times and 2.7 times higher, respectively.

[0237] For the determination of LOD, it has been shown that there is generally a correlation between Stx activity and Stx concentration (Stx ELISA) for Stx1a, Stx2a, and Stx1a / 2a. To investigate the extent to which this correlation enables conclusions to be drawn about Stx concentration from the measured fluorescence signals, the culture supernatants of eight of the previously investigated strains were adjusted to a concentration of 80 ng / mL (results not shown). This concentration was within the linear range of the previously determined correlation line. A direct comparison of the Stx activities of different Stx subtypes at the same concentration showed differences in fluorescence signals that were 3- to 5-fold different.

[0238] Example 7 - STEC detection is serogroup-independent There are diverse bacterial groups among STEC, which are further characterized in diagnostics, especially by the types of their surface O and H antigens (Beutin et al., 2007). Currently, 185 types of O antigens and 53 types of H antigens are described, and these can occur in different combinations in STEC (Iguchi et al., 2020). When STEC is grouped according to O antigens, STEC belonging to the same serogroup. The combination of O and H antigens results in a serotype, e.g., O157:H7. Since evaluating the serogroup is useful, especially regarding the development of HUS in STEC infections, 18 additional STEC strains from six different non-O157 serogroups (O26, O91, O111, O113, O121, O145) were analyzed. Three different strains were examined from each serogroup, and one representative strain from each of them is shown in Figure 12.

[0239] Stx was detected in all strains by Western blotting and cytotoxicity. The Stx subtypes of the test strains determined by WGS included Stx1a, Stx1c, Stx2a, Stx2b, and Stx2d, and their activity was detected by enzyme assay. Three of these strains showed low fluorescence signals in the enzyme assay: 19-01474 (O91, Stx1a / 2b), 19-01776 (O91, Stx2d), and 16-03404 (O145, Stx2a). Comparison with Western blotting confirmed low Stx concentrations in these strains, demonstrating a correlation between Stx concentration and activity.

[0240] In the process of this example, a total of 64 STEC strains were examined, comprising 21 different serogroups, and their Stx subtypes, serogroups, and serotypes were confirmed by whole-genome sequencing (WGS). 38% of these strains were O157 (n=27), while the remaining 62% were non-O157 (n=37) from a total of 20 different serogroups. These strains also included three sorbitol-fermenting strains. Two of the 64 strains (3%) from the different serogroups tested were negative in enzyme assays using culture supernatant (O104-Stx1c and O157-Stx2c). All sorbitol-fermenting STEC O157:H strains were positive in enzyme assays.

[0241] Example 8 - Stx-producing Shigera can be detected by enzyme assay. Shiga toxin was originally described in relation to the bacterium Sigella. Subsequent studies have demonstrated the production of Stx in STEC and its close relationship with Sigella. Similar to STEC, Sigella produces Stx1 and Stx2. Stx1 is produced by Sigella decentelli, and Stx2 is produced by Sigella flexinelli. Since Stx1 and Stx2 are equivalent to the toxins found in STEC, enzyme assays were expected to detect Stx produced by Sigella. To test this hypothesis, Stx production and Stx activity were examined in five S. decentelli strains and six S. flexinelli strains, and the results for representative strains are shown in Figure 13.

[0242] In all strains of S. dicentellie, Stx1 production was detected via its cytotoxic effect on Vero cells, similar to Stx1-producing STEC, but not by enzyme assays. In S. flexinelli, Stx production was not detected in Western blot and cytotoxicity assays in 3 out of 6 strains, and Stx activity was not detected by enzyme assays. In the remaining 3 strains of S. flexinelli, both Stx production and strong Stx activity were demonstrated by enzyme assays. Stx activity in all 3 cases was stronger than that of the reference strain EDL933, as well as Western blot signals and observed cytotoxicity. Based on the tests, it was possible to demonstrate that Stx2-producing S. flexinelli can be detected in Sigella using rapid Stx activity detection.

[0243] Example 9 - No cross-reactivity with other stx-negative enteropathogenic E. coli in the enzyme assay. (Bloody) diarrhea and intestinal inflammation can be caused by other enteropathogens in addition to STEC. The type of diarrhea can be used to narrow down the primary diagnosis. Other diarrhea-causing pathogens were included in the study to eliminate possible cross-reactivity of other enteropathogens in enzyme tests for STEC detection. The investigation focused on both other enteropathogenic E. coli such as EAEC, and other enteropathogens such as Yersinia. These investigations aimed to evaluate the specificity of enzyme tests.

[0244] In addition to Shiga toxin-producing E. coli (STEC), other pathogenic E. coli strains can also cause diarrhea. These include EAEC, EPEC, EIEC, and ETEC. These pathogenic E. coli strains are related to STEC but do not produce Shiga toxin. For example, six strains were included to check the accuracy of the test, in order to rule out potential nonspecific cross-reactivity caused by other enzymes in pathogenic E. coli.

[0245] Figure 14 shows the results of the tests. Shiga toxin production was not detected in Western blotting or cytotoxicity assays for the six strains examined. Vero cell viability was only slightly impaired, at levels similar to the negative control EDL933 1stx1 / 2 for the culture supernatant of pathogenic E. coli. In enzyme assays for Stx activity detection, Stx activity was detected only for the positive controls EDL933 (stx1a / 2a) and 16-02409 (stx2a), but not for EPEC, EAEC, or EIEC. This result was consistent with the results of Stx detection. With the exception of one strain, the curves for these strains showed consistently low RFU values ​​of 1200 after a 12-hour reaction time. The curve for one strain (01-05814, EPEC) rose minimally to an RFU of 1500 after approximately 7 hours of reaction time. Nevertheless, the curve was significantly negative, almost at the level of the negative control EDL933 1stx1 / 2 ("Is this a typo for Δstx1 / 2?"). Since the two Stx-positive control strains were clearly evaluated as positive in the enzyme assay at reaction times of 1 hour and 2 hours, respectively, the slight increase in the curve for EPEC strain 01-05814 represented normal behavior in the assay. ("Δstx1 / 2")

[0246] Example 10 - Other STX-negative enteric pathogens Other pathogens causing diarrheal diseases were included in the investigation of the accuracy of the enzyme assay, resulting in the examination of a total of four Yersinia enterocolitica strains and six Salmonella species (Figure 15). For Salmonella, four serotypes were selected: S. typhimurium, S. enteritidis, S. Virginia, and S. infantis. Two strains each were examined for two clinically relevant serotypes: S. typhimurium and S. enteritidis. In all strains, Stx production was not detected by Western blotting or cytotoxicity assays, and enzyme activity was not detected by enzyme assays. At all stages of the reaction, the RFU values ​​of all enteropathogens were below the negative control values. After a reaction time of 2 hours, the positive control EDL933 was determined to be significantly positive.

[0247] Based on the tested strains of enteropathogenic E. coli and other pathogens, these pathogens, which also cause diarrheal diseases, were shown to lack enzymatic activity against specific SRL substrates in enzyme assays.

[0248] Example 11 - The detection limit of the enzyme assay is in the range of ng / mL. To determine the detection limit of the method according to the present invention ("enzyme assay"), the culture supernatant of selected strains quantified by Stx-ELISA was used. Based on the calculated Stx concentrations, a dilution series with eight dilution steps in arithmetic dilution was prepared for each of the three Stx-producing strains. The concentration ranges of the dilution series were approximately the same: 1 ng / mL to 113 ng / mL for EDL933 (stx1a / 2a), 1 ng / mL to 126 ng / mL for 20-01044 (stx1a), and 1 ng / mL to 138 ng / mL for 16-02409 (stx2a). Since the comparison of the activity of different Stx subtypes has not been previously described in the literature, the LOD was determined for three strains expressing different Stx subtypes.

[0249] All three STEC strains examined showed similar curves between the Stx concentration used and the measured fluorescence (results not shown). Linear increases were observed for 20-01044 (stx1a) from 35 ng / mL to 126 ng / mL, for 16-02409 (stx2a) from 25 ng / mL to 138 ng / mL, and for EDL933 (stx1a / 2a) from 30 ng / mL to 113 ng / mL. Positive Pearson correlations (p>0.0001) were determined for all three graphs within the linear range. Higher Stx concentrations were associated with higher measurable RFU values.

[0250] Linear regression across the entire curve was used to calculate the detection limits for all three samples. The regression curve is Stx1a(R 2 =0.9806) best approximates the measured value, and Stx2a(R 2 The worst results were for (=0.8694). The detection limits determined from this were 11 ng / mL to 29 ng / mL for the Stx activity of the culture supernatant used, and varied slightly between Stx subtypes.

[0251] Example 12 - Specific detection of Stx variants using DNA constructs The substrate StxSense4 was tested as both a DNA-based and RNA-based substrate under standard assay conditions (see above). Compared to the DNA-based substrate, no specific activity of Shiga toxin was detected with RNA-StxSense4 (SEQ ID NO: 29) for STEC strain EDL933 O157:H7 (stx1a / 2a) (Figure 20). As a result, the RNA-SRL substrate (StxSense4 RNA; SEQ ID NO: 29) based on the successful DNA sequence StxSense4 is not suitable for detecting the desired Stx activity.

[0252] Example 13 - Additional DNA-SRL substrates In this experiment, two STEC strains (Figures 17 and 18) and an Stx knockout mutant (Figure 19) were used to test the substrates StxSense1 to StxSense4 (SEQ ID NOs. 4 to 7) and six other DNA-SRL substrates (StxSense5, StxSense9, StxSense12, StxSense15, StxSense16, see Table 6) in the enzyme assay according to the present invention under previous standard assay conditions (see above).

[0253] [Table 6] Table 6: Summary of substrates used Substrate: Substrate (100 μM) Feature: Array (5'→3') Fluorophore labeling at the adenine: F / Q at the 5'- / 3' end: F / Q at the 5'- / 3' end Recognition sequence GAGAG 2x: Recognition sequence GAGAG 2x Modified linkers: Modified linkers Larger loop structure: Shortened stem: shortened stem Shortened stem with A / T pairing (2 van der Waals): RNA substrate; modified linkers: RNA substrate; modified linker Exclusively A: A only Shortened sequence: abbreviated sequence

[0254] In addition to the SRL substrate StxSense4 (SEQ ID NO: 7), substrates StxSense12 (SEQ ID NO: 13), StxSense15 (SEQ ID NO: 16), and StxSense16 (SEQ ID NO: 17) were also suitable for positive detection of Stx. In particular, the larger loop structure (StxSense12) amplified Stx activity and therefore the RFU signal. On the other hand, substrates without a loop structure (StxSense9; SEQ ID NO: 27) or substrates without the central sequence GAGA (StxSense5; SEQ ID NO: 28) significantly reduced the RFU signal. No nonspecific reactions were detected for any of the substrates when using the knockout mutant EDL933 O157:H7 Δstx1 / 2 or LB culture medium.

[0255] Example 14 - Detection in fecal samples Sixteen fecal samples (nine stx-PCR positive, six stx-PCR negative) and fecal samples spiked with Stx culture supernatant were analyzed using the substrate according to the present invention. As a result, Stx could be detected in the fecal samples either directly or after concentration.

[0256] References Amagliani, G., Rotundo, L., Carloni, E., Omiccioli, E., Magnani, M., Brandi, G., & Fratamico, P. (2018). Detection of Shiga toxin-producing Escherichia coli (STEC) in ground beef and bean sprouts: Evaluation of culture enrichment conditions. Food Research International, 103, 398-405. https: / / doi.org / 10.1016 / J.FOODRES.2017.10.059 Basu, D., Li, X. P., Kahn, J. N., May, K. L., Kahn, P. C., & Tumer, N. E. (2015). The A1 subunit of Shiga toxin 2 has higher affinity for ribosomes and higher catalytic activity than the A1 subunit of Shiga toxin 1. Infection and Immunity, 84(1), 149-161. https: / / doi.org / 10.1128 / IAI.00994-15 Becher F et al. Detection of functional ricin by immunoaffinity and liquid chromatography-tandem mass spectrometry. Anal Chem 2007 Jan 15;79(2):659-606. Beddoe, T., Paton, A. W., Le Nours, J., Rossjohn, J., & Paton, J. C. (2010). Structure, Biological Functions and Applications of the AB5 Toxins. Trends in Biochemical Sciences, 35(7), 411. https: / / doi.org / 10.1016 / J.TIBS.2010.02.003 Bergan, J., Dyve Lingelem, A. B., Simm, R., Skotland, T., & Sandvig, K. (2012). Shiga toxins. Toxicon, 60(6), 1085-1107. https: / / doi.org / 10.1016 / j.toxicon.2012.07.016 Beutin, L., Miko, A., Krause, G., Pries, K., Haby, S., Steege, K., & Albrecht, N. (2007). Identification of human-pathogenic strains of shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes. Applied and Environmental Microbiology, 73(15), 4769-4775. https: / / doi.org / 10.1128 / AEM.00873-07 / ASSET / AA811C1D-487C-40A3-8866-00AA6F26DFC4 / ASSETS / GRAPHIC / ZAM0150780370002.JPEG Brigotti, M., Carnicelli, D., Ravanelli, E., Vara, A. G., Martinelli, C., Alfieri, R. R., Petronini, P. G., & Sestili, P. (2007). Molecular damage and induction of proinflammatory cytokines in human endothelial cells exposed to shiga toxin 1, shiga toxin 2, and α-sarcin. Infection and Immunity, 75(5), 2201-2207. https: / / doi.org / 10.1128 / IAI.01707-06 Byrne, L., Adams, N., & Jenkins, C. (2020). Association between Shiga Toxin-Producing Escherichia coli O157:H7 stx Gene Subtype and Disease Severity, England, 2009-2019. Emerging Infectious Diseases, 26(10), 2394. https: / / doi.org / 10.3201 / EID2610.200319 Chan YS, Ng TB. Shiga toxins: from structure and mechanism to applications. Appl Microbiol Biotechnol. 2016 Feb;100(4):1597-610. COMMISSION Staff Working Document. Lessons learned from the 2011 outbreak of Shiga toxin-producing Escherichia coli (SEC) O104:H4 in sprouted seeds. Commission of the European Communities. https. / / ec.europa.eu / food / sites / food / files / safety / docs / biosafety-crisis-cswd_lesson_learned_en.pdf. Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013 Oct;26(4):822-80. De Rauw, K., Jacobs, S., & Pierard, D. (2018). Twenty-seven years of screening for Shiga toxin-producing Escherichia coli in a university hospital. Brussels, Belgium, 1987-2014. PLOS ONE, 13(7), e0199968. https: / / doi.org / 10.1371 / JOURNAL.PONE.0199968 Deleavey GF, Damha MJ. Designing chemically modified oligonuclotides for targeted gene silencing. Chem Biol. 2012 Aug 24;19(8):937-54. Endo, Y., & Tsurugi, K. (1988). The RNA N-glycosidase activity of ricin A-chain. The characteristics of the enzymatic activity of ricin A-chain with ribosomes and with rRNA. Journal of Biological Chemistry, 263(18), 8735-8739. https: / / doi.org / 10.1016 / S0021-9258(18)68367-X Epid Bull 2016;44:489-93. Fagerquist CK et al. Top-Down proteomic identification of Shiga toxin 2 subtypes from Shiga toxin-producing Escherichia coli by matrix-assisted laser desorption ionization-tandem time of light mass spectrometry. Appl Environ Microbiol 2014 May;80(9):2928-40. FDA Bacteriological Analytical Manual, 8th Edition 1995, Chapter 4, Feb;2(2):123-40. Flieger A, Mielke M, Tietze E. Role of pathogen surveillance and subtyping for outbreak detection in foodborne bacterial infections – a microbiological perspective – aims, methods and perspectives of pathogen subtyping. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 2013;56(1):42-6. Frank C et al. Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N Engl J Med. 2011 Nov 10;365(19):1771-80. Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany. Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany. Epid Bull 2016;44:489-93. Fruth A, Prager R, Tietze E, Rabsch W, Flieger A. Molecular epidemiological view on Shiga toxin-producing Escherichia coli causing human disease in Germany: Diversity, prevalence, and outbreaks. Int J Med Microbiol. 2015 Oct;305(7):697-704. Review. Garcia A, Fox JG, Besser TE. Zoonotic enterohemorrhagic Escherichia coli: A One Health perspective. ILAR J. 2010;51(3):221-32. Garred O, van Deurs B, Sandvig K. Furin-induced cleavage and activation of Shiga toxin.J Biol Chem. 1995 May 5;270(18):10817-21. Glueck, A., Endo, Y., & Wool, I. G. (1992). Ribosomal RNA identity elements for ricin A-chain recognition and catalysis: Analysis with tetraloop mutants. Journal of Molecular Biology, 226(2), 411-424. https: / / doi.org / 10.1016 / 0022-2836(92)90956-K Gobert AP et al. Moculation of chemokine gene expression by Shiga-toxin producing Escherichia coli belonging to various origins and serotypes. Microbes Infect. 2008 Feb;10(2):159-65. Hull AE, Acheson DW, Echeverria P, Donohue-Rolfe A, Keusch GT. Mitomycin immunoblot colony assay for detection of Shiga-like toxin-producing Escherichia coli in fecal samples: comparison with DNA probes. J Clin Microbiol. 1993 May;31(5):1167-72. Iguchi, A., Nishii, H., Seto, K., Mitobe, J., Lee, K., Konishi, N., Obata, H., Kikuchi, T., & Iyoda, S. (2020). Additional og-typing PCR techniques targeting escherichia coli-novel and shigella-unique O-antigen biosynthesis gene clusters. Journal of Clinical Microbiology, 58(11). https: / / doi.org / 10.1128 / JCM.01493-20 / SUPPL_FILE / JCM.01493-20-S0001.PDF Iordanov, M. S., Pribnow, D., Magun, J. L., Dinh, T.-H., Pearson, J. A., Li, S., Chen, -Ye, & Magun, B. E. (1997). Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin / ricin loop in the 28S rRNA. Molecular and Cellular Biology, 17(6), 3373-3381. https: / / doi.org / 10.1128 / MCB.17.6.3373 Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004. Karch H et al. The enemy within us: lessons from the 2011 European Escherichia coli O104:H4 outbreak. EMBO Mol Med. 2012 Sep;4(9):841-8. Kase JA, Maounounen-Laasri A, Son I, Lin A, Hammack TS. Comparison of eight different agars for recovery of clinically relevant non-O157 Shiga toxin-producing Escherichia coli from baby spinach, cilantro, alfalfa sprouts and raw milk. Food Microbiology 46(2015):280-287 Kimmitt, P. T., Harwood, C. R., & Barer, M. R. (2000). Toxin gene expression by shiga toxin-producing Escherichia coli: the role of antibiotics and the bacterial SOS response. Emerging Infectious Diseases, 6(5), 458. https: / / doi.org / 10.3201 / EID0605.000503 Kurmanova A et al. Structural requirements for furin-induced cleavage and activation of Shiga toxin. Biochem Biophys Res Commun. 2007 May 25;357(1):144-9. Lang C et al. Zinc metalloproteinase ProA directly activates Legionella pneumophila PlaC glycerophospholipid:cholesterol acyltransferase. J Biol Chem. 2012 Jul 6;287(28):23464-78. Lang C, Hiller M, Flieger A. Disulfide loop cleavage of Legionella pneumophila PlaA boosts lysophospholipase A activity. Sci Rep. 2017 Nov 24;7(1):16313. Li, X.-P., Tumer, N. E., Barbier, J., & Gillet, D. (2017). Differences in Ribosome Binding and Sarcin / Ricin Loop Depurination by Shiga and Ricin Holotoxins. Toxins 2017, Vol. 9, Page 133, 9(4), 133. https: / / doi.org / 10.3390 / TOXINS9040133 Mao, H., Luo, G., Zhan, Y., Zhang, J., Yao, S., & Yu, Y. (2018). The mechanism and regularity of quenching the effect of bases on fluorophores: the base-quenched probe method. Analyst, 143(14), 3292-3301. https: / / doi.org / 10.1039 / C8AN00116B Marras SAE, Kramer FR, Tyagi S. Efficiencies of fluorescence resonance energy transfer and contact-mediated quenching in oligonucleotide probes. Nucleic Acids Research, 2002, 30(21): e122, Melton-Celsa AR, Kokai-Kun JF, O'Brien AD. Activation of Shiga toxin type 2d (Stx2d) by elastase involves cleavage of the C-terminal two amino acids of the A2 pepetide in the context of the appropriate B pentamer. Mol Microbiol. 2002 Jan;43(1):207-15. Melton-Celsa AR, O'Brien AD. New Therapeutic Developments against Shiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014 Oct;2(5). Noble, J. E., Wang, L., Cole, K. D., & Gaigalas, A. K. (2005). The effect of overhanging nucleotides on fluorescence properties of hybridising oligonucleotides labelled with Alexa-488 and FAM fluorophores. Biophysical Chemistry, 113(3), 255-263. https: / / doi.org / 10.1016 / J.BPC.2004.09.012 Olsnes S, Reisbig R, Eiklid K. Subunit structure of Shigella cytotoxin. J Biol Chem. 1981 Aug 25;256(16):8732-8. Perna, N. T., Plunkett, G., Burland, V., Mau, B., Glasner, J. D., Rose, D. J., Mayhew, G. F., Evans, P. S., Gregor, J., Kirkpatrick, H. A., Posfai, G., Hackett, J., Klink, S., Boutin, A., Shao, Y., Miller, L., Grotbeck, E. J., Davis, N. W., Lim, A., … Blattner, F. R. (2001). Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 2001 409:6819, 409(6819), 529-533. https: / / doi.org / 10.1038 / 35054089 Persad AK, LeJeune JT. Animal Reservoirs of Shiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014 Aug;2(4):EHEC-0027-2014. Prochnow H et al. Subecllular quantification of uptake in Gram-negative bacteria. Anal Chem 2018 Nov 28. doi: 10.1021 / acs.analchem.8b03586. [Epub ahead of print] Robert Koch Institute (RKI). Epidemiological Yearbook of Notifiable Diseases for 2016. Berlin 2017. Robert Koch Institute (RKI). Epidemiological Yearbook of Notifiable Diseases for 2017. Berlin 2018. Roday, S., Sturm, MB, Blakaj, D., & Schramm, VL (2008). Detection of an abasic site in RNA with stem-loop DNA beacons: Application to an activity assay for Ricin Toxin A-Chain. Journal of Biochemical and Biophysical Methods, 70(6), 945-953. https: / / doi.org / 10.1016 / J.JPROT.2007.12.010 Scheutz F et al. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol. 2012 Sep;50(9):2951-63. Scotland, S. M., Rowe, B., Smith, H. R., Willshaw, G. A., & Gross, R. J. (1988). Vero cytotoxin-producing strains of Escherichia coli from children with haemolytic uraemic syndrome and their detection by specific DNA probes. Journal of Medical Microbiology, 25(4), 237-243. https: / / doi.org / 10.1099 / 00222615-25-4-237 / CITE / REFWORKS Tesh, V. L., Burris, J. A., Owens, J. W., Gordon, V. M., Wadolkowski, E. A., O'brien, A. D., Samuel3, J. E., Wadolkowski, E. A., Sung, L. M., Burris, J. A., Samuel, J. E., & O'brien, A. D. (1993). Comparison of the relative toxicities of Shiga-like toxins type I and type II for mice. Infection and Immunity, 61(8), 3392-3402. https: / / doi.org / 10.1128 / IAI.61.8.3392-3402.1993 Tzschoppe, M., Martin, A., & Beutin, L. (2012). A rapid procedure for the detection and isolation of enterohaemorrhagic Escherichia coli (EHEC) serogroup O26, O103, O111, O118, O121, O145 and O157 strains and the aggregative EHEC O104:H4 strain from ready-to-eat vegetables. International Journal of Food Microbiology, 152(1-2), 19-30. https: / / doi.org / 10.1016 / J.IJFOODMICRO.2011.10.009 Wagner, PL, Livny, J., Neely, MN, Acheson, DWK, Friedman, DI, & Waldor, MK (2002). Bacteriophage control of Shiga toxin 1 production and release by Escherichia coli. Molecular Microbiology, 44(4), 957-970. https: / / doi.org / 10.1046 / J.1365-2958.2002.02950.X Wang J et al. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays. Toxins 2016,8;(4),92. [Explanation of symbols]

[0257] Drawing translation Figure 1 A: Natural substrate A: Natural substrate Depurination at position 15 Ricin loop = Stx1 / 2 substrate B: FRET substrate position 15 15th place No fluorescence due to FRET quenching. Quencher Dye C: Flowchart C: Flowchart Agar plate with chromogenic substrate + trypsin + mitomycin C Plating of STEC enrichment culture Depurination and detachment from the substrate = activation of fluorescence after maximum 24-48 hours Color change due to processing of chromogenic substrate Figure 2 SRL Homo sapiens SRL Homo sapiens SRL Rattus norvegicus Figure 4 Location of the SRL Sarcin Ricin Loop Mode of action of Stx: ​​Mechanism of action of Stx SRL substrate SRL substrate no fluorescence Depurination and hydrolysis Fluorescence Figure 5 Liquid cultivation of STEC and extraction of the Stx culture supernatant Mix the culture supernatant with the reaction mix (which contains the SRL substrate). If Stx is present, the SRL substrate is depurinated and cleaved. Fluorophore and quencher are spatially separated, thereby making a fluorescence signal visible. Measurement of the fluorescence signal Figure 7 10 mM vs. 100 mM ammonium acetate in 10 mM ammonium acetate: in 100 mM ammonium acetate: Figure 8 Different pH values ​​of the depurination buffer Figure 10 Culture supernatant diluted 1:2 Culture supernatant diluted 1:5 Figure 11 Stx subtype detection in culture supernatants Controls: Stx subtype detection in single colonies Western Blot Cytotoxicity Cell viability [%] Cell viability [%] Figure 12 Cytotoxicity Cell viability [%] Cell viability [%] Western Blot Stx activity Stx activity Figure 13 Shigella genus S. flexneri S. dysenteriae Western Blot Cytotoxicity Cell viability [%] Cell viability [%] Shigella dysenteriae Shigella flexneri Figure 14 Cytotoxicity Cell viability [%] Cell viability [%] Western Blot Stx activity Stx activity Figure 15 Cytotoxicity Cell viability [%] Cell viability [%] Yersinia enterocolitica S. Enteritidis S. Infantis S. Virginia S. Typhimurium Western Blot Y. enterocolitica Stx activity Stx activity Figure 16 Required materials Sample Preparation Culture supernatant or STEC Colonies Incubation shaker / incubator Reaction mix Depurination buffer 10 mM and 100 mM ammonium acetate, pH 4 SRL substrate (stock solution), 100 μM in H2O Detection 96-well plate, white Detection device with FAM / fluorescein filter STEC colony STECag Sample preparation / cultivation 12 ng / mL Ciprofloxacin 37°C, 24-hour incubation Positive control Negative control LB medium LB agar LB agar Reaction mix Approximately 2 μM of SRL substrate per reaction. 14.6 μL depurination buffer (100 mM) 0.4 μL SRL substrate (stock solution) 19.5 μL depurination buffer (10 mM) 0.5 μL SRL substrate (stock solution) Preparation of the plate 1 well / reaction 15 μL reaction mix 5 μL culture supernatant 5 μL culture supernatant 20 μL reaction mix 1 to 3 colonies Enzymatic assay Reaction conditions Temperature: 44℃ Time: 1 to 12 hours Filter: FAM / Fluorescein Figure 17 n=3; 2 μM in the reaction mix Figure 18 n=3; 2 μM in the reaction mix Figure 19 n=3; 2 μM in the reaction mix Figure 20 n=3; 2 μM in the reaction mix

Claims

1. It is an oligonucleotide, a) A nucleotide sequence of the salsin-lysine loop (SRL) of the 60S ribosome subunit of a eukaryote / mammalian, wherein the SRL nucleotide sequence contains at least one adenine, b) at least one cleavage-dependent marker, Includes, The oligonucleotide is single-stranded and preferably constitutes at least one loop structure or stem-loop structure.

2. The oligonucleotide according to claim 1, wherein the at least one cleavage-dependent label comprises at least one fluorophore and at least one quencher, wherein preferably the at least one fluorophore and the at least one quencher are arranged such that the at least one quencher quenches the fluorescence of the at least one fluorophore as long as the oligonucleotide is not cleaved.

3. The oligonucleotide according to claim 1 or 2, wherein the at least one cleavage-dependent label comprises at least one label at the 3' end and / or at least one label at the 5' end of the oligonucleotide.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is single-stranded RNA (ssRNA) or DNA (ssDNA).

5. The oligonucleotide according to any one of claims 1 to 4, wherein the oligonucleotide further comprises at least one linker sequence between the SRL nucleotide sequence and the at least one label, preferably wherein the 5' linker sequence comprises ACTT and / or the 3' linker sequence comprises AGT.

6. The oligonucleotide according to any one of claims 1 to 5, wherein the SRL nucleotide sequence comprises at least one GAGAG sequence.

7. The oligonucleotide according to any one of claims 1 to 6, wherein the SRL nucleotide sequence comprises at least one AGTACGAGAGGAAC sequence (SEQ ID NO: 3).

8. The oligonucleotide according to any one of claims 1 to 7, wherein the SRL nucleotide sequence comprises at least one ACTTAGTACGAGAGGAACAGT sequence (SEQ ID NO: 7).

9. The oligonucleotide according to any one of claims 1 to 8, wherein the oligonucleotide constitutes a single loop structure or a stem-loop structure and preferably comprises fewer than 26 nucleotides.

10. The oligonucleotide according to any one of claims 1 to 9, wherein the oligonucleotide is present in the reaction solution, detection solution, bacterial growth medium, or the aforementioned mixture.

11. A method for detecting active Shiga toxin in a sample, a) A step of preparing at least one single-stranded oligonucleotide according to claims 1 to 10, b) The process of preparing the sample to be tested for Shiga toxin, c) A step of incubating the sample with the at least one single-stranded oligonucleotide, d) A step of detecting a signal from a label, wherein the signal indicates the presence of Shiga toxin in the sample. Methods that include...

12. The method according to claim 11, wherein in step c), a signal is generated as soon as Shiga toxin depurines at least one adenine of the oligonucleotide, at which point the oligonucleotide is cleaved.

13. The method according to claim 11 or 12, wherein the Shiga toxin contained in the sample is selected from the group including Stx1, Stx2, Stx1a to Stx1d, and Stx2a to Stx2g, or other Stx types or subtypes.

14. The method according to any one of claims 11 to 13, comprising the detection of a Shiga toxin-producing pathogen, wherein the Shiga toxin-producing pathogen is Shiga toxin-producing E. coli (STEC), Acinetobacter, or Shigera.

15. The method according to any one of claims 11 to 14, wherein in step a) the oligonucleotide is present in the agar medium, in step b) the sample is applied to the agar medium, and / or the detection in step d) detects a signal in the agar medium.

16. The method according to any one of claims 11 to 15, wherein in step a) the oligonucleotide is present in a liquid reaction solution or detection solution, and in step b) the sample is introduced into the liquid reaction medium.

17. at least, a) an oligonucleotide according to any one of claims 1 to 10, b) Optionally, at least one reaction solution and / or detection solution, wherein the reaction solution and / or detection solution is preferably a depurinating buffer containing ammonium acetate, A kit that includes this.